instruction stringlengths 225 2.35k | input stringlengths 89 1.5k | response stringclasses 698 values |
|---|---|---|
<Instruct>: Given the context 'All nine hybrids were used in PCR reactions with 3'-Alu primer 3144 and two were used with 5'-Alu
Figure 3: Hybridization of Alu-PCR products generated with Alu primer 3144 from irradiation hybrid 54 to a filter containing 420 YAC clones from the human X chromosome.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human]
<Options>: A: suborder
B: primate (aka primates)
C: cellular organisms (biota) (aka cellular organisms)
D: this
E: homo sapiens (human) (aka homo sapiens)
F: None of the above. | [E] |
<Instruct>: Given the context 'Example hybridizations to a human X chromosome cosmid filter in Fig 2 shows the intensity and reliability of positive clones identified on duplicate filters with Alu-PCR products from the same irradiation hybrid (48) and the independence of clones identified with Alu-PCR products from a different hybrid (54).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human]
<Options>: A: primate (aka primates)
B: human (aka homo sapiens)
C: avian (aka aves)
D: genus
E: kingdom
F: None of the above. | [B] |
<Instruct>: Given the context 'Fig 3 shows a single positive YAC clone after hybridization of Alu-PCR products from irradiation hybrid 54 to a filter containing about 420 YAC clones specific for the human X chromosome.
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human]
<Options>: A: homo sapiens (human) (aka homo sapiens)
B: macrobiotus sapiens
C: this
D: suborder
E: mammals (aka mammalia)
F: None of the above. | [A] |
<Instruct>: Given the context 'Since only 27 probes from the X chromosome were used to initially characterize the hybrids and the length of individual human fragments in the irradiation hybrids is about 1000-5000 kb, many regions could have been undetected in the original analysis.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human]
<Options>: A: species
B: avian (aka aves)
C: human (aka homo sapiens)
D: macrobiotus sapiens
E: primate (aka primates)
F: None of the above. | [C] |
<Instruct>: Given the context 'However, since the exact length of the human DNA fragments for each hybrid and the spacing of Alu-PCR products along the chromosome is not known, it is difficult to directly correlate the number of target cosmids to the DNA content of the hybrids.
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human]
<Options>: A: biota (aka cellular organisms)
B: kingdom
C: species
D: homo sapiens (human) (aka homo sapiens)
E: genus
F: None of the above. | [D] |
<Instruct>: Given the context 'The dissection of a total genomic YAC library by this method may be more efficient than generating chromosome specific YAC libraries from somatic cell hybrids (usually a haploid human chromosome on a diploid or greater rodent background) or flow-sorted chromosomes, because of the low transformation efficiency of yeast.
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human; yeast]
<Options>: A: genus
B: saccharomyces cf. cerevisiae
C: probles
D: saccharomycetes (hemiascomycetes) (aka saccharomycetes)
E: saccharomyces cerevisiae or paradoxus (aka saccharomyces cf. cerevisiae/paradoxus)
F: homo sapiens (human) (aka homo sapiens)
G: saccharomyces cerevisiae (saccharomyces cerevisiae (desm.) meyen ex e.c. hansen, 1883) (aka saccharomyces cerevisiae)
H: saccharomyces lactis (aka kluyveromyces lactis)
I: cellular organisms (biota) (aka cellular organisms)
J: birds (aka aves)
K: None of the above. | [F; G] |
<Instruct>: Given the context 'The dissection of a total genomic YAC library by this method may be more efficient than generating chromosome specific YAC libraries from somatic cell hybrids (usually a haploid human chromosome on a diploid or greater rodent background) or flow-sorted chromosomes, because of the low transformation efficiency of yeast.
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human; yeast]
<Options>: A: animals (aka metazoa)
B: human (aka homo sapiens)
C: saccharomyceta
D: candida/saccharomycetales (aka candida/saccharomycales clade)
E: this
F: baker's yeast (aka saccharomyces cerevisiae)
G: primate (aka primates)
H: saccharomyces cerevisiae x saccharomyces mikatae
I: saccharomyces albicans (aka candida albicans)
J: species
K: None of the above. | [B; F] |
<Instruct>: Given the context 'The dissection of a total genomic YAC library by this method may be more efficient than generating chromosome specific YAC libraries from somatic cell hybrids (usually a haploid human chromosome on a diploid or greater rodent background) or flow-sorted chromosomes, because of the low transformation efficiency of yeast.
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human; yeast]
<Options>: A: saccharomyces cerevisiae x saccharomyces mikatae
B: saccharomyceta
C: human (aka homo sapiens)
D: this
E: primate (aka primates)
F: species
G: saccharomyces albicans (aka candida albicans)
H: candida/saccharomycetales (aka candida/saccharomycales clade)
I: animals (aka metazoa)
J: None of the above. | [C; J] |
<Instruct>: Given the context 'Results
As neural crest cells coalesce to form sympathetic ganglia, TrkB-positive cells are seen in both chicken and mouse embryos.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [chicken; mouse]
<Options>: A: mus cricetus (aka cricetus cricetus)
B: miletus gallus gallus
C: gallus gallus domesticus (aka gallus gallus)
D: arilus gallus
E: wild turkey (aka meleagris gallopavo)
F: peromyscus
G: gallorhynchus
H: mus (aka mus <subgenus>) (aka mus <subgenus>)
I: mus molossinus (aka mus musculus molossinus)
J: mouse (aka mus musculus)
K: None of the above. | [C; J] |
<Instruct>: Given the context 'Results
As neural crest cells coalesce to form sympathetic ganglia, TrkB-positive cells are seen in both chicken and mouse embryos.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [chicken; mouse]
<Options>: A: miletus gallus gallus
B: chickens (aka gallus gallus)
C: gallus
D: mus <subgenus> (mus (aka mus <subgenus>))
E: mouse (aka mus <genus>)
F: peromyscus
G: mouse (aka mus musculus)
H: birds (aka aves)
I: mus musculus musculus (eastern european house mouse) (aka mus musculus musculus)
J: gallus sp.
K: None of the above. | [B; G] |
<Instruct>: Given the context 'In chicken embryos, TrkB-expressing cells first appear at Hamburger-Hamilton Stage (St) 27 and they co-express HNK-1, confirming that they are migrating neural crest cells.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [chicken]
<Options>: A: galliformes (landfowls) (aka galliformes)
B: chickens (aka gallus gallus)
C: miletus gallus gallus
D: gallasellus
E: avian (aka aves)
F: None of the above. | [B] |
<Instruct>: Given the context 'BDNF transcript expression parallels that of TrkB. In the mouse, TrkB-positive cells surround newly formed sympathetic ganglia and a small number of TrkB positive cells that co-express tyrosine hydroxylase are seen within ganglia between E13.5-15.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse]
<Options>: A: mus molossinus (aka mus musculus molossinus)
B: mouse (aka mus <genus>)
C: mus <subgenus> (mus (aka mus <subgenus>))
D: house mouse (aka mus musculus)
E: mus musculus domesticus (western european house mouse) (aka mus musculus domesticus)
F: None of the above. | [D] |
<Instruct>: Given the context 'In cell culture, many cells from St. 29–30 chicken lumbar sympathetic ganglia express neural markers and are dividing, indicating that they are sympathoblasts.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [chicken]
<Options>: A: birds (aka aves)
B: gallio
C: gallus gallus (gallus gallus domesticus) (aka gallus gallus)
D: galliformes (landfowls) (aka galliformes)
E: wild turkey (aka meleagris gallopavo)
F: None of the above. | [C] |
<Instruct>: Given the context 'In chicken embryos, migrating neural crest cells express catecholamines at Hamburger/Hamilton Stage (St.) 19, and these cells form the primary sympathetic chain dorsolateral to the aorta at St. 22 (E3.5)', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [chicken]
<Options>: A: chicken (aka gallus gallus)
B: gallasellus
C: gallio
D: gallus sp.
E: arilus gallus
F: None of the above. | [A] |
<Instruct>: Given the context 'Time lapse photography has shown that cultured E15.5–E16.5 sympathetic neurons from rat embryos extend axons while they divide [3-5].', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [rat]
<Options>: A: roof rat (aka rattus rattus)
B: rattus norvegicus albus
C: rats (aka rattus sp.) (aka rattus sp.)
D: rattus rattoides (aka rattus pyctoris)
E: brown rat (aka rattus norvegicus)
F: None of the above. | [E] |
<Instruct>: Given the context 'There are severe sympathetic defects in the superior cervical ganglion of individual NT-3 and NGF knockout mice [8-10].', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mice]
<Options>: A: mus musculus (house mouse) (aka mus musculus)
B: mus cricetus (aka cricetus cricetus)
C: mus musculus domesticus (western european house mouse) (aka mus musculus domesticus)
D: eastern european house mouse (aka mus musculus musculus)
E: mus sp. (mice (aka mus sp.))
F: None of the above. | [A] |
<Instruct>: Given the context 'There are severe sympathetic defects in the superior cervical ganglion of individual NT-3 and NGF knockout mice [8-10].', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mice]
<Options>: A: mus cricetus (aka cricetus cricetus)
B: mus musculus domesticus (western european house mouse) (aka mus musculus domesticus)
C: mus sp. (mice (aka mus sp.))
D: eastern european house mouse (aka mus musculus musculus)
E: None of the above. | [E] |
<Instruct>: Given the context 'Furthermore, there is no additional cell death in the superior cervical ganglion of NT-3 and NGF double knockout mouse embryos, suggesting that all of the neurons are dependent on both neurotrophins for survival [11].', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse]
<Options>: A: peromyscus
B: mus <subgenus> (mus (aka mus <subgenus>))
C: western european house mouse (aka mus musculus domesticus)
D: mus molossinus (aka mus musculus molossinus)
E: house mouse (aka mus musculus)
F: None of the above. | [E] |
<Instruct>: Given the context 'There is also an increase in sympathetic neuron cell death in TrkA knockout mice [12].', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mice]
<Options>: A: mus musculus (house mouse) (aka mus musculus)
B: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
C: mus domesticus (aka mus musculus domesticus)
D: mus castaneus (aka mus musculus castaneus)
E: mouse (aka mus <genus>)
F: None of the above. | [A] |
<Instruct>: Given the context 'However, in TrkB and BDNF knockout mice, there is no apparent phenotype in the superior cervical ganglion, and there is little evidence that TrkB or BDNF is expressed in sympathetic ganglia.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mice]
<Options>: A: mus (aka mus <subgenus>) (aka mus <subgenus>)
B: mus musculus domesticus (western european house mouse) (aka mus musculus domesticus)
C: mus castaneus (aka mus musculus castaneus)
D: mus musculus (house mouse) (aka mus musculus)
E: eastern european house mouse (aka mus musculus musculus)
F: None of the above. | [D] |
<Instruct>: Given the context 'To test whether BDNF, the ligand for TrkB, was present in embryonic chick sympathetic ganglia, we used quantitative real-time PCR with TaqMan probes to determine the relative abundance of BDNF transcripts in total RNA extracted from lumbar sympathetic ganglia at St. 29/30 (E6.5), St. 31 (E7), St. 34 (E8), and E9.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [chick]
<Options>: A: gallus gallus gallus (gallus gallus philippensis) (aka gallus gallus gallus)
B: zebrafish (aka danio rerio)
C: gallus gallus domesticus (aka gallus gallus)
D: gallio
E: arilus gallus
F: None of the above. | [C] |
<Instruct>: Given the context 'Discussion
We report that the neurotrophin receptor TrkB is expressed in a subset of embryonic sympathoblasts during the early development of lumbar paravertebral sympathetic ganglia in chicken and mouse embryos.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [chicken; mouse]
<Options>: A: gallus domesticus (aka gallus gallus)
B: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
C: gallus
D: mus musculus (house mouse) (aka mus musculus)
E: eastern european house mouse (aka mus musculus musculus)
F: mus domesticus (aka mus musculus domesticus)
G: gallio
H: miletus gallus gallus
I: gallasellus
J: mus (aka mus <subgenus>) (aka mus <subgenus>)
K: None of the above. | [A; D] |
<Instruct>: Given the context 'Discussion
We report that the neurotrophin receptor TrkB is expressed in a subset of embryonic sympathoblasts during the early development of lumbar paravertebral sympathetic ganglia in chicken and mouse embryos.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [chicken; mouse]
<Options>: A: mice (aka mus sp.) (aka mus sp.)
B: gallus sp.
C: house mouse (aka mus musculus)
D: miletus gallus gallus
E: chicken (aka gallus gallus)
F: mus (aka mus <subgenus>) (aka mus <subgenus>)
G: turkey (aka meleagris gallopavo)
H: mus musculus musculus (eastern european house mouse) (aka mus musculus musculus)
I: mus molossinus (aka mus musculus molossinus)
J: landfowls (aka galliformes)
K: None of the above. | [E; C] |
<Instruct>: Given the context 'In the chicken, TrkB expression is transient, and completely lost by St 34 (E8).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [chicken]
<Options>: A: wild turkey (aka meleagris gallopavo)
B: birds (aka aves)
C: gallus sp.
D: gallorhynchus
E: gallus gallus domesticus (aka gallus gallus)
F: None of the above. | [E] |
<Instruct>: Given the context 'Early sympathetic ganglia contain at least two subpopulations: early differentiating neurons that lack TrkB expression and express TrkA and TrkC, and late differentiating sympathoblasts that express TrkB. Explant cultures of sympathetic ganglia from E16 chick embryos give rise to two neuronal populations: one that remains close to the explant, and one that migrates away from the explant [1].', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [chick]
<Options>: A: gallorhynchus
B: gallio
C: gallus gallus domesticus (aka gallus gallus)
D: fopius
E: galliformes (landfowls) (aka galliformes)
F: None of the above. | [C] |
<Instruct>: Given the context 'Early sympathetic ganglia contain at least two subpopulations: early differentiating neurons that lack TrkB expression and express TrkA and TrkC, and late differentiating sympathoblasts that express TrkB. Explant cultures of sympathetic ganglia from E16 chick embryos give rise to two neuronal populations: one that remains close to the explant, and one that migrates away from the explant [1].', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [chick]
<Options>: A: gallio
B: fopius
C: galliformes (landfowls) (aka galliformes)
D: gallorhynchus
E: None of the above. | [E] |
<Instruct>: Given the context 'In the superior cervical ganglion, an increase in the number of neurons of BDNF null mice is likely due to apoptosis induced by BDNF via p75NTR', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mice]
<Options>: A: mus musculus (house mouse) (aka mus musculus)
B: mus (aka mus <genus>) (aka mus <genus>)
C: mice (aka mus sp.) (aka mus sp.)
D: mus <subgenus> (mus (aka mus <subgenus>))
E: eastern european house mouse (aka mus musculus musculus)
F: None of the above. | [A] |
<Instruct>: Given the context 'If our results indicating that BDNF promotes proliferation of TrkB-positive sympathoblasts in the chicken embryo can be extrapolated to the subset of TrkB-positive sympathoblasts in murine ganglia, then these TrkB-positive cells may be neurons destined to innervate the erector pilli.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [chicken]
<Options>: A: gallus
B: gallus gallus gallus (gallus gallus philippensis) (aka gallus gallus gallus)
C: chickens (aka gallus gallus)
D: gallus sp.
E: avian (aka aves)
F: None of the above. | [C] |
<Instruct>: Given the context 'In other studies, TrkB null mice showed no changes in morphology or cell number in superior cervical ganglia [12] or in the intermediolateral column [20]; but this may not be predictive of a phenotype in the lumbar paravertebral chain.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mice]
<Options>: A: mus sp. (mice (aka mus sp.))
B: mus (aka mus <genus>) (aka mus <genus>)
C: mus (aka mus <subgenus>) (aka mus <subgenus>)
D: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
E: mus musculus (house mouse) (aka mus musculus)
F: None of the above. | [E] |
<Instruct>: Given the context 'However, if TrkB-positive cells are not normally actively proliferating in vivo, then it would not be surprising that the development of the paravertebral sympathetic chain is not disrupted in TrkB or BDNF null mice.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mice]
<Options>: A: house mouse (aka mus musculus)
B: eastern european house mouse (aka mus musculus musculus)
C: mus cricetus (aka cricetus cricetus)
D: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
E: mus castaneus (aka mus musculus castaneus)
F: None of the above. | [A] |
<Instruct>: Given the context 'It may be more informative to examine mice that over express BDNF on a promoter that targets expression to embryonic lumbar ganglia.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mice]
<Options>: A: mice (aka mus <genus>) (aka mus <genus>)
B: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
C: mus (aka mus <subgenus>) (aka mus <subgenus>)
D: eastern european house mouse (aka mus musculus musculus)
E: mus musculus (house mouse) (aka mus musculus)
F: None of the above. | [E] |
<Instruct>: Given the context 'Unfortunately, such mice do not exist.
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mice]
<Options>: A: mus castaneus (aka mus musculus castaneus)
B: mouse (aka mus <genus>)
C: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
D: mus domesticus (aka mus musculus domesticus)
E: mouse (aka mus musculus)
F: None of the above. | [E] |
<Instruct>: Given the context 'Our findings that the St. 29/30 (E6.5) sympathoblasts are dependent on both NT-3 and NGF for survival in culture are consistent with previous work on mouse sympathoblasts from the superior cervical ganglion', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse]
<Options>: A: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
B: mus <subgenus> (mus (aka mus <subgenus>))
C: mus musculus (house mouse) (aka mus musculus)
D: mus (aka mus <genus>) (aka mus <genus>)
E: western european house mouse (aka mus musculus domesticus)
F: None of the above. | [C] |
<Instruct>: Given the context 'In contrast, cultured rat superior cervical ganglion sympathetic neurons respond to NT-3 at E14.5 and then to NGF at E19.5, although time points in between were not analyzed [6].
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [rat]
<Options>: A: rattus norvegicus albus
B: rattus sp. (rats (aka rattus sp.))
C: rattus norvegicus (rats (aka rattus norvegicus))
D: rats (aka rattus) (aka rattus)
E: black rat (aka rattus rattus)
F: None of the above. | [C] |
<Instruct>: Given the context 'NT-3 can promote the incorporation of [3H]-thymidine into cultured quail neural crest cells from the trunk region [21,22], Later in rat sympathetic development, NT-3 supports survival of neurons, but does not promote proliferation', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [rat]
<Options>: A: rats (aka rattus sp.) (aka rattus sp.)
B: rattus (rats (aka rattus))
C: rattus pyctoris (rattus rattoides) (aka rattus pyctoris)
D: rats (aka rattus norvegicus) (aka rattus norvegicus)
E: house rat (aka rattus rattus)
F: None of the above. | [D] |
<Instruct>: Given the context 'NGF promotes an increase in BrdU incorporation from 25% to 35% in the DRG cervical segment 2 in the chick embryo [23].', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [chick]
<Options>: A: chicken (aka gallus gallus)
B: miletus gallus gallus
C: galliformes (landfowls) (aka galliformes)
D: birds (aka aves)
E: zebrafish (aka danio rerio)
F: None of the above. | [A] |
<Instruct>: Given the context 'NGF promotes an increase in BrdU incorporation from 25% to 35% in the DRG cervical segment 2 in the chick embryo [23].', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [chick]
<Options>: A: zebrafish (aka danio rerio)
B: miletus gallus gallus
C: galliformes (landfowls) (aka galliformes)
D: birds (aka aves)
E: None of the above. | [E] |
<Instruct>: Given the context 'In chicken embryos that are treated with NGF in ovo at St. 18 and 21, there is an increase in BrdU uptake after formation of the primary sympathetic chain at St. 23', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [chicken]
<Options>: A: avian (aka aves)
B: gallus gallus gallus (gallus gallus philippensis) (aka gallus gallus gallus)
C: gallio
D: gallus gallus (gallus gallus domesticus) (aka gallus gallus)
E: galliformes (landfowls) (aka galliformes)
F: None of the above. | [D] |
<Instruct>: Given the context 'Since NGF does not appear to affect proliferation of St. 29/30 (E6.5) chick sympathoblasts, NGF may only promote proliferation in primary, but not secondary chain sympathoblasts.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [chick]
<Options>: A: fopius
B: zebrafish (aka danio rerio)
C: chicken (aka gallus gallus)
D: gallasellus
E: avian (aka aves)
F: None of the above. | [C] |
<Instruct>: Given the context 'Motor neuron progenitors in the ventral neural tube from the chick embryo express TrkB and when ventral neural tube explants are treated with BDNF, there is an increase in the number of motor neurons produced and BrdU incorporation', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [chick]
<Options>: A: gallus
B: gallio
C: fopius
D: mus spretus (mus musculus spretus) (aka mus spretus)
E: gallus domesticus (aka gallus gallus)
F: None of the above. | [E] |
<Instruct>: Given the context 'Future studies will determine whether constitutive expression of BDNF and TrkB in the chick embryo sustains proliferation of differentiating sympathoblasts.
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [chick]
<Options>: A: gallus
B: gallio
C: arilus gallus
D: gallus sp.
E: gallus gallus (gallus gallus domesticus) (aka gallus gallus)
F: None of the above. | [E] |
<Instruct>: Given the context 'Methods
Preparation of tissue for immunohistochemistry
The lumbar spinal column and surrounding tissues were dissected from chicken embryos at the indicated stages and placed in Zamboni's fixative (4% (w/v) paraformaldehyde, 15% (v/v) picric acid in 0.1 M sodium phosphate buffer, pH 7.4) for two hours at room temperature.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [chicken]
<Options>: A: gallus domesticus (aka gallus gallus)
B: birds (aka aves)
C: gallus sp.
D: gallus
E: arilus gallus
F: None of the above. | [A] |
<Instruct>: Given the context 'Mouse embryos at 13–15 days post-coitus were collected according to an IACUC-approved protocol to Dr. L. Sherman at the Oregon Health and Science University.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse]
<Options>: A: mus (aka mus <genus>) (aka mus <genus>)
B: western european house mouse (aka mus musculus domesticus)
C: mus (aka mus <subgenus>) (aka mus <subgenus>)
D: mouse (aka mus musculus)
E: peromyscus
F: None of the above. | [D] |
<Instruct>: Given the context 'The mouse embryos were immersion-fixed in Zamboni's fixative overnight at 4 degrees C then washed with phosphate buffered saline (PBS; 130 mM NaCl, 20 mM sodium phosphate buffer, pH 7.4).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse]
<Options>: A: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
B: peromyscus
C: eastern european house mouse (aka mus musculus musculus)
D: mouse (aka mus musculus)
E: mus musculus domesticus (western european house mouse) (aka mus musculus domesticus)
F: None of the above. | [D] |
<Instruct>: Given the context 'Fixed mouse embryos were shipped to Vermont in sucrose.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse]
<Options>: A: mus (aka mus <subgenus>) (aka mus <subgenus>)
B: mus cricetus (aka cricetus cricetus)
C: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
D: mus musculus (house mouse) (aka mus musculus)
E: mice (aka mus <genus>) (aka mus <genus>)
F: None of the above. | [D] |
<Instruct>: Given the context 'Sections were dried at room temperature, washed in 1× PBS and incubated overnight in blocking buffer (1× PBS consisting of 10% (v/v) heat-inactivated horse serum (Invitrogen/Gibco), 0.5% Triton X-100 (Sigma), and 0.1% sodium azide (Fisher)).
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [horse]
<Options>: A: eques
B: equus ferus (equus caballus ferus) (aka equus ferus)
C: equus caballus (equus przewalskii forma caballus) (aka equus caballus)
D: equus sp.
E: equus przewalskii (equus caballus przewalskii) (aka equus przewalskii)
F: None of the above. | [C] |
<Instruct>: Given the context 'Primary antibodies used were: rabbit anti-p75 (1:1500, generous gift from Louis Reichardt, UCSF', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [rabbit]
<Options>: A: bovidae
B: european hare (aka lepus europaeus)
C: cattle (aka bos)
D: lepus cuniculus (aka oryctolagus cuniculus)
E: leporidae (rabbits and hares) (aka leporidae)
F: None of the above. | [D] |
<Instruct>: Given the context 'Primary antibodies used were: rabbit anti-p75 (1:1500, generous gift from Louis Reichardt, UCSF', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [rabbit]
<Options>: A: bovidae
B: european hare (aka lepus europaeus)
C: cattle (aka bos)
D: leporidae (rabbits and hares) (aka leporidae)
E: None of the above. | [E] |
<Instruct>: Given the context '[26]), mouse IgG2b anti-Hu C/D, (1:250, Molecular Probes); mouse IgG1 anti-Islet-1, (1:10, Developmental Studies Hybridoma Bank); rabbit anti-chicken TrkA (1:500); rabbit anti-chicken TrkB (1:500); rabbit anti-chicken TrkC (1:500) (all Trk antibodies were generous gifts of Dr. Louis Reichardt, UCSF', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse; rabbit; chicken]
<Options>: A: mus (aka mus <subgenus>) (aka mus <subgenus>)
B: leporidae (rabbits and hares) (aka leporidae)
C: peromyscus
D: house mouse (aka mus musculus)
E: miletus gallus gallus
F: mus musculus domesticus (western european house mouse) (aka mus musculus domesticus)
G: birds (aka aves)
H: domestic rabbit (aka oryctolagus cuniculus)
I: bovidae
J: arilus gallus
K: gallio
L: mus cricetus (aka cricetus cricetus)
M: gallus domesticus (aka gallus gallus)
N: marsh rabbit (aka sylvilagus palustris)
O: hares (aka lepus)
P: None of the above. | [D; H; M] |
<Instruct>: Given the context '[26]), mouse IgG2b anti-Hu C/D, (1:250, Molecular Probes); mouse IgG1 anti-Islet-1, (1:10, Developmental Studies Hybridoma Bank); rabbit anti-chicken TrkA (1:500); rabbit anti-chicken TrkB (1:500); rabbit anti-chicken TrkC (1:500) (all Trk antibodies were generous gifts of Dr. Louis Reichardt, UCSF', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse; rabbit; chicken]
<Options>: A: gallio
B: mice (aka mus sp.) (aka mus sp.)
C: mus musculus musculus (eastern european house mouse) (aka mus musculus musculus)
D: mus musculus (house mouse) (aka mus musculus)
E: chicken (aka gallus gallus)
F: ox (aka bos taurus) (aka bos taurus)
G: mouse (aka mus <genus>)
H: gallus gallus philippensis (aka gallus gallus gallus)
I: swamp rabbit (aka sylvilagus aquaticus)
J: lepus cuniculus (aka oryctolagus cuniculus)
K: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
L: arilus gallus
M: oryctolagus cuniculus cuniculus (lepus cuniculus cuniculus) (aka oryctolagus cuniculus cuniculus)
N: european hare (aka lepus europaeus)
O: gallorhynchus
P: None of the above. | [D; J; E] |
<Instruct>: Given the context '[26]), mouse IgG2b anti-Hu C/D, (1:250, Molecular Probes); mouse IgG1 anti-Islet-1, (1:10, Developmental Studies Hybridoma Bank); rabbit anti-chicken TrkA (1:500); rabbit anti-chicken TrkB (1:500); rabbit anti-chicken TrkC (1:500) (all Trk antibodies were generous gifts of Dr. Louis Reichardt, UCSF', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse; rabbit; chicken]
<Options>: A: eastern european house mouse (aka mus musculus musculus)
B: house mouse (aka mus musculus)
C: landfowls (aka galliformes)
D: hares (aka lepus)
E: wild turkey (aka meleagris gallopavo)
F: cattle (aka bos)
G: miletus gallus gallus
H: mice (aka mus sp.) (aka mus sp.)
I: gallorhynchus
J: leporidae (rabbits and hares) (aka leporidae)
K: lepus europaeus europaeus
L: mus (aka mus <subgenus>) (aka mus <subgenus>)
M: chickens (aka gallus gallus)
N: peromyscus
O: oryctolagus cuniculus (japanese white rabbit) (aka oryctolagus cuniculus)
P: None of the above. | [B; O; M] |
<Instruct>: Given the context '[26]), mouse IgG2b anti-Hu C/D, (1:250, Molecular Probes); mouse IgG1 anti-Islet-1, (1:10, Developmental Studies Hybridoma Bank); rabbit anti-chicken TrkA (1:500); rabbit anti-chicken TrkB (1:500); rabbit anti-chicken TrkC (1:500) (all Trk antibodies were generous gifts of Dr. Louis Reichardt, UCSF', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [rabbit; chicken]
<Options>: A: arilus gallus
B: hares (aka lepus)
C: bovidae
D: gallus
E: avian (aka aves)
F: chicken (aka gallus gallus)
G: ox (aka bos taurus) (aka bos taurus)
H: lepus cuniculus (aka oryctolagus cuniculus)
I: gallio
J: european hare (aka lepus europaeus)
K: None of the above. | [H; F] |
<Instruct>: Given the context '[26]), mouse IgG2b anti-Hu C/D, (1:250, Molecular Probes); mouse IgG1 anti-Islet-1, (1:10, Developmental Studies Hybridoma Bank); rabbit anti-chicken TrkA (1:500); rabbit anti-chicken TrkB (1:500); rabbit anti-chicken TrkC (1:500) (all Trk antibodies were generous gifts of Dr. Louis Reichardt, UCSF', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [rabbit; chicken]
<Options>: A: gallus sp.
B: miletus gallus gallus
C: lepus europaeus europaeus
D: marsh rabbit (aka sylvilagus palustris)
E: gallus
F: gallus domesticus (aka gallus gallus)
G: oryctolagus cuniculus cuniculus (lepus cuniculus cuniculus) (aka oryctolagus cuniculus cuniculus)
H: rabbit (aka oryctolagus cuniculus)
I: birds (aka aves)
J: ox (aka bos taurus) (aka bos taurus)
K: None of the above. | [H; F] |
<Instruct>: Given the context '[26-28]); mouse anti-HNK-1 (1:50, Developmental Studies Hybridoma Bank); mouse IgG2a anti-tyrosine hydroxylase (1:10, Developmental Studies Hybridoma Bank), sheep anti-BrdU (1:100, Biodesign International), rabbit anti-tyrosine hydroxylase (1:100, Chemicon), and goat anti-TrkB (1:1000, R&D Systems).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse; sheep; rabbit]
<Options>: A: european hare (aka lepus europaeus)
B: mus <genus> (mice (aka mus <genus>))
C: marsh rabbit (aka sylvilagus palustris)
D: cow (aka bos taurus) (aka bos taurus)
E: mus musculus musculus (eastern european house mouse) (aka mus musculus musculus)
F: cattle (aka bos)
G: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
H: mus <subgenus> (mus (aka mus <subgenus>))
I: domestic rabbit (aka oryctolagus cuniculus)
J: lepus europaeus europaeus
K: ovis ammon aries (aka ovis aries)
L: ovis dalli (dall's sheep) (aka ovis dalli)
M: mus musculus (house mouse) (aka mus musculus)
N: suidae (pigs (aka suidae))
O: None of the above. | [M; K; I] |
<Instruct>: Given the context '[26-28]); mouse anti-HNK-1 (1:50, Developmental Studies Hybridoma Bank); mouse IgG2a anti-tyrosine hydroxylase (1:10, Developmental Studies Hybridoma Bank), sheep anti-BrdU (1:100, Biodesign International), rabbit anti-tyrosine hydroxylase (1:100, Chemicon), and goat anti-TrkB (1:1000, R&D Systems).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse; sheep; rabbit]
<Options>: A: mus musculus musculus (eastern european house mouse) (aka mus musculus musculus)
B: bovidae
C: ovis
D: oryctolagus cuniculus cuniculus (lepus cuniculus cuniculus) (aka oryctolagus cuniculus cuniculus)
E: mus domesticus (aka mus musculus domesticus)
F: cattle (aka bos)
G: mus sp. (mice (aka mus sp.))
H: ovis aries vignei (aka ovis vignei)
I: dall sheep (aka ovis dalli)
J: ovis ovis (aka ovis aries)
K: rabbits (aka oryctolagus cuniculus)
L: mus (aka mus <subgenus>) (aka mus <subgenus>)
M: rabbits and hares (aka leporidae)
N: ox (aka bos taurus) (aka bos taurus)
O: mus musculus (house mouse) (aka mus musculus)
P: None of the above. | [O; J; K] |
<Instruct>: Given the context '[26-28]); mouse anti-HNK-1 (1:50, Developmental Studies Hybridoma Bank); mouse IgG2a anti-tyrosine hydroxylase (1:10, Developmental Studies Hybridoma Bank), sheep anti-BrdU (1:100, Biodesign International), rabbit anti-tyrosine hydroxylase (1:100, Chemicon), and goat anti-TrkB (1:1000, R&D Systems).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse; sheep; rabbit]
<Options>: A: mus cricetus (aka cricetus cricetus)
B: rabbits (aka oryctolagus cuniculus)
C: ovis sp.
D: oryctolagus cuniculus cuniculus (lepus cuniculus cuniculus) (aka oryctolagus cuniculus cuniculus)
E: ovis
F: bovidae
G: ox (aka bos taurus) (aka bos taurus)
H: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
I: mouse (aka mus musculus)
J: ovis aries vignei (aka ovis vignei)
K: cow (aka bos taurus) (aka bos taurus)
L: wild sheep (aka ovis aries)
M: eastern european house mouse (aka mus musculus musculus)
N: lepus europaeus europaeus
O: mice (aka mus sp.) (aka mus sp.)
P: None of the above. | [I; L; B] |
<Instruct>: Given the context '[26-28]); mouse anti-HNK-1 (1:50, Developmental Studies Hybridoma Bank); mouse IgG2a anti-tyrosine hydroxylase (1:10, Developmental Studies Hybridoma Bank), sheep anti-BrdU (1:100, Biodesign International), rabbit anti-tyrosine hydroxylase (1:100, Chemicon), and goat anti-TrkB (1:1000, R&D Systems).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [goat]
<Options>: A: capraita
B: capreolus
C: sueus
D: bovidae
E: domestic goat (aka capra hircus)
F: None of the above. | [E] |
<Instruct>: Given the context 'RNA Extraction/cDNA synthesis
Sympathetic ganglia were removed from chick embryos and RNA was isolated using TriReagent (Molecular Research Center), an acidified guanidinium with phenol extraction method', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [chick]
<Options>: A: miletus gallus gallus
B: chickens (aka gallus gallus)
C: fopius
D: gallus sp.
E: birds (aka aves)
F: None of the above. | [B] |
<Instruct>: Given the context 'TaqMan probes were used to quantify the progression of the PCR reaction and reactions were normalized using the constitutively expressed gene chick ribosomal binding protein s17 (CHRPS).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [chick]
<Options>: A: avian (aka aves)
B: galliformes (landfowls) (aka galliformes)
C: arilus gallus
D: gallasellus
E: gallus gallus domesticus (aka gallus gallus)
F: None of the above. | [E] |
<Instruct>: Given the context 'The sequences were used for primer/probes sets: for BDNF: forward: 5'-AGCCCAGTGAGGAAAACAAG-3', reverse: 5'-ACTCCTCGAGCAGAAAGAGC-3', probe: 5'-[6-FAM]-TACACATCCCGAGTCATGCTGAGCA-[BHQ]-3'; for CHRPS (chick ribosomal binding protein S-17): 5'AACGACTTCCACACCAACAA3', reverse: 5'CTTCATCAGGTGGGTGACAT3', probe: 5'-[6-FAM]-CGCCATCATCCCCAGCAAGA [BHQ]-3'.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [chick]
<Options>: A: gallorhynchus
B: arilus gallus
C: gallus
D: gallus domesticus (aka gallus gallus)
E: galliformes (landfowls) (aka galliformes)
F: None of the above. | [D] |
<Instruct>: Given the context 'Sympathetic ganglia were removed from the lumbar region of the paravertebral chain of St. 29/30 (E6.5) chick embryos and placed in Modified Puck's solution with glucose (MPG).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [chick]
<Options>: A: gallorhynchus
B: miletus gallus gallus
C: gallus gallus domesticus (aka gallus gallus)
D: zebrafish (aka danio rerio)
E: birds (aka aves)
F: None of the above. | [C] |
<Instruct>: Given the context 'Cells were then resuspended in Dulbecco's Modified Eagle Medium (DMEM) consisting of 10% horse serum, 2% fetal calf serum, and 10 mg/ml penicillin/streptomycin.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [horse]
<Options>: A: equus sp.
B: equus przewalskii (equus caballus przewalskii) (aka equus przewalskii)
C: equine (aka equus caballus)
D: horses (aka equidae)
E: eques
F: None of the above. | [C] |
<Instruct>: Given the context 'For in vivo studies, 25 μg BrdU was injected into the amnion of chick embryos at St. 27.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [chick]
<Options>: A: gallus gallus gallus (gallus gallus philippensis) (aka gallus gallus gallus)
B: gallus gallus domesticus (aka gallus gallus)
C: zebrafish (aka danio rerio)
D: galliformes (landfowls) (aka galliformes)
E: birds (aka aves)
F: None of the above. | [B] |
<Instruct>: Given the context 'Abbreviations
BDNF, brain-derived neurotrophic factor; BrdU, Bromodeoxyuridine; DA, dorsal aorta; DMEM, Dulbecco's Modified Eagle's Medium; DRG, dorsal root ganglion; E, embryonic day; HS, horse serum; MPG, Modified Puck's solution with glucose; NGF, nerve growth factor; NC, notochord; NT, neural tube; NT-3, neurotrophin-3; NTR, neurotrophin receptor; PBS, phosphate-buffered saline; SC, spinal cord; SCG, superior cervical ganglion; SEM, standard error of the mean; SG, sympathetic ganglion; St., stage; w/v, weight/volume; v/v, volume/volume.
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [horse]
<Options>: A: horse (aka equus caballus)
B: equus asinus (ass (aka equus asinus))
C: eques
D: equus przewalskii (equus caballus przewalskii) (aka equus przewalskii)
E: equus subg. equus (aka equus)
F: None of the above. | [A] |
<Instruct>: Given the context 'Abbreviations
BDNF, brain-derived neurotrophic factor; BrdU, Bromodeoxyuridine; DA, dorsal aorta; DMEM, Dulbecco's Modified Eagle's Medium; DRG, dorsal root ganglion; E, embryonic day; HS, horse serum; MPG, Modified Puck's solution with glucose; NGF, nerve growth factor; NC, notochord; NT, neural tube; NT-3, neurotrophin-3; NTR, neurotrophin receptor; PBS, phosphate-buffered saline; SC, spinal cord; SCG, superior cervical ganglion; SEM, standard error of the mean; SG, sympathetic ganglion; St., stage; w/v, weight/volume; v/v, volume/volume.
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [horse]
<Options>: A: equus asinus (ass (aka equus asinus))
B: equus subg. equus (aka equus)
C: equus przewalskii (equus caballus przewalskii) (aka equus przewalskii)
D: eques
E: None of the above. | [E] |
<Instruct>: Given the context 'Identification of a human peripheral blood monocyte subset that differentiates into osteoclasts
Abstract
Increased bone resorption mediated by osteoclasts causes various diseases such as osteoporosis and bone erosion in rheumatoid arthritis (RA).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human]
<Options>: A: this
B: homo (humans) (aka homo)
C: kingdom
D: human (aka homo sapiens)
E: macrobiotus sapiens
F: None of the above. | [D] |
<Instruct>: Given the context 'In the present study, we show that the purified CD16- human peripheral blood monocyte subset, but not the CD16+ monocyte subset, differentiates into osteoclast by stimulation with receptor activator of NF-κB ligand (RANKL) in combination with macrophage colony-stimulating factor (M-CSF).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human]
<Options>: A: eutherian mammals (aka eutheria)
B: homo (humans) (aka homo)
C: suborder
D: probles
E: human (aka homo sapiens)
F: None of the above. | [E] |
<Instruct>: Given the context 'Interestingly, the deletion of RANKL or c-Fos gene, which is important for osteoclastogenesis, results in minimal bone destruction in mouse models of arthritis [1,2].', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse]
<Options>: A: mus <subgenus> (mus (aka mus <subgenus>))
B: mus (aka mus <genus>) (aka mus <genus>)
C: peromyscus
D: mus musculus musculus (eastern european house mouse) (aka mus musculus musculus)
E: mus musculus (house mouse) (aka mus musculus)
F: None of the above. | [E] |
<Instruct>: Given the context 'It is reported that osteoclast precursors reside in human peripheral blood monocytes [4,5].', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human]
<Options>: A: homo sapiens (human) (aka homo sapiens)
B: species
C: macrobiotus sapiens
D: animals (aka metazoa)
E: primate (aka primates)
F: None of the above. | [A] |
<Instruct>: Given the context 'A marked increase of the circulating osteoclast precursors was demonstrated in patients with erosive psoriatic arthritis as well as in arthritic TNFα transgenic mice [6,7].', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [patients; mice]
<Options>: A: mus musculus (house mouse) (aka mus musculus)
B: mus musculus musculus (eastern european house mouse) (aka mus musculus musculus)
C: theraps
D: suborder
E: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
F: western european house mouse (aka mus musculus domesticus)
G: mus cricetus (aka cricetus cricetus)
H: homo (humans) (aka homo)
I: mus <genus> (mice (aka mus <genus>))
J: homo sapiens (human) (aka homo sapiens)
K: None of the above. | [J; A] |
<Instruct>: Given the context 'A marked increase of the circulating osteoclast precursors was demonstrated in patients with erosive psoriatic arthritis as well as in arthritic TNFα transgenic mice [6,7].', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [patients; mice]
<Options>: A: mus <subgenus> (mus (aka mus <subgenus>))
B: mus musculus (house mouse) (aka mus musculus)
C: eastern european house mouse (aka mus musculus musculus)
D: other (aka unidentified)
E: mus musculus domesticus (western european house mouse) (aka mus musculus domesticus)
F: human (aka homo sapiens)
G: aides
H: theraps
I: goes
J: peromyscus
K: None of the above. | [F; B] |
<Instruct>: Given the context 'Monocytes are therefore involved not only in synovial inflammation, but also in bone remodeling as potential precursors for synovial macrophages and osteoclasts.
Human peripheral blood monocytes consist of two major subsets, CD16+ and CD16-, comprising 5–10% and 90–95% of the monocytes, respectively.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human]
<Options>: A: human (aka homo sapiens)
B: macrobiotus sapiens
C: avian (aka aves)
D: primate (aka primates)
E: genus
F: None of the above. | [A] |
<Instruct>: Given the context 'In the present study, we determined the human peripheral blood monocyte subset that differentiates into osteoclasts, and revealed that each subset exhibits a different response for osteoclastogenic stimuli.
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human]
<Options>: A: animals (aka metazoa)
B: genus
C: suborder
D: homo sapiens (human) (aka homo sapiens)
E: species
F: None of the above. | [D] |
<Instruct>: Given the context 'In the present study, we determined the human peripheral blood monocyte subset that differentiates into osteoclasts, and revealed that each subset exhibits a different response for osteoclastogenic stimuli.
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human]
<Options>: A: genus
B: suborder
C: animals (aka metazoa)
D: species
E: None of the above. | [E] |
<Instruct>: Given the context 'Flow cytometry analysis using FITC-conjugated mouse anti-CD14 mAb (MY4; Bechman Coulter, Fullerton, CA, USA) and phycoerythin-conjugated mouse anti-CD16 mAb (3G8; BD Biosciences, San Jose, CA, USA) showed that the purities of the CD16+ and CD16- monocytes were more than 90% and 92%, respectively.
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse]
<Options>: A: mus molossinus (aka mus musculus molossinus)
B: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
C: mus musculus (house mouse) (aka mus musculus)
D: mice (aka mus <genus>) (aka mus <genus>)
E: mus domesticus (aka mus musculus domesticus)
F: None of the above. | [C] |
<Instruct>: Given the context 'For the other experiment, monocytes were purified using CD14 MicroBeads (Miltenyi Biotec), and then stained either with FITC-conjugated mouse anti-CD33 mAb (MY9; Bechman Coulter) or phycoerythin-conjugated mouse anti-CD16 mAb (3G8).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse]
<Options>: A: mus (aka mus <subgenus>) (aka mus <subgenus>)
B: mus musculus (house mouse) (aka mus musculus)
C: mus musculus domesticus (western european house mouse) (aka mus musculus domesticus)
D: mice (aka mus sp.) (aka mus sp.)
E: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
F: None of the above. | [B] |
<Instruct>: Given the context 'Osteoclast differentiation
Purified CD16+ and CD16- monocytes (5 × 104 cells/well) were incubated in 96-well plates in αMEM (Sigma, St Louis, MO, USA) with heat-inactivated 10% fetal bovine serum (FBS) (Sigma) or with Ultra-Low IgG FBS (IgG < 5 μg/ml; Invitrogen, Carlsbad, CA, USA), and where indicated with M-CSF + RANKL (Peprotech, Rocky Hill, NJ, USA).
', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [bovine]
<Options>: A: ox (aka bos taurus) (aka bos taurus)
B: bos bubalis (aka bubalus bubalis)
C: bovidae
D: bovinae
E: bos (cattle) (aka bos)
F: None of the above. | [A] |
<Instruct>: Given the context 'Antibodies used were goat anti-RANK antibody (Techne Corporation, Minneapolis, MN, USA), goat anti-c-fms antibody (R&D systems, Minneapolis, MN, USA), and mouse anti-β-actin mAb (AC-15; Sigma).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [goat; mouse]
<Options>: A: house mouse (aka mus musculus)
B: caponia
C: capraita
D: western european house mouse (aka mus musculus domesticus)
E: domestic goat (aka capra hircus)
F: mus (aka mus <genus>) (aka mus <genus>)
G: peromyscus
H: capra
I: mus molossinus (aka mus musculus molossinus)
J: bovidae
K: None of the above. | [E; A] |
<Instruct>: Given the context 'Antibodies used were goat anti-RANK antibody (Techne Corporation, Minneapolis, MN, USA), goat anti-c-fms antibody (R&D systems, Minneapolis, MN, USA), and mouse anti-β-actin mAb (AC-15; Sigma).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [goat; mouse]
<Options>: A: mus sp. (mice (aka mus sp.))
B: caponia
C: capreolus
D: house mouse (aka mus musculus)
E: capra hircus (capra aegagrus hircus) (aka capra hircus)
F: mus <genus> (mice (aka mus <genus>))
G: bovidae
H: eastern european house mouse (aka mus musculus musculus)
I: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
J: capra hircus aegagrus (aka capra aegagrus)
K: None of the above. | [E; D] |
<Instruct>: Given the context 'Peroxidase-conjugated rabbit anti-goat IgG antibody (Dako) or peroxidase-conjugated rabbit anti-mouse IgG antibody (Dako) was used as the second antibody.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [rabbit; goat; mouse]
<Options>: A: lepus (hares) (aka lepus)
B: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
C: oryctolagus cuniculus cuniculus (lepus cuniculus cuniculus) (aka oryctolagus cuniculus cuniculus)
D: japanese white rabbit (aka oryctolagus cuniculus)
E: house mouse (aka mus musculus)
F: rabbits and hares (aka leporidae)
G: donkey (aka equus asinus)
H: capra aegagrus cretica (aka capra hircus cretica)
I: sueus
J: mus cricetus (aka cricetus cricetus)
K: bovidae
L: goats (aka capra hircus)
M: mus sp. (mice (aka mus sp.))
N: mus <subgenus> (mus (aka mus <subgenus>))
O: None of the above. | [D; L; E] |
<Instruct>: Given the context 'Peroxidase-conjugated rabbit anti-goat IgG antibody (Dako) or peroxidase-conjugated rabbit anti-mouse IgG antibody (Dako) was used as the second antibody.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [rabbit; goat; mouse]
<Options>: A: mus sp. (mice (aka mus sp.))
B: japanese white rabbit (aka oryctolagus cuniculus)
C: sueus
D: rabbits and hares (aka leporidae)
E: oryctolagus cuniculus cuniculus (lepus cuniculus cuniculus) (aka oryctolagus cuniculus cuniculus)
F: lepus (hares) (aka lepus)
G: donkey (aka equus asinus)
H: mus cricetus (aka cricetus cricetus)
I: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
J: capra aegagrus cretica (aka capra hircus cretica)
K: bovidae
L: mus <subgenus> (mus (aka mus <subgenus>))
M: goats (aka capra hircus)
N: None of the above. | [B; M; N] |
<Instruct>: Given the context 'Peroxidase-conjugated rabbit anti-goat IgG antibody (Dako) or peroxidase-conjugated rabbit anti-mouse IgG antibody (Dako) was used as the second antibody.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [rabbit; goat; mouse]
<Options>: A: mus sp. (mice (aka mus sp.))
B: sueus
C: bovidae
D: oryctolagus cuniculus (japanese white rabbit) (aka oryctolagus cuniculus)
E: domestic goat (aka capra hircus)
F: cattle (aka bos)
G: capra
H: mus musculus musculus (eastern european house mouse) (aka mus musculus musculus)
I: mus (aka mus <subgenus>) (aka mus <subgenus>)
J: mice (aka mus <genus>) (aka mus <genus>)
K: lepus (hares) (aka lepus)
L: marsh rabbit (aka sylvilagus palustris)
M: european hare (aka lepus europaeus)
N: capneidae
O: house mouse (aka mus musculus)
P: None of the above. | [D; E; O] |
<Instruct>: Given the context 'Peroxidase-conjugated rabbit anti-goat IgG antibody (Dako) or peroxidase-conjugated rabbit anti-mouse IgG antibody (Dako) was used as the second antibody.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [rabbit; goat; mouse]
<Options>: A: donkey (aka equus asinus)
B: capra aegagrus (capra hircus aegagrus) (aka capra aegagrus)
C: mus <genus> (mice (aka mus <genus>))
D: mus <subgenus> (mus (aka mus <subgenus>))
E: lepus europaeus europaeus
F: mouse (aka mus musculus)
G: mus musculus domesticus (western european house mouse) (aka mus musculus domesticus)
H: capra aegagrus hircus (aka capra hircus)
I: mus cricetus (aka cricetus cricetus)
J: bovidae
K: leporidae (rabbits and hares) (aka leporidae)
L: hares (aka lepus)
M: cattle (aka bos)
N: rabbits (aka oryctolagus cuniculus)
O: None of the above. | [N; H; F] |
<Instruct>: Given the context 'Alexa 647-conjugated mouse IgG2a (Serotec), FITC-conjugated mouse IgG1 (BD Biosciences) and phycoerythin-conjugated mouse IgG1 (Bechman Coulter) were used as isotype controls.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse]
<Options>: A: mouse (aka mus musculus)
B: eastern european house mouse (aka mus musculus musculus)
C: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
D: peromyscus
E: mus cricetus (aka cricetus cricetus)
F: None of the above. | [A] |
<Instruct>: Given the context 'Peripheral blood monocytes (1 × 105 cells) were incubated with 1 μg human IgG for 15 minutes, and were then stained with three fluorochrome-labeled mAbs for 45 minutes on ice.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human]
<Options>: A: macrobiotus sapiens
B: homo sapiens (human) (aka homo sapiens)
C: birds (aka aves)
D: cellular organisms (biota) (aka cellular organisms)
E: kingdom
F: None of the above. | [B] |
<Instruct>: Given the context 'The cells were fixed in acetone and then stained with anti-αvβ3 mAb (LM609; Chemicon, Temecula, CA, USA) or mouse IgG1 (11711; R&D Systems) as an isotype-matched control.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse]
<Options>: A: peromyscus
B: mus musculus musculus (eastern european house mouse) (aka mus musculus musculus)
C: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
D: mouse (aka mus <genus>)
E: mouse (aka mus musculus)
F: None of the above. | [E] |
<Instruct>: Given the context 'Alexa fluor546-conjugated goat anti-mouse IgG1 antibody (Molecular Probes, Eugene, OR, USA) was used as the second antibody.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [goat; mouse]
<Options>: A: house mouse (aka mus musculus)
B: capreolus
C: cattle (aka bos)
D: mus cricetus (aka cricetus cricetus)
E: western european house mouse (aka mus musculus domesticus)
F: mus musculus musculus (eastern european house mouse) (aka mus musculus musculus)
G: domestic goat (aka capra hircus)
H: donkey (aka equus asinus)
I: capraita
J: mus sp. (mice (aka mus sp.))
K: None of the above. | [G; A] |
<Instruct>: Given the context 'Alexa fluor546-conjugated goat anti-mouse IgG1 antibody (Molecular Probes, Eugene, OR, USA) was used as the second antibody.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [goat; mouse]
<Options>: A: mus musculus domesticus (western european house mouse) (aka mus musculus domesticus)
B: mus molossinus (aka mus musculus molossinus)
C: mus cricetus (aka cricetus cricetus)
D: capra aegagrus hircus (aka capra hircus)
E: capra hircus aegagrus (aka capra aegagrus)
F: caponia
G: house mouse (aka mus musculus)
H: mus sp. (mice (aka mus sp.))
I: capraita
J: capra aegagrus cretica (aka capra hircus cretica)
K: None of the above. | [D; G] |
<Instruct>: Given the context 'A total of 1 × 105 cells was then Fc blocked with 1 μg human IgG for 15 minutes, and was stained with Alexa Fluor 647-conjugated mAb either to phospho-p38 MAPK (T180/Y182) or to phospho-ERK1/2 (T202/Y204) (BD Biosciences) for 30 minutes at room temperature.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human]
<Options>: A: human (aka homo sapiens)
B: macrobiotus sapiens
C: species
D: biota (aka cellular organisms)
E: kingdom
F: None of the above. | [A] |
<Instruct>: Given the context 'Alexa Fluor 647-conjugated mouse IgG1 (BD Biosciences) was used as an isotype control.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse]
<Options>: A: mus <genus> (mice (aka mus <genus>))
B: peromyscus
C: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
D: mus musculus (house mouse) (aka mus musculus)
E: mus molossinus (aka mus musculus molossinus)
F: None of the above. | [D] |
<Instruct>: Given the context 'Immunohistochemistry
Synovial tissue samples were obtained during total knee joint replacement surgery from four RA patients.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [patients]
<Options>: A: mus <genus> (mice (aka mus <genus>))
B: homo sapiens (human) (aka homo sapiens)
C: theraps
D: goes
E: genus
F: None of the above. | [B] |
<Instruct>: Given the context 'The samples were then blocked with 10% goat serum in PBS for 60 minutes at room temperature, and were incubated with anti-CD16 mAb (3G8; Immunotech, Marseille, France) or mouse IgG1 (11711) as an isotype-matched control in 1% bovine serum albumin/PBS for 60 minutes at room temperature.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [goat; mouse; bovine]
<Options>: A: capra
B: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
C: mus cricetus (aka cricetus cricetus)
D: mus musculus domesticus (western european house mouse) (aka mus musculus domesticus)
E: bovinae
F: boveria
G: cattle (aka bos)
H: domestic cow (aka bos taurus)
I: domestic goat (aka capra hircus)
J: bos sp.
K: capra cretica (aka capra hircus cretica)
L: donkey (aka equus asinus)
M: mus molossinus (aka mus musculus molossinus)
N: mouse (aka mus musculus)
O: bos (cattle) (aka bos)
P: None of the above. | [I; N; H] |
<Instruct>: Given the context 'The samples were then blocked with 10% goat serum in PBS for 60 minutes at room temperature, and were incubated with anti-CD16 mAb (3G8; Immunotech, Marseille, France) or mouse IgG1 (11711) as an isotype-matched control in 1% bovine serum albumin/PBS for 60 minutes at room temperature.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [goat; mouse; bovine]
<Options>: A: mus <subgenus> (mus (aka mus <subgenus>))
B: capneidae
C: capra aegagrus hircus (aka capra hircus)
D: cow (aka bos taurus) (aka bos taurus)
E: capra hircus aegagrus (aka capra aegagrus)
F: peromyscus
G: boveria
H: mouse (aka mus musculus)
I: mus sp. (mice (aka mus sp.))
J: bos (cattle) (aka bos)
K: capreolus
L: sueus
M: bovinae
N: bos taurus indicus (aka bos indicus)
O: mus cricetus (aka cricetus cricetus)
P: None of the above. | [C; H; D] |
<Instruct>: Given the context 'The samples were then blocked with 10% goat serum in PBS for 60 minutes at room temperature, and were incubated with anti-CD16 mAb (3G8; Immunotech, Marseille, France) or mouse IgG1 (11711) as an isotype-matched control in 1% bovine serum albumin/PBS for 60 minutes at room temperature.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [goat; mouse; bovine]
<Options>: A: mus musculus musculus (eastern european house mouse) (aka mus musculus musculus)
B: donkey (aka equus asinus)
C: house mouse (aka mus musculus)
D: capreolus
E: bos taurus x bos indicus (aka bos indicus x bos taurus)
F: mus musculus domesticus (western european house mouse) (aka mus musculus domesticus)
G: bovidae
H: capra hircus aegagrus (aka capra aegagrus)
I: peromyscus
J: cattle (aka bos)
K: sueus
L: boveria
M: goat (aka capra hircus) (aka capra hircus)
N: mus cricetus (aka cricetus cricetus)
O: ox (aka bos taurus) (aka bos taurus)
P: None of the above. | [M; C; O] |
<Instruct>: Given the context 'The samples were then washed three times in PBS, for 5 minutes each, and incubated with Alexa fluor546-conjugated goat anti-mouse IgG1 antibody (Molecular Probes) in 1% bovine serum albumin/PBS for 60 minutes at room temperature.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [goat; mouse; bovine]
<Options>: A: capraita
B: bovinae
C: mus sp. (mice (aka mus sp.))
D: mus musculus (house mouse) (aka mus musculus)
E: capra aegagrus (capra hircus aegagrus) (aka capra aegagrus)
F: dairy cow (aka bos taurus)
G: capra
H: mus cricetus (aka cricetus cricetus)
I: bos bubalis bubalis (aka bubalus bubalis bubalis)
J: eastern european house mouse (aka mus musculus musculus)
K: bovidae
L: bos sp.
M: mus domesticus (aka mus musculus domesticus)
N: cattle (aka bos)
O: goats (aka capra hircus)
P: None of the above. | [O; D; F] |
<Instruct>: Given the context 'The samples were then washed three times in PBS, for 5 minutes each, and incubated with Alexa fluor546-conjugated goat anti-mouse IgG1 antibody (Molecular Probes) in 1% bovine serum albumin/PBS for 60 minutes at room temperature.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [goat; mouse; bovine]
<Options>: A: capra cretica (aka capra hircus cretica)
B: cattle (aka bos)
C: bovidae
D: domestic cow (aka bos taurus)
E: mus cricetus (aka cricetus cricetus)
F: mice (aka mus sp.) (aka mus sp.)
G: eastern european house mouse (aka mus musculus musculus)
H: bos taurus x bos indicus (aka bos indicus x bos taurus)
I: bovinae
J: house mouse (aka mus musculus)
K: boveria
L: bos indicus (bos primigenius indicus) (aka bos indicus)
M: capra hircus (capra aegagrus hircus) (aka capra hircus)
N: donkey (aka equus asinus)
O: mus domesticus (aka mus musculus domesticus)
P: None of the above. | [M; J; D] |
<Instruct>: Given the context 'The samples were then washed three times in PBS, for 5 minutes each, and incubated with Alexa fluor546-conjugated goat anti-mouse IgG1 antibody (Molecular Probes) in 1% bovine serum albumin/PBS for 60 minutes at room temperature.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [goat; mouse; bovine]
<Options>: A: peromyscus
B: sueus
C: mus cricetus (aka cricetus cricetus)
D: bos bovis (aka bos taurus)
E: capra aegagrus (capra hircus aegagrus) (aka capra aegagrus)
F: capra aegagrus hircus (aka capra hircus)
G: mus musculus (house mouse) (aka mus musculus)
H: capra
I: bos (cattle) (aka bos)
J: mice (aka mus sp.) (aka mus sp.)
K: capneidae
L: bovinae
M: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
N: bos sp.
O: bos taurus indicus (aka bos indicus)
P: None of the above. | [F; G; D] |
<Instruct>: Given the context 'The samples were stained with anti-CD68 mAb (PGM1; Immunotech) or mouse IgG3 (6A3; MBL, Nagoya, Japan) followed by labeling with Alexa fluor488-conjugated goat anti-mouse IgG3 antibody (Molecular Probes).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse; goat]
<Options>: A: sueus
B: mus (aka mus <subgenus>) (aka mus <subgenus>)
C: mus musculoides (mus musculoides enclavae) (aka mus musculoides)
D: mus cricetus (aka cricetus cricetus)
E: mus musculus (house mouse) (aka mus musculus)
F: capra hircus cretica (capra aegagrus cretica) (aka capra hircus cretica)
G: capra hircus (capra aegagrus hircus) (aka capra hircus)
H: capraita
I: donkey (aka equus asinus)
J: peromyscus
K: None of the above. | [E; G] |
<Instruct>: Given the context 'The samples were stained with anti-CD68 mAb (PGM1; Immunotech) or mouse IgG3 (6A3; MBL, Nagoya, Japan) followed by labeling with Alexa fluor488-conjugated goat anti-mouse IgG3 antibody (Molecular Probes).', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [mouse; goat]
<Options>: A: peromyscus
B: capneidae
C: capreolus
D: mus cricetus (aka cricetus cricetus)
E: mus molossinus (aka mus musculus molossinus)
F: capra aegagrus hircus (aka capra hircus)
G: mus (aka mus <subgenus>) (aka mus <subgenus>)
H: house mouse (aka mus musculus)
I: cattle (aka bos)
J: caponia
K: None of the above. | [H; F] |
<Instruct>: Given the context 'Results
Induction of osteoclasts from CD16- peripheral blood monocytes
To identify the monocyte subset that differentiates into osteoclasts, we examined osteoclast formation from CD16+ and CD16- human peripheral blood monocytes.', select the correct biomedical concept for each mention using the provided options. Answer by listing the selected options, one for each mention, separated by semicolon. | <Mentions>: [human]
<Options>: A: human (aka homo sapiens)
B: mammals (aka mammalia)
C: macrobiotus sapiens
D: genus
E: avian (aka aves)
F: None of the above. | [A] |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.