query
stringclasses
175 values
positive
listlengths
1
9
negative
listlengths
10
10
system
stringlengths
69
2.19k
What is the biomedical concept corresponding to 'human'?
[ "human (homo sapiens)", "homo sapiens (human)" ]
[ "humans (homo)", "homo (humans)", "macrobiotus sapiens", "primate (primates)", "hominoidea (apes (hominoidea))", "hominidae (great apes)", "ape (hominoidea) (hominoidea)", "kingdom", "apes (hominoidea) (hominoidea)", "homininae (homo/pan/gorilla group)" ]
Given the context '9329 Nucleic Acids Research Organization of the mouse IL-2 gene resembles to that of the human gene (Fig.', answer the user's query.
What is the biomedical concept corresponding to 'mouse'?
[ "mouse (mus musculus)", "house mouse (mus musculus)", "mus musculus (house mouse)" ]
[ "mouse (mus <genus>)", "mice (mus <genus>) (mus <genus>)", "mus <genus> (mice (mus <genus>))", "mice (mus sp.) (mus sp.)", "mus musculus musculus (eastern european house mouse)", "eastern european house mouse (mus musculus musculus)", "western european house mouse (mus musculus domesticus)", "mus sp. ...
Given the context 'There seems to be little sequence homology between corresponding introns of mouse and human IL-2 genes, except for the intron-exon junctions part of which is thought to be necessary for the RNA splicing (17, 18).', answer the user's query.
What is the biomedical concept corresponding to 'human'?
[ "human (homo sapiens)", "homo sapiens (human)" ]
[ "humans (homo)", "homo (humans)", "macrobiotus sapiens", "primate (primates)", "hominoidea (apes (hominoidea))", "hominidae (great apes)", "ape (hominoidea) (hominoidea)", "kingdom", "apes (hominoidea) (hominoidea)", "homininae (homo/pan/gorilla group)" ]
Given the context 'There seems to be little sequence homology between corresponding introns of mouse and human IL-2 genes, except for the intron-exon junctions part of which is thought to be necessary for the RNA splicing (17, 18).', answer the user's query.
What is the biomedical concept corresponding to 'murine'?
[ "mouse (mus musculus)", "house mouse (mus musculus)", "mus musculus (house mouse)" ]
[ "mice (mus <genus>) (mus <genus>)", "mouse (mus <genus>)", "eastern european house mouse (mus musculus musculus)", "mice (mus sp.) (mus sp.)", "mus <genus> (mice (mus <genus>))", "western european house mouse (mus musculus domesticus)", "mus musculus musculus (eastern european house mouse)", "mus musc...
Given the context 'In spite of the divergence in sequence of introns, the size and position of the introns are very similar between the murine and human IL-2 genes. ', answer the user's query.
What is the biomedical concept corresponding to 'human'?
[ "human (homo sapiens)", "homo sapiens (human)" ]
[ "humans (homo)", "homo (humans)", "macrobiotus sapiens", "primate (primates)", "hominoidea (apes (hominoidea))", "hominidae (great apes)", "ape (hominoidea) (hominoidea)", "kingdom", "apes (hominoidea) (hominoidea)", "homininae (homo/pan/gorilla group)" ]
Given the context 'In spite of the divergence in sequence of introns, the size and position of the introns are very similar between the murine and human IL-2 genes. ', answer the user's query.
What is the biomedical concept corresponding to 'human'?
[ "human (homo sapiens)", "homo sapiens (human)" ]
[ "humans (homo)", "homo (humans)", "macrobiotus sapiens", "primate (primates)", "hominoidea (apes (hominoidea))", "hominidae (great apes)", "ape (hominoidea) (hominoidea)", "kingdom", "apes (hominoidea) (hominoidea)", "homininae (homo/pan/gorilla group)" ]
Given the context 'Of particular interests is the presence of highly conserved sequences in the 5' -flanking region of the human and mouse IL-2 gene (Fig. 4). ', answer the user's query.
What is the biomedical concept corresponding to 'mouse'?
[ "mouse (mus musculus)", "house mouse (mus musculus)", "mus musculus (house mouse)" ]
[ "mouse (mus <genus>)", "mice (mus <genus>) (mus <genus>)", "mus <genus> (mice (mus <genus>))", "mice (mus sp.) (mus sp.)", "mus musculus musculus (eastern european house mouse)", "eastern european house mouse (mus musculus musculus)", "western european house mouse (mus musculus domesticus)", "mus sp. ...
Given the context 'Of particular interests is the presence of highly conserved sequences in the 5' -flanking region of the human and mouse IL-2 gene (Fig. 4). ', answer the user's query.
What is the biomedical concept corresponding to 'mouse'?
[ "mouse (mus musculus)", "house mouse (mus musculus)", "mus musculus (house mouse)" ]
[ "mouse (mus <genus>)", "mice (mus <genus>) (mus <genus>)", "mus <genus> (mice (mus <genus>))", "mice (mus sp.) (mus sp.)", "mus musculus musculus (eastern european house mouse)", "eastern european house mouse (mus musculus musculus)", "western european house mouse (mus musculus domesticus)", "mus sp. ...
Given the context 'Since we have not yet determined the nucleotide sequence further upstream of the mouse gene, we do not know whether or not this similarity extends further. ', answer the user's query.
What is the biomedical concept corresponding to 'human'?
[ "human (homo sapiens)", "homo sapiens (human)" ]
[ "humans (homo)", "homo (humans)", "macrobiotus sapiens", "primate (primates)", "hominoidea (apes (hominoidea))", "hominidae (great apes)", "ape (hominoidea) (hominoidea)", "kingdom", "apes (hominoidea) (hominoidea)", "homininae (homo/pan/gorilla group)" ]
Given the context 'Our preliminary results indicate that the 5 '-flanking sequence of the human IL-2 gene mediates mitogen induced expression of the gene in T-lymphocytic cells (Fujita & Taniguchi, unpublished observation). ', answer the user's query.
What is the biomedical concept corresponding to 'mouse'?
[ "mouse (mus musculus)", "house mouse (mus musculus)", "mus musculus (house mouse)" ]
[ "mouse (mus <genus>)", "mice (mus <genus>) (mus <genus>)", "mus <genus> (mice (mus <genus>))", "mice (mus sp.) (mus sp.)", "mus musculus musculus (eastern european house mouse)", "eastern european house mouse (mus musculus musculus)", "western european house mouse (mus musculus domesticus)", "mus sp. ...
Given the context 'We thank Dr. T. Honjo for mouse gene library. ', answer the user's query.
What is the biomedical concept corresponding to 'human'?
[ "human (homo sapiens)", "homo sapiens (human)" ]
[ "humans (homo)", "homo (humans)", "macrobiotus sapiens", "primate (primates)", "hominoidea (apes (hominoidea))", "hominidae (great apes)", "ape (hominoidea) (hominoidea)", "kingdom", "apes (hominoidea) (hominoidea)", "homininae (homo/pan/gorilla group)" ]
Given the context 'More than half of human genes are known to have alternative polyadenylation (31).', answer the user's query.
What is the biomedical concept corresponding to 'human'?
[ "human (homo sapiens)", "homo sapiens (human)" ]
[ "humans (homo)", "homo (humans)", "macrobiotus sapiens", "primate (primates)", "hominoidea (apes (hominoidea))", "hominidae (great apes)", "ape (hominoidea) (hominoidea)", "kingdom", "apes (hominoidea) (hominoidea)", "homininae (homo/pan/gorilla group)" ]
Given the context 'Over two-thirds of human genes are thought to undergo alternative splicing (32).', answer the user's query.
What is the biomedical concept corresponding to 'human'?
[ "human (homo sapiens)", "homo sapiens (human)" ]
[ "humans (homo)", "homo (humans)", "macrobiotus sapiens", "primate (primates)", "hominoidea (apes (hominoidea))", "hominidae (great apes)", "ape (hominoidea) (hominoidea)", "kingdom", "apes (hominoidea) (hominoidea)", "homininae (homo/pan/gorilla group)" ]
Given the context 'Although, G-quadruplexes have been surveyed in the human genome with such techniques (34,35), there are no known user-friendly computational tools easily accessible to the public.', answer the user's query.
What is the biomedical concept corresponding to 'human'?
[ "human (homo sapiens)", "homo sapiens (human)" ]
[ "humans (homo)", "homo (humans)", "macrobiotus sapiens", "primate (primates)", "hominoidea (apes (hominoidea))", "hominidae (great apes)", "ape (hominoidea) (hominoidea)", "kingdom", "apes (hominoidea) (hominoidea)", "homininae (homo/pan/gorilla group)" ]
Given the context 'We had previously built a database of mapped G-quadruplex sequences in selected alternatively processed human and mouse genes (36).', answer the user's query.
What is the biomedical concept corresponding to 'mouse'?
[ "mouse (mus musculus)", "house mouse (mus musculus)", "mus musculus (house mouse)" ]
[ "mouse (mus <genus>)", "mice (mus <genus>) (mus <genus>)", "mus <genus> (mice (mus <genus>))", "mice (mus sp.) (mus sp.)", "mus musculus musculus (eastern european house mouse)", "eastern european house mouse (mus musculus musculus)", "western european house mouse (mus musculus domesticus)", "mus sp. ...
Given the context 'We had previously built a database of mapped G-quadruplex sequences in selected alternatively processed human and mouse genes (36).', answer the user's query.
What is the biomedical concept corresponding to 'canis familiaris'?
[ "canis familiaris (canis lupus familiaris)", "canis domesticus (canis lupus familiaris)", "canis canis (canis lupus familiaris)", "canis lupus familiaris (dogs (canis lupus familiaris))", "dog (canis lupus familiaris) (canis lupus familiaris)", "dogs (canis lupus familiaris) (canis lupus familiaris)", "...
[ "canis sp.", "canis", "canis vulpes (vulpes vulpes)", "canidae (dog, coyote, wolf, fox)", "canis lupus (grey wolf)", "canis variabilis (canis lupus variabilis)", "felis domesticus (felis catus)", "domestic cat (felis catus)", "this canus", "canis lupus variabilis (canis variabilis)" ]
Given the context 'For example, entering the gene ID 403437 results in downloading the Brca1 gene sequence for Canis familiaris.', answer the user's query.
What is the biomedical concept corresponding to 'mouse'?
[ "mouse (mus musculus)", "house mouse (mus musculus)", "mus musculus (house mouse)" ]
[ "mouse (mus <genus>)", "mice (mus <genus>) (mus <genus>)", "mus <genus> (mice (mus <genus>))", "mice (mus sp.) (mus sp.)", "mus musculus musculus (eastern european house mouse)", "eastern european house mouse (mus musculus musculus)", "western european house mouse (mus musculus domesticus)", "mus sp. ...
Given the context 'For example, the mouse version of the gene PTPRU, which is 69822 bases long, contains 94681 QGRS of length up to 45 bases.', answer the user's query.
What is the biomedical concept corresponding to 'human'?
[ "human (homo sapiens)", "homo sapiens (human)" ]
[ "humans (homo)", "homo (humans)", "macrobiotus sapiens", "primate (primates)", "hominoidea (apes (hominoidea))", "hominidae (great apes)", "ape (hominoidea) (hominoidea)", "kingdom", "apes (hominoidea) (hominoidea)", "homininae (homo/pan/gorilla group)" ]
Given the context 'As an example, the Gene View for the human GREB1 is displayed in Figure 2, showing the table of gene information and product information for the first product (the output for all products may be seen in the supplementary material). ', answer the user's query.
What is the biomedical concept corresponding to 'yeast'?
[ "saccharomyces cerevisiae (saccharomyces cerevisiae (desm.) meyen ex e.c. hansen, 1883)", "saccharomyces cerevisiae (desm.) meyen ex e.c. hansen, 1883 (saccharomyces cerevisiae)", "baker's yeast (saccharomyces cerevisiae)", "mycoderma cerevisiae (saccharomyces cerevisiae)" ]
[ "true yeasts (saccharomycotina)", "saccharomycetes (hemiascomycetes)", "saccharomyces sp.", "candida/saccharomycetales (candida/saccharomycales clade)", "budding yeasts & others (saccharomycotina)", "saccharomyceta", "saccharomycodes", "saccharomyces cerevisiae or paradoxus (saccharomyces cf. cerevisi...
Given the context 'Enp1, a yeast protein associated with U3 and U14 snoRNAs, is required for pre-rRNA processing and 40S subunit synthesis Abstract ENP1 is an essential Saccharomyces cerevisiae gene encoding a 483 amino acid polypeptide.', answer the user's query.
What is the biomedical concept corresponding to 'saccharomyces cerevisiae'?
[ "saccharomyces cerevisiae (saccharomyces cerevisiae (desm.) meyen ex e.c. hansen, 1883)", "saccharomyces cerevisiae (desm.) meyen ex e.c. hansen, 1883 (saccharomyces cerevisiae)", "baker's yeast (saccharomyces cerevisiae)", "mycoderma cerevisiae (saccharomyces cerevisiae)", "brewer's yeast (saccharomyces ce...
[ "saccharomyces cf. cerevisiae", "saccharomyces cerevisiae or paradoxus (saccharomyces cf. cerevisiae/paradoxus)", "saccharomyces sp.", "saccharomyces cerevisiae x saccharomyces mikatae", "saccharomyces cf. cerevisiae/paradoxus (saccharomyces cerevisiae or paradoxus)", "saccharomyces cerevisiae fleischmann...
Given the context 'Enp1, a yeast protein associated with U3 and U14 snoRNAs, is required for pre-rRNA processing and 40S subunit synthesis Abstract ENP1 is an essential Saccharomyces cerevisiae gene encoding a 483 amino acid polypeptide.', answer the user's query.
What is the biomedical concept corresponding to 'yeast'?
[ "saccharomyces cerevisiae (saccharomyces cerevisiae (desm.) meyen ex e.c. hansen, 1883)", "saccharomyces cerevisiae (desm.) meyen ex e.c. hansen, 1883 (saccharomyces cerevisiae)", "baker's yeast (saccharomyces cerevisiae)", "mycoderma cerevisiae (saccharomyces cerevisiae)" ]
[ "true yeasts (saccharomycotina)", "saccharomycetes (hemiascomycetes)", "saccharomyces sp.", "candida/saccharomycetales (candida/saccharomycales clade)", "budding yeasts & others (saccharomycotina)", "saccharomyceta", "saccharomycodes", "saccharomyces cerevisiae or paradoxus (saccharomyces cf. cerevisi...
Given the context 'In the yeast Saccharomyces cerevisiae, each rRNA gene is transcribed by RNA polymerase I into a 35S rRNA precursor, consisting of 18S, 5.8S and 25S rRNA sequences flanked by two external transcribed spacers (ETS) and separated by two internal transcribed spacers (ITS) (Fig. 1).', answer the user's query.
What is the biomedical concept corresponding to 'saccharomyces cerevisiae'?
[ "saccharomyces cerevisiae (saccharomyces cerevisiae (desm.) meyen ex e.c. hansen, 1883)", "saccharomyces cerevisiae (desm.) meyen ex e.c. hansen, 1883 (saccharomyces cerevisiae)", "baker's yeast (saccharomyces cerevisiae)", "mycoderma cerevisiae (saccharomyces cerevisiae)", "brewer's yeast (saccharomyces ce...
[ "saccharomyces cf. cerevisiae", "saccharomyces cerevisiae or paradoxus (saccharomyces cf. cerevisiae/paradoxus)", "saccharomyces sp.", "saccharomyces cerevisiae x saccharomyces mikatae", "saccharomyces cf. cerevisiae/paradoxus (saccharomyces cerevisiae or paradoxus)", "saccharomyces cerevisiae fleischmann...
Given the context 'In the yeast Saccharomyces cerevisiae, each rRNA gene is transcribed by RNA polymerase I into a 35S rRNA precursor, consisting of 18S, 5.8S and 25S rRNA sequences flanked by two external transcribed spacers (ETS) and separated by two internal transcribed spacers (ITS) (Fig. 1).', answer the user's query.
What is the biomedical concept corresponding to 'yeast'?
[ "saccharomyces cerevisiae (saccharomyces cerevisiae (desm.) meyen ex e.c. hansen, 1883)", "saccharomyces cerevisiae (desm.) meyen ex e.c. hansen, 1883 (saccharomyces cerevisiae)", "baker's yeast (saccharomyces cerevisiae)", "mycoderma cerevisiae (saccharomyces cerevisiae)" ]
[ "true yeasts (saccharomycotina)", "saccharomycetes (hemiascomycetes)", "saccharomyces sp.", "candida/saccharomycetales (candida/saccharomycales clade)", "budding yeasts & others (saccharomycotina)", "saccharomyceta", "saccharomycodes", "saccharomyces cerevisiae or paradoxus (saccharomyces cf. cerevisi...
Given the context 'In yeast cells there are more than 100 different snoRNAs playing important roles in rRNA modification and processing.', answer the user's query.
What is the biomedical concept corresponding to 'yeast'?
[ "saccharomyces cerevisiae (saccharomyces cerevisiae (desm.) meyen ex e.c. hansen, 1883)", "saccharomyces cerevisiae (desm.) meyen ex e.c. hansen, 1883 (saccharomyces cerevisiae)", "baker's yeast (saccharomyces cerevisiae)", "mycoderma cerevisiae (saccharomyces cerevisiae)" ]
[ "true yeasts (saccharomycotina)", "saccharomycetes (hemiascomycetes)", "saccharomyces sp.", "candida/saccharomycetales (candida/saccharomycales clade)", "budding yeasts & others (saccharomycotina)", "saccharomyceta", "saccharomycodes", "saccharomyces cerevisiae or paradoxus (saccharomyces cf. cerevisi...
Given the context 'The yeast protein was localized to the nucleus in a previous study (18).', answer the user's query.
What is the biomedical concept corresponding to 'human'?
[ "human (homo sapiens)", "homo sapiens (human)" ]
[ "humans (homo)", "homo (humans)", "macrobiotus sapiens", "primate (primates)", "hominoidea (apes (hominoidea))", "hominidae (great apes)", "ape (hominoidea) (hominoidea)", "kingdom", "apes (hominoidea) (hominoidea)", "homininae (homo/pan/gorilla group)" ]
Given the context 'On the other hand, an Enp1 human homolog, called bystin, was reported to localize to the cytoplasm and was proposed to be involved in cell adhesion (19). ', answer the user's query.
What is the biomedical concept corresponding to 'human'?
[ "human (homo sapiens)", "homo sapiens (human)" ]
[ "humans (homo)", "homo (humans)", "macrobiotus sapiens", "primate (primates)", "hominoidea (apes (hominoidea))", "hominidae (great apes)", "ape (hominoidea) (hominoidea)", "kingdom", "apes (hominoidea) (hominoidea)", "homininae (homo/pan/gorilla group)" ]
Given the context 'We also found that human Enp1, expressed in yeast, was located in the nucleus and the nucleolus, suggesting that the function of this protein is conserved. ', answer the user's query.
What is the biomedical concept corresponding to 'yeast'?
[ "saccharomyces cerevisiae (saccharomyces cerevisiae (desm.) meyen ex e.c. hansen, 1883)", "saccharomyces cerevisiae (desm.) meyen ex e.c. hansen, 1883 (saccharomyces cerevisiae)", "baker's yeast (saccharomyces cerevisiae)", "mycoderma cerevisiae (saccharomyces cerevisiae)" ]
[ "true yeasts (saccharomycotina)", "saccharomycetes (hemiascomycetes)", "saccharomyces sp.", "candida/saccharomycetales (candida/saccharomycales clade)", "budding yeasts & others (saccharomycotina)", "saccharomyceta", "saccharomycodes", "saccharomyces cerevisiae or paradoxus (saccharomyces cf. cerevisi...
Given the context 'We also found that human Enp1, expressed in yeast, was located in the nucleus and the nucleolus, suggesting that the function of this protein is conserved. ', answer the user's query.
What is the biomedical concept corresponding to 'yeast'?
[ "saccharomyces cerevisiae (saccharomyces cerevisiae (desm.) meyen ex e.c. hansen, 1883)", "saccharomyces cerevisiae (desm.) meyen ex e.c. hansen, 1883 (saccharomyces cerevisiae)", "baker's yeast (saccharomyces cerevisiae)", "mycoderma cerevisiae (saccharomyces cerevisiae)" ]
[ "true yeasts (saccharomycotina)", "saccharomycetes (hemiascomycetes)", "saccharomyces sp.", "candida/saccharomycetales (candida/saccharomycales clade)", "budding yeasts & others (saccharomycotina)", "saccharomyceta", "saccharomycodes", "saccharomyces cerevisiae or paradoxus (saccharomyces cf. cerevisi...
Given the context 'MATERIALS AND METHODS Yeast strains and media The S.cerevisiae strains used in this study are all derivatives of a wild-type diploid strain W303 (MATa/MATα ura3-1/ura3-1 leu2-3,112/leu2-3,112 trp1-1/trp1-1 his3-11,15/his3-11,15 ade2-1/ade2-1 can1-100/can1-100) except for strain RS1938.', answer the user's query.
What is the biomedical concept corresponding to 's.cerevisiae'?
[ "saccharomyces cerevisiae (saccharomyces cerevisiae (desm.) meyen ex e.c. hansen, 1883)", "saccharomyces cerevisiae (desm.) meyen ex e.c. hansen, 1883 (saccharomyces cerevisiae)", "baker's yeast (saccharomyces cerevisiae)", "mycoderma cerevisiae (saccharomyces cerevisiae)", "brewer's yeast (saccharomyces ce...
[ "saccharomyces cf. cerevisiae", "saccharomyces cerevisiae or paradoxus (saccharomyces cf. cerevisiae/paradoxus)", "saccharomyces cerevisiae fleischmanns baking yeast", "saccharomyces cf. cerevisiae/paradoxus (saccharomyces cerevisiae or paradoxus)", "saccharomyces cerevisiae x saccharomyces mikatae", "sac...
Given the context 'MATERIALS AND METHODS Yeast strains and media The S.cerevisiae strains used in this study are all derivatives of a wild-type diploid strain W303 (MATa/MATα ura3-1/ura3-1 leu2-3,112/leu2-3,112 trp1-1/trp1-1 his3-11,15/his3-11,15 ade2-1/ade2-1 can1-100/can1-100) except for strain RS1938.', answer the user's query.
What is the biomedical concept corresponding to 'schizosaccharomyces pombe'?
[ "fission yeast (schizosaccharomyces pombe)", "schizosaccharomyces pombe (schizosaccharomyces malidevorans)" ]
[ "schizosaccharomyces", "schizosaccharomyces sp.", "fission yeasts (schizosaccharomycetaceae)", "schizosaccharomyces kambucha x schizosaccharomyces pombe", "schizosaccharomyces pombe oy26", "schizosaccharomyces pombe strain spy73 975 h+", "schizosaccharomycetes (archiascomycota)", "zygosaccharomyces sp...
Given the context 'Strain JBY45 (MATa/MATα ENP1/Δenp1::his5+) was constructed by replacing one copy of the ENP1 open reading frame (ORF) with the Schizosaccharomyces pombe his5+ gene (18).', answer the user's query.
What is the biomedical concept corresponding to 'human'?
[ "human (homo sapiens)", "homo sapiens (human)" ]
[ "humans (homo)", "homo (humans)", "macrobiotus sapiens", "primate (primates)", "hominoidea (apes (hominoidea))", "hominidae (great apes)", "ape (hominoidea) (hominoidea)", "kingdom", "apes (hominoidea) (hominoidea)", "homininae (homo/pan/gorilla group)" ]
Given the context '[MATa/pCW109 (pMET25-GFP-hENP1, URA3, CEN6)] has a human homolog of Enp1 expressed in W303-1a.', answer the user's query.
What is the biomedical concept corresponding to 'human'?
[ "human (homo sapiens)", "homo sapiens (human)" ]
[ "humans (homo)", "homo (humans)", "macrobiotus sapiens", "primate (primates)", "hominoidea (apes (hominoidea))", "hominidae (great apes)", "ape (hominoidea) (hominoidea)", "kingdom", "apes (hominoidea) (hominoidea)", "homininae (homo/pan/gorilla group)" ]
Given the context 'The human homolog of yeast Enp1 was PCR amplified from a human cDNA clone BC007340 (Research Genetics), then cloned into pGFP-N-FUS, p415-ADH, p415-GPD and p415-TEF (24) via XbaI and SalI sites to generate pCW109, pCW113, pCW115 and pCW117, respectively.', answer the user's query.
What is the biomedical concept corresponding to 'yeast'?
[ "saccharomyces cerevisiae (saccharomyces cerevisiae (desm.) meyen ex e.c. hansen, 1883)", "saccharomyces cerevisiae (desm.) meyen ex e.c. hansen, 1883 (saccharomyces cerevisiae)", "baker's yeast (saccharomyces cerevisiae)", "mycoderma cerevisiae (saccharomyces cerevisiae)" ]
[ "true yeasts (saccharomycotina)", "saccharomycetes (hemiascomycetes)", "saccharomyces sp.", "candida/saccharomycetales (candida/saccharomycales clade)", "budding yeasts & others (saccharomycotina)", "saccharomyceta", "saccharomycodes", "saccharomyces cerevisiae or paradoxus (saccharomyces cf. cerevisi...
Given the context 'The human homolog of yeast Enp1 was PCR amplified from a human cDNA clone BC007340 (Research Genetics), then cloned into pGFP-N-FUS, p415-ADH, p415-GPD and p415-TEF (24) via XbaI and SalI sites to generate pCW109, pCW113, pCW115 and pCW117, respectively.', answer the user's query.
What is the biomedical concept corresponding to 'human'?
[ "human (homo sapiens)", "homo sapiens (human)" ]
[ "humans (homo)", "homo (humans)", "macrobiotus sapiens", "primate (primates)", "hominoidea (apes (hominoidea))", "hominidae (great apes)", "ape (hominoidea) (hominoidea)", "kingdom", "apes (hominoidea) (hominoidea)", "homininae (homo/pan/gorilla group)" ]
Given the context 'The human homolog of yeast Enp1 was PCR amplified from a human cDNA clone BC007340 (Research Genetics), then cloned into pGFP-N-FUS, p415-ADH, p415-GPD and p415-TEF (24) via XbaI and SalI sites to generate pCW109, pCW113, pCW115 and pCW117, respectively.', answer the user's query.
What is the biomedical concept corresponding to 'human'?
[ "human (homo sapiens)", "homo sapiens (human)" ]
[ "humans (homo)", "homo (humans)", "macrobiotus sapiens", "primate (primates)", "hominoidea (apes (hominoidea))", "hominidae (great apes)", "ape (hominoidea) (hominoidea)", "kingdom", "apes (hominoidea) (hominoidea)", "homininae (homo/pan/gorilla group)" ]
Given the context 'The fragment of the human Enp1 homolog (amino acids 152–437) was also cloned into these vectors to generate pCW110, pCW114, pCW116 and pCW118. ', answer the user's query.
What is the biomedical concept corresponding to 'mouse'?
[ "mouse (mus musculus)", "house mouse (mus musculus)", "mus musculus (house mouse)" ]
[ "mouse (mus <genus>)", "mice (mus <genus>) (mus <genus>)", "mus <genus> (mice (mus <genus>))", "mice (mus sp.) (mus sp.)", "mus musculus musculus (eastern european house mouse)", "eastern european house mouse (mus musculus musculus)", "western european house mouse (mus musculus domesticus)", "mus sp. ...
Given the context 'Cells were fixed with 3.7% formaldehyde at room temperature for 1.5 h. Antibodies included a mouse monoclonal anti-Nop1 (a gift from John P. Aris, University of Florida, Gainesville, Florida) and a Texas-red-conjugated donkey-anti-mouse antibody (Jackson Lab), both used at 1:500 dilution.', answer the user's query.
What is the biomedical concept corresponding to 'donkey'?
[ "donkey (equus asinus)", "domestic ass (equus asinus)", "equus asinus (ass (equus asinus))", "african wild ass (equus asinus)", "african ass (equus asinus)", "ass (equus asinus) (equus asinus)" ]
[ "equus caballus x equus asinus (hybrid of male horse and female donkey)", "hybrid of male horse and female donkey (equus caballus x equus asinus)", "equus asinus x equus caballus (hybrid of male donkey and female horse)", "equus subg. asinus (equus)", "equidae (horses)", "horses (equidae)", "equus afric...
Given the context 'Cells were fixed with 3.7% formaldehyde at room temperature for 1.5 h. Antibodies included a mouse monoclonal anti-Nop1 (a gift from John P. Aris, University of Florida, Gainesville, Florida) and a Texas-red-conjugated donkey-anti-mouse antibody (Jackson Lab), both used at 1:500 dilution.', answer the user's query.
What is the biomedical concept corresponding to 'mouse'?
[ "mouse (mus musculus)", "house mouse (mus musculus)", "mus musculus (house mouse)" ]
[ "mouse (mus <genus>)", "mice (mus <genus>) (mus <genus>)", "mus <genus> (mice (mus <genus>))", "mice (mus sp.) (mus sp.)", "mus musculus musculus (eastern european house mouse)", "eastern european house mouse (mus musculus musculus)", "western european house mouse (mus musculus domesticus)", "mus sp. ...
Given the context 'Cells were fixed with 3.7% formaldehyde at room temperature for 1.5 h. Antibodies included a mouse monoclonal anti-Nop1 (a gift from John P. Aris, University of Florida, Gainesville, Florida) and a Texas-red-conjugated donkey-anti-mouse antibody (Jackson Lab), both used at 1:500 dilution.', answer the user's query.
What is the biomedical concept corresponding to 'mouse'?
[ "mouse (mus musculus)", "house mouse (mus musculus)", "mus musculus (house mouse)" ]
[ "mouse (mus <genus>)", "mice (mus <genus>) (mus <genus>)", "mus <genus> (mice (mus <genus>))", "mice (mus sp.) (mus sp.)", "mus musculus musculus (eastern european house mouse)", "eastern european house mouse (mus musculus musculus)", "western european house mouse (mus musculus domesticus)", "mus sp. ...
Given the context 'Following electrophoresis, the proteins were transferred to nitrocellulose membranes and detected using anti-Nop1 antibody at 1:3000 dilution (provided by J. Aris) and anti-L3 antibody (provided by J. Warner) at 1:3000 dilution followed by peroxidase-conjugated anti-mouse secondary antibody at 1:5000 dilution.', answer the user's query.
What is the biomedical concept corresponding to 'yeast'?
[ "saccharomyces cerevisiae (saccharomyces cerevisiae (desm.) meyen ex e.c. hansen, 1883)", "saccharomyces cerevisiae (desm.) meyen ex e.c. hansen, 1883 (saccharomyces cerevisiae)", "baker's yeast (saccharomyces cerevisiae)", "mycoderma cerevisiae (saccharomyces cerevisiae)" ]
[ "true yeasts (saccharomycotina)", "saccharomycetes (hemiascomycetes)", "saccharomyces sp.", "candida/saccharomycetales (candida/saccharomycales clade)", "budding yeasts & others (saccharomycotina)", "saccharomyceta", "saccharomycodes", "saccharomyces cerevisiae or paradoxus (saccharomyces cf. cerevisi...
Given the context 'RESULTS Construction and analysis of ENP1 temperature-sensitive alleles ENP1 is an essential yeast gene conserved among eukaryotes (18).', answer the user's query.
What is the biomedical concept corresponding to 'staphylococcus aureus'?
[ "staphylococcus pyogenes aureus (staphylococcus aureus)", "micrococcus aureus (staphylococcus aureus)", "staphylococcus aureus (staphylococcus aureus subsp. anaerobius)", "micrococcus pyogenes (staphylococcus aureus)" ]
[ "staphylococcus aureus subsp. aureus col (staphylococcus aureus col)", "staphylococcus aureus col (staphylococcus aureus subsp. aureus col)", "staphylococcus staphylolyticus (staphylococcus simulans bv. staphylolyticus)", "staphylococcus sp. s", "staphylococcus aureus usa_1", "staphylococcus sp. i", "st...
Given the context 'The TAP tag contains Staphylococcus aureus Protein A as well as calmodulin-binding peptide sequences, so the tagged Enp1 binds IgG beads with high specificity.', answer the user's query.
What is the biomedical concept corresponding to 'human'?
[ "human (homo sapiens)", "homo sapiens (human)" ]
[ "humans (homo)", "homo (humans)", "macrobiotus sapiens", "primate (primates)", "hominoidea (apes (hominoidea))", "hominidae (great apes)", "ape (hominoidea) (hominoidea)", "kingdom", "apes (hominoidea) (hominoidea)", "homininae (homo/pan/gorilla group)" ]
Given the context 'Comparison of Enp1 with homologs in other organisms Homologs of Enp1 protein in human, Drosophila and Caenorhabditis elegans have been reported (18).', answer the user's query.
What is the biomedical concept corresponding to 'drosophila'?
[ "fruit fly (drosophila melanogaster)" ]
[ "drosophila (drosophila <flies,genus>)", "drosophila (drosophila <basidiomycete fungi>)", "drosophila (drosophila <flies,subgenus>)", "drosophila <basidiomycete fungi> (drosophila)", "drosophila <flies,subgenus> (drosophila)", "drosophila <flies,genus> (fruit flies)", "fruit fly (drosophila <flies,genus...
Given the context 'Comparison of Enp1 with homologs in other organisms Homologs of Enp1 protein in human, Drosophila and Caenorhabditis elegans have been reported (18).', answer the user's query.
What is the biomedical concept corresponding to 'caenorhabditis elegans'?
[ "caenorhabditis elegans (rhabditis elegans)", "rhabditis elegans (caenorhabditis elegans)" ]
[ "elegans subgroup (in: flies)", "caenorhabditis sp.", "drosophila elegans", "caenorhabditis", "cyclostrongylus elegans", "polyzonia elegans", "elegans subgroup (in: mosquitos)", "enyo elegans (zodarion elegans)", "uronema elegans", "zodarion elegans (enyo elegans)" ]
Given the context 'Comparison of Enp1 with homologs in other organisms Homologs of Enp1 protein in human, Drosophila and Caenorhabditis elegans have been reported (18).', answer the user's query.
What is the biomedical concept corresponding to 'human'?
[ "human (homo sapiens)", "homo sapiens (human)" ]
[ "humans (homo)", "homo (humans)", "macrobiotus sapiens", "primate (primates)", "hominoidea (apes (hominoidea))", "hominidae (great apes)", "ape (hominoidea) (hominoidea)", "kingdom", "apes (hominoidea) (hominoidea)", "homininae (homo/pan/gorilla group)" ]
Given the context 'A previously described human homolog, bystin, was only 306 amino acids in length, and lacked sequences corresponding to the N-terminal 163 amino acids of yeast Enp1 (19).', answer the user's query.
What is the biomedical concept corresponding to 'yeast'?
[ "saccharomyces cerevisiae (saccharomyces cerevisiae (desm.) meyen ex e.c. hansen, 1883)", "saccharomyces cerevisiae (desm.) meyen ex e.c. hansen, 1883 (saccharomyces cerevisiae)", "baker's yeast (saccharomyces cerevisiae)", "mycoderma cerevisiae (saccharomyces cerevisiae)" ]
[ "true yeasts (saccharomycotina)", "saccharomycetes (hemiascomycetes)", "saccharomyces sp.", "candida/saccharomycetales (candida/saccharomycales clade)", "budding yeasts & others (saccharomycotina)", "saccharomyceta", "saccharomycodes", "saccharomyces cerevisiae or paradoxus (saccharomyces cf. cerevisi...
Given the context 'A previously described human homolog, bystin, was only 306 amino acids in length, and lacked sequences corresponding to the N-terminal 163 amino acids of yeast Enp1 (19).', answer the user's query.
What is the biomedical concept corresponding to 'human'?
[ "human (homo sapiens)", "homo sapiens (human)" ]
[ "humans (homo)", "homo (humans)", "macrobiotus sapiens", "primate (primates)", "hominoidea (apes (hominoidea))", "hominidae (great apes)", "ape (hominoidea) (hominoidea)", "kingdom", "apes (hominoidea) (hominoidea)", "homininae (homo/pan/gorilla group)" ]
Given the context 'In contrast, we identified a human expressed sequence tag (EST), BC007340 in a Blast search that revealed an ORF of 1311 nucleotides encoding a 437 amino acid polypeptide (39).', answer the user's query.
What is the biomedical concept corresponding to 'human'?
[ "human (homo sapiens)", "homo sapiens (human)" ]
[ "humans (homo)", "homo (humans)", "macrobiotus sapiens", "primate (primates)", "hominoidea (apes (hominoidea))", "hominidae (great apes)", "ape (hominoidea) (hominoidea)", "kingdom", "apes (hominoidea) (hominoidea)", "homininae (homo/pan/gorilla group)" ]
Given the context 'Comparison of this 437 amino acid polypeptide with human bystin (19) showed that they were encoded by the same gene on human chromosome 6.', answer the user's query.
What is the biomedical concept corresponding to 'human'?
[ "human (homo sapiens)", "homo sapiens (human)" ]
[ "humans (homo)", "homo (humans)", "macrobiotus sapiens", "primate (primates)", "hominoidea (apes (hominoidea))", "hominidae (great apes)", "ape (hominoidea) (hominoidea)", "kingdom", "apes (hominoidea) (hominoidea)", "homininae (homo/pan/gorilla group)" ]
Given the context 'Comparison of this 437 amino acid polypeptide with human bystin (19) showed that they were encoded by the same gene on human chromosome 6.', answer the user's query.
What is the biomedical concept corresponding to 'human'?
[ "human (homo sapiens)", "homo sapiens (human)" ]
[ "humans (homo)", "homo (humans)", "macrobiotus sapiens", "primate (primates)", "hominoidea (apes (hominoidea))", "hominidae (great apes)", "ape (hominoidea) (hominoidea)", "kingdom", "apes (hominoidea) (hominoidea)", "homininae (homo/pan/gorilla group)" ]
Given the context 'The reported sequence for human bystin is a fragment of the 437 amino acid human Enp1 protein, due to a truncated cDNA sequence.', answer the user's query.
What is the biomedical concept corresponding to 'human'?
[ "human (homo sapiens)", "homo sapiens (human)" ]
[ "humans (homo)", "homo (humans)", "macrobiotus sapiens", "primate (primates)", "hominoidea (apes (hominoidea))", "hominidae (great apes)", "ape (hominoidea) (hominoidea)", "kingdom", "apes (hominoidea) (hominoidea)", "homininae (homo/pan/gorilla group)" ]
Given the context 'The reported sequence for human bystin is a fragment of the 437 amino acid human Enp1 protein, due to a truncated cDNA sequence.', answer the user's query.
What is the biomedical concept corresponding to 'human'?
[ "human (homo sapiens)", "homo sapiens (human)" ]
[ "humans (homo)", "homo (humans)", "macrobiotus sapiens", "primate (primates)", "hominoidea (apes (hominoidea))", "hominidae (great apes)", "ape (hominoidea) (hominoidea)", "kingdom", "apes (hominoidea) (hominoidea)", "homininae (homo/pan/gorilla group)" ]
Given the context 'Also, a sequence discrepancy at the C-terminus is due to inaccurate DNA sequence of the human bystin, as confirmed by available human genome and EST sequences.', answer the user's query.
What is the biomedical concept corresponding to 'human'?
[ "human (homo sapiens)", "homo sapiens (human)" ]
[ "humans (homo)", "homo (humans)", "macrobiotus sapiens", "primate (primates)", "hominoidea (apes (hominoidea))", "hominidae (great apes)", "ape (hominoidea) (hominoidea)", "kingdom", "apes (hominoidea) (hominoidea)", "homininae (homo/pan/gorilla group)" ]
Given the context 'Also, a sequence discrepancy at the C-terminus is due to inaccurate DNA sequence of the human bystin, as confirmed by available human genome and EST sequences.', answer the user's query.
What is the biomedical concept corresponding to 's.pombe'?
[ "fission yeast (schizosaccharomyces pombe)", "schizosaccharomyces pombe (schizosaccharomyces malidevorans)" ]
[ "schizosaccharomyces", "fission yeasts (schizosaccharomycetaceae)", "schizosaccharomyces sp.", "schizosaccharomyces pombe oy26", "schizosaccharomyces pombe strain spy73 975 h+", "schizosaccharomyces kambucha x schizosaccharomyces pombe", "schizosaccharomyces pombe 927", "zygosaccharomyces sp.", "zyg...
Given the context 'Searches of the database of other organisms identified Enp1 homologs in S.pombe, Arabidopsis thaliana, C.elegans, Drosophila melanogaster and mouse.', answer the user's query.
What is the biomedical concept corresponding to 'arabidopsis thaliana'?
[ "arabidopsis thaliana (mouse-ear cress)", "arabis thaliana (arabidopsis thaliana)", "mouse-ear cress (arabidopsis thaliana)", "thale-cress (arabidopsis thaliana)", "thale cress (arabidopsis thaliana)" ]
[ "arabidopsis sp.", "arabidopsis thaliana x arabidopsis arenosa", "arabidopsis thaliana x arabidopsis lyrata", "arabidopsis thaliana x arabidopsis halleri", "arabidopsis environmental sample", "arabidopsis (cardaminopsis)", "(arabidopsis thaliana x arabidopsis arenosa) x arabidopsis suecica", "arabidop...
Given the context 'Searches of the database of other organisms identified Enp1 homologs in S.pombe, Arabidopsis thaliana, C.elegans, Drosophila melanogaster and mouse.', answer the user's query.
What is the biomedical concept corresponding to 'c.elegans'?
[ "caenorhabditis elegans (rhabditis elegans)", "rhabditis elegans (caenorhabditis elegans)" ]
[ "elegans subgroup (in: flies)", "drosophila elegans", "theocolax elegans", "cyclostrongylus elegans", "polyzonia elegans", "actinomucor elegans var. elegans", "elegans subgroup (in: mosquitos)", "bactris elegans", "sipha elegans", "urocitellus elegans elegans (spermophilus elegans elegans)" ]
Given the context 'Searches of the database of other organisms identified Enp1 homologs in S.pombe, Arabidopsis thaliana, C.elegans, Drosophila melanogaster and mouse.', answer the user's query.
What is the biomedical concept corresponding to 'drosophila melanogaster'?
[ "fruit fly (drosophila melanogaster)", "drosophila melanogaster (sophophora melanogaster)" ]
[ "melanogaster (melanogaster <basidiomycete fungi>)", "melanogaster (melanogaster <flies>)", "melanogaster <basidiomycete fungi> (melanogaster)", "melanogaster <flies> (melanogaster)", "drosophila (drosophila <basidiomycete fungi>)", "drosophila <basidiomycete fungi> (drosophila)", "drosophila (drosophil...
Given the context 'Searches of the database of other organisms identified Enp1 homologs in S.pombe, Arabidopsis thaliana, C.elegans, Drosophila melanogaster and mouse.', answer the user's query.
What is the biomedical concept corresponding to 'mouse'?
[ "mouse (mus musculus)", "house mouse (mus musculus)", "mus musculus (house mouse)" ]
[ "mouse (mus <genus>)", "mice (mus <genus>) (mus <genus>)", "mus <genus> (mice (mus <genus>))", "mice (mus sp.) (mus sp.)", "mus musculus musculus (eastern european house mouse)", "eastern european house mouse (mus musculus musculus)", "western european house mouse (mus musculus domesticus)", "mus sp. ...
Given the context 'Searches of the database of other organisms identified Enp1 homologs in S.pombe, Arabidopsis thaliana, C.elegans, Drosophila melanogaster and mouse.', answer the user's query.
What is the biomedical concept corresponding to 'human'?
[ "human (homo sapiens)", "homo sapiens (human)" ]
[ "humans (homo)", "homo (humans)", "macrobiotus sapiens", "primate (primates)", "hominoidea (apes (hominoidea))", "hominidae (great apes)", "ape (hominoidea) (hominoidea)", "kingdom", "apes (hominoidea) (hominoidea)", "homininae (homo/pan/gorilla group)" ]
Given the context 'The human Enp1 homolog was cloned and expressed in yeast and tested for function.', answer the user's query.
What is the biomedical concept corresponding to 'yeast'?
[ "saccharomyces cerevisiae (saccharomyces cerevisiae (desm.) meyen ex e.c. hansen, 1883)", "saccharomyces cerevisiae (desm.) meyen ex e.c. hansen, 1883 (saccharomyces cerevisiae)", "baker's yeast (saccharomyces cerevisiae)", "mycoderma cerevisiae (saccharomyces cerevisiae)" ]
[ "true yeasts (saccharomycotina)", "saccharomycetes (hemiascomycetes)", "saccharomyces sp.", "candida/saccharomycetales (candida/saccharomycales clade)", "budding yeasts & others (saccharomycotina)", "saccharomyceta", "saccharomycodes", "saccharomyces cerevisiae or paradoxus (saccharomyces cf. cerevisi...
Given the context 'The human Enp1 homolog was cloned and expressed in yeast and tested for function.', answer the user's query.
What is the biomedical concept corresponding to 'human'?
[ "human (homo sapiens)", "homo sapiens (human)" ]
[ "humans (homo)", "homo (humans)", "macrobiotus sapiens", "primate (primates)", "hominoidea (apes (hominoidea))", "hominidae (great apes)", "ape (hominoidea) (hominoidea)", "kingdom", "apes (hominoidea) (hominoidea)", "homininae (homo/pan/gorilla group)" ]
Given the context 'Expressed under the control of ADH, TEF or GPD promoter, the human Enp1 homolog did not complement a yeast enp1 null mutant.', answer the user's query.
What is the biomedical concept corresponding to 'yeast'?
[ "saccharomyces cerevisiae (saccharomyces cerevisiae (desm.) meyen ex e.c. hansen, 1883)", "saccharomyces cerevisiae (desm.) meyen ex e.c. hansen, 1883 (saccharomyces cerevisiae)", "baker's yeast (saccharomyces cerevisiae)", "mycoderma cerevisiae (saccharomyces cerevisiae)" ]
[ "true yeasts (saccharomycotina)", "saccharomycetes (hemiascomycetes)", "saccharomyces sp.", "candida/saccharomycetales (candida/saccharomycales clade)", "budding yeasts & others (saccharomycotina)", "saccharomyceta", "saccharomycodes", "saccharomyces cerevisiae or paradoxus (saccharomyces cf. cerevisi...
Given the context 'Expressed under the control of ADH, TEF or GPD promoter, the human Enp1 homolog did not complement a yeast enp1 null mutant.', answer the user's query.
What is the biomedical concept corresponding to 'human'?
[ "human (homo sapiens)", "homo sapiens (human)" ]
[ "humans (homo)", "homo (humans)", "macrobiotus sapiens", "primate (primates)", "hominoidea (apes (hominoidea))", "hominidae (great apes)", "ape (hominoidea) (hominoidea)", "kingdom", "apes (hominoidea) (hominoidea)", "homininae (homo/pan/gorilla group)" ]
Given the context 'However, a GFP fusion to the N-terminus of human Enp1 homolog localized to the nucleus and was enriched in the nucleolus (data not shown). ', answer the user's query.
What is the biomedical concept corresponding to 'yeast'?
[ "saccharomyces cerevisiae (saccharomyces cerevisiae (desm.) meyen ex e.c. hansen, 1883)", "saccharomyces cerevisiae (desm.) meyen ex e.c. hansen, 1883 (saccharomyces cerevisiae)", "baker's yeast (saccharomyces cerevisiae)", "mycoderma cerevisiae (saccharomyces cerevisiae)" ]
[ "true yeasts (saccharomycotina)", "saccharomycetes (hemiascomycetes)", "saccharomyces sp.", "candida/saccharomycetales (candida/saccharomycales clade)", "budding yeasts & others (saccharomycotina)", "saccharomyceta", "saccharomycodes", "saccharomyces cerevisiae or paradoxus (saccharomyces cf. cerevisi...
Given the context 'DISCUSSION ENP1 is a yeast gene first identified in a genetic screen for complementation of mutations in ost4, which encodes a subunit of oligosaccharide transferase (17), although subsequent work showed that it is unlikely that Enp1 has any connection to oligosaccharide transferase (18).', answer the user's query.
What is the biomedical concept corresponding to 'yeast'?
[ "saccharomyces cerevisiae (saccharomyces cerevisiae (desm.) meyen ex e.c. hansen, 1883)", "saccharomyces cerevisiae (desm.) meyen ex e.c. hansen, 1883 (saccharomyces cerevisiae)", "baker's yeast (saccharomyces cerevisiae)", "mycoderma cerevisiae (saccharomyces cerevisiae)" ]
[ "true yeasts (saccharomycotina)", "saccharomycetes (hemiascomycetes)", "saccharomyces sp.", "candida/saccharomycetales (candida/saccharomycales clade)", "budding yeasts & others (saccharomycotina)", "saccharomyceta", "saccharomycodes", "saccharomyces cerevisiae or paradoxus (saccharomyces cf. cerevisi...
Given the context 'Among the more than 100 snoRNAs in yeast cells, U3, U14, snR10, snR30 and MRP RNA are the only ones required for rRNA processing.', answer the user's query.
What is the biomedical concept corresponding to 'yeast'?
[ "saccharomyces cerevisiae (saccharomyces cerevisiae (desm.) meyen ex e.c. hansen, 1883)", "saccharomyces cerevisiae (desm.) meyen ex e.c. hansen, 1883 (saccharomyces cerevisiae)", "baker's yeast (saccharomyces cerevisiae)", "mycoderma cerevisiae (saccharomyces cerevisiae)" ]
[ "true yeasts (saccharomycotina)", "saccharomycetes (hemiascomycetes)", "saccharomyces sp.", "candida/saccharomycetales (candida/saccharomycales clade)", "budding yeasts & others (saccharomycotina)", "saccharomyceta", "saccharomycodes", "saccharomyces cerevisiae or paradoxus (saccharomyces cf. cerevisi...
Given the context 'Recently, a genome-wide study of yeast protein complexes, using a TAP tag method similar to ours, reported a number of proteins that co-immunoprecipitated with Enp1 (43).', answer the user's query.
What is the biomedical concept corresponding to 'human'?
[ "human (homo sapiens)", "homo sapiens (human)" ]
[ "humans (homo)", "homo (humans)", "macrobiotus sapiens", "primate (primates)", "hominoidea (apes (hominoidea))", "hominidae (great apes)", "ape (hominoidea) (hominoidea)", "kingdom", "apes (hominoidea) (hominoidea)", "homininae (homo/pan/gorilla group)" ]
Given the context 'A previous study on the Enp1 human homolog, bystin, reported that the protein was localized in the cytoplasm of mammalian cells and might be involved in cell adhesion (19).', answer the user's query.
What is the biomedical concept corresponding to 'human'?
[ "human (homo sapiens)", "homo sapiens (human)" ]
[ "humans (homo)", "homo (humans)", "macrobiotus sapiens", "primate (primates)", "hominoidea (apes (hominoidea))", "hominidae (great apes)", "ape (hominoidea) (hominoidea)", "kingdom", "apes (hominoidea) (hominoidea)", "homininae (homo/pan/gorilla group)" ]
Given the context 'Our discovery of the 437 amino acid human Enp1 homolog revealed that the bystin studied previously was from a truncated library cDNA encoding only the C-terminal 306 amino acids.', answer the user's query.
What is the biomedical concept corresponding to 'human'?
[ "human (homo sapiens)", "homo sapiens (human)" ]
[ "humans (homo)", "homo (humans)", "macrobiotus sapiens", "primate (primates)", "hominoidea (apes (hominoidea))", "hominidae (great apes)", "ape (hominoidea) (hominoidea)", "kingdom", "apes (hominoidea) (hominoidea)", "homininae (homo/pan/gorilla group)" ]
Given the context 'Although the human homolog of Enp1 did not complement a yeast Δenp1 mutant, we did show that it was localized to the nucleus and enriched in the nucleolus (data not shown).', answer the user's query.
What is the biomedical concept corresponding to 'yeast'?
[ "saccharomyces cerevisiae (saccharomyces cerevisiae (desm.) meyen ex e.c. hansen, 1883)", "saccharomyces cerevisiae (desm.) meyen ex e.c. hansen, 1883 (saccharomyces cerevisiae)", "baker's yeast (saccharomyces cerevisiae)", "mycoderma cerevisiae (saccharomyces cerevisiae)" ]
[ "true yeasts (saccharomycotina)", "saccharomycetes (hemiascomycetes)", "saccharomyces sp.", "candida/saccharomycetales (candida/saccharomycales clade)", "budding yeasts & others (saccharomycotina)", "saccharomyceta", "saccharomycodes", "saccharomyces cerevisiae or paradoxus (saccharomyces cf. cerevisi...
Given the context 'Although the human homolog of Enp1 did not complement a yeast Δenp1 mutant, we did show that it was localized to the nucleus and enriched in the nucleolus (data not shown).', answer the user's query.
What is the biomedical concept corresponding to 'human'?
[ "human (homo sapiens)", "homo sapiens (human)" ]
[ "humans (homo)", "homo (humans)", "macrobiotus sapiens", "primate (primates)", "hominoidea (apes (hominoidea))", "hominidae (great apes)", "ape (hominoidea) (hominoidea)", "kingdom", "apes (hominoidea) (hominoidea)", "homininae (homo/pan/gorilla group)" ]
Given the context 'The cytoplasmic localization of bystin and its proposed function in cell adhesion are unlikely to reflect the actual function of the human Enp1 homolog. ', answer the user's query.
What is the biomedical concept corresponding to 'human'?
[ "human (homo sapiens)", "homo sapiens (human)" ]
[ "humans (homo)", "homo (humans)", "macrobiotus sapiens", "primate (primates)", "hominoidea (apes (hominoidea))", "hominidae (great apes)", "ape (hominoidea) (hominoidea)", "kingdom", "apes (hominoidea) (hominoidea)", "homininae (homo/pan/gorilla group)" ]
Given the context 'Epigenetic inactivation and aberrant transcription of CSMD1 in squamous cell carcinoma cell lines Abstract Background The p23.2 region of human chromosome 8 is frequently deleted in several types of epithelial cancer and those deletions appear to be associated with poor prognosis.', answer the user's query.
What is the biomedical concept corresponding to 'human'?
[ "human (homo sapiens)", "homo sapiens (human)" ]
[ "humans (homo)", "homo (humans)", "macrobiotus sapiens", "primate (primates)", "hominoidea (apes (hominoidea))", "hominidae (great apes)", "ape (hominoidea) (hominoidea)", "kingdom", "apes (hominoidea) (hominoidea)", "homininae (homo/pan/gorilla group)" ]
Given the context 'Background CUB and Sushi Multiple Domains 1 (CSMD1) was cloned as a candidate tumor suppressor or progression gene from a region of human chromosome 8 deleted in tumors of the upper aerodigestive tract, prostate, ovary and bladder', answer the user's query.
What is the biomedical concept corresponding to 'human'?
[ "human (homo sapiens)", "homo sapiens (human)" ]
[ "humans (homo)", "homo (humans)", "macrobiotus sapiens", "primate (primates)", "hominoidea (apes (hominoidea))", "hominidae (great apes)", "ape (hominoidea) (hominoidea)", "kingdom", "apes (hominoidea) (hominoidea)", "homininae (homo/pan/gorilla group)" ]
Given the context 'RT-PCR of human fetal brain cDNA reveals very low levels of an RT-PCR product corresponding in size to that expected from the internally deleted transcript.', answer the user's query.
What is the biomedical concept corresponding to 'human'?
[ "human (homo sapiens)", "homo sapiens (human)" ]
[ "humans (homo)", "homo (humans)", "macrobiotus sapiens", "primate (primates)", "hominoidea (apes (hominoidea))", "hominidae (great apes)", "ape (hominoidea) (hominoidea)", "kingdom", "apes (hominoidea) (hominoidea)", "homininae (homo/pan/gorilla group)" ]
Given the context 'Normal oropharyngeal epithelium was isolated from discarded tissue from uvulopalatopharyngoplasties (UPPP) collected anonymously with the approval of the Washington University Human Studies Committee. ', answer the user's query.
What is the biomedical concept corresponding to 'bovine'?
[ "bovine (bos taurus)", "bos bovis (bos taurus)", "cow (bos taurus) (bos taurus)", "domestic cattle (bos taurus)", "domestic cow (bos taurus)", "bos taurus (bos primigenius taurus)", "bos primigenius taurus (bos taurus)", "ox (bos taurus) (bos taurus)", "dairy cow (bos taurus)" ]
[ "cattle (bos)", "bos (cattle)", "bovidae", "bos taurus indicus (bos indicus)", "boveria", "bos sp.", "bos indicus (bos primigenius indicus)", "bos primigenius indicus (bos indicus)", "bos taurus x bos indicus (bos indicus x bos taurus)", "beefalo (bos taurus x bison bison)" ]
Given the context 'Cell Culture and Tissue Preparation Squamous cell carcinoma cell lines were grown in DMEM or DMEM:F-12, 1:1 Mixture (BioWhittaker) containing 10% fetal bovine serum (Sigma).', answer the user's query.
What is the biomedical concept corresponding to 'human'?
[ "human (homo sapiens)", "homo sapiens (human)" ]
[ "humans (homo)", "homo (humans)", "macrobiotus sapiens", "primate (primates)", "hominoidea (apes (hominoidea))", "hominidae (great apes)", "ape (hominoidea) (hominoidea)", "kingdom", "apes (hominoidea) (hominoidea)", "homininae (homo/pan/gorilla group)" ]
Given the context 'An amplicon from human 18S RNA was used as a basis for comparisons across cell lines (primers prm2396, ttcggaactgaggccatgat and prm2397, tttcgctctggtccgtcttg).', answer the user's query.
What is the biomedical concept corresponding to 'bovine'?
[ "bovine (bos taurus)", "bos bovis (bos taurus)", "cow (bos taurus) (bos taurus)", "domestic cattle (bos taurus)", "domestic cow (bos taurus)", "bos taurus (bos primigenius taurus)", "bos primigenius taurus (bos taurus)", "ox (bos taurus) (bos taurus)", "dairy cow (bos taurus)" ]
[ "cattle (bos)", "bos (cattle)", "bovidae", "bos taurus indicus (bos indicus)", "boveria", "bos sp.", "bos indicus (bos primigenius indicus)", "bos primigenius indicus (bos indicus)", "bos taurus x bos indicus (bos indicus x bos taurus)", "beefalo (bos taurus x bison bison)" ]
Given the context 'Cells were grown for 72 hours in media containing DMEM:F-12, 1:1 Mixture (BioWhittaker) with 1X MEM Nonessential Amino Acids (BioWhittaker) and 10% fetal bovine serum and then switched to media containing 5aza-dC at concentrations of 0 μm, 5 μM, 25 μM, or 100 μM. Cells were fed daily for 4–5 days and then both plates were harvested in 3 ml of Trizol (Invitrogen) for isolation of RNA and DNA according to the manufacturer's instructions.', answer the user's query.
What is the biomedical concept corresponding to 'human'?
[ "human (homo sapiens)", "homo sapiens (human)" ]
[ "humans (homo)", "homo (humans)", "macrobiotus sapiens", "primate (primates)", "hominoidea (apes (hominoidea))", "hominidae (great apes)", "ape (hominoidea) (hominoidea)", "kingdom", "apes (hominoidea) (hominoidea)", "homininae (homo/pan/gorilla group)" ]
Given the context 'Human growth hormone (GH1) gene polymorphism map in a normal-statured adult population Abstract Objective GH1 gene presents a complex map of single nucleotide polymorphisms (SNPs) in the entire promoter, coding and noncoding regions.', answer the user's query.
What is the biomedical concept corresponding to 'patients'?
[ "human (homo sapiens)" ]
[ "clientister", "theraps", "personidae", "proxys", "perna", "genus", "aides", "pero", "inquisitor", "plasmids" ]
Given the context 'Systematic GH1 gene analysis in patients with growth delay and suspected GH deficiency/insufficiency will clarify whether different SNP frequencies and/or the presence of different sequence changes may be associated with phenotypes in them. ', answer the user's query.
What is the biomedical concept corresponding to 'human'?
[ "human (homo sapiens)", "homo sapiens (human)" ]
[ "humans (homo)", "homo (humans)", "macrobiotus sapiens", "primate (primates)", "hominoidea (apes (hominoidea))", "hominidae (great apes)", "ape (hominoidea) (hominoidea)", "kingdom", "apes (hominoidea) (hominoidea)", "homininae (homo/pan/gorilla group)" ]
Given the context 'Introduction Human skeletal growth and final height attainment are a result of a multifactorial regulation involving systemic and local hormones, growth and nutritional factors, lifestyle and genetic factors.', answer the user's query.
What is the biomedical concept corresponding to 'patients'?
[ "human (homo sapiens)" ]
[ "clientister", "theraps", "personidae", "proxys", "perna", "genus", "aides", "pero", "inquisitor", "plasmids" ]
Given the context 'Large deletions within the GH1 gene cluster were described first followed by point mutations, the majority of which affect introns 3 or 4, provoke skipping of exon 3 product and exert a dominant effect.3,7,8 More recently, the presence of single nucleotide polymorphic points (SNPs) in the promoter region or in intron 4 of the GH1 gene have been described9–12 and associations with promoter allele activities or with GH secretion efficacy and circulating IGF-I levels in growth-retarded patients have also been described.11,12 Other studies have analysed several GH1 gene SNP genotypes as related to the incidence of neoplasia, with a positive association with colorectal neoplasia for intron 4 SNP,13 a negative result for breast carcinoma14,15 or a positive one for breast cancer risk.16,17 In addition, a recent study in a cohort of adults over ages 60 years detected a significant association between genotypes at one SNP in the GH1 gene promoter region and at the intron 4 SNP described by Hasegawa et al.11 with baseline bone density and accelerated bone loss together with an interaction with weight at 1 year.18 Intron 4 SNP described by Hasegawa et al.11 has also been associated, in women, with shorter body height and reduced mortality,19 whereas another intron 4 SNP (T1169A) has been associated in both sexes with a favourable metabolic profile.20', answer the user's query.
What is the biomedical concept corresponding to 'patients'?
[ "human (homo sapiens)" ]
[ "clientister", "theraps", "personidae", "proxys", "perna", "genus", "aides", "pero", "inquisitor", "plasmids" ]
Given the context 'Subjects and methods Subjects A total of 307 adult subjects of both sexes (164 women and 143 men) were recruited from hospital personnel and parents of patients with no history of growth retardation.', answer the user's query.
What is the biomedical concept corresponding to 'participant'?
[ "human (homo sapiens)" ]
[ "assessor", "clientister", "inquisitor", "subsessor", "euproctis actor", "proxys", "exeristes", "interjectio", "necrophorus investigator (nicrophorus investigator)", "cohort" ]
Given the context 'The protocol was approved by the Hospital Vall d’Hebron Ethics Committee and written informed consent was obtained from each participant.', answer the user's query.
What is the biomedical concept corresponding to 'patients'?
[ "human (homo sapiens)" ]
[ "clientister", "theraps", "personidae", "proxys", "perna", "genus", "aides", "pero", "inquisitor", "plasmids" ]
Given the context 'Several sequence changes have been reported in patients with familial or idiopathic short stature,11,26,27 whereas P8, P19, P20 and P25 (at positions 5165, 5681, 5686 and 6358, respectively, in the Genebank accession GI 183148) located in the promoter, intron 2 and intron 4 regions, respectively, had not been previously described. ', answer the user's query.
What is the biomedical concept corresponding to 'human'?
[ "human (homo sapiens)", "homo sapiens (human)" ]
[ "humans (homo)", "homo (humans)", "macrobiotus sapiens", "primate (primates)", "hominoidea (apes (hominoidea))", "hominidae (great apes)", "ape (hominoidea) (hominoidea)", "kingdom", "apes (hominoidea) (hominoidea)", "homininae (homo/pan/gorilla group)" ]
Given the context 'Discussion Genetic variations within human GH1 gene have been described by several authors.9–12,21', answer the user's query.
What is the biomedical concept corresponding to 'patients'?
[ "human (homo sapiens)" ]
[ "clientister", "theraps", "personidae", "proxys", "perna", "genus", "aides", "pero", "inquisitor", "plasmids" ]
Given the context 'The populations described to date comprised small numbers of normal-stature individuals,9 male adults with narrow height range12 or growth-retarded patients with/without GHD before achievement of adult height.9,11,12 Our study was designed to characterize the GH1 gene sequence variation in individuals within the whole range of normal adult height (between −2 and +2 SDS) according to the standards for our population.', answer the user's query.
What is the biomedical concept corresponding to 'patient'?
[ "human (homo sapiens)" ]
[ "clientister", "personidae", "theraps", "proxys", "perna", "pera", "pero", "aides", "personopsis", "inquisitor" ]
Given the context 'Five single nucleotide changes are located in exon 5; of these five, three predict an amino acid change, and one of the three (Ile179Met) has been described by Lewis et al.27 in a paediatric patient with familial short stature and the other two, as yet undescribed, are contiguous in a single individual (Pro133Hys and Arg134Leu).', answer the user's query.
What is the biomedical concept corresponding to 'patient'?
[ "human (homo sapiens)" ]
[ "clientister", "personidae", "theraps", "proxys", "perna", "pera", "pero", "aides", "personopsis", "inquisitor" ]
Given the context 'Analysis of SNP association with adult height was subsequently performed to establish a body of knowledge useful for comparing patient genotypes and phenotypes.', answer the user's query.
What is the biomedical concept corresponding to 'rat'?
[ "rat (rattus norvegicus) (rattus norvegicus)", "rattus norvegicus (rats (rattus norvegicus))", "rats (rattus norvegicus) (rattus norvegicus)" ]
[ "rats (rattus) (rattus)", "rat (rattus) (rattus)", "rattus (rats (rattus))", "rats (rattus sp.) (rattus sp.)", "house rat (rattus rattus)", "rattus rattoides (rattus rattus)", "rattus sp. (rats (rattus sp.))", "mus rattus (rattus rattus)", "black rat (rattus rattus)", "roof rat (rattus rattus)" ]
Given the context 'A recent study from Giordano et al.34 has shown a twofold reduced luciferase activity for the G nucleotide bearing promoter haplotype in transfected rat pituitary cells.', answer the user's query.
What is the biomedical concept corresponding to 'patient'?
[ "human (homo sapiens)" ]
[ "clientister", "personidae", "theraps", "proxys", "perna", "pera", "pero", "aides", "personopsis", "inquisitor" ]
Given the context 'The high density of SNPs and their proximity hamper other genotyping strategies for rapid determination of the complete GH1 SNP map in large control and patient populations.', answer the user's query.
What is the biomedical concept corresponding to 'patients'?
[ "human (homo sapiens)" ]
[ "clientister", "theraps", "personidae", "proxys", "perna", "genus", "aides", "pero", "inquisitor", "plasmids" ]
Given the context 'Systematic GH1 gene analysis in patients with growth delay and suspected GH deficiency/insufficiency will clarify whether different SNP frequencies and/or the presence of different sequence changes may be associated with phenotypes in them. ', answer the user's query.
What is the biomedical concept corresponding to 'rat'?
[ "rat (rattus norvegicus) (rattus norvegicus)", "rattus norvegicus (rats (rattus norvegicus))", "rats (rattus norvegicus) (rattus norvegicus)" ]
[ "rats (rattus) (rattus)", "rat (rattus) (rattus)", "rattus (rats (rattus))", "rats (rattus sp.) (rattus sp.)", "house rat (rattus rattus)", "rattus rattoides (rattus rattus)", "rattus sp. (rats (rattus sp.))", "mus rattus (rattus rattus)", "black rat (rattus rattus)", "roof rat (rattus rattus)" ]
Given the context 'Down-regulation of the M6P/IGF-II receptor increases cell proliferation and reduces apoptosis in neonatal rat cardiac myocytes Abstract Background The mannose 6-phosphate/insulin-like growth factor-II receptor (M6P/IGF2R) is a multi-functional protein that has been implicated in regulation of cell growth and apoptosis.', answer the user's query.
What is the biomedical concept corresponding to 'rat'?
[ "rat (rattus norvegicus) (rattus norvegicus)", "rattus norvegicus (rats (rattus norvegicus))", "rats (rattus norvegicus) (rattus norvegicus)" ]
[ "rats (rattus) (rattus)", "rat (rattus) (rattus)", "rattus (rats (rattus))", "rats (rattus sp.) (rattus sp.)", "house rat (rattus rattus)", "rattus rattoides (rattus rattus)", "rattus sp. (rats (rattus sp.))", "mus rattus (rattus rattus)", "black rat (rattus rattus)", "roof rat (rattus rattus)" ]
Given the context 'Results We down-regulated the expression of M6P/IGF2R in neonatal rat cardiac myocytes and examined the effect on cell proliferation and apoptosis.', answer the user's query.
What is the biomedical concept corresponding to 'human'?
[ "human (homo sapiens)", "homo sapiens (human)" ]
[ "humans (homo)", "homo (humans)", "macrobiotus sapiens", "primate (primates)", "hominoidea (apes (hominoidea))", "hominidae (great apes)", "ape (hominoidea) (hominoidea)", "kingdom", "apes (hominoidea) (hominoidea)", "homininae (homo/pan/gorilla group)" ]
Given the context 'However, alterations in the control of apoptosis have also been shown to contribute to human diseases.', answer the user's query.
What is the biomedical concept corresponding to 'mice'?
[ "mouse (mus musculus)", "house mouse (mus musculus)", "mus musculus (house mouse)" ]
[ "mice (mus <genus>) (mus <genus>)", "mouse (mus <genus>)", "mus <genus> (mice (mus <genus>))", "mice (mus sp.) (mus sp.)", "eastern european house mouse (mus musculus musculus)", "mus musculus musculus (eastern european house mouse)", "western european house mouse (mus musculus domesticus)", "mus sp. ...
Given the context 'Cardiac myocytes express relatively high levels of M6P/IGF2R and transgenic mice containing a homologous deletion of the M6P/IGF2R gene manifest ventricular hyperplasia due to an increase in cell number [9,10], suggesting that the M6P/IGF2R normally acts to suppress cardiac myocyte cell growth.', answer the user's query.
What is the biomedical concept corresponding to 'rat'?
[ "rat (rattus norvegicus) (rattus norvegicus)", "rattus norvegicus (rats (rattus norvegicus))", "rats (rattus norvegicus) (rattus norvegicus)" ]
[ "rats (rattus) (rattus)", "rat (rattus) (rattus)", "rattus (rats (rattus))", "rats (rattus sp.) (rattus sp.)", "house rat (rattus rattus)", "rattus rattoides (rattus rattus)", "rattus sp. (rats (rattus sp.))", "mus rattus (rattus rattus)", "black rat (rattus rattus)", "roof rat (rattus rattus)" ]
Given the context 'Adenoviral delivery of ribozymes increases the proliferation of cardiac myocytes We examined the effects of the ribozyme on the growth of cultured neonatal rat cardiac myocytes.', answer the user's query.
What is the biomedical concept corresponding to 'mice'?
[ "mouse (mus musculus)", "house mouse (mus musculus)", "mus musculus (house mouse)" ]
[ "mice (mus <genus>) (mus <genus>)", "mouse (mus <genus>)", "mus <genus> (mice (mus <genus>))", "mice (mus sp.) (mus sp.)", "eastern european house mouse (mus musculus musculus)", "mus musculus musculus (eastern european house mouse)", "western european house mouse (mus musculus domesticus)", "mus sp. ...
Given the context 'Supporting evidence for the involvement of IGF-II in the proliferative effect resulting from loss of M6P/IGF2R function comes from studies of M6P/IGF2R knock-out mice.', answer the user's query.
What is the biomedical concept corresponding to 'mice'?
[ "mouse (mus musculus)", "house mouse (mus musculus)", "mus musculus (house mouse)" ]
[ "mice (mus <genus>) (mus <genus>)", "mouse (mus <genus>)", "mus <genus> (mice (mus <genus>))", "mice (mus sp.) (mus sp.)", "eastern european house mouse (mus musculus musculus)", "mus musculus musculus (eastern european house mouse)", "western european house mouse (mus musculus domesticus)", "mus sp. ...
Given the context 'M6P/IGF2R-null mice display global hyperplasia that coincides with elevated levels of IGF-II.', answer the user's query.
What is the biomedical concept corresponding to 'rat'?
[ "rat (rattus norvegicus) (rattus norvegicus)", "rattus norvegicus (rats (rattus norvegicus))", "rats (rattus norvegicus) (rattus norvegicus)" ]
[ "rats (rattus) (rattus)", "rat (rattus) (rattus)", "rattus (rats (rattus))", "rats (rattus sp.) (rattus sp.)", "house rat (rattus rattus)", "rattus rattoides (rattus rattus)", "rattus sp. (rats (rattus sp.))", "mus rattus (rattus rattus)", "black rat (rattus rattus)", "roof rat (rattus rattus)" ]
Given the context 'The nucleotide numbers of the rat M6P/IGF2R sequence targeted by the hammerhead ribozyme is 1147–1160 after coding site (exon 9).', answer the user's query.