query
stringclasses
175 values
positive
listlengths
1
9
negative
listlengths
10
10
system
stringlengths
69
2.19k
What is the biomedical concept corresponding to 'wheat'?
[ "wheat (triticum aestivum)", "common wheat (triticum aestivum)", "bread wheat (triticum aestivum)", "triticum vulgare (triticum aestivum)", "triticum aestivum (triticum aestivum subsp. aestivum)", "triticum sativum (triticum aestivum)", "triticum aestivum subsp. aestivum (triticum aestivum)" ]
[ "english wheat (triticum turgidum)", "triticum", "triticum durum (triticum turgidum subsp. durum)", "one-grained wheat (triticum monococcum)", "triticum x secale (x triticosecale)", "triticum aethiopicum (triticum turgidum)", "cone wheat (triticum turgidum)", "rivet wheat (triticum turgidum)", "trit...
Given the context 'As described above, the rps10 transcript was not processed in wheat but it was correctly spliced in cognate mitochondria (Figure 5A).', answer the user's query.
What is the biomedical concept corresponding to 'wheat'?
[ "wheat (triticum aestivum)", "common wheat (triticum aestivum)", "bread wheat (triticum aestivum)", "triticum vulgare (triticum aestivum)", "triticum aestivum (triticum aestivum subsp. aestivum)", "triticum sativum (triticum aestivum)", "triticum aestivum subsp. aestivum (triticum aestivum)" ]
[ "english wheat (triticum turgidum)", "triticum", "triticum durum (triticum turgidum subsp. durum)", "one-grained wheat (triticum monococcum)", "triticum x secale (x triticosecale)", "triticum aethiopicum (triticum turgidum)", "cone wheat (triticum turgidum)", "rivet wheat (triticum turgidum)", "trit...
Given the context 'The fact that the four editing sites were found either edited or unedited in spliced rps10 mRNA is an indication that editing does not precede splicing as was previously found for cox2 in wheat (15). ', answer the user's query.
What is the biomedical concept corresponding to 'potato'?
[ "potato (solanum tuberosum)", "potatoes (solanum tuberosum)", "solanum tuberosum (solanum aracc-papa)" ]
[ "chilean potato-tree (solanum crispum)", "sweet potato (ipomoea batatas)", "air-potato (dioscorea bulbifera)", "chinese-potato (dioscorea polystachya)", "agave potatorum", "solanum crispum (chilean potato-tree)", "potato yam (dioscorea bulbifera)", "chaco potato (solanum chacoense)", "dioscorea bulb...
Given the context 'This possibility can be discarded since potato rps10 precursor mRNA was found to be edited in vivo (23).', answer the user's query.
What is the biomedical concept corresponding to 'wheat'?
[ "wheat (triticum aestivum)", "common wheat (triticum aestivum)", "bread wheat (triticum aestivum)", "triticum vulgare (triticum aestivum)", "triticum aestivum (triticum aestivum subsp. aestivum)", "triticum sativum (triticum aestivum)", "triticum aestivum subsp. aestivum (triticum aestivum)" ]
[ "english wheat (triticum turgidum)", "triticum", "triticum durum (triticum turgidum subsp. durum)", "one-grained wheat (triticum monococcum)", "triticum x secale (x triticosecale)", "triticum aethiopicum (triticum turgidum)", "cone wheat (triticum turgidum)", "rivet wheat (triticum turgidum)", "trit...
Given the context 'This led us to postulate that the inability of wheat mitochondria to recognize rps10 editing sites is likely due to the fact that wheat mitochondria have lost the editing trans-recognition elements which become dispensable after transfer of rps10 to the nucleus.', answer the user's query.
What is the biomedical concept corresponding to 'wheat'?
[ "wheat (triticum aestivum)", "common wheat (triticum aestivum)", "bread wheat (triticum aestivum)", "triticum vulgare (triticum aestivum)", "triticum aestivum (triticum aestivum subsp. aestivum)", "triticum sativum (triticum aestivum)", "triticum aestivum subsp. aestivum (triticum aestivum)" ]
[ "english wheat (triticum turgidum)", "triticum", "triticum durum (triticum turgidum subsp. durum)", "one-grained wheat (triticum monococcum)", "triticum x secale (x triticosecale)", "triticum aethiopicum (triticum turgidum)", "cone wheat (triticum turgidum)", "rivet wheat (triticum turgidum)", "trit...
Given the context 'This led us to postulate that the inability of wheat mitochondria to recognize rps10 editing sites is likely due to the fact that wheat mitochondria have lost the editing trans-recognition elements which become dispensable after transfer of rps10 to the nucleus.', answer the user's query.
What is the biomedical concept corresponding to 'wheat'?
[ "wheat (triticum aestivum)", "common wheat (triticum aestivum)", "bread wheat (triticum aestivum)", "triticum vulgare (triticum aestivum)", "triticum aestivum (triticum aestivum subsp. aestivum)", "triticum sativum (triticum aestivum)", "triticum aestivum subsp. aestivum (triticum aestivum)" ]
[ "english wheat (triticum turgidum)", "triticum", "triticum durum (triticum turgidum subsp. durum)", "one-grained wheat (triticum monococcum)", "triticum x secale (x triticosecale)", "triticum aethiopicum (triticum turgidum)", "cone wheat (triticum turgidum)", "rivet wheat (triticum turgidum)", "trit...
Given the context 'To test this possibility, rps10 chimeric plasmids containing editing site C259 from wheat cox2 inserted either in exon1 or the intron were constructed.', answer the user's query.
What is the biomedical concept corresponding to 'wheat'?
[ "wheat (triticum aestivum)", "common wheat (triticum aestivum)", "bread wheat (triticum aestivum)", "triticum vulgare (triticum aestivum)", "triticum aestivum (triticum aestivum subsp. aestivum)", "triticum sativum (triticum aestivum)", "triticum aestivum subsp. aestivum (triticum aestivum)" ]
[ "english wheat (triticum turgidum)", "triticum", "triticum durum (triticum turgidum subsp. durum)", "one-grained wheat (triticum monococcum)", "triticum x secale (x triticosecale)", "triticum aethiopicum (triticum turgidum)", "cone wheat (triticum turgidum)", "rivet wheat (triticum turgidum)", "trit...
Given the context 'The wheat C259 editing site in the chimeric construct was correctly edited by potato mitochondria.', answer the user's query.
What is the biomedical concept corresponding to 'potato'?
[ "potato (solanum tuberosum)", "potatoes (solanum tuberosum)", "solanum tuberosum (solanum aracc-papa)" ]
[ "chilean potato-tree (solanum crispum)", "sweet potato (ipomoea batatas)", "air-potato (dioscorea bulbifera)", "chinese-potato (dioscorea polystachya)", "agave potatorum", "solanum crispum (chilean potato-tree)", "potato yam (dioscorea bulbifera)", "chaco potato (solanum chacoense)", "dioscorea bulb...
Given the context 'The wheat C259 editing site in the chimeric construct was correctly edited by potato mitochondria.', answer the user's query.
What is the biomedical concept corresponding to 'potato'?
[ "potato (solanum tuberosum)", "potatoes (solanum tuberosum)", "solanum tuberosum (solanum aracc-papa)" ]
[ "chilean potato-tree (solanum crispum)", "sweet potato (ipomoea batatas)", "air-potato (dioscorea bulbifera)", "chinese-potato (dioscorea polystachya)", "agave potatorum", "solanum crispum (chilean potato-tree)", "potato yam (dioscorea bulbifera)", "chaco potato (solanum chacoense)", "dioscorea bulb...
Given the context 'This result is not unexpected since the corresponding region in endogenous potato cox2 mRNA, which presents two differences at positions −3 (C instead of A) and −7 (G instead of A), is edited.', answer the user's query.
What is the biomedical concept corresponding to 'wheat'?
[ "wheat (triticum aestivum)", "common wheat (triticum aestivum)", "bread wheat (triticum aestivum)", "triticum vulgare (triticum aestivum)", "triticum aestivum (triticum aestivum subsp. aestivum)", "triticum sativum (triticum aestivum)", "triticum aestivum subsp. aestivum (triticum aestivum)" ]
[ "english wheat (triticum turgidum)", "triticum", "triticum durum (triticum turgidum subsp. durum)", "one-grained wheat (triticum monococcum)", "triticum x secale (x triticosecale)", "triticum aethiopicum (triticum turgidum)", "cone wheat (triticum turgidum)", "rivet wheat (triticum turgidum)", "trit...
Given the context 'Surprisingly, the C259 editing site grafted in rps10 was not recognized by the wheat editing machinery.', answer the user's query.
What is the biomedical concept corresponding to 'wheat'?
[ "wheat (triticum aestivum)", "common wheat (triticum aestivum)", "bread wheat (triticum aestivum)", "triticum vulgare (triticum aestivum)", "triticum aestivum (triticum aestivum subsp. aestivum)", "triticum sativum (triticum aestivum)", "triticum aestivum subsp. aestivum (triticum aestivum)" ]
[ "english wheat (triticum turgidum)", "triticum", "triticum durum (triticum turgidum subsp. durum)", "one-grained wheat (triticum monococcum)", "triticum x secale (x triticosecale)", "triticum aethiopicum (triticum turgidum)", "cone wheat (triticum turgidum)", "rivet wheat (triticum turgidum)", "trit...
Given the context 'The fact that the wheat editing site C259 inserted in chimeric rps10 transcripts was not recognized by wheat mitochondria is a strong argument for this hypothesis.', answer the user's query.
What is the biomedical concept corresponding to 'wheat'?
[ "wheat (triticum aestivum)", "common wheat (triticum aestivum)", "bread wheat (triticum aestivum)", "triticum vulgare (triticum aestivum)", "triticum aestivum (triticum aestivum subsp. aestivum)", "triticum sativum (triticum aestivum)", "triticum aestivum subsp. aestivum (triticum aestivum)" ]
[ "english wheat (triticum turgidum)", "triticum", "triticum durum (triticum turgidum subsp. durum)", "one-grained wheat (triticum monococcum)", "triticum x secale (x triticosecale)", "triticum aethiopicum (triticum turgidum)", "cone wheat (triticum turgidum)", "rivet wheat (triticum turgidum)", "trit...
Given the context 'The fact that the wheat editing site C259 inserted in chimeric rps10 transcripts was not recognized by wheat mitochondria is a strong argument for this hypothesis.', answer the user's query.
What is the biomedical concept corresponding to 'tetrastigma voinierianum'?
[ "tetrastigma voinierianum (vitis voinieriana)", "vitis voinieriana (tetrastigma voinierianum)" ]
[ "poecilimon vodnensis", "anapochrysa voeltzkowi", "phacelia vossii", "sclerochiton vogelii (isacanthus vogelii)", "platycelyphium voense", "myriophyllum votschii", "atopochilus vogti", "gymnopilus voitkii", "magnolia vovidesii", "sphaeria vogesiaca (hypoxylon vogesiacum)" ]
Given the context 'The power function Tf=f(Pc) theoretically derived was experimentally confirmed by concomitant Pp and Pc measurements on intact leaflets of the liana Tetrastigma voinierianum under greenhouse conditions.', answer the user's query.
What is the biomedical concept corresponding to 'tetrastigma voinierianum'?
[ "tetrastigma voinierianum (vitis voinieriana)", "vitis voinieriana (tetrastigma voinierianum)" ]
[ "poecilimon vodnensis", "anapochrysa voeltzkowi", "phacelia vossii", "sclerochiton vogelii (isacanthus vogelii)", "platycelyphium voense", "myriophyllum votschii", "atopochilus vogti", "gymnopilus voitkii", "magnolia vovidesii", "sphaeria vogesiaca (hypoxylon vogesiacum)" ]
Given the context 'This could be verified by combined turgor pressure probe and leaf patch clamp pressure probe measurements on leaflets of the liana Tetrastigma voinierianum.', answer the user's query.
What is the biomedical concept corresponding to 'tetrastigma voinierianum'?
[ "tetrastigma voinierianum (vitis voinieriana)", "vitis voinieriana (tetrastigma voinierianum)" ]
[ "poecilimon vodnensis", "anapochrysa voeltzkowi", "phacelia vossii", "sclerochiton vogelii (isacanthus vogelii)", "platycelyphium voense", "myriophyllum votschii", "atopochilus vogti", "gymnopilus voitkii", "magnolia vovidesii", "sphaeria vogesiaca (hypoxylon vogesiacum)" ]
Given the context 'Materials and methods Plant material Experiments were performed on two specimens of the liana Tetrastigma voinierianum, growing in the c. 12 m tall tropical greenhouse of the University of Salzburg, Austria.', answer the user's query.
What is the biomedical concept corresponding to 't. voinierianum'?
[ "tetrastigma voinierianum (vitis voinieriana)", "vitis voinieriana (tetrastigma voinierianum)" ]
[ "haplotrema voyanum (ancotrema voyanum)", "byttneria voulily", "albinaria voithii (clausilia voithii)", "ancotrema voyanum (haplotrema voyanum)", "clausilia voithii (albinaria voithii)", "leucochloridium vogtianum", "helix voyana (haplotrema voyanum)", "poecilimon vodnensis", "citheronia vogleri", ...
Given the context 'Turgor pressure measurements on leaf cells of T. voinierianum were difficult to perform because of the presence of mucilage.', answer the user's query.
What is the biomedical concept corresponding to 't. voinierianum'?
[ "tetrastigma voinierianum (vitis voinieriana)", "vitis voinieriana (tetrastigma voinierianum)" ]
[ "haplotrema voyanum (ancotrema voyanum)", "byttneria voulily", "albinaria voithii (clausilia voithii)", "ancotrema voyanum (haplotrema voyanum)", "clausilia voithii (albinaria voithii)", "leucochloridium vogtianum", "helix voyana (haplotrema voyanum)", "poecilimon vodnensis", "citheronia vogleri", ...
Given the context 'Experience collected with patch clamp pressure measurements on T. voinierianum and on preliminary results of other plants (e.g. grapevines, bananas, Eucalyptus, and Arabidopsis) showed that a smooth intercostal leaf area for clamping can readily be found.', answer the user's query.
What is the biomedical concept corresponding to 'bananas'?
[ "banana (musa acuminata)", "dwarf banana (musa acuminata)", "dessert bananas (musa acuminata)", "sweet banana (musa acuminata)" ]
[ "banana (musa x paradisiaca)", "cooking banana (musa abb group)", "baniana", "banchus", "bannoa", "banjos", "flowering banana (musa ornata)", "banta banta", "banana family (musaceae)", "dessert banana (musa acuminata aaa group)" ]
Given the context 'Experience collected with patch clamp pressure measurements on T. voinierianum and on preliminary results of other plants (e.g. grapevines, bananas, Eucalyptus, and Arabidopsis) showed that a smooth intercostal leaf area for clamping can readily be found.', answer the user's query.
What is the biomedical concept corresponding to 'bananas'?
[ "banana (musa acuminata)", "dwarf banana (musa acuminata)", "dessert bananas (musa acuminata)", "sweet banana (musa acuminata)" ]
[ "banana (musa x paradisiaca)", "cooking banana (musa abb group)", "baniana", "banchus", "bannoa", "banjos", "flowering banana (musa ornata)", "banta banta", "banana family (musaceae)", "dessert banana (musa acuminata aaa group)" ]
Given the context 'Analogous recordings of turgor pressure and patch clamp pressure on grapevines, bananas, and Eucalyptus trees also yielded results (D Zimmermann, unpublished results) which were consistent with the predictions of equation 8.', answer the user's query.
What is the biomedical concept corresponding to 'eucalyptus'?
[ "eucalyptus" ]
[ "eucalybites", "eucalymnatus", "eucalyptus occidentalis", "eucalyptus absita", "eucalyptus pterocarpa", "eucalyptus communalis", "eucalyptus luculenta", "eucalyptus globulus (blue gum)", "eucalyptus pulverulenta (powdered gum)", "eucalyptus canescens" ]
Given the context 'Analogous recordings of turgor pressure and patch clamp pressure on grapevines, bananas, and Eucalyptus trees also yielded results (D Zimmermann, unpublished results) which were consistent with the predictions of equation 8.', answer the user's query.
What is the biomedical concept corresponding to 'myrothamnus flabellifolia'?
[ "myrothamnus flabellifolia (myrothamnus flabellifolius)", "myrothamnus flabellifolius (myrothamnus flabellifolia)" ]
[ "chaetanthera flabellifolia", "mimosa flabellifolia", "hymenophyllum flabellatum", "acacia flabellifolia", "pimpinella flabellifolia", "babiana flabellifolia", "hakea flabellifolia", "pannaria flabellosa (placynthium flabellosum)", "pleurostomum flabellatum", "placynthium flabellosum (pannaria fla...
Given the context 'The process seemed to be very similar to the refilling of the cells of the resurrection plant Myrothamnus flabellifolia with water after desiccation (Wagner et al., 2000).', answer the user's query.
What is the biomedical concept corresponding to 't. voinierianum'?
[ "tetrastigma voinierianum (vitis voinieriana)", "vitis voinieriana (tetrastigma voinierianum)" ]
[ "haplotrema voyanum (ancotrema voyanum)", "byttneria voulily", "albinaria voithii (clausilia voithii)", "ancotrema voyanum (haplotrema voyanum)", "clausilia voithii (albinaria voithii)", "leucochloridium vogtianum", "helix voyana (haplotrema voyanum)", "poecilimon vodnensis", "citheronia vogleri", ...
Given the context '4A and B, restoration of full turgescence in T. voinierianum was faster than the preceding turgor pressure loss if the lianas were well-watered.', answer the user's query.
What is the biomedical concept corresponding to 't. voinierianum'?
[ "tetrastigma voinierianum (vitis voinieriana)", "vitis voinieriana (tetrastigma voinierianum)" ]
[ "haplotrema voyanum (ancotrema voyanum)", "byttneria voulily", "albinaria voithii (clausilia voithii)", "ancotrema voyanum (haplotrema voyanum)", "clausilia voithii (albinaria voithii)", "leucochloridium vogtianum", "helix voyana (haplotrema voyanum)", "poecilimon vodnensis", "citheronia vogleri", ...
Given the context 'Even though more work is required, the present study shows that the leaf patch clamp pressure probe is a promising tool to elucidate short- and long-distance water transport in T. voinierianum and other plants. ', answer the user's query.
What is the biomedical concept corresponding to 'patient'?
[ "human (homo sapiens)" ]
[ "clientister", "personidae", "theraps", "proxys", "perna", "pera", "pero", "aides", "personopsis", "inquisitor" ]
Given the context 'Nevertheless, the choice of the systemic artery in each individual patient is important since in certain cases one or another is unsuitable. ', answer the user's query.
What is the biomedical concept corresponding to 'patients'?
[ "human (homo sapiens)" ]
[ "clientister", "theraps", "personidae", "proxys", "perna", "genus", "aides", "pero", "inquisitor", "plasmids" ]
Given the context 'The subclavian branch of the innominate has generally been preferred in patients ranging between two and twelve years of age and in older individuals in whom there is a right aortic arch.', answer the user's query.
What is the biomedical concept corresponding to 'patients'?
[ "human (homo sapiens)" ]
[ "clientister", "theraps", "personidae", "proxys", "perna", "genus", "aides", "pero", "inquisitor", "plasmids" ]
Given the context 'Excluding the patients mentioned in the present report, only in two was an unquestionably good result obtained. ', answer the user's query.
What is the biomedical concept corresponding to 'patient'?
[ "human (homo sapiens)" ]
[ "clientister", "personidae", "theraps", "proxys", "perna", "pera", "pero", "aides", "personopsis", "inquisitor" ]
Given the context 'Case report The patient was a 19-year-old girl who had been cyanotic since the age of six months.', answer the user's query.
What is the biomedical concept corresponding to 'patient'?
[ "human (homo sapiens)" ]
[ "clientister", "personidae", "theraps", "proxys", "perna", "pera", "pero", "aides", "personopsis", "inquisitor" ]
Given the context 'The patient had an uneventful but disappointing convalescence.', answer the user's query.
What is the biomedical concept corresponding to 'patient'?
[ "human (homo sapiens)" ]
[ "clientister", "personidae", "theraps", "proxys", "perna", "pera", "pero", "aides", "personopsis", "inquisitor" ]
Given the context 'Though the patient has been markedly improved, it is recognized that the result is not as good as is commonly obtained when patients with more adequate pulmonary arteries are treated by the conventional anastomosis of a systemic artery to the side of the pulmonary artery.', answer the user's query.
What is the biomedical concept corresponding to 'patients'?
[ "human (homo sapiens)" ]
[ "clientister", "theraps", "personidae", "proxys", "perna", "genus", "aides", "pero", "inquisitor", "plasmids" ]
Given the context 'Though the patient has been markedly improved, it is recognized that the result is not as good as is commonly obtained when patients with more adequate pulmonary arteries are treated by the conventional anastomosis of a systemic artery to the side of the pulmonary artery.', answer the user's query.
What is the biomedical concept corresponding to 'patient'?
[ "human (homo sapiens)" ]
[ "clientister", "personidae", "theraps", "proxys", "perna", "pera", "pero", "aides", "personopsis", "inquisitor" ]
Given the context 'Nevertheless, the patient has thus far been given such good health and relatively normal capacity for ordinary activity that further operation has seemed unwarranted, though the possibility of some future attempt at creation of an additional shunt is being kept in mind. ', answer the user's query.
What is the biomedical concept corresponding to 'patient'?
[ "human (homo sapiens)" ]
[ "clientister", "personidae", "theraps", "proxys", "perna", "pera", "pero", "aides", "personopsis", "inquisitor" ]
Given the context 'TREATMENT OF TETRALOGY OF FALLOT Case reports The first patient was a fully grown young man of 17 with tetralogy of Fallot which caused considerable incapacity.', answer the user's query.
What is the biomedical concept corresponding to 'man'?
[ "human (homo sapiens)", "homo sapiens (human)" ]
[ "humans (homo)", "homo (humans)", "manis", "manisuris", "macrobiotus sapiens", "mammals (mammalia)", "manotes", "manica", "manoa", "neandertal man (homo sapiens neanderthalensis)" ]
Given the context 'TREATMENT OF TETRALOGY OF FALLOT Case reports The first patient was a fully grown young man of 17 with tetralogy of Fallot which caused considerable incapacity.', answer the user's query.
What is the biomedical concept corresponding to 'patient'?
[ "human (homo sapiens)" ]
[ "clientister", "personidae", "theraps", "proxys", "perna", "pera", "pero", "aides", "personopsis", "inquisitor" ]
Given the context 'The patient had an uneventful convalescence.', answer the user's query.
What is the biomedical concept corresponding to 'patient'?
[ "human (homo sapiens)" ]
[ "clientister", "personidae", "theraps", "proxys", "perna", "pera", "pero", "aides", "personopsis", "inquisitor" ]
Given the context 'The second patient was a 16-year-old boy who had been cyanotic since birth.', answer the user's query.
What is the biomedical concept corresponding to 'patient'?
[ "human (homo sapiens)" ]
[ "clientister", "personidae", "theraps", "proxys", "perna", "pera", "pero", "aides", "personopsis", "inquisitor" ]
Given the context 'The operation performed in my first patient constitutes in reality the use of the subclavian artery as an autogenous graft between the aorta and pulmonary artery.', answer the user's query.
What is the biomedical concept corresponding to 'dogs'?
[ "dogs (canis lupus familiaris) (canis lupus familiaris)", "dog (canis lupus familiaris) (canis lupus familiaris)", "canis lupus familiaris (dogs (canis lupus familiaris))", "canis familiaris (canis lupus familiaris)", "canis domesticus (canis lupus familiaris)", "canis canis (canis lupus familiaris)" ]
[ "canidae (dog, coyote, wolf, fox)", "felidae (cat family)", "canis", "dogielinotidae", "cat family (felidae)", "canis vulpes (vulpes vulpes)", "dogielius", "felis", "canis sp.", "catiniidae" ]
Given the context 'Observation on arterial grafts in dogs.', answer the user's query.
What is the biomedical concept corresponding to 'human'?
[ "human (homo sapiens)", "homo sapiens (human)" ]
[ "humans (homo)", "homo (humans)", "macrobiotus sapiens", "primate (primates)", "hominoidea (apes (hominoidea))", "hominidae (great apes)", "ape (hominoidea) (hominoidea)", "kingdom", "apes (hominoidea) (hominoidea)", "homininae (homo/pan/gorilla group)" ]
Given the context 'Report of transplantation of preserved arterial grafts in nine human cases.', answer the user's query.
What is the biomedical concept corresponding to 'mouse'?
[ "mouse (mus musculus)", "house mouse (mus musculus)", "mus musculus (house mouse)" ]
[ "mouse (mus <genus>)", "mice (mus <genus>) (mus <genus>)", "mus <genus> (mice (mus <genus>))", "mice (mus sp.) (mus sp.)", "mus musculus musculus (eastern european house mouse)", "eastern european house mouse (mus musculus musculus)", "western european house mouse (mus musculus domesticus)", "mus sp. ...
Given the context 'Organization and structure of the mouse interleukin-2 gene. ', answer the user's query.
What is the biomedical concept corresponding to 'murine'?
[ "mouse (mus musculus)", "house mouse (mus musculus)", "mus musculus (house mouse)" ]
[ "mice (mus <genus>) (mus <genus>)", "mouse (mus <genus>)", "eastern european house mouse (mus musculus musculus)", "mice (mus sp.) (mus sp.)", "mus <genus> (mice (mus <genus>))", "western european house mouse (mus musculus domesticus)", "mus musculus musculus (eastern european house mouse)", "mus musc...
Given the context 'Abstract We have cloned a chromosomal DNA segment which covers the entire sequence for the murine interleukin-2 gene and analysed the structure of the gene.', answer the user's query.
What is the biomedical concept corresponding to 'human'?
[ "human (homo sapiens)", "homo sapiens (human)" ]
[ "humans (homo)", "homo (humans)", "macrobiotus sapiens", "primate (primates)", "hominoidea (apes (hominoidea))", "hominidae (great apes)", "ape (hominoidea) (hominoidea)", "kingdom", "apes (hominoidea) (hominoidea)", "homininae (homo/pan/gorilla group)" ]
Given the context 'The coding regions are separated into four blocks by three introns each of which is located similarly to the corresponding human gene.', answer the user's query.
What is the biomedical concept corresponding to 'mouse'?
[ "mouse (mus musculus)", "house mouse (mus musculus)", "mus musculus (house mouse)" ]
[ "mouse (mus <genus>)", "mice (mus <genus>) (mus <genus>)", "mus <genus> (mice (mus <genus>))", "mice (mus sp.) (mus sp.)", "mus musculus musculus (eastern european house mouse)", "eastern european house mouse (mus musculus musculus)", "western european house mouse (mus musculus domesticus)", "mus sp. ...
Given the context 'Of particular interests is the presence of sequences within the 5'-flanking region which are highly conserved between mouse and man.', answer the user's query.
What is the biomedical concept corresponding to 'man'?
[ "human (homo sapiens)", "homo sapiens (human)" ]
[ "humans (homo)", "homo (humans)", "manis", "manisuris", "macrobiotus sapiens", "mammals (mammalia)", "manotes", "manica", "manoa", "neandertal man (homo sapiens neanderthalensis)" ]
Given the context 'Of particular interests is the presence of sequences within the 5'-flanking region which are highly conserved between mouse and man.', answer the user's query.
What is the biomedical concept corresponding to 'mouse'?
[ "mouse (mus musculus)", "house mouse (mus musculus)", "mus musculus (house mouse)" ]
[ "mouse (mus <genus>)", "mice (mus <genus>) (mus <genus>)", "mus <genus> (mice (mus <genus>))", "mice (mus sp.) (mus sp.)", "mus musculus musculus (eastern european house mouse)", "eastern european house mouse (mus musculus musculus)", "western european house mouse (mus musculus domesticus)", "mus sp. ...
Given the context 'Images Volume 12 Number 24 1984 Nucleic Acids Research Organization and structure of the mouse interleukin-2 gene Akira Fuse*, Takashi Fujita, Hidetaro Yasumitsu, Nobukazu Kashima+, Katsushige Hasegawa and Tadatsugu Taniguchi? Department of Biochemistry, Cancer Institute, Japanese Foundation for Cancer Research, Toshimaku, Tokyo 170 and Institute for Molecular and Cellular Biology, Osaka University, Suita-shi, Osaka 565, Japan Received 10 October 1984; Revised and Accepted 20 November 1984 ABSTRACT We have cloned a chromosomal DNA segment which covers the entire sequence for the murine interleukin-2 gene and analysed the structure of the gene.', answer the user's query.
What is the biomedical concept corresponding to 'murine'?
[ "mouse (mus musculus)", "house mouse (mus musculus)", "mus musculus (house mouse)" ]
[ "mice (mus <genus>) (mus <genus>)", "mouse (mus <genus>)", "eastern european house mouse (mus musculus musculus)", "mice (mus sp.) (mus sp.)", "mus <genus> (mice (mus <genus>))", "western european house mouse (mus musculus domesticus)", "mus musculus musculus (eastern european house mouse)", "mus musc...
Given the context 'Images Volume 12 Number 24 1984 Nucleic Acids Research Organization and structure of the mouse interleukin-2 gene Akira Fuse*, Takashi Fujita, Hidetaro Yasumitsu, Nobukazu Kashima+, Katsushige Hasegawa and Tadatsugu Taniguchi? Department of Biochemistry, Cancer Institute, Japanese Foundation for Cancer Research, Toshimaku, Tokyo 170 and Institute for Molecular and Cellular Biology, Osaka University, Suita-shi, Osaka 565, Japan Received 10 October 1984; Revised and Accepted 20 November 1984 ABSTRACT We have cloned a chromosomal DNA segment which covers the entire sequence for the murine interleukin-2 gene and analysed the structure of the gene.', answer the user's query.
What is the biomedical concept corresponding to 'human'?
[ "human (homo sapiens)", "homo sapiens (human)" ]
[ "humans (homo)", "homo (humans)", "macrobiotus sapiens", "primate (primates)", "hominoidea (apes (hominoidea))", "hominidae (great apes)", "ape (hominoidea) (hominoidea)", "kingdom", "apes (hominoidea) (hominoidea)", "homininae (homo/pan/gorilla group)" ]
Given the context 'The coding regions are separated into four blocks by three introns each of which is located similarly to the corresponding human gene. ', answer the user's query.
What is the biomedical concept corresponding to 'mouse'?
[ "mouse (mus musculus)", "house mouse (mus musculus)", "mus musculus (house mouse)" ]
[ "mouse (mus <genus>)", "mice (mus <genus>) (mus <genus>)", "mus <genus> (mice (mus <genus>))", "mice (mus sp.) (mus sp.)", "mus musculus musculus (eastern european house mouse)", "eastern european house mouse (mus musculus musculus)", "western european house mouse (mus musculus domesticus)", "mus sp. ...
Given the context 'Of particular interests is the presence of sequences within the 5'flanking region which are highly conserved between mouse and man.', answer the user's query.
What is the biomedical concept corresponding to 'man'?
[ "human (homo sapiens)", "homo sapiens (human)" ]
[ "humans (homo)", "homo (humans)", "manis", "manisuris", "macrobiotus sapiens", "mammals (mammalia)", "manotes", "manica", "manoa", "neandertal man (homo sapiens neanderthalensis)" ]
Given the context 'Of particular interests is the presence of sequences within the 5'flanking region which are highly conserved between mouse and man.', answer the user's query.
What is the biomedical concept corresponding to 'human'?
[ "human (homo sapiens)", "homo sapiens (human)" ]
[ "humans (homo)", "homo (humans)", "macrobiotus sapiens", "primate (primates)", "hominoidea (apes (hominoidea))", "hominidae (great apes)", "ape (hominoidea) (hominoidea)", "kingdom", "apes (hominoidea) (hominoidea)", "homininae (homo/pan/gorilla group)" ]
Given the context 'We previously reported isolation and sequence analysis of the cDNA for human IL-2 (8), as well as the chromosomal gene (9).', answer the user's query.
What is the biomedical concept corresponding to 'murine'?
[ "mouse (mus musculus)", "house mouse (mus musculus)", "mus musculus (house mouse)" ]
[ "mice (mus <genus>) (mus <genus>)", "mouse (mus <genus>)", "eastern european house mouse (mus musculus musculus)", "mice (mus sp.) (mus sp.)", "mus <genus> (mice (mus <genus>))", "western european house mouse (mus musculus domesticus)", "mus musculus musculus (eastern european house mouse)", "mus musc...
Given the context 'More recently, we have isolated a cDNA which encodes murine IL-2 (Kashima et al., submitted for publication). ', answer the user's query.
What is the biomedical concept corresponding to 'murine'?
[ "mouse (mus musculus)", "house mouse (mus musculus)", "mus musculus (house mouse)" ]
[ "mice (mus <genus>) (mus <genus>)", "mouse (mus <genus>)", "eastern european house mouse (mus musculus musculus)", "mice (mus sp.) (mus sp.)", "mus <genus> (mice (mus <genus>))", "western european house mouse (mus musculus domesticus)", "mus musculus musculus (eastern european house mouse)", "mus musc...
Given the context 'In order to study the structure of the murine IL-2 chromosomal gene and its controlling region, we isolated and analysed a A phage clone containing the gene and its flanking sequences. ', answer the user's query.
What is the biomedical concept corresponding to 'mouse'?
[ "mouse (mus musculus)", "house mouse (mus musculus)", "mus musculus (house mouse)" ]
[ "mouse (mus <genus>)", "mice (mus <genus>) (mus <genus>)", "mus <genus> (mice (mus <genus>))", "mice (mus sp.) (mus sp.)", "mus musculus musculus (eastern european house mouse)", "eastern european house mouse (mus musculus musculus)", "western european house mouse (mus musculus domesticus)", "mus sp. ...
Given the context 'MATERIALS AND METHODS Southern blotting of total mouse DNA Mouse chromosomal DNA was extracted from liver of BALB/c6 ?', answer the user's query.
What is the biomedical concept corresponding to 'mouse'?
[ "mouse (mus musculus)", "house mouse (mus musculus)", "mus musculus (house mouse)" ]
[ "mouse (mus <genus>)", "mice (mus <genus>) (mus <genus>)", "mus <genus> (mice (mus <genus>))", "mice (mus sp.) (mus sp.)", "mus musculus musculus (eastern european house mouse)", "eastern european house mouse (mus musculus musculus)", "western european house mouse (mus musculus domesticus)", "mus sp. ...
Given the context 'MATERIALS AND METHODS Southern blotting of total mouse DNA Mouse chromosomal DNA was extracted from liver of BALB/c6 ?', answer the user's query.
What is the biomedical concept corresponding to 'mouse'?
[ "mouse (mus musculus)", "house mouse (mus musculus)", "mus musculus (house mouse)" ]
[ "mouse (mus <genus>)", "mice (mus <genus>) (mus <genus>)", "mus <genus> (mice (mus <genus>))", "mice (mus sp.) (mus sp.)", "mus musculus musculus (eastern european house mouse)", "eastern european house mouse (mus musculus musculus)", "western european house mouse (mus musculus domesticus)", "mus sp. ...
Given the context 'Nucleic Acids Research Volume 12 Number 24 1984 9323 Nucleic Acids Research mouse as described before (10).', answer the user's query.
What is the biomedical concept corresponding to 'mouse'?
[ "mouse (mus musculus)", "house mouse (mus musculus)", "mus musculus (house mouse)" ]
[ "mouse (mus <genus>)", "mice (mus <genus>) (mus <genus>)", "mus <genus> (mice (mus <genus>))", "mice (mus sp.) (mus sp.)", "mus musculus musculus (eastern european house mouse)", "eastern european house mouse (mus musculus musculus)", "western european house mouse (mus musculus domesticus)", "mus sp. ...
Given the context 'Screening of genomic DNA library A bacteriophage XCharon 4A/mouse genomic DNA library prepared with partial EcoRI digests of mouse DNA from MPC 11 plasmacytoma cells was kindly provided by Dr. T. Honjo.', answer the user's query.
What is the biomedical concept corresponding to 'mouse'?
[ "mouse (mus musculus)", "house mouse (mus musculus)", "mus musculus (house mouse)" ]
[ "mouse (mus <genus>)", "mice (mus <genus>) (mus <genus>)", "mus <genus> (mice (mus <genus>))", "mice (mus sp.) (mus sp.)", "mus musculus musculus (eastern european house mouse)", "eastern european house mouse (mus musculus musculus)", "western european house mouse (mus musculus domesticus)", "mus sp. ...
Given the context 'Screening of genomic DNA library A bacteriophage XCharon 4A/mouse genomic DNA library prepared with partial EcoRI digests of mouse DNA from MPC 11 plasmacytoma cells was kindly provided by Dr. T. Honjo.', answer the user's query.
What is the biomedical concept corresponding to 'mouse'?
[ "mouse (mus musculus)", "house mouse (mus musculus)", "mus musculus (house mouse)" ]
[ "mouse (mus <genus>)", "mice (mus <genus>) (mus <genus>)", "mus <genus> (mice (mus <genus>))", "mice (mus sp.) (mus sp.)", "mus musculus musculus (eastern european house mouse)", "eastern european house mouse (mus musculus musculus)", "western european house mouse (mus musculus domesticus)", "mus sp. ...
Given the context 'Mouse IL-2-specific clones were screened by the method of Benton and Davis (12), using 700 bp PstI-AccI fragment of a cDNA clone, pMIL2-45 as the probe (Kashima et al., submitted for publication). ', answer the user's query.
What is the biomedical concept corresponding to 'mouse'?
[ "mouse (mus musculus)", "house mouse (mus musculus)", "mus musculus (house mouse)" ]
[ "mouse (mus <genus>)", "mice (mus <genus>) (mus <genus>)", "mus <genus> (mice (mus <genus>))", "mice (mus sp.) (mus sp.)", "mus musculus musculus (eastern european house mouse)", "eastern european house mouse (mus musculus musculus)", "western european house mouse (mus musculus domesticus)", "mus sp. ...
Given the context 'Subcloninq and sequencing of the mouse IL-2 gene Two EcoRI fragments of 3.3 Kbp and 2.8 Kbp from the positive recombinant X phage were subcloned into EcoRI site of plasmid pBR322. ', answer the user's query.
What is the biomedical concept corresponding to 'mouse'?
[ "mouse (mus musculus)", "house mouse (mus musculus)", "mus musculus (house mouse)" ]
[ "mouse (mus <genus>)", "mice (mus <genus>) (mus <genus>)", "mus <genus> (mice (mus <genus>))", "mice (mus sp.) (mus sp.)", "mus musculus musculus (eastern european house mouse)", "eastern european house mouse (mus musculus musculus)", "western european house mouse (mus musculus domesticus)", "mus sp. ...
Given the context 'RESULTS Total DNA blotting analysis In order to study structural organization of the mouse IL-2 gene, we first subjected total mouse DNA to the blotting analysis by using various probes specific for IL-2 gene.', answer the user's query.
What is the biomedical concept corresponding to 'mouse'?
[ "mouse (mus musculus)", "house mouse (mus musculus)", "mus musculus (house mouse)" ]
[ "mouse (mus <genus>)", "mice (mus <genus>) (mus <genus>)", "mus <genus> (mice (mus <genus>))", "mice (mus sp.) (mus sp.)", "mus musculus musculus (eastern european house mouse)", "eastern european house mouse (mus musculus musculus)", "western european house mouse (mus musculus domesticus)", "mus sp. ...
Given the context 'RESULTS Total DNA blotting analysis In order to study structural organization of the mouse IL-2 gene, we first subjected total mouse DNA to the blotting analysis by using various probes specific for IL-2 gene.', answer the user's query.
What is the biomedical concept corresponding to 'mouse'?
[ "mouse (mus musculus)", "house mouse (mus musculus)", "mus musculus (house mouse)" ]
[ "mouse (mus <genus>)", "mice (mus <genus>) (mus <genus>)", "mus <genus> (mice (mus <genus>))", "mice (mus sp.) (mus sp.)", "mus musculus musculus (eastern european house mouse)", "eastern european house mouse (mus musculus musculus)", "western european house mouse (mus musculus domesticus)", "mus sp. ...
Given the context 'When mouse DNA was digested with various restriction endonucleases and then probed with a 7 kb human chromosomal DNA segment which contains the human IL-2 gene and its flanking region (Fig. 1 lane 1-8, ref.', answer the user's query.
What is the biomedical concept corresponding to 'human'?
[ "human (homo sapiens)", "homo sapiens (human)" ]
[ "humans (homo)", "homo (humans)", "macrobiotus sapiens", "primate (primates)", "hominoidea (apes (hominoidea))", "hominidae (great apes)", "ape (hominoidea) (hominoidea)", "kingdom", "apes (hominoidea) (hominoidea)", "homininae (homo/pan/gorilla group)" ]
Given the context 'When mouse DNA was digested with various restriction endonucleases and then probed with a 7 kb human chromosomal DNA segment which contains the human IL-2 gene and its flanking region (Fig. 1 lane 1-8, ref.', answer the user's query.
What is the biomedical concept corresponding to 'human'?
[ "human (homo sapiens)", "homo sapiens (human)" ]
[ "humans (homo)", "homo (humans)", "macrobiotus sapiens", "primate (primates)", "hominoidea (apes (hominoidea))", "hominidae (great apes)", "ape (hominoidea) (hominoidea)", "kingdom", "apes (hominoidea) (hominoidea)", "homininae (homo/pan/gorilla group)" ]
Given the context 'When mouse DNA was digested with various restriction endonucleases and then probed with a 7 kb human chromosomal DNA segment which contains the human IL-2 gene and its flanking region (Fig. 1 lane 1-8, ref.', answer the user's query.
What is the biomedical concept corresponding to 'mouse'?
[ "mouse (mus musculus)", "house mouse (mus musculus)", "mus musculus (house mouse)" ]
[ "mouse (mus <genus>)", "mice (mus <genus>) (mus <genus>)", "mus <genus> (mice (mus <genus>))", "mice (mus sp.) (mus sp.)", "mus musculus musculus (eastern european house mouse)", "eastern european house mouse (mus musculus musculus)", "western european house mouse (mus musculus domesticus)", "mus sp. ...
Given the context 'Additional bands corresponding to those observed by using mouse IL-2 cDNA probes (lane 13-17) also appeared by longer 9324 Nucleic Acids Research M 1 2 3 4 M 5 6 7 8 M 9 101112 M 13 141516 17 a~ ~ 3 .. I pMIL2-45 SacI Acc I CZI~~1 1t L2- 20 Acc I 1 00', answer the user's query.
What is the biomedical concept corresponding to 'mouse'?
[ "mouse (mus musculus)", "house mouse (mus musculus)", "mus musculus (house mouse)" ]
[ "mouse (mus <genus>)", "mice (mus <genus>) (mus <genus>)", "mus <genus> (mice (mus <genus>))", "mice (mus sp.) (mus sp.)", "mus musculus musculus (eastern european house mouse)", "eastern european house mouse (mus musculus musculus)", "western european house mouse (mus musculus domesticus)", "mus sp. ...
Given the context '1. Blot hybridization analysis of mouse chromosomal DNA.', answer the user's query.
What is the biomedical concept corresponding to 'mouse'?
[ "mouse (mus musculus)", "house mouse (mus musculus)", "mus musculus (house mouse)" ]
[ "mouse (mus <genus>)", "mice (mus <genus>) (mus <genus>)", "mus <genus> (mice (mus <genus>))", "mice (mus sp.) (mus sp.)", "mus musculus musculus (eastern european house mouse)", "eastern european house mouse (mus musculus musculus)", "western european house mouse (mus musculus domesticus)", "mus sp. ...
Given the context 'High molecular DNA prepared from Liver BALB/C6 mouse was digested with various restriction endonucleases (BamHI for lanes 1, 5, 9, 13 ; EcoRI for lanes 2, 6, 10, 14, 17 ; HindIII for lanes 3, 7, 11, 15 ; XbaI for lanes 4, 8, 12, 16 ).', answer the user's query.
What is the biomedical concept corresponding to 'human'?
[ "human (homo sapiens)", "homo sapiens (human)" ]
[ "humans (homo)", "homo (humans)", "macrobiotus sapiens", "primate (primates)", "hominoidea (apes (hominoidea))", "hominidae (great apes)", "ape (hominoidea) (hominoidea)", "kingdom", "apes (hominoidea) (hominoidea)", "homininae (homo/pan/gorilla group)" ]
Given the context 'Filters were hybridized by the published procedure (13) either with the nick-translated chromosomal DNA containing human IL-2 gene and its flanking region (total length, 7.0 kb, ref. 9) (lane 1-8) or with the nick-translated cDNA for mouse IL-2 (see figure).', answer the user's query.
What is the biomedical concept corresponding to 'mouse'?
[ "mouse (mus musculus)", "house mouse (mus musculus)", "mus musculus (house mouse)" ]
[ "mouse (mus <genus>)", "mice (mus <genus>) (mus <genus>)", "mus <genus> (mice (mus <genus>))", "mice (mus sp.) (mus sp.)", "mus musculus musculus (eastern european house mouse)", "eastern european house mouse (mus musculus musculus)", "western european house mouse (mus musculus domesticus)", "mus sp. ...
Given the context 'Filters were hybridized by the published procedure (13) either with the nick-translated chromosomal DNA containing human IL-2 gene and its flanking region (total length, 7.0 kb, ref. 9) (lane 1-8) or with the nick-translated cDNA for mouse IL-2 (see figure).', answer the user's query.
What is the biomedical concept corresponding to 'mouse'?
[ "mouse (mus musculus)", "house mouse (mus musculus)", "mus musculus (house mouse)" ]
[ "mouse (mus <genus>)", "mice (mus <genus>) (mus <genus>)", "mus <genus> (mice (mus <genus>))", "mice (mus sp.) (mus sp.)", "mus musculus musculus (eastern european house mouse)", "eastern european house mouse (mus musculus musculus)", "western european house mouse (mus musculus domesticus)", "mus sp. ...
Given the context 'Brief restriction endonuclease cleavage map for the mouse IL-2 cDNAs is presented in the lower part of the figure. ', answer the user's query.
What is the biomedical concept corresponding to 'human'?
[ "human (homo sapiens)", "homo sapiens (human)" ]
[ "humans (homo)", "homo (humans)", "macrobiotus sapiens", "primate (primates)", "hominoidea (apes (hominoidea))", "hominidae (great apes)", "ape (hominoidea) (hominoidea)", "kingdom", "apes (hominoidea) (hominoidea)", "homininae (homo/pan/gorilla group)" ]
Given the context 'Those results suggest the presence of highly conserved sequences between human and mouse DNA either in the flanking regions or in the introns of the IL-2 gene, since the coding regions apparently show lower degree of sequence homology as evidenced in this series of blotting analysis (see below). ', answer the user's query.
What is the biomedical concept corresponding to 'mouse'?
[ "mouse (mus musculus)", "house mouse (mus musculus)", "mus musculus (house mouse)" ]
[ "mouse (mus <genus>)", "mice (mus <genus>) (mus <genus>)", "mus <genus> (mice (mus <genus>))", "mice (mus sp.) (mus sp.)", "mus musculus musculus (eastern european house mouse)", "eastern european house mouse (mus musculus musculus)", "western european house mouse (mus musculus domesticus)", "mus sp. ...
Given the context 'Those results suggest the presence of highly conserved sequences between human and mouse DNA either in the flanking regions or in the introns of the IL-2 gene, since the coding regions apparently show lower degree of sequence homology as evidenced in this series of blotting analysis (see below). ', answer the user's query.
What is the biomedical concept corresponding to 'mouse'?
[ "mouse (mus musculus)", "house mouse (mus musculus)", "mus musculus (house mouse)" ]
[ "mouse (mus <genus>)", "mice (mus <genus>) (mus <genus>)", "mus <genus> (mice (mus <genus>))", "mice (mus sp.) (mus sp.)", "mus musculus musculus (eastern european house mouse)", "eastern european house mouse (mus musculus musculus)", "western european house mouse (mus musculus domesticus)", "mus sp. ...
Given the context 'When the PstI insert of a mouse IL-2 cDNA clone, pMIL2-20, was used as the probe, a simple pattern was 9325 Nucleic Acids Research obtained at higher stringent condition (lane 13-17). ', answer the user's query.
What is the biomedical concept corresponding to 'human'?
[ "human (homo sapiens)", "homo sapiens (human)" ]
[ "humans (homo)", "homo (humans)", "macrobiotus sapiens", "primate (primates)", "hominoidea (apes (hominoidea))", "hominidae (great apes)", "ape (hominoidea) (hominoidea)", "kingdom", "apes (hominoidea) (hominoidea)", "homininae (homo/pan/gorilla group)" ]
Given the context 'The 3.3 kb band was similar in its size with the positive band which became detectable by probing the same DNA with the 7.0 kb human DNA probe (Fig. 1, lane 2).', answer the user's query.
What is the biomedical concept corresponding to 'mouse'?
[ "mouse (mus musculus)", "house mouse (mus musculus)", "mus musculus (house mouse)" ]
[ "mouse (mus <genus>)", "mice (mus <genus>) (mus <genus>)", "mus <genus> (mice (mus <genus>))", "mice (mus sp.) (mus sp.)", "mus musculus musculus (eastern european house mouse)", "eastern european house mouse (mus musculus musculus)", "western european house mouse (mus musculus domesticus)", "mus sp. ...
Given the context 'BamHI digest of the mouse DNA (Fig. 1, lane 1, 13) constantly gave a very faint signal which would correspond to a DNA larger than 15 kb. ', answer the user's query.
What is the biomedical concept corresponding to 'murine'?
[ "mouse (mus musculus)", "house mouse (mus musculus)", "mus musculus (house mouse)" ]
[ "mice (mus <genus>) (mus <genus>)", "mouse (mus <genus>)", "eastern european house mouse (mus musculus musculus)", "mice (mus sp.) (mus sp.)", "mus <genus> (mice (mus <genus>))", "western european house mouse (mus musculus domesticus)", "mus musculus musculus (eastern european house mouse)", "mus musc...
Given the context 'Taken together, the results suggested the presence of a single copy gene for murine IL-2. ', answer the user's query.
What is the biomedical concept corresponding to 'mouse'?
[ "mouse (mus musculus)", "house mouse (mus musculus)", "mus musculus (house mouse)" ]
[ "mouse (mus <genus>)", "mice (mus <genus>) (mus <genus>)", "mus <genus> (mice (mus <genus>))", "mice (mus sp.) (mus sp.)", "mus musculus musculus (eastern european house mouse)", "eastern european house mouse (mus musculus musculus)", "western european house mouse (mus musculus domesticus)", "mus sp. ...
Given the context 'On the other hand appearance of the multiple positive bands at lower stringent washing condition (lane 9-12) indicates the presence of IL-2 related sequences within the mouse genome. ', answer the user's query.
What is the biomedical concept corresponding to 'mouse'?
[ "mouse (mus musculus)", "house mouse (mus musculus)", "mus musculus (house mouse)" ]
[ "mouse (mus <genus>)", "mice (mus <genus>) (mus <genus>)", "mus <genus> (mice (mus <genus>))", "mice (mus sp.) (mus sp.)", "mus musculus musculus (eastern european house mouse)", "eastern european house mouse (mus musculus musculus)", "western european house mouse (mus musculus domesticus)", "mus sp. ...
Given the context 'Screening of recombinant phaqe libraries We next screened a gene library from partial EcoRIdigested DNA from MPC 11 cells and by using 0.8 Kbp SacI-AccI cDNA fragment as the probe and isolated 14 positive clones containing sequences specific to the mouse IL-2 gene.', answer the user's query.
What is the biomedical concept corresponding to 'mouse'?
[ "mouse (mus musculus)", "house mouse (mus musculus)", "mus musculus (house mouse)" ]
[ "mouse (mus <genus>)", "mice (mus <genus>) (mus <genus>)", "mus <genus> (mice (mus <genus>))", "mice (mus sp.) (mus sp.)", "mus musculus musculus (eastern european house mouse)", "eastern european house mouse (mus musculus musculus)", "western european house mouse (mus musculus domesticus)", "mus sp. ...
Given the context '2. Comparison of the mouse genomic IL-2 sequence with mouse IL-2 cDNA sequence revealed that, like the human gene, the gene is divided into four exons. ', answer the user's query.
What is the biomedical concept corresponding to 'mouse'?
[ "mouse (mus musculus)", "house mouse (mus musculus)", "mus musculus (house mouse)" ]
[ "mouse (mus <genus>)", "mice (mus <genus>) (mus <genus>)", "mus <genus> (mice (mus <genus>))", "mice (mus sp.) (mus sp.)", "mus musculus musculus (eastern european house mouse)", "eastern european house mouse (mus musculus musculus)", "western european house mouse (mus musculus domesticus)", "mus sp. ...
Given the context '2. Comparison of the mouse genomic IL-2 sequence with mouse IL-2 cDNA sequence revealed that, like the human gene, the gene is divided into four exons. ', answer the user's query.
What is the biomedical concept corresponding to 'human'?
[ "human (homo sapiens)", "homo sapiens (human)" ]
[ "humans (homo)", "homo (humans)", "macrobiotus sapiens", "primate (primates)", "hominoidea (apes (hominoidea))", "hominidae (great apes)", "ape (hominoidea) (hominoidea)", "kingdom", "apes (hominoidea) (hominoidea)", "homininae (homo/pan/gorilla group)" ]
Given the context '2. Comparison of the mouse genomic IL-2 sequence with mouse IL-2 cDNA sequence revealed that, like the human gene, the gene is divided into four exons. ', answer the user's query.
What is the biomedical concept corresponding to 'mouse'?
[ "mouse (mus musculus)", "house mouse (mus musculus)", "mus musculus (house mouse)" ]
[ "mouse (mus <genus>)", "mice (mus <genus>) (mus <genus>)", "mus <genus> (mice (mus <genus>))", "mice (mus sp.) (mus sp.)", "mus musculus musculus (eastern european house mouse)", "eastern european house mouse (mus musculus musculus)", "western european house mouse (mus musculus domesticus)", "mus sp. ...
Given the context 'Restriction map and sequencing strategy of mouse IL-2 gene.', answer the user's query.
What is the biomedical concept corresponding to 'mouse'?
[ "mouse (mus musculus)", "house mouse (mus musculus)", "mus musculus (house mouse)" ]
[ "mouse (mus <genus>)", "mice (mus <genus>) (mus <genus>)", "mus <genus> (mice (mus <genus>))", "mice (mus sp.) (mus sp.)", "mus musculus musculus (eastern european house mouse)", "eastern european house mouse (mus musculus musculus)", "western european house mouse (mus musculus domesticus)", "mus sp. ...
Given the context 'Horizontal lines indicate the length of mouse DNA inserted into the X phage Charon 4A or plasmid subclones. ', answer the user's query.
What is the biomedical concept corresponding to 'murine'?
[ "mouse (mus musculus)", "house mouse (mus musculus)", "mus musculus (house mouse)" ]
[ "mice (mus <genus>) (mus <genus>)", "mouse (mus <genus>)", "eastern european house mouse (mus musculus musculus)", "mice (mus sp.) (mus sp.)", "mus <genus> (mice (mus <genus>))", "western european house mouse (mus musculus domesticus)", "mus musculus musculus (eastern european house mouse)", "mus musc...
Given the context 'As seen also in the murine IL-2 cDNA, there is an unusual repeat of CAG triplet coding for 12 glutamine residues in a row in the first exon.', answer the user's query.
What is the biomedical concept corresponding to 'human'?
[ "human (homo sapiens)", "homo sapiens (human)" ]
[ "humans (homo)", "homo (humans)", "macrobiotus sapiens", "primate (primates)", "hominoidea (apes (hominoidea))", "hominidae (great apes)", "ape (hominoidea) (hominoidea)", "kingdom", "apes (hominoidea) (hominoidea)", "homininae (homo/pan/gorilla group)" ]
Given the context 'As far as the available sequence data are concerned, it seems that, despite their identical location, intron sequences are distinctly dissimilar except for the junction regions between the human and mouse IL-2 genes. ', answer the user's query.
What is the biomedical concept corresponding to 'mouse'?
[ "mouse (mus musculus)", "house mouse (mus musculus)", "mus musculus (house mouse)" ]
[ "mouse (mus <genus>)", "mice (mus <genus>) (mus <genus>)", "mus <genus> (mice (mus <genus>))", "mice (mus sp.) (mus sp.)", "mus musculus musculus (eastern european house mouse)", "eastern european house mouse (mus musculus musculus)", "western european house mouse (mus musculus domesticus)", "mus sp. ...
Given the context 'As far as the available sequence data are concerned, it seems that, despite their identical location, intron sequences are distinctly dissimilar except for the junction regions between the human and mouse IL-2 genes. ', answer the user's query.
What is the biomedical concept corresponding to 'mouse'?
[ "mouse (mus musculus)", "house mouse (mus musculus)", "mus musculus (house mouse)" ]
[ "mouse (mus <genus>)", "mice (mus <genus>) (mus <genus>)", "mus <genus> (mice (mus <genus>))", "mice (mus sp.) (mus sp.)", "mus musculus musculus (eastern european house mouse)", "eastern european house mouse (mus musculus musculus)", "western european house mouse (mus musculus domesticus)", "mus sp. ...
Given the context 'There are two potential poly (A) addition signals within the mouse gene (nucleotide positions 793 - 798 and 924 - 929 in Fig. 3 ) and, based on our sequence data for various cDNA clones, both signals seem to function and give rise to heterogeneous termini of the mRNA in the LBRM-33 cells (16). ', answer the user's query.
What is the biomedical concept corresponding to 'mouse'?
[ "mouse (mus musculus)", "house mouse (mus musculus)", "mus musculus (house mouse)" ]
[ "mouse (mus <genus>)", "mice (mus <genus>) (mus <genus>)", "mus <genus> (mice (mus <genus>))", "mice (mus sp.) (mus sp.)", "mus musculus musculus (eastern european house mouse)", "eastern european house mouse (mus musculus musculus)", "western european house mouse (mus musculus domesticus)", "mus sp. ...
Given the context 'We have also determined the sequence of about 500 bp of 5'-flanking region of mouse IL-2 gene, since (i) promoter/regulatory sequences are located in this region in many other genes of eukaryotes and (ii) this region appeared to contain sequences which show strongest cross-hybridization between human and mouse DNA around the IL-2 gene (Fig. 1).', answer the user's query.
What is the biomedical concept corresponding to 'human'?
[ "human (homo sapiens)", "homo sapiens (human)" ]
[ "humans (homo)", "homo (humans)", "macrobiotus sapiens", "primate (primates)", "hominoidea (apes (hominoidea))", "hominidae (great apes)", "ape (hominoidea) (hominoidea)", "kingdom", "apes (hominoidea) (hominoidea)", "homininae (homo/pan/gorilla group)" ]
Given the context 'We have also determined the sequence of about 500 bp of 5'-flanking region of mouse IL-2 gene, since (i) promoter/regulatory sequences are located in this region in many other genes of eukaryotes and (ii) this region appeared to contain sequences which show strongest cross-hybridization between human and mouse DNA around the IL-2 gene (Fig. 1).', answer the user's query.
What is the biomedical concept corresponding to 'mouse'?
[ "mouse (mus musculus)", "house mouse (mus musculus)", "mus musculus (house mouse)" ]
[ "mouse (mus <genus>)", "mice (mus <genus>) (mus <genus>)", "mus <genus> (mice (mus <genus>))", "mice (mus sp.) (mus sp.)", "mus musculus musculus (eastern european house mouse)", "eastern european house mouse (mus musculus musculus)", "western european house mouse (mus musculus domesticus)", "mus sp. ...
Given the context 'We have also determined the sequence of about 500 bp of 5'-flanking region of mouse IL-2 gene, since (i) promoter/regulatory sequences are located in this region in many other genes of eukaryotes and (ii) this region appeared to contain sequences which show strongest cross-hybridization between human and mouse DNA around the IL-2 gene (Fig. 1).', answer the user's query.
What is the biomedical concept corresponding to 'mouse'?
[ "mouse (mus musculus)", "house mouse (mus musculus)", "mus musculus (house mouse)" ]
[ "mouse (mus <genus>)", "mice (mus <genus>) (mus <genus>)", "mus <genus> (mice (mus <genus>))", "mice (mus sp.) (mus sp.)", "mus musculus musculus (eastern european house mouse)", "eastern european house mouse (mus musculus musculus)", "western european house mouse (mus musculus domesticus)", "mus sp. ...
Given the context 'Nucleotide sequence of mouse IL-2 gene. ', answer the user's query.
What is the biomedical concept corresponding to 'mouse'?
[ "mouse (mus musculus)", "house mouse (mus musculus)", "mus musculus (house mouse)" ]
[ "mouse (mus <genus>)", "mice (mus <genus>) (mus <genus>)", "mus <genus> (mice (mus <genus>))", "mice (mus sp.) (mus sp.)", "mus musculus musculus (eastern european house mouse)", "eastern european house mouse (mus musculus musculus)", "western european house mouse (mus musculus domesticus)", "mus sp. ...
Given the context 'CACCCCCTTAAAGAAAGGAGGAAAAACTGTTTCATACAGAAGGCGTTAATTGCATGAATTAGAGCTATCACCTAAGTGTGGGCTAATGTAA -200 -150 CCAAGAGGGATTTCACCTAAATCCATTCAGTCAGTATAT GGGGTTTAAACAAATTCCAGAGAGTCATCAGAAGAGGAAAAACAAAGGTAA CAAAGAGGGATTTCACCTACATCCATTCAGTCAGTCTTTGGGGGTTTAAA AAATTCCAAAGAGTCATCAGAAGAGGAAAAATGAAGGTAA -100 -50 TACTTTCTGCCACACAGGTAGACTCTTTTGAAAATATGTGTXATATTAAAACATCGTGACACCCCCATATiXrTCCAGCATTAACAG TGTTTTTT CAGACAGGTAAAGTC TTTGAAAATATGTGTAATATGTAAAACATTTTGACACCCCCATAATATTTTTCCAGAATTAACAG ATAAGCCTCCCATGCTGAAGAGCTGCCTATCACCCTTGCTAATCACTCCTCACAGTGACCTCAAGTCCTGCAGGCATG Mouse rTATGCATCTCTTGTTCAAGAGTTCCCTATCACTCTCTTTAATCACTACACACAGTAACCTCAACTCCTGCCACTATG Human Fig. ', answer the user's query.
What is the biomedical concept corresponding to 'human'?
[ "human (homo sapiens)", "homo sapiens (human)" ]
[ "humans (homo)", "homo (humans)", "macrobiotus sapiens", "primate (primates)", "hominoidea (apes (hominoidea))", "hominidae (great apes)", "ape (hominoidea) (hominoidea)", "kingdom", "apes (hominoidea) (hominoidea)", "homininae (homo/pan/gorilla group)" ]
Given the context 'CACCCCCTTAAAGAAAGGAGGAAAAACTGTTTCATACAGAAGGCGTTAATTGCATGAATTAGAGCTATCACCTAAGTGTGGGCTAATGTAA -200 -150 CCAAGAGGGATTTCACCTAAATCCATTCAGTCAGTATAT GGGGTTTAAACAAATTCCAGAGAGTCATCAGAAGAGGAAAAACAAAGGTAA CAAAGAGGGATTTCACCTACATCCATTCAGTCAGTCTTTGGGGGTTTAAA AAATTCCAAAGAGTCATCAGAAGAGGAAAAATGAAGGTAA -100 -50 TACTTTCTGCCACACAGGTAGACTCTTTTGAAAATATGTGTXATATTAAAACATCGTGACACCCCCATATiXrTCCAGCATTAACAG TGTTTTTT CAGACAGGTAAAGTC TTTGAAAATATGTGTAATATGTAAAACATTTTGACACCCCCATAATATTTTTCCAGAATTAACAG ATAAGCCTCCCATGCTGAAGAGCTGCCTATCACCCTTGCTAATCACTCCTCACAGTGACCTCAAGTCCTGCAGGCATG Mouse rTATGCATCTCTTGTTCAAGAGTTCCCTATCACTCTCTTTAATCACTACACACAGTAACCTCAACTCCTGCCACTATG Human Fig. ', answer the user's query.
What is the biomedical concept corresponding to 'mouse'?
[ "mouse (mus musculus)", "house mouse (mus musculus)", "mus musculus (house mouse)" ]
[ "mouse (mus <genus>)", "mice (mus <genus>) (mus <genus>)", "mus <genus> (mice (mus <genus>))", "mice (mus sp.) (mus sp.)", "mus musculus musculus (eastern european house mouse)", "eastern european house mouse (mus musculus musculus)", "western european house mouse (mus musculus domesticus)", "mus sp. ...
Given the context 'Comparison of 5'-flanking regions of mouse and human IL-2 genes. ', answer the user's query.
What is the biomedical concept corresponding to 'human'?
[ "human (homo sapiens)", "homo sapiens (human)" ]
[ "humans (homo)", "homo (humans)", "macrobiotus sapiens", "primate (primates)", "hominoidea (apes (hominoidea))", "hominidae (great apes)", "ape (hominoidea) (hominoidea)", "kingdom", "apes (hominoidea) (hominoidea)", "homininae (homo/pan/gorilla group)" ]
Given the context 'Comparison of 5'-flanking regions of mouse and human IL-2 genes. ', answer the user's query.
What is the biomedical concept corresponding to 'mouse'?
[ "mouse (mus musculus)", "house mouse (mus musculus)", "mus musculus (house mouse)" ]
[ "mouse (mus <genus>)", "mice (mus <genus>) (mus <genus>)", "mus <genus> (mice (mus <genus>))", "mice (mus sp.) (mus sp.)", "mus musculus musculus (eastern european house mouse)", "eastern european house mouse (mus musculus musculus)", "western european house mouse (mus musculus domesticus)", "mus sp. ...
Given the context 'We have isolated recombinant clones for mouse IL-2 gene from a phage Charon 4A/mouse genomic DNA library and determined the entire sequence of the gene except for the sequence of the internal portion of the second and third introns. ', answer the user's query.
What is the biomedical concept corresponding to 'mouse'?
[ "mouse (mus musculus)", "house mouse (mus musculus)", "mus musculus (house mouse)" ]
[ "mouse (mus <genus>)", "mice (mus <genus>) (mus <genus>)", "mus <genus> (mice (mus <genus>))", "mice (mus sp.) (mus sp.)", "mus musculus musculus (eastern european house mouse)", "eastern european house mouse (mus musculus musculus)", "western european house mouse (mus musculus domesticus)", "mus sp. ...
Given the context 'We have isolated recombinant clones for mouse IL-2 gene from a phage Charon 4A/mouse genomic DNA library and determined the entire sequence of the gene except for the sequence of the internal portion of the second and third introns. ', answer the user's query.
What is the biomedical concept corresponding to 'mouse'?
[ "mouse (mus musculus)", "house mouse (mus musculus)", "mus musculus (house mouse)" ]
[ "mouse (mus <genus>)", "mice (mus <genus>) (mus <genus>)", "mus <genus> (mice (mus <genus>))", "mice (mus sp.) (mus sp.)", "mus musculus musculus (eastern european house mouse)", "eastern european house mouse (mus musculus musculus)", "western european house mouse (mus musculus domesticus)", "mus sp. ...
Given the context 'The mouse IL-2 cDNA sequence was aligned with the genomic sequence and both sequences matched completely each other.', answer the user's query.
What is the biomedical concept corresponding to 'human'?
[ "human (homo sapiens)", "homo sapiens (human)" ]
[ "humans (homo)", "homo (humans)", "macrobiotus sapiens", "primate (primates)", "hominoidea (apes (hominoidea))", "hominidae (great apes)", "ape (hominoidea) (hominoidea)", "kingdom", "apes (hominoidea) (hominoidea)", "homininae (homo/pan/gorilla group)" ]
Given the context 'Although we can not rule out the possibility for the deletion of this sequence in the human IL-2 gene, it is more likely that the CAG repeat has been generated in the mouse genome rather recently. ', answer the user's query.
What is the biomedical concept corresponding to 'mouse'?
[ "mouse (mus musculus)", "house mouse (mus musculus)", "mus musculus (house mouse)" ]
[ "mouse (mus <genus>)", "mice (mus <genus>) (mus <genus>)", "mus <genus> (mice (mus <genus>))", "mice (mus sp.) (mus sp.)", "mus musculus musculus (eastern european house mouse)", "eastern european house mouse (mus musculus musculus)", "western european house mouse (mus musculus domesticus)", "mus sp. ...
Given the context 'Although we can not rule out the possibility for the deletion of this sequence in the human IL-2 gene, it is more likely that the CAG repeat has been generated in the mouse genome rather recently. ', answer the user's query.
What is the biomedical concept corresponding to 'mouse'?
[ "mouse (mus musculus)", "house mouse (mus musculus)", "mus musculus (house mouse)" ]
[ "mouse (mus <genus>)", "mice (mus <genus>) (mus <genus>)", "mus <genus> (mice (mus <genus>))", "mice (mus sp.) (mus sp.)", "mus musculus musculus (eastern european house mouse)", "eastern european house mouse (mus musculus musculus)", "western european house mouse (mus musculus domesticus)", "mus sp. ...
Given the context '9329 Nucleic Acids Research Organization of the mouse IL-2 gene resembles to that of the human gene (Fig.', answer the user's query.