text
stringlengths
181
608k
id
stringlengths
47
47
dump
stringclasses
3 values
url
stringlengths
13
2.97k
file_path
stringlengths
125
140
language
stringclasses
1 value
language_score
float64
0.65
1
token_count
int64
50
138k
score
float64
1.5
5
int_score
int64
2
5
Whether you live in the “bowl area” of Edmonds or in the neighborhoods just above known as the “rim,” you must at one time or another have heard about the Edmonds Marsh. Edmonds has a precious commodity, as this estuary is one of the very few still in existence within urbanized areas along Puget Sound. As you can see from the time lapse photography here, the Edmonds Marsh was once quite larger and occupied nearly 40 acres downtown. Today, the Edmonds Marsh is at 22 1/2 acres and owned by the City of Edmonds. The Port of Edmonds-owned property — the Harbor Square business complex — sits next to this precious place, which hosts 225 species of birds during the course of a year. Feeling curious to check this place out? Head on over to the Harbor Square area and locate the interpretative walkway and 300 feet of boardwalk for your viewing pleasure. Recently, I interviewed a few local folks who are very involved with the history and the future of the Edmonds Marsh. I learned from Sally Lider, City of Edmonds environmental coordinator, that the City of Edmonds obtained the Edmonds Marsh as a quit claim deed from Unocal — hence its former name, the Union Oil Marsh, on Nov. 17, 1981. Rich Lindsay, the City of Edmonds parks manager, explained to me that the walkway and interpretative signage have all been funded over the years by various grants, the Port of Edmonds and Unocal (now called Chevron). Lindsay went on to tell me that over the years various groups have been involved in clean-ups and invasive plant removals within the Marsh including the Faith Community Church and People for Puget Sound (PFPS) volunteers. “While the City of Edmonds Parks Department crews clean walkways along the Marsh twice a month and trim the vegetation that grows into the pathways and boardwalks there is still volunteer work and restoration that needs to be done,” Lindsay explained. Most of the restoration issues mainly involve invasive weeds living within our Marsh, including Purple Loosestrife, Japanese Knotweed and Giant Hogweed, Lindsay stated. This is where Keeley O’Connell, our local resident and restoration team lead for People for Puget Sound comes in. O’Connell, a restoration ecologist for PFPS, was first contracted in 2008 through the Maureen Norberry Foundation. This foundation, which is headed by Maureen Norberry (a PFPS member at the time), was concerned about the Edmonds Marsh possibly being affected by the planned Edmonds Crossing Project. (Edmonds Crossing, which would have involved relocating the Edmonds ferry terminal south of the existing site, is currently on hold.) The foundation paid PFPS to do a study that would look at social perceptions of the Marsh and the possible impact that ferry traffic would have on it. The study results included a conceptual design of restorative actions that the City of Edmonds could take such as a better boardwalk system to better connect residents to the Marsh. O’Connell involved her Sound Stewards program to work with the City to transform the landscape around the Marsh to better support wildlife habitat needs. O’Connell and a few other Edmonds residents formed a “Friends of the Edmonds Marsh” group in 2009. The group’s mission is to expand and restore functional estuarine habitat within the Edmonds Marsh and protect the remaining wildlife habitat by engaging the community to preserve, steward and enjoy this natural asset. To learn more about the Friends of the Edmonds Marsh’s vision, goals and rational, visit their Facebook page. “There is still more work to be done around the Marsh and vegetative buffers to be built,” said O’Connell, who credits the work of local resident Sean Madden, a concerned citizen who took it upon himself to research all the vegetation existing within the Edmonds Marsh and its local wildlife. Madden designed a planting plan that would benefit wildlife and native vegetation needs within the Marsh. O’Connell also mentioned that without the sincere partnership of the City of Edmonds Parks Department, whose crews tirelessly pick up the many bags of plant debris and even large metal objects found within the Marsh, this restoration project couldn’t happen. O’Connell recently applied for and received a “Restore America’s Estuaries” grant through the National Oceanic and Atmospheric Administration, which she has already started to use create two upcoming stream side landowners workshops in May 2012 for residents who live on Shell, Willow or Shelbarger creeks, which flow into the Edmonds Marsh. Thanks to O’Connell’s organization, People for Puget Sound, and their new Eco-Techs Internship Program, the Edmonds Marsh has a team of folks monitoring its current heron colony for the Washington State Department of Fish and Wildlife in 2012-2013. Stay tuned for part two of this series, where we look into what restoration efforts are happening today at the Edmonds Marsh and what the new development at Harbor Square and the Port has planned for the Marsh. Laura Spehar is a Montessori teacher and environmental educator, and was named Edmonds’ Citizen of the Year in 2011. She is a WSU Master Gardener, Beach Watcher and Carbon Master, and holds certifications in wildlife habitat and native plant stewardships. Spehar serves on the Snohomish Conservation District’s Advisory Board, Pilchuck Audubon Society Board, Friends of the Edmonds Library Board, and the City of Edmonds Mayor’s Climate Action Committee Board and Tree Board. She was awarded the National Wildlife Federation’s National Conservation Service Award in 2010. Spehar lives in Edmonds with her husband Paul and their two dogs Goldie and Happy on two acres of well-loved and protected wetland/stream side habitat.
<urn:uuid:9279c6b1-69f8-4863-8001-3b9d1540f3e0>
CC-MAIN-2017-04
http://myedmondsnews.com/2012/04/the-environmental-advocate-a-hidden-jewel-among-the-cattails-the-edmonds-marsh/
s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560279650.31/warc/CC-MAIN-20170116095119-00437-ip-10-171-10-70.ec2.internal.warc.gz
en
0.957414
1,220
2.3125
2
One of the frequently asked questions we get about buying from Resin Obsession is why there are shipping restrictions on certain items. These items are considered a ‘hazardous material’ product and must be shipped according to very stringent guidelines. What is different about shipping a hazardous material product? Certain items we carry are designated as ORM-D products. Specifically, this means that it is a hazardous material that can be shipped in small quantities using a shipping service such as the post office or other commercial carrier such as UPS or FedEx. In order for us to ship large quantities, we would have to have a hazardous materials shipping license and include paperwork with every shipment. Businesses can get an exemption on shipping these products without a license and paperwork if they only ship small amounts at a time and go through the proper training. How are these items shipped? When shipping these items, we have to label them with a blue ORM-D sticker plus any additional recommendations, such as ‘up’ arrow stickers, on the outside of the package. These items can also only ship by ground methods, meaning it cannot travel by plane. The ground shipping methods we offer are USPS parcel post and UPS ground shipping. When using parcel post, in addition to using the ORM-D sticker, we also have to mark on the outside ‘surface shipping only’ to ensure that the package is not put on a plane. Why can’t these products ship by air? Since aerosol cans are packaged under pressure, they may expand or contract during flight and can explode. For the non-aerosol items, it is dependent on other factors, such as flash point of the item or whether or not it is considered corrosive. (Flash point is the temperature at which a substance may become volatile and explode.) Why can’t the aerosol cans ship by USPS? The post office will not ship any package containing an aerosol can, even if it is labeled as parcel post surface shipping only.
<urn:uuid:8a2686ac-a236-4691-a161-d48e78aebfb6>
CC-MAIN-2017-04
https://www.resinobsession.com/resin-frequently-asked-questions/why-are-there-shipping-restrictions-on-certain-resin-and-resin-items
s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560280310.48/warc/CC-MAIN-20170116095120-00183-ip-10-171-10-70.ec2.internal.warc.gz
en
0.95648
412
1.78125
2
Gratitude is at the very heart of St Ignatius’ Spiritual Exercises: it re-calibrates our relationship with God. Practicing gratitude reminds us that, at the deepest level, all is a loving gift, and that the proper response to receiving that gift is to give it to others. As we enter into this busy social season, may we be surprised when we reflect on what God has been doing in our lives, and may He help us respond with even greater generosity, especially to the needy and neglected of the world. Rev. Dorian Llywelyn, S.J.
<urn:uuid:cb739395-44f4-4d1f-b53d-dbc5989cdf37>
CC-MAIN-2022-33
https://www.scu.edu/ic/enews/newsletters/november-2017-news/
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882573193.35/warc/CC-MAIN-20220818094131-20220818124131-00470.warc.gz
en
0.963919
129
1.617188
2
Reprinted with permission from Creators. Another black boy was killed by police, this time in Texas. His name was Jordan Edwards. Jordan was 15, a “model student,” a “popular football player” and “a kid that did everything right.” He was a freshman at Mesquite High School, in a suburb east of Dallas. In a recorded message to the school community, principal Kevin Samples described Jordan as “a good student who was very well-liked by his teachers, coaches and his fellow students.” Samples added that the “entire district — especially the staff and students of Mesquite High School — are mourning this terrible loss.” Head football coach Jeff Fleener posted on social media: “Nothing can prepare you for a day like today. … I have felt a range of emotions from extreme sadness, sick to my stomach, anger, questioning, and simply asking, ‘Why?’ My faith tells me that only God can tell me why, but that answer will come in His time. But knowing Jordan, his huge heart, his big smile, and his constant, positivity, God is putting him to work.” I wanted to start with these details about Jordan, because how else can we even try to comprehend his loss? I am writing from the city of Cleveland, where less than three years ago, another black boy, 12-year-old Tamir Rice, was shot and killed by police. If I learned anything from the immediate coverage after his death, it’s that we must emphasize early that this boy — this black boy — did not deserve to die. Jordan Edwards spent his last conscious moments in a car driven by his 16-year-old brother in another Dallas suburb. As has been subsequently reported, the teens in the car — Jordan, his two brothers and two friends — had no weapons, and they were not drunk. None of them has been charged with any crime. At first, Balch Springs Police Department Chief Jonathan Haber claimed that one of his officers, later identified as Roy Oliver, fired at the teens’ car because it was backing down the street in an “aggressive manner” toward officers called to break up a teen party. Hours later, the police chief walked that story back, saying body camera footage showed the car driving away when the officer raised his rifle and began shooting. “After reviewing the video,” Haber said, “I don’t believe that (the shooting) met our core values.” The Dallas County medical examiner has ruled Jordan’s death a homicide. Cause of death: rifle wound to the head. The police officer has been fired. We await further news about what happens next. Meanwhile, Jordan Edwards’ family is not the family it used to be, before Jordan was shot in the head. “This entire ordeal has been inescapable,” family members said in a statement released through their lawyer. They described Jordan as a “loving child, with a humble and sharing spirit,” sharing a bond with his siblings that was “indescribable.” His brothers, the family continued, will never be the same. “Not only have Jordan’s brothers lost their best friend; they witnessed firsthand his violent, senseless, murder. Their young lives will forever be altered. No one, let alone young children, should witness such horrific, unexplainable violence.” We too often fail to mention this, let alone dwell on it, when children are killed. Family members — parents and grandparents, siblings and cousins, aunts and uncles — all of them are shattered in their own ways, none of which we want to imagine. Jordan Edwards’ family is asking that we try. It is the very least we can do. Our discomfort is irrelevant. The Washington Post editorial board asks, “Will this latest, utterly needless death of a young African American male make ‘Black Lives Matter’ more than a hashtag by spurring needed police reforms?” As the Post reported, about 25 percent of the 330 people shot and killed this year by police were black, and 7 percent of them were unarmed. If you think Black Lives Matter is only a hashtag, get off Twitter and start talking to the families in our communities — emphasis on “our” — who worry every day that the black sons they kiss goodbye in the morning will be dead by midnight. We’d rather not think about that, either. Connie Schultz is a Pulitzer Prize-winning columnist and professional in residence at Kent State University’s school of journalism. She is the author of two books, including “…and His Lovely Wife,” which chronicled the successful race of her husband, Sherrod Brown, for the U.S. Senate. To find out more about Connie Schultz (firstname.lastname@example.org) and read her past columns, please visit the Creators Syndicate webpage at www.creators.com.
<urn:uuid:1ecc15aa-4be8-43d1-aba0-aa197a9d4c66>
CC-MAIN-2022-33
https://www.nationalmemo.com/name-jordan-edwards
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882570868.47/warc/CC-MAIN-20220808152744-20220808182744-00072.warc.gz
en
0.980107
1,063
1.65625
2
(For more resources related to this topic, see here.) In 2013, there were almost as many mobile cellular subscriptions as there were people on earth, says International Telecommunication Union (ITU). The following figure shows the global mobile cellular subscriptions from 2005 to 2013. Mobile cellular subscriptions are moving at lightning speed and passed a whopping 7 billion early in 2014. Portio Research Ltd. predicts that mobile subscribers will reach 7.5 billion by the end of 2014 and 8.5 billion by the end of 2016. Mobile cellular subscription growth from 2005 to 2013 Smartphones of today, such as the Apple iPhone, Samsung Galaxy series, and BlackBerry phones, are compact forms of computers with high performance, huge storage, and enhanced functionalities. Mobile phones are the most personal electronic device a user accesses. They are used to perform simple communication tasks, such as calling and texting, while still providing support for Internet browsing, e-mail, taking photos and videos, creating and storing documents, identifying locations with GPS services, and managing business tasks. As new features and applications are incorporated into mobile phones, the amount of information stored on the devices is continuously growing. Mobiles phones become portable data carriers, and they keep track of all your moves. With the increasing prevalence of mobile phones in peoples' daily lives and in crime, data acquired from phones become an invaluable source of evidence for investigations relating to criminal, civil, and even high-profile cases. It is rare to conduct a digital forensic investigation that does not include a phone. Mobile device call logs and GPS data were used to help solve the attempted bombing in Times Square, New York, in 2010. The details of the case can be found at http://www.forensicon.com/forensics-blotter/cell-phone-email-forensics-investigation-cracks-nyc-times-square-car-bombing-case/. The science behind recovering digital evidence from mobile phones is called mobile forensics. Digital evidence is defined as information and data that is stored on, received, or transmitted by an electronic device that is used for investigations. Digital evidence encompasses any and all digital data that can be used as evidence in a case. Digital forensics is a branch of forensic science, focusing on the recovery and investigation of raw data residing in electronic or digital devices. Mobile forensics is a branch of digital forensics related to the recovery of digital evidence from mobile devices. Forensically sound is a term used extensively in the digital forensics community to qualify and justify the use of particular forensic technology or methodology. The main principle for a sound forensic examination of digital evidence is that the original evidence must not be modified. This is extremely difficult with mobile devices. Some forensic tools require a communication vector with the mobile device, thus standard write protection will not work during forensic acquisition. Other forensic acquisition methods may involve removing a chip or installing a bootloader on the mobile device prior to extracting data for forensic examination. In cases where the examination or data acquisition is not possible without changing the configuration of the device, the procedure and the changes must be tested, validated, and documented. Following proper methodology and guidelines is crucial in examining mobile devices as it yields the most valuable data. As with any evidence gathering, not following the proper procedure during the examination can result in loss or damage of evidence or render it inadmissible in court. The mobile forensics process is broken into three main categories: seizure, acquisition, and examination/analysis. Forensic examiners face some challenges while seizing the mobile device as a source of evidence. At the crime scene, if the mobile device is found switched off, the examiner should place the device in a faraday bag to prevent changes should the device automatically power on. Faraday bags are specifically designed to isolate the phone from the network. If the phone is found switched on, switching it off has a lot of concerns attached to it. If the phone is locked by a PIN or password or encrypted, the examiner will be required to bypass the lock or determine the PIN to access the device. Mobile phones are networked devices and can send and receive data through different sources, such as telecommunication systems, Wi-Fi access points, and Bluetooth. So if the phone is in a running state, a criminal can securely erase the data stored on the phone by executing a remote wipe command. When a phone is switched on, it should be placed in a faraday bag. If possible, prior to placing the mobile device in the faraday bag, disconnect it from the network to protect the evidence by enabling the flight mode and disabling all network connections (Wi-Fi, GPS, Hotspots, and so on). This will also preserve the battery, which will drain while in a faraday bag and protect against leaks in the faraday bag. Once the mobile device is seized properly, the examiner may need several forensic tools to acquire and analyze the data stored on the phone. Mobile device forensic acquisition can be performed using multiple methods, which are defined later. Each of these methods affects the amount of analysis required. Should one method fail, another must be attempted. Multiple attempts and tools may be necessary in order to acquire the most data from the mobile device. Mobile phones are dynamic systems that present a lot of challenges to the examiner in extracting and analyzing digital evidence. The rapid increase in the number of different kinds of mobile phones from different manufacturers makes it difficult to develop a single process or tool to examine all types of devices. Mobile phones are continuously evolving as existing technologies progress and new technologies are introduced. Furthermore, each mobile is designed with a variety of embedded operating systems. Hence, special knowledge and skills are required from forensic experts to acquire and analyze the devices. Mobile forensic challenges One of the biggest forensic challenges when it comes to the mobile platform is the fact that data can be accessed, stored, and synchronized across multiple devices. As the data is volatile and can be quickly transformed or deleted remotely, more effort is required for the preservation of this data. Mobile forensics is different from computer forensics and presents unique challenges to forensic examiners. Law enforcement and forensic examiners often struggle to obtain digital evidence from mobile devices. The following are some of the reasons: Hardware differences: The market is flooded with different models of mobile phones from different manufacturers. Forensic examiners may come across different types of mobile models, which differ in size, hardware, features, and operating system. Also, with a short product development cycle, new models emerge very frequently. As the mobile landscape is changing each passing day, it is critical for the examiner to adapt to all the challenges and remain updated on mobile device forensic techniques. Mobile operating systems: Unlike personal computers where Windows has dominated the market for years, mobile devices widely use more operating systems, including Apple's iOS, Google's Android, RIM's BlackBerry OS, Microsoft's Windows Mobile, HP's webOS, Nokia's Symbian OS, and many others. Mobile platform security features: Modern mobile platforms contain built-in security features to protect user data and privacy. These features act as a hurdle during the forensic acquisition and examination. For example, modern mobile devices come with default encryption mechanisms from the hardware layer to the software layer. The examiner might need to break through these encryption mechanisms to extract data from the devices. Lack of resources: As mentioned earlier, with the growing number of mobile phones, the tools required by a forensic examiner would also increase. Forensic acquisition accessories, such as USB cables, batteries, and chargers for different mobile phones, have to be maintained in order to acquire those devices. Generic state of the device: Even if a device appears to be in an off state, background processes may still run. For example, in most mobiles, the alarm clock still works even when the phone is switched off. A sudden transition from one state to another may result in the loss or modification of data. Anti-forensic techniques: Anti-forensic techniques, such as data hiding, data obfuscation, data forgery, and secure wiping, make investigations on digital media more difficult. Dynamic nature of evidence: Digital evidence may be easily altered either intentionally or unintentionally. For example, browsing an application on the phone might alter the data stored by that application on the device. Accidental reset: Mobile phones provide features to reset everything. Resetting the device accidentally while examining may result in the loss of data. Device alteration: The possible ways to alter devices may range from moving application data, renaming files, and modifying the manufacturer's operating system. In this case, the expertise of the suspect should be taken into account. Passcode recovery: If the device is protected with a passcode, the forensic examiner needs to gain access to the device without damaging the data on the device. Communication shielding: Mobile devices communicate over cellular networks, Wi-Fi networks, Bluetooth, and Infrared. As device communication might alter the device data, the possibility of further communication should be eliminated after seizing the device. Lack of availability of tools: There is a wide range of mobile devices. A single tool may not support all the devices or perform all the necessary functions, so a combination of tools needs to be used. Choosing the right tool for a particular phone might be difficult. Malicious programs: The device might contain malicious software or malware, such as a virus or a Trojan. Such malicious programs may attempt to spread over other devices over either a wired interface or a wireless one. Legal issues: Mobile devices might be involved in crimes, which can cross geographical boundaries. In order to tackle these multijurisdictional issues, the forensic examiner should be aware of the nature of the crime and the regional laws. Mobile phone evidence extraction process Evidence extraction and forensic examination of each mobile device may differ. However, following a consistent examination process will assist the forensic examiner to ensure that the evidence extracted from each phone is well documented and that the results are repeatable and defendable. There is no well-established standard process for mobile forensics. However, the following figure provides an overview of process considerations for extraction of evidence from mobile devices. All methods used when extracting data from mobile devices should be tested, validated, and well documented. A great resource for handling and processing mobile devices can be found at http://digital-forensics.sans.org/media/mobile-device-forensic-process-v3.pdf. Mobile phone evidence extraction process The evidence intake phase The evidence intake phase is the starting phase and entails request forms and paperwork to document ownership information and the type of incident the mobile device was involved in, and outlines the type of data or information the requester is seeking. Developing specific objectives for each examination is the critical part of this phase. It serves to clarify the examiner's goals. The identification phase The forensic examiner should identify the following details for every examination of a mobile device: The legal authority The goals of the examination The make, model, and identifying information for the device Removable and external data storage Other sources of potential evidence We will discuss each of them in the following sections. The legal authority It is important for the forensic examiner to determine and document what legal authority exists for the acquisition and examination of the device as well as any limitations placed on the media prior to the examination of the device. The goals of the examination The examiner will identify how in-depth the examination needs to be based upon the data requested. The goal of the examination makes a significant difference in selecting the tools and techniques to examine the phone and increases the efficiency of the examination process. The make, model, and identifying information for the device As part of the examination, identifying the make and model of the phone assists in determining what tools would work with the phone. Removable and external data storage Many mobile phones provide an option to extend the memory with removable storage devices, such as the Trans Flash Micro SD memory expansion card. In cases when such a card is found in a mobile phone that is submitted for examination, the card should be removed and processed using traditional digital forensic techniques. It is wise to also acquire the card while in the mobile device to ensure data stored on both the handset memory and card are linked for easier analysis. Other sources of potential evidence Mobile phones act as good sources of fingerprint and other biological evidence. Such evidence should be collected prior to the examination of the mobile phone to avoid contamination issues unless the collection method will damage the device. Examiners should wear gloves when handling the evidence. The preparation phase Once the mobile phone model is identified, the preparation phase involves research regarding the particular mobile phone to be examined and the appropriate methods and tools to be used for acquisition and examination. The isolation phase Mobile phones are by design intended to communicate via cellular phone networks, Bluetooth, Infrared, and wireless (Wi-Fi) network capabilities. When the phone is connected to a network, new data is added to the phone through incoming calls, messages, and application data, which modifies the evidence on the phone. Complete destruction of data is also possible through remote access or remote wiping commands. For this reason, isolation of the device from communication sources is important prior to the acquisition and examination of the device. Isolation of the phone can be accomplished through the use of faraday bags, which block the radio signals to or from the phone. Past research has found inconsistencies in total communication protection with faraday bags. Therefore, network isolation is advisable. This can be done by placing the phone in radio frequency shielding cloth and then placing the phone into airplane or flight mode. The processing phase Once the phone has been isolated from the communication networks, the actual processing of the mobile phone begins. The phone should be acquired using a tested method that is repeatable and is as forensically sound as possible. Physical acquisition is the preferred method as it extracts the raw memory data and the device is commonly powered off during the acquisition process. On most devices, the least amount of changes occur to the device during physical acquisition. If physical acquisition is not possible or fails, an attempt should be made to acquire the file system of the mobile device. A logical acquisition should always be obtained as it may contain only the parsed data and provide pointers to examine the raw memory image. The verification phase After processing the phone, the examiner needs to verify the accuracy of the data extracted from the phone to ensure that data is not modified. The verification of the extracted data can be accomplished in several ways. Comparing extracted data to the handset data Check if the data extracted from the device matches the data displayed by the device. The data extracted can be compared to the device itself or a logical report, whichever is preferred. Remember, handling the original device may make changes to the only evidence—the device itself. Using multiple tools and comparing the results To ensure accuracy, use multiple tools to extract the data and compare results. Using hash values All image files should be hashed after acquisition to ensure data remains unchanged. If file system extraction is supported, the examiner extracts the file system and then computes hashes for the extracted files. Later, any individually extracted file hash is calculated and checked against the original value to verify the integrity of it. Any discrepancy in a hash value must be explainable (for example, if the device was powered on and then acquired again, thus the hash values are different). The document and reporting phase The forensic examiner is required to document throughout the examination process in the form of contemporaneous notes relating to what was done during the acquisition and examination. Once the examiner completes the investigation, the results must go through some form of peer-review to ensure the data is checked and the investigation is complete. The examiner's notes and documentation may include information such as the following: Examination start date and time The physical condition of the phone Photos of the phone and individual components Phone status when received—turned on or off Phone make and model Tools used for the acquisition Tools used for the examination Data found during the examination Notes from peer-review The presentation phase Throughout the investigation, it is important to make sure that the information extracted and documented from a mobile device can be clearly presented to any other examiner or to a court. Creating a forensic report of data extracted from the mobile device during acquisition and analysis is important. This may include data in both paper and electronic formats. Your findings must be documented and presented in a manner that the evidence speaks for itself when in court. The findings should be clear, concise, and repeatable. Timeline and link analysis, features offered by many commercial mobile forensics tools, will aid in reporting and explaining findings across multiple mobile devices. These tools allow the examiner to tie together the methods behind the communication of multiple devices. The archiving phase Preserving the data extracted from the mobile phone is an important part of the overall process. It is also important that the data is retained in a useable format for the ongoing court process, for future reference, should the current evidence file become corrupt, and for record keeping requirements. Court cases may continue for many years before the final judgment is arrived at, and most jurisdictions require that data be retained for long periods of time for the purposes of appeals. As the field and methods advance, new methods for pulling data out of a raw, physical image may surface, and then the examiner can revisit the data by pulling a copy from the archives. Practical mobile forensic approaches Similar to any forensic investigation, there are several approaches that can be used for the acquisition and examination/analysis of data from mobile phones. The type of mobile device, the operating system, and the security setting generally dictate the procedure to be followed in a forensic process. Every investigation is distinct with its own circumstances, so it is not possible to design a single definitive procedural approach for all the cases. The following details outline the general approaches followed in extracting data from mobile devices. Mobile operating systems overview One of the major factors in the data acquisition and examination/analysis of a mobile phone is the operating system. Starting from low-end mobile phones to smartphones, mobile operating systems have come a long way with a lot of features. Mobile operating systems directly affect how the examiner can access the mobile device. For example, Android OS gives terminal-level access whereas iOS does not give such an option. A comprehensive understanding of the mobile platform helps the forensic examiner make sound forensic decisions and conduct a conclusive investigation. While there is a large range of smart mobile devices, four main operating systems dominate the market, namely, Google Android, Apple iOS, RIM BlackBerry OS, and Windows Phone. More information can be found at http://www.idc.com/getdoc.jsp?containerId=prUS23946013. Android is a Linux-based operating system, and it's a Google open source platform for mobile phones. Android is the world's most widely used smartphone operating system. Sources show that Apple's iOS is a close second (http://www.forbes.com/sites/tonybradley/2013/11/15/android-dominates-market-share-but-apple-makes-all-the-money/). Android has been developed by Google as an open and free option for hardware manufacturers and phone carriers. This makes Android the software of choice for companies who require a low-cost, customizable, lightweight operating system for their smart devices without developing a new OS from scratch. Android's open nature has further encouraged the developers to build a large number of applications and upload them onto Android Market. Later, end users can download the application from Android Market, which makes Android a powerful operating system. iOS, formerly known as the iPhone operating system, is a mobile operating system developed and distributed solely by Apple Inc. iOS is evolving into a universal operating system for all Apple mobile devices, such as iPad, iPod touch, and iPhone. iOS is derived from OS X, with which it shares the Darwin foundation, and is therefore a Unix-like operating system. iOS manages the device hardware and provides the technologies required to implement native applications. iOS also ships with various system applications, such as Mail and Safari, which provide standard system services to the user. iOS native applications are distributed through AppStore, which is closely monitored by Apple. Windows phone is a proprietary mobile operating system developed by Microsoft for smartphones and pocket PCs. It is the successor to Windows mobile and primarily aimed at the consumer market rather than the enterprise market. The Windows Phone OS is similar to the Windows desktop OS, but it is optimized for devices with a small amount of storage. BlackBerry OS is a proprietary mobile operating system developed by BlackBerry Ltd., known as Research in Motion (RIM), exclusively for its BlackBerry line of smartphones and mobile devices. BlackBerry mobiles are widely used in corporate companies and offer native support for corporate mail via MIDP, which enables wireless sync with Microsoft Exchange, e-mail, contacts, calendar, and so on, while used along with the BlackBerry Enterprise server. These devices are known for their security. Mobile forensic tool leveling system Mobile phone forensic acquisition and analysis involves manual effort and the use of automated tools. There are a variety of tools that are available for performing mobile forensics. All the tools have their pros and cons, and it is fundamental that you understand that no single tool is sufficient for all purposes. So understanding the various types of mobile forensic tools is important for forensic examiners. When identifying the appropriate tools for the forensic acquisition and analysis of mobile phones, a mobile device forensic tool classification system (shown in the following figure) developed by Sam Brothers comes in handy for the examiners. Cellular phone tool leveling pyramid (Sam Brothers, 2009) The objective of the mobile device forensic tool classification system is to enable an examiner to categorize the forensic tools based upon the examination methodology of the tool. Starting at the bottom of the classification and working upward, the methods and the tools generally become more technical, complex, and forensically sound, and require longer analysis times. There are pros and cons of performing an analysis at each layer. The forensic examiner should be aware of these issues and should only proceed with the level of extraction that is required. Evidence can be destroyed completely if the given method or tool is not properly utilized. This risk increases as you move up in the pyramid. Thus, proper training is required to obtain the highest success rate in data extraction from mobile devices. Each existing mobile forensic tool can be classified under one or more of the five levels. The following sections contain a detailed description of each level. This method involves simply scrolling through the data on the device and viewing the data on the phone directly through the use of the device's keypad or touchscreen. The information discovered is then photographically documented. The extraction process is fast and easy to use, and will work on almost every phone. This method is prone to human error, such as missing certain data due to unfamiliarity with the interface. At this level, it is not possible to recover deleted information and grab all the data. There are some tools that have been developed to aid an examiner to easily document a manual extraction. Logical extraction involves connecting the mobile device to forensic hardware or to a forensic workstation via a USB cable, RJ-45 cable, Infrared, or Bluetooth. Once connected, the computer initiates a command and sends it to the device, which is then interpreted by the device processor. Next, the requested data is received from the device's memory and sent back to the forensic workstation. Later, the examiner can review the data. Most of the forensic tools currently available work at this level of the classification system. The extraction process is fast, easy to use, and requires little training for the examiners. On the flip side, the process may write data to the mobile and might change the integrity of the evidence. In addition, deleted data is almost never accessible. A hex dump, also referred to as a physical extraction, is achieved by connecting the device to the forensic workstation and pushing unsigned code or a bootloader into the phone and instructing the phone to dump memory from the phone to the computer. Since the resulting raw image is in binary format, technical expertise is required to analyze it. The process is inexpensive, provides more data to the examiner, and allows the recovering of the deleted files from the device-unallocated space on most devices. Chip-off refers to the acquisition of data directly from the device's memory chip. At this level, the chip is physically removed from the device and a chip reader or a second phone is used to extract data stored on it. This method is more technically challenging as a wide variety of chip types are used in mobiles. The process is expensive and requires hardware level knowledge as it involves the de-soldering and heating of the memory chip. Training is required to successfully perform a chip-off extraction. Improper procedures may damage the memory chip and render all data unsalvageable. When possible, it is recommended that the other levels of extraction are attempted prior to chip-off since this method is destructive in nature. Also, the information that comes out of memory is in a raw format and has to be parsed, decoded, and interpreted. The chip-off method is preferred in situations where it is important to preserve the state of memory exactly as it exists on the device. It is also the only option when a device is damaged but the memory chip is intact. The chips on the device are often read using the Joint Test Action Group (JTAG) method. The JTAG method involves connecting to Test Access Ports (TAPs) on a device and instructing the processor to transfer the raw data stored on memory chips. The JTAG method is generally used with devices that are operational but inaccessible using standard tools. The process involves manually viewing and interpreting data seen on the memory chip. The examiner uses an electron microscope and analyzes the physical gates on the chip and then translates the gate status to 0's and 1's to determine the resulting ASCII characters. The whole process is time consuming and costly, and it requires extensive knowledge and training on flash memory and the file system. Due to the extreme technicalities involved in micro read, it would be only attempted for high profile cases equivalent to a national security crisis after all other level extraction techniques have been exhausted. The process is rarely performed and is not well documented at this time. Also, there are currently no commercial tools available to perform a micro read. Data acquisition methods Data acquisition is the process of imaging or otherwise extracting information from a digital device and its peripheral equipment and media. Acquiring data from a mobile phone is not as simple as a standard hard drive forensic acquisition. The following points break down the three types of forensic acquisition methods for mobile phones: physical, logical, and manual. These methods may have some overlap with a couple of levels discussed in the mobile forensics tool leveling system. The amount and type of data that can be collected will vary depending on the type of acquisition method being used. Physical acquisition of mobile phones is performed using mobile forensic tools and methods. Physical extraction acquires information from the device by direct access to the flash memory. The process creates a bit-for-bit copy of an entire file system, similar to the approach taken in computer forensic investigations. A physical acquisition is able to acquire all of the data present on a device including the deleted data and access to unallocated space on most devices. Logical acquisition of mobile phones is performed using the device manufacturer application-programming interface for synchronizing the phones contents with a computer. Many of the forensic tools perform a logical acquisition. However, the forensic analyst must understand how the acquisition occurs and whether the mobile is modified in any way during the process. Depending on the phone and forensic tools used, all or some of the data is acquired. A logical acquisition is easy to perform and only recovers the files on a mobile phone and does not recover data contained in unallocated space. With mobile phones, physical acquisition is usually the best option, and logical acquisition is the second-best option. Manual extraction should be the last option when performing the forensic acquisition of a mobile phone. Both logical and manual acquisition can be used to validate findings in the physical data. During manual acquisition, the examiner utilizes the user interface to investigate the contents of the phone's memory. The device is used normally through a keypad or touchscreen and menu navigation, and the examiner takes pictures of each screen's contents. Manual extraction introduces a greater degree of risk in the form of human error, and there is a chance of deleting the evidence. Manual acquisition is easy to perform and only acquires the data that appears on a mobile phone. Potential evidence stored on mobile phones The range of information that can be obtained from mobile phones is detailed in this section. Data on a mobile phone can be found in a number of locations: SIM card, external storage card, and phone memory. In addition, the service provider also stores communication-related information. The article primarily focuses on data acquired from the phone memory. Mobile device data extraction tools recover data from the phone's memory. Even though data recovered during a forensic acquisition depends on the mobile model, in general, the data in the next set of bullet items is common across all models and useful as evidence. Note that most of the following artifacts contain date and time stamps: Address Book: This stores contact names, numbers, e-mail addresses, and so on Call History: This contains dialed, received, missed calls, and call durations SMS: This contains sent and received text messages MMS: This contains media files such as sent and received photos and videos E-mail: This contains sent, drafted, and received e-mail messages Web browser history: This contains the history of websites that were visited Photos: This contains pictures that are captured using the mobile phone camera, those downloaded from the Internet, and the ones transferred from other devices Videos: This contains videos that are captured using the mobile camera, those downloaded from the Internet, and the ones transferred from other devices Music: This contains music files downloaded from the Internet and those transferred from other devices Documents: This contains documents created using the device's applications, those downloaded from the Internet, and the ones transferred from other devices Calendar: This contains calendar entries and appointments Network communication: This contains GPS locations Maps: This contains looked-up directions, and searched and downloaded maps Social networking data: This contains data stored by applications, such as Facebook, Twitter, LinkedIn, Google+, and WhatsApp Deleted data: This contains information deleted from the phone Rules of evidence Courtrooms rely more and more on the information inside a mobile phone as vital evidence. Prevailing evidence in court requires a good understanding of the rules of evidence. Mobile forensics is a relatively new discipline and laws dictating the validity of evidence are not widely known. However, there are five general rules of evidence that apply to digital forensics and need to be followed in order for evidence to be useful. Ignoring these rules makes evidence inadmissible, and your case could be thrown out. These five rules are—admissible, authentic, complete, reliable, and believable. This is the most basic rule and a measure of evidence validity and importance. The evidence must be preserved and gathered in such a way that it can be used in court or elsewhere. Many errors can be made that could cause a judge to rule a piece of evidence as inadmissible. For example, evidence that is gathered using illegal methods is commonly ruled inadmissible. The evidence must be tied to the incident in a relevant way to prove something. The forensic examiner must be accountable for the origin of the evidence. When evidence is presented, it must be clear and complete and should reflect the whole story. It is not enough to collect evidence that just shows one perspective of the incident. Presenting incomplete evidence is more dangerous than not providing any evidence at all as it could lead to a different judgment. Evidence collected from the device must be reliable. This depends on the tools and methodology used. The techniques used and evidence collected must not cast doubt on the authenticity of the evidence. If the examiner used some techniques that cannot be reproduced, the evidence is not considered unless they were directed to do so. This would include possible destructive methods such as chip-off extraction. A forensic examiner must be able to explain, with clarity and conciseness, what processes they used and the way the integrity of the evidence was preserved. The evidence presented by the examiner must be clear, easy to understand, and believable by jury. Good forensic practices Good forensic practices apply to the collection and preservation of evidence. Following the good forensic practices ensures that evidence will be accepted in a court as being authentic and accurate. Modification of evidence, either intentionally or accidentally, can affect the case. So, understanding the best practices is critical for forensic examiners. Securing the evidence With advanced smartphone features such as Find My iPhone and remote wipes, securing a mobile phone in a way that it cannot be remotely wiped is of great importance. Also, when the phone is powered on and has service, it constantly receives new data. To secure the evidence, use the right equipment and techniques to isolate the phone from all networks. With isolation, the phone is prevented from receiving any new data that would cause active data to be deleted. Preserving the evidence As evidence is collected, it must be preserved in a state that is acceptable in court. Working directly on the original copies of evidence might alter it. So, as soon as you recover a raw disk image or files, create a read-only master copy and duplicate it. In order for evidence to be admissible, there must be a method to verify that the evidence presented is exactly the same as the original collected. This can be accomplished by creating a hash value of the image. After duplicating the raw disk image or files, compute and verify the hash values for the original and the copy to ensure that the integrity of the evidence is maintained. Any changes in hash values should be documented and explainable. All further processing or examination should be performed on copies of the evidence. Any use of the device might alter the information stored on the handset. So, perform only the tasks that are absolutely necessary. Documenting the evidence Be sure to document all the methods and tools that are used to collect and extract the evidence. Detail your notes so that another examiner could reproduce them. Your work must be reproducible; if not, a judge may rule it inadmissible. Documenting all changes It's important to document the entire recovery process, including all the changes made during the acquisition and examination. For example, if the forensic tool used for the data extraction sliced up the disk image to store it, this must be documented. All changes to the mobile device, including power cycling and syncing, should be documented in your case notes. Mobile device forensics includes many approaches and concepts that fall outside of the boundaries of traditional digital forensics. Examiners responsible for mobile devices must understand the different acquisition methods and the complexities of handling the data during analysis. Extracting data from a mobile device is half the battle. The operating system, security features, and type of smartphone will determine the amount of access you have to the data. Resources for Article: - Introducing an Android platform [Article] - New Connectivity APIs – Android Beam [Article] - BlackBerry Enterprise Server 5: MDS Applications [Article]
<urn:uuid:cbb6245c-b71e-402c-97ab-ee7bef6f3959>
CC-MAIN-2017-04
https://www.packtpub.com/books/content/introduction-mobile-forensics
s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560281574.78/warc/CC-MAIN-20170116095121-00016-ip-10-171-10-70.ec2.internal.warc.gz
en
0.931938
7,273
2.625
3
It is estimated that 2.2 billion people around the world have some form of vision impairment, out of which 1 billion could have prevented it or have eye issues that are yet to be addressed In India alone, over 15 million people are blind, and the numbers rise further when considering visual impairments. Population coverage and treatment resources are disproportionately distributed and such inequities should be fully addressed. Additionally, social, economic and demographic factors can reduce an intervention’s success. A large proportion of the “neglected population” (Galambos, 2005; Rao, 2015) constituting people from urban slums or tribal areas, illiterates from socially and economically backward groups, women and children, people with disabilities, migrants and refugees, are at the receiving end of relatively poor health care. Inequity in healthcare can take place at the level of availability, accessibility, and affordability. Costs of Visual Impairment Social determinants based on scheduled castes, scheduled tribes, women and children, religious minorities and the queer community determine the accessibility patterns of healthcare in India. These social inequities are unfair and unjust and reveal the societal make-up of a country. Apart from social determinants, statist interventions also play a significant role in ensuring accessibility of healthcare services. For example, Information, Education, and Communication (IEC) services and their prevalence in a society determine the ease with which citizens can approach and access healthcare services. With the Indian government’s National Program for Control of Blindness and Visual Impairment (NPCBI) along with several state action plans and the involvement of large NGOs and international organizations, the eye care scenario has been steadily improving. This is the need of the hour, as experts determined a loss of 88,900 crore rupees to the economy due to vision impairments, 35% of which are preventable in India. The National Program for Control of Blindness 2017-2019 is applauded for considerable success for most of its target achievements, but experts argue that the targets were not set high enough and not enough was done for specific problem areas such as tackling the gender disparity in the treatment of visual impairments. Implications for Women Women bear a disproportionate burden of health inequity everywhere around the world, and the case is no different for visual impairments. This is due to several factors, such as their traditional household roles, and the fact that they are less likely to receive access to care and treatment. 139 million out of the 253 million people around the world who are visually impaired are women, which is about 55%. The gender disparity widens further where eye care is concerned. The coverage of cataract surgery among women is always lower, sometimes even half of that of men. Several national surveys and Rapid Assessment of Avoidable Blindness Studies (RAABs) have confirmed that women account for about 64 percent of the total number of blind persons globally and that in many areas, especially in the Global South, men are twice as likely as women to be able to access eye care. The cause of higher rates of visual impairments is usually explored from the perspective of higher risk factors such as being primary caregivers to children and the elderly, from whom preexisting eye infections such as trachoma may be contracted. Women’s general lack of mobility in developing countries hinders them from seeking thorough medical treatments, especially since they may not have financial decision-making authority within the family to pay for eye care services. In addition, women’s childcare responsibilities may make it difficult for them to leave home. Illiteracy can affect women from availing refraction services across their life course, for example, if they believe that eye care services are for those who can read and write, and for people who need their eyesight to do their job. Even when younger, girls can be discouraged from getting their eyesight sorted with a pair of spectacles. As they age, women may have less access to financial resources or be reluctant to ask for it from the wider family as they prioritize the needs of their children and other family members. Women put themselves at the back of the queue because of previous discrimination they experienced, and families do not challenge that view. There is evidence that adult men and women still have unequal access to cataract services. Because women have a slightly higher incidence of cataracts and tend to have a longer life expectancy than men, women should account for 60–65 percent of all cataract operations. However, a recent analysis of 22 population-based studies in 17 low- and middle-income countries showed that, in all studies except one, more men than women received cataract surgery. Trachoma is one of the few ‘life cycle’ eye diseases affecting people of all ages in endemic areas of the world. Recent work in Southern Sudan has demonstrated trichiasis in children, with girls being 1.5 times more likely to have trichiasis than boys. As the SAFE strategy indicates, addressing trachoma requires planners and health care providers to consider all of the various ways we reach into communities and address the needs of women and girls. Interventions can be related to water use, latrines, distribution of antibiotics, or surgery for trichiasis. Rural outreach programs have proven to be the most successful in shrinking the gender disparity in eye health as they actively address the barriers that are preventing women or girls from accessing eye care services. However, in order to thoroughly and more effectively combat this unfair disparity, it is necessary to devise an intensive strategy that is permanent rather than periodic, which would allow eye care services to be equally accessible for men and women, responsive to their actual needs. Given both the diversity and variable nature of disabilities and the intersection with other disciplines, from sociology and cultural studies to health science and rehabilitation science, a comprehensive introduction to the field is problematic. Acknowledgment: Malcolm Antony is a Research Intern at IMPRI
<urn:uuid:0f3e216a-b9d0-44f3-b3ad-057c85f2e3e1>
CC-MAIN-2022-33
https://www.impriindia.com/insights/eye-care-sdg-gender-inequality/?noamp=mobile
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572833.78/warc/CC-MAIN-20220817001643-20220817031643-00275.warc.gz
en
0.960268
1,221
3.3125
3
To: Supportive Living Facilities (SLF) Date: April 10, 2009 Re: Health Care Worker Registry and Sex Offender Checks Health Care Worker Registry The Department of Public Health (DPH) maintains the Health Care Worker Registry (Registry). The Registry is composed of individuals with background checks conducted pursuant to the Health Care Worker Background Check Act (225 ILCS 46). It also contains training information for certified nursing assistants (CNA) and other healthcare workers. Additionally, it displays administrative findings of abuse, neglect or misappropriation of property. The Department recently received direction from the DPH that any employee who falls under the requirements of the Health Care Worker Background Check Act must be included on the Registry, not just CNAs. Effective immediately, for all new Supportive Living Facility (SLF) employees who fall under the requirements of the Health Care Worker Background Check Act, the SLF must: - Check the Registry to see if the potential employee is listed (must be done prior to employment beginning). - If the employee appears on the Registry, verify that a background check completed within the past 12 months is included. If the background check results contained on the registry are older than 12 months, a new background check must be conducted and the results forwarded to the Registry. - If the employee is NOT listed on the Registry, the SLF must send a copy of the Uniform Conviction Information Act (UCIA) background check results, along with a cover letter that includes the employee's name, employment title, address, date of birth and Social Security number (if this information is not already included on the background check results) to the Health Care Worker Registry. As a reminder, the requirements of the Health Care Worker Background Check Act pertain to SLF employees who provide direct care to residents or those who have access to resident apartments or financial, medical or personal records. Staff licensed by the State of Illinois (i.e., RNs) are exempt from the requirements of this Act. Sex Offender Checks Recently the Department learned that registered sex offenders in Illinois who have a known alias(es), may not be identified on the National Sex Offender Public Website. For instance, if a person is named Mary Smith, but may also be known as Mary Jones, only one of these names appears on the National Website. If Mary Jones is typed into the search, it may not show anything under this name, even if she is a registered sex offender. In other words, the search will not identify Mary Jones and Mary Smith as the same person. The Illinois State Police sex offender registry does include all known aliases and will identify the registered sex offender by any of the known names that are entered into the search page. Entering either Mary Jones or Mary Smith on the search page would identify the registered sex offender. Additionally, the Illinois Department of Corrections (DOC) sex offender registry only contains registered sex offenders who are on parole from DOC or mandatory supervised release. Not all registered sex offenders are listed on the DOC registry. In order to ensure resident safety and to allow both current and future residents to make an informed decision when considering residency or continued residency, now the Department requires all three sex offender registries to be searched prior to a resident's admission (see links below). Documentation of the checks should be contained in the residents' files. Although it is not required, the Department recommends searching all three of the registries on current residents, especially if only the National registry or IDOC registry was used. Links to Sex Offender Registries: Questions regarding this notice should be directed to the Healthcare and Family Services Bureau of Long Term Care at 217-524-0372. Theresa A. Eagleson, Administrator Division of Medical Programs
<urn:uuid:1fc00bcd-5bf7-4c25-bfda-b2a0ea6580a6>
CC-MAIN-2022-33
https://www2.illinois.gov/hfs/MedicalProviders/notices/Pages/prn090410b.aspx
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882570879.1/warc/CC-MAIN-20220808213349-20220809003349-00476.warc.gz
en
0.922351
764
1.554688
2
Southern India and Sri Lanka The southern tip of India and the island nation of Sri Lanka can be observed here. An algal bloom is present in the Palk Strait, the body of water separating the two countries. The skies above Sri Lanka and India’s coastal plains west of the Cardamom Hills (part of the southern Western Ghats mountain range) are dotted by clouds. In Sri Lanka, only the area around the peak of Pidurutalagala, (also known as Mount Pedro), a mountain in the central hill-country of Sri Lanka, is cloud-free. At a height of 2.534 metres (8,281 feet), it is the highest mountain in Sri Lanka.
<urn:uuid:4b0100d8-4c3b-42f7-8ec9-eec663669513>
CC-MAIN-2017-04
http://www.eosnap.com/snapshots/southern-india-and-sri-lanka-2/
s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560280266.9/warc/CC-MAIN-20170116095120-00501-ip-10-171-10-70.ec2.internal.warc.gz
en
0.922419
148
2.65625
3
Long-COVID is a whole new disease Here’s what else you should know about the condition that keeps some people sick more than a year after a COVID infection While scientists are clear that a SARS-CoV-2 infection is a trigger for long-COVID, little else is understood about the condition that affects between 10% and 80% of those diagnosed with COVID. Researchers have several … Continued Here’s what else you should know about the condition that keeps some people sick more than a year after a COVID infection While scientists are clear that a SARS-CoV-2 infection is a trigger for long-COVID, little else is understood about the condition that affects between 10% and 80% of those diagnosed with COVID. Researchers have several theories: One study suggested that the coronavirus might reactivate latent viruses, including the Epstein-Barr virus, causing long-term symptoms, and another indicated that an ineffective immune response to COVID failed to trigger the antibodies needed to fight the infection, leading to lingering symptoms. Researchers agree on one theory no matter what causes it: Long- COVID is not a lingering COVID infection. Long-COVID is a whole new syndrome, a whole new disease, researchers believe. Severe infections increase the risk Patients with long-COVID primarily fall into three categories: those who never recovered after their initial infection; those who developed long-COVID symptoms following COVID-related hospitalization; and those who continued experiencing symptoms after they recovered from their initial COVID battle. Among those groups, there seems to be a link between how severe their COVID infections were and the risk of becoming a long hauler. Doctors at the ReCOVer Clinic at Cleveland Clinic have reported that people who suffer from long-COVID and were hospitalized, treated in the intensive care unit, or were placed on ventilators have tissue and organ damage are far different from COVID sufferers who were never hospitalized. But that doesn’t mean those who had mild infections are risk-free. For example, 80% of long-COVID patients who received treatment at the ReCOVer Clinic were never hospitalized, and doctors at other extended COVID treatment centers are seeing similar patterns. A study of 13 million people found that those who received the COVID vaccine were 15% less likely to develop long COVID than those who were unvaccinated; smaller studies have shown that those who received two doses of the COVID vaccine reduced their risk of developing long-COVID in half. Research is ongoing The National Institutes of Health started the RECOVER Initiative, a $1.15 billion project to research long-COVID. Hundreds of clinical trials are recruiting long haulers to understand the condition and possible treatments better. But clinical research takes time. That’s why no one can offer answers about long-COVID right now, and researchers believe it may take several years before that happens. Delaying treatment affects recovery The latest data shows that long-COVID symptoms lasted an average of 14.8 months among patients who were not hospitalized for COVID, with some patients experiencing long-COVID symptoms for 18 months following their initial COVID infection. While there is no cure for long-COVID, seeking a diagnosis and treatment is still essential. Long-COVID treatment centers can help Long-COVID centers have been set up in 48 states and are staffed with multidisciplinary health care teams to help long haulers manage their symptoms. Long-COVID treatment centers are helping many people with the condition, but a long list of questionable companies with vague promises also are making unfounded promises to help. The list of COVID scams is getting longer. The companies promote diagnoses and treatments with blood tests, special diets, breathing exercises, and cocktails of supplements. But the treatments don’t have science to support the claims. Doctors treating long-COVID and the Department of Health and Human Services warn vulnerable people against potential scams: “If it sounds too good to be true, it probably is.”
<urn:uuid:882a9c3d-8566-41de-ade3-9cc24afd8822>
CC-MAIN-2022-33
https://blacknewsportal.com/long-covid-is-a-whole-new-disease
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882570767.11/warc/CC-MAIN-20220808061828-20220808091828-00469.warc.gz
en
0.966098
854
3.078125
3
Painter, K. J. and Maini, P. K. and Othmer, H. G. (2000) Development and applications of a model for cellular response to multiple chemotactic cues. Journal of Mathematical Biology, 41 (4). pp. 285-314. The chemotactic response of a cell population to a single chemical species has been characterized experimentally for many cell types and has been extensively studied from a theoretical standpoint. However, cells frequently have multiple receptor types and can detect and respond chemotactically to more than one chemical. How these signals are integrated within the cell is not known, and we therefore adopt a macroscopic phenomenological approach to this problem. In this paper we derive and analyze chemotactic models based on partial differential (chemotaxis) equations for cell movement in response to multiple chemotactic cues. Our derivation generalizes the approach of Othmer and Stevens , who have recently developed a modeling framework for studying different chemotactic responses to a single chemical species. The importance of such a generalization is illustrated by the effect of multiple chemical cues on the chemotactic sensitivity and the spatial pattern of cell densities in several examples. We demonstrate that the model can generate the complex patterns observed on the skin of certain animal species and we indicate how the chemotactic response can be viewed as a form of positional indicator. |Uncontrolled Keywords:||cell movement, chemotaxis, multiple signals, pattern formation| |Subjects:||A - C > Biology and other natural sciences| |Research Groups:||Centre for Mathematical Biology| |Deposited By:||Philip Maini| |Deposited On:||22 Nov 2006| |Last Modified:||29 May 2015 18:21| Repository Staff Only: item control page
<urn:uuid:b88394e8-319e-494f-8d89-260aa2ccc3a4>
CC-MAIN-2016-44
http://eprints.maths.ox.ac.uk/412/
s3://commoncrawl/crawl-data/CC-MAIN-2016-44/segments/1476988719908.93/warc/CC-MAIN-20161020183839-00157-ip-10-171-6-4.ec2.internal.warc.gz
en
0.864606
378
1.773438
2
An apparatus comprises a test signal generator (401) which generates an ultrasonic test signal by modulating an audio band test signal on an ultrasonic signal. The ultrasonic test signal is radiated from a parametric loudspeaker (403) and is demodulated by non-linearities in the air. A reflected audio signal may arise from reflections of an object, such as a wall. An audio band sensor (405) generates an audio band captured signal which comprises the demodulated reflected audio band signal. A distance circuit (407) then generates a distance estimate for the distance from the parametric loudspeaker (403) to the object in response to a comparison of the audio band captured signal and the audio band test signal. Specifically two signals may be correlated to determine a delay corresponding to the full path length.; Based on the distance estimates an audio environment may be estimated and a sound system may be adapted accordingly. |Patent number||US8811119 (B2)| |Publication status||Published - 19 Aug 2014| Bibliographical noteAlso published as:
<urn:uuid:c3c350aa-0a70-4ea2-9d26-e7a3b65e2c93>
CC-MAIN-2022-33
https://research.tue.nl/en/publications/distance-estimation-using-sound-signals
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572833.78/warc/CC-MAIN-20220817001643-20220817031643-00276.warc.gz
en
0.829246
259
2.234375
2
Recognition of grit of students A list of the awardees at the IIHM presents The Telegraph School Awards for Excellence 2020, 25th Edition, in association with The Bhawanipur Education Society College The Caring Minds Award for a ‘School that Cares’ Special mention (for handling the pandemic) Calcutta Rescue: Distributed smartphones among slum children Adamas World School: Provided a part of its Barasat campus to set up a quarantine centre Antyodoy Ashram: Home to 78 children, orphans or children of single parents incapable of bringing them up Batighar Pathshala: School for 56 children, mostly from slums and footpaths Don Bosco School, Liluah: Host of welfare activities like teaching girls over 14 years for free and conducting night schools The Somak Dutta Endowment Award Moner Unmesh: A school for tribal children, mostly first-generation learners, in Garbeta, West Midnapore. The mud building of the school was damaged by Cyclone Fani (2019) and razed by Cyclone Amphan in May this year The Anand Paul Memorial Award for Social Service Chowringhee High School St Joseph’s School, North Point The Ambuja Neotia Award for Excellence in Maintenance and Eco-Friendly Initiatives Adamas World School Tribeni Tissues Vidyapith Scholarships, Section 1 Dr. Ashin Dasgupta Memorial Scholarship Rhichick Dey: South Point High School Lakshmipat Singhania Education Foundation Scholarship Jyoti Mardi: Maladang Koherakuri Bangshidhar Uchcha Vidyalaya, Birbhum Dr Amiya Kumar Bose Memorial Scholarship Indrajit Roy Laskar: Haldibari Uchha Madhyamik Vidyalaya The Late Debaprasad Das Purkayastha Memorial Scholarship Santanu Dutta: Malpar Vivekananda Sikshaniketan, West Midnapore Hariyana Vidyamandir Scholarship Jhumi Debnath: Ranaghat Nasra Girls High School, Nadia The Bansari Saha and Late Malay Saha Scholarship Prerna Rana: Belda Gangadhar Academy, West Midnapore The Sonika Chauhan Award for Courage Yubasana Kapa: Gokhale Memorial Girls’ School Susmita Sarkar: National High School Hazra Road Campus (The Sonika Chauhan 27 Foundation Scholarship) The Surrendra Paul Memorial Award for Courage Aaditya Kumar Agarwal: MC Kejriwal Vidyapeeth Arkojit Mukherjee: Union Chapel School Kinkini Chatterjee: Lakshmipat Singhania Academy Ronit Adhikary: Calcutta Public School Kalikapur (also winner of the Tarun Kumar Sinha Memorial Scholarship) Sk Muhemin Ali: Saifee Golden Jubilee English Public School Sumit Kumar Lal: National High School, Hazra Road Campus (also winner of the Chittajit De Memorial Scholarship) Soumili Hor: The Assembly of God Church School, Park Street (Died on September 17. Diagnosed with a degenerative neurological disease in Class VI, for which she struggled to move even with crutches. She attended school regularly despite her numerous health issues) The IIHM Award for Excellence in Academics CBSE: Lakshmipat Singhania Academy ICSE and ISC: The Heritage School Madhyamik and HS: GB Memorial Institution The Madanlal Dhandhania Charitable Trust Award for Academic Excellence by a Student Auhona Mukherjee: Delhi Public School Megacity (Humanities stream) Subham Ghosh: DAV Model School, Durgapur (Science stream) Yamini Chetani: Mahadevi Birla World Academy (Commerce stream) Sreemanti Dey: Delhi Public School Ruby Park Utsav Basu: South Point High School Scholarships, Section II The Delhi Public School Megacity Scholarship Prabir Mukherjee: Malpar Vivekananda Sikshaniketan, West Midnapore The Admissiontree Scholarship Kajal Das: Paschim Barisha Kamala Vidyamandir The Tarinidas Roy and The Pratibha Roy Memorial Scholarship Piyali Nayak: AK Mitra Institution, Dhakuria The Mayukh Mitter Memorial Scholarship Debanjan Sarkar: Ashokenagar Boys Secondary School, North 24-Parganas The Capt. Sanjib Sen and Mrs Suchitra Sen Memorial Scholarship Barsha Mandal: Kanaknagar SD Institution, Hingalganj, North 24-Parganas The Bhawanipur Education Society College Award for an Educationist Chhaya Biswas: She started at Loreto Day School Bowbazar in 1955 as a teacher, worked in several other schools and more than six decades later, she is still guiding students and this time in online mode. Ratan Chandra Dhara: The teacher of Bonbibitala High School (HS) writes skits to raise awareness against child marriage. Dipak Roy Chowdhury: He uses magic to teach sciences and mathematics at Niva Ananda Vidyalaya, Brahmapur, Garia. Theo Baker. Now in her 90s, she was associated with many schools as a care-giver to underprivileged children. The Dr Mrs NB O’Brien Memorial Lifetime Achievement Award for a Teacher Mukta Nain: The director of Birla High Schools has been in the field of education for more than three decades and believes in providing all-round education to students. Nazirah Ganjee: The former teacher of La Martiniere for Girls, both “strict and soft”, has involved herself with various occasions like Founders’ Day, Sports Day and Children’s Day. Grace Williams: The teacher at Loreto Convent Entally, also a social worker, has instilled the Loreto values in her students. The Abhirup Bhadra Memorial ‘Thank You Baba-Ma Award’ Rehana Sardar: A single mother of three children in a middle-class family, she took up a job after her husband abandoned them and is bringing up her daughters. One of the daughters, Mehdiya Binte Aftab, of Jewish Girls’ School, received The Dr Krishna Roy Scholarship. Sunil Sharma and Mamta Sharma: They have never let their hard times impact their daughter’s education. Sunil Sharma lost his job a few years back, got a part-time job but met with an accident. Mamta Sharma does a part-time tailoring job. Daughter Anjali Sharma, of St John's Diocesan Girls' Higher Secondary School, received The Saradindu Sen & Indira Sen Memorial Scholarship. Kalyan Adhya and Rupa Adhya: Rupa had to sell a kidney to make ends meet and pay for the treatment of son Acharya, who had a rare disease. Acharya received The Indu Basu & Pritish Chandra Basu Memorial Scholarship. Abhijit Sarkar and Late Mandira Sarkar Chakraborty: The couple’s son, Arkodeep of St Luke's Day School, has scored 96 per cent in ISC. His mother, who passed away last year, played a significant role in guiding him in academics and music. The Kalyan Bharati Trust Award for All-Round Excellence Dhruv Banka, of La Martiniere for Boys, scored 94 per cent in ISC. He is a debater and a cricketer, and his social work includes conducting food drives Acharya Adhya, of Abhinav Bharati High School, has fought a disease in childhood, excelled in academics and also in rifle shooting and other sports. The Adamas University Award for Outstanding Talent in Sports Shreyas Bahadur Shah, of St Joseph's School North Point, for volleyball, basketball and athletics. Aronyak Ghosh, of South Point High School, an international master who has been playing chess since he was nine The Balrampur Chini Mills Award for Outstanding Talent Nilav Bose (photography): Don Bosco School, Liluah Shivam Agarwal (space technology): Lakshmipat Singhania Academy The Anirban Sinha Award for Outstanding Talent in Music Sagnik Sen: South Point High School Shreyan Bhattacharya: DAV Public School, Midnapore The Shining Star Honour Suchandan Ghosh: K. Carmel School, Sarisha Usha Mondal: Calcutta Public School Kalikapur Mira Das: Silver Point School Biswajit Mazumder: Bhavan's Gangabux Kanoria Vidyamandir Satyabrata Kayal: Gems Akademia International School The Telegraph Education Foundation Award for Excellence in Extra Curricular Activities Lakshmipat Singhania Academy South Point High School The Telegraph School of The Year The Heritage School Delhi Public School Megacity Chairman and CEO, IIHM We are very proud and privileged to be a part of The Telegraph School Awards for the past four years. I would like to congratulate the entire The Telegraph Education Foundation for providing support to students for the past 25 years and this is something that nobody has done. I also want to thank every teacher for their selfless service towards educating children during the Covid-19 pandemic. Miraj D. Shah Vice-chairman, The Bhawanipur Education Society College Stepping into 25 years is a huge thing for any programme and the fact that The Telegraph Education Foundation has been helping students all along is just amazing. The sheer number of students’ lives it has touched is incredible. We can only wish all the best and want this programme to grow even bigger and better. Trustee, The Telegraph Education Foundation Twenty-five years is a long time and over this time period some of us have doubled or tripled our chins. However, The Telegraph School Awards has grown in strength and we are grateful to those who stood by rock solid at our side. Chairman, The Telegraph Education Foundation The Telegraph School Awards has become extremely popular over the past 25 years not only in the city but all over the state and it is extremely heartening for us. The programme that we had started 25 years ago has transformed the lives of many young children as it helped them pursue their educational endeavours despite their problems and we are grateful to all the individuals, corporates, schools as well as the teachers who have all made it possible for us.
<urn:uuid:e19253f3-8838-4039-8bbe-5833d5abe2a1>
CC-MAIN-2022-33
https://www.telegraphindia.com/west-bengal/calcutta/the-telegraph-school-awards-for-excellence-2020-recognition-of-grit-of-students/cid/1800404
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572833.95/warc/CC-MAIN-20220817032054-20220817062054-00475.warc.gz
en
0.933514
2,366
1.601563
2
Guided tissue regeneration around dental implants in immediate extraction sockets: comparison of e-PTFE and a new titanium membrane To evaluate the efficacy of guided tissue regeneration around exposed implant threads, 16 implants were placed into fresh extraction sockets in beagle dogs. Polytetrafluoroethylene (e-PTFE) membranes and titanium membranes were used to cover the defects around implants. A control group did not receive any membranes. Results were evaluated histologically. The average gain in bone height was 2.1 mm for e-PTFE sites, 0.8 mm for titanium membranes, and 2.9 mm for control sites. The greatest gain in bone levels was seen for two sites that received e-PTFE membranes and remained covered for the entire evaluation interval. Within the limits of this study, clinical and histologic evidence demonstrated that, when primary coverage is maintained, the use of e-PTFE membranes can significantly enhance bone regeneration around implants.
<urn:uuid:c3ec9c74-edf5-4106-be12-e644c51d310f>
CC-MAIN-2016-44
http://www.quintpub.com/journals/prd/abstract.php?iss2_id=519&article_id=6208&article=5&title=Guided%20tissue%20regeneration%20around%20dental%20implants%20in%20immediate%20extraction%20sockets:%20comparison%20of%20e-PTFE%20and%20a%20new%20titanium%20membrane
s3://commoncrawl/crawl-data/CC-MAIN-2016-44/segments/1476988720737.84/warc/CC-MAIN-20161020183840-00221-ip-10-171-6-4.ec2.internal.warc.gz
en
0.922376
196
1.765625
2
papillary urothelial neoplasm of low malignant potential WHO/ISUP Classification, 2004 Friday 24 May 2013 PUNLMP - WHO/ISUP Classification, 2004 Papillary urothelial neoplasms of low malignant potential (PUNLMP) show urothelial thickening but lack cytologic features of malignancy. The image shows several papillary fragments with an orderly arrangement of cells. Umbrella cell layer can be recognized even at low magnification. PUNLMPs are characterized by a homogenous monotonous appearance, normal to slightly enlarged nuclei and inconspicuous nucleoli. Mitotic figures are uncommon and, when present, are confined to the basal layer. The major distinction between PUNLMP and urothelial papilloma is thickening of the urothelium in the former. There is an orderly arrangement of urothelial cells and a lack of cytologic atypia. PUNLMPs are not benign lesions, unlike papilloma, and although the incidence of recurrences and progression is low, close follow-up is recommended. Most PUNLMPs correspond to "Papillary Urothelial Carcinoma, Grade 1" according to the previously used WHO Classification, 1973. At higher magnification, urothelial lining is thickened. There is no cytologic atypia. Mitotic figures are absent. low-grade papillary urothelial carcinoma Long-term outcome of primary Papillary Urothelial Neoplasm of Low Malignant Potential (PUNLMP) including PUNLMP with inverted growth. Maxwell JP, Wang C, Wiebe N, Yilmaz A, Trpkov K. Diagn Pathol. 2015 Mar 13;10:3. doi : 10.1186/s13000-015-0234-z PMID: 25886613 (Free)
<urn:uuid:14bd4032-9674-4b94-88bd-1b8740b3fc36>
CC-MAIN-2017-04
http://www.humpath.com/spip.php?article19424
s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560280929.91/warc/CC-MAIN-20170116095120-00420-ip-10-171-10-70.ec2.internal.warc.gz
en
0.843537
415
1.6875
2
Interesting, so let me make sure I understood it: the trimmed pieces (any minimal length?) of the roots were just placed on top of thin layer of sopping wet sphagnum in a shaded location? BTW nelumbifolia is back in my collection yay!!! Something to do with invading rolons. I like it. Live sphagnum and it's anti microbial properties, and water regulation / evaporative cooling. True Bugs really Suck thanks so much for sharing Ron! i too am at that stage where root stolons are not advantageous for propagation, but i think my failure came from not keeping them constantly damp, and they were subjected to drying out many many times. T.T nice to finally see success! i take it quelchii will be making a plentiful debut next time around may? In hindsight, I think I just needed to ensure the root fragments stayed in a thin film of water - I was originally keeping them too dry. I was also excited by the sheer number of little emerging leaves. For a plant that is mostly unavailable in the US, I found this very cool. Last edited by RL7836; 11-18-2011 at 11:42 AM. Reason: Respond to Amp Very interesting method. I have left the "rolons" attached to the mother plant while "air layering" them in small cups of LFS in water trays. Once established, I "cut the chord". I will be looking for that Quelchii at the auction "the memories of a man in his old age, are the deeds of a man in his prime" that was from a leaf? could have fooled me---looks like a tuber. congrats! you've successfully propagated an orchidioides utric from a leaf pulling! gill_za: very cool pics - thanks for sharing. I'm very curious about people's success with this species. I've read numerous accounts of folk's having problems growing it. So far, mine has been a super-robust grower without odd idiosyncrasies. I believe RSS has had similar experience.
<urn:uuid:3bb7e692-2ed4-42d7-9b93-e87a423455fd>
CC-MAIN-2017-04
http://www.terraforums.com/forums/utricularia-aldrovanda-genlisea/125223-utricularia-section-orchidioides-info-sharing-discussion-13.html
s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560280872.69/warc/CC-MAIN-20170116095120-00312-ip-10-171-10-70.ec2.internal.warc.gz
en
0.96842
447
1.960938
2
In light of recent research confirming that human papillomavirus (HPV) is a risk factor for cervical cancer, the National Cancer Institute (NCI) released revised Pap-screening guidelines last February. Here are some of the things you should know. When should I be tested? Women should have a Pap test for the first time three years after they begin sexual activity or at age 21, whichever comes first—a change from previous recommendations to begin screening at age 18. Experts recommend waiting three years following initiation of sexual activity because transient HPV infections and insignificant cervical-cell changes are common, and it takes years for significant abnormalities or cancer to develop. Cervical cancer is also extremely rare in women under age 25. How often should I be tested? You should have a screening at least every three years, although annual screening is preferable until a woman has had three or more consecutive normal results. The American Cancer Society recommends annual screening until age 30 and screening once every two to three years afterward. Women at higher-than-average risk of cervical cancer because of factors such as HIV infection should seek medical advice regarding frequency of screenings. Is my monthly cycle a factor? The timing of your Pap test is important. NCI guidelines say the best time to schedule your Pap test is between 10 and 20 days after the start of your last menstrual period. Naturopathic family practitioner Kristy Fassler, ND, DHANP, of Portsmouth, New Hampshire, however, recommends seven to ten days or 18 to 28 days after the start of your period, so the increased amount of mucus during ovulation won't affect specimen quality. If your appointment for a physical doesn't coincide with this, ask whether you can return for your Pap test, usually a quick procedure, at a better time in your cycle. Also, avoid douching and using spermicides or vaginal medicines two days prior to testing to avoid interfering with specimen quality. Who doesn't need to be tested? Screening isn't required for women who have had a total hysterectomy for a noncancerous condition. Nor is screening required for women 65 and older who have had normal Pap tests and aren't otherwise at increased risk for cervical cancer. "Many women stop coming for Pap tests after they've had children," notes Carole Hicks, ARNP OB-GYN, site manager of the Planned Parenthood Health Center in Portsmouth, New Hampshire. "Perhaps they've had a tubal ligation or stopped using birth control and think the need for screenings is behind them." But regardless of her state of fertility or sexual activity, to be safe, every woman should continue to receive regular Pap screening until she is 65 or older. That's because a significant number of women develop cervical cancer in their 50s and 60s, says Hicks.
<urn:uuid:19ab5b81-f35f-4c7b-a65f-3a7624cea754>
CC-MAIN-2016-44
http://deliciousliving.com/health/screening-basics
s3://commoncrawl/crawl-data/CC-MAIN-2016-44/segments/1476988721027.15/warc/CC-MAIN-20161020183841-00551-ip-10-171-6-4.ec2.internal.warc.gz
en
0.957854
574
2.265625
2
by Susan Rosenthal (Chapter 1 of SICK and SICKER: Essays on Class, Health and Health Care) The United States boasts the most expensive medical system in the world, yet consistently ranks behind Australia, Canada, Germany, New Zealand and the United Kingdom in access to care, equity of care, patient safety and patient outcomes.(1) While the US medical system delivers billions in profits, it delivers little in terms of population health. By the end of 2009, compared with all other nations, the US ranked 50th in life expectancy(2) and 45th in infant mortality.(3) The relatively poor health of Americans(4) is often blamed on a fragmented, for-profit medical system that denies millions of people access to care. The United States is the only industrial nation(5) without a universal public system, and this must change. However, improving the overall health of Americans requires even more fundamental change. Social inequality affects the health of populations more than any other factor – more than diet, smoking, exercise and even more than access to medical care.(6) As we shall see, social inequality generates poor health and inadequate health-care systems. It is obvious why poor people have worse health than those who are better off. Poor people eat less nutritious food and are more likely to live in substandard housing in more dangerous neighborhoods located closer to industrial pollution. They suffer more unemployment and financial stress and have less access to medical care. What is not obvious is that inequality hurts the health of the entire population. A study of 282 metropolitan areas in the United States found that the greater the difference in income, the more the death rate rose for all income levels, not just for the poor.(7) Researchers calculated that reducing income inequality to the lowest level found in the United States would save as many lives as would be saved by eradicating heart disease or by preventing all deaths from lung cancer, diabetes, motor vehicle crashes, HIV infection, suicide and homicide combined! Even greater benefits would flow from eliminating class inequality entirely. Consider the lives that would be saved by ending racial inequality. Without racism, death rates for Black and White Americans would be the same. Yet, every year, Black Americans suffer 300 more deaths per 100,000 people than White Americans. Compare these 300 additional deaths with the national homicide rate of about 6 per 100,000. Do the math. Racism kills 50 times more people than die at the hands of individual murderers. The health-damaging impact of inequality counters the health benefits of higher income. Poorer people in more equal nations tend to be healthier and live longer than wealthier people in more unequal nations. Middle-income people in Britain enjoy better health than wealthier Americans.(8) And men in Bangladesh, one of the world’s poorest countries, are more likely to reach age 65 than Black men in Harlem, USA. Harlem men have higher incomes than Bangladeshi men but live in a more unequal society. Many Black Americans die prematurely from cardiovascular and other diseases that are linked with class and race inequality.(9) Why is inequality so damaging? Power = Health In 1948, the British National Health Service was established to provide universal access to medical care. However, universal access has not eliminated health inequality. A 1980 study of the highly-stratified British civil service found that health deteriorated as social status fell. This decline in health could not be explained by smoking, exercise, body weight or access to medical care.(10) A 2008 American study also found health differences between income levels (income level is often used to measure social status in the US). At every income level, the wealthier group was healthier than the one below it. Moreover, this trend was observed in all racial groups.(11) Every nation studied, regardless of its type of medical system, shows this same link between higher social status and better health.(12) How can we explain this? The answer lies in the surprising fact that those at the top of the power structure enjoy better health than those near the top, even though their life-styles are essentially the same. Moreover, professionals enjoy better health than non-professionals, even when the non-professionals make more money. Michael Marmot, who studies the relationship between social status and health, explains, “Your position in the hierarchy very much relates to how much control you have over your life…Sustained, chronic and long-term stress is linked to low control over life circumstances.”(13) Bosses live the longest, healthiest lives because they have the most social power. As social status falls, power diminishes, stress rises and health deteriorates.(14) Children show rising levels of stress hormones as their social position falls.(15) Nurses who work under “unfair and unreasonable” bosses suffer higher blood pressure.(16) Just talking with someone with higher social status will raise your blood pressure.(17) The greatest damage is done to those who are put down and ordered around their entire lives. “Stress triggers a higher heart rate, a release of adrenaline, glucose and other neurological responses to help the body respond to a short-term threat. But when extended over long periods of time, these changes can harm the cardiovascular and immune systems, making individuals more vulnerable to a wide range of conditions including infections, diabetes, high blood pressure, heart attack, stroke, asthma and aggression.”(18) Hard work is not harmful to health unless there is also a lack of control. The most health-damaging jobs are those that expose workers to oppressive conditions that they would change if they had the power to do so, and jobs that saddle workers with great responsibilities while denying them the power to meet those responsibilities. People with little control over demanding jobs are more likely to be overweight and have high cholesterol regardless of age, amount of exercise, smoking habits and access to medical care.(19) In a class-divided society, only a few people get to make the important decisions. The rest of us get no say over how work is organized and how social resources will be used. We don’t get to decide if society will invest in schools or in prisons, make peace or wage war, develop renewable energy or build more nuclear plants. All of these matters, that affect us so deeply, are decided by an elite whose primary concern is making profit. Being excluded from decision-making is strongly linked with cardiovascular disease,(20) and the more powerless a person feels, the faster the disease progresses.(21) Oppressed sections of the working-class have the least social power and the highest rates of cardiovascular disease.(22) Capitalism: The Root Source of Inequality Capitalism is based on inequality and generates more inequality. The unequal relationship between the capitalist and the worker is enshrined in law. The capitalist owns the means of production and the worker does not. The capitalist also owns everything the worker produces. The wages paid to the worker can never equal the value of what the worker produces or there would be no profit.(23) Profit that is reinvested to make more profit becomes capital. Competition compels capitalists to raise worker productivity (the net value of what workers produce) to generate more capital. The most effective way to raise productivity is to put workers in charge. Increasing worker decision-making has been shown to raise productivity more than any other factor.(24) Capitalism cannot give workers any meaningful control over production without making itself redundant, so it raises productivity by intensifying worker exploitation: - increasing the length of the workday - increasing the number of days worked per year - increasing the speed of production - redesigning the work to increase output-per worker - using technology and machines to increase output-per-worker - employing fewer workers to do the same job - cutting wages and benefits - lowering the cost of consumer goods The process of capital accumulation enriches the capitalist at the expense of the worker. The more capital is accumulated, the more inequality is generated between the classes. The United States is a prime example. The US boasts the world’s richest economy, the world’s largest corporations and the world’s most powerful military. It is also the most unequal nation on the planet, with fabulous wealth existing alongside abject poverty. The two are directly linked. The American elite reached the pinnacle of wealth and power by stealing native lands and by exploiting African slaves and waged workers. This process is ongoing. Since the late 1970s, the productivity of American workers has risen steadily, while the median household income has dropped. To compensate for falling wages, people work more hours. By 2000, the average American worker was spending 199 more hours on the job, or five weeks more than in 1973. In 1991, Juliet Schor calculated, “Working hours are already longer than they were forty years ago. If present trends continue, by the end of the century, Americans will be spending as much time on their jobs as they did back in the nineteen twenties.”(25) Most Americans are not only working longer and harder, they are taking home less money. In the late 1960’s, the minimum wage in America was half of what the average worker earned per hour. By 2003, it had fallen to 34 percent of the average wage. A 2004 report, Working Hard, Falling Short found that, “More than one out of four American working families now earn wages so low that they have difficulty surviving financially. By 2003, one in five American workers were in occupations where the median wage was less than $8.84 an hour, which is considered to be a poverty-level wage for a family of four. A full-time job at the federal minimum wage of $5.15 an hour would not be enough to keep a family of three out of poverty…In all, more than 14 million, or 21 percent of all kids under 18, still live in poverty — a higher proportion than in 1975.”(26) Real wages have dropped so low that two people must work to earn the same income that one used to make. By 2000, half of all families were two-earner families. Families that depend on two incomes are less able to care for the young, the sick, and the elderly. Now, let’s look at the other side of the equation. Between 1992 and 2000, the incomes of the 400 wealthiest taxpayers in the US increased 15 times faster than the bottom 90 percent, whose income barely kept up with the rate of inflation. In 2005, the New York Times reported, “The top fifth of earners in Manhattan now make 52 times what the lowest fifth make – $365,826 compared with $7,047– which is roughly comparable to the income disparity in Namibia…Put another way, for every dollar made by households in the top fifth of Manhattan earners, households in the bottom fifth made about 2 cents.”(27) The growing gap between the classes is often measured by the income differential between top corporate executives (CEOs) and average workers. In 1980, America’s top CEOs earned 42 times the pay of average workers. By 1998 they were earning 419 times the pay of average workers. To visualize this difference, imagine that the height of the Washington monument (555 feet) represents the average income of the top 500 American CEOs. In 1980, the average American worker’s income would have been only 13 feet tall in comparison. Eighteen years later, the average American worker’s income was only 16 inches tall in comparison.(28) These comparisons are deceiving because they ignore the fortunes accumulated by America’s wealthiest families, both old (Rockefellers, du Ponts, Vanderbilts, Rothschilds) and new (Buffets, Gates, Waltons). Forty-four percent of America’s richest 25 families trace their fortunes back to the 1800s, and another 36 percent to the first half of the 1900s. In other words, 80 percent of these families were already super-rich more than 60 years ago.(29) No one knows how rich these families actually are because their financial dealings are a closely-guarded secret and because their wealth is invested in so many different businesses. We do know that the top one percent of the US population owns more than one-third of the nation’s wealth. We also know that, in 2009, the 400 richest individuals in America had a combined wealth of $1.27 trillion, which is equivalent to 9 percent of the value of all goods and services produced in one year by the entire US labor force. Sustaining such massive social inequality requires: - a legal code that protects the right of the capitalist to exploit the worker, to evade taxes, and to pass wealth from one generation to the next - an education system that trains the majority to be subordinate - a penal system to contain discontent - a military to crush open rebellions - and a mass media that insists there is no alternative. These functions are provided by the capitalist State. Without such a State, the majority who labor to create the wealth would rise up against the elite who control it. The extent to which the State serves the rich and protects their wealth is revealed during financial crises, when government treasury doors swing open to save large corporations and slam shut against desperate individuals who have lost life savings, pensions, jobs and homes. During the savings and loans crisis of the 1980s, the US government spent about $160 billion to float financial institutions. In response to the financial crisis of 2008-2009, the government gave 20 financial giants an estimated $300 billion, even though, “these executives helped drive the US – and global – economy off a cliff. Their reckless joy ride has brought hardship to tens of millions of families. Yet these executives have emerged, virtually unscratched, out of the accident scene…The 20 US financial firms that received the most bailout dollars from taxpayers awarded their top five executive officers, in the three years through 2008, pay packages worth a combined $3.2 billion…One hundred US workers making the 2008 annual average wage would have to labor over 1,000 years to make as much as these 100 executives made in three.”(30) Improve Health – End Capitalism As capital accumulates at the top of society, misery accumulates at the bottom. The more the workers produce, the more the capitalists take. The less workers get in relation to what they produce, the sicker they become. Americans suffer the worst health in the industrialized world because they live in the most unequal society. They also have the worst medical system because their ruling class, the most powerful in the world, has consistently opposed any universal public system. National medicare would be a definite improvement. However, even the best medical system cannot eliminate the health-damaging effects of exploitation, poverty, social discrimination, unsafe work, bad housing, poor schools and being denied the right to make the decisions that affect our lives. We can end these miseries only by ending capitalism and the inequality that it generates. See also How Inequality is Killing Us 1. K. Davis, et. al. (2007). Mirror, mirror on the wall: An international update on the comparative performance of American health care. The Commonwealth Fund, May. 2. CIA. The World Factbook. Country Comparison: Life expectancy at birth. accessed December, 2009. 3. CIA. The World Factbook. Country Comparison: Infant mortality rate, accessed December, 2009. 4. The term ‘American’ properly describes the residents of North and South America. However, US imperialism has made the term synonymous with residents of the United States. 5. The term ‘industrial nations’ is commonly used to identify those nations that sit at the top of the global power hierarchy. 6. Wilkinson, R.G. (1992). National mortality rates: The impact of inequality? Am J Public Health, Vol 82, pp. 1082-1084. See also, PBS (2008). Unnatural causes: Is inequality making us sick? 7. Lynch, J.W. et. al. (1998). Income inequality and mortality in metropolitan areas of the United States. Am J Public Health. Vol. 88, pp.1074-1080. 8. Quoted in Bowe, C. (2008). US society helping to make people sicker. The Financial Times Limited, February 29. 9. McCord C, Freeman H.P. (1990). Excess mortality in Harlem. New England Journal of Medicine. Vol. 322, pp.173-7. 10. Department of Health and Social Security. (1980). Inequalities in health: Report of a research working group. Middlesex: U.K. Author. 11. Robert Wood Johnson Foundation. (2008). Overcoming obstacles to health. 12. A discussion of US studies linking class and heath can be found in Schmidt. J. (2000). Disciplined minds: A critical look at salaried professionals and the soul-battering system that shapes their lives. Rowman & Littlefield, pp.103-104. 13. Quoted in Cohen, P. (2004). Forget lonely. Life is healthy at the top. New York Times, May 15. 14. Wilkinson, R. (1996). Unhealthy societies: The afflictions of inequality. Routledge. 15. Lupien S.J. et al. (2000). Child’s stress hormone levels correlate with mother’s socioeconomic status and depressive state. Biol Psychiatry. Nov 15. Vol.48, pp. 976-80. 16. CBC. (2003). Bad bosses bring blood pressure to boil: Study. June 24. 17. Long, J.M, et. al. (1982). The effect of status on blood pressure during verbal communication. Journal of Behavioral Medicine. Vol.5, pp.165-71 18. Quoted in Cohen, P. (2004). Forget lonely. Life is healthy at the top. New York Times, May 15. 19. Kivimääki, M. et. al. (2002). Work stress and risk of cardiovascular mortality: Prospective cohort study of industrial employees. BMJ. October 19, Vol. 325, p.857. 20. Raphael, D. (2001). Inequality is bad for our hearts: Why low income and social exclusion are major causes of heart disease in Canada. North York Heart Health Network, Toronto. 21. Everson S, et. al. (1997). Hopelessness and 4-year progression of carotid atherosclerosis. Arteriosclerosis, Thrombosis, and Vascular Biology. Vol. 17, No.8, pp.1490-5. 22. Raphael, D. (2002). Poor choice or no choice?: Even more evidence links low income with disease so why keep blaming lifestyle choices like fries? The Toronto Star. October 11, p.F6. 23. Marx, K. (1898). Value, price and profit. 24. Scientists and Engineers for Social and Political Action. (1973). Chile. Bulletin of Scientists and Engineers for Social and Political Action. 5(6), pp.26-28. 25. Schor, J.B., (1991). The overworked American: The unexpected decline of leisure. HarperCollins, p.1. 26. Waldron, T., Roberts, B. & Reamer, A. (2004). Working hard, falling short: America’s working families and the pursuit of economic security. Baltimore, MD: Annie E. Casey Foundation. 27. Roberts, S. (2005). In Manhattan, poor make 2¢ for each dollar to the rich. New York Times, September 4. 28. Leondar-Wright, B. (1999). CEOs now earn 419 times the pay of average workers, up from 326 in 1997 and 42 in 1980. Common Dreams News Wire, April 8. 29. Greenberg, D. and Thibault, M. (2009). America’s richest families. Forbes.com, posted December 3. 30. Anderson, S., Cavanagh, J., Collins, C. & Pizzigati, S. Executive Excess 2009: 16th annual executive compensation survey. Institute for Policy Studies. Washington, DC.
<urn:uuid:b51576d0-0634-4735-9b08-6dd52b8321a5>
CC-MAIN-2017-04
http://www.susanrosenthal.com/articles/america-in-crisis/inequality-the-root-source-of-sickness
s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560281419.3/warc/CC-MAIN-20170116095121-00487-ip-10-171-10-70.ec2.internal.warc.gz
en
0.934781
4,249
3.203125
3
Show All Answers Note: if you fully downloaded the book into Adobe Digital Editions on your computer, the app MUST be using the same Adobe ID as your Adobe Digital Editions for this to work. You do not need to worry about this if you just checked out the book but did not fully download. Freading - ReDownload Book-On your device, go to the Freading site (http://kslib.freading.com ) and login with your Kansas Library eCard. -Go to "My Downloads." This is your checkout history.-Tap the 'redownload' link for the book. Your browser should prompt you to open the book in the ereader app, confirm this. Enki - Download Book-On your device, go to the Enki site (http://ksl.enkilibrary.org) and log in with your Kansas Library eCard. -Go to "My Account." -Each checked out book will have a download button, tap it. Your browser should prompt you to open the book in the ereader app, confirm this. Windows 8: Associate a File Type to Adobe Digital Editions1. Open your right-side menu, and select Settings then Control Panel. 2. Go to Programs, Default Programs, and select "Make a file type always open in a specific program."3. Find .acsm in the file extensions list. Click it one time to select it.4. Click the "Change program" button above the list.5. An "Open with" box will come up. Select Adobe Digital Editions from the list of programs recommended.6. Click OK. Your ebooks should now default to opening in Adobe Digital Editions. Windows Vista or 7: Associate File Type to Adobe Digital Editions1. On your computer, go to Start, then Control Panel.2. Select Programs, then Default Programs.3. Open "Associate a file type or protocol with a program." This window may take a minute to load, it contains a lot of information.4. Find .acsm in the file extensions list. Click it one time to select it.5. Click the "Change program" button above the list.6. An "Open with" box will come up. Select Adobe Digital Editions from the list of programs recommended. Note: if ADE is not listed, please double-check that it is installed on your computer, or use the "Browse" button to find and select it.7. Click OK. Your ebooks should now default to opening in Adobe Digital Editions. Windows XP: Associate File Type to Adobe Digital Editions1. Open 'My Computer' and select Tools menu > Folder Options. The 'Folder Options' dialog box is displayed.2. Select the 'File Types' tab. A list of all file types will be displayed--this may take a minute to fully generate. 3. Select '.acsm' in the file extentions list and click the 'Change' button.4. Select 'Adobe Digital Editions' and click 'OK'. Adobe Digital Editions is now set to open ACSM files. Mac Computers: 1. In Finder, select the Downloads folder. 2. Scroll down and find the .acsm file (this was the attempted book download). 3. Hold down the Control key, and click on the .acsm file. 4. This opens a small menu - choose "Always open with..." and set to Adobe Digital Editions. Older Macs - if "always open with" is not an option - start as above then: 4. Select "Open" then "Other." 5. A new window opens. Select Adobe Digital Editions from the list and check the "Always open with" box. -Make sure your current Adobe Digital Editions program is closed.-Go to the Adobe Digital Editions download page. -Choose the correct installer for your computer (Windows or Mac). Download & install the file as you normally would if this was new software.-As installation nears the end, the installer it will ask permission to migrate all data from the old Adobe Digital Editions version. Say yes to this! You should not need to do anything else.
<urn:uuid:5ad79c32-95ab-417a-ae29-d0da7c8631a5>
CC-MAIN-2016-44
http://kslib.info/Faq.aspx?TID=27,
s3://commoncrawl/crawl-data/CC-MAIN-2016-44/segments/1476988719273.38/warc/CC-MAIN-20161020183839-00064-ip-10-171-6-4.ec2.internal.warc.gz
en
0.823039
865
1.65625
2
One in the background One is the host. One was made from the ground One is high the most. Two identical umbilical cords Two feathery flightless birds. Two rules to live as life Two must meet, one would be wife. One exercises humans to sin One cannot alone act the scene. One has to eye, one has to be seen. One would make a story’s skin. Two humans will make good pages if they synchronized their stages. Two humans will make good music, if they’re both slow and not quick. One God still made two humans to live with us is good and bad. One design can wield one journey two humans can make the world grow.
<urn:uuid:34f2c652-5db2-4880-866f-6160fcb1a4e7>
CC-MAIN-2022-33
https://ebartsng.org/2018/11/07/two-humans/
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572221.38/warc/CC-MAIN-20220816060335-20220816090335-00072.warc.gz
en
0.956257
169
1.75
2
The do not waste paper module displays a message on the print page in browser. Our days there is no need to print a whole website with all its graphics, sidebars and colors. If you like to print data from a website, copy and paste the needed data to an office text editor and continue with further editing and printing. - Displays a message on the print page (customizable) - Hides website content completely - Website user is not able to print the entire website via browser This project has been sponsored by: sense-design.de | online solutions
<urn:uuid:396e6949-6815-4c35-b1dd-33406963ed80>
CC-MAIN-2017-04
https://www.drupal.org/sandbox/sense/1779656
s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560280929.91/warc/CC-MAIN-20170116095120-00426-ip-10-171-10-70.ec2.internal.warc.gz
en
0.862157
117
1.554688
2
Learn the objeto directo (OD) and the objeto indirecto (OI) in Spanish. Have you ever wondered what "lo" is in Spanish, and why Spanish speakers use it so much? In this video I will give you a Spanish class about the most commonly used pronouns in Spanish: me, te, lo, la, nos los, and las, which are known as pronombres de objectos directos y pronombres de objetos indirectos. This is a complex Spanish grammar topic, but you will learn and master direct and indirect object pronouns with ease because I make this topic friendly and approachable. You will learn why we use direct and indirect object pronouns, and how and when to use them. In this Spanish lesson I will give you a clear explanation, and you will master the object pronouns. You will know what "lo" is, and you will know it very well. Watch my video and learn one of the most difficult topics in Spanish that I make easy for your understanding and learning. Watch part two of this video and learn how to use direct and indirect object pronouns in Spanish WITH VERBS: https://youtu.be/4-YrnN4AZ4U Learn more Spanish grammar with me because I make Spanish grammar friendly. Just watch: If you think you are learning Spanish with my videos and you would like to donate so I can make more videos, I thank you. You can donate at: https://www.butterflyspanish.com/ Or through PayPal: https://www.paypal.me/ButterflySpanish Muchas gracias :) Ana at Butterfly Spanish where we learn Spanish in a fun and easy way.
<urn:uuid:98b41937-a224-4cab-b494-3b309b032d8b>
CC-MAIN-2022-33
https://coolisen.github.io/direct-indirect-object-pronouns-in-spanish-all-you-need-to-know-me-te.html
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572833.78/warc/CC-MAIN-20220817001643-20220817031643-00269.warc.gz
en
0.906948
402
4.125
4
From HTML WG Wiki added fact that @alt can also be sued on the area and input type=img elements - If we allow authors to specify any image as the placeholder image, we have given the author a means to add additional content/information to the page above and beyond the actual video, using a graphical (visual) means to do so. We have no means however of ensuring that the placeholder image is semantically linked to the video. When an author adds a video to a web page, the intent is to share that (video) information with the end user; when that same author goes to the effort of creating and posting a separate image file to be used in association with that video (as a placeholder graphic), a means of conveying intent and meaning of that image file should also exist, independent of the video file: there have been 2 creative visual efforts undertaken by the author, and each requires a means of textual representation. (This is further confirmed by the fact that both the video and the placeholder image are referenced by URI strings fetching 2 independent binary assets on the server.) The current proposed guidance for determining @alt text is dependent on author intent and context: "Is alt attribute content a replacement for an image? The answer to this question depends on the content of the image and the context the image is being used in"(http://dev.w3.org/html5/alt-techniques/)
<urn:uuid:f74b48ac-02cc-47a7-8eab-073af9ebdf07>
CC-MAIN-2017-04
https://www.w3.org/html/wg/wiki/Talk:ChangeProposals/PosterElement
s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560280872.69/warc/CC-MAIN-20170116095120-00317-ip-10-171-10-70.ec2.internal.warc.gz
en
0.918096
292
1.664063
2
Nobody likes paying for insurance, but when it comes time to file a claim, everyone is relieved that they have it. The same could be said about coatings. Some don’t like putting out the money for what they mistakenly believe to be a nonessential luxury. However, when something goes wrong that could have resulted in a catastrophic failure but only caused a minor inconvenience, they’re happy that they had the foresight to pay for coatings. For those of you who don’t know what coatings are for, their use can be summed up in one word: PROTECTION. If you look at coatings in their raw form, all you’ll see is powder. BUT, it’s a powder with a lot of technology behind it. Have you ever thought that a powder would act as a film of oil, in case of an oil pump failure? It does, and it might just be that coating that keeps your rods from hanging out the side of your block. Then there is the biggest factor for most – heat. Keeping combustion temperatures down while keeping the engine bay cooler can be achieved by using some “simple” powders. “We started using coatings back in NHRA Pro Stock about fifteen years ago in order to gain horsepower,” explained Dart founder Dick Maskin. “What we found is that not only did we gain horsepower, but we also gained added protection.” Coatings help protect everything from piston tops to the inside of oil pans. As the old saying goes, ‘An ounce of prevention is worth a pound of cure.’ “You know, I have spun cam bearings and I also know people who have, and that will just ruin your day,” Maskin said. “This is why we coat all the cam bearings in the blocks we sell, and to our knowledge, we have never heard of one fail.” Great advice from the master, but let’s dig a little deeper. Why Coat – And What Can You Coat? There are coatings for virtually every part of an internal combustion engine, which do everything from shedding oil to retaining heat. Even parts like crankshaft counterweights can be coated with an oil shedding coating, to keep the weight of the oil off the rotating assembly. Water jackets can be coated to prevent corrosion, especially important in marine applications, and lubricating coatings can be used to promote air flow on hard to port items. We are going to go over some of the popular coatings that Dart Heads offers from their coating department. The coating department at Dart's headquarters in Troy, MI. Anyone who has ever owned an iron block knows how they look after a short time, and it isn’t much better on the inside. If you have ever had an oil pump fail, you’ve most likely had to deal with spun bearings. Being smart with your money when it comes to coatings can help combat these horrific situations. Coatings are typically powders made from different compounds, that are sprayed evenly over the part through a low pressure airbrush. After the coating has been applied, it is allowed to air dry. This not the final step, however, as the coating does not properly cure until it is baked in an oven for up to an hour. During this process, the coating becomes chemically bonded, virtually becoming part of the metal itself. Coatings are designed to block heat, reduce friction, shed oil, and reduce corrosion. In order to truly understand why a coating is needed, you need to understand the three main properties you are trying to combat: Friction, Heat, and Corrosion. There are multiple factors to consider when it comes to coating a part, the first being friction. The concept is rather simple – if you can reduce the friction of a moving part, less energy is required to move it, thereby freeing up lost power. The two most common places you are probably thinking of are your piston skirts and main bearings. A Teflon based coating will act as a permanent layer of oil that will provide protection in case of oil starvation. DCB-3 Coated cam bearings (center) offer lubrication in case of oil loss. All Dart engines come with coated cam bearings pre-installed. Turbo compressor housing coated with DC-4 to increase airflow and decrease turbulence. There are numerous places aside from the inside of an engine where coatings can be beneficial. The inside of a turbo compressor housing can be coated to decrease turbulence and increase airflow. The interior of a smooth plenum can hurt fuel atomization, and adding a slight texture coating can actually promote a healthier air/fuel mixture. The last application in this line is an oil shedding coating for parts that do not need oil on them, such as rods and crankshaft counterweights. Using a coating in these instances will decrease weight on the rotating assembly. This is the second most obvious factor of an engine, the heat generated through combustion. Not only does reducing heat increase power, it also increases life. Combustion chamber components, such as piston tops and cylinder head bowls, can benefit greatly from a heat reflective coating that will keep the heat in the combustion chamber and off the parts. This promotes a better burn, while decreasing metal fatigue. A heat reflective coating can even be used on external engine parts that you don’t want to get hot, like the outside of an intake manifold. Turbo manifold coated with DC2 to keep heat in. Piston tops coated with DC2 heat reflective coating. The skirt is coated with an MOS2 Teflon coating to promote lubrication. Coatings designed to retain heat will also help keep engine bays cooler. Headers and turbo exhaust housings are prime examples of engine parts that emit excessive heat. Keeping the heat in the exhaust keeps the engine running cooler. “Alcohol and methanol engines face special challenges when it comes to corrosion,” explained Nate McInnis of Dart. “Coatings using a blend of fluorinated polymers are often used to address the harsh effects of these fuels on piston skirts, bearings, and on valve springs. As with the thermal coatings above, many of these are formulated to provide frictional benefits as well, making them doubly useful.” During our visit to Dart, we were able see that top fuel teams use this same coating on the inside of their fuel pumps and pump gears to reduce the corrosion that is also caused by Nitromethane. Funny Car pump cases and gears coated with DC-7 to resist corrosion from Nitromethane and other gases. This common corrosion application can also be used on marine applications. Salt water can wreak havoc on the outside of iron blocks (and even aluminum), and on the inside where boats use the ocean water to cool the engine. Water passages in the intake manifold, cylinder heads and block can all be coated, and can serve as a thermal barrier from surrounding components and keep coolant cooler. On a Budget? What Dart Recommends First While you can go crazy coating every conceivable part of an engine, it might not be the most economical option. Start out with the parts that are most accessible first. If you are building a new engine, that would be the time to get any internal parts coated. Dart can even coat used race parts if you are freshening up an engine. DC2 heat reflective barriers on intake manifolds keep heat out. While at Dart, we asked Richard Maskin what he would recommend as the first three coatings for someone building an engine. This is what he had to say: Cam Bearings – For oil protection. This is the number one part in the engine that is likely to not get oil early. Spinning a cam bearing can not only destroy a cam, but the block itself. Rod/Main Bearings – Again, for oil protection. The thin layer will provide lubrication if oil starvation occurs. Main bearings can cause irreparable damage to the bottom end, while a rod bearing can cause a rod to break and send pieces through your block. Piston Skirts – Also for oil protection. The piston skirt can become hot from friction if oil is starved from the cylinder walls, causing piston cracking and possible total engine failure. Turbo exhaust housing coated with DC2 to keep heat in. Dart’s Different Library: DCI MOS2 Teflon Skirt Coating – Reduce Friction Prevent piston skirt scuffing and galling, extending piston ring seal life with a DCI MOS2/Teflon skirt coating. DC2 High Temperature Reflective Heat Barrier – Protect and Enhance Protect piston tops with DC2, high temperature highly reflective heat barrier. Enhances flame propagation, reflects more heat into the combustion chamber, protecting piston tops, piston rings and lands. Ideal for any high temperature – heat reflective / insulative application like combustion chambers, valve faces, exhaust port, intake manifold, brake caliper/pad/piston. DCB-3 Engine Bearing Coating Dart’s engine bearing coating is a Molybdenum disulfide / Teflon based material with high-load / non-stick properties, providing protection to bearings and crankshaft in case of lack of lubricant or detonation. The bowls of the heads are coated with DC2 heat reflective coating, while water jackets are coated with an anti-corrosive coating. DC-4 Lubricating Coating High pressure lubricant contains a combination of lubricating pigments, including MOS2, creating exceptional wear life and load capacity in applications such as valve springs, oil pump gears, ring and pinion, transmission gear and bushing, valve stems, timing gears, bearing races, camshafts and any friction related area. DC-5 Oil Shedding Coating Oil shedding coating for applications in which oil and other petroleum liquids should be shed off rather than retained on a particular piece, such as crankshaft counterweights, inside oil pan, windage trays, inside valve covers and connecting rods. DC-6 Anti-Friction Coating Special coating for alcohol / methanol engines. Primary uses are piston skirts, bearings and valve springs. Fluorinated polymers have a low coefficient of friction and are chemically inert. Lubricates without shedding. DC-7 Anti-Corrosive Protectant Anti-corrosive protectant coating for application in an environment of exposure to weather elements, gasoline, alcohol, Nitromethane, brake fluid, and antifreeze on varied types of materials, including magnesium and aluminum. Iron cylinder head coated with DC-7 anti-corrosive coating to keep from rusting. Again, Insurance For Your Engine! While choosing a coating can seem like a complicated task because their uses vary so widely, and they have long names that are difficult to pronounce, the main thing to remember is that coatings offer protection for your expensive engine parts. Even if you don’t have brand new parts, you can still increase their effectiveness and extend their lifespan by using coatings. If you’re still confused about what coatings are best suited for your needs, call Dart. Let them know what your specific application will be used for. They will be happy to offer their advice and suggestions, and you’ll be able to rest a bit more easily knowing that you have insurance for your engine.
<urn:uuid:29b5729a-64e5-42ff-8b76-e19f811cb726>
CC-MAIN-2017-04
http://www.corvetteonline.com/tech-stories/engine/dart-coatings-101-insurance-for-your-engine/
s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560281151.11/warc/CC-MAIN-20170116095121-00107-ip-10-171-10-70.ec2.internal.warc.gz
en
0.949287
2,425
1.726563
2
Cooper Union's comprehensive 4-year structures curriculum culminates in a semester-long project wherein a team of three designs the complete structural system for a steel-and-concrete high-rise building. All aspects and stages are accounted for, from calculating tributary areas, dead loads, and concrete strength, to preparing a column schedule, to detailing footings, flat plates, and reinforcement. All drawings done in AutoCAD. Professors Ysrael Seinuk, Sheng Shi, Elizabeth O'Donnell Cooper Union; 2009
<urn:uuid:dc964b0e-9bba-48da-b799-ccb0f7ea7029>
CC-MAIN-2022-33
https://ivanhimanen.com/structures.html
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571911.5/warc/CC-MAIN-20220813081639-20220813111639-00469.warc.gz
en
0.841059
112
1.59375
2
ERIC Number: ED296221 Record Type: RIE Publication Date: 1987-Nov Reference Count: N/A Role of Social Support in Bereavement Outcomes. O'Brien, Ruth A. This study examined four propositions by which social support may impact the physical and mental well-being of the bereaved: (1) social support has a direct effect on health; (2) social support reduces stress which, in turn, affects health; (3) social support stimulates the development of coping strategies and promotes mastery, thereby affecting health; and (4) social support promotes health protective behaviors which, in turn, impact on health. Data to test the proposed model were collected through semi-structured interviews and standardized questionnaires with 490 widows and widowers at 6 weeks (T1), 6 months (T2), 12 months (T3), 18 months (T4), and 24 months (T5) following the loss of the spouse. A linear structural equation approach using the statistical program LISREL was employed in the analysis of data. A model was estimated with an adequate fit for T1, T2, and T3, but not for T4 or T5. There was no evidence for a direct effect of social support on the well-being of the bereaved. In examining the indirect effects of social support, parameter estimates were consistent with the premise that social support enhances coping behaviors which, in turn foster well-being (as evidenced by diminished illness symptomatology). Perceived stress also had a direct positive effect on illness symptomatology. (Six figures and 25 references are included.) (Author) Publication Type: Reports - Research; Speeches/Meeting Papers Education Level: N/A Sponsor: National Inst. on Aging (DHHS/PHS), Bethesda, MD. Authoring Institution: N/A Note: Paper presented at the Annual Scientific Meeting of the Gerontological Society (40th, Washington, DC, November 18-22, 1987).
<urn:uuid:90cbebd8-ffc7-4b66-9786-a92ad956ab2e>
CC-MAIN-2017-04
https://eric.ed.gov/?id=ED296221
s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560280891.90/warc/CC-MAIN-20170116095120-00161-ip-10-171-10-70.ec2.internal.warc.gz
en
0.915336
417
1.8125
2
Bullying, cyberbullying, and harassment (14) Injury and violence prevention and safety–interpersonal violence. The student understands the impact of interpersonal violence and the importance of seeking guidance and help to maintain personal safety. The student is expected to: - Health TEK 115.16 (14)(A) analyze distinguishing characteristics of cyberbullying; - Health TEK 115.16 (14)(B) describe the negative impact bullying, including cyberbullying, has on both the victim and the bully; Legal Ramifications and Other Consequences (13) Injury and violence prevention and safety-digital citizenship and media. The student understands how to be a safe and responsible citizen in digital and online environments. The student is expected to: - Health TEKS 115.16 (13)(C): Discuss the consequences of cyberbullying and inappropriate online and digital communication in relation to home and school environments.
<urn:uuid:610bc9e2-7bfa-439b-9658-26ad31cb4b29>
CC-MAIN-2022-33
https://www.davidslegacy.org/sel-elementary-modules-materials-presentations/
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571869.23/warc/CC-MAIN-20220813021048-20220813051048-00065.warc.gz
en
0.91484
187
3.390625
3
Welcome to Health Care Magic You may have to repeat the Holter for a longer duration...Event monitors usually detect TMT (Treadmill exercise ECG) / LABORATORY work-up – may be necessary Anxiety / Alcohol / Tobacco (smoking) / Caffeine (too much coffee, cola) are common causes. Medicines may be responsible – like Phenylephrine used for ‘cold’ / Salbutamol used for asthma and so on. Illicit ‘drugs’ like Amphetamine are notorious to cause abnormal beats At times, abnormal nerve paths in the heart (bypass tracts) are responsible! - If there are no clues and if the problem is still bothering to the extent of interfering with life style, there is Electro Physiological Studies (EPS) for its evaluation... Wishing speedy recovery
<urn:uuid:01b716c7-e6b8-4306-8a91-4f01ec33c52d>
CC-MAIN-2016-44
http://www.healthcaremagic.com/questions/Problem-in-Tachycardia-heart-rate-consistently-runs-in-90-EKG-and-holter-monitor-normal-Any-test-to-detect-this/386204
s3://commoncrawl/crawl-data/CC-MAIN-2016-44/segments/1476988720972.46/warc/CC-MAIN-20161020183840-00250-ip-10-171-6-4.ec2.internal.warc.gz
en
0.82597
184
2.046875
2
Regardless of age, you need to eat right and stay fit. However, as we grow older, certain types of nutrients become more important. Here is a list of some of the essential nutrients for seniors prepared by a Home Health Aide in Stockbridge, Georgia: - Calcium and Vitamin D These nutrients help in maintaining bone health. Calcium-rich foods and beverages must be for three servings, including fortified cereals, dark green leafy vegetables, and beverages such as fruit juices, milk, or fortified plant beverages. - Vitamin B12 This is a critical vitamin for older adults as vitamin B12 plays a role in cell metabolism, nerve function, cell formation, and bone health, but many people older than 50 do not get enough of this vitamin. Let Home Care Services in Georgia help you or your loved ones prepare rich sources of vitamin B12 such as fortified cereal, lean meat, and seafood. Supplements will also do, too. To stay regularly fit, eat more fiber-rich foods. Fiber also helps lower your risk for heart disease and prevent Type 2 diabetes and is mostly found in cereals, whole-grains, beans, and peas along with fruits and vegetables. Increased potassium intake may lower your risk of high blood pressure. Fruits, vegetables, and beans are good sources of potassium. You will also have to keep salt to the minimum. Nursing Services at Dignity Senior Care Services will help you and your loved ones stay healthy and fit in every way.
<urn:uuid:517dc5be-51fe-4650-b0f2-144b53efa76f>
CC-MAIN-2022-33
https://www.dignityseniorcareservices.net/special-nutrient-needs-of-older-adults
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572089.53/warc/CC-MAIN-20220814234405-20220815024405-00076.warc.gz
en
0.947069
314
2.515625
3
Problem 1. [10 points] Amdahl’s Law George P. Burdell is an avid player of the new “Jackets vs. Dawgs” sports simulation game, but is disappointed by the game’s performance on his old laptop and wants to buy a new laptop. He has determined that his old laptop’s processor spends - 50% of its time on graphics processing, - 30% of its time on physics computations, and - 20% of its time on modeling the intelligence of players (mostly for The new laptop has a processor with - a special processing unit for green, yellow, white, and red pixels, allowing the processor to process graphics 10 times as fast as on George’s old laptop - new specialized instructions such as “TCKL”, “KCK”, and “THRW” which result in physics processing that is 6 times as fast as on George’s - an improved microarchitecture, which makes everything else twice as fast as it was on George’s old laptop. What is the overall speedup of the new laptop over the old one when playing this game?
<urn:uuid:3d54e779-50d9-4806-adfd-ca535ff292cc>
CC-MAIN-2016-44
https://www.udacity.com/wiki/hpca/SampleMidterms/Midterm1/problem1
s3://commoncrawl/crawl-data/CC-MAIN-2016-44/segments/1476988725475.41/warc/CC-MAIN-20161020183845-00509-ip-10-171-6-4.ec2.internal.warc.gz
en
0.962578
257
2.921875
3
Brad Oliver says the Amish families planning to relocate to Prince Edward Island are looking forward to living and farming in rural P.E.I. MONTAGUE - Realtor Brad Oliver isn't horsing around when revealing plans to install a hitching post outside his office this spring. It's one of the more subtle changes coming to Kings County as community members prepare to welcome a large population of Amish moving to the province from Ontario. Oliver said it will soon be common to see horse-drawn buggies travelling on roads throughout central eastern P.E.I. "My office is downtown by the bank and stores, and they'll need somewhere to tie up," said Oliver. "The very first ones intend to be here in the springtime to plant crops and put up some buildings... right now they're back and forth all the time." Oliver said there are currently 10 farms that have either been sold or have contracts in place with Amish families. Those farms are in areas just east of Vernon River around the county line through to New Perth, Summerville, Greenfield and Victoria Cross. Other areas include around Cardigan, Dundas and Bridgetown. The influx is a welcome sight for many in Kings County, which is sparsely populated. Oliver, who began talks with the Amish in the summer of 2013, said there are about 18,000 residents in Kings County, including about 2,000 Buddhist monks. "There's nobody out here anymore," he said. "What we have (with the Amish) are people who want to go back out onto the farms, people who want to live in rural P.E.I. and farm." Reg Phelan, the Maritimes regional co-ordinator for the National Farmers Union, said the arrival of the Amish will be interesting to see and expected it would bring benefits to Island agriculture. "They farm in a very ecologically friendly way and diversify agriculture. I think it will be good for the land," he said. "It can help revitalize the area, and hopefully it will brighten up government and other policy makers to support the young farmers here." The Amish are traditionalist Christian fellowships, which are similar but also distinct from Mennonites. They're often known for their simple living, which excludes most modern technology and electricity. The Amish faith is also divided into many smaller communities, which range from a couple of families to more than a hundred. "Each community has their own rules and things, they tend to stay to themselves," said Oliver. "In fact, the two groups that are settling here are purposely leaving a buffer zone between themselves." Oliver said he believes more Amish families will eventually follow the original 10 moving to P.E.I. "I could sell another 10 farms today if I had the right farms. There's a lot of interest."
<urn:uuid:2b17beea-acc2-453c-90d8-c9abf7322dc2>
CC-MAIN-2017-04
http://www.theguardian.pe.ca/news/local/2016/2/3/amish-are-on-the-way-4424824.html
s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560279933.49/warc/CC-MAIN-20170116095119-00122-ip-10-171-10-70.ec2.internal.warc.gz
en
0.974894
605
1.578125
2
The Foundry's RollingShutter Plug-in Tackles CMOS Skew and Wobble Effects Leading visual effects software developer, The Foundry, has announced the release of RollingShutter, a brand new plug-in tool for After Effects and Nuke, which tackles the image-distortion problems often experienced by users of CMOS cameras. Rolling shutter effects are commonly found with video cameras employing CMOS image sensors, which record every frame line-by-line from top to bottom of the image, rather than as a single snapshot of a point in time. As parts of the image are recorded at different times, moving objects can become distorted and appear skewed. Problems can also arise with flashing or strobing lights. Aside from not looking great, 3D tracking during VFX post production can become a very difficult task as the tracking points themselves are unstable. The Foundry's RollingShutter plug-in tackles skew and perceived ‘wobble' problems from the VFX artist's perspective. The plug-in will often vastly improve the look of distorted footage, by either minimising or eradicating image distortions. Unlike solutions tied to camera stabilisation, that stretch the image as a whole, the RollingShutter plug-in compensates for local skewing and distortion in the scene, by correcting each object individually. This approach even allows the digital artist to correct objects moving in different directions in locked-off shots. RollingShutter is therefore particularly good at enabling software camera trackers to work effectively on a wide range of problematic footage. "The CMOS camera is becoming an increasingly important and popular tool in filmmaking," said Tom Cowland, plug-in product manager at The Foundry. "Our new RollingShutter product will provide a helping hand to artists working with affected footage during post production. The demonstration of our initial idea, developed by The Foundry's chief scientist Simon Robinson, received a lot of attention at NAB 2009, and encouraged by this feedback we have been working hard to productise it in a timely fashion." Victor Wolansky, FX PHD professor commented, "As one of the beta testers for The Foundry's RollingShutter, I have been very impressed with its assistance in making skewed footage trackable. So much so that I've decided to teach it as part of my FX PHD camera tracking curriculum." RollingShutter is available for After Effects CS3 & CS4 and Nuke 5.1 or later for $500/£300 (nodelocked). SPECIAL AUGUST PROMOTION Buy one get one free! Buy a license of RollingShutter in August and The Foundry will provide a second copy absolutely free. RollingShutter can work on both After Effects and Nuke systems or workstation and laptop at the same time. A video demonstration of RollingShutter, plus examples showing how its approach differs, can be found at http://www.youtube.com/TheFoundryChannel. Additional product detail and demo licenses can be found at http://www.thefoundry.co.uk.
<urn:uuid:88e08ba8-cafa-4908-8041-9a8e9e983f82>
CC-MAIN-2017-04
http://www.eventdv.net/Articles/PrintArticle.aspx?ArticleID=55556
s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560280221.47/warc/CC-MAIN-20170116095120-00238-ip-10-171-10-70.ec2.internal.warc.gz
en
0.945644
637
1.835938
2
|Pericles, Prince of Tyre| | Act 1, Scene 4 Previous scene | Next scene Enter CLEON, the governor of Tarsus, with DIONYZA, and othersCLEON My Dionyza, shall we rest us here,DIONYZA And by relating tales of others' griefs, See if 'twill teach us to forget our own? That were to blow at fire in hope to quench it;CLEON For who digs hills because they do aspire Throws down one mountain to cast up a higher. O my distressed lord, even such our griefs are; Here they're but felt, and seen with mischief's eyes, But like to groves, being topp'd, they higher rise. Who wanteth food, and will not say he wants it, Or can conceal his hunger till he famish? Our tongues and sorrows do sound deep Our woes into the air; our eyes do weep, Till tongues fetch breath that may proclaim them louder; That, if heaven slumber while their creatures want, They may awake their helps to comfort them. I'll then discourse our woes, felt several years, And wanting breath to speak help me with tears. I'll do my best, sir.CLEON This Tarsus, o'er which I have the government,DIONYZA A city on whom plenty held full hand, For riches strew'd herself even in the streets; Whose towers bore heads so high they kiss'd the clouds, And strangers ne'er beheld but wondered at; Whose men and dames so jetted and adorn'd, Like one another's glass to trim them by: Their tables were stored full, to glad the sight, And not so much to feed on as delight; All poverty was scorn'd, and pride so great, The name of help grew odious to repeat. O, 'tis too true.CLEON But see what heaven can do! By this our change,DIONYZA These mouths, who but of late, earth, sea, and air, Were all too little to content and please, Although they gave their creatures in abundance, As houses are defiled for want of use, They are now starved for want of exercise: Those palates who, not yet two summers younger, Must have inventions to delight the taste, Would now be glad of bread, and beg for it: Those mothers who, to nousle up their babes, Thought nought too curious, are ready now To eat those little darlings whom they loved. So sharp are hunger's teeth, that man and wife Draw lots who first shall die to lengthen life: Here stands a lord, and there a lady weeping; Here many sink, yet those which see them fall Have scarce strength left to give them burial. Is not this true? Our cheeks and hollow eyes do witness it.CLEON O, let those cities that of plenty's cupLord And her prosperities so largely taste, With their superfluous riots, hear these tears! The misery of Tarsus may be theirs. Enter a Lord Where's the lord governor?CLEON Speak out thy sorrows which thou bring'st in haste, For comfort is too far for us to expect. We have descried, upon our neighbouring shore,CLEON A portly sail of ships make hitherward. I thought as much.Lord One sorrow never comes but brings an heir, That may succeed as his inheritor; And so in ours: some neighbouring nation, Taking advantage of our misery, Hath stuff'd these hollow vessels with their power, To beat us down, the which are down already; And make a conquest of unhappy me, Whereas no glory's got to overcome. That's the least fear; for, by the semblanceCLEON Of their white flags display'd, they bring us peace, And come to us as favourers, not as foes. Thou speak'st like him's untutor'd to repeat:Lord Who makes the fairest show means most deceit. But bring they what they will and what they can, What need we fear? The ground's the lowest, and we are half way there. Go tell their general we attend him here, To know for what he comes, and whence he comes, And what he craves. I go, my lord.CLEON Welcome is peace, if he on peace consist;PERICLES If wars, we are unable to resist. Enter PERICLES with Attendants Lord governor, for so we hear you are,All Let not our ships and number of our men Be like a beacon fired to amaze your eyes. We have heard your miseries as far as Tyre, And seen the desolation of your streets: Nor come we to add sorrow to your tears, But to relieve them of their heavy load; And these our ships, you happily may think Are like the Trojan horse was stuff'd within With bloody veins, expecting overthrow, Are stored with corn to make your needy bread, And give them life whom hunger starved half dead. The gods of Greece protect you!PERICLES And we'll pray for you. Arise, I pray you, rise:CLEON We do not look for reverence, but to love, And harbourage for ourself, our ships, and men. The which when any shall not gratify,PERICLES Or pay you with unthankfulness in thought, Be it our wives, our children, or ourselves, The curse of heaven and men succeed their evils! Till when,--the which I hope shall ne'er be seen,-- Your grace is welcome to our town and us. Which welcome we'll accept; feast here awhile, Until our stars that frown lend us a smile. ExeuntEnter GOWERGOWERHere have you seen a mighty king His child, I wis, to incest bring; A better prince and benign lord, That will prove awful both in deed and word. Be quiet then as men should be, Till he hath pass'd necessity. I'll show you those in troubles reign, Losing a mite, a mountain gain. The good in conversation, To whom I give my benison, Is still at Tarsus, where each man Thinks all is writ he speken can; And, to remember what he does, Build his statue to make him glorious: But tidings to the contrary Are brought your eyes; what need speak I? Enter at one door PERICLES talking with CLEON; all the train with them. Enter at another door a Gentleman, with a letter to PERICLES; PERICLES shows the letter to CLEON; gives the Messenger a reward, and knights him. Exit PERICLES at one door, and CLEON at anotherGood Helicane, that stay'd at home, Not to eat honey like a drone From others' labours; for though he strive To killen bad, keep good alive; And to fulfil his prince' desire, Sends word of all that haps in Tyre: How Thaliard came full bent with sin And had intent to murder him; And that in Tarsus was not best Longer for him to make his rest. He, doing so, put forth to seas, Where when men been, there's seldom ease; For now the wind begins to blow; Thunder above and deeps below Make such unquiet, that the ship Should house him safe is wreck'd and split; And he, good prince, having all lost, By waves from coast to coast is tost: All perishen of man, of pelf, Ne aught escapen but himself; Till fortune, tired with doing bad, Threw him ashore, to give him glad: And here he comes. What shall be next, Pardon old Gower,--this longs the text. Shakespeare homepage | Pericles | Act 1, Scene 4 Previous scene | Next scene
<urn:uuid:c70c28b3-50d1-4dea-b0b7-a94fea6c0d2f>
CC-MAIN-2017-04
http://shakespeare.mit.edu/pericles/pericles.1.4.html
s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560283008.19/warc/CC-MAIN-20170116095123-00087-ip-10-171-10-70.ec2.internal.warc.gz
en
0.939459
1,782
2.203125
2
T his is the reality: If you are an IT manager at a medium or large-sized enterprise, your infrastructure is going to get more virtual — and quickly—over the next few years. Why? server virtualization in 2010 or they are more likely to do it to improve overall IT efficiency. So what should IT do to prepare for this inevitable invasion of server virtualization? How are you going Because the benefits created by virtualization— to get from 20% virtualization to 60% virtualization in consolidation, reduced power consumption, three years or less? scalability, flexibility and an improved ROI—are The first and by far most critical step is to make simply too compelling to ignore. sure that you have in place an infrastructure that The pressure on IT to deliver more using fewer is optimized for virtualization. A virtual-ready resources is not going away no matter what happens infrastructure should enable you to add and allocate with the economy. The analyst firm Gartner expects resources dynamically as needed and should also more than 60% of server workloads to be virtualized provide virtualization capabilities across the entire within the next three years, up from today’s estimated infrastructure: Servers, storage and networks. range of 15% to 20%. It should support the rapid rollout of servers What’s more, virtualization is going to spread and services and provide all of the benefits of rapidly to a broader cross section of mission- virtualization, such as reduced costs, lower energy critical functions —think virtualized corporate consumption and improved operational efficiencies. databases, corporate finance and all of your It should also “future-proof” your infrastructure with company’s various homegrown applications. In an architecture that will last by supporting a variety a recent survey by InformationWeek, 73% f IT of standards as well as all types of devices. Finally, it professionals said they will either continue to do should be simple to install and easy to manage. If the goal is to get beyond 20% virtualization— What You Should Look and it should be—there are several important features that you will require from your virtual-ready for in a Solution infrastructure platform, including: Since a virtual-ready infrastructure will define the • Support for heterogeneous hypervisors. While data center of the future, the obvious next question VMware has been the dominant platform to date, is: When is the right time to make the move? The there are now other options – notably Microsoft’s answer, quite simply, is this: If you choose the right Hyper-V – and it will be important to have flexibility technology solution, there is no better time to make for multiple solutions within the IT infrastructure. the move than now. By not being tied into one hypervisor, organizations Why? Because you will be able to achieve immediate can seamlessly re-target their workloads between cost benefits and consolidate space in your data center. physical servers and virtual servers without having to You will also be able to create an architecture where go through a time-consuming conversion process. it will be much simpler and cost efficient when the Basically, you never know which hypervisor is going inevitable time comes to add IT resources to support to provide the best performance or features in the the changing demands of the business. future, so why lock yourself into one solution? A Guide To Rolling out a Virtual-Ready Infrastructure Dell offers a four-step methodology for moving to a virtual-ready infrastructure. The goal is to make the transformation more manageable, particularly in environments where existing operational policies must be respected, such as IP address administration, network access restrictions, storage security and service-level requirements. Step 1: This begins in the server department. It involves a simple and non-intrusive mechanism for deploying a Dell AIM environment and building an inventory of servers. Processes include automatic server discovery and remote Step 2: This incorporates tools and methodologies for migrating existing workloads to central storage and gradually transitioning from local booting to booting from central storage. Functions include centralized booting and the creation of personas, which are software constructs that combine the server’s operating and installed applications with metadata that describes its unique properties and configuration. Step 3: This requires cooperation across departments, particularly between the server and network departments. It incorporates automated network topology management. Step 4: The transformation is completed by automating server image configuration and integration with other management software in the ecosystem through Dell AIM abstraction and APIs. • The ability to manage both virtual and physical servers. Many individuals and Taking AIM at organizations are still not fully comfortable with virtualization.With the right virtual-ready Virtualization infrastructure, the organization should be able to seamlessly migrate between virtual machines and There are many management solutions that physical machines. So, while the infrastructure aspire to be virtual-ready. However, when you focus can be in place for virtualization, it doesn’t have on the features that will be truly important to the to be an all-or-nothing proposition. This way, the infrastructure as it becomes more virtual—features organization can still have the architecture for a such as one management platform for physical virtual-ready infrastructure, but if it isn’t ready and virtual machines and support for multiple to virtualize the Oracle database or Microsoft hypervisors —the one solution that really “gets it” Exchange, for example, it doesn’t have to do so. is the Dell Advanced Infrastructure Manager (AIM). • Rapid provisioning of servers, storage and AIM provides integrated virtualization management network devices. With a virtual-ready infrastructure across the infrastructure so, in addition to supporting you should be able to instantly provision servers, centralizing booting of physical servers, AIM boots storage and network connectivity without having hypervisor stacks or virtualization host operating to make physical changes to the servers, cables or systems—such as VMware ESX, Microsoft Hyper-V storage area networks (SANs). The infrastructure or Red Hat Xen—from central storage. This enables should also be based on industry standards so IT can IT to dynamically manage the number of servers that take advantage of all existing assets. This can help are part of virtualized environments. In addition to the to save money and also ensure that as you refresh hypervisors noted above, Dell AIM will also support your technology base—servers, SANs, switches and SUSE XEN and Citrix XenServer in the future. other networking devices—all of your technology As the data center moves forward from 20% investment is “future-proofed” and will be supported virtualization, it will be important to extend the same no matter what happens in the data center. management paradigm for bare metal services to The other important feature to look for in a virtual- include virtual resources as well. If you look at current ready infrastructure is a management platform data centers, there are generally two different groups that is software-based and resides on a separate handling physical servers and virtual servers because physical server or virtual machine. This way the the management philosophies are different. management of the infrastructure is separated However, by offering one simple solution for from the infrastructure itself, which means the managing both environments, AIM makes it easier management platform does not impact performance for IT to manage resources and to prepare IT and also enables the infrastructure and applications departments for the inevitable influx of virtualization. to continue to operate unaffected by anything taking It also helps to blur the line between virtual and place at the management layer. physical environments, enabling flexible resource sharing and workload mobility. By enabling the same server image to move between physical and virtual resources AIM eases the path toward a more virtual AIM automatically discovers a virtualization host The Path to 60% and all virtual machines configured on that host. The process of discovering this host is the same Virtualization as the one used for physical servers. AIM also enables the repurposing of virtual machines and The shift to a virtual-ready infrastructure is With the right virtual-ready infrastructure, the organization should be able to seam- lessly migrate between virtual machines and either boots them directly using images stored on inevitable. The benefits are too compelling and the standard storage devices or by using images stored opportunities too great to ignore. In a recent survey in proprietary formats such as VMware VMDK and by Symantec on the 2010 State of the Data Center, Microsoft Hyper-V VHDs. more than 70% of IT professionals rated virtualization AIM also provides specific advantages in as either somewhat or absolutely important as a data managing VMware environments. AIM enables rapid center initiative for 2010. What’s more, virtualization and dynamic provisioning of physical resources is expanding from servers into networks and required to estimate, expand and shrink VMware storage. IT departments realize they must remove ESX clusters. A common, shared pool of bare-metal the boundaries between the separate silos that have servers can be used to service the needs of any been artificially erected within their IT organizations. cluster. The path to 60% or greater virtualization is clear and it starts with a virtual-ready infrastructure. How A Next-Generation Infrastructure Can Facilitate The Use of Virtualization Dell’s AIM enables a virtual-ready data center that Many mid-sized and large enterprises have different helps organizations address operational, procedural silos for servers, storage and networking. Moving to a and cultural challenges. next-generation virtual-ready data center will require some changes in procedures, but using Dell AIM In addition to the technical challenges in moving as the foundation makes the transition much easier beyond 20 percent virtualization, many businesses compared with solutions from other vendors. must also overcome organizational, procedural and AIM still allows servers, storage and networks to cultural obstacles that can hamper virtualization be administrated separately, but it helps to fill in the usage. The Dell Advanced Infrastructure Management gaps between these functions, automating many architecture for a virtual-ready infrastructure has been of the tasks involved in provisioning new servers as designed from the ground up to help IT come up with well as new storage and networking devices. In this innovative and elegant solutions to address some of way, the various administrators remain in charge of these organizational challenges. their own domains. In contrast, other solutions forces For example, one of the key issues in many separate tools for network and server administrators, organizations is whether IT has the authority to take often putting them in conflict. business applications into a virtual environment. One While choosing the right technology can be critical in key concern is performance: Will running a hypervisor helping companies overcome the obstacles preventing slow down the responsiveness of the application? them from moving beyond 20 percent virtualization, it Another is control: Some business managers, in also sometimes helps to have a valued, experienced finance or HR for example, may want to be on a partner. Understanding some of the challenges faced dedicated physical server. With AIM, IT can easily by others can help you plan and adapt your own revert a workload back to a bare-metal server in the processes. Dell offers a ProConsult practice in this area, time it takes to reboot the server. called Virtualization Operations Readiness Assessment, Another organizational and cultural issue has to which focuses on helping organizations assess, plan, do with the way in which the data center operates. design and implement virtualization projects.
<urn:uuid:1afa0fe3-3773-404b-8793-f7e3064879be>
CC-MAIN-2017-04
http://www.slideshare.net/dellenterprise/gettingbeyond20virtualization42-100414134642phpapp01-4799104
s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560280891.90/warc/CC-MAIN-20170116095120-00159-ip-10-171-10-70.ec2.internal.warc.gz
en
0.906326
2,468
1.570313
2
Although there are many important criteria that need to be met when deciding who is a good candidate for bariatric surgery, it appears body mass index may not have to be high on the list. A new Canadian study finds factors other than B-M-I, like diabetes, are more important in predicting the risk of death in patients eligible for bariatric surgery. University of Alberta researchers looked at nearly 16,000 obese people with an average B-M-I of 36.2. An adult with a BMI over 30 is considered obese. Results show age and type-2 diabetes were the strongest risk factors for death within 10 years, while B-M-I was the weakest. Researchers say the next step would be to determine a low, moderate, and high risk threshold to help people make an informed decision.
<urn:uuid:6b9925c5-f8ff-4d32-975f-8966920092d4>
CC-MAIN-2017-04
http://www.mysuncoast.com/health/news/bariatric-surgery-risk-factors/article_bdcef216-367c-11e3-8c43-001a4bcf6878.html
s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560279650.31/warc/CC-MAIN-20170116095119-00436-ip-10-171-10-70.ec2.internal.warc.gz
en
0.95451
166
2.78125
3
Krishnamurti to Himself: His Last Journal Jiddu Krishnamurti, "Krishnamurti to Himself: His Last Journal" 1993 | pages: 89 | ISBN: 0062506498 | PDF | 4,4 mb Krishnamurti's last journal, spoken into a tape recorder at his home, Pine Cottage, in the Ojai Valley, brings the reader close to this renowned spiritual teacher. Dictated in the mornings, from his bed, undisturbed, Krishnamurti's observations are captured here in all their immediacy and candor, from personal reflections to poetic musings on nature and a serene meditation on death. Reflecting the culmination of a life of spiritual exploration, these remarkable final teachings engage and enlighten. Buy Premium From My Links To Support Me & Download with MaX SPeeD!
<urn:uuid:6d101376-9eed-4237-ab98-069258ad15bf>
CC-MAIN-2016-44
http://freshrls.com/1429455-krishnamurti-to-himself-his-last-journal.html
s3://commoncrawl/crawl-data/CC-MAIN-2016-44/segments/1476988718309.70/warc/CC-MAIN-20161020183838-00404-ip-10-171-6-4.ec2.internal.warc.gz
en
0.8962
185
1.601563
2
Researchers at the MD Anderson Cancer Center say a newly identified gene, DEAR1, may serve as a biomarker for high risk of local recurrence, especially for younger women with triple negative breast cancer. They studied tissues from tumors of 123 women whose breast cancer began between ages 25 and 49 and advanced to invasive disease. Of these, 56 percent had lost DEAR1 ((ductal epithelium-associated ring chromosome 1) expression. This correlated with a family history of breast cancer and with triple-negative disease. The authors suggested that measurement of DEAR1 expression “could be an important marker to stratify early-onset breast cancer patients for increased vigilance in follow-up and adjuvant therapy.” “The correlation with local recurrence is significant because so many young women have recurrences in the breast, and cancers that do recur tend to be more aggressive,” said senior author Ann McNeill Killary, Ph.D., professor in M. D. Anderson’s Department of Genetics. “Young age has been considered a risk factor for local recurrence and metastasis. It is important to understand the genetic mechanisms operating in early-onset breast cancer and to determine whether there is a way to identify young women who might be at a higher risk of recurrence.”
<urn:uuid:5ee74942-0fbb-4801-9758-a22a5990ec33>
CC-MAIN-2022-33
https://patriciaprijatel.com/2009/05/dear1-gene-could-explain-triple-negative-breast-cancer/?noamp=mobile
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571190.0/warc/CC-MAIN-20220810131127-20220810161127-00071.warc.gz
en
0.949249
272
2.3125
2
What is a birth chart, and how do I get one? Whether you are a fan of astrology or not, chances are you have heard the term "birth chart", or "natal chart". You may even know someone who has seen a professional astrologer for guidance and advice, and has perhaps paid to receive a birth chart. But what exactly is it all about? A birth, or natal chart is essentially a stylized map of the planets and their arrangement at the exact moment you were born. It is mapped out using the person's name, date of birth, location at time of birth (city, state, and country), and exact time of birth. Each person's birth chart is unique, and this is because the planets are constantly moving both in their own courses of orbit, and through the zodiac. They are at a different position in the sky and the zodiac with each passing second. This is the reason each chart is unique to the individual it represents, and a big reason why the exact time of birth really helps accuracy. No two people are alike, and no two birth charts are exactly the same. However, they will all look a little something like this: What will I learn from my birth chart? While the image above looks a little chaotic, it is describing planetary relationships. The planetary relationships outlined in a person's birth chart can give insight into what a person's relationships will be like, challenges he or she may face, motivations, personal strengths/weaknesses, family and money matters, and one's life purpose can all be detailed within a birth chart. Yes, all of that information is contained in that colorful, seemingly non-sensical image! How much does it cost? Well, the cost really depends on who is doing the writing for you. Prices vary, and can be inexpensive (I've seen as low as $4.00) or they can be a bit more expensive. I've seen some going for $40. There are also options online at varying websites that are offered at no cost. A well-known site is Astrolabe. Really, you don't have to spend anything if you don't want to, but be aware that the free sites won't give you as much detail...you have to pay for the real juicy stuff. Can I do my own birth chart? Do I have to pay for someone to do it for me? Nope, you absolutely don't have to pay, and yes, you can do your own! It's not that difficult to write your own birth chart, either. Thanks to modern technology, computer software has made it much easier for us to draw up birth charts accurately and quickly. There's also a plethora of sources out there to assist you on your mission. If you're entirely new to the subject of astrology, some books can actually be pretty dense and somewhat overwhelming. Astrology has its own language, and that language can be complicated at first. If you feel that you're dedicated and up to the task of creating your own birth charts either for yourself or for others (it's a really fun hobby, and people will be amazed at your talent), there are a ton of great astrology books that can help guide you, whether you decide to take a serious approach to astrology, or simply want to have an enjoyable, refreshing hobby. I hope this article was helpful for you. I highly recommend either having someone draw up a chart for you, or making one yourself. You'll likely find that it's an enlightening tool that will better help you to explore and understand yourself and what drives you.
<urn:uuid:425f1049-b0df-405a-90e8-0ad0014aa5b0>
CC-MAIN-2017-04
http://www.infobarrel.com/What_Exactly_Is_An_Astrological_Birth_Chart
s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560280221.47/warc/CC-MAIN-20170116095120-00236-ip-10-171-10-70.ec2.internal.warc.gz
en
0.975554
745
1.671875
2
At the time it arrives to learning, money must not be the object. It is, but one must forever try to get the greatest education that money can purchase. It defines saving up for the fee of tuition of the top most universities. The education, however, can be as sheer as that of schools. In most of the cases, they are also more costly. Here is a top 10 most expensive schools in the world. 10. Purnell School, Pottersville, New Jersey This boarding school only educates girls from the grade of ninth to 12th. Conscription stands at 94 students along with total 18 staff members, providing it a remarkable ratio of student to teacher of just more than five students for each teacher. The cost of this school is $52,800 for each year. 9. Sandy Spring Friends School, Sandy Spring, Maryland This is an introductory school connected with the Quakers which educates students from the nursery level to the way of 12th grade. It was recognized in the year 1961 and initially served total 77 students in the standard 10th as well as 11th standard. The grade 12th was added one year later. The school even has a general program for global students, putting them in the classes as per to their proficiency level in the English. Cost: $52,850 per year 8. Salisbury School, Salisbury, Connecticut This school just admits boys from the grade 9th to 12th levels. It has a very discriminating acceptance procedure such that just a 3rd of entire applicants are acknowledged. Cost: $53,015 per year. 7. Dana Hall School, Wellesley, Massachusetts The school was first shaped to assist students get ready for life in the Wellesley College. With support from the Charles Dana, the Dana Hall School was started in the year 1881 to help offer education of liberal arts for young female. Cost: $53,211 per year. 6. Idyllwild Arts Academy, Idyllwild, California However the school was just started in the year 1986, it can map out its roots to 1946 at the time Dr. Max Krone formed the Foundation of Idyllwild Arts. It was specified to the Southern California’s University in the 1946 earlier than the Foundation recovers independent management and sole ownership of the school in the center of 80s. Cost: $53,600 per year. 5. Appleby College, Oakville, Ontario For those people who live in the particular area and don’t wish the boarding facilities of school, the charges goes downward to just $35,989 for each year. This is a global school that educates students from the 7th grade to the 12th grades. Cost: $53,911 per year. 4. Woodside Priory School, Portola Valley, California Also recognized as The Priory, the school was launched in the year 1957 by Fr. Egon Javor. It educates students from the 6th grade to 12th grades. It educates students generally from the Bay Area, this school swank of the international structure of 16 nations. Cost: $53,925 per year. 3. St. Albans School, Washington D.C. This Episcopal school is situated in the Washington D.C. and educates students from the 4th to 12th grades. This school founded by Harriet Lane Johnston in the year 1909. It has approx 575 students as well as 100 staff members. Cost: $54,151 per year 2. College Alpin International Beau Soleil, Villars-sur-Ollon, Switzerland This was launched in 1910 in the Gstaad chalet earlier than it shifted to its existing location a period later. Its complete enrollment is just 200 students. It has educated students of European royals and other popular people. Cost: $93,158 per year 1. Institut Le Rosey, Rolle, Switzerland Also recognized as Rosey, this is a private, boarding international school situated in Rolle in the Switzerland. Established by Emile Carnal in 1880, it is also recognized by “School of Kings”. Cost: $99,566 per year.
<urn:uuid:2ae10a50-1e1c-4301-9c84-52a7c7e2f606>
CC-MAIN-2017-04
http://alltoptens.com/top-ten-expensive-schools-world/
s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560280763.38/warc/CC-MAIN-20170116095120-00512-ip-10-171-10-70.ec2.internal.warc.gz
en
0.970089
867
1.679688
2
- Research article - Open Access Key bottlenecks to the provision of safe obstetric anaesthesia in low- income countries; a cross-sectional survey of 64 hospitals in Uganda BMC Pregnancy and Childbirth volume 17, Article number: 387 (2017) Despite recent advances in surgery and anaesthesia which significantly improve safety, many health facilities in low-and middle-income countries (LMICs) remain chronically under-resourced with inability to cope effectively with serious obstetric complications (Knight et al., PLoS One 8:e63846, 2013). As a result many of these countries still have unacceptably high maternal and neonatal mortality rates. Recent data at the national referral hospitals in East Africa reported that none of the national referral hospitals met the World Federation of Societies of Anesthesiologists (WFSA) international standards required to provide safe obstetric anaesthesia (Epiu I: Challenges of Anesthesia in Low-and Middle-Income Countries. WFSA; 2014 http://wfsa.newsweaver.com/Newsletter/p8c8ta4ri7a1wsacct9y3u?a=2&p=47730565&t=27996496). In spite of this evidence, factors contributing to maternal mortality related to anaesthesia in LMICs and the magnitude of these issues have not been comprehensively studied. We therefore set out to assess regional referral, district, private for profit and private not-for profit hospitals in Uganda. We conducted a cross-sectional survey at 64 government and private hospitals in Uganda using pre-set questionnaires to the anaesthetists and hospital directors. Access to the minimum requirements for safe obstetric anaesthesia according to WFSA guidelines were also checked using a checklist for operating and recovery rooms. Response rate was 100% following personal interviews of anaesthetists, and hospital directors. Only 3 of the 64 (5%) of the hospitals had all requirements available to meet the WFSA International guidelines for safe anaesthesia. Additionally, 54/64 (84%) did not have a trained physician anaesthetist and 5/64 (8%) had no trained providers for anaesthesia at all. Frequent shortages of drugs were reported for regional/neuroaxial anaesthesia, and other essential drugs were often lacking such as antacids and antihypertensives. We noted that many of the anaesthesia machines present were obsolete models without functional safety alarms and/or mechanical ventilators. Continuous ECG was only available in 3/64 (5%) of hospitals. We conclude that there is a significant lack of essential equipment for the delivery of safe anaesthesia across this region. This is compounded by the shortage of trained providers and inadequate supervision. It is therefore essential to strengthen anaesthesia services by addressing these specific deficiencies. This will include improved training of associate clinicians, training more physician anaesthetists and providing the basic equipment required to provide safe and effective care. These services are key components of comprehensive emergency obstetric care and anaesthetists are crucial in managing critically ill mothers and ensuring good surgical outcomes. Low- and middle-income countries are faced with many competing challenges and public health threats, which are often exacerbated by poor health care. Global initiatives to improve public health have traditionally focused on immunization, sanitation, nutrition, and infectious diseases in low and middle income countries (LMICs). The total volume of surgery undertaken worldwide has recently been estimated for 2004 as 234 million (95% confidence interval, 187.2 million-281.2 million) procedures per year, in comparison with 136 million births worldwide in 2006 . Obstetrics is therefore critical to public health, with safe surgery and safe anaesthesia being critical components of comprehensive emergency obstetric care. Anaesthesia is one of the medical specialties which has sought to improve the quality of health care and patient safety in these regions by setting standards for safe practice in anesthesia that were adopted by the World Federation of Societies of Anesthesiologists (WFSA) . These standards were specifically determined to ensure minimal error and prevent harm to patients by addressing the needs of LMICs whereby the presence of an appropriately trained and experienced anesthetist is the main determinant of patient safety during anesthesia. These standards also include a provision for monitoring, which has been shown to reduce risks by detecting the consequences of errors as well as giving early warning when the condition of a patient deteriorates [3, 4]. Therefore it is expected that high-level facilities offering anesthesia during major operations, should be meeting the minimum WFSA standards. However, evidence from a recent study conducted at five national referral hospitals across East Africa (Uganda, Kenya, Tanzania, Rwanda and Burundi) showed that none of these hospitals had all the WFSA requirements available to provide safe obstetric anaesthesia . Some of the documented challenges anaesthetists and surgeons face in many low-income countries include a critical shortage of trained providers, poor facilities and a lack of essential drugs, equipment and supplies . Additionally, there is limited published information describing the standards of anaesthesia practice not only at national referral hospitals but also at regional and district hospitals as these provide most anaesthetic care in such countries. Specifically caesarian sections (CS) are top priority of the World Health Organization (WHO) . We therefore set out to estimate the proportion of high level hospitals in Uganda that meet the WFSA international standards, specifically among those that provide obstetric anaesthesia. Additionally, we sought to identify key bottlenecks in the provision of safe obstetric anaesthesia. This is important to improve patient safety by implementing recommendations to minimize the risks and addressing some of the main causes that lead to poor outcomes . This was a cross-sectional survey conducted in Uganda from September 2014 to August 2015. A total of 64 hospitals across Uganda were selected based on the criteria that they provided obstetric anaesthesia. At least 15 hospitals from each region; East, West, North and Central were included for representativeness. This study was part of a larger comprehensive survey of the emergency and anaesthesia services in Uganda conducted during the corresponding authors’ National Institutes of Health (NIH) funded fellowship in Global Health where peri-operative data was collected following the World Federation of Societies’ of Anaesthesiologists (WFSA) international guidelines for safe anaesthesia. A survey tool to evaluate compliance was developed based on WFSA Guidelines and the WHO Safe surgery checklist. Additionally we evaluated demographic data on staffing, availability of equipment, monitors, and drugs. These included pre-operative assessment of patients, staffing and continuous monitoring intra-operatively and post-operatively. In this report we have included the peri-operative components of staffing, availability of equipment, monitors, and drugs recommended for safe anaesthesia by the WFSA. We purposefully selected all the 12 regional referral hospitals because these are level 3 centres and the lower health centres usually refer patients here for surgery. We also randomly selected hospitals from the other groups to include general (government district hospitals), private for profit and private not for profit hospitals. The survey tool comprised of 3 components, the first was an interviewer-administered questionnaire to one Anaesthetist available at each hospital with the aim of understanding the quality of anaesthesia care. The second was a checklist to objectively assess the obstetric theatres. The third was another interviewer-administered questionnaire with the Directors of the hospital in order to document other challenges faced in delivery of anaesthesia care at the government and private hospitals. Data on caesarean sections and anaesthetists countrywide was obtained from the ministry of health. With the help of the statistician, data was subsequently cleaned and, coded, into Epidata version 3.1. Range, consistency and validity checks were built in to minimize errors. Data was exported and analyzed using STATA version 14 (Statcorp, College Station, Texas, USA). We dichotomised according to drugs and 15 facility variables available in theatre and postoperative recovery areas including functional anaesthesia machine, oxygen source, reservoir oxygen source, continuous Blood Pressure, Continuous ECG, and Continuous pulse oximetry, suction machine, laryngoscope, Endotracheal tubes (ETT), Face Masks and Laryngeal Mask Airways (LMA), Stethoscope, Difficult Airway Cart, Defibrillator, Capnograph and availability of ICU facilities for post-operative care of complicated cases. Ethical approval was obtained from Makerere University School of Medicine Research and Ethics Committee (SOMREC), the appropriate hospital ethics committees for participating hospitals, and the Uganda National Council for Science and Technology Ethics Committee. Informed consent was obtained from all individuals participating in the study. We contacted 64 hospitals in Uganda, 41% of all the hospitals in the country . The hospital directors reported the major challenges faced during delivery of obstetric anaesthesia being few anaesthesia providers. Of 64 hospitals evaluated, 54/65 (84%) did not have a trained physician anaesthetist, 59/64 (92.2%) had ≥1 nurse anaesthetist and 5/64 (8%) had no trained providers for anaesthesia (Table 1). There were reports of deficiencies in regional anaesthetics supplies throughout the country, and other essential drugs like antacids and anti-hypertensive drugs (Fig. 1). The availability of monitors for anaesthesia varied (Table 2). Table 3 shows the hospitals compliance to WFSA International standards for safe anaesthesia and only 3 facilities (4.7%) fulfilled the standards. In our study we considered 15 facility variables available in theatre and postoperative recovery areas including functional anaesthesia machine, oxygen source, reservoir oxygen source, continuous Blood Pressure, Continuous ECG, and Continuous pulse oximetry, suction machine, laryngoscope, Endotracheal tubes, Face Masks and Laryngeal Mask Airways, Stethoscope, Difficult Airway Cart, Defibrillator, Capnograph and availability of ICU facilities for post-operative care of complicated cases. We noted that many of the anaesthesia machines present were obsolete models without functional safety alarms and/or mechanical ventilators (Fig. 2). Our observations of postoperative recovery facilities revealed them to be poorly equipped in regional referral and general hospitals when compared to the private facilities (Table 2). Continuous ECG was only available in 3/64 (5%) of hospitals. Figure 3 shows the intraoperative availability and usage of monitoring equipment. The main challenges to provision of safe anaesthesia highlighted from the key informant interviews with the hospital directors at the study sites include: Few anaesthetic providers, a high patient load, under funding of the anaesthesia service and lack of local protocols to guide patient management (Fig. 4). In 2015 there was a total of 79,417 cesarean sections reported from the Ministry of Health and 280 associate clinician anaesthetists as received from the District reports. For every 1000 cesarean sections there was an average of 4 associate clinician anaesthetists and 0.1 physician anaesthetist. Our cross-sectional study represents almost 50% of all the hospitals in Uganda providing maternity and emergency surgery services. Of the 64 hospitals 4% did not have a trained physician anaesthetist, 92% had ≥1 nurse anaesthetist, while 8% had no trained anaesthesia staff at all; neither physician nor associate clinicians. In this 8% “anaesthetic assistants” who merely learnt a few limited techniques “on the job” conducted anaesthesia, or alternatively the district called in an anaesthetist from a neighbouring district to help and several patients were actually referred for surgery in other districts if they failed to get an anaesthetist. In Uganda Anaesthesia is a growing discipline with an increase from 13 in 2007 to just over 50 physician anaesthetists in the country in the last 10 years; mostly concentrated in larger urban areas. While there are about 280 associate clinician anaesthetists they are spread out thinly mostly in rural areas and yet these hospitals are barely equipped with the required facilities and drugs for safe anaesthesia. Complicated cases therefore need to be referred to bigger hospitals introducing significant delay in transport resulting in high maternal mortality and morbidity . The global shortage of healthcare workers is estimated to be at 4.2 million, with approximately 1 million more workers needed in sub-Saharan Africa alone [12, 13]. In high-income countries fully accredited physician or nurse anesthetists provide anesthesia. Regrettably as we have identified in Uganda, there are parts of the world where anesthesia providers have only technical training, and sometimes not much of that. The WFSA views anesthesia as a medical practice, but acknowledges that access to anesthesia would not always be possible without the contribution of associate clinicians . The mere availability of pulse oximetry will not, in and of itself, improve patient care. Anesthesia providers must actually make use of these monitors, and respond appropriately to the information they provide. This implies certain other resources, such as oxygen and the means to manage hypoventilation and maintain a patent airway. It also implies a fairly comprehensive knowledge of the relevant physiology, and an understanding of clinical anesthesia . Safe anesthesia practice in any region depends on the knowledge and skills of those who live and work there. Education is the catalyst by which local standards can be improved, and it serves as the vehicle through which local aspirations to the internationally accepted standards of health care expected in the high-income world can be realized . In a 2016 systematic review article , anaesthesia contributed to 13.8% of all maternal deaths after cesarean sections with the overall risk of any maternal death when associate clinicians provided care was 9.8 per 1000 (95% CI 5.2–15.7), compared to 5.2 per 1000 (0.9–12.6) for physician anaesthetists. The underlying causes were reported for 124 maternal deaths (24 studies). Of all deaths, 56 (45%) resulted from airway complications such as difficult or failed tracheal intubation, oesophageal intubation, bronchospasm, ventilation difficulties, and hypoxia; 38 (31%) from pulmonary aspiration; 34 (27%) from issues related to staff competency, poor pre-assessment, intraoperative monitoring, and equipment failure. Other causes included cardiac arrest at induction or during the procedure (seven [6%]), high spinal anaesthesia (eight [6%]), and drug overdose or adverse reactions (seven [6%]). Aside from the limited number of anesthesia personnel in Uganda, there are frequent stock outs of regional anaesthetics and other essential drugs throughout the country. There was also variable availability of monitoring equipment in government and private hospitals. Only 3 (5%) of the hospitals had all the 15 variables in the operating theatre and recovery room, meeting the WFSA International standards for safe anaesthesia. Other bottlenecks in provision of safe anaesthesia in Uganda included the lack of local protocols and guidelines for patient management, shortage of blood and blood products for transfusion, poorly serviced equipment and under funding of the anesthesia service. The strengths of our study are that it was conducted at 64 hospitals in Uganda, representing 41% of all the hospitals in the country and 100% of the government regional referral hospitals, 15% of government district hospitals and 33% of all private hospitals in the country. Our recommendations are hereby generalizable to low-income countries that face similar challenges. We acknowledge that this study is limited by the fact that it was a cross-sectional survey and some hospitals were purposefully selected for representation of government regional referral and district hospitals, and private for profit and not-for profit hospitals. This could have introduced a degree of selection bias, but individual anaesthetists were selected by simple random sampling depending on their availability at the hospital. While the United Nations Millennium Development Goals targeted a 75% reduction in maternal mortality ratio (MMR) by 2015, many countries failed to reach the goal and some failed to achieve any reduction at all. Uganda has still not met the target with a 2015 MMR of 343 deaths per 100,000 live births . Many of these deaths are preventable and access to safe anaesthesia and quality cesarean section services have an important role. We conclude that there is an urgent need to strengthen anaesthesia services in Uganda; to train more physician anaesthetists, improve training of associate clinicians and provide necessary equipment and drugs required for safe anaesthesia. These services are a key component of comprehensive emergency obstetric care and appropriately trained anaesthetists have a key role in the critically ill mother and ensuring improved surgical outcomes. In addition there is need to develop local guidelines for safe anaesthesia. This will be a great step towards implementing the World Health Assembly Resolution 68.15: Strengthening Emergency and Essential Surgical Care as a Component of Universal Health Coverage. Intensive care unit Laryngeal mask airway Low-and middle-income countries University of California Global Health Institute Uganda National Council for Science & Technology Ethics Committee World Federation of Societies’ of Anaesthesiologists World Health Organization Weiser TG, Regenbogen SE, Thompson KD, Haynes AB, Lipsitz SR, Berry WR, Gawande AA. An estimation of the global volume of surgery: a modelling strategy based on available data. Lancet. 372(9633):139–44. Merry A, Cooper J, Soyannwo O, Wilson I, Eichhorn J. An iterative process of global quality improvement: the international standards for a safe practice of anesthesia 2010. Can J Anesth. 2010;57(11):1021–6. Keenan RL BC. Decreasing frequency of anesthetic cardiac arrests. J Clin Anesth. 1991;3:354–7. Moller JT JN, Espersen K, Ravlo O, Pedersen BD, Jensen PF RN, Rasmussen LS, Pedersen T, Cooper JB, Gravenstein JS, Chraemmer Jorgensen B DM, Wiberg Jorgensen F, Heslet L, Johansen SH. Randomized evaluation of pulse oximetry in 20,802 patients. II. Perioperative events and postoperative complications. Anesthesiology. 1993;78:444–53. Epiu I, Mijumbi C, Chokwe T, Lugazia E, Twagirumugabe T, Ndarugire F, Tindimwebwa J VB, Dubowitz G. Challenges of anesthesia in low-and middle-income countries: a cross-sectional survey of access to safe obstetric anesthesia in East Africa. Anesth Analg. 2017;124(1):290–9. Grimes CE, Bowman KG, Dodgion CM, Lavy CB. Systematic review of barriers to surgical care in low-income and middle-income countries. World J Surg. 2011;35(5):941–50. Monitoring Emergency Obstetric Care: A Handbook. WHO. Evidence of unsafe care in developing and transitional countries [http://www.who.int/patientsafety/research/evidence_of_unsafe/en] World Health Organisation. Accessed Oct 2016. Hospital Categories Ministry of Health Uganda. [http://health.go.ug/affiliated-institutions/hospitals]. Accessed Nov 2017. Hodges SC, Mijumbi C, Okello M, McCormick BA, Walker IA, Wilson IH. Anaesthesia services in developing countries: defining the problems. Anaesthesia. 2007;62(1):4–11. Barnes-Josiah D, Myntti C, Augustin A. The three delays, as a framework for examining maternal mortality in Haiti. Soc Sci Med. 1998;46(8):981–93. Crisp N GB, Sharp I. Training the health work-force: scaling up, saving lives. Lancet. 2008;371:689–91. Chen L ET, Anand S et al. Human resources for health: overcoming the crisis. Lancet. 2004;364:1984–90. Enright A, Merry A. The WFSA and patient safety in the perioperative setting. Can J Anesth. 2009;56(1):8–13. Sobhy S, Zamora J, Dharmarajah K, Arroyo-Manzano D, Wilson M, Navaratnarajah R, Coomarasamy A, Khan KS, Thangaratinam S. Anaesthesia-related maternal mortality in low-income and middle-income countries: a systematic review and meta-analysis. Lancet Glob Health. 4(5):e320–7. Maternal Mortality Ratio The World Bank. [http://data.worldbank.org/indicator/SH.STA.MMRT]. Accessed July 2017. Support for manuscript writing provided by Fogarty International Center, National Institutes of Health (grant # D43TW009771 “HIV co-infections in Uganda: TB, Cryptococcus, and Viral Hepatitis). This study was sponsored by the National Institutes of Health; (NIH Research Training Grant Number #R25TW009343) during the corresponding author’s 2014/2015 Post-doctoral Fellowship in Global Health with UCGHI. Availability of data and materials The datasets generated and analyzed during the current study are available from the corresponding author on reasonable request. Questionnaires are available at https://www.ncbi.nlm.nih.gov/pubmed/27918334. Ethics approval and consent to participate Ethical approval was obtained from Makerere University School of Medicine Research and Ethics Committee (SOMREC), P. O. Box 7072 Kampala, Uganda. +256,414,530,020. The Uganda National Council for Science & Technology Ethics Committee (UNCST), P. O. Box 6448 Kampala, Uganda +256,414,705,500. Consent to participate in the study was obtained form participants. Consent for publication The authors declare that they have no competing interests. Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. About this article Cite this article Epiu, I., Wabule, A., Kambugu, A. et al. Key bottlenecks to the provision of safe obstetric anaesthesia in low- income countries; a cross-sectional survey of 64 hospitals in Uganda. BMC Pregnancy Childbirth 17, 387 (2017). https://doi.org/10.1186/s12884-017-1566-3 - Safe Anaesthesia - Obstetric Anaesthesia - Low-income countries - Caesarean section - Health system - Maternal mortality - Universal health care
<urn:uuid:71b9b17b-2363-470e-b8a4-87a1ced6dcc4>
CC-MAIN-2022-33
https://bmcpregnancychildbirth.biomedcentral.com/articles/10.1186/s12884-017-1566-3
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572033.91/warc/CC-MAIN-20220814113403-20220814143403-00267.warc.gz
en
0.921464
5,001
2.046875
2
Homing endonuclease gene Keywords: homing endonuclease gene Description: Homing endonuclease genes (HEGs) are ‘selfish’ genetic elements that combine the capability to selectively disrupt specific gene sequences with the ability to rapidly spread from a Homing endonuclease genes (HEGs) are ‘selfish’ genetic elements that combine the capability to selectively disrupt specific gene sequences with the ability to rapidly spread from a few individuals to an entire population through homologous recombination repair events. Because of these properties, HEGs are regarded as promising candidates to transfer genetic modifications from engineered laboratory mosquitoes to wild-type populations including Anopheles gambiae the vector of human malaria. Here we show that I-SceI and I-PpoI homing endonucleases cleave their recognition sites with high efficiency in A. gambiae cells and embryos and we demonstrate HEG-induced homologous and non-homologous repair events in a variety of functional assays. We also propose a gene drive system for mosquitoes that is based on our finding that I-PpoI cuts genomic rDNA located on the X chromosome in A. gambiae. which could be used to selectively incapacitate X-carrying spermatozoa thereby imposing a severe male-biased sex ratio. Mosquito species of the Anopheles gambiae complex represent the major vectors of human malaria and they pose an enormous burden on global health and economies. Every year 300–500 million people are infected by malaria and over a million people die as consequence of Plasmodium parasite infections (1 ). While many insect pests have long been successful targeted with population control measures such as insecticides or release of sterile males (2 ), for others, including A. gambiae. classical control measures have largely failed to deliver long-term solutions. Disease endemic countries often do not have the economic resources and the logistics to sustain control efforts like the massive and prolonged use of insecticides. New control strategies that are affordable, easy to implement and sustainable are desperately needed. This global health problem has prompted an unprecedented effort aimed at generating new molecular tools and a better understanding of the biology and the genetics of Anopheline mosquitoes that culminated in the sequencing of the A. gambiae genome (3 ) and development of gene transfer technology for a series of vectors species (4 ,5 ). These molecular advances have made it possible to express genes that can block the transmission of Plasmodium in model systems (6–8 ) or express traits facilitating the implementation of sterile insect techniques for vector control (9 ). The translation of these achievements in suitable control measures still represents a major scientific and technical challenge. Genetically modified mosquitoes carrying a desired trait such as malaria refractoriness would need to be released on a gigantic scale given the vast numbers of these insects and the wide areas that are inhabited by vectors of human tropical diseases. Therefore, a mechanism must be developed to spread the desired genetic modification from a few laboratory-reared mosquitoes to a large fraction of the wild-type vector population (10 ,11 ). Naturally occurring ‘selfish’ genetic elements that have non-mendelian inheritance mechanisms and spread through populations even when they provide no benefit to the host organism (12 ) have been proposed to transform wild-type mosquito populations. Homing endonuclease genes (HEGs) are highly specific DNA endonucleases found in some viruses, bacteria and eukaryotes. The endonuclease promotes the movement of its encoding DNA from one allele to the other by creating a double-strand break (DSB) at a specific, long (15–40 bp) target site in an allele that lacks the HEG. Homologous DNA repair then copies the HEG to the cut chromosome in a process called ‘gene conversion’ (13 ,14 ). The observation that HEGs can be engineered to cleave novel DNA sequences (15–18 ) offers a multitude of opportunities to utilize these elements for mosquito control. For example, HEGs could be used to disrupt genes regulating the ability of Anopheles mosquitoes to function as efficient vectors for Plasmodium parasites, or to drive recombinant refractory genes through a mosquito population, rendering them unable to transmit malaria. Alternatively, HEGs designed to target an essential mosquito gene or a gene required for female fertility could be utilized to introduce a genetic load on the population leading to population size reduction or collapse (19 ). More recently, it has been suggested that a harmful selfish element put under the control of a promoter which is active in individuals susceptible to Plasmodium infection but inactive in refractory individuals should drive alleles causing refractoriness through the population (20 ). Finally, HEGs could be used to bias the sex ratio towards males, using an endonuclease that targets X-linked sequences and is expressed during male spermatogenesis from the Y chromosome (19 ). To investigate the feasibility of using HEGs as driving genetic element in mosquitoes, we have analysed the activity of ectopic HEGs in both A. gambiae cells and embryos, using experimental systems that are highly predictive of in vivo behaviour of mobile genetic elements (21 ,22 ). We determined the activity of two well-characterized HEGs, I-PpoI (a member of the His-Cys box family of endonucleases from the slime mold Physarum polycephalum ) (23–25 ) and I-SceI (a LAGLIDADG class endonuclease originally isolated from Saccharomyces cerevisiae mitochondria) (26–28 ), both of which have been used in a variety of organisms (including Drosophila ) to induce DNA DSBs (29–32 ). We systematically analysed the nature of HEG-mediated integration and recombination events in A. gambiae and the effect of expressing these endonucleases on cell proliferation. The target plasmids pBC/SacRB S1/S2/S3 and pBC/SacRB P1 were constructed as follows: pBC/SacRB (21 ) was cut with SalI and PstI, ends filled in with T4 DNA polymerase and religated to remove a redundant EcoRI site. Linkers were created by annealing 5′ phosphorylated oligonucleotides (S1: AATTCATTACCCTGTTATCCTAG and AATTCTAGGGATAACAGGGTAATG; S2: AATTCGATAGGGATAACAGGGTAATTG and AATTCAATTACCCTGTTATCCCTATCG; S3: AATTCAATTACCCTGTTATCCCTACCG and AATTCGGTAGGGATAACAGGGTAATTG; P1: AATTCCGCTACCTTAAGAGAGTCG and AATTCGACTCTCTTAAGGTAGCGG), which were cloned into the now unique EcoRI site in the SacRB CDS. Selection against SacRB was performed in LB agar lacking NaCl containing 15% sucrose (w/v) and chloramphenicol (25 μg/ml). To create pSL-SacRB Tet. the minimal 1.5 kb tetracycline (Tet) resistance cassette from pBR322 was amplified with the primers TTCAAGAATTCTCATGTTTGACAG and ATGAATTCTGCTAACCAGTAAGGCAACC and cloned into pBC/SacRB with EcoRI. The Tet cassette replaces the I-SceI site and disrupts the SacRB gene. The 3.4 kb SacRB Tet cassette was moved to pSLfa1180fa (33 ) using XhoI/XbaI to create pSL-SacRB Tet . To create pDR-CMV-GFP, the CMV promoter from pEGFP-Ppo was amplified with the primers AAAGGGCCCTAGTTATTAATAGTAATCAATTACGGGGTCATTAG and AAAGAATTCGATCTGACGGTTCACTAAACCAGCTC and cut with ApaI and EcoRI. The fragment was ligated into partially ApaI and EcorI digested pDR-GFP (34 ). This replaces the 3′ part of the chicken β-actin promoter with CMV. To remove the remaining sequences of the chicken β-actin promoter, the resulting vector was cut with SnaBI and religated. PSL-Act-EGFP was constructed in pSLFa1180fa to contain the 2.5 kb Drosophila Actin 5C promoter driving EGFP (BamHI/XbaI fragment) and the Drosophila Hsp70 terminator. Cells from the stable anchorage-dependent A. gambiae cell line, Suakoko 4 (Sua 4.0) (Müller,H.M. et al.. 1999) were cultured in Schneider's Drosophila medium (Invitrogen) supplemented with 10% FCS (Invitrogen) and 200 U/ml penicillin and 200 μg/ml streptomycin sulphate (Invitrogen) in a cooled incubator at 27°C. In vivo HEG activity assays were performed by lipid-mediated transient transfections (Effecten, Qiagen) of 1–3 × 10 5 cells with 2 μg/ml (culture volume) recipient plasmid and 4 μg/ml donor plasmid. When necessary, cells were heat-shocked for 1 h at 41°C, 24 h post-transfection to induce expression of I-SceI from the Drosophila Hsp70 promoter on the pP[v+, 70 I-SceI] plasmid. Total DNA was extracted 48 h post-transfection (Promega Wizard Genomic DNA purification Kit) and re-suspended at 25–40 μl. This preparation was used to transform Escherichia coli DH5α strain. Anopheles gambiae adult females (G3 strain) were allowed to deposit their embryos 72 h after a blood meal on a moist filter paper. Embryos were injected 60–120 min after oviposition, essentially as described (35 ). Embryos were injected with a mixture of I-SceI donor plasmid pP[v+, 70 I-SceI] (400 μg/ml), Tet donor plasmid pSL-SacRB Tet (500 μg/ml) and HEG target plasmid pBC/SacRB S1 (500 μg/ml). Between 150 and 200 embryos were microinjected and 12 h later embryos were heat-shocked for 1 h at 41°C and left to recover for 2 h. Low molecular weight DNA was extracted (21 ), re-suspended in 20 μl and 150 ng of the recovered DNA was used to transform E. coli DH5α strain. Genomic DNA was digested with ClaI in the presence and absence of I-PpoI. As a probe we used a 2 kb rDNA PCR fragment amplified from genomic DNA using the primers GCCGAAGCAATTAGCCCTTAAAATGGATG and CACCAGTAGGGTAAAACTAACCTGTCTCACG. The probe was P 32 labelled using the High Prime DNA labelling kit (Roche) and purified with ProbeQuant™ G-50 columns (GE Healthcare). For primer extension, genomic DNA was digested with HincII (a.k.a. HindII). The reaction was performed essentially as described (36 ) using the 5′ P 32 -labelled primer rPrex GTTAATCCATTCATGCGCGTCACTAATTAG and vent (exo-) polymerase (New England Biolabs). The reaction products were resolved on a 6% denaturing polyacrylamide gel. Results for both experiments were visualized using a FUJIFILM-FLA-5000 Phosphoimager (Fuji Photo Film Co. Ltd, Stamford, CT, USA). For in vitro digestions, we used commercially available I-PpoI (Promega) and I-SceI (New England Biolabs) enzymes. Sua 4.0 cells were transfected with either of the two endonuclease plasmids (4 μg/ml) together with pIB/V5-His (2 μg/ml), conferring resistance to blasticidin (Invitrogen). Forty-eight hours post-transfection, blasticidin was supplemented to complete medium at 50 μg/ml. Cells were incubated in blasticidin for an initial proliferation period of 5 days, at which point they were harvested and re-seeded at 1.5 × 10 5 cells/ml and grown for a further 5 days. Transfections were performed in triplicates and cell numbers for each were counted in four replicates. Anopheles gambiae Sua 4.0 cells were transfected with pEGFP-Ppo, pEGFP-Ppo H98A and the control pSL-Act-GFP, and 48 h later cells were fixed for 5 min in 4% paraformaldehyde and permiabilized for 10 min with 0.1% Triton X-100. Nuclei were stained with DAPI (2 ng/μl) and actin filaments with Alexa546-phalloidin (1 U/ml, Invitrogen). Cell micrographs were taken at ×40 magnification using a Zeiss widefield microscope. I-SceI and I-PpoI expression constructs and their activity in A. gambiae cells. (a ) Maps of HEG expression and target vectors used in the interplasmid activity assay. CMV, cytomegalovirus promoter; Hsp70, Drosophila heatshock protein 70 promoter; eGFP . The I-SceI or I-PpoI recognition sites were inserted in the SacRB sequence after Glu67, downstream of the signal peptide required for secretion (39 ), at a position predicted not to be essential (40 ). We assessed the effect of inserting several recognition site variants in different frames on SacRB activity. None of the inserted amino acid variants (pBC/SacRB S1: ITLLSL. pBC/SacRB S2: D RDNRV I, pBC/SacRB S3: N YPVIP I for I-SceI; pBC/SacRB P1: ATLRE for I-PpoI) interfered with SacRB function as inferred by the continued inability of bacteria transformed with these vectors to grow on Cam supplemented with 15% sucrose (data not shown). We therefore concluded that the SacRB gene is tolerant to amino acid insertions at this position and a variety of recognition sequences of natural and reengineered HEGs could be inserted and tested using this approach. We transfected the plasmids pP[v+,70I-SceI] and pEGFP-Ppo together with their corresponding target pBC/SacRB S1 and pBC/SacRB P1 into A. gambiae Sua4.0 cell lines ( Figure 1 a). The plasmid pP[v+,70I-SceI] (30 ) expresses the I-SceI ORF with an N-terminal SV40 NLS and hemagglutinin (HA) tag under the control of the Drosophila Hsp70 promoter, which directs a significant inducible expression of I-SceI in Sua4.0 cells ( Figure 1 d, lanes 2 and 3). The plasmid pEGFP-Ppo expresses the EGFP-I-PpoI fusion protein containing a SV40 NLS ( Figure 1 a and d) under the control of the CMV promoter. An inactive variant pEGFP-Ppo H98A (Raymond Monnat personal communication) was used as a control. Cells were heat-shocked for 1 h at 41°C 24 h post transfection and DNA extracted after an additional 24 h. Under these experimental conditions, we observed that the target plasmids were cut in vivo by the corresponding endonuclease ( Figure 1 b). Digestion of DNA extracted from transfected cells with purified endonucleases in vitro revealed the presence of a fraction of endonuclease resistant plasmids ( Figure 1 b, lanes 6–10, white arrow), possibly generated by non-homologous religation of HEG-mediated cleavage events. To recover and analyse non-homologous end joining (NHEJ) events generated in mosquito cells, total DNA (which includes plasmid DNA) extracted from transfected cells was used to transform bacterial cells plated on Cam or Cam/Suc selective media. Compared to control experiments (target plasmid only), transfection of mosquito cells with I-SceI- or I-PpoI expressing plasmids increases the number of Cam/Suc resistant clones by 15- and 8-fold, respectively ( Figure 1 c). By comparing the colony numbers on Cam and Cam/Suc plates of bacteria transformed with recovered DNA from A. gambiae cells, we found that ∼0.5–2% of recovered plasmids allowed growth on Cam/Suc as compared to Cam alone. This indicates that although HEG cleavage is efficient ( Figure 1 b) only a small number of these plasmids are subsequently religated. Plasmids from Cam/Suc-resistant bacterial cells were isolated and digested with BamHI and HindIII endonucleases. Only plasmids showing a 1.8 kb band, indicating the presence of an intact SacRB gene ( Figure 1 a), were analysed by sequencing ( Figure 2 ). This step was undertaken to ensure that sucrose resistance is due to HEG-mediated disruption of SacRB, as we occasionally observed the growth of Cam/Suc-resistant bacteria in the absence of a HEG expression vector ( Figure 1 c). Digestion of plasmids with BamHI/HindIII in the presence of I-SceI or I-PpoI showed that all recovered clones were also resistant to endonuclease cleavage in vitro (data not shown). The sequence of the regions surrounding the HEG cleavage sites was analysed in plasmids recovered from Cam/Suc-resistant bacteria ( Figure 2 ). All 27 sequenced clones showed deletion events of variable sizes, ranging from 1 to 80 bp, close to the predicted HEG cleavage site. We did not observe any nucleotide insertions, contrary to reports of NHEJ repair products in human cell lines (41 ,42 ). DNA sequence analysis of clones created by HEG cleavage and non-homologous repair. (a ) Clones of pBC/SacRB P1 isolated from Sua4.0 cells after co-transfection with I-PpoI expression vector pEGFP-Ppo. (b ) Clones of pBC/SacRB S1 isolated from Sua4.0 cells .
<urn:uuid:def01743-4e8b-4c00-88bd-4329894b3b02>
CC-MAIN-2017-04
http://xn----itbkqkfiq.xn--p1ai/4/homing-endonuclease-gene.php
s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560283008.19/warc/CC-MAIN-20170116095123-00079-ip-10-171-10-70.ec2.internal.warc.gz
en
0.92385
4,033
3.046875
3
Alex Manly, black newspaper editor and Republican party leader in Wilmington, published the Wilmington Daily Record, which described itself as "the only negro daily in the world." The Record covered local as well as national news and championed the interests of the black community. Manly is usually remembered for an editorial he published during the violent "white supremacy campaign" of 1898. The article was in response to a speech by a white supremacist, Rebecca Felton, who charged that black males were raping white women and needed to be suppressed. Manly countered that the whole black race should not be blamed for the folly of a few. He also argued that in many cases of so-called rape, the white women were willing participants until the liaison was revealed. In conclusion, he pointed out the hypocrisy of white supremacists who railed against black "rapists" while overlooking the many whites who were debauching black women. Under headings such as "An Insult to the White Women of North Carolina," Democratic newspapers republished Manly's editorial to convince white voters that blacks condoned rape and favored miscegenation. In Wilmington itself, well-armed whites gathered on the day after the election to denounce "black Republican rule" and issue an ultimatum to the black community that Manly must leave the city. By this time Manly was already gone, but the white posse, receiving no reply to its demand, sacked and burned the office of the Daily Record. In the ensuing riot several people (mostly blacks) were shot, the Republican city council was replaced by a Democratic one, and many prominent blacks were forced into permanent exile. Manly appealed to President William McKinley to reverse this coup d'état, but neither the president nor North Carolina's Republican governor, Daniel L. Russell, would take action. Manly moved to Philadelphia, where his later career remains obscure. Helen G. Edmunds, The Negro in Fusion Politics (1951). Harry Hayden, The Story of the Wilmington Rebellion (1935). http://core.ecu.edu/umc/wilmington/scans/ticketTwo/hayden.pdf (accessed July 29, 2014). Wilmington Daily Record, 18 Aug. 1898. Wilmington Messenger, 8–11 Nov. 1898. "Alex Manly and wife, Carolina Sadgwar Manly." Photograph. 1925. Digital Collections, East Carolina University. http://digital.lib.ecu.edu/4183 (accessed July 29, 2014). "Milo Manly." Photograph. [undated]. Digital Collections, East Carolina University. http://digital.lib.ecu.edu/4180 (accessed July 29, 2014). "Alexander Manly." Biographical Sketches, The North Carolina Election of 1898. The North Carolina Collection, UNC University Libraries. http://www2.lib.unc.edu/ncc/1898/bios/manly.html (accessed July 29, 2014). 1 January 1991 | Miller, Daniel R.
<urn:uuid:79a53064-8beb-4c64-9395-bbc204eca64c>
CC-MAIN-2017-04
http://www.ncpedia.org/biography/manly-alex-1
s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560280835.60/warc/CC-MAIN-20170116095120-00475-ip-10-171-10-70.ec2.internal.warc.gz
en
0.951592
627
2.859375
3
The Burden of Proof An article I wrote recently about New Jersey shifting the burden of proof in individualized education program hearings is generating a lot of thoughtful reader comments. The issue: When a school creates an IEP for a student and the provisions of the plan are disputed, who has to prove their case? Does the school have to prove that it is doing the right thing, or do the parents have to prove that the school's plan is wrong? In 2005, the Supreme Court decided in the case Schaffer v. Weast that, in the absence of any other state law, the "party seeking relief" should always have the burden of proof. Practically speaking, the ruling means that it's the parents' job to prove that the school is wrong, because parents are most likely to be the party seeking relief. New Jersey, however, recently passed a law stating that no matter who is complaining about the IEP, it's the school's job to prove that its plan is appropriate for the child. You can read more of the details in the article. Feel free to join the lengthy conversation that is already taking place in the comments appended to the bottom of the story, or to talk about the topic here.
<urn:uuid:09627815-13fb-419a-9e19-52ce427db787>
CC-MAIN-2017-04
http://blogs.edweek.org/edweek/speced/2008/02/the_burden_of_proof.html
s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560279410.32/warc/CC-MAIN-20170116095119-00163-ip-10-171-10-70.ec2.internal.warc.gz
en
0.974311
251
1.65625
2
Congratulations to this result of their master thesis SolMate. We highly appreciate the competences in sustainability at Phoenix Design. Winners of the German Sustainability Award Design 2021: Chris Götze and Winfried Werthmann Stuttgart, 10.12.2020 Phoenix designers win German Sustainability Award Design 2021 Phoenix designers Chris Götze and Winfried Werthmann win the first time awarded German Sustainability Award Design with their master's thesis SolMate - Solar energy for everyone. The work was written as part of the Eco Innovative Design master's program at the Johanneum University of Applied Sciences in Graz. Congratulations and we highly appreciate the competences in sustainability at Phoenix Design. Self-produced solar power lowers electricity costs and significantly reduces the carbon footprint. But not everyone has the opportunity to install their own solar system on the roof. Phoenix designers Chris Götze and Winfried Werthmann are addressing this problem in the product SolMate, that was realized in cooperation with the start-up EET. That's because the modern SolMate photovoltaic and storage system makes solar power accessible to practically everyone - and so easily that even technical laymen can do it. The solar panels are simply mounted where there is space and sunshine, for example on the balcony railing, and the storage unit is plugged into a standard power socket - that's it! Self-generated, green electricity flows directly into the household's power grid via this socket and is thus available throughout the entire home. Of course, SolMate is also suitable for additional applications, such as the caravan, the garden shed or even as a green emergency power solution. SolMate, unlike most rooftop systems, has an integrated emergency power supply. And the fact that you don't need an official permit or a contract with the electricity provider to operate it makes the product even more appealing. 37 entrepreneurs were chosen as winners of the first German Sustainability Award Design on December 03. Among a total of 9 competitions, the national award was presented in design for the first time. Phoenix designers were honored in the building and furnishings category. Design legend Dieter Rams also expressed his gratitude via video message for being awarded the first DNP Design Honorary Award. Juror of the jury of design and sustainability experts Tobias Lutz, founder of the Architonic platform, commented on the submissions: "All winners are united by their potential to drive the change towards more sustainability - in very different ways. We hope that the award will support the companies to position themselves in the market thanks to the dynamics of this guiding idea and motivate others to work on innovative projects as well." About the German Sustainability Award: The German Sustainability Award is the national award for excellence in sustainability. With now nine competitions - including for companies, cities and municipalities, research, start-ups and, this year, a brand new one for design - the award is the largest of its kind in Europe. The award is presented by the Stiftung Deutscher Nachhaltigkeitspreis e.V. (German Sustainability Award Foundation) in cooperation with the German federal government, leading municipal associations, business associations, civil society organizations and research institutions. The German Sustainability Award Design was initiated to honor groundbreaking products. The new award is based on the goals of the UN's 2030 Agenda for Sustainable Development and is intended to provide orientation for consumers at a time when sustainable design is more in demand than ever. About Phoenix Design: Phoenix Design is a design and innovation studio creating smart and substantial brand experiences that make eminent business sense and which touch people – today, for tomorrow. Since 1987, products, interactions, and digital ecosystems have been created based on the fundamental values of Logic, Morals, and Magic. More than 800 design awards (1st place – iF World Design Index, Design Studios) confirm the quality and continuity of the worldwide work, i. a. the award of honour "Red Dot: Design Team of the Year 2018". Today, the team comprising 80 international experts at the Stuttgart, Munich, and Shanghai locations – together with its partners – are creating a joint vision of Smart Living. www.phoenixdesign.com/en Franziska Warnke Communication Manager M +49 173 7294632
<urn:uuid:df2840f0-dc49-41ab-90a4-2d924fe9c4e1>
CC-MAIN-2022-33
https://phoenixdesign.com/cn/company/presse/pressreleases/gewinner-des-deutschen-nachhaltigkeitspreises-design-2021-chris-gotze-und-winfried-werthmann/
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571745.28/warc/CC-MAIN-20220812170436-20220812200436-00473.warc.gz
en
0.945772
907
1.5625
2
What is House Flipping? – Earn More With Real Estate Everyone wants to earn money and while some people turn to the stock market, others turn to concrete things, most of the time, real estate. Purchasing property is great and can mean lots of money earned. It can also mean money lost, depending on how you manage your purchases and sales. House flipping is a term used to describe a process of purchasing real estate, usually houses or apartments, then selling them later on, but at a bigger price. The term flipping can be applied to any sort of real estate and not just houses or apartments. This is a possible way of earning money and people have used it. Could you do it? Possibly, yes. Based on the Market, Flipping Could Work Given that the real estate market goes in circles and is called cyclical, flippers, or rather, people who live by house flipping, can profit. If there is a boom in the market and the property you own is in demand, or properties in the area you own a property, you could make a lot of money. On the other hand, if the market is not booming and is at its slowest part, you will never earn money by selling your property. Actually, you will end up losing money if you sell properties when the market is at a slow pace, if you can actually sell it. You need buyers if you want to sell something. How to Earn by House Flipping – When to Buy, When to Sell The real estate market changes and shifts. If you want to purchase a property which you would later sell, you would need to judge whether it is a property which will retain value or if it’s in a neighborhood where the value will go up. Purchasing should be done before a neighborhood goes up in value and selling when it is at its peak. That sounds amazing, but finding a market’s peak isn’t easy. You would have to be a good judge of the market in general, and experience is mandatory. Should You Try House Flipping? House flipping can be done by anyone who has enough money to purchase a property and has enough courage to enter such a market. You could do it, but you should do some research before entering a business which can lose you money. You could earn money, but also lose it. It ends up being gambling if you haven’t enough knowledge about how real estate works. In order to avoid that, you should learn from an expert. Be Vary Once You Start If you see great, too good to be true, amazing deals, you should skip them. They most often are. Things which seem like they have value might actually not, like old, haunted houses. This also falls under the area of research but you should know these things even before starting as these are the most common ones. These are the things you need to know about house flipping, the things which will help you understand it and get into it.
<urn:uuid:21b58228-3a82-4d96-b047-7e9680be9c1b>
CC-MAIN-2022-33
https://www.creasey-biles-king.co.uk/what-is-house-flipping-earn-more-with-real-estate/
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882573399.40/warc/CC-MAIN-20220818185216-20220818215216-00077.warc.gz
en
0.971809
617
1.710938
2
Norway has set an ambitious target of quintupling the country’s seafood production by 2050, and much of this growth is to come from aquaculture. The new HAVBRUK2 programme is designed to achieve this. The primary objective of the HAVBRUK2 programme is to generate knowledge and solutions for socially, economically and environmentally sustainable growth in the Norwegian aquaculture industry. Among other things, the programme will give priority to research on societal perspectives, management and markets. “We need to know more about the role of the aquaculture industry in society in order to realise these growth expectations,” says incoming chair of the programme board Aud Skrudland. One example she cites is that there is plenty of research documenting farmed fish as a safe and healthful food, but this documentation does not appear to have enough impact on public perception. We need to understand more about why this is the case. Aud Skrudland of the Norwegian Food Safety Authority is board chair for the Research Council’s new aquaculture programme. (Photo: Sigurd Aarvig) Willing to take risks The HAVBRUK2 programme incorporates seven thematic priority areas, most of them continued from the previous programme period. The programme will fund projects spanning the entire range from basic knowledge development to problem-solving and innovation. “Traditionally, public funding has primarily been used to finance basic research,” explains Ms Skrudland, “and this will continue to be a task under the new programme. At the same time, we know that more pioneering research may be needed, which is why we want to offer funding for more experimental proposals that can better encompass wild ideas with major potential but higher risk.” NOK 200 million in available funding The programme is now accepting grant applications for its first call for proposals, with submission deadlines of 9 September for Researcher Projects and 14 October for Innovation Projects for Industry. “With a total of NOK 200 million of funding available, this is the largest funding announcement for aquaculture research in the history of the Research Council,” says Fridtjof Unander, Executive Director of the Research Council’s Division for Energy, Resources and the Environment. This funding round greatly expands the focus on industry, both through the open call for proposals in which companies can seek funding for projects in any of the programme’s research areas and through the joint call with the Innovation Programme for Maritime Activities and Offshore Operations (MAROFF). Fridtjof Unander is Executive Director of the Research Council’s Division for Energy, Resources and the Environment. Technology development and new species The HAVBRUK2 programme also seeks to boost the level of research aimed at developing aquaculture technology and further applying biotechnology tools, nanotechnology and ICT. At the same time, the programme will continue to promote activities on fish health, fish nutrition, food safety, production methods and fish welfare. The greatest change under the new programme involves stepping up efforts to produce aquatic biomass and new species. “Achieving the growth targets for aquaculture will truly require new solutions,” continues Ms Skrudland. “To produce more salmon, we will need to produce more fish feed – without using feed ingredients that could be used for human consumption. This will entail research on utilising species at lower trophic levels such as macro- and microalgae and molluscs as well as marine species such as cod and cleanerfish.” Ambitious targets, steady course In Norway, close cooperation between the research community and industry has elevated Norwegian producers of salmon and salmon trout to global industry leaders. This cooperation is founded on mutual trust and transparency, and has helped to deal with a wide variety of challenges. An independent evaluation of the previous HAVBRUK programme concluded that the programme generated significant results and was well organised, and recommended that it should be continued. “We see no reason to do too many things very differently in the new programme,” confirms Aud Skrudland. “The consensus is that we should stay the course, and at the same time address the major new challenges ahead and seize opportunities as they reveal themselves.”
<urn:uuid:28f31f27-5a1f-461c-a35a-c161cf94276f>
CC-MAIN-2017-04
http://www.nortrade.com/sectors/news/new-aquaculture-programme-with-a-stronger-focus-on-industry/
s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560281331.15/warc/CC-MAIN-20170116095121-00222-ip-10-171-10-70.ec2.internal.warc.gz
en
0.935332
886
1.984375
2
Are you feeling that someone is trying to spy on you through your computer? If so, keep reading. This article may help you defend yourself against anonymous, unscrupulous people. 1Download antivirus software. This will help protect you and your computer (or other device) from malware. - If you have an Android device, it's recommended you download AVG Antivirus Security or AVG TAB Antivirus Security (if you're using Tab). There are other good brands of antivirus software, too. 2Don't share your personal information with strangers on the internet. Avoid personal contact with any strangers. They may be trying to spy on or steal from you. 3Don't post a lot on Facebook, Twitter, We Chat, etc. The more you post, the easier it will be for strangers to identify and locate you. - Personal information you want to protect includes email address, physical address, phone numbers, passwords and account numbers. - Change your passwords periodically. Also, to avoid phishing attempts, don't click on any link that doesn't begin with "http://" or "https://". An exception to this rule is any website you know you can trust. 4Scan your computer or other device once a day using antivirus software. Delete any infected files. Do not ignore warnings provided by your antivirus software. 5Be wary of any stranger trying to contact you. Don't "friend" anyone you're unsure of or haven't been in contact with for a long time. - "Friends" should be actual friends or family members. 6Beware of hackers posing as someone you know. Don't share personal information, passwords or security questions/answers with anyone you're not positive about. 7Never connect to the internet through a Wi-Fi you're not familiar with. Hackers can use a program called DsPloit to spy on you through certain Wi-Fi connections. - Change your password regularly. - Don't use an easily guessed password like your pet's name or the name of the website. - You can use a password manager like KeePass to use highly secure passwords without having to remember them. - Research any antivirus software before downloading it. Know its strengths and weaknesses and how it compares with other similar programs. Some are badly designed. Some can even do you more harm than good.
<urn:uuid:d0eca3c7-bcfe-469f-b9e7-257adaa0e788>
CC-MAIN-2017-04
http://www.wikihow.com/Stop-People-from-Spying-on-Your-Computer
s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560280929.91/warc/CC-MAIN-20170116095120-00420-ip-10-171-10-70.ec2.internal.warc.gz
en
0.915287
487
3.0625
3
Child Find is a process designed to identify, locate, and evaluate individuals (birth through 21) with disabilities who may need special education services. Anyone can start the referral process. It can be a parent, doctor, teacher, relative or friend. They just need to call the Magnolia ISD Special Education office at 281-252-2111. Early identification and intervention may help to prevent failure and frustration. Special attention to teaching and learning strategies may help students overcome barriers to learning. If a child is referred, the parent will be contacted by Magnolia ISD personnel and a decision will be made to determine if an assessment is needed to evaluate areas of concern. The evaluation will be conducted by appropriately trained personnel. Upon completion of the evaluation, the parents or legal guardian will meet with the evaluation personnel to discuss the results, special education eligibility, and service options. Individuals qualify for special education services when they have one or more of the following disabilities, according to federal and state criteria: - Learning Disability (LD) - Speech Impairment (SI) - Orthopedic Impairment (OI) - Other Health Impairment (OHI) - Intellectual Disability (ID) - Emotional Disturbance (ED) - Autism (AU) - Multiple Disabilities (MD) - Traumatic Brain Injury (TBI) - Visual Impairment (VI) - Auditory Impairment (AI) - Deaf-Blindness (DB) - Noncategorical Early Childhood (NCEC) Each individual's need(s) will be addressed on an individualized basis by a team consisting of school personnel, the parents or legal guardian, and the student, as appropriate. The team will review assessment information, discuss eligibility, identify areas of need for specialized instruction, including related services, and develop a plan to meet the educational needs of the student. All services are provided at no cost to the individual, parents, or guardian. Early Childhood Screenings are held the first Tuesday of each month. Please call Betty Whittington 281-252-2111 to schedule an appointment.
<urn:uuid:6d35cce0-1a0d-41b1-8703-feae424ff3b7>
CC-MAIN-2017-04
http://www.magnoliaisd.org/apps/pages/index.jsp?uREC_ID=258906&type=d&pREC_ID=589001
s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560285289.45/warc/CC-MAIN-20170116095125-00150-ip-10-171-10-70.ec2.internal.warc.gz
en
0.914928
444
2.265625
2
What does it mean to live a faithful life in the present context of our changing awareness of the place of human beings within the whole creation? How do we “confess the Lord in fresh words and deeds” as this new occasion demands? (Basis of Union, paragraph 11) The Uniting Earth Ministry is a collaboration of Uniting Mission and Education, the Mid North Coast Presbytery, and the Uniting Earthweb Group, built around a project agreement, and with these aims: We will know ourselves to be part of God’s mission of the reconciliation and renewal of the whole creation over which God in Christ has reasserted claim (Basis of Union, paragraph 3). We will be identified as a faith community to which people who are passionate or anxious about our ecological future can turn as they explore the spiritual and faith dimensions of their relationship with the rest of creation. The new Uniting Earth Project capitalises on previous work, but with a reshaped set of priorities. • Rev Dr Jason John is in a 0.5 ministerial placement in the Mid North Coast which will prioritise new expressions of church, and provide action/reflection based educational opportunities for ecologically engaged discipleship and leadership as part of the new Uniting Learning Network. Collaborations will include the UME discipleship resourcing faculty, plus secular educational agents through the Bellingen Ecological Learning Hub. • Dr Miriam Pepper holds a 0.4 lay employee position, based in Sydney, will focus on engaging members of existing congregations in ecologically engaged worship and mission. For more information about Uniting Earth Ministry, please follow the link provided below:
<urn:uuid:fed67080-97d0-4e28-abe9-8c88a6077062>
CC-MAIN-2017-04
http://ume.nswact.uca.org.au/our-work/uniting-earth-ministry/
s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560279489.14/warc/CC-MAIN-20170116095119-00011-ip-10-171-10-70.ec2.internal.warc.gz
en
0.933248
340
1.53125
2
Nonprofit working to help human trafficking survivors MOSELLE, Miss. (WDAM) - A South Mississippi nonprofit is extending its reach to the Pine Belt and beyond in an effort to assist human trafficking victims in our state. Jubilee Havens is on a mission to help those survivors. "There are predators our there that have sick minds. They want to prey on these victims, because they are vulnerable,” said Debra Brown. Law enforcement agencies across our state continue working to fight human trafficking in Mississippi. It’s a crime, leaders say, can happen in any community at any time. Brown works with Jubilee Havens, based out of Ocean Springs. The organization is bringing its work to the Pine Belt all in an effort to help victims of what is known as modern day slavery. "Our mission is to provide safe havens for the victims of human trafficking. To be able to open up an undisclosed home for these victims. What they need is a safe respite emergency home that would cover a 30 to 90 day program where it would meet their psychological, emotional and physical needs. Most of these victims have severe consequences in this area.” The organization was established back in 2017 and is progressively working to make a difference in the lives of victims across our state. "There’s basically over 27.5 million victims. Whatever we can do to help them be successful citizens once again, and not only successful, but be recovered and restored from the trauma experiences they’ve had from this trauma,” said Brown. Right now, the organization is working to raise money to not only open one safe haven, but the long term plan is to purchase four buildings where more victims can be housed and can stay for a longer period of time, rehabilitating and recovering. "We want to provide a program that will hopefully be a holistic approach that will deal with the psychological, emotional and physical needs of that victim soon to be survivor,” Brown. If you want to learn more about human trafficking, hear from a survivor and learn more about what this group is focused on, they are holding an upcoming event in Petal called Freedom Tea. To learn more about the event and the organization click here. Copyright 2020 WDAM. All rights reserved.
<urn:uuid:352251f9-d6cf-4086-8454-0936e66ba705>
CC-MAIN-2022-33
https://www.wdam.com/2020/02/07/nonprofit-working-help-human-trafficking-survivors/
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882573399.40/warc/CC-MAIN-20220818185216-20220818215216-00077.warc.gz
en
0.961085
472
1.648438
2
A technology industry standards body is considering setting benchmarks for how virtualization should work in a computer network. The Standard Performance Evaluation Corp. (SPEC) this week is forming a group to discuss whether virtualization benchmarks are needed and, if so, then set those benchmarks over an estimated three-month process. "It seems like a number of our member companies have simultaneously agreed they are ready to move on it and form a working group," said Walter Bays, president of SPEC "All of them must have been hearing the same thing from their customers." SPEC is a nonprofit organization of top companies in the technology industry collaborating to establish impartial standards to measure the performance of various types of technology. SPEC has set benchmarks for servers, software applications, high performance computing systems, for example. Virtualization is a growing field for improving the performance of data centers without having to add more servers. For instance, virtualization makes it possible to run several software applications, even based on different operating systems, on the same physical server. Because many IT managers at companies are still learning what virtualization is, benchmarks would help educate them, said Bays. "It would actually increase the market for virtualization because it would reduce uncertainty about it for the buyers," he said. "They would be better able to do comparison shopping." The virtualization market doesn't seem to be hindered by so far. VMware Inc., the subsidiary of storage vendor EMC Corp. that sells virtualization software, on Oct. 17 reported an 86 percent growth in third quarter revenue to US$188.5 million, compared to the third quarter of 2005. The third quarter revenue, up 20 percent from the second quarter, translates into an annual run rate of $750 million, VMware said. "Based on the adoption rate, benchmarking is not first and foremost in customers' minds," said Brian Byun, vice president of global partners and solutions for VMware. Whether one virtualization software package runs 5 percent or 10 percent faster than another isn't as important as the increased performance of virtualization versus nonvirtualization, Byun said. The lack of benchmarks isn't preventing Advanced Micro Devices Inc. from touting the virtualization capabilities of its microprocessors. "Virtualization is getting deployed. It's beyond the test beds and R&D labs," said Patrick Patla, director of server and workstation marketing for AMD. Still, he added, "We would love to have an industry standard benchmark." Benchmarks are also needed to compare different types of virtualization software. Although VMware is the leader, the benchmarking process would compare virtualization software from multiple vendors. "We do believe that industry standards are very important but they should be vendor neutral," said Lorie Wigle, marketing director for server, software and technology initiatives for chip maker Intel Corp. Intel already offers a virtualization measurement tool, called VConsolidate, which hardware vendors and customers use to gauge how virtualization will work in various computing environments. A Web server, an e-mail server or a database program all have different performance benchmarks, but they could all operate simultaneously on one virtual server, so performance benchmarks have to be rethought. "Virtualization requires a completely different usage model," Wigle said. SPEC's Bays said the working group will include representatives from Intel, AMD, Fujitsu Siemens Computers, VMware and other major vendors, but that SPEC would also like to invite end users to participate in the process.
<urn:uuid:88bc209d-360f-4b6a-9a43-fcc087a25a5a>
CC-MAIN-2017-04
http://www.infoworld.com/article/2659551/networking/group-to-study-virtualization-benchmarks.html
s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560281069.89/warc/CC-MAIN-20170116095121-00271-ip-10-171-10-70.ec2.internal.warc.gz
en
0.949321
711
1.6875
2
The High Cost of Hospital-Acquired Infection According to an article posted on EverdayHealth.com, the five most common infections that patients acquire after being admitted into the hospital costs the health care system nearly $10 billion per year. The infections can be contracted various ways, including surgical sites, catheters and ventilators. According to a study performed by the Center for Disease Control and Prevention, one out of every 20 patients admitted to the hospital will contract an infection while there. The infections can range from mild to life-threatening, and can cost the health care systems thousands of dollars to treat per infection. The article also states that Medicare has decided that they will no longer cover the cost for certain infections caused by health care organizations in hopes that more precautions will be taken to prevent these infections. Many of these infections are preventable, and hospital staff are being urged to take extra steps to prevent the risk of infections for patients. Click here to read the article.
<urn:uuid:807947e0-46ad-4a06-b92e-ead626e68a22>
CC-MAIN-2017-04
http://www.fastmed.com/health-resources/fastmed-blog/the-high-cost-of-hospital-acquired-infection
s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560279933.49/warc/CC-MAIN-20170116095119-00129-ip-10-171-10-70.ec2.internal.warc.gz
en
0.955526
201
2.296875
2
Group aims to tie a yellow ribbon in Rosemount A local group is aiming to make Rosemount a Yellow Ribbon City. The application has been sent off and now it's up to the Minnesota National Guard to give its blessing. In the meantime, the group plans to keep helping military personnel, veterans and their families. The aim of being a Yellow Ribbon City is to connect resources to help military personnel and their families adjust to life after deployment. Don Sinnwell, a veteran who is leading the effort to get the designation, said it's not easy coming home. "Ten percent have problems reintegrating and we want to be there for them. The rest come home and have to find jobs or have other issues and we want to be there for them too," said Sinnwell. The committee, which consists of about 15 people, came up with an action plan that links organizations and entities in the community to help veterans. The group has identified schools, law enforcement and city hall. Sinnwell said the group turned in a plan a while back and the National Guard sent back suggestions on how to improve upon it. On March 15 the city council gave its support to submit a revised version of the plan. Getting the designation as a Yellow Ribbon City will show veterans throughout the area that there is group of people and business committed to helping veterans, said mayor Bill Droste. "It shows strong community support and I think that's important," said Droste. The committee is already working to provide that support. On March 29 the group sponsored a workshop called "How we can support military families in our midst." The workshop was aimed at helping law enforcement officers, pastors, school counselors and other professionals identify service members and their families. Members of the Minnesota National Guard Deployment Cycle Support staff provided insight on what service members and their families are facing. Sinnwell said the committee will continue to look for ways ways it can help the community provide for returning service members. The committee hopes to help veterans from throughout the area, not just Rosemount. While it's easy to find the members of the National Guard, Sinnwell said the group wants to reach out to all members of the military who have connections to the Rosemount area. "We need to identify people who aren't known. We are here to help all veterans," said Sinnwell. City administrator Dwight Johnson said the city is a supporting member of the Yellow Ribbon effort and hopes to see it come to fruition. As a city, he said, it's important to support efforts that involve residents. While they are playing the waiting game at present, Sinnwell said the Rosemount Yellow Ribbon committee is looking for more people to get involved in it the effort. The group meets at 7 p.m. on the second Monday of the month at city hall. Anyone interested can email Sinnwell at at email@example.com or call him at 651-261-0499.
<urn:uuid:96c086a5-d990-4d28-99d5-db0e7db698fc>
CC-MAIN-2017-04
http://www.rosemounttownpages.com/content/group-aims-tie-yellow-ribbon-rosemount
s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560280891.90/warc/CC-MAIN-20170116095120-00164-ip-10-171-10-70.ec2.internal.warc.gz
en
0.971393
608
1.648438
2
On Sunday November 17, the CIS 300 Project Management Class taught a local Girl Scout troop how to program Lego Mindstorm robots. The girl scouts competed in teams to successfully navigate a course set out on a track. The project management students had been planning this event all semester. Students developed project documents such as a Project Charter, a Work Breakdown Structure, and a Time Schedule. Before the event, the project management students worked out the bugs with two test runs. The Girl Scouts were excited, and Simpson students applied what they learned in Project Management class. This was great hands-on learning for collaborative leadership, and a service to the community.
<urn:uuid:227d7777-0c7f-41ff-b3e7-bcaf81fb4c43>
CC-MAIN-2017-04
http://simpson.edu/2013/11/girl-scouts-learn-lego-mindstorms-programming/
s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560280825.87/warc/CC-MAIN-20170116095120-00210-ip-10-171-10-70.ec2.internal.warc.gz
en
0.951124
130
2.703125
3
I don’t know how the kids are doing it, but there is no question: today’s elementary school volleyball players are far superior to the ones I remember when I was their age. During the term, it has been a pleasure to support both of our girls’ and boys’ teams who have enjoyed capital seasons. In fact, both teams have been more successful and consistent on the volleyball court than any previous Matthews Hall team. When I think back to my own days playing the game, there is no comparison. Our students simply understand the game better, have superior technical skills, and “get” the teamwork dimension necessary for a winning effort. There are a number of reasons for their success. To being with, they are coached well by teachers who understand that the co-curricular program in a good school must be viewed as a crucial part of the whole experience. It is not an “add-on” or a “volunteer dimension” of the learning experience. We believe it is fundamental to the education of our students and, for this reason, it is not viewed as an ancillary part of the curriculum. There are also many ways to learn – about yourself, about the world, about others – and the team effort required in sports like volleyball is an important way many children accomplish this. Team sports are about so much more than their physical benefits. This is especially so when group sports are incorporated into a young person’s life. Studies have shown a direct correlation between physical activity and academic performance. A University of Kansas study looking at the performance of students in Grades 9 to 12 showed that more than 97% of student athletes graduated high school – 10% higher than those students who had never participated in sports. Athletes were also shown to have better grade point averages (GPAs) than non-athletes. The social and academic benefits of our athletic program are many. Although we are a small school, we are committed to ensuring our students always have a wide array of activities, competitive and friendly, which are viewed as integral to the teaching and learning experience. In addition to the physical training and stamina that sports provide, team sports are an excellent way to build those “soft skills” like communication, collaboration, time management, self-esteem, confidence, goal-setting, sportsmanship, and diplomacy. According to decorated American volleyball coach, Marv Dunphy, “…volleyball is one of the most interactive games going. It is a game of intuition, imagination, improvisation—but most of all, of reciprocity. Of teamwork. There is no way to freelance in volleyball.” Anyone watching this year’s teams probably feels the same way. Team sports provide athletes with a natural community, which we have certainly seen at Matthews Hall during this year’s volleyball season. There is just no doubt that youth who play sports have higher levels of social support, and that the sense of community created with teammates, coaches, and family members incubates the perfect setting for critical self-esteem development. Congratulations to both our volleyball teams for a memorable season and thank you to their coaches – Ms. Farr, Ms. Coleman, Mr. Lee and Mr. Whitmill – for their skill, passion, and commitment in developing our student athletes! And best of luck to our boys as they progress through their play-off season! Ric Anderson, Head of School
<urn:uuid:ba8eb78b-ddf4-4425-afd4-4426785548a3>
CC-MAIN-2022-33
https://matthewshall.ca/2019/11/15/heads-blog-bump-set-spike-itthats-how-our-kids-like-it/
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882573118.26/warc/CC-MAIN-20220817213446-20220818003446-00672.warc.gz
en
0.978291
709
2.796875
3
Vail Valley Anglers, a fly shop and outfitter located in the High Rockies of Colorado, is offering an “E-Bike and Fly Fish Guided Trip.” The guided trip involves using electric e-bikes to access a variety of different water that may be tougher for other anglers to access. Flylords caught up with one of the “e-bike guides” Eric Phannenstiel to discuss what this trip offering is all about. Flylords: Where did the idea come from? Eric: The first I heard about the idea was from our General Manager John Cochran. He tapped me to lead the implementation of the idea since I am an avid cyclist. I have ridden “Ride the Rockies”, a week-long cycling event in Colorado as well as some of the longer single-day ride events that are available in Colorado and New Mexico. Flylords: What’s the advantage of using a bike? Eric: There are several. Most notably is that we can access parts of our rivers where parking for motor vehicles is not readily available. In addition, we can be more selective about where we fish since we can view much more of the river from our paths which follow the river system. Also, since we use e-bikes, we can cover a lot of river in a day. Lastly, you get to exercise in a sport that is not typically known for its workout benefits! Flylords: What types of electric bikes do you use? Eric: The bikes are from a company named Sondors. When we started the program, there were very few affordable bikes available, but these seemed to fit our needs nicely. Flylords: How do you transport the fly rods and other gear? Eric: We have two-piece rod cases that attach to the bike frames with bungee balls and we use spacers between the case and the frame to ensure that the cases don’t interfere with the bikes in any way. On the guide’s bike, we have a set of panniers to stow the guide’s equipment pack and other items that are necessary for the trip. There is also space on top of the guide’s bike rack for a large landing net. We typically go wet wading (wading boots and neoprene socks) since riding a bike in waders and boots is not very practical. Flylords: Have you had any issue with clients crashing or equipment problems? Eric: During the test phase of this program we had initially envisioned a trailer behind the guide’s bike to carry all of the necessary gear. On one of the test drives, a wheel fell off the trailer which led to a catastrophic crash that broke multiple fly rods. It was not pretty… I am not aware of any client crashes. The bikes are very sturdy and are well balanced. They have 4 inch wide tires on them too, which helps with the stability. In fact, I have had a 72 year old man on a guided trip where we were riding on single-track trails. It was awesome! Flylords: What rivers do you mainly fish? Eric: We typically fish the Eagle River in the Vail Valley. It is a freestone river that has a wonderful history of legendary fish during pioneer days, then an unfortunate period where the river was subjected to heavy metals contamination from the mining industry. The Eagle River is now a very productive, healthy fishery that offers primarily Brown and Rainbow trout, some Cutthroats, and the occasional Brook trout. Flylords: Do you think this concept will trend amongst other anglers? Eric: I think that this mode of travel is a great opportunity for our guests to check multiple things off their list of things to do in a single activity. It is a fun way to experience fishing and see parts of our valley from a bike that would otherwise not be practical. I have been riding my bike and fishing since I was a young boy, but I have yet to see many fishermen doing this yet. Perhaps with the growing popularity of e-bikes, this will allow more fishermen to experience this activity mashup. Article and interview made possible by Eric Phannenstiel at Vail Valley Anglers, if you are interested in contacting Eric or the fly shop, check them out online at vailvalleyanglers.com.
<urn:uuid:293f09c6-76a3-4ee4-a2aa-99263fd7e1b4>
CC-MAIN-2022-33
https://flylordsmag.com/electric-bike-e-bike-and-fly-fishing-trips-in-colorado/
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882570651.49/warc/CC-MAIN-20220807150925-20220807180925-00468.warc.gz
en
0.970327
904
1.5625
2
* Fast and cheap global payments * Buy goods and services online * Advanced security features * Create a bitcoin wallet where you can securely store bitcoin * Connect your bank account so that you can exchange bitcoin into and out of your local currency * Buy your first bitcoin to begin using the future of money * Popular bitcoin wallet works on your Android or iPhone in addition to your web browser * Bitcoin stored on their servers is covered by their insurance policy * Send and receive bitcoin that is immediately exchanged to your local currency * They store the vast majority of bitcoin in secure offline storage * Maintain full control of your private keys with their multi-signature vault * Invest in bitcoin slowly over time by scheduling buys weekly or monthly * Accept payments from anywhere in the world, with low transaction fees * The leading platform for professional bitcoin traders * The world’s most popular bitcoin API. Financial infrastructure for your apps What is Bitcoin? Bitcoin is digital money used for secure and instant transfer of value anywhere in the world. It is not controlled or issued by any bank or government – instead it is an open network which is managed by its users. Much in the way email improved communication by making it fast and cheap, bitcoin is an improvement on existing payment methods which were not designed for the internet era. Is Bitcoin safe? Bitcoin’s core protocol is viewable by anyone, has been vetted by thousands of security researchers around the world, and has proven to be robust and reliable after immense scrutiny. Using bitcoin is similar to using other private applications on the internet, such as email or online banking. Just like these other web services, you must access your bitcoin with a password in order to ensure only you have access to your money. Is it tied to the value of the dollar? The value of a bitcoin is not tied or pegged to the value of any other currency. Similar to stocks or property, bitcoin’s value is determined by buying and selling in the open market. A bitcoin’s price changes in real time based on the number of people who want to buy or sell it at a given moment. Why does it change value? Bitcoin is traded for dollars, euros, yen, and other currencies in real time 24 hours a day. Depending on the demand for buying or selling bitcoin, the price can fluctuate from day to day. This is similar to the manner in which the value of a stock or property can go up or down based on supply and demand. Bitcoin’s value can be volatile compared to traditional currencies such as the US dollar because it is still an emerging technology. Is it similar to a credit card or paypal? Unlike credit card networks like Visa and payment processors like Paypal, bitcoin is not owned by an individual or company. Bitcoin is the world’s first completely open payment network which anyone with an internet connection can participate in. Bitcoin was designed to be used on the internet, and doesn’t depend on banks or private companies to process transactions. Why would I use bitcoin? Bitcoin allows you to instantly send any amount of money to anyone in the world without needing a bank. It allows you to access your money without needing an ATM or credit card – bitcoin gives you back control over your money. Plus you can pay friends back for dinner, buy your next computer, and donate to charity, all using bitcoin. Where can I spend bitcoin? Many large online businesses accept bitcoin, such as Overstock, Expedia, and Dell. Non-profits such as Wikipedia and the United Way also accept bitcoin donations. Look for a bitcoin payment option at many of your favorite websites and you’ll be surprised how many accept bitcoin! You can view a list of merchants here. !!! Top Revenue Share Sites: CLICK HERE !!! !!! Top HYIP Sites: CLICK HERE !!! !!! Top CrowdFunding Sites: CLICK HERE !!! !!! Top Bitcoin Mining Sites: CLICK HERE !!! !!! Top Paid To Click Sites: CLICK HERE !!! !!! Get Emails Frequently from me on Genuine Online Income Opportunities with zero/low Investments… Absolutely Free !!! To earn free $10 Bitcoin bonus, just sign up via this Coinbase Referral Link, and then purchase $100 of Bitcoin or more to qualify for your $10 Bitcoin bonus.
<urn:uuid:c573453c-b7a0-4ae4-a3fe-b2ce8ebc3c25>
CC-MAIN-2017-04
https://mydollarincome.wordpress.com/coinbase/
s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560279650.31/warc/CC-MAIN-20170116095119-00433-ip-10-171-10-70.ec2.internal.warc.gz
en
0.929434
889
2.25
2
The Onion Skinning feature allows you to create a new cast member in the Paint window while using one or more existing cast members as a reference. The reference images appear dimmed in the background, as though you had tracing paper over them. (In fact, the name of this feature comes from the onion-skin tracing paper that animators traditionally used when drawing animation sequences.) Onion skinning comes in handy when you need to create a sequence of frame-by-frame animation in which each new cast member varies only slightly from the one before. To use onion skinning: To view more than one reference image at a time:
<urn:uuid:4b13f2eb-e03c-4dc2-a558-15d22f7fd3b7>
CC-MAIN-2022-33
https://flylib.com/books/en/4.258.1.61/1/
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571472.69/warc/CC-MAIN-20220811133823-20220811163823-00667.warc.gz
en
0.941531
133
1.726563
2
A GRIM murder back in 1947 is one of the most famous unsolved cases in the world. It is now 70 years since the murder and the case, which is still as intriguing as ever, has been the subject of countless books, intriguing confessions and even a Hollywood film starring Scarlett Johansson. Here is everything you need to know about the Black Dahlia Case. What is the Black Dahlia Case? The Black Dahlia case is an unsolved murder dating back to 1947. On the morning of January 15, 1947 a lady out for a walk in a suburb of Los Angeles with her young daughter spotted what looked like a mannequin cut into two halves on a patch of undeveloped ground just a few feet from the pavement . It turned out not to be a mannequin but the naked body of Elizabeth Short who had been murdered and her corpse butchered in a gruesome manner. Despite huge publicity and an extensive investigation, the murderer was never found and the case still remains open. Who was Elizabeth Short? Elizabeth Short was a 22-year-old aspiring actress born in Boston. She was living in Los Angeles and working as a waitress while trying to get her big break into Hollywood. She led an active social life which involved dating lots of different men, and the sensationalist tabloids in Los Angeles at the time played on this and wrongly described that she had been wearing tight clothes during her last sighting, implying she was a prostitute. She was dubbed 'Black Dahlia' by the newspapers after her murder in reference to a dark noir movie named Blue Dahlia released a year before. What do we know about the murder? The last time Short was seen alive was on January 9, 1947 at the Biltmore Hotel - six days before her body was discovered. Her corpse had been severely mutilated. She had been cut in half very neatly at the waist and drained of blood. Her intestines had been removed and tucked neatly under her head and a cement bag of watery blood was found nearby. Her mouth was cut from ear to ear and her body had been washed before being dumped on the empty wasteland. The only clue was a single heel print on the ground amid tyre tracks. The killer mysteriously sent various letters and clues to the local newspaper including a package purported to contain the contents of her handbag. There were numerous false reports during the murder enquiry and even several false confessions. Her shoe and handbag were later found but not much else to go on. The sole witness reported seeing a black sedan parked in the area in the early hours of the morning and little else. Are there any suspects? One of the original detectives, Harry Hansen, said that he thought the murderer was a "medical man", because of the precision in the way the body was mutilated. There have been many claims about the identity of the murderer with one woman even claiming she was going to use her psychic abilities to solve the crime, and another coming forward to say that regression therapy had recovered memories of her father forcing her to watch him torture and kill Short. Over the years there have been 25 viable suspects, including Walter Bayley - a surgeon who lived in a house one block south of the vacant lot Short's body was found in. Another man, an Army corporal, claimed to have been out drinking with Short a few days before her body was discovered. He said he had blacked out and come round in a cab in New York City - however he was later found to have been on his military base on the day she died. As recently as 2013, police were still following up leads on the case. Steve Hodel, a former homicide detective, came forward claiming his father George, who was a physician, was responsible for the murder. A police dog specially trained in sniffing out human remains searched George Hodel's former home and apparently became excited by something it discovered. Soil samples were submitted for lab testing but nothing came of the lead.
<urn:uuid:d2710d64-8d3b-42a7-8745-ec2b07a715a3>
CC-MAIN-2017-04
https://www.thesun.co.uk/news/2582342/what-is-the-black-dahlia-case-elizabeth-short-murder/
s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560281226.52/warc/CC-MAIN-20170116095121-00377-ip-10-171-10-70.ec2.internal.warc.gz
en
0.989254
825
1.71875
2
When Ann Romney was diagnosed with multiple sclerosis 14 years ago, the governor's wife needed something to life her spirits. She found it through her love of horses. While guest hosting ABC's Good Morning America October 10, the 63-year-old wife of Republican presidential candidate Mitt Romney, 65, opened up about how horses helped her cope during the most difficult period of her life. "I was very, very weak and very much worried about my life, thinking I was going to be in a wheelchair as well," she said. "I turned to horses and my life has been dramatically different. They gave me the energy and the passion to get out of bed when I was so sick that I didn't think I'd ever want to get out of bed." The mother-of-five was joined by paralympian Becca Hart and a horse named LoLu during the morning broadcast. Both women spoke about the benefits of equine therapy. "It has maintained my mobility," Hart said. "Without, I would probably be in a wheelchair. The fact that I'm standing here in Times Square with a horse is just phenomenal to me." Added Ann, "It's so extraordinary what horses do for us. For me, it's balance, it's love, it's joy. . . Horses are a gift from God is the way I look at it, and they are our partners in life's journey and they can bring such joy." Mitt's wife of 43 years was filling in for Good Morning America co-host Robin Roberts, who is recovering from a recent bone marrow transplant. This article originally appeared on Usmagazine.com: Ann Romney: Horses Helped Me Cope With Multiple Sclerosis Diagnosis
<urn:uuid:f4ca6ac2-ca03-42a4-80fe-d038d282b909>
CC-MAIN-2016-44
http://www.wonderwall.com/entertainment/ann-romney-horses-helped-me-cope-with-multiple-sclerosis-diagnosis-1711011.article
s3://commoncrawl/crawl-data/CC-MAIN-2016-44/segments/1476988720737.84/warc/CC-MAIN-20161020183840-00219-ip-10-171-6-4.ec2.internal.warc.gz
en
0.988967
352
1.570313
2
Nottinghamshire Wildlife Trust are hoping to increase our understanding of the value of nature and issues facing wildlife by suggesting 30 books to read throughout June (#30WildBooks). One writer not on their list is DH Lawrence. If he were to be included in a future campaign I would recommend Birds, Beasts and Flowers (1923) which, based on his experiences of the Mediterranean and the American Southwest, explores the poetry of nature and the otherness of the non-human world. But pick up any work by Lawrence and you’ll find a writer completely connected to his immediate environment. His Midlands novels explore the destruction of “the country of my heart” and the dehumanising effects of industrialisation, whereas his debut novel, The White Peacock (1911) includes references to over 140 different plants, flowers and trees. “Under the froth of flowers were the purple vetch-clumps, yellow milk vetches, and the scattered pink of the wood-betony, and the floating stars of marguerites. There was a weight of honeysuckle on the hedges, where pink roses were waking up for their broad-spread flight through the day. Morning silvered the swaths of the far meadow, and swept in smooth, brilliant curves round the stones of the brook; morning ran in my veins; morning chased the silver, darting fish out of the depth, and I, who saw them, snapped my fingers at them, driving them back.” The White Peacock. Lawrence’s short stories Adolf (rabbit) and Rex (dog) explore his childhood relationship with animals. In Adolf his father brings home a nearly-dead rabbit he’d found on his walk home. Through pure tenderness the rabbit is saved but goes on to cause havoc in the house, leaving droppings on saucers while helping itself to the sugar pot, much to the displeasure of his house-proud mother. Rex explores the naming of a dog donated to the family by an uncle. Like Adolf, the dog disrupts the order of the house and the mother wants him out. But he returns, “wagging his tail as if to say ‘Yes, I’ve come back. But I didn’t need to. I can carry on remarkably well by myself.'” It’s classic Lawrence, forcing us to see things from a different perspective. One book on the Wildlife Trust’s recommended reading list is Moby Dick by Herman Melville. Lawrence helped establish Melville’s reputation after an essay published in Studies in Classical American Literature in 1923. It’s an incredible piece of literary criticism about the “tiresome New Englander of the ethical mystical- transcendentalist sort” and the #30WildBooks project gave me the opportunity to revisit it once more. You can feel Lawrence’s excitement reading this seminal book. It’s like it’s written in real time, becoming more frenetic as he jumps on the ship with Ahab on “the last great hunt”. He’s intrigued as to the symbolism of this “warm-blooded” and “lovable” Leviathan and suggests that the reason the whale was never worshipped by the South Sea Islanders, Polynesians, and Malays, was because “the whale is not wicked. He doesn’t bite. And their gods had to bite”. Lawrence is fascinated by the other and how people change when placed in isolation. Here is it the wilderness of the sea that has a profound effect on Captain Ahab’s character. “For with sheer physical vibrational sensitiveness, like a marvellous wireless-station, he registers the effects of the outer world. And he records also, almost beyond pain or pleasure, the extreme transitions of the isolated, far-driven soul, the soul which is now alone, without any real human contact.” Lawrence analyses the “incredible crew” on the Pequod, exploring their relationships to each other and the outer world. They make The Argonauts seem like “mild lambs in comparison” as they’re “a collection of maniacs fanatically hunting down a lonely, harmless white whale.” Never one to overplay things, he is equally irked by “the sonorous mysticism” that “gets on one’s nerves”. As much as he recognises the novel as being unequalled in terms of “esoteric symbolism” it is also one of “considerable tiresomeness”, accusations that could equally be levelled at Lawrence’s later work, particularly The Plumed Serpent (1926). Kettle black, etc. Lawrence’s is always able to see things from the non- human perspective: “Moby Dick, the great white whale, tore off Ahab’s leg at the knee, when Ahab was attacking him. Quite right, too. Should have torn off both his legs, and a bit more besides.” Touché . Lawrence being Lawrence, he uses Melville as a prism through which to explore his own favourite topics, most notably; blood consciousness, the spinal cord, primordial cultures, spirituality and the obligatory bromance. This was picked up by critic John Middleton Murry: “He is not concerned with Melville in and for himself, in his own quiddity. Melville exists only as a paradigm for Lawrence. But the projection of himself that Lawrence makes by means of Melville is amazing (…) It does not matter in the least whether this is a true interpretation of Moby Dick: its importance lies in the self-revelation of Lawrence.” It’s all about me… Biographer Andrew Harrison (2016) takes this further, suggesting “the attempt to understand the Americans and, through them, his own work, implied an incipient desire to imagine an audience for (Women in Love).” One other area of controversy is Lawrence’s assumption that Ishmael does not survive the wreck of the Pequod. Research by JoEllyn Clarey (1986) suggests this was because he was using the original English edition of Moby Dick that omitted the epilogue. Things are never simple with Lawrence, are they? - 30 Wild Books to Read in June (dawnoftheunread.wordpress.com) - Nottinghamshire Wildlife Trust website (nottinghamshirewildlife.org) - DH Lawrence – Herman Melville’s Moby Dick (xroads.virginia.edu) - Charles Olson, Call me Ishmael (San Francisco, 1947) - Michael J. Colacurcio, “The Symbolic and the Symptomatic: D. H. Lawrence in Recent American Criticism,” American Quarterly 27 (1975): 488. 28/Chase, p. 24. - Ren Wellek, “The Literary Criticism of D. H. Lawrence,” Sewanee Review 91 (1983): 598-613 - JoEllyn Clarey “D. H. Lawrence’s “Moby-Dick”: A Textual Note,” Modern Philology Vol. 84, No. 2 (Nov., 1986), pp. 191-195
<urn:uuid:b37788d5-8eb0-45ff-9c86-d13829265ea4>
CC-MAIN-2022-33
https://thedigitalpilgrimage.wordpress.com/tag/moby-dick/
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572908.71/warc/CC-MAIN-20220817122626-20220817152626-00064.warc.gz
en
0.950025
1,558
1.710938
2
DEARBORN HEIGHTS -- A resident who wants to return to his native Lebanon to receive stem cell treatments that might allow him to walk again has received the green light from the federal government. Jamal Rizk, 54, was removed from the federal No Fly List 2 1/2 months after suing the U.S. Department of Justice, the FBI and its Terrorist Screening Center in federal court. His attorney, Arab-American Civil Rights League Chairman Nabih Ayad, was told in February that Rizk was removed from the No Fly List. "We are extremely pleased with the federal government's decision to amend their records and allow Mr. Rizk to travel freely and get the medical treatment he has sought for several months now," Ayad said in a press release. "This is a great victory for our community. It sends a message to our government that we will continue to challenge such egregious conduct on behalf of Arab-Americans who are denied basic rights without due process." Rizk was paralyzed from the waist down when he was shot in a 2004 gas station robbery. He was not allowed to board Delta Air Lines flights at Detroit Metropolitan Airport on Sept. 30 and Nov. 5, 2012. Ayad, who specializes in civil rights law, accompanied him on the second effort. Rizk, represented pro bono by Ayad, filed the suit later that month to get off the list and to force a way for those on the No Fly and Terrorist Watch lists to get off them if they don't belong there. Travelers can file a complaint with the Department of Homeland Security's Travelers Redress Inquiry Program. There are about 400,000 people on the No Fly List. Rizk has no criminal history and is in a wheelchair. He was born in Lebanon, came to the U.S. in 1978 and became a naturalized U.S. citizen in 1984. His wife and five children also are U.S. citizens. Rizk initially was told at the airport Nov. 5 there was an issue with his reservation, and a Delta employee called a supervisor. Law enforcement was called, Ayad said at a press conference later that month, "without telling him or appraising him of what's going on." "Law enforcement won't tell you why you can't fly," Ayad said. "It's unsettling to this community. We refuse to be treated like second-class citizens." Rizk said when he was traveling from Lebanon to the U.S., before the two incidents at Metro, he was given a hard time by U.S. customs officials in Frankfurt, Germany. He was put in a separate room and questioned for 3 1/2 hours. He was asked about certain people he said he doesn't know. "They checked me like a terrorist," Rizk said. "They don't treat me like a human being." Ayad said putting someone on the No Fly List without telling them why is a violation of their rights. "While we are quite satisfied with the outcome of this particular case, our work is far from over," said Rana Abbas, Arab-American Civil Rights League executive director, in a press release. "We must keep in mind that serious concerns and reservations remain over the government's No Fly List. As a community, we must continue to work towards urging the federal government to adopt a fair and transparent process for adding and removing names from the list."
<urn:uuid:69ac76e7-e415-475b-84f9-327395b8e1dd>
CC-MAIN-2016-44
http://www.theoaklandpress.com/general-news/20130321/dearborn-heights-paraplegic-removed-from-federal-no-fly-list
s3://commoncrawl/crawl-data/CC-MAIN-2016-44/segments/1476988719465.22/warc/CC-MAIN-20161020183839-00095-ip-10-171-6-4.ec2.internal.warc.gz
en
0.982391
712
1.632813
2
You are here: Home › flickr › Against the violence of women! by lapamela Against the violence of women! by lapamela No! to women violence millions of women live en a prison of poverty, machismo, and violence. via Flickr http://flic.kr/p/25rUt Leave a Reply Cancel reply Your email address will not be published. Required fields are marked *Comment Name * Email * Website Yes, add me to your mailing list This site uses Akismet to reduce spam. Learn how your comment data is processed.
<urn:uuid:fd31d1e2-dd5a-43d1-852d-fa138a8a2549>
CC-MAIN-2022-33
https://kersplebedeb.com/posts/against-the-violence-of-women-by-lapamela/
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571472.69/warc/CC-MAIN-20220811133823-20220811163823-00665.warc.gz
en
0.829063
114
1.507813
2
When most people here the term “managed services”, it’s too general to actually mean much, but the reality is that it could be the very thing that protects your business from going completely under. That may sound overly dramatic, but the truth is that managed IT services can save your business. Simple. Many companies around Atlanta would come to an immediate standstill if their computers quit working or their data was compromised. Preventing that from happening is only the beginning of what a managed IT service provider does for you. Definition Of Managed Services Believe it or not, there are many companies out there that have “a guy” (or gal) who is responsible for all the IT in the company. This person typically has other responsibilities, but he or she also takes care of buying, repairing, licensing, protecting, supplying all the computers, printers and phone systems used at the company. It can get overwhelming very quickly. The concept of manage services began back in the 1990s when companies started hiring outsourced IT experts to manage their systems. These vendor partners worked closely with management or a specific designee to suggest the most efficient IT solutions for the business along with all the other tasks mentioned above (and probably others). The relationship between managed service providers (MSPs) and businesses has grown ever since. It’s a working relationship that’s mutually beneficial and allows the business to focus on the core mission rather than get bogged down and distracted from what makes them profitable. Size Of Companies Using MSPs The truth is that larger companies often decide to hire IT staff to manage their network and connected devices, so hiring an outsourced IT provider makes only makes sense for small to mid-sized companies. Some people think the size of the company is only measured by their annual revenue, but the truth is, when you’re talking about IT, the size really does boil down to the number of computers or connected devices Here at Uplinked IT Services, we work with businesses that have anywhere from 1-100 computers typically. Why Consider Hiring A Managed Service Provider? There are a lot of great reasons to use an MSP, but here’s a quick list: · Helps your business select the right IT solutions to save money and be more efficient/productive · Stays current on IT solutions (so you don’t have to) · Brings effective solutions to your company from other verticals · Saves your staff the time, energy and confusion of trying to stay on top of licensing, updating and managing software/hardware. · Let’s your staff stay focused on the things needed to keep your company profitable instead of IT related distractions · Acts as a guard dog for your data and network · Helps you identify and implement data backup and disaster recovery solutions to protect your business · Gives you the extra hands you need when implementing changes to your IT system · Provides feedback, advice and recommendations about cloud storage solutions · Gives your business expert help desk solutions to manage day to day issues. When you add up the cost of paying your employees to juggle all of these duties with or without the proper expertise plus the cost of any issues related to IT, hiring an MSP pays for itself many times over. Call the staff at Uplink IT Services today to discuss what we can do for your business. You’ll be glad you made the call.
<urn:uuid:5af9b033-36fa-4667-a548-b5941ff24f89>
CC-MAIN-2022-33
https://uplinkeditservices.com/the-basics-of-managed-services/
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571190.0/warc/CC-MAIN-20220810131127-20220810161127-00074.warc.gz
en
0.956563
722
1.554688
2
Well, yes, fever can cause glassy eyes. Generally speaking, when your eyes appear shiny or have a glassy appearance, we can say that you may be suffering from glassy eyes. And at that moment, you will have a feeling of listlessness, and the eyes are unfocused, and without any luster. According to some experts, fever can lead to glassy eyes, for when you have high fever, it can just affect your eyes, leading to some eye problems, such as glassy eyes. you can put some cool cucumber on your eyes, and it will relieve your situation. By the way, you should know that glassy eyes are a common result of chronic alcohol abuse. Because of it, it will cause the eyes to become dry, and leading to glassy eyes. So just do not drink too much alcohol. The term of glassy eyes generally refers to an appearance of listlessness in which the eyes are unfocused and without lustre. It is true that fever will cause glassy eyes and burning eyes because fever will disorder your immune system. When you get a high fever, you blood even your whole body become high and it make your eyes pressure high. In so doing, eyes will turn to be glassy for high temperature. By the way, as for your question, in my opinion, there are many ways for you to choose. Firstly, drink a lot of water. That is because water can circulate your blood quickly. Secondly, keeping your eyes moisturized with eye drops. Thirdly, check up thyroid problems. As we know, hyperthyroidism can also cause your eyes to be glassy. Therefore, from what i have mentioned above, you will the reason of glassy eyes and the methods to get rid of it. Best wishes for you! Yes, it is possible for you to cause glassy eyes because of fever which will make your immune system decline a lot. At the same time, your shining eyes will get the infection easily. You could use some eye drops to moisture the eyes. In addition, you could eat the food with vitamin C to moisture the eyes.
<urn:uuid:328bebc7-3b60-496d-b371-908f89fad4e9>
CC-MAIN-2022-33
https://answer.firmoo.com/question/8740.html
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571198.57/warc/CC-MAIN-20220810161541-20220810191541-00275.warc.gz
en
0.956015
431
2.265625
2
The wedding of Ferdinando de’Medici to Christine of Lorraine was a spectacular Florentine affair. It took place in 1589, two years after Ferdinando became Grand Duke of Tuscany. The wedding was lavish and spared no expense. This included its principal entertainment: a performance of Girolamo Bargagli’s comedy La Pellegrina, which is remembered today not for its drama but for the musical interludes that accompanied it. Those six interludes, better known as intermedi, are comprised primarily of music by court composers Cristofano Malvezzi and Luca Marenzio. The intermedio was a musical interlude unique to the Renaissance. It could be placed during feasts, processions, tournaments, or before, after and in between acts of a play, as is the case for La Pellegrina. However, contrary to the belief that they were secondary compositions, La Pellegrina’s interludes were anything but typical. Ther were, in fact, the pinnacle of all intermedi. With a budget relative to that of the feature flims of today, the six intermedi were truly something to behold; their enormous sets and grand compositions offering an experience that was nothing short of stunning. There were other composers who contributed music to the intermedi. They included Giulio Caccini, Giovanni de’ Bardi, Jacopo Peri, and Emilio de’ Cavalieri—four men who were a part of a movement that ushered in the Baroque Era. Fortunately for us, Ferdinando ordered the music of the intermedi to be published shortly after its premiere. That act not only preserved it for posterity, but helped to populize the one tune that became a hit across Europe in the decades that followed. Better known as the Ballo del Gran Duca, it was the closing movement to the sixth and final intermedio. Here’s video of a performance by the Chamber Choir of Namur and La Fenice (Jean Tubery, dir.) of the final movement from the sixth intermedio—Emilio de’ Cavalieri’s O che nuovo miracolo:
<urn:uuid:50696632-4640-4a86-9d01-e57c2dd45b38>
CC-MAIN-2017-04
http://indianapublicmedia.org/harmonia/la-pellegrina/
s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560285001.96/warc/CC-MAIN-20170116095125-00307-ip-10-171-10-70.ec2.internal.warc.gz
en
0.969168
455
2.546875
3
Artificial trees have many advantages over live trees, starting with the fact that getting one doesn’t require cutting down a living tree. We’ve put together a list of the top reasons to choose an faux Christmas tree over a real tree this holiday season – read on to learn more! Artificial trees usually come in a compact cardboard box that will easily fit in most cars or they can even be delivered right to you front door. Artificial ficus trees also typically come with a stand designed specifically for that particular tree which helps to mitigate the risk of the tree leaning or tipping over. It may seem like an artificial tree costs more than a real tree if you only look at the cost of using it one season. However, an artificial tree can easily last 10+ years whereas a real tree often hits the trash after only a few weeks. When you calculate the cost of using the artificial tree for several years, it only takes a few years to come out ahead. After that, it’s like having a free tree every year! Also, as we mentioned previously, artificial trees often include a tree stand and lights (if the tree is pre-lit), so that’s even more savings you can count on! Live trees have a tendency to dry out while artificial trees are made from fire retardant materials, making them a much safer option for your home. You do, however, need to be diligent about not overloading electrical sockets with lights. Additionally, when live trees dry out their branches tend to droop which can cause ornaments to slip off and shatter. Artificial trees hold their shape so you can rest easy that your favorite ornaments won’t easily fall off branches and break. Contact Person: Ms. Venus Tel: +86 13512774552
<urn:uuid:478d080f-0d27-4c67-b48b-d25e3690afb0>
CC-MAIN-2022-33
http://www.artificial-landscape.com/news/why-fake-trees-are-better-than-real-ones-115914.html
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572304.13/warc/CC-MAIN-20220816120802-20220816150802-00478.warc.gz
en
0.94945
378
1.609375
2
Do you love working onto Notepad writing your notes or other stuff, well have you ever wondered somehow you can use browser's as your text editors. Well yes now you can with the ability that has been added in all modern browser's to convert themselves into text editors by simply typing a web address programmed right for them. So now I tried this thing up and its beneficial for a nice big white canvas option if you need that, but let me tell you, you are not going to get an font modification tools, color options, size options or anything it's a simple white canvas on which you can write what ever you want. So now check below steps on how to get it out. - Open Chrome or Firefox - Now type data:text/html, <html contenteditable>in your address bar. - Now press Enter and you will be able to see that blinking cursor & now you can type anything you can see how its going to type all the words you typing.| - So now you can easily copy this text onto any text editing tool like notepad or WordPad.
<urn:uuid:8dda01d5-2b6d-42f7-9321-03df37e9eeac>
CC-MAIN-2017-04
http://www.hackinguniversity.in/2013/03/browser-text-editor.html
s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560284411.66/warc/CC-MAIN-20170116095124-00463-ip-10-171-10-70.ec2.internal.warc.gz
en
0.910667
225
2.171875
2
Travelers line up in the United Airlines terminal at O'Hare International… (Tim Boyle / Bloomberg News ) Fliers are slightly more satisfied with the service offered by U.S.-based airlines since last year. But with the airline industry ranked below the U.S. Postal Service for customer satisfaction, it still has a way to go. The findings come from an annual survey of about 70,000 Americans and show that the airline industry ranks higher than only subscription TV and Internet service companies. The American Customer Satisfaction Index, an independent benchmarking business developed at the University of Michigan, concluded that the industry improved 3% in 2013 to a rating of 69 on a 100-point scale. Not surprisingly, airline travelers were most turned off by crowded seating, extra passenger fees and poor customer service, according to the report. Low-cost carriers JetBlue and Southwest airlines led the industry with scores of 83 and 81, respectively, while network airlines Delta, American, US Airways and United scored no better than 68, the survey found. Industry officials defended the nation’s carriers, saying airfares have increased at only half the rate of inflation since 2000, even when accounting for those extra passenger fees. Airlines also compare favorably with other modes of transportation such as taxis, said Jean Medina, spokeswoman for Airlines for America, the trade group for the nation’s airlines. For example, she noted that the U.S. Department of Transportation received 1.18 complaints against airlines for every 100,000 passengers that flew in 2011. By comparison, New York City taxicabs got 3,125 complaints for every 100,000 passengers that year, she said. “We have great numbers compared to other modes of transportation,” Medina said. TSA stops using 'nude scanners' Fees for airline extras have made the trip to Europe Senators urge scrutiny of American Airlines and US Airways merger
<urn:uuid:ad12c0c2-1cf9-49a9-87ea-ff267846c959>
CC-MAIN-2017-04
http://articles.latimes.com/2013/jun/23/business/la-fi-mo-customer-satisfaction-airlines-20130620
s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560280587.1/warc/CC-MAIN-20170116095120-00556-ip-10-171-10-70.ec2.internal.warc.gz
en
0.935593
399
1.546875
2
Chapter - X The Jaina religions like other religions of India has suffered from the tendency of schisms and secessions. The different sects gradually sprang from time to time on account of the different interpretations put on the canonical texts. Besides, the circumstances of the particular time also compelled them to give up old ideas and to adopt new ones. The separation between the Digambaras and the Svetambaras took place in 79 or 82 A.D. A terrible famine occurred in Magadha in 293 B.C. and 14,000 monks under the leadership of Bhadrabahu with Candragupta Maurya moved on to the South. Some monks under the leadership of Sthulabhadra stayed no gaoha. Both the traditions do not differ as regards the twelve-year famine that took place in Magadha and as regards the consequent emigration of the Jaina Saãgha under his leadership. But while the Digambara tradition states that the Saãgha migrated to the South, Ávetämbara tradition says that Bhadrabähu went to Nepal. The origin of the great schism, which later on developed into Digambara and Ávetämbara sects, is ultimately traced to this event. After Bhadrabähu's departure Sthülabhadra assumed the leadership of the Saãgha in Magadha. He was a contemporary of Maurya Candragupta and Bindusära. After the famine was over he convened a council at Päûaliputra, at which the remnant of the Saãgha left behind in Magadha tried to put in order the sacred lore that had fallen into a state of decay. Sthülabhadra was succeeded by Ärya Mahägiri and then came Suhastin who was the religious preceptor of the Maurya king Samprati who is said to have been a devout Jaina and to have done much for the glory of his religion. After Suhastin came Susthita, Indradinna (Kälaka I), Priyagrantha and Vôddhavädï, one after the other. At this time lived Kälaka II of the Áaka-Vikrama fame. Then followed Dinnasüri, Siãhagiri and Vairasvämi. The last of these was the last Daáapürvï or keeper of a part of the original canon. It was in his time in M.E. 609 (or A.D. 82) that the gradually growing schism in the Jaina Saãgha was finalised and the two sects, Ávetämbara and Digambara, separated for good. Jacobi observes that the division of the Jaina Saãgha into Svetambara-Digambara took place gradually, and that they became aware of their mutual differences about the end of the first century A.D. It is necessary to know what is the exact difference between these two sects, Literally, Digambara mean, 'sky-clad' and Ávetambara means 'white-robed' i.e. the monks of the Digambaras are naked, while those of the Svetambaras wear white clothes. In fact there is very little difference between the two branches as regards the essentials of doctrine. The most authoritative book, namely, Tattvartha Sutra by Umasvati or Umasvami has been accepted by both the sects. However, there are some major as well as minor points on which the two sections are opposed to each other. The major points of difference between the Digambaras and Svetambaras are as follows : (i) While the Digambaras believe that a monk who wears clothes, can not attain salvation; the Ávetämbaras assert that the practice of complete nudity is not essential to attain liberation. (ii) The Digambaras hold the view that woman, is not entitled to Mokÿa in this life. On the contrary, the Ávetämbaras believe that women can attain Moksa in this life. (iii) According to the Digambaras, once a saint has attained Kevala Jõäna (Omniscience) he needs no food, but can sustain life without eating. The view is not acceptable to the Ávetämbaras. Leaving aside the trivial differences in rituals, customs and manners, the following are some of the minor points on which the two sects do not agree : (i) The Digambaras maintain that the embryo of Mahävïra, the last Tïrthaõkara, was not removed from the womb of Devänadä, a Brähmin lady, to that of Triáalä or Priyakäriîi, a Kshatriya lady, as the Ávetämbaras contend. (ii) The Digambaras believe in the complete disappearance of the ancient sacred literature and as such they disown the canonical books of the Ávetämbaras. (iii) The Digambaras assert that Mahävïra never married but according to the Ávetämbaras, Mahävïra married Yaáodä and had a daughter by name Anojjä or Priyadaráanä. (iv) The Ávetämbaras consider Mallinätha, the 19th Tïrthaõkara as a female but the Digambaras state that Mallinätha was a male. (v) According to Digambaras, the Tïrthaõkaras must be represented as nude and unadorned and with downcast eyes. The need not be so according to Ávetämbars.6 Saãgha, Gaîa and Gachchha The Saãgha and Gaîa are well known political terms. The Saãgha-räjya means the rule of a community and the Gana-räjya indicates the rule of many a republic. In early times, there was perhaps no distinction between political Saãgha and Gana, because Päîini equates Gaîa with Saãgha. The Saãgha and Gaîa in Jainism and Buddhism might have come into existence in imitations of the political Saãghas and Gaîas which flourished in ancient India. Both Mahävïra and Buddha were born and brought up in the republican atmosphere. They had Saãghas arround them. It is for this reason that they adopted the name as well as the constitution of the political Saãgha in organizing their religious Saãghas. It is also possible to suggest that the political Saãghas as Gaîas might have been founded in imitation of the religious Saãghas and Gaîas which had existed since the time when the two great religions were organized. The head of the Gaîa was known as Gaîadhara. Both these terms in the political and religious spheres indicate the group of persons with the main characteristic of possessing a mind conscious of certain ideology. The existence of large number of Saãghas and Gaîas in the Jaina community in ancient times points out that it was politically and culturally Saãgha highly organized. It is due to the efficiency of the Saãgha organization that Jainism has survived through all vicissitudes. The Gaîas in course of time also began to be known as Gacchas. Gaîa in the Kalpa-Sütra and Kushäîa Inscriptions of Mathura The Kalpasütra tells us that there were seven schools of thought with their respective branches (Áäkhäs) each of which separated in course of time into its own family Kula. It is interesting to note that several of these Jaina orders are mentioned in Kushäîa records. The seven Gaîas are Godäsa, Uddeha, Uduväûika, Vesaväûika, Cäraîa, Mänava and Kauûika.7 The first Gaîa had four Áäkhäs and Kulas. The second Gaîa Uddeha was founded by Ärya Rohaîa and was divided into four Áakhäs and six kulas. Nägabhüta and Parihasaka Kulas of Kalpasütra may be identified with Nägabhütikïya8 and the Paridhäsika9 of the Kuáäna records. The third gaîa Uduväûika was subdivided into four Áakhäs and three kulas. None of these can be traced in any of the Kuáäîa inscriptions. The fourth Gaîa Veáavätika, founded by Kämarddhi, was subdivided into four Áakhäs and Kulas. Among these, only, the Mehika Kula10 is mentioned in a Kushaîa grant. The fifth Gaîa Caraîa identified by Buhler with Väraîa Gaîa of the inscriptions, was subdivided into four Áakhäs and seven Kulas.11 The Kuáäîa inscriptions refer to several of them.12 The Áäkhäs may be identified with the Häritamalakari, Vajranägari and Säãkäáikä and Partidharmikä of the Kalpasütra. The sixth Gaîa Mänava was divided into four Áäkhäs and three Kulas. But only a few of these are mentioned in Kuáäîa records. The seventh Gaîa Kauûiya Gaîa founded by Susthita was subdivided into four Kulas and seven Áakhäs. This Gaîa is well represented in the Kuáaîa inscriptions.13 The Áäkhäs must be identified with the Vajrä, Mädhyamikä, Uchhänagari and the Vätsaliya while the Kulas may be identified with the Väîiya, Brahmaliptika and the Pôishîavähanaka of the Kalpasütra. The Madhyamikä branch was named after the ancient place Madhyamikä identified with modern Nagarï in Mewar. It was founded by Priyagrantha, the second pupil of Susthita and Supratibuddha.14 Pañcastüpänyäya There is a controversy regarding the origin of the Pañcastüpanyäya, a sect of the Digambaras. One view is that it originated from Mathura while the other view is that it was established by Arhadbali who was the native of Puîâravardhana. Puîâravardhana was a centre of Jainism. The Pahärpur copper plate grant of the year 159 (478-479 A.D.)15 records that a Brähmaîa and his wife deposited three dinärs or gold coins with the city Council and lands for the maintenance of worship of the divine Arhats at the Vihära of Vaûa-Gohäli which was presided over by the disciples and the disciples of disciples of the Nirgrantha preceptor Guhanandin, belonging to the Pañchastüpanikäya of Banaras. It seems that Guhanandina belonged to the third or fourth century A.D. Vïrasena, who wrote a commentary on the Dhavlä, was the follower of Pañchastüpanyäya. Harisheîa has mentioned it in the Kathäkosha written in 937 A.D. Digambara Saãghas, Gaîas and Gachchhas of the South Nirgrantha Mahäáramaîa Saãgha From the two inscriptions16 of the Kadamba ruler Môgeáa (500 A.D.), it is known that villages and lands were given to the Munis of Nirgrantha Mahäáramaîa Saãgha. What was the shape of this original Saãgha, it is not known. The term Nirgrantha or Niganûha was used for Mahävïra, and also for his followers. It seems that Nirgrantha Mahäáramaîa Saãga was in existence during the time of Mahävïra, and it continued even afterwards. Bhadrabähu accompanied this Saãgha for going to the South. During the third or fourth century A.D., there were two main divisions of the Jaina Saãgha (1) Nirgrantha Mahäáramaîa Saãgha and (2) Ávetapata. The Digambaras and the Ávetambaras lived together at Devagiri as known from the inscription17 and probably there were no separate temples. The Nirgrantha Mahäsramaîa Saãgha was of the Digambaras. Müla Saãgha The earliest mention of the Mülasaãgha is in the inscription (C. 400 A.D.) of Gaõga ruler Mädhavavarma II, and in the inscription of 425 A.D. of his son Avinïta.18 In the above two inscriptions, we find the names of Äcärya Vïradeva and Candranandi. These two Äcäryas performed the consecration of the temples, and the Gaõga rulers Mädhava II and his son Avinïta granted lands and villages. It seems that in South India, Mülasãgha was used to indicate the separation of the Digambaras from the Ávetämbaras. The name Nirgrantha-Mahäsramaîa Saãgha probably ceased, and it seems to have been called the Mülasaãgha. The early great Acaryas Kundakunda, Umäsvämï and Samantabhadra belonged to the Mülasaãgha. The Mülasaãgha has been divided into seven Gaîas - Devagaîa, Senagaîa, Deáiyagaîa, Sürasûhagaîa Käîüragaîa and Balätkäragaîa. Generally these Gaîas were called after the end names of the Munis, and after the names of the provinces and regions. Devagana Among the above Gaîas, Devagaîa is the oldest. The existence of this Gaîa is known from the four inscriptions19 of Lakáameávara and the eleventh century inscription20 of Kadavanti. It is not mentioned afterwards. The names of the Äcäryas of this Gaîa are Püjyapäda, Udayadeva21, Rämadeva, Jayadeva, Vijayadeva22, Ekadeva, Jayadeva23, Aõkadeva and Mahïdeva24. Pujyapada was the founder of this Gaîa. Deáï Gaîa and Koîâakunâänvaya Deáigaîa is mentioned in several inscriptions as Desiya, Deáika, Desiga and Deáïya. The term Deáï originated from Deáa which meant province. Some region of Karîäûaka was known by the name of Deáa. From the inscriptions, it is known that there were several centres of this Gaîa in Karîätaka. Among them, Hanasoge (Cikahanasoge) was prominent. From the Äcäryas of this place originated the Hanasogebali or Gaccha. From the inscriptions25 of Chikahanasoge, it is learnt that there were several Vasadis (Temples) of this Gaîa here, and they received patronage from the Caõgälva rulers. Deáïgaîa has been classified into Pustakagachchha, Äryasiãhagrahakula, Candrakaräc ärjämnäya and Maitradänvya. Pustakagaccha In the Puïra inscription26 dated 1087 A.D., the donation of the land given to Padmanandi Maladharideva of the Pustakagachchha has been described. In the Halebeed inscription27 of the eleventh century, the erection of an image by the disciples of Nemichand Bhaûûäraka has been mentioned. In the Citapura inscription28 of the twelfth century A.D., the renovation of a temple by this Gaccha has been recorded. In the image inscription of Peddatuãbalam, the name of Bhaûûäraka Cändrakïrti is found. In the Stavanidhi inscription29 of 1400 A.D., the construction of the temple at the preaching of Vïranandi of this Gaccha has been mentioned. The Samädhimaraîa of the Äcärya of Gomini Änvaya of the Pustakagaccha in the Heritage inscription dated 1224 has been engraved.30 The first subdivision of Pustakagaccha was Panasoge (Hanasoge) Bali. Its first mention31 is in the early tenth century and there is a reference to Samädhimarana of Nemicandra, disciple of Sridharadeva. The second mention32 of this Bali is of 1180 A.D. Balacanda, pupil of Jayakïrti, installed an image. There are four inscriptions33 of this branch which belong from 12th to 14th century A.D. The Äcäryas Lalitakïrti, Devacandra and Nayakïrti have been mentioned. The second sub-division of Pustakagaccha was Iõguleávara Bali. It is mentioned in the seven inscriptions34 and they belong to the 12th-13th centuries A.D. In these inscriptions, the names of the Äcäryas Haricandra, Árutakïrti, Bhanukirti, Mäghanandi, Nemideva, Chandrakïrti and Jayadeva are mentioned. Pustakagaccha has been mentioned without any sub-division in several inscriptions. The first such inscription35 is of 1081 A.D., and Bhaûûäraka Sakalakïrti is mentioned in it. There are seventeen such inscriptions which belong to the 16th century A.D. The Pustakagaccha of Deáigîa is found with Koîâakuîâänvaya. In some inscriptions, only Koîâakunâänvaya is mentioned. The oldest inscription regarding. Konâakunâanvaya is the Tamra idia obtained for Markaräbhip Lekh Tämrapatra. The other inscriptions37 are dated 802 A.D. and 797 A.D. It mentions Koîâakunâeye Anvaya. It indicates the place Koîâakunâa. This inscription mentions that Räÿûraküta ruler Kambharäja donated a village to the Acarya Vardhamäna. The Second Sub-division of Deáïgaîa named Äryasaãgha Graha Kula is found only in one inscription38. It belongs to the tenth century, and it mentions Áubhacandra, disciple of Kulacandra. This inscription was discovered in the Khaîâagiri hill of Orissa, while other inscriptions of Deáigaîa belonged to Karîäûaka. The third sub-division of Deáigaîa is Candrakarä-cäryämnäya which is mentioned in only one inscription.39 It has been discovered in Madhya Pradesh. Subhadra is known to have performed the consecration ceremony of the temple. The fourth sub-division of Mainadänvaya of Subhacandra Äcärya is mentioned in the inscription40 and it belonged to the 13th century. The are several inscriptions of Deáigana without any sub-division. In two inscriptions41 dated 950 and 1096 A.D., there is mention respectively of the Äcäryas Guîacandra and Ravichandra. In these inscriptions, there is mention of Deáïgaîa along with Koîâa Kundänvaya. In eighteen inscriptions, there is mention of Mülasaãgha Deáïgaîa. Among them, old inscriptions42 belong to the twelfth century A.D. Eight inscriptions mention Deáïgaîa only. The old inscription43 among them are dated 1032 A.D. and 1054 A.D. The ancient name in the inscription of the current name Kundakundänvaya was Koîâakundänvaya, which means it originated from Koîâakundapura. Some scholars prove on literary grounds that Mülasaãgha and Koîâakundänvaya are synonymous, and Äcärya Kondakunda is the founder of the Mülasaãgha. This is not proved from any inscription before the eleventh century A.D. Mülasaãgha and Koîâakundänvaya were together used in the inscription44 of 1044 A.D. Koîâakundänvaya has been independently used in the inscriptions45 of the eighth or ninth century A.D. In the inscription of 802 A.D., Koîâakundänvaya was regarded as Gaîa46. The earliest use of Deáïyagana with Koîâakundänvaya was used in the inscription of 931 A.D.47 From the inscriptions, it appears that the use of Koîâakundänvaya started from the later half of the seventh century A.D., and in the eighth or ninth century, efforts were made to make it powerful. Its first influence fell on the Deáastha Saints of Karîäûaka region. They began to be called Koîâakundänvaya Deáïyagîa. The Draviâa Saãgha was also slightly influenced by Koîâakundänvaya.48 It is known from the inscription but it seems that influence was not permanent. The Dräviâa Saãgha Koîâakundänvaya is not found mentioned in any other inscription. Nandi Gana Seeing the similar names of the ancient Äcäryas in the inscriptions of the Mülasaãgha and the Dräviâasãgha, it appears that old Nandigaîa (Saãga) might have come from outside in these two Saãghas. These ancient Äcäryas might have belonged to Nandigana. It seems that the Draviâa-Saãgha and the Mülasaãgha might have adopted the Nandigana of the Yäpanïya Saãgha. The Nandisaãgha was on important one among the Yäpanïyas. Senagan The earliest mention of the Senagaîa is found in the inscription49 dated 821 A.D. It is also found in the Mulagunda inscription50 of 903 A.D. Guîabhadra, the author of the Uttarapuräna, regarded his teacher Jinasena and grand-teacher as scholars of Senänvaya. Vïrasena and Jinasena in the commentaries of Dhavala and Jayadhavala mention Pañchastüpänvaya. Gunabhadra mentions for the first time Pañchästüpänvaya as Senänvaya in the Uttarapuräîa. Senagaîa has been sub-divided into three Gacchas (1) Pogari or Hogiri Gaccha, (2) Pustakagaccha and (3) Chandrakapäûa. The first mention of the Pogarigaccha is found in the inscription dated 893 A.D. This inscription51 records the grant of the village to Kanakasena, disciple of Vinayasena. In this inscription, it has been called Pogariyagaîa of Mülasenänvaya. Another inscription52 is of 1047 A.D., and Pandita Nägasena has been called the Äcärya of Senagaîa-Hogari-gaccha. The Cälukya queen Akkädevï granted some donation to him. The Pogarï Gachchha is found mentioned in the inscriptions53 up to the 13th century A.D. The first inscription54 of Chandrakaväûa Anvaya is dated 1053 A.D. wherein the lineage of Ajitasena, Kanakasena, Nayasena etc. has been described. Saradära Kancarasena of Sindakula gave some charity to Nayasena. Narendrasena II, disciple of Nayasena, has been mentioned in 1081 A.D.55 An officer named Droîa gave him some donation. Narendrasena and Nayasena were well versed in Grammar. In the inscription56 of 1066 A.D., Bhaûûäraka Áäntinandi of Candrikävaûa has been mentioned. The name Mulasamgha is given but not of Senagaîa. The third sub-division Pustakagachchha of Senagaîa is found in the inscription of the 14th century A.D. A lineage of the eleven Äcäryas has been given in it. There is a mention of Samädhimaraîa of Laksmïsena and of Mänasena, disciple of Lakÿmisena. Thirteen inscriptions of the Senagaîa from the eighth to seventeenth centuries are known. Five inscriptions from the 12th to the 15th century of this Gaîa were found at Hire Ävali.This proves that Hire Ävali was a great centre of this Gaîa. In the inscription of the 13th century A.D., Kundakundanvaya was associated with Senagaîa. From the 15th century onwards, its influence gradually decreased. Sürastha Gaîa A Gaîa named Sürastha of the Mülasaãgha was famous. This Gaîa is known from the inscriptions.57 It is mentioned as Sürastha, Surästra, and Sürastha. It appears that the monks of this Gaîa might have lived in Surasûhra from the beginning. Hence, this name was given. It is possible that there might be some region of Suräsûra in South India, from where the Munis might have derived this name. The first mention of this Gaîa is in the inscription58 of 962 A.D. in which Mülasaãgha has been associated with Draviâa Saãgha. The lineage of the saints namely Prabhäcandra, Kalneledeva, Ravicandra, Ravinadi and Eläcärya has been decribed. The Ganga ruler Marasiãha II donated a village to Eläcärya. The inscriptions of this Gaîa from the 11th to the 13th century are found. No Kundakundanvaya has been found in the inscriptions of this Gaîa. Two sub-divisions of the Sürastha Gaîa are known Kärüra Gachchha and Chitrakuûänvaya. There is only one inscription59 dated 1007 A.D. in which Arhanandi Paîâita has been described. There are ten inscriptions of Chitraküûänvaya. The first inscription60 is dated 1071 A.D. in which some donation given to Áishyä of Sri Nandi Pandita has been described. The thrid inscription61 is dated 1074 A.D. in which some donation given to Ärya Pandita, pupil of Arhanandi has been mentioned. The next two inscriptions62 give the lineage of this Aanvaya Väsupüjya, Harinandi and Nägachandra. Harinandi and Nägacandra got some donation in 1148 A.D. That the Sürastha gaîa was in existence from the tenth to the twelfth century is known from fourteen inscriptions. The donation of village to Eläcärya of this Gaîa has been mentioned in the Kädalüra Copper plate inscription.63 In this inscription dated 963, the names of early Äcäryas are given Prabhächandra, Kalneledeva, Ravicandra, and Ravinandi. In three inscriptions64 of the 13th century Adalageri, Nägachandra, Nandibhaûûäraka and Jayakriti of this Gaîa have been mentioned. These are the memorials of the Samädhimaraîa of those Saints Käîüra Gaîa Käîüragaîa is similar to Kaîâura Gaîa the Yäpanïyas. Both Käîura and Kandüra reveals a particular place, from where the group of monks of this Gaîa derived this name. The earliest inscription of this Gaîa belongs to the tenth century A.D.65 It describes the teachers lineage, and mentions some donation given to the disciple of Äcärya Municandra. The inscriptions of this Gaîa up to the 14th century are available. From the inscription, it is known that in the 11th and 12th centuries, Gaõa king Bhujabala, Gaõgavarmadeva, his queen Gaõga Mahadevi and four sons were devotees of the Äcäryas of this Gaîa and honoured them by the charities. Three sub-divsions of Kräîüra Gaîa are known (i) Tintriîï Gachchha, (ii) Meshapäshäîa Gachchha are (iii) Pustaka Gachchha. Tintrinï Gachchha There are six inscriptions66 of Tintriîïgachchha. The first two belong to the twelfth century A.D. and they describe Meghacandra and Parvatamuni Äcäryas. The thrid is dated 1207 A.D. and it mentions some donation given to Bhaûûäraka Anantakïrti. The fourth inscription67 dated 1556 A.D. mentions Devakïrti, Municandra and Devacandra. The inscription68 dated 1130 of Meáapaÿäîa gachchha describes Äcärya Kulacandra or Prabhäcandra, and another inscription69 is concerned with Vasadikä. There are inscriptions of Meshapäshäîa gachchha70 and Tintrinïka gachchha71. Meáapäÿaîa means stone meant for sitting of goats. It seems to be a particular place from where the saints of this Gaîa might be somehow related. Tintriîika was a name of the tree. An inscription of the Pustaka Gachchha is dated 1150 A.D.72 The existence of this Gaîa from the tenth to the sixteenth century is known from sixteen inscriptions. Balätkära Gaîa Looking at the resemblance, Balätkäragaîa originated from Balihäri or Balahäragaîa of the Yäpaniya. Balihära or Balagära appears to be territorial in nature. There was a village named Balagära in South India.73 The earliest inscription74 of Balätkäragaîa is dated 1071 A.D. It mentions the names of eight Äcäryas. Another inscription75 of 1075 mentions Anantakïrti, disciple of Municanda of Chitraküûämnäya of this gaîa. Anotherinscription76 mentions the names of three Äcäryas. There is mention of Tribhuvanacandra in the inscription77 dated 1074 A.D. Next important inscriptions of this Gaîa are of the 13th century78. In the 14th century, Balätkaragaîa is found associated with Sarasvatïgachchha. In the inscriptions of the later half of the 14th century, there was special influence of this Gaîa. The kings of the Vijayanagara kingdom honoured them. An inscription79 of the reign of Vïra Bukkyaräya mentions Äcärya Siãhanandi as Räjaguru and Maîâaläcärya. Another inscription80 mentioning Nandisaãgha with Mülasaãgha and Särasvata gachchha with Balätkära gaîa is important. Inscriptions of Kärañja branch and its Lätüra sub-branch of Balätkarägaîa of the South were discovered at Ukhalada. Nigamänvaya : An inscription81 of Mülasaãgha-Nigaãänvaya is dated 1310 A.D. It records the installation of an image by Kôÿîadeva. Yäpanïa Saãgha : According to the Daráanasära of Devasena- Süri, Yäpanïya Saãgha was established by Ávetambara Árïkalaáa in V.S. 205 at Kalyäîa town in Gulbarga District in Karîätaka. Like Ávetämbaras, it recognized the existence of sacred books and believed that women could attain salvation and saints could take food after attaining omniscience. At the same time, it was, like the Digambaras, against using clothes and it followed the rules and regulations of Digambara ascetics. They used the bunch of peacock feathers. It appears that this Saãgha was a connecting link between the Digambaras and the Ávetämbaras. This Saãgha produced several renowned scholars such as Aparäjita, Pälyakïrti Áäkaûäyana and Vimalasuri. The Yäpanïya Saãgha received the royal patronage from the kings of Kadamba, Chälukya, Gaîga, Räshûraküta and Baûûa dynasties. These kings donated lands to this Saãgha and its saints. The Kadamba ruler Môigeáavarä (470-490 A.D.) performed pious deed by donating land at the place Paläsikä to this Saãgha along with other Saãghas namely Nirgranthas and Kürchakas82 Ravivarmä, son of the above Kadamba king, donated the Purukheûaka village in donation to Kumäradatta, the main Äcärya of this Saãgha.83 Yuvaräja Devavarmä of the second branch of the Kadamba dynasty also granted some lands to this Saãgha84. Some Kadamba inscriptions85 inform that the influence of Yäpanïya Saãgha at the time early Kadamba kings was great. We learn about the Gaîas and Gachchhas of Yapaniya-Saãgha from some inscriptions86. In the Sect of the Yäpanïyas, Nandi Saãgha was the main, and also the oldest. The names of the Äcäryas of this Saãgha were particularly Nandyanta and Kirtyanta.87 Nandisamgha was divided into several Ganas. Among them Kanakopala Saãbhüta Vôiksha Müla Gaîa88, Sri Mülamüla Gaîa89 and Puîîägavôiksha Mülagaîa90 were important. The names of the Gaîas were connected with some trees. The lineage of the Äcäryas of Kanakopalasambhutavôikÿa Mülagaîa, as mentioned in the inscription91 dated 488 A.D. is as follows : Siddhanandi, Chitakäcärya (who had five hundred disciples), Nägadeva and Jinanandi. A feudatory named Sämiyära of Sendraka dynasty of Chälukya king Jayasiãha after constructing Jaina temple for Jinanandi donated a village and some land. Chandranandi, Kumäranandi, Kïrtinandi and Vimalachandrchärya are mentioned in the inscription92. This inscription refers to Eregitturagaîa and Pulikalagachchha. At the preaching of Vimaläcandräcärya, a Sämanta Nirgundaräja Paramagüla during fifty year reign of the Gaîga ruler Árï Purusha after constructing Jaina temple and freeing people from all taxes granted a village in charity. The lineage of the Äcäryas of Punnäga Vôiksha Müla Gaîa in the inscription93 is given as follows Árï Kityäcärya, Kaviläcärya, Vijayakïrti and Arhakïrti. At the request of his feudatory Cäkiräja, the Räshûraküûa king Prabhrita Varsha Govinda III donated a village named Jälamaõgala to Arakakïrti for the management of a Jaina temple in 812 AD. Äcärya Pälyakïrti, author of the Säkatäyana Vyäkarana of the Yäpanïya Saãgha lived during the time of Amöghavarsha. Palyakïrti was either a disciple or a religious associate of Arkakïrti. In the inscription94 of 1108 A.D., we find Puîîagavôksha Mülagaîa as branch of the Mulasaãgha which was afterwards it was absorbed by the Mülasaãgha. Like Karîäûaka, Yäpanïya Saãgha was popular even in Tamil Province. Koûimaâuvagîa of Nandi Gacchha (Saãgha) of the Yäpanïyas is mentioned in the inscription95 and its Äcäryas were Jinanandi, Diväkara and Árï Mandiradeva (Dhïradeva). Dhïradeva was the Adhishthätä (Builder) of the Kaûakämaraîa Jinälaya. At the request of commander (Kaûakaräja) Durgaräja. Ambharäja II of the Early Cälukya Dynasty, donated a village to that temple for the Yapanïya Säãgha. In another inscription,96 the lineage of the Äcäryas of Aõkaligacchha Balaharigaîa has been given as follows Sakalacandra, Ayyapoti and Arhanandi. Ambharäja II donated a village named Kalucumbaru on Attilinaîdu province for repairing of the kitchen of Sarvalokäáraya Jinälaya. It appears that Balahärigaîa and Aîkaligaccha belonged to the Yäpanïyas. Balahäri or Balagäragaîa is mentioned in the inscription97 of the later half of the eleventh century A.D. in the form of Balätkäragana of the Mulasaãgha. In the inscriptions of the kings of Raûûa dynasty, we find two names of the Gaîas of the Yäpanïyas Käreyagaîa and Kaîâüragaîa. Indrakïrti (disciple of Guîakirti), teacher of the first ruler Pôithvïräma of the Raûûa dynasty, belonged to the Yäpanïya Saãgha. In another inscritpion,98 Käreyagaîa is mentioned, and Mailäpänvaya in place of Mailäpatïrtha. The lineage of the saints of Käreyagaîa Mailäpa Anvaya is as follows Mülabhaûûäraka Guîakïrti, Indra Kïrti, Nägachandra, Jinacandra, Áubhakïrti and Devakïrti. Gaîga feudatory of some Amoghavarÿa king after constructing Jaina temple donated a village to Muni Devakïrti. The existence of Kaîdüra Gaîa of the Yäpanïyas is known from the two inscriptions99 of Raûûa kings. The lineage of the teachers of Kaîâüragaîa of the Yäpanïyas is given as below Devacandra, Devasiãha, Ravicandra, Arhanandi, Áubhacandra, Maunideva and Prabhäcandra Deva. From the inscriptions of the Yäpanïyas, it is learnt, that it remained well organized from the fifth to the fifteenth century A.D. There were several influential Gaîas in it. Later on, Punnäga Vôiksha Mulagaîa, Balahärigaîa and Kaîâüra Gaîa joined the Mulasaãgha, Nandi saãgha, Draviâasaãgha first, but were afterwards absorbed in the Mülasaãgha. There is a copper plate inscription100 of the early sixth century A.D. of the Yäpanïyas. It belongs to Ganga king Avinïta. It records the donation of a temple installed by Yavanika Saãgha. There is mention of Kumili or Kumudi gaîa of Yäpanïya Saãgha in four inscriptions101. The first inscription102 of the ninth century A.D. describes Amara Mudala Guru, disciple of the Acarya Mahävïra. He got built Deáavallabha Jinälaya in the north of the village Kïreppäkkam. In another inscription103 dated 1045 A.D., some Äcäryas of this Gaîa have been described. At this time, an official name Chävuãâa got a Jinälaya constructed. Other two inscriptions104 are of uncertain time. These are Niÿidhi inscriptions. The first inscription is the memorial of Samadhimaraîa of Áänta Vïradeva of this Gaîa. There are four inscriptions105 of Punnägavrikshamülagaîa of the Yäpanïya Saãgha. The first inscription dated 1044 records the donation to Bälachandra Äcärya of this gaîa for the newly constructed Jinälaya in Pulinagara. It also mentions donation to Rämacandra Äcärya in 1145 A.D. The next inscription106 is dated 1165 A.D., and the lineage of the teachers is given. The commander Kälaîa of the Áilähära king Vijayäditya after constructing a Jinälaya at Ekkasambuge city made some donation to Vijayakïrti for it. The inscription107 dated 1096 A.D. records some donation to Paîâita Cärukïrti, disciple of Munichandra Traividya of Vôiksha Mülagaîa. In an inscription108 of the time not definite, there is mention of the temple of Kusuma Jinälaya of Vôikÿamülagaîa. The Kaîâura gaîa of the Yäpanïya Saãgha is mentioned in three inscriptions.109 The first is of the early twelfth century A.D., and it describes the four Äcäryas namely Bähubali, Áubhacandra, Maunideva and Maghanandi. There is a reference to a temple of this gaîa in the inscription of the 13th century. The third inscription mentions a Jaina image of this time. The reference to Käreyagaîa of Yäpanïya Saãgha is in the inscription110 of the early twelfth century A.D. Müla Bhaûûäraka and Jinadevasüri were the Äcäryas of this Gaîa. Yäpanïya saãgha has been mentioned in the five inscriptions111 without any reference to Gana or Gaccha. The first inscription is dated 1060 A.D., and it informs the lineage of teachers Jayakïrti, Nägacandra and Kanakaáakti. The next two inscriptions belong to the twelfth century A.D., and they mention the Samädhimaraîa of Municandra and his disciple Pälyakïrti. The last inscription of the 13th century A.D. refers to Traikïrti Äcärya. The Dharmapurï inscription112 of the eleventh century A.D. records donation to Mahävïra Paîâita of Vandiyüra gaîa of Yäpänïya Saãgha. The Varaõgala inscription of 1132 A.D. refers to the passing away of Gunacandra of Mahämuni of this gaîa.113 In the Tengalï inscription114 of the twelfth century A.D., Vaâiyüragaîa has been mentioned. The disciple of Äcärya of Nägavïra of this gaîa installed in image115. The four inscriptions of this Gaîa belong from 980 A.D. to the 13th century. Kürcaka Saãgha : The Kürcaka Saãgha was in existence in Karîataka during the fifth century A.D. along with the Yapaniya Saãgha as is guided from the inscriptions of the Kadamba rulers. As the Monks of this Saãgha had beard-mustache, it was called Kürchaka. In the Kadamba inscription115, Kürcaka Saãgha is mentioned along with the Nirgranthas and the Yäpaniyas. Kadamba ruler Mrigeáavarmä granted land to the Kürcakas along with the Yäpanïyas and the Nirgranthas. In an inscription116, Vïrasneîäcärya Saãgha, a branch of the Kürcakas, has been mentioned Kadamba king Harivarmä at the preaching of Áivaratha donated a village named Vasuntavätaka for the worship of a Jaina temple built by Môigesä, son of the Senapati Siãha and for Ähära (food) or Sarvasaãgha. In the inscription117, there is mention of one more Áramana Saãgha named Aharishûi to which at the request of Sendraka feudatory Bhaîuáakti, Kadamba King Harivarmä donated a village named Marade. Dravida Samgha : A group of Jaina Saints residing in Draviâadeáa was known as Dräviâasaãgha. In the inscriptions, it is mentioned as Draviâa, Draviâa, Draviîa, Dräviâa, Davila and Tibula. Draviâadeáa covers the modern Andhra and Madras region which is called Tamiladeáa. According to the Daráanasära of Äcärya Devasena, Dräviâasaãgha, was established by Vajranandi disciple of Püjyapäda at Madura in the South in V.S. 526. Generally, most of the inscriptions of this Saãgha belong to the kings of Koõgälva dynasty, Áäntara dynasty and Hoysala dynasties. These inscriptions inform that Dräviâasaãgha received royal patronage from the kings of these dynasties. Most of the inscriptions of this Saãgha belong to the kings of Hoysala dynasty. It is learnt from these inscriptions that Äcärya of this Saãgha contributed to the propagation of worship of Padmävati. The monks of this Saãgha renovated the Vasadis or Jaina temples in which they were living, gave ähäradäna, and managed lands, Jägira etc. The early inscriptions of Drävïâa Saãgha were found at Aõgadi (Solebüraan), the origin place of the Hoysalas. In one inscription119 dated 990 of this place, this Saãgha was written as Draviâasaãgha Koîâakundänvaya and in another inscription120 dated 1040 as Mülasaãgha Dravidänvaya. But in the inscriptions121 of the later half of the eleventh century A.D., it has been mentioned Draviâagaîa along with Nandisaãgha I Saõgalänvaya or Aruõgalänvaya. In the beginning, Dravida Saãgha reamined associated with Mülasaãgha or Kundakundänvaya but afterwords, it came to be related with the Nandisaãgha of the Yäpanïyas. When Draviâagaîa became influential, it became Dräviâa Saãgha. The discovery of early inscriptions of the Hoysalas at Aõgädi (Solebüra) proves that they might have contributed to strengthen the Drabida Saãgha. In some inscriptions of Nandisaãgha, Aruõgalänvaya has been mentioned. Aruñgala is the name of the place in Gudiyapattana Tälukä of Tamila Province. The combined name Draviâa Saãgha, Nandi Saãgha Aruõgalänvaya informs that it was the Nandisaãgha of Tamil province, and Nandisamgha originated from Arungala. From the Nandisaãgha of the Yäpanïyas came into existence the Nandisaãgha of Drävida Saãgha. In the eleventh and twelfth centuries, the seats of the Munis of this Saãgha were Mullüra of Kongälva kingdom and Hummach, capital of Áäntara Kings. The inscriptions122 found at Hummach inform about several Äcäryas of this Saãgha Áreyäãáa Pandita, Sudharmä, Kamalabhadra, Vädhïbhasiãha and Ajitasena Pandita. An inscription123 of Nandigaîa Aruõgala Anvaya of Dräviâa Saãgha belongs to the eleventh century A.D. The lineage of Áäntamuni, Vädiräja and Vardhamäna has been given in it. The next inscription124 of this Anvaya is dated 1192 A.D. and it describes about Vajaranandi, disciple of Väsapüjya. In an inscription125 of the 14th century A.D., the lineage of the Anvaya-Árïpäla, Padmaprabha and Dharmasena is known. In three inscriptions126 of the Dräviâa Saãgha, Aruõgala Anvaya has not been mentioned. The Vajïrakheâa copper plate inscriptions127 dated 915 A.D. record the donation of village to Vardhamäna guru, disciple of Lekabhadra of Vïragaîa-Vïrnäya Anvaya of Draviâ Saãgha. Amoghavasati of Chandanäpurï and Uriammavasati of Vaâanera were looked after by them. It is the oldest of all the available inscriptions so far available. Varnita Viragana Vïrîayya Anvaya is not found mentioned in any other inscription. It is the first and only inscription of the Dräviâa Saãgha found outside Mysore Pradeáa. The Pudüra inscription128 dated 1087 A.D. records the donation of land to Äcärya Kanakasena for Pallava Jinälaya. The Ujjili inscription129 dated 1167 A.D. mentions the donation of land to Indrasena Äcärya of Drävida Saãgha Senagana Kairüra gachchha. The association of Sënagaîa with Drävïâa-Saãgha was not known earlier. Earlier Senagaîa was told related with Mülasaãgha and Kairüra gaccha with Surästha gaîa. The inscription130 dated 1194 A.D. is the last of this collection. It was discovered from Yetina hatti and it records the death of Äcärya Ajitasena. Käshthä Saãgha There is a controversy among scholars about the origin of the Käshûhä Saãgha. Devasena, an author of the tenth century A.D., mentions in the Daráanasära that Kumärasena established the Käshûhä Saãgha in the south. In two inscriptions,131 its name has been mentioned Käñchï Saãgha. It has been written in the Vacanakoáa of the 17th century that Lohäcärya, Pattadhara of Umäsvämï established this Saãgha at Amarohä in North India. According to Kamta Prasad,132 Käshthä Saãgha originated from Käshûhä village near Mathura located on the bank of the river Yamunä. The main gacchas or branches of the Käshûhä Saãgha were Nanditala, Mäthura, Vägaâa and Läûavägaâa. Jambükhanda, Gaîa Jambükhaîâagaîa has been mentioned in the inscription133 of the sixth-seventh century A.D. Sentraka king Indraîanda donated something to Äcärya Äryanandi. Siãhavüra Gaîa There is an inscription134 dated 860 A.D. of Siãhavüra gaîa. It records some donation by king Amoghavarsha to Äcärya Näganandi of this Gaîa. It seems that there was not much difference in the functiong of the Saãhas, Gaîas and Gacchas of the South. Munis of these organizations go constructed temples and Mathas (Monasteries). They received the donation of the villages, lands, gardens, houses etc. They participated in discussions of the royal courts. Incidentally, they helped the kings to manage the affairs of their kingdoms. They tried to increase the influence of Jainism even by Mantra Sädhanä, Astrology and Medicines. Ávetämbara Gachchhas of North India During Medieval Period The number of Ávetämbara Gachchhas was originally 84 but it seems to be only conventional. Neither the castes nor the Gachchhas were founded at one time. They came into existence at different times. Some names of the Gachchhas have no significance but were added simply to make their number 84. This increase in number started about the eleventh century A.D. At present, their number seems to be about one hundred fifty. Most of these Gachchhas originated in Rajasthan, but a few in Gujarat. The Äcäryas of these Gachchhas are known to have performed the consecration ceremony of images and temples at different times and places. These gachchhas originaged in different ways. Some of the gachchhas were named after certain good deeds by certain persons while others named after influential persons. Some of the ancient Kulas in course of time were also converted into the Gacchas. The Gacchas are also territorial in origin. (1) Bôihad Gachchha Uddyotana Suri bestowed the designation of 'Süri' on the eight monks including Devasüri under the shade of a large banian tree at a village Teli situated at Mount Abu. According to the opinion of some, the designation of the (highest priest) was conferred only on Sarvadevasuri. As the designation was conferred under the banian tree, the Nirgrantha Gaccha began to be called Vaûa Gaccha. Vaûa Gachcha is known also by another name Brihad Gaccha.135 The earliest inscription of 1086 A.D. of this Gaccha in Rajasthan is found at Kotarä in Sirohi State.136 The next early inscription of 1158 A.D. is found at Nädol in Marwar.137 From the inscriptions it seems that it became popular in Sirohi138 and Marwar States in the 12th, 13th and 14th centuries. The inscriptions of the 14th and 15th centuries of this Gaccha are also found Udaipur and Jaisalmer.139 (2) Kharatara Gaccha Kharatara Gaccha is the most famous and influential Gaccha. Jineávarasüri by defeatng the Chaityaväsïs in the royal court of Durlabharäja got the title 'Kharatara' in 1017 A.D. From him started the Kharatara Gaccha.140 It arose outside Rajasthan but gathered a large number of followers here. In course of time, it was divided into many branches.The inscriptions of this Gaccha are found in the different parts of Rajasthan. But it remained dominant in Jaisalmer from the 14th century to the 19th century.141 The Ächäryas of this Gaccha installed several images and wrote many works. (3) Tapä Gaccha : Jagacandra Süri was not only a scholar but he was also a great ascetic practising penances. He accepted the penance of doing 'Äyambil' for the whole life and passed twelve years in this way. Seeing it, Jaitra Simha, the king of Mewar, gave him the title of Tapä (which means a real ascetic) in 1228 A.D. From this time, Nirgrantha Gaccha got another name of Tapä Gaccha.142 The saints of this Gaccha contributed considerably to the growth of Jainism. Later on, it was also divided into many branches. Vôiddha Pausälika Tapä-Gaccha started from Vijayacandra who was the pupil of Jagacandra Süri. From Devendra Suri, there started the Laghu Pausälika Tapä-Gaccha. Vijayacandra Suri was indolent in the performance of religious rites while Devendra Süri devoted himself to the performance of the purifying rites and contributed to the development of Jainism.143 The images installed by the Äcäryas of this Gaccha are found in different parts of Rajasthan. But still, it remained strong in Sirohi,144 Mewar and Jaisalmer.145 (4) Añchala Gaccha : Vijayachanda Upädhyäya was the first person to start a Gaccha called Vidhipakÿha in order to support the pure rites. Once the merchant Koûï went to Pätan. While performing the rites of paâikkamaîa, he used the edge of his cloth in bowing down instead of using the 'mubhapaûûï' (a piece of cloth kept on the mouth by the Jaina ascetics). Kumärapäla asked him the reason of this. The Guru told him about Vidhi-paksha (the new sect) and then Kumärapäla used the edge of his cloth (called äñchala in Gujaräti) in saluting. Thence forward, Vidhi-pakÿha was called Äñchala Gaccha.146 This Gaccha started in 1166 A.D. outside Rajasthan but it spread in Jaisalmer, Udaipur, Jïräualä in Sirohi State and Nagara in Marwar in the 15th century A.D. as known to us from the inscriptions. Several Äcäryas of this Gaccha composed important works and celebrated the consecration of many images.147 (5) Pürîimiyä Gaccha and Särdha Pürîimiyä Gaccha : From Pürîimä, it seems to be named Pürîimiyä Gaccha. Särdha Pürîimiyä system started in 1179 A.D. The great king Kumärapäla once asked Hemachandra to call the leader of the Pürîimiyä Gaccha in order to inquire whether its followers acted according to the Jaina holy books or not. The leader of the Gaccha was called and questioned by Kumärapäla. But he could not give satisfactory answers, so the ascetics of the Gaccha were asked to go into exile. After the death of Kumärapäla, Sumatisiãha, the Ächärya of the Gaccha, came to Pätan. On being asked by the people about his Gaccha, he said, 'We belong to Särdha Pürîimiya Gaccha.' The followers of this system do not worship a Jaina shrine with fruits.148 It originated outside Rajasthan but it gathered the followers here also. It remained very dominant in the 15th century in Jaisalmer and Sirohi States as it is known to us from the inscriptions. Its inscriptions are also found at Jodhpur and Nagaur in Marwar, Ajmer and Udaipur.149 (6) Ägamika Gaccha : Áïlaguîasüri and Devabhadrasüri were the two Äcäryas who belonged to Pürîimiyä Gaccha. They joined the Äñcala Gaccha, but they soon left it and started their own sect. They taught that prayers should not be offered to Kÿetra Devatä. Besides this, they propounded some new theories and gave the name of Ägamika Gaccha to their section.150 This sect either started in 1157 A.D., or 1193 A.D., but in Rajasthan it spread in the 15th century A.D. It was prevalent in Jaisalmer, Ajmer, Jaipur and Nagaur, Barmer and Osiä in Marwar State and Sirohi State.151 Kula Gacchas : (1) Candra Gaccha : Candra Kula in course of time was converted into Candra Gaccha. Its name is also mentioned in the inscription of 1182 A.D. at Jälor in Marwar.152 It seems to have been in existence from 1125 A.D. to 1435 A.D. in Sirohi State as known to us from the inscriptions.153 (2) Nägendra Gaccha : From Nägendra Kula, it became famous as Nägendra Gaccha. The preceptor of the founder of Aîahilapura-pätan named Áïlaguîasüri also belongs to this Gaccha. The earliest inscription of 1031 A.D. of this Gaccha in Rajasthan is found at Osiä in Marwar.154 It became dominant at Jaisalmer from the 13th century to the 16th century. It was in existence at Pälï, Nagaur, Sirohi and Udaipur at this time.155 (3) Nivôtti Gaccha : Probably Nivôitti Kula in course of time began to be called Nivôitti Gaccha. In the early inscriptions discovered in Sirohi State, Nivôitti-kula is mentioned,156 but in the inscriptions of 1412 A.D. on the metal image of Sïtalanätha at Udaipur, Nivôitti Gaccha is mentioned.157 Gacchas Named after Influential Persons (1) Kharatara Gaccha : The Kharatara Gaccha in course of time was divided into many branches which were started after the influential persons. Bhävaharÿa Kharatara Säkhä is the 7th Gacchabheda, and it was founded by Bhävaharshopädhyäya.158 In 1643 A.D., there originated the Raõgavijaya Kharatara Áäkhä from Raõgavijaya Gaîi. This is the 9th Gaccha-bheda, and from this Áäkhä sprang the Árïsärïya Kharatara Áäkhä founded by Árïsäropädhyäya as the tenth Gaccha-bheda.159 It seems to have remained in existence at Jaipur in the 19th century. (2) Tatä Gaccha : In course of time, the Tapä Gaccha was also divided into many branches. Some of the branches were named after the great Äcäryas. After the demise of Äcärya Mahärja Vijayasena Süri, there were the five divisions in Tapä Gaccha after the names of Äcäryas. One was formed by the followers of Äcärya Mahäräja Deva Süri and known as Deva Süri Gaccha. The second formed by the followers of Äcärya Änanda Süri was known as Änanda Süri Gaccha. The third division known as Sägara Gaccha was organized in 1629 A.D. by Äcärya Räja Sägara Süri. The fourth division named Vimala Gaccha was named after Vimala Süri in 1692 A.D. The fifth division known as Saãvegï Gaccha was created by Pannyäsa Satya Vijayajï Gaîi.160 Pärávanätha Gaccha is also a branch of Tapä Gaccha. An intelligent man called Päráva Candra took initiation under Árï Sädhuratna Süri of Nägauri Tapä Gaccha in 1515 A.D. About some courses of conduct, he differed from his perceptor and aptly preached his view vigorously. His Gaccha was named after his own name.161 He too believed in image worship, and images have been consecrated by himself and other saints of the Gaccha. The saint Kôishîarshi founded Kôishîarshi Gaccha, a branch of Tapä Gaccha. The earliest mention of it is found in the inscription of 1426 A.D. at Jïrävalä in Sirohi State.162 The next mention of it is found in the inscription of 1468 A.D. of Nagaur in Marwar.163 In the 15th century, this Gaccha was in existence at Jaisalmer.164 Kamala Kalaáa is also a branch of the Tapä Gaccha and it became separated as Kamala Kalaáa in the 16th century. It seems to have reamined popular in Sirohi State as known from the inscriptions.165 (3) Gaccha of this Type in Sirohi State : From the name of the Ächärya Pishpälächärya, it was known Pishpälächärya Gaccha. It was in existence in Sirohi State from 1151A.D. as it is known from the inscriptions.166 Mahendra Süri Gaccha came into existence after the name of the Äcärya Mahendra Süri. It is mentioned in the inscription of the 13th century at Ajärï in Sirohi State.167 Ämradeväcärya Gaccha was named after Ämradeväcärya. It was in existence at Ajäri and Lotäîa in Sirohi State in the 11th century. From the inscriptions, it seems that it was associated with Nivôitti Kula.168 (4) Gaccha of this Type in Jodhpur State : From the Achärya Prabhäkara, it became famous as Prabhäkara Gaccha. It is mentioned in the inscription of 1515 A.D. found at Mertä in Marwar.169 The name of Kaâaumati Gaccha became famous after the name of Kaâäväáäha in 1505 A.D. The name of this Gaccha is mentioned in the inscription of 1626 A.D. of Osia.170 (5) Common Gaccha Found in the States : Dharmaghosha Gaccha was named after Dharmaghoÿa Süri probably in the 12th or 13th century. It became dominant at places such as Jaisalmer, Udaipur and Nagaur in the 14th, 15th and 16th centuries.171 From Bhävadeva Süri, Bhävadevächärya Gaccha was named. Bhävadära Gaccha and Baâähaâa Gachha also seem to be of the above type. The earliest mention of its is found in the inscription of 1157 A.D. discovered at a village Sïverä in Sirohi State.172 From the 13th century to 15th century, the existence of this Gaccha in Jaisalmer is known from the inscriptions.173 Malladhärï Gaccha was called after Malladhärï Äcärya. It remained in existence from the 13th century to the 16th century at the places such as Jaisalmer, Udaipur and Sirohi State.174 Vidyädhara Gaccha was probably named after Vidyädhara Süri. From the 14th century to the 17th century, it seems to have been in existence in Rajasthan. Its inscriptions are found at Osia and Nagaur in Marwar, Näîä in Sirohi State and Jaisalmer.175 Probably, Vijaya Gaccha was named after Vijayadeva Süri. There is an inscription of 1642 A.D. found at Bhäraja in Sirohi State.176 Another inscription of 1661 A.D. is found at Bälotarä in Marwar.177 In the 19th century, a person belonging to Alwar of this Gaccha performed the installation ceremony of the image.178 Rämaseniya Gaccha was probably named after Rämasena. The earliest inscription of 1401 A.D. of this Gaccha is found at Nagur in Marwar.179 It seems to have been in existence in Mewar in the 15th century.180 Yaáa Süri Gaccha was established after the name of the Äcärya Yaáa Süri. The inscription of 1185 A.D. of this Gaccha was found out at Ajmer.181 (1) Gacchas Originated from the Places in Sirohi State : Sirohi State remained the stronghold of the Jaina religion in early Hindu period. It was, therefore, natural that the Gacchas were named after the places thereof. Madähaâa Gaccha became famous from the village Maâära in Sirohi State. The oldest inscription of 1230 A.D. of this Gaccha has been found at Maâära, the place of its origin.182 The large number of inscriptions of this Gaccha discovered in Sirohi State indicate that this area remained the stronghold of this Gaccha.183 In the 14th and 15th centuries, it was also prevalent in Jaisalmer and Udaipur.184 Nänaväla Gaccha and Jñänakïya Gaccha seem to be the one and the same Gaccha. It seems to have originated from the village named Näîä in Sirohi State. Numerous inscriptions from the 11th century to the 15th century discovered in Sirohi State indicate that it was the centre of this Gaccha.185 It was in existence at Jaisalmer from the 13th to 15th century.186 In the 15th and 16th centuries, it was found in Mewar.187 According to the Paûûävali, Jirävalï Gaccha is a branch of Bôihad Gaccha. It originated from the place named Jirävali in Sirohi State. It was even in existence in the 14th century at the very place of its origin.188 Brähamîa Gaccha among the Jainas originated from the place Varmäna the ancient name of which was Brähamaîa Mahästhäna. The centre of this Gaccha was the region of Sirohi State from the 12th century to the 16th century A.D. as it is clear from a large number inscriptions discovered in this area.189 It was found at Varmäna in the 12th century A.D. The Jaina temple of Mahävira of this place belonged to this Gacha, and it was built in 1185 A.D. or even before by the Árävakas or lay disciples. The inscription of 1185 A.D. records that Puniga and other Árävakas constructed Padmaáilä of the temple, of Mahävïra of Brähamaîa Gaccha.190 There is an inscription of 1087 A.D. with the name of this Gaccha found at Pälï in Marwar.191 This Gaccha was prevalent in Mewar in the 14th and 15th centuries and in the 15th and 16th centuries, it was in existence at Jaisalmer.192 Kächoli Gaccha seems to be connected with the place named Kächolü in Sirohi State. It was a branch of the Pürnimä-pakÿa. It was in existence in Sirohi State in the 14th and 15th centuries.193 (2) Gaccha Originated from the Places in Marwar : Upakeáa Gaccha was named after Osiä in Marwar. The inscription of 1202 A.D. with the name of this Gaccha has been also discovered at this place.194 There is also the inscription of 1137 A.D. found at the village Ajärï in Sirohi State.195 It remained popular from the 13th to the 16th century in Jaisalmer, Udaipur and Sirohi States as a very large number of the inscriptions have been discovered here.196 The name of Koraîûaka Gaccha was given after Koraîûa in Marwar. The earliest inscription of this Gaccha of 1031 A.D. has been found out at Pïîâaväâä in Sirohi State.197 From this time to the 16th century it remained in existence in this area.198 From the 14th century to the 16th century, it was also prevalent in Jaisalmer.199 Saîâerä in Marwar is supposed to be the original seat of Saîâeraka Gaccha, founded by Yaáodeva Süri who came from Kathiawar because of the fear of the Mlecchas. He settled with the people at the tank. He saw a fight between the bull and the lion in which the bull emerged victorious. The village and Gaccha were named as Saîâeraka Gaccha. This Gaccha spread much in the different parts of Rajasthan. It was in existence at Näâol in Marwar in the 12th century.200 In the 15th century, it was dominant in Jaisalmer. From the 14th century to the 16th century, it was prevalent in Mewar.5 From the place named Hatikuîdï in Marwar, Hastikuîdï Gaccha became famous. It is mentioned in the inscription of 1396 A.D. of Udaipur.202 Chaitraväla Gaccha and Chaitra Gaccha seem to be identical. They possibly originated from the place named Chaitraväla-nagara in Marwar. They prevailed in Jaisalmer and Udaipur from the 13th to the 16th century.203 Palliväla Gaccha originated from Pälï of Marwar. It is known both as Palliväla Gaccha and Pälli Gaccha. Palli Gaccha is mentioned in the inscription of 1405 A.D. at Jaisalmer and of 1451 A.D. at Jaipur.204 Palliväla Gaccha is found in two incriptions of the 15th century found at Ajmer.205 Nägapurïya Gaccha originated from Nagaur in Marwar. The disciple of the famous Vädideva Süri named Padma Prabha Süri practised hard austerities at Nagaur in 1117 A.D. and he was therefore given the title Nägaurïya Tapa. Harshapurïya Gaccha, a branch of Srï Pärávanäthakula, originated probably from the place named Harsaur situated between Ajmer and Pushkar. Some of the Ächäryas of this Gaccha were very powerful and had great influence over their contemporary rulers. At the request of Abhayadeva Süri, the Cauhäna ruler Pôûhvïräja I of Áäkambharï, who lived in 1105 A.D., put the golden cupolas on the Jaina temples of Raîthambhoô.206 His pupil was Maladhärï Hemachandra who had influence over Jayasiãha Siddharäja of Gujarat. The name of this Gaccha is mentioned in the inscription of 1498 A.D. found at Nagaur.207 Maîâovara Gaccha is a branch of the Kharatara Gaccha. In 1745 A.D., this branch became separated from Jinamahendra Süri at Maîâovara and therefore was named Maîâovara Säkhä.208 (3) Gacchas Originated from the Places in Mewar : Bhartôipurïya Gaccha orginated from the village Bhartôipura now known as Bhaûevara in Mewar. It was founded by Bhartôibhaûa, the father of the famous king Allaûa, in the 10th century A.D. This Gaccha is mentioned in an inscription of the 13th century.209 Ratnapurïya Gaccha was originally a branch of Maâähaâ Gaccha, but afterwards, it became a separate Gaccha after Ratanapura in Mewar. It is mentioned in the inscription of 1453 A.D. on the metal image found in the Jaina temple of Udaipur.210 (4) Gacchas Originated from the Other Known Places : Kämyaka Gaccha originated from Kämä in Bharatpur State. It is said that there was a Kämyaka forest in this area. It is mentioned in the Bayänä stone inscription of 1043 A.D. The names of the Jaina teachers Vishîu Süri and Maheávara Süri are mentioned.211 Rudrapalliya Gaccha is a branch of the Kharatara Gaccha. In 1147 A.D. at Rudrapalli, it was founded by Jinaáekharächärya.212 It is said to have originated from the place named Rudrapalli near Delhi. In the 15th century it spread at Nagaur and Bälotarä in Marwar and Jaisalmer.213 (5) Gacchas Originated from Unknown Places : There are some regional Gacchas but the places of their origin have not been definitely identified. Pïppälaka Gaccha is also one of the branches of the Kharatara sect. This branch became separated in 1417 A.D. from Jinavardhana Süri.214 It was connected with the place Pippälaka and therefore it was named Pïppälaka. It seems that both Humbaâa Caste as well as Gaccha originated from the place named Humbaâa which has not been identified yet. It is mentioned in the inscription of 1396 A.D. of Udaipur,215 Jalyodhara Gaccha originated from the village named Joräudra. This name has been mentioned in an inscription of 1156 A.D. which has been discovered at Ajärï in Sirohi State.216 This Gaccha was especially connected with Moâhavaãáa from 1169 A.D., to 1366 A.D. Bhïmapallïya Gaccha is a branch of Pürîimä Gaccha and originated from the village named Bhïmapallïya. It is, therefore, known as Bhïmapallïya Gaccha. It is mentioned in the inscription of 1541 A.D. found at Jodhpur.217 Kuûuvapurä Gaccha is one of the branches of Tapä Gaccha. It started from the place named Kuûuvapurä. It was prevalent at Näâläï in the early 16th century. Indranandi of this Gaccha installed the images in 1512 A.D., 1513 A.D. and 1514 A.D. at this place.218 Other Remaining Gaccha (1) Sub-Branches of Kharatara Gaccha : It is mentioned in the paûûävalïs that Madhukharatara Áäkhä was the first Gaccha-bheda which started in about 1107 A.D. from Jinavallabha Süri. Laghukharatara Säkhä, the third schism, was founded by Jina Siãha Süri in 1274 A.D. In 1365 A.D., Vegaâ Áäkhä took its rise founded by Dharma - Vallabha Gani. It remained dominant from the 16th century to the 19th century in Jaisalmer.219 It was the fourth Gaccha-bheda. In 1507 A.D., Acäryïya Kharatara Säkhä arose founded by Ächärya Áäntisägära in Marudeáa. This is the sixth division. In 1629 A.D., there originated the Laghuvächäryïya Kharatara Áäkhä from Ächärya Jinasägara Süri occasioned by Harshanandana, pupil of Samaya Sundara. This is the eighth Gaccha-bheda in the Kharatara sect.220 (2) Gacchas Found in Marwar : Marwar remained the chief centre of the Jaina religion, therefore, the followers of the different Gacchas resided here. Siddhäntï Gaccha is mentioned in the inscription of 1508 A.D. found out at Jodhpur.221 Jäpaâäîa Gaccha is mentined in the inscription of 1477 A.D. of Nagaur.222 An inscription (19th century) referring to Kavala Gaccha is engraved on the pillar of the Jaina temple at Rainapura.223 The name of Tävaâära Gaccha is found in the inscription of 1442 A.D. of the Jaina temple of Munisuvrata at Jodhpur.224 (3) Gacchas Found in Jaisalmer State : In Jaisalmer State, Jainism flourished greatly because of its situation in the heart of the desert. Väûapïya Gaccha is mentioned in the two inscriptions of 1105 A.D. and 1281 A.D. discovered at Jaisalmer.225 Saraväla Gaccha seems to be in existence the 12th and 13th centuries in the area.226 In 1364 A.D., Iávara Süri of Bähaâa Gaccha performed the installation ceremony of the image of Sumatinätha.227 (4) Gacchas Found in Jaipur State : Some Gacchas are also found to be mentioned in the inscriptions of Jaipur. In 1472 A.D., the image of Padmaprabhu was set up by Bhäkhara through Vajreávara Süri of Cäîacäla Gaccha.228 In 1452 A.D., Áivaräja celebrated the consecrations ceremony of the image of Kunthunätha through Padmananda of Räja Gaccha.229 Chahiterä Gaccha is mentioned in the inscription of 1555 A.D., found on the Pañcatïrthï in the Jaina temple of Jaipur.230 (5) Gacchas Found in Mewar : There are some Gacchas which are not known to have been in existence at any other place except Mewar. The inscription of 1317 A.D. with the name of Präyä Gaccha is found at Udaipur.231 In 1144 A.D., Kanudeva of Deväbhidita Gaccha performed the installation ceremony of the image through Sïla Süri of Deväbhidita Gaccha.232 The inscription of 1439 A.D. with the name of Niûûhati Gaccha233 is engraved. (6) Common Gacchas : Thäräpadrïya Gaccha and Thirädrä Gaccha seem to be the one and the same Gaccha. In the 12th century, it was in existence in Sirohi State.234 In the 15th century, it seems to be prevalent in Jaisalmer.235 The earliest mention of Pippala Gaccha is in the inscription of 1151 A.D. found at Koûarä in Sirohi State.236 It was in existence from the 14th century to the 16th century in Jaisalmer.237 Mahukara Gaccha also seems to be known by the name of Madhukara Gaccha which is mentioned in the inscription of 1436 A.D. discovered at Rohiâä in Sirohi State.238 It is also mentioned in the inscriptions of 1470 A.D. and 1506 A.D. discovered at Alwar and Jaisalmer respectively239. Bokadiyä Gaccha seems to have been prevalent in the area of Jaipur and Nagaur in the 14th and 15th centuries.240 Gujarat : That Jamaîapura Gaccha originated from Jamanapura is situated in Mahesana District. This Gaccha is mentioned in a metal icon of V.S. 1285. The Tharäpadra Gaccha, originated from the ancient name Tharäpadra, is located in Banas Kantha District. At present, it is known as Tharäda. Harïjagaccha originated from the place Härïjagaccha originated from the place Härïja in Mehasana District241. The literary evidence for the existenve of this Gaccha is dated V.S. 1556 (1500 A.D.) while the epigraphical evidence goes from V.S. 1330 to V.S. 1577. The Aââälijiya Gaccha is connected with a place named Aâälaja, near Ahmedabad.242 Four inscriptions dated V.S. 1136, V.S. 1207, V.S. 1228 and V.S. 1273 found in the Jaina temple at Badhaväîa mention this Gaccha. The inscriptions engraved on the Jaina images found at Palithana, Áaturunjaya, Cambay, Bharu Kaccha (Gandhara). Anahilavada etc. mention different Gacchas. Some of them might have originated in Gujarat. The followers of the different Ávetämbara Gacchas migrated from Rajasthan to the neighbouring regions of Malwa, Maharashtra and Uttara Pradesh, and settled there. They became prosperous and performed the installation ceremony of images. They also carried old images with them and placed them in the temples. Numerous images engraved with the names of the Gacchaas of the 15th and 16th centuries are noticed. The Árävakas of these Gacchas also got prepared the copies of manuscripts for presentation to the Äcäryas. It seems that there was nothing like unity in the Ávetämbara Jaina Saãgha, but on the contrary, it was divided into several Gacchas with differences. They gradually spread throughout North India. There was no personality to unite them under One Saãgha. Malvä : Tapägaccha became very popular in Malwa during the 15th and 16th centuries. Next important Gacchas known were Khaôatara, Ägama, Äñchala and Upakeáa. The other Gacchas mentioned in the Jaina inscriptions are Näîapäla, Pali, Bhävada, Näîakäya, Äáapallïya, Nagendra, Koraîta, Dharmaghoáa, Jïrapallïya, Rudrapalliya, Brahmaîa etc. The main centres of these Gacchas were Ujjain, Badnawar (Vardhamänapura), Mandu (Mandapadurga) and Dhar.243 Mahäraÿtra : The inscriptions are engraved on Jaina metal images place in the Jaina temples of Bombay, Nagpur, Amravati, Akola, Chandväâ near Nasik, Manamäda, Karanja, Wardha, Chälïsagäõva and Bhadravati244. Some Jaina inscriptions were found at Dhulia245. These inscriptions give information about the gacchas. The most popular, in this region, were Tapä and Kharatara Gacchas. The other Gacchas known from the inscriptions of the metal images were Kuranûa, Chitra, Bôihad, Äñchala, Jiräpali, Pali, Dharmaghosha, Sandera, Kôishnarshi, Ägama, Pippala, Nägendra, Brahmaîa, Bhïmapalli, Gyänakïya, Bhävadära etc. Uttra Pradeáa : The inscriptions of Jaina images found at Banaras, Agra, Ayodhya etc. also give information of these Gacchas such as Kharatara, Tapä, Pürnima pakÿa, Maladhärï, Dharmaghosha, Änchala, Koranûa, Brahamaîa Ägama etc. An important inscription from Kangra, Himachal Pradesh mentions the names of two Jaina saints belonging to Räjakula-gaccha which is probably the same as Räjagaccha. The Komalagaccha was already in existence in Multan.248 Digambara Saãghas, Ganas and Gacchas in the North during the Medieval Period The Digambara Saãghas of the Medieval period in North-India were Mäthura, Vägaâa, Lätavägeda and Nandïtata. Besides, there were Käshûhä Saãgha and Ãülasaãgha. Later on, Mäthura, Vägada, Läûavägeâa and Nandi became the branches of the Käshthä-saãgha. The Ãülasaãgha along with the Balätkäragana became powerful from the 14th century onwards. The Äcäryas of these Saãghas performed the installation ceremony of images and got prepared the copies of the manuscripts. They led pilgrimage to the holy places along with the Árävakas. The image of Áäntinätha was consecrated by the Äcärya Subhadra who belonged to the line of Deáïgaîa in the Ämnäya of Candrakara Äcärya249. The Puîêäta-Saãgha from Badnawar is also known. Mäthura Saãgha : Mäthura Saãgha seems to have originated from Mathura. According to the Daráanasära, Rämasena was the Äcärya of the Saãgha. He prohibited the use of Picchï (small brown peacok feather). The frist historical mention of this Saãgha is found in the works of Amitagati. His teacher's lineage is Devasena, Amitagati, Nemiseîa and Mädhavasena. He wrote the Subhäáitaratnasaãdoha in V.S. 1050 during the reign of Paramära king Muñja, the Vardhamänanïti in V.S. 1068, the Dharmaparïkshä in V.S. 1070 and the Pañcasaãgraha in V.S. 1073250 : Another old Äcärya of Mäthura Saãgha was Chatrasena. His Äcärya Äloka got the Ôÿabhanätha temple built in V.S. 1166. The third known Äcärya of this Saãgha is Gunabhadra. He wrote a lengthy Praáasti of the temple of Pärávanätha in V.S. 1226. Lalitakïrti is the fourth Äcärya who installed the Devï image in V.S. 1234. The fifth Äcärya was Amarakïrti who wrote the Neminäthacarita, and Shaûakarmopadeáa in V.S. 1247251. The Mäthura Sãgha is known from the inscriptions of the twelfth century engraved on the Jaina images discovered at Badnawar252. The Mäthura Saãgha and its Äcäryas are known from the inscription of V.S. 1308.253 Mäthura Saãgha seems to have remained dominant in Rajasthan during the eleventh and the twelfth centuries. At this time, images were installed by the Äcäryas of this Saãgha at different places. There is a mention of Paîâita Mahäsena of Mäthura Saãgha in the inscription of 1158 A.D. on the stone image of Brahmäîï in the Jaina temple of Baghera.254 Yaáakïrti appears to be the influential Äcärya who performed the consecration ceremony of the white stone image now placed in the temple of Singhiji at Sanganer in 1167 A.D.255 and the white marble image of Padmaprabhu now found at Maroth in 1175 A.D.256 This function was organized by Kuladhara, son of Manoratha who seems to be a rich Árävaka. In 1175 A.D., Hetyä and his son Vilhaîa also installed the image of Märoûha through the same Yaáakïrti257. The author of the Bijaulia inscription of 1170 A.D. was Guîabhadra, a Mahämuni who belonged to the Mäthura Saãgha258. An inscription of 1176 A.D. engraved on one side of a four-sided massive Jaina pillar in the Jaina temple at Rüpähelï, near Udaipur, records that the pillar was erected by Padmaárï, a female disciple of Ajikä belonging to the Mäthura Saãgha259. There was a hold of Mäthura Saãgha at Badnawar in Malwa. This is clear from the Jaina inscriptions of V.S. 1210, 1226 and 1236 of images260. The medieval lineage of Mäthura Gaîa starts from Mädhavasena who had two disciples Uddharasena and Vijayasena. According to traditions, Mädhavasena lived during the reign of Alauddïn Khilji261. After Uddharasena, Devasena, Vimalasena, Dharmasena, Sahasrakïrti and Guîakïrti gradually became Bhaûûärakas. In the Ämnäya of Guîakïrti, a copy of the Pañcästikäya was written in V.S. 1468 during the reign of Vïramadeva of Gwalior. The successor of Gunakirti was Yaáahkirti. In V.S. 1486, he got the Bhavishyadatta Pañchamï Kathä prepared at Gwalior during reign of Düõgarasiãha. Paîdita Raidhu, disciple of Yaáahkïrti, installed an image of Ädinätha in Gwalior during the reign of Âüngarasiãha. The Paûûaáishya of Yasahkïrti was Malayakïrti who installed the Yantra in 1502 and image in V.S. 1510. After Guîabhadra, Malayakïrti became Bhaûûäraka. Jinadäsa got a copy of the Samayasära written in Gwalior during the reign of Âüõgarasiãha. A copy of the Jñänärîava was prepared in Gwalior in V.S. 1521 during the reign of Kïrtisãha. The consecration of images was performed in V.S. 1529, 1531, 1547 and 1548 during the reign of Kalyäîamala. Caudharï Ûodarmala of the Ämnäya of Guîabhadra got a copy of the Mahäpuräîa written. Brahma Maîâana, grand disciple of Guîabhadra wrote a Guûakä of Stotras at Sonapata in V.S. 1576 during the reign of Ibrähim. In the Amnäya of Dharmadäsa, pupil of Guîabhadra, a copy of the Dhanadacarita was written in V.S. 1590 during the reign of Humayun. Bhänukïrti became Bhaûûäraka after Guîabhadra. Säha Rüpacanda presented a copy of the Uttarapuräîa to Bhaûûäraka, Bhänukïrti in V.S. 1606 during the reign of Áäha Salïma (ruler of the Sur dynasty V.S. 1545-1554) at Abrähmäbäâa. A copy of the Bhavishyadatta carita was written in the Ämnäya of Kumärasena, disciple of Bhänukïrti in V.S. 1615 during the reign of Akbar. At the request of Sähu Todara, Paîâita Räjamalla wrote the Jambüsvämï Charita in V.S. 1632 during the reign of Akbar. The second lineage of medieval period of Mäthura Gaccha started from Vijayasena, disciple of Mädhavasena. Afterwards, Mäsopaväsï Jayasena, Áreyäãsasena, Anantakïrti and Kamalakïrti respectively became the Bhaûûärakas. Kamalakïrti established an image in V.S. 1443 during the reign of Näthadeva (Local ruler). Hariräja, pupil of Padmakïrti, wrote a copy of the Pravacanasära in V.S. 1469 at Gwalior during the reign of Viramadeva. The disciple of Hemakïrti was Kmalakïrti who erected an image of Chandraprabhu in V.S. 1506. A copy of the Bhavisatta-Kathä was written in V.S. 1056 in his Ämnäya at Gwalior during the reign of Düñgarasiãha. Áubacandra and Kumärasena, disciples of Kamalakïrti erected an image of Mahävïra in V.S. 1510. Áubhacandra installed an image in V.S. 1530 at Gwalior during the reign of Kïrtisiãha. From the Harivaãáa Puräna of Raidhu, it is known that their monastery was at Sonagiri. His pupil Yaáahsena installed the DaáalakshaîaYantra in V.S. 1639. Another disciple of Kamalakïrti was Kumärasena. His disciple was Hemacandra whose pupil was Padmanandi. Padmanandi's disciple was Mäîikaräja. The disciple of Padmanandi was Yaáahkïrti. Bhagavatïdäsa wrote the Mugatiáiromani Cünadï in V.S. 1680 during the reign of Jahangir and the Änckärtha Nämamäla in V.S. 1687 during the reign f Shahjahan. Another disciple of Yaáahkïrti was Kshemakïrtï. Pandit Räjamalla wrote the Läûisamhita in V.S. 1641 for Säha Fämana when Akbar was ruling. The natives of Bairäûh were the followers of Kÿemakïrti. The successor of Kÿemakïrti was Tribhuvanakïrti. His paûûa ceremony was held at Hisära. Then, Sahasrakirti became successor in V.S. 1663. The Paûûa Áiÿhya of Sahasrakïrti was Mahïcandra. Devendrakïrti, disciple of Mahicandra, renovated the Jaina temple of Fatehapur in V.S. 1770. The disciple of Devendrakïrti was Jagatkïrti.262 Käÿthä Saãgha : There is some controversy among scholars about the origin of the Käÿûhä Saãgha. One view263 is that it originated from the village Käÿûhä, near Delhi. It was the capital of the rulers of Takka dynasty in the twelfth century A.D. Devasena, author of the Daráanasära, holds a different view264 about the origin of the Käÿthä Saãgha. Kumärasena, disciple of Vinayasena, established this Saãgha at Nandiyäda (modern Nändeâa in Maharashtra). The earliest inscription265 of the Käshûhä Saãgha is engraved on a memorial of Jaina Pillar dated 1095 A.D. of the great Acarya Devasena at Dubkunda. After the 14th century A.D., this Saãgha was divided into four branches Mäthura Gaccha, Vägaâa Gaccha, Läâavägaâa Gaccha and Nanditaûa Gaccha. Surendrakïrti who lived in V.S. 1747 and belonged to Nanditaûa-Gaccha, mentions the above four branches266. Käÿûhä Saãgha was in existence at some places in Dhära District. It is clear from the Jaina image inspriptions dated V.S. 1328, V.S. 1408, V.S. 1470 and V.S. 1510267 discovered there. That there were followers of the Käÿûhäsaãgha at Mainapuri in Uttar Pradesh as known from the Jaina image inscriptions dated V.S. 1414, V.S. 1473 and V.S. 1515.268 Käÿûhäsaãgha seems to have flourished mostly in the Pañjäba and Mälawä, and Agravalas generally remained associated with it. Most probably, the images and the manuscripts of this Saãgha found in Rajasthan were either brought later from outside or installed by Agravälas of Rajasthan. In Rajasthan, there were still some places which somehow remained associated with this Saãgha. The work of restoration and repairs of the famous temple of Ôishabhadeva of Dhuleva near Udaipur was carried out by the followers of this Saãgha. The inscription of 1374 A.D. tells us that Hardäna, the son of Säha Vïjä, restored this temple at the instrictions of Bhaûûäraka Dharmakïrti of Käÿûhäsaãgha. From the inscription of 1515 A.D., it is clear that Kadiyäpriyä of Käcchlü gotra with his son and wife constructed a hall and a shrine in the time of Bhaûûäraka of Käÿûhä Saãgha. Bhoja, son of Sanghï Älhä of the Bagheraväla caste, celebrated the installation ceremony of the newly constructed temple, with the members of his family in the time of Bhaûûäraka Surendrakïrti. Through the influence of the same Bhaûûäraka, Bhüpatä constructed a small shrine in 1697 A.D.269 From some inscriptions and Praáastis of manuscripts, it is known that the ancient Vägaâa Province, including the area of Âüngarpur, Bänswärä and Pratapagôh, was the headquarters of this Saãgha. Vägaâa Saãgha : Vägaâasaãgha originated from the region Vägaâa which includes Düãgarpura, Bäãsavarä and Pratäpagaâha Districtis of Rajasthan. The inscription of 994 A.D. on the image of a Jaina found at Bayänä says that it was caused to be made in accordance with the instructions of Sürasena of the Vägaâa Saãgha by three brothers Siãhaka, Yaáoräja and Nonnaika270. There is an image inscription dated V.S. 1324 of Vägaâa Saãgha Daáapuränvaye found at Ujjaina271. Another Jaina image inscription dated V.S. 1325 found at Tälanpur (Dhar District) is of Vagaâa Saãgha272. Läûa Vägada Gaîa : The Läûa Vägada Gaîa originated from the region of Gujarat Vägaâa, Äcärya Mahäsena, who composed the Pradyumna Carita Kävya in V.S. 1050 during the reign of Paramära ruler Mañju, belonged to Läûa Vägaâa Saãgha. From the Dubakuõda stone inscription273, it is known that encouraged by the teaching of the Jaina monk Vijayakïrti of the Läûavägaâa Gaîa, some Jaina Árävakas (Laymen) constructed Jaina temple, and the Kacchapaghäûa ruler Mahäräjädhiräja of the Dubakunda branch made some donation of land and other things in favour of this temple in 1088 A.D. The Läâa Vägaâ Gaccha is also mentioned in the Jaina image dated V.S. 1325 found at Tälanpura274. The Laâa Vägaâa Gaccha is found mentioned in the Jaina image inscriptions of V.S. 1251 at Badnäwara, of V.S. 1288 at Dhära and of V.S. 1325 at Tälanpur in Dhära District.275 Nandi Tata Gaccha : Nanditata Gaccha seems to have been named after Nanditaûa village (modern Nändeda) in Mahäräshtra. Rämasena of this gaccha founded the Narasiãhapura caste and got constructed the temple of Áantinätha in Narsiãhapura. His disciple Nemisena worshipped Padmävatï and founded the Bhaûûapurä caste. The historical period of Nanditaûa Gaccha is available from Lakshmsena, disciple of Ratnakïrt. The two disciples of Lakshmïsena were Bhïmasena and Dharmasena. From thems two lineage of Äcäryas are known. The pupil of Bhïmasena was Somakïrti. He installed an image of Áitalanätha in V.S. 1532 along with Vïrasena. He wrote the Yaáodhara carita at Godhili in V.S. 1536 and set up an image in V.S. 1540. He showed a miracle of flying in the sky at Pävägaâha by the grace of Padmävati in the reign of Firozshah. After Somakïrti, Vijayasena, Yaáahkïrti, Udayasena, Tribhuvanakïrti and Ratnabhüshaîa became Bhaûûärakas one after another. Kôÿîadäsa, pupil of Ratnabhüÿaîa, composed the Vimalanatha puraîa in V.S. 1674 at Kalpavalli. After Ratnabhüÿaîa Jayakïrti became Bhaûûäraka. An image of Pärávanätha was set up in V.S. 1686. Then, Keáavasena became Bhaûûäraka after Jayakïrti. Keáavasena was succeeded by Viávakirti who wrote a copy of the Harivaãáa Puräîa in V.S. 1700. The second lineage of Acaryas of Nanditaûa Gaccha starts from Dharmasena, disciple of Lakshmïsena. He wrote the Atiáaya Jayamäla. After Dharmasena, Vimalasena and Viáälakïrti respectively became Bhaûûärakas. His disciple Viávasena installed an image in V.S. 1596. Vidyäbhüÿaîa, disciple of Viávasena, set up the image of Pärávanätha in V.S. 1604, and another image in V.S. 1636. Vidyäbhüÿaîa was succeeded by Árïbhüÿaîa. He installed the Pärávanätha image in V.S. 1636, wrote the Säntinätha Puräîa at Sojitra in V.S. 1659, installed the image of Padmävatï in V.S. 1660, a Ratnatraya Yaõtra in V.S. 1665 and Candraprabha image in V.S. 1676. The main disciple of Árï Bhüÿaîa was Brahma Jñänasägara who wrote several works... Ári Bhüshaîa was succeeded by Bhaûûäraka Candrakïrti who wrote the Pärávanätha Puräîa in V.S. 1654 at Devagiri, installed Padmävati image in V.S. 1681 and composed several Püjäs. Candrakïrti, while going on pilgrimage of the South, defeated Kôÿîa Bhaûûa at Narasiãha Paûûaîa on the bank of Käverï. Candrakïrti's disciple was Bhaûûäraka Räjakïrti who gained victory in discussion at Varänasi. Räjakïrti's pupil was Lakshmïsena who set up the image of Padmävatï image in Áaka Sämvat 1561 and Bähubali image in V.S. 1703. Indrabhüÿaîa became Bhaûûäraka after Lakshmïsena. Some of his disciples led pilgrimage to Gommateávara in V.S. 1718. After Indrabhüÿaîa, Surendrakïrti became Bhaûûäraka. Images ad Yaõtras were installed, and copies of the manuscripts were prepared. The three disciples of Surendrasena were Lakshmïsena, Sakalakïrti and Devendrakïrti. After Lakshmisena, Vijayakïrti became Bhaûûäraka276. Punnäta Saãgha : As Äcäryas of this Saãgha moved in Karîäûaka regioõ, it became famous by the name of Puîîaûa Saãgha. Badnävara (Vardhamänapura) in Malwa became a stronghold of Jainism. Äcärya Jinasena of this Saãgha wrote the Harivaãáapuräîa at Vardhamänapura in Áaka Samvat 705 (782 A.D.). Äcärya Häriÿeîa composed the Bôihat Kathä-Kosha in V.S. 989 at this place. Vijayakirti, disciple of Äcärya Amritacndra of this Saãgha, installed an image in V.S. 1154277. There is an image inscription of V.S. 1227 mentioning Puîîäûasaãgha at Badnavana.278 Müla Saãgha : There is a divergence of traditions found in Paûûävalïs279 not only about succession but also about the residence or immigrations of the Pontiffs of the Mülasaãgha. The four Paûûävalïs agree on the main points but the fifth Paûûävalï presents considerably different traditions. The fifth Pattävalï closes with the name of Áubhachandra who reigned up to 1443 A.D. Hence, this is the oldest Paûûävalï and as such the information supplied by it seems to be correct. The Paûûävalïs tell us that the first 26 pontificates took place in Bhaddalapura. According to the four Paûûävalïs, Bhaddalapura is in Malwa, while the fifth Paûûävalï tells us correctly that it was in the South. After that the 27th pontiff transferred his seat from Bhaddalapura to Ujjaina according to all Paûûävalïs. From Ujjaiîa Mäghacandra II, the 53rd pontiff, shifted his seat to Bäräã in Kotä state in about 1083 A.D. Down to No. 63 or 64, the pontificates took place in Bäräã. From here, 14 pontificates, took place in Gvaliara down to 77 according to the four Paûûävalïs but the fifth Paûûävalï tells us correctly that ten pontificates were established at Cittora and four at Bagherä. This is further confirmed from the fact that there was the existence of a prosperous colony of Digambara Jainas on the hill at Cittora at the time of Kumärapäla280, and Bagheravälas were converted to Jainism, and Jaina temples were built at Bagherä in about eleventh century A.D.281. From the 78th Pontiff Vasantakïrti, the seat was transferred to Ajmer in about 1208 A.D. according to all the Paûûävalïs. From the 84th Pontiff Padmanandi, the seat was transferred to Delhi in about 1328 A.D. according to the four Paûûävalïs but the fifth Paûûävali tells us correctly that it was trasnferred to Idar in ancient Vägaâa province. Padmanandi was especially associated with Vägaâa province. A certain Árävaka of Vägaâa called Prabhäcandra II of Ajmer was invited for the purpose of performing a consecration ceremony of images but he could not come. Then after giving the Sürãantra to Äcärya Padmanandi, the Árävaka conferred on him the title of Bhaûûäraka. Thus Padmanandi became the Bhaûûäraka in 1328 A.D. of Vägaâa. The term Bhaûûäraka is applied to a particular type of Jaina ascetics who unlike Munis assumed the position of religious rulers and enjoyed supreme authority in religious matters. After Padmanandi, separation took place among his successive Acaryas. These separations were not actually the schisms but seem to be based on temperaments. Padmanandi had two pupils namely Sakalakïrti and Áubhachandra. During his lifetime, the separation took place between his two pupils. One section under Sübhacandra moved to Cittora while the other continued to live under Sakalakïrti. Again under Jinacandra the 86th pontiff, the disagreement arose between the two disciples namely Prabhäcandra and Ratnakïrti. Prabhäcandra continued to live at Cittor, but one section under Ratnakïrti moved to Nagaura. Again, differences arose at Nägaura and one section continued to reside at Nägaura, while the other under Ratnakïrti shifted to Ajamera. From Cittora, it came to Cätasu in the time of Candrakïrti. After that, it migrated to Sanganera, Äõvä, Ämber and lastly to Jaipur. Balätkära Gana : Mülasaãgha, in course of time, became associated with Balätkäragaîa which seems to have derived its name Balätkära Gaîa (powerful gaîa) from its ancestor Arhadbalin, who was also known as Guptigupta, the master of Mäghanandi. Its earliest mention is found in the inscription of the 11th century282 but it was in existence considerably earlier. Afterwards, this was distinguished by the term Sarasvatï. In the 14th century A.D., this name seems to have come from the miracle of the pontiff padmanandi who is said to have made a stone figure of Sarasvastï speak283. Several branches of the Balätkäragaîa are known. The Kärañja Áäkhä started from Amarakïrti. The Lätüra Áäkha began from Ajitakirti. The Delhi-Jaipur branch began from Áubhacandra. The Nagaura branch started from Ratnakirti, the Atera branch from Siãhakïrti, Idar branch from Sakalakïrti, Bhänapurä Áäkhä from Jñanakïrti, the Sürat branch from Devendrakïrti and Jerahaûâ branch from Tribhuvanakïrti.284 No activities of the early Bhäûûärakas before Padmanandi are known in Northern India from any other source. No doubt, there is mention of Mülasaãgha in the inscription of 1170 A.D. and 1186 A.D.285 but without any reference to any Bhaûûäraka. Mülasaãgha has been mentioned in the inscirption of V.S. 1230 found at Badnawar in Malwa. The Mülasaãgha and its Äcärya Ratnakïrti has been mentioned in the inscription of V.S. 1323286 From Padmanandi onwards, we possess some knowledge of the Bhaûûärakas of Mülasaãgha regarding their activities. The Mülasaãgha remained dominant in North India from the fourteenth century to the eighteenth century A.D. The Äcäryas of the Mülasaãgha are noticed to have performed installation ceremony of the images and temples in Rajasthana287, Madhya Pradeáa288 and Uttara Pradeáa289. Various copies of Manuscripts were prepared. Their Pädukäs and Nishedhikas are also found. Padmanandi : According to the Paûûävalïs, Padmanandi became Bhaûûäraka in 1325 A.D. This date seems to be doubtful as he was living in 1415 A.D. He did enjoy such a long age as known from the Paûûävalïs and he therefore, must have become Bhaûûäraka sometime after 1325 A.D. He was an influential Bhaûûäraka who is said to have caused a stone figure of Sarasvatï to speak. From this miracle, Müla Saãgha was distinguished by the term Sarasvatï. He made the installation ceremony of images from time to time. The image with the inscription of 1400 A.D. was installed at his bidding.290 He had two disciples namely Viáälakïrti and Nemicanda who also set up images in his time. From the inscription of 1413 A.D. engraved on the images discovered at Tonk, it is clear that Vïlhaîa and his sons got installed several images by his pupil Viáälakïrti.291 In 1415 A.D., Asapäla on his preaching set up the image of Pärávanätha.292 In the same year, the consecration ceremony of the image was performed by Äpä through his pupil Nemicanda.293 Sakalakïrti : After Padmanandi, Sakalakïrti became the head of the seat of Vägaâa in about 1420 A.D. He was the highly respected saint of medieval times and had also a good reputation for his scholarship. He wandered from place to place for the propagation of Jainism. In 1424 A.D., he came to Baâalï where he spent the rainy season with his Saãgha.294 Several images were installed by him from time to time. There is a mention of his name in the inscription of 1430 A.D. found on the image in the Digambara Jaina temple at Abu.295 It is known from the inscription of 1433 A.D. that as a result of his preaching, Nïsala with his wife, sons and brothers set up the Caubïsï with Ädinätha as a Mülanäyaka.296 In 1435 A.D., Campä set up the image of Áäntinätha after hearing his discourses.297 He is said to have passed away in 1442 A.D. at Mahäsana in Gujarata. Bhuvanakïrti : After Sakalakïrti, Bhuvanakïrti became the Paûûadhara. He was also a scholar like his predecessor. The consecration function of several images was performed by him. The installation ceremony of the Trimürti was presided over by him in 1443 A.D.298 In 1458 A.D., Nähuyä, the son of Särä, performed the Daáalakshaîa Yantra Pratiáûhä on his instructions.299 In 1459 A.D., Surä of his line celebrated the consecration ceremony.300 As a result of his preaching, Chäpä and his wife Gaõgä performed the installation ceremony of some yantra in 1471 A.D.301 Jñänabhüÿaîa : After Bhuvanakïrti, Jñänabhüÿaîa became the Bhaûûäraka. There is a Yantra of 1377 A.D. consecrated by him in the Jaina temple of Udaipur.302 On his advice, Räma with his wife and son set up the image of Mahävïra in 1487 A.D.303 Other Bhûûaärakas of this Seat : Jñänabüÿaîa was succeeded by Vijayakïti in about 1500 A.D. At his discourses, Áresûhï Melä with his wife, son and brothers made the Pratiÿûhä of Samavaáaraîa of Ädinätha in 1513 A.D. 304 Then Áubhacandra became the Bhaûûäraka in about 1515 A.D. He was a well known scholar who wrote a large number of works in a period between 1515 A.D. and 1556 A.D. His earliest work is Adhyätmataraõgiîï and the latest work written by him in 1556 A.D. is the Sanskrit commentary on the Svämikärttikeyänuprekÿä. On his instructions, Dhannä and his wife Dhannäde set up the metal image of Pärávanätha in 1538 A.D.305 In 1550 A.D., Áreÿûhi Sävara with his brothers, wife and son celebrated the function of Jñänanirväaîa on his preachings.306 After his discourses, Árïpäla erected the image of Áäntinätha in 1551 A.D.307 He was succeeded by Sumatikïrti. On his instructions, Säha Jayavanta with his wife and brothers set up the metal image of Padmaprabhu in 1563 A.D.308 He installed the images of Munisuvrata309 and Anantanätha310 in 1562 A.D. and 1570 A.D. respectively. After him, Guîakïrti became the Bhaûûäraka. He was succeeded by Vädibhüsaîa. On his advice, Äsä of Idar with his wife Lakshmï and daughter Jhilä installed the image of Neminätha.311 An inscription on the pedestal of a stone image of Áitalanätha in the Ávetämbara Jaina temple at Maujïpura in Alwar State records that it was set up by Humbaâa Läla and Galä resident of Hardoya in 1597 A.D. as a result of his preaching.312 After his discourÿes, Hansa with his wife and son performed the installation ceremony of Shoâaáakäraîa yantra in 1604 A.D.313 After him, Rämakïrti became the Bhaûûäraka. He was succeeded by Padmanandi II. At his preaching, the consecration ceremony was performed by Ratnä.314 Then, Devendrakïrti became his paûûadhara. He was succeeded by Kÿemakïrti. By the influence of his discourses, Saõghï Dïgaladäsa, Mänaka, Nemidäsa, Anantadäsa, Somadäsa and Ratnä erected the image of Áäntinätha in 1639 A.D.315 Soma316 with the whole Saãgha constructed the Pürägära in the Jaina temple of Ädinätha at Sägaväâä. After him, Narëndrakïrti, Vijayakïrti II, Nemicanda, Candrakïrti, Rämakïrti, Yaáakïrti, Surendrakïrti, Vijayakïrti II, Nemichanda, Chandrakïrti, Rämakïrti, Yaáakïrti, Surendrakïrti, Ramacandrakïrti and Kanakakïrti became the Bhaûûärakas of the seat of Idar one after another in succession. Bhaûûärakas of the Seat of Cittorr : During the lifetime of Padmanandi, Áubhacandra separated from Sakalakïrti and established his own Paûûa at Cittora in about 1415 A.D. At this time, Mewara became a centre of Jainism under the royal patronage of Kumbhakaraîa. The famous Jaina Kïrtistambha was also built. The two Bijaulia inscriptions of 1405 A.D. and 1426 A.D. speak of a Niÿedhikä of a Jaina nun named Bäï ¨Ägamasiri and of a Niÿedhikä of Hemakïrti, pupil of Áubhacandra respectively.317 With regard to these Niÿedhikäs, a wish has been expressed that they may be endured as long as the Sun and Moon last. On the same pillar that bears the second inscription are sculptured the foot-prints of some saints or pontiffs. On one side is engraved the name of Bhaûûäraka Árï Padmanandideva and on the other of Bhaûûäraka Ári Áubhacandra. At Äõvä near Uniara in Jaipur district, there is a Niÿedhikä of Áubhacandra. Áubhacandra was followed by Jinacandra in about 1450 A.D. Under his inspiration many-sided activities for the propagation of Jainism received an impetus. Copies of several manuscripts such as Árïpälacaritra,318 Pradyumnacaritra319 and Varddhamänacaritra320 were prepared in his time and probably inspired by him. A number of temples were built and images were placed in them. There is a Caubïsï consecrated by Hararäja of his line in 1460 A.D.321 In 1466 A.D., Säha Dharmasï with his wife and sons celebrated the consecration ceremony in his time.322 The installation ceremony of the metal image of Pärávanätha was also performed through him in 1485 A.D.323 Jïvaräja Päpaâivala at his instructions performed the installation ceremony of a large number of images at Muîâäsä in the reign of Rävala Álïvasiãha in 1461 A.D.324 The city Muîâäsä seems to be in Gujarat; but from there, these images were sent to the seats of Jainism in different parts of Rajasthan. He enjoyed a long life because Säha Seâa with his wife and sons performed the Yantra Praiiÿûhä in 1514 A.D. when Jinacandra was living.325 There is also a niÿedhikä of Jinacandra at Äõvä. Prabhäcandra came after Jinacandra in about 1515 A.D. By his persuasion, a large number of manuscripts were written for presentation to the monks. His followerrs got copies of the manuscripts such as Madanaparäjaya,326 Kriyäkaläpastuti,327 Árïpälacaritra,328 Karakaîâacaritra,329 Bäbubalicaritra330 and Ratnakaraîâa331 prepared in 1519 A.D. 1522 A.D., 1524 A.D., 1527 A.D. and 1535 A.D. respectively. In 1518 A.D. Bäi Pärvatï got the Yaáodharacaritra written and presented to him.332 Säha Dodu got the Yaáodharacaritra written and gave it to Bramha Vïâä, pupil of Bhaûûäraka Prabhäcandra.333 Images and Yantras were also installed through him in 1515 A.D. Säha Ûälä of his line performed the Cäraîayaîtra Pratiÿûhä in 1516 A.D.334 In the same year, Räho with his wife, son and daughter-in-law celebrated the installation ceremony of Samyakcäritrayantra through him.335 His Niÿedhikä also exists at Äõvä. After Prabhäcandra, Dharmacandra became the Bhaûûäraka in about 1518 A.D. Under his patronage and inspiration, various copies of manuscripts were prepared at different places for presentation to him and his disciples. With a view to propagating Jainism, he proceeded to Nagaur where his devotees got the copies of the Uttarapuräîa saûïka,336 Pravacanasära-präbhôitavôitti,337 Karmaprakôitti338 and Pärávanäthacaritra339 written in 1520 A.D. in order to present him. In 1526 A.D., a copy of the Candraprabhacaritra was made at Cätasu as a result of his discourses.340 In 1528 A.D., Kodamade got a copy of the aûpähuâa written for offering him.341 Säha Kïlhä made a copy of the Päîâavapuräîa342 ready in 1545 A.D. to give it to his pupil Kamalakïrti. In 1554, Säha Mahäräja prepared the Pärávanäthacaritra for his presentation.343 Besides other copies of manuscripts such as the Sukumälacarita344 in 1526 A.D., Bhavishyadattacarita345 in 1532 A.D., Varddhamänacaritra346 in 1536 A.D. Ädipuräîa347 and Saûpähuâa348 in 1537 A.D.,Varäõgacaritra349 and Bhavishyadattacaritra350 in 1538 A.D. and Candraprabahcärita351 in 1546 A.D., were prepared with the object of offering them as gifts to Sädhus. Several Yantra Pratiÿûhäs are also known to have been performed in his time. Tälu352 and Välamita353 of his line performed the consecration ceremony of Samyagdaráanayantra and Soâaáakäraîayantra in 1532 A.D. Inm 1536 A.D., Säha Päsa and Hemä installed the Arham-yantra.354 Dharmacandra was followed by Lalitakïrti in about 1546 A.D. A large number of mansucripts were written in his time. In 1553 A.D., Lohara got a copy of the Yaáodharacaritra written for him.355 At the invitation of the Árävakas, he went to Todaraisingh where Säha Tehü and Säha Püjä got the copies of the Nägakumäracaritra,356 and Yaáodharacaritra357 prepared in order to offer him as present. Besides other copies of manuscripts such as the Upäsakädhyayana358 in 1566 A.D. Áreîikacaritra359 in 1570 A.D., Varddhamänacaritra360 in 1574 A.D. amd Sudaráanacaritra361 in 1575 A.D. were made ready by his followers for presenting them to monks. Candrakïrti became Bhaûûäraka after Lalitakïrti in about 1575 A.D. He seems to have removed his seat from Cittora and established it at Cätasu as known from the inscription of 1604 A.D. that he was residing at Cätasu.362 The reason was that Mewar at this time was unsafe and insecure Ämera from the political point of view. On the other hand, Cätasu was under Ämera rulers who were on friendly relations with Mughal emperors and were patrons of Jainism. This was the time of Akbar who followed the policy of religious toleration. It was, therefore, natural that the activities of Jainism progressed. Some of the copies of manuscripts such as Jïvandharacaritra and Päîâavapuräîa363 in 1579 A.D., Pañhästikäyapräbhôita364 in 1580 A.D. and Harivaãáapuräîä365 in 1588 A.D. were prepared by his devotees for offering them to monks of his line. Besides, Candrakïrti is known to have performed the installation ceremony of images, Yantras and temples. In 1584 A.D., Säha Mokä,366 Säha Kälu,367 Säha Chelä368 and Säha Ratnä369 of his line with the members of their respective families separately made the pratiÿûhä of Samayagdaráana Yantra, Ôiõkära Yantra, Karakuîâa Pärávanätha Yantra and Daáalakshaîa Yantra. In 1591 A.D., Thänasiãha went on pilgrimage to Päväpuri where he celebrated the installation ceremony of oâaáakäraîa Yantra at his preaching.370 In the same year, Cokhä of his line installed the Samyak cäritra Yantra and Samyagjñäna Yantra with the members of their family.371 In 1603 A.D., Säha Jütä372 and Säha Jüõgä373 performed the consecration ceremony of the metal image and oâaáakäraîayantra through him separately. Bohitha of Ajmer with his sons and grandsons set up Caubïsï through him in 1601 A.D.374 In 1604 A.D., Äsänätha of his line made the Pratiÿûhä of Riõkära Yantra.375 An inscription of 1604 A.D. stated that the pillar of the Jaina temple was erected by him when he was residing at Campävatï (Cätasu).376 Candrakïrti was succeeded by Devendrakïrti in about 1606 A.D. Some copies of the manuscripts were written by his inspiration. In 1605 A.D., he went to Sanganer where Kalyäîa gave a copy of the Harivaãáapuräîna377 to him in present. Nänu and his wife Nikäde got a copy of the Ädipuräîa written in the temple of Ädinätha at Todaraisingh and presented to him in 1607 A.D.378 A copy of the Neminäthapuräîa was prepared in 1617 A.D.379 In 1620 A.D., when he went to Cätasu, Säha Debü offered him a welcome by presenting a mansucript of the Sudaráanacaritra.380 Narendrakïrti came after Devendrakïrti in about 1634 A.D. He is known to have performed the installation ceremony of images and Yantras. An inscription of 1649 A.D. engraved on the lower portion of a large pillar records that it was erected in the temple of Neminätha at Cätasu by Bhaûûäraka Narendrakïrti.381 He went on pilgrimage to holy places such as Girnar and Hastinäpura from time to time with the Saãgha. In 1652 A.D., Saõghï Tejasi and Udaikaraîa of Nevaûä led the Saãgha to Girnar where the Yantra-pratisûhä was performed by Narendrakïrti.382 Saõghï Sambhü and Saõghï Näâä together celebrated the installation ceremony of Daáalakshaîa Yantra at his hands in 1653 A.D.383 In 1654 A.D., Jagatasiãha in the company of the Caturvidha-Saãgha went to Hastinäpura where he installed the Samyak Yantra.384 In 1659 A.D. Jagatasiãha also celebrated the installation ceremony of Riõkära Yantra through him.385 At the same time, his devotee Khemasiãha of Amber led a pilgrimage to Hastinäpura where the installation ceremony of the Ôinkära Yantra was performed by him.386 Surendrakïrti became the Paûûadhara of Narendrakïrti in about 1665 A.D. In 1672 A.D., he proceeded to Sammedaáikhara where his followers named Saõghavi Naraharidäsa and Saõghï Pürvänanda celebrated the installation ceremony of Daáalakshaîayantra as a result of his preaching.387 In 1675 A.D., Naraharidäsa and Sukhänanda of Amber and Ghäsïräma with his wife and sons celebrated the consecration ceremony of Pärávanätha Yantra through him.388 Surendrakïrti was succeeded by Jagatakïrti in about 1676 A.D. This was a terribe time and the persecutions of Aurangzeb were going on. The old temples were pulled down and the construction of the new ones was not allowed. In spite of this, the activities for the propagation of Jainism continued because some ruling chiefs of Rajasthan were on friendly terms with Aurangzeb. Some copies of the manuscripts such as Upadeáaratnamäla389 in 1688 A.D., Padmatpuräîa390 in 1694 A.D. and Saûpähuâasatïka391 in 1708 A.D. were prepared by his followers in order to present them to Bramhacärï Näthüräma, Acärya Áubhacandra and Âoâaräja, pupils of Jagatakïrti. He also celebrated the consecration ceremony of images and Yantras. In 1684 A.D., Saõghï Sonapäla made the Yantra Pratiÿthä at Karavara through him.392 The consecration ceremony of a large number of images was organized by his devotee Saõghï Kôishîadäsa at Cändakheâï in 1689 A.D.393 In 1709 A.D, Dayäladäsa of his line set up the metal image of Pärávanätha.394 The next Bhaûûäraka after Jagatakïrti was Devendrakïrit II. Under his patronage, manuscripts were written and the consecration of the images took place. Dhanaräja wrote a copy of the Karmakäîâasatïka in 1720 A.D. at Ämber for the study of Paîâita Kiáanadäsa, pupil of Devendrakirti.395 In 1728 A.D., A specimen of Harivaãáapuräîa was prepared by his followers for the presentation.396 Chïhaâa and Sagamala performed the installation ceremony of images at Dholeûa through him in 1716 A.D.397 In 1726 A.D., the consecration ceremony of images was organized at Bansakhoha by his devotee Hôidayaräma.398 The successor of Devendrakïrti II was Mahendrakïrti who became Pontiff in 1735 A.D. He came from Sanganer and established his seat at Amber. It is for this reason Ämer Paûûa started from him. It is further confirmed by a praáasti.399 Copies of the Jambüsvämicaritra400 in 1736 A.D., and Trilokadarpaîa401 in 1741 A.D. were prepared by his devotees. Mahendrakïrti was succeeded by Kÿemendrakïrti in about 1758 A.D. After him, Surendrakïrti became the paûûadhara in 1765 A.D. In 1769 A.D., Saõghï Nandaläla performed the installation cerermony of images on a large scale at Sawaimadhopura as a result of his preaching402 Vadhuräma prepared a copy of the Munisuvrata-puräîa403 in order to offer him as a gift. Sukhendrakïrti became his successor in 1795 A.D. His followers made the specimen of Väraõgacaritra404 ready for presentation in 1816 A.D. He participated in the Saãgha led by Saîghi Räyacandra to Junagad where an Installation ceremony of some Yantra was performed by Räyacandra through him.405 In 1804 A.D., the same person celebrated the consecration ceremony of images at Jaipur as a result of his preachng.406 After him, Narendrakïrti II, Devendrakirti and Mahendrakïrti became the Bhaûûärakas one after another in succession. Bhaûûärakas of Nagaura Paûûa : Jinacandra had two pupils named Prabhäcandra and Ratnakïrti. During his life time, there arose a disagreement and his second disciple Ratnakïrti established his separate seat at Nagaur. He died at Ajmer which is shown by an inscription of 1515 A.D. on the Chatrï of Bhaûûäraka Ratnakïrti.407 After him, Bhuvanakïrti became the Paûûadhara who was followed by Dharmakïrti in about 1533 A.D. In 1542 A.D., a copy of the Dharmaparïkÿä408 was prepared by this devotee. After him, Viáälakïrti became the Pontiff in about 1544 A.D. He was followed Lakshmïcandra. In 1579 A.D., Lüîä of his line got a copy of the Dhanyakumäracaritra409 written in order ot offer it to the nun Karamäi in present. Later on, Sahasrakïrti, Nemicandra and Yaáakïrti became Bhaûûärakas one after another in succession. Yaáakïrti was the Bhaûûäraka of some importance. Under his inspiration, manuscripts were prepared and images were installed. An inscription engraved in the Jaina temple of Ädinätha at Reväsä of 1604 A.D. records that it was constructed by Säha Jitamala and his brother Nathamala, the two sons of Devidäsa the chief minister of Räyasäla at the preaching of Bhaûûäraka Yaáakïrti.410 His followers Rüpä and his son Düãgarasï of Jobanera made the specimen of Dharmaparïkhä411 ready for presenting it to Guîacandra in 1609 A.D. The Pañcas of Reväsä presented a throne to him in 1615 A.D.412 He was followed by Bhänukïrti and Bhüÿaîakïrti. Bhüÿaîakïrti had two pupils namely Dharmacandra and Ratnakïrti. Again a trouble arose between them, and Ratnakïrti established his separate Paûûa at Ajamera. After Dharmacandra, Devendrakïrti, Amerandrakïrti and Ratnakïrti became the Bhaûûärakas one after another in succession of Nagaura Paûûa. Bhaûûärakas of Ajamera Paûûa : Ajamera already remained a seat of the Bhaûûärakas in early times; but fot it, there is no definite epigraphical and monumental evidence. Mr. Harbiläsa Áärdä in his book413 mentioned the inscriptions of the eighth or ninth century on the Cabütaras and Chatrïs commemorating the death of the Digambara Jaina Bhaûûärakas and the Paîâitas. But in reality these inscriptions belong to the eighteenth and nineteenth centuries. Ratnakïrti separated himself from Nagaura Paûûa and established his seat at Ajamera. In 1694 A.D., Saõghï Jesä of his line celebrated the consecration ceremony of images at Jobanera through him.414 He was followed by Vidyädhara and then, Mahendrakïrti became the Bhaûûäraka. In 1709 A.D., Vijayakïrti constructed the Cabütarä over the remains of Bhaûûäraka Ratnakïrti. Later on, Anantakïrti became the Pontiff. Rämasiãha performed the consecration of the temple of Sähas as well as of images at Märoûha in 1737 A.D. as advised by him.415 Next Bhuvanabhüÿaîa became the Paûûadhara who was followed by Vijayakïrti. In 1753 A.D., Vijayakïrti constructed the Chatrïs over the remains of Anantakïrti and Bhuvanabhüÿaîa. Äcärya Räjyakïrti constructed the Chatrï over Bhaûûäraka Vidyänanda. In 1760 A.D., Vijayakïrti spent the rainy seasons at Märoûha.416 After him, Trilokendrakïrti became the Bhaûûäraka. Bhaûûäraka Bhuvanakïrti erected the Pädukä of Trilokendrakïrti in 1781 A.D. In 1795 A.D., Dharmadäsa celebrated the installation ceremony of images on a large scale through Bhuvanakïrti.417 In 1805, he visited Maroûha from where he proceeded to Kucämaî418 In 1818 A.D., Pannäläla, pupil of Bhuvanakïrti repaired the throne brought from Reväsä for Yaáakïrti. Bhaûûäraka Ratnabhüÿaîa constructed Chatrïs over the remains of Bhaûûäraka Bhuvanakïrti in 1835 A.D. There is also the Chatrï of Bhaûûäraka Padmanandi with the inscription of 1871 A.D. Besides, a large number of Cabütaräs and Chatrïs built over the remains of the Äcäryas and the Paîâitas are found at Ajmer. There is an inscription of 1725 A.D. on the Cabütarä built over the remains of Viáälakirti. Äcärya Bhaûûäraka Árï Vijayakriti constructed the Cabütarä and footprints of Äcärya Árï Bhänukirti in 1744 A.D. at Ajamera whereas he actually passed away at Danta in Áekhäväûï. Paîâita Basantaräma constructed the Cabütarä of the Äcärya Ratnabhüÿaîa in 1756 A.D. The Cabütarä of Äcärya Devendrakïrti was built by Gaîeáïmala in 1757 A.D. Paîâita Basantaräma also constructed the Cabütarä over the remains of Tilakabhüÿaîa in 1754 A.D. Pt. Tulasïdäsa constructed the Chatrï over the remains of Pt. Hemaräja, a disciple of Äcärya Räjakïrti. In 1754 A.D., the Pädukä of Pt. Vakasaräma was erected. In 1760 A.D., Pt. Daulataräma constructed the Pädukä of his teacher Rämachandra who was a pupil of Hemaräja. In 1761 A.D., Pt. Saväirama constructed the Cabütaräs of Pt. Rüpachanda, Pt. Malukacanda and Pt. Abhairäma. The Pädukä of Pt. Viradhicanda was erected in 1798 A.D. The Cabütarä of Pt. Pannäläla was built in 1844 A.D. Pt. Pannäläla was a disciple of Bhaûûäraka Bhuvanakïrti who repaired the throne of his master in 1818 A.D. It is thus clear that several Bhaûûärakas, Äcäryas and Paîâitas lived and played an important part in the history of medieval Jaina society when there was anarchy. At this time, the Muslims were carrying on persecutions and destruction, and the Maräûhäs were raiding the different parts of the country. The life and property of the people became unsafe and insecure. Even at this time, Bhaûûärakas wandered from place to place without any anxiety and fear for the propagation of Jainism. Bhaûûärakas rendered valuable services to Jainism in medieval times. Some of the Bhaûûärakas like Sakalakïrti and Áubhacandra were great scholars who wrote their literary works in Sanskrit, Präkrit, Apabhraãáa, Hindi, Gujaräti and Räjasthänï languages. The preservation of manuscripts was the most valuable work done by them at this time. Several copies of the works on grammar, medicine, mathematics and similar subjects were prepared. They also contributed towards art and architecture. Installation of various images was considered to be their main work. As their Maûhas were cultural centres, they patronised music, painting, sculpture, dancing and other arts. In social sphere also, their services are remarkable. They often arranged long pilgrimages with a large number of followers. They sometimes looked after the management of the holy places; for instance, Árï Mahäviraji was managed by the Bhaûûärakas of Jaipur. Some of them possessed miraculous powers gained through Mantras. To walk through air, to remove the effect of poison and to make stone image speak are some of the miracles ascribed to them. They used to visit the courts of Hindu and Muslim rulers and induced them to observe the doctrine of Ahimsä by the prohibition of the slaughter of animals in their kingdom on certain fixed days of the year. Caityaväsï System in Räjasthäna The system of the Caityaväsï functioned in Räjasthäna with great success and advantage. A Jaina monk according to the rule prescribed for him does not usually stay longer than one night in a village or five nights in a town. This practice is found in Jainism as well as in Buddhism; and it is an inheritance of Áramaîa culture. At the same time, there came gradually a good deal of laxity in the conduct of the saints. Äcärya Dharmasägara in his Paûûävalï writes that in 355 A.D., this practice of Caityaväsï started.419 But according to Muni Kalyäîa Vijaya, it had originated even earlier and in 355 A.D., it had become well established practice.420 At present, the Yatis or Árïpüjyas in the Ávetämbaras and the Bhattärakas in the Digambaras are known as Maûhaväsï. All are collectively known as Caityavasï. The Caityaväsï system seems to have developed in Rajasthana from about the 8th century A.D. The Jaina Äcäryas of Räjasthäna such as Haribadrasüri421 and Jinavallabhasüri422 had drawn the attention of the people towards the laxity in the ways of the monks. They resided in temples and used their wealth for their personal good. They put on even coloured or scented clothes. They are food or sweets fetched by the monks. They used to hoard money and relish delicious dishes. They used Sacitta water as well as fruits and flowers. They sold idols and purchased children in order to make them their disciples. Áïlaguîasüri, the teacher of king Vanaräja Cävadä (765-825 A.D.) asked him to issue orders forbidding the stay of other saints except Caityaväsï saints in the city of Aîahilaväda. In order to violate it, in 957 A.D. Jineávarasüri and Buddhisägarasüri defeated the Caityaväsïs in the debate in the royal court of Durlabharäja and thus sought permission for the admission of the Vidhimärga in Päûaî. That Caityavuasïs had deviated considerably from the traditional ways of Jaina Sädhus is evident from several Jaina temples and idols installed by them. This was the practice of the laity and not of the Sädhus. But the Caityaväsïs saw no harm in these deviations and argued that what was meritorious for the laity was equally creditable for the Sädhus. There are inscriptions which give us information about the practice of the Caityaväsï in Räjasthäna. In 1354 A.D., Rämacandrasüri of Jïräpallï Gaccha for self-merit constructed the Devakulikü at Jïräpallï in Sirohi State.423 Hematilakasüri for the merit of his teacher constructed the Raõgamaîâapa of the temple at the village Varmäna in Sirohi State in 1389 A.D.424 In 1397 A.D., Väcaka Somaprabhasüri of Pispaläcärya Gaccha constructed an image of Sumatinätha at Ajärï which was consecrated by Vïraprabhasüri.425 Vïraprabhasüri constructed the Maîâapa in 1418 A.D. at the village Vïraväâä.426 In 1464 A.D. Vijayaprabhasüri of Käccholïvälä Gaccha built the Devakulikä in the temple of Ajitanätha for the merit of Guîasägarasüri at Sirohi.427 Bhadreávarasüri for the merit of Tilaka Süri made Devakulikä of Ädinätha at Jïrapallï.428 Udaivardhana of Käccholïväla Gaccha built Devakulikä at Sirohi.429 Pärávadevasüri of Näîaka Gaccha with his disciple Vïracanda constructed Lagikä at the village Velära.430 Nanna Süri of Pratimäkadhära Pratishûhä Gachcha erected the image of Ädideva in the building at Vasantagadh.431 In the Digambara Jaina literature, there is no definite and clear mention of the time when the system of Caityaväsïs started. But that it was in existence in the 8th century A.D. in the south is known from several inscriptions. In Räjasthäna, the Bhaûûärakas were also in possession of villages and gardens. They renovated temples, constructed inns and gave good to other monks. It seems that, in spite of their being Caityaväsïs, the earlier Bhaûûärakas remained naked, and this was probably necessary in order to show their separation from the saints of the Ávetämbaras. At present, there is a tendency in the Bhaûûärakas to put off their clothes while eating food but wear them at all other times. It shows that they remained naked in the past and the practice of wearing clothes started afterwards. In the domain of religion, the Bhaûûärakas were the spiritual heads. They enjoyed comforts and received money in various ways from the Árävakas. They possessed administrative powers and used to appoint the Paîâitas at different places in order to carry on the religious affairs. Minor Protestant and Non-Protestant Sects The effect of the Muslim invasions of the Jaina religion is seen in two ways. It brought different Jaina sects closer together for self-defence against the iconoclasts. At the same time, it drove others away from idolatry altogether. It, therefore, naturally divided both Digambaras and Ávetämbaras each into two divisions known as idol-worshippers and non-idol-worshippers. The sect of non-idol-worshippers reminds one of the early Hindu traditions of Vedänta and Nirguîa Bhakti movement of Kabïra and Nänaka. With the impact of the Muslim culture, some sections of Jains began to denounce idol worship with great vehemence. The following sects are the opponents of the idol worship in Rajasthan. (a) Loõkä Sect : In Ahmedabada, Loõkä earned his livelihood by copying books in the Upäsarä of a Yati called Jñänajï. While writing these books, he was struck with the fact that idol worship was not mentioned them. He pointed it out to Jñänajï and others, and a sharp controversy arose between them as to the desirability of idolatry. At last in 1451 A.D., he organized a new sect of his own called Loõkä Sect after his own name. He declared his disbelief in such essential rites as Paushadha, Pratikramaîa, Pratyäkhyäna and even in charity. He did not like the rites in which even the slightest touch of violence or injury was involved. The Muslims at this time were destroying the temples and the images. This gave him the opportunity to spread his doctrine well. Great slackness had also come in the mendicants, because they possessed not only the books and clothes but even wealth. There were mutual quarrels among them. For this type of behaviour, the people began to criticize them. He took advantage of all these circumstances in propagating his doctrines by going from place to place. Loõkä pronounced 31 Sütras as the foundation of his tenet and gave a new interpretation of such Sütras seemed to support image worship. He made such drastic changes in the Ävaáyakasütra that they altogether assumed a new form. In 1476 A.D., he met a man named Bhäîa, a native of Äräghaûapäûaka near Sirohi who took Sanyäsa without being initiated by any Acarya. This monk assumed the false name of Dhuîâhaka. In 1511 A.D., he secured a disciple called Rüpakajï and the old Vara Siãha became his disciples in 1521 A.D. and 1530 A.D. respectively. Thus, though Loõkäáäha himself was not initiated, others were initiated by him and became saints. (b) Sthänakavasï Sect : Some of the members of the Loõks Sect disapproved of the lines of their Sädhus declaring that they lived less strictly than Mahävïra would have wished. A Loõkä layman Vïrajï of Sürat received initiation as a Sädhu and won great admiration through the strictness of his life. Many from the Loîkä Sect joined this reformer; and they took the name of Sthänakaväsïs while their enemies called them Dhüãdhiyä. The followerss of this sect are found in all the important cities of Räjasthäna. (c) Teräpanthï Sect : The founder of Teräpanthï Sect was Bhïkamajï. After a critical study of the scriptures, he came to know that the Jaina Sädhus were not leading their lives according to Áästric injunctions and were not promulgating the true principles of Jainism. The Sthänakväsïs stayed in the places specially set apart for Sädhus to live in. He began to stay even in the places meant for laymen. Once, a strange coincidence took place. Some Sädhus and laymen both numbering thirteen were staying in a shop. This led a poet of the Sevaga class to compose a short parody ridiculing the sect and nicknaming it Teräpanthï (the path of thirteen). Bhïkamajï gave a very appropriate interpretation to it. He said the number indicated five great vows (Mahävrata), five rules of conduct (Samitis), and control of body, mind and speech (three Guptis). Teräpanthïs do not worship idols. They think that worship of idols does not lead to salvation. They meditate upon and mentally worship those highly developed souls who have attained liberation. They worship and revere those living beings who have renounced the world asbsolutely and lead the life of asceticism strictly observing the five great vows. The followers of this sect are mostly found in Bikanera and Jodhpura States. Like the Ávetämbaras, the Digambaras were also divided into the sects of idol-worshippers and non-idol-worshippers. In course of time, the sect of idol-worshippers was further split into several sub-sects. (a) Täraîasvämï, who was the revolutionary saint, born in V.S. 1505 at Pushpävatï Nagarï (Bailahari), near Katni in Madhya Pradesh. He raised his voice against the rituals of the Bhaûûärakas. He was highly influenced by the works of Kundakunda. He was against the Idol worship but emphasised on the worship of manuscripts in Jaina temples. He wrote 14 works, and out of them Mälärohanajï, Paõdita Püjäjï and Kamala Battïsïji are important. He died in V.S. 1572.432 (b) Teräpanthi Sect : The idolatrous sect of Teräpanthïs was founded by Pt. Banarasidas, a resident of Ajgra. It became rapidly popular in Rajputana in the 17th century. Originally, it was known as Vidhimärga but its opponents nicknamed it as Teräpanthïs just to ridicule it. The Teräpanthïs protested against the elaborate ritualism of the Bhaûûärakas. During the lifetime of Banärasïdäsa, the great scholar and reformer of Agra, this sect gained great popularity. It is defined by some as a sect which emphasizes the thirteen points of self discipline for building up the character; others, however, believe that the name was given by its opponents to ridicule it.433 The Digambara Teräpanthïs are held in contempt by the Bhaûûärkas like the Ávetämbara Teräpanthïs by the Árïpüjyas. Bakhata Räma in the Buddhiviläsa says that this sect differs from the original faith in thirteen points; and hence, it is called Teräpanthï. The Teräpanthïs do not recognize the superior position of the Bhaûûärkas. The Teräpanthïs of the Ávetämbaras and the Digambaras differ from each other. The former do not worhsip the images while the later do. The Digambara Teräpanthïs worship the images but not with the flowers, fruits, sandal and prakÿäla. The worship, in this way according to them, involves Hiãsä and therefore militates against the fundamental principles of Jainism. (c) Gumänapanthi Sect : Gumänapanthï Sect flourished in the 18th century A.D. and was so called after the name of its founder Gumänïräma, the son of Pt. Toâarmal of Jaipur. It was also known as Áuddhämnäya, because particular emphasis was laid on the purity of conduct of its followers by imposing certain rules of discipline on them. This sect spread in several parts of Rajasthana outside Jaipur such as Märotha, Bhädavä etc. (d) Bïsapanthi Sect : The Bïsapanthïs are the followers of the Bhaûûärakas. They assumed its name because they thought that they were superior to Teräpanthïs. This sect permits idol worship and supports the cult and methods of the Bhaûûärakas. In this sect, the idols are worshipped with water, lamp, flowers and sandal. The followers of this sect are found in Jaipur, Ajamera, Nagaura and Märoûha. (e) Totäpanthi Sect : In course of time, an attempt was made for the compromise between Bïsapanthïs and Teräpanthïs. A new sect known as Totäpanthï came into existence. This sect partly consists of Bïsapanthï Sect and partly Teräpanthï Sect. It is, therefore, also known as Säâhï Soläha Panthï Sect. It remained confined only to Nagaur. These idolatrous sects do not materially differ from each other in the Digambaras. Their founders namely Amara Canda Baâajätyä and Gumänï Räma were anxious to maintain the individuality of their sects; and hence, the nominal differences were emphasized. 1. Daráanasära, p.7. 2. Áramaîa Bhagvän Mahävïra, IV, P. 269 3. Ibid, p. 272 4. EI, XXI, p. 85; IHQ, 1934, p. 57. 5. Jacobi H : Encylopedia of Religion and Ethics, Vol. VII, p. 473. 6. Vilas a. sangave : Jaina community - A Social Survey, pp. 50-51. 7. Kalpasütra, S.B.E., Vol. 22, p. 288 f. 8. E I, I, No. XIX, p. 391. 9. Lüders : Epig. Notes. IA, XXXIII, p. 109 10. E I, II, p. 382. 11. Buhler : On the Indian Sect of the Jainas, p. 55. 12. E I, I, No. VI, pp. 385, 87, 88, 97, 96 and 289. 13. E.I., I, VI, pp. 385, 87, 88, 97, 96 and 289. 14. Kalpäsütra, SBE, XXII, p. 293. 15. E I, XX, pp. 59-61 16. Jsls, Nos. 96, 99. 17. Ibid, 90, 94. 18. Jsls, Nos. 90, 94. 19. Ibid Nos. 111, 113, 114, and 149. 20. Ibid, No. 193 21. Ibid, No. 113. 22. Ibid, No. 114. 23. Ibid, No. 149. 24. Ibid, No. 193. 25. Jsls, Nos. 175, 195, 196 and 223. 26. Ibid, V, No. 55. 27. Ibid, No. 66. 28. Ibid, No. 130. 29. Ibid, No. 183. 30. Ibid, No. 139. 31. Jsls, V, No. 74. 32. Ibid, No. 262. 33. Ibid, IV, Nos. 292, 335, 416 and 538. 34. Ibid, Nos. 290, 310, 369, 378, 382, 606 and 642. 35. Ibid, No. 164. 36. Ibid, Nos. 180 and 222. 37. Ibid, No. 54. 38. Ibid, IV, No. 94. 39. Jsls, II No. 217. 40. Ibid, No. 372. 41. Ibid, IV, Nos. 83 and 169. 42. Ibid, Nos. 193, 229 and 256. 43. Ibid Nos. 126, 139 and 140. 44. Jsls, No. 1, 180. 45. Ibid, Nos. 122, 123, and 135. 46. Ibid, No. 123. 47. Ibid, No. 150. 48. Ibid, No. 166 49. Jsls, N. 55. 50. Ibid, No. 137. 51. Ibid, IV, No. 61. 52. Ibid, No. 134. 53. Ibid, III, No. 186, 217 and 511. 54. Ibid, No. 138. 55. Ibid, II, No. 165. 56. Ibid, No. 147. 57. Jsls, IVI, No. 185, 234, 269, 318, 490 and 541. 58. Ibid, No. 185. 59. Ibid, IV, No. 117. 60. Jsls, III, No. 153. 61. Ibid, No. 158. 62. Ibid, Nos, 237-238. 63. Ibid, No. 17. 64. Ibid Nos. 163-165. 65. Ibid, IV, No. 96. 66. Jsls, No. IV, No. 212, 291, 323, 476, 565 and 609. 67. Ibid, No. 476. 68. Ibid, No. 214. 69. Ibid, No. 603. 70. Ibid, III, Nos. 267, 277, 299 and 353. 71. Ibid, 209, 263, 313, 377, 389, 408, 431, 459, 582. 72. Ibid, IV, No. 240 73. Medieval Jainism, P. 327. 74. Ibid, IV, No. 154. 75. Jsls, III, No. 208. 76. Ibid, IV, No. 55. 77. Ibid, IV, No. 157. 78. Ibid, Nos. 342, 376. 79. Ibid, III, No. 569. 80. Ibid, No. 585. 81. Ibid, IV, No. 390, p. 13. 82. jsls, III, No. 99. 83. Ibid, No. 100. 84. Ibid, No. 105. 85. Ibid, Nos. 99, 100, 105. 86. Ibid, I, Nos. 106, 121, 124 and 142. 87. Ibid, III, No. 124. 88. Ibid, No. 106. 89. Ibid, No. 121. 90. Ibid, No. 124. 91. Ibid, No. 106. 92. Jsls, III, No. 121. 93. Ibid, No. 124. 94. Ibid, No. 250. 95. Ibid, No. 143. 96. Ibid, No. 144. 97. Jsls, III, No. 130. 98. Ibid, No. 182. 99. Ibid, Nos. 160 and 205. 100. Jsls, IV, No. 20. 101. Ibid, Nos. 70, 131, 611 and 612. 102. Ibid, No. 70. 103. Ibid, No. 131. 104. Ibid, Nos. 611 and 612. 105. Ibid, Nos. 130, 259, 168, 607. 106. Ibid, No. 259. 107. Ibid, No. 168. 108. Ibid, No. 607. 109. Jsls, IV, Nos. 207, 368 and 386. 110. Ibid, No. 209. 111. Ibid, Nos. 143, 298, 300 and 384. 112. Ibid, V, No. 70. 113. Ibid, No. 86. 114. Ibid, No. 125. 115. Jsls, V, No. 117 116. Ibid, III, No. 103. 117. Ibid, No. 104. 118. Ibid, No. 104. 119. JSLS, III, No. 166. 120. Ibid, No. 178 121. Ibid, Nos. 188, 189, 190, 192, 202, 214, 215, 216 and 226. 122. JSLS, III, Nos. 213, 214, 215, 216. 123. Ibid, IV, No. 175. 124. Ibid, No. 282 125. Ibid, No. 344. 126. Ibid, Nos. 252, 357 and 409. 127. JSLS, V, Nos. 14-15. 128. Ibid, No. 56. 129. Ibid, No. 104. 130. Ibid, No. 111. 131. J.S.L.S., III, Nos. 633 and 640. 132. Jaina Siddhänta Bhaskara, Vol. 2, IV, pp. 28-29. 133. J.S.L.S. IV, No. 22. 134. Ibid, No. 56. 135. Áramaîa Bhagavän Mahävïra, Vol, V, Pt. II. Sthavirävalï, p. 2. 136. PJS, Pt. I, No. 3. 137. MJI., No. 833 and 834. 139. NJI., Pt. I, II & III. 140. I.A., Vol. IX, p. 248. 141. NJI. Pt. III. 142. Áramaîa Bhagavän Mahävïra, Vol. V, Pt. II, Sthavirävalï, p. 75. 143. Áramaîa B.M. 145. NJI. Pt. I, II & III and PLS. 146. Áramaîa Bhagvän Mahävïra, Vol. V. Pt. II. Sthavirävalï, p. 65. 147. NJI. Pt. II, III, PLS. Pt. I, and APJLS. 148. Áramaîa Bhagvän Mahävïra, Vol. V, Pt. II, Sthavirävalï, p. 65. 149. NJI. Pt. I, II and III & APJLS. 150. Áramaîa Bhagvän Mahävïa, Vol. V, Pt. II, Sthavirävalï, Pt. II, p. 66. 151. NJI. Pt. I, II and III & APJLS. 152. NJI., No. 899. 154. NJI. No. 792. 155. NJI., Pt. I & II. 157. PLS. No. 106. 158. IA., V. XI, p. 250. 159. IA., V. XI, p. 250. 160. Áraman Bhagavän Mahävïra, Vol. V, Pt. II, Sthavirävalï, p. 176. 161. Áraman Bhagavän Mahävïra, Vol. V, Pt. II, Sthavirävalï p. 176. 162. APJLS. No. 138 & 141. 163. NJI., Pt II No. 1275. 164. Ibid. Pt. III. 165. NJI., Pt. I, No. 970 & 971. 167. Ibid., No. 425. 168. APJLS. Nos. 396, 470, 471, 472 and 473. 169. NJI., Pt. No. 764. 170. Ibid., No. 899. 171. NJI., Pt. I, II & III. 172. APJLS., No. 319. 173. NJI., Pt. III. 174. NJI., Pt. I, II and III & APJLS., Nos. 82 & 142. 175. NJI., Nos. 789, 1313 & 2278. APJLS., No. 348. 176. APJLS., No. 620. 177. NJI., No. 738. 178. Ibid., No. 1000. 179. NJI., No. 1236. 180. Ibid., Nos. 1080 & 1017. 181. NJI., No. 530. 182. APJLS., No. 66. 184. NJI., Pt. I, II & III. 186. NJI., Pt. III. 187. Ibid., Nos. 1111, 1143 & 1031. 188. APJLS., Nos. 74 and 119. 190. Ibid., No. 110. 191. NJI., No. 811. 192. NJI., Pt. I, II & III. 194. NJI., Pt. I, No. 791. 195. APJLS., No. 404. 196. NJI., Pt. II & III & APJLS. 197. APJLS., No. 366. 199. NJI., Pt. III. 200. PLS., Nos. 5 & 23. 201. NJI., Pt. II & III. 202. PLS., No. 43. 203. NJI., Pt. II & III. 204. NJI., Nos. 2478 & 577. 205. Ibid., Nos. 533 & 539. 206. Catalogue of the MSS in the Patan Bhaîâäras, p. 312. 207. NJI., No. 1295. 208. IA., XI, p. 249. 209. ARRMA. Yr. 1923 No. IX. 210. PLS., Nos. 49, 124 & 256. 211. IA., XIV, p. 8. 212. IA., XI, p. 248. 213. NJI., Nos. 734, 1267, 1315 & pt. III. 214. I.A., XI, 249. 215. NJI., No. 1059. 216. APJLS., No. 408. 217. NJI., No. 604. 218. NJI., Nos. 849, 850 and 851. 219. NJI., Pt. III. 220. IA., XI, pp. 248-249. 221. NJI., No. 597. 222. Ibid., No. 1288. 223. NJI., No. 717. 224. NJI., No. 616. 225. NJI., Nos. 2218 & 2232. 226. Ibid., Nos. 2220-22 & 2415. 227. Ibid., No. 2269. 228. Ibid., 1159. 229. NJI., No. 1174. 230. Ibid., No. 1194. 231. Ibid., 1042. 232. NJI., No 1998. 233. Ibid., 1078. 234. APJLS. Nos. 9, 454 & 466. 235. NJI., Pt. III. 236. NJI. No. 966. 237. NJI., Pt. III. 238. ABJLS, No. 575. 239. NJI, Pt. I & III. 240. Ibid, Nos. 1167, 1169 and 1246. 241. Sramana Oct. -Dec. 1995, p. 28. 242. Ibid, 1997, pp. 81-82. 243. Malaväñchala Ke Jaina-lekha. 244. MUNI KANTISAGAR : Jaina Dhäthu Pratïma Lekha Saãgraha, I. 245. Mälavänchala Ke Jaina-Lekha. pp. 77-78. 246. P.C. NAHAR : Jaina Inscriptions III, Nos. 403-425. 247. E.I., I, P. 120. 248. Jaina Jorunal Mahavïra Jayantï Special, pp. 195-196. 249. K.M.T.J., II, p. 410. 250. Bhaûûäraka Sampradäya, p. 239. 251. Bhaûûäraka Sampradäya, 252. KMTJ, p. 505. 253. Ibid, p. 505. 254. Vïravänï, VI, p. 355. 255. Ibid, V, p. 41. 256. Jainism in Rajasthan, p. 72. 258. E.I., XXIV, p. 84. 259. ARRMA, 1925-26, No. 3. 260. Mälaväñchala Ke Jaina-lekha, Nos 3, 6 and 7. 261. Bhaûûäraka Sampradäya, p. 239. 262. Bhaûûäraka Sampradäya, pp. 241-242. 263. Ibid, p. 211. 265. Bhandarkar List No. 161; ARADGS, 1973, No. 48. 266. Bhaûûaraka Sampradäya, p. 211. 267. Malävanchala Ke Jaina-Lekha, Nos. 217, 209, 198 and 106. 268. KAMTA PRASAD - Pôatimä Lekha Saãgrah, Nos. 60, 56 and 20. 269. Udaipur Räjya Kä Itihäsa, p. 41. 270. PRAS, WC, 1909-10, P. 52. 271. Malaväñchala Ke Jaina-Lekha, No. 59. 272. Mälaväñchala Ke Jaina-Lekha, No. 170. 273. E.I., II, pp. 232-240. 274. K.M.T.A., p. 505. 275. Mälaväñchala Ke Jaina-Lekha, Nos, 7, 167, 215, 216. 276. Bhaûûäraka Sampradäya, pp. 293-294. 277. JSLS, V, p.No. 98. 278. Mälaväñchala Ke Jaina-Lekha, p. 24, No. 7. 279. PR 1883-84; I.A., XX and IA XXI. 280. PRAS. WC, 1903-04, p. 46. 281. E.I., XXIV, p. 84. 282. JSLS. No. 208. 283. JBBRAS, No. XLIV, Vol. XVII, p. 163 and PR 1883-84. 284. Bhaûûäraka Sampradäya. 285. Jainism in Rajasthan, p. 74. 286. KMTA, p. 505. 287. Jainism in Rajasthan, 288. Mälväñchala Ke Jaina Lekha. 289. KAMATA PRASAD JAIN : Pratima Lekha Saãgraha. 290. NJI, No, 1009. 291. Vïraväîï, VII. 292. Anekänta, XIII, p. 126. 294. JGPS, p. 10 (Int.) 296. ¢Ã 1490 ·¸ ÒÊÊþ ÈË 9 üÊË Í¢ÉÊ ¢Ë¢ÉÊ ÊàݧʦU ªáÊ ¦USÃË ªë¿U üÊË ÝȧãÝȧãÊøÊÿʸãÿ ÷^ÔUʦUݧ üÊË ¬l¢Á Ãà¬^ÔU üÊË Ý§Ý§ËÁø ©U¬ÊÊà ÈU«ÞU ¡ÊÁà ªÊ¢Ë ¡Ë ÷Êÿʸ ªÊ¢ªË Èà üÊË ªÙߢ ÷Êÿʸ ¦UÕÈ ÊÃÎ þËÊ ÷Êÿʸ ¦UÊÈU ÷ÊÃÎ ÊÊ ÷Êÿʸ »§³UÝȧ ÊÃÎ ÊÊ ÷Êÿʸ ¦UªË ÍÊÿݧ üÊË ÊÁÊÕ ¬²ÁÃcÐÈU ݧʦUÊÁ¬Ã ªÙòÊ üÊË Ý§¦U Sݧ¸ ÊÿÊÕ¸ 1476 Ý§Ê ©Ö¡Ò Á. ¢. 297. Anekänta, XIII, p. 126. 298. In the Jaina temple at Jaipur. 299. ¢Ã 1515 ÊÉÊ ÈË 11 üÊË Í¢ÉÊ ÊàݧʦU ªáÊ ¦USÃË ªë¿U üÊË ÝÈ¢§ÝÈ¢§øÊÿʸãÿ ÷. üÊË Ý§Ý§ËÁø Ãà¬^ÔU ÷. ÷ÈݧËÁø éU¬ÊÊà ÈU«ÞUôÊÊÃËÿ üÊË Ê¦UÊ ¬ÈòÊ ÊUÿÊ ß¢ Áàÿ¢ ¬²áÊÁà (In the temple of Chaudharis, Jaipur). ¢Ã 1496 ÒÊÊ ÈË -11 ¥ ÷^ÔUʦUݧ üÊË ¬ËÁ ÷^ÔUʦUݧ üÊË Ý§Ý§ËÁø Ý§Ê ©UÀþ - Á. ¢. ݧËÁø 300. ¢Ã 1516 ·¸ øÒòÊÁ 5 ªÈ¦UË üÊË Í¢ÉÊ ÷. ÷ÈݧËÁø ÊêÊÿ ȦUÊ ÷Ê. ÊUÊË Èà ÷³UݧÊÊ UÊÊ ×à üÊË Á¡Ã Á¡ ¬²áÊÁà (On the metal image in the temple of Lunakarana, Jaipur). 301. ¢Ã 1528 ·¸ ÒÊÊþ Á 1 Í¢ÉÊ üÊË ÷ÈݧËÁø ©U¬ÊÊà ¢. øÊ¬Ê ÷Êÿʸ ª¢ªÊ Áàÿ¢ ¬²áÊÁà (Inscription on a Yantra in the temple of Chaudharis, Jaipur) 302. NJI., No. 1120. 303. Anekänta, XIII, P. 126. 304. ¢Ã 1570 ·¸ ¬Ù· - ×à üÊË ÊÁÁ¡ ʦUáÊ Áàÿ¢ ¬²áÊÁà 305. ¢Ã 1595 ·¸ ÒÊÊþ ÈË x ٠͢ÉÊ ÷^ÔUʦUݧ üÊË ÊÈ÷øãº² ©U¬ÊÊà ÛÊÊ ÷Êÿʸ ÛÊÊ Áàÿ¢ ¬²áÊÁà 306. ¢Ã 1607 ·¸ ÒÊÊþ Ë ªÈ¦U ʪ«ÞU Ê ÊªÊ«ÞUÊ È÷SÕÊ ¦UÊ ÊÊ ¦UÊ Ê·Ý§¦UáÊ Á¡ÿ ¦UÊÖÿ üÊË ÊÁÊÕ øÒàÿÊÿ üÊË Í¢ÉÊ ÷^ÔUʦUݧ üÊË ÊÈ÷øãº² ªÈM§¬ÊÊà U. Á¦UÊ¡Ê ªÙòÊ Ê¦U ÷Ê. «ÞUÝͧ Èà üÊ Ã¡Ê, ÷Ê. ¦¢UªË, ÷²Ê. üÊ ªÙ, ÷². Á¡Ê, ÷Ê. M§¬ ×à ݧ¸ôÊÊ ÁʸáÊ Ý§ÀÿÊáÊݧÙà (In the temple of Laskara, Jaipur). 307. NJI., No. 520. 308. ¢Ã 1620 ·¸ ÒÊÊþ ÈË 9 È üÊË Í¢ÉÊ ¦USÃË ªë¿U ó ÷. üÊË ÈÁÃݧËÁø ªÈL§¬ÊÊà ÈU«ÞU¡ÊÃËÿ þ¦U¡ ªÙòÊ Ê ÁæUÊ©Uà ÷Ê. ¦UÊÈà ʢ ¦UÊÊ ÷Ê. ¦UÊÊ È. ¢¡ÿ¢Ã ÷Ê. ݧ¸Ë ÷Ê. ÙÊ, ¬Ê, ÷Ê. ¬Á¦U üÊË ¬k¬²÷ Á¡ Áê Áàÿ¢ ¬²áÊÁà 309. NJI., No 1636. 310. Ibid., No. 631. 311. Anekänta; XIII; p: 126. 312. ARRMA, 1919-20 Nos. 1 & 6. 313. Inscription in the temple of Päûodï at Jaipur. ¢Ã 1661 ·¸ ÊUÈË Ù üÊË Í¢ÉÊ ÷. üÊË ÊÁ÷Í·áÊ ªÈM§¬ÊÊà ¢UÊ ÷Ê. ³UÙÝȧ È. ʦUÊ ÷Ê. ˦UÊUÃÊêÿ¢ Ù«ÞU ݧʦUáÊ ÿ¢òÊ Áàÿ¢ ¬²áÊÁà 314. Anekänta, XIII, p. 127. 316. ¢Ã 1751 ÖÿcÐU ÈË 5 Ù ÊÇ«ÞUÊ Êª¬Ã üÊË Í¢ÉÊ Ã ÊÁÊÕ øÒàÿÊÿ ¦USÃË ªë¿U ÊàݧʦU ªáÊ ÝȧãÝȧãøÊÿʸãÿ ÷. üÊË Ý§Ý§ËÁø ÃÊêÊÿ ÷. üÊË ¬k¢Á ÃÊêÊÿ ÷. üÊË ãº² ݧËÁø Ãà¬^ÔU ÷. üÊË ÊݧËÁø ªÈM§¬ÊÊà üÊË ÙÊ ÃÕÊ Sà üÊË ¢ÉÊ ¬¦Uª¦U ݧʦUÊÁ¬ÃÊ Áàÿ¢ ¬²áÊÁà 317. PRAS. wc., 1904-05, p. 57. 318. PS, p. 177. 319. Ibid., p. 138. 320. Ibid., p. 170. 321. ¢Ã 1517 ·¸ ÊÉÊ ÈË 10 ¦U üÊË Í¢ÉÊ ÷^ÔUʦUݧ üÊË Á¡øãº²Ê þ¢«UÊÊãÿ ÊU U¦U¦UÊ¡ ÷Êÿʸ ÊUݧ ¬ÈòÊ ÃÊÊ ÊU«ÞU (Jaina temple of Patodi, Jaipur).¢Ã 1299 ÿ¢òÊ ÈË 9 ¥ Á. Á. ©U--- 322. ¢Ã 1523 ·¸ ·Ê ÞÞU ÈË 2 ªÈL§ üÊË Í¢ÉÊ ÷^ÔUʦUݧ üÊË ¬k¢ÁÊ Ãà¬^ÔU üÊË ÊÈ÷øãº²Ê Ãà¬^ÔUüÊË Á¡øãº²Ê ¦UÊ ôÊÊÁà Á¦UÊ«ÞÞUÿÊ ªÙòÊ ÊU ¸Ë ÷Êÿʸ M§ ¬ÈòÊ ÊþÊ ¦UÁ¢ÉÊ, U˦UÊ ¦Uøã Áàÿ¢ ¬²áÊÁà (Jaina temple Siramauriya, Jaipur). 323. ¢Ã 1532 ·¸ ÒÊÊþ ÈË 7 üÊË Í¢ÉÊ ÷^ÔUʦUݧ Á¡øãº²Ê ÉʦUÊÊãÿ ÊU ³UËݧ ¬ÈòÊ Ý§ÊÊ ÷Êÿʸ ¸Ë ÃSÿ ¬ÈòÊ üÊË ¿U÷Ê©U Áàÿ¢ ¬²áÊÁà 324. ¢Ã 1518 ·¸ ÒÊÊþ ÈË 3 üÊË Í¢ÉÊ ÷^ÔUʦUݧ üÊË Á¡øãº²Ê ÊU ¡Ë¦UÊ¡ ¬Ê¬«ÞUËÊÊ Áàÿ¢ ¬²áÊÁà ¦UÊ¡Ê ÿÙÁ¢U ¦UÊ ÊU¦U È¢«UÊÊ 325. ¢Ã 1571 ·¸ ÖÿcÐU ÈË 2 Ù üÊË Í¢ÉÊ ÝȧãÝȧãøÊÿʸãÿ ÷. üÊË Á¡øãº²Ê ÃÊêÊÿ þ¢«UÊÊãÿ ÙÐUÊ«ÞU ªÙòÊ Ê «ÞU ÷Ê. ÈUʪ ÃSÿ ¬ÈòÊ Õ, Ê, ¸Ê, Õ ¬ÈòÊ Ê¡Í, øÊßáÊ ¢«UáÊ ×à ¬²áÊÁà 326 PS., P. 154. 327. Ibid., p. 98. 328. Ibid., p. 177. 329. Ibid., p. 96. 330. Ibid., p. 147. 331. Ibid., p. 167. 332. Ibid., p. 163 333. Ibid., p. 164. 334. ¢Ã 1573 »§ÊÀªÈáÊ ÈË 3 üÊË Í¢ÉÊ ÷^ÔUʦUݧ üÊË Á¡øãº²Ê Ãà ÷^ÔUʦUݧ üÊË ¬²÷Êøãº²Ê þ¢«UÊÊãÿ ¿UÊ«ÞUÊ ªÙòÊ Ê. ³UËÊ ¬²áÊÁà 335. ¢Ã 1573 »§ÊªÈáÊ ÈË 3 üÊË Í¢ÉÊ ¦USÃË ªë¿U ÊàݧʦU ªáÊ ÷^ÔUʦUݧ üÊË ÝȧãÝȧãøÊÿʸãÿ ÷. Á¡øãº²Ê Ãà¬^ÔU üÊË ¬²÷Êøãº²Ê ÃÊêÊÿ þ¢«UÊÊãÿ ݧÊÊ ªÙòÊ üÊË ¦UÙUÙ ÷Êÿʸ ݧÊÊ Ãà¬ÈòÊ ¬kÊ ÷Ê. ¬kÁ Áàÿ¢ ¬²áÊÁà 336. PS., p.2. 337. Ibid., pp. 36 & 37. 338. Ibid., p. 96. 339. Ibid., p. 131. 340. Ibid., p. 99. 341. Ibid., p. 174. 342. PS., p. 127. 343. Ibid., p. 128. 344. Ibid., p. 200. 345. Ibid., p. 149. 346. Ibid., p. 170. 347. Ibid., p. 88. 348. Ibid., p. 175. 349. Ibid., p. 55. 350. Ibid., p. 148. 351. Ibid., p. 99. 352. ¢Ã 1590 ÊÉÊ ÈË 7 Í¢ÉÊ ÷^ÔUʦUݧ ¬²÷Êøãº² Ãà ÁÊcÿ ¢«UÊøÊÿ¸ ¸øãº² ÃÊêÊÿ ÊU ÉÊÊ ÷Êÿʸ ¸ÊË Ã¡Ê ¡ËáÊÊ ÷Êÿʸ ¡ËáÊÊ Ãà ¬ÈòÊ ÃÊÍ ¬²áÊÁà (Temple of Luîakaranajï, Jaipur). 353. ¢Ã 1590 ·¸ ÊU ÈË 4 ÈʦU üÊË Í¢ÉÊ ¢lÊêÊÿ ÊàݧʦUªáÊ ¦USÃË ªë¿U üÊË ÝÈ¢§ÝÈ¢§ÊøÊÿʸãÿ ÷. üÊË ¬²÷ÊøãÊ Ãà ÁÊcÿ ÷^ÔUʦUݧ ¸øãÊ ÃÊêÊÿ þ¢«UÊÊãÿ ÈUÊÁ«UÿÊ ªÙòÊ Ê ÕÊÊ ÷Ê. ¦ËÃÈ Ãà¬ÈòÊ Ê. ÊÊ ÷Ê. ªÁ¦UáÊà Ãà¬ÈòÊ Ê¦UÊÈUà ÊÊÁÃÊ Áàÿ¢ ¬²áÊÁÁà (Temple of Lunakaranji, Jaipur). 354. ¢Ã 1593 ÖÿcÐU ÈË 3 üÊË Í¢ÉÊ ÷^ÔUʦUݧ üÊË ¬²÷Êøãº²Ê Ãà ÁÊcÿ ¢«UÊøÊÿ¸ ¸øã ÃÊêÊÿ þ¢«UÊÊãÿ ÊU ªÙòÊ ÊUÃÈ Ã ÷Êÿʸ U¦U à ¬ÈòÊ ÊU ¬ÊÊ ÊU UÊ ¬²áÊÁà 355. P.S., p. 163. 356. Ibid., p. 77 357. Ibid., p. 162. 358. Ibid., p. 94. 359. Ibid., p. 169. 360. Ibid., p. 17. 361. Ibid., p. 190. 362. ARAMA, 1927-28, No.11. 363. PS., p. 125. 364. Ibid., p. 132. 365. Ibid., p. 73. 366. ¢Ã 1642 ·¸ »§ÊÀªÍ Ë 7 ÈʦU üÊË Í¢ÉÊ ÷^ÔUʦUݧ üÊË ¬²÷Êøãº², ÷. ¸øãº², ÷. üÊË øãº²Ý§ËÁø ÃÊêÊÿ þ¢«UÊÊãÿ ªÙòÊ Ê. ÙÝ§Ê ÷Êÿʸ ÈÄÃÊ ¬ÈòÊ ÊÕáÊ ¦UÊUÕ ÁªÁ¦U¦UÊ¡ ×à ¬²áÊÁà 367. ¢Ã 1641 ·¸ »§ÊÀªÍ Ë 7 È üÊË Í¢ÉÊ ¢«UÊøÊÿ¸ ¬²÷Êøã Ãà ¢«UÊøÊÿ¸ üÊË ¸øã Ã㢫UÊøÊÿ¸ ÁÃݧËÁø Ãà ø¢º²Ý§ËÁø ÃÊêÊÿ þ¢«UÊÊãÿ ݧ¦UÊݧ¦UÊ ªÙòÊ ÊU ݧÊÍ þÿ Áàÿ¢ ¬²áÊÁà 368. ¢Ã 1641 ·¸ »§ÊÀªÈ Ë 2 Èh üÊË Í¢ÉÊ ÷. üÊË øãº²Ý§ËÁø ÃÊêÊÿ þ¢«UÊÊãÿ ÙË ªÙòÊ øÊ ¬È. Ê Ã¡Ê, Ê Ùþ Ê. ÉÊøã Ê Ã¡Ê ¬ÈòÊ Ù Ê. ݧÀÿÊáÊ, Ê ¦UÊ¡ Áàÿ¢ ¬²áÊêÿ 369. ¢Ã 1641 ·¸ »§ÊÀªÈ ÈË 7 È üÊË Í¢ÉÊ ÷. üÊË øãº²Ý§ËÁÃ¸Ê ÃÊêÊÿ þ¢«UÊÊãÿ ÙU¦UÊ ªÙòÊ Ê. ¦UÃÊ ¬È. Ã߸ ¬È. ݧʦU, Ê ¦UÊ ¦UUÁ¦UÊ Áàÿ¢ ¬²áÊÁà 370. ¢Ã 1648 ÒÊÊþ Ê ¬ÊʬȦU ª¦U üÊË ¦UÊ¡Ê ÊÁ¢U üÊË Í¢ÉÊ ÷. üÊË øãº²Ý§ËÁø ªÈM§¬ ÊÊà þ¢«UÊ Ê«ÞUÊ ªÙòÊ Ê. ¦UÊ Ê ÷Ê. ÈUʪËÈ ¬ÈòÊ Ê ¬Ê¦UÕ ÃÃ Ê U¦UÊ¡ Ãà ÷Ê. U¦U ¬Ê¦UÕ ÷Ê. ¬Ê³U ¦UÊ Ãà ÷Ê. ËòÊÊ ¬ÈòÊ Ê U Ãà ÊÁ¢U Ãà ÕÊÁ¢U Áàÿ¢ ¬²áÊÁà 371. ¢Ã 1648 ÒÊÊþ Ë 5 üÊË Í¢ÉÊ ÷. üÊË øãº²Ý§ËÁø þ¢«UÊÊãÿ ª¢ªÊ ªÙòÊÒ¥ ÊU øÙþÊ, ÷Ê. ËË Ãà¬ÈòÊ Ê¸ Ã÷Êÿʸ ß«ÞUË ÃÿÙ ¬ÈòÊ Ã¡Ê ÁàÿÁàÿ ¬²áÊÁà 372. ¢Ã 1651 ·¸ ÊÉÊ ÈË 10 ÊÁø¦U Í¢ÉÊ øãº²Ý§ËÁø ÃÊêÊÿ þ¢«UÊÊãÿ ¬Ê³UË ªÙòÊ ÊU ¡ÍÃÊ Ãà ¬ÈòÊ ÊU ÊÍ Ãà ¬ÈòÊ ÊU ¦Uà 373. ¢Ã 1651 ·¸ ÊÉÊ ÈË ¬¢øêÿÊ ªÈ¦U ÷^ÔUʦUݧ üÊË øãº²Ý§ËÁÃ¸Ê ¡¦UÊ ªÙòÊ ÊU ¡Í¢ªÊ Áàÿ¢ ¬²áÊÁà 374. ¢Ã 1658 Ê·Ê ÞU ÈË 10 ¦UÁʦU ó ÷. üÊË øãº²Ý§ËÁÃ¸Ê ÃÊêÊÿ þ¢«UÊÊãÿ ÙË ªÙòÊ ¡¦U ÊSÃÿ Ê ËÀUÊ Ãà¬ÈòÊ òÊÿ Ê. ÃÊ, mË. ¦UUÕ, ÃÎ. Ê. þÛÊÊ ÃÊ ¬ÈòÊ ÙÁUà Ãà¬ÈòÊ UÊ Ãà¬ÈòÊ Ê. ¦UþÊ, ¡ËÊ, Ê ÙÁUà Áàÿ¢ ¬²áÊÁà 375. ¢Ã 1661 ·¸ »§ÊÀªÈ ÈË 2 üÊË Í¢ÉÊ ¢«UÊøÊÿ¸ üÊË øãº²Ý§ËÁø ÃÊêÊÿ þ¢«UÊÊãÿ ª¢ªÊ ªÙòÊ ÕÊ Ãã¬ÈòÊ ÊÊÊÊÕ Áàÿ¢ ¬²áÊÁà 376. ARRMA, 1927-28, p.11. 377. PS. p. 76. 378. Ibid., p. 89. 379. Ibid., p. 28. 380. Ibid., pp. 189-90. 381. ARRMA., 1927-28, No. 12. 382. ¢Ã 1709 »§ÊÀªÈ Ë 7 üÊË Í¢ÉÊ ÷^ÔUʦUݧ 㺲ݧËÁø Ãà ÁÊcÿ ¦U㺲ݧËÁø Ã¡Ë ¢ÉÊË ©Uÿݧ¦UáÊÊèÿÊ¢ ³UÊ ª¦UÊà Áª¦UʦUÁªÁ¦U ¢êÿݧ ¬²ÁÃcÐUÊÁ¬Ã 383. See above, p. 48. 384. ¢Ã 1711 ·¸ øÒòÊ ÈË 4 Ù üÊË Í¢ÉÊ ¢kÊêÊÿ.... ÷^ÔUʦUݧ üÊË ¦U㺲ݧËÁø ÃÊêÊÿ ª²ÊÊãÿ ªª¸ ªÙòÊ ¢. ¢¦UÊ Ãà¬ÈòÊ ¦UÙÊÁ¬Áà ¡ªÃÁ¢U ¢ÊàÿÊ øÃÈÁ¸¢ ÊU USÃʪ¬È¦U ʪàÿ ¬²ÁÃcÐUÊÁ¬ÃÊ ¡ªÁ¢U Áàÿ¢ ¬²áÊÁà 385. ¢Ã 1716 ·¸ øÒòÊ Ë 4 Ù üÊË Í¢ÉÊ ó üÊË 108 ¦U㺲ݧËÁø ÃÊêÊÿ ª²ÊÊãÿ ªª¸ªÙòÊ ¢¦UÊ ¬ÈòÊ ¢ÉÊÊÁ¬Áà ¡ªÁ¢U ¢ÊàÿÊ ¬²ÁÃcÐUÊ Ý§Ê¦UÊÁ¬ÃÊ 386. ¢Ã 1716 ·¸ øÒòÊ Ë 4 Ù üÊË Í¢ ó ÷^ÔUʦUݧ üÊË ¦U㺲ݧËÁø ÃÊêÊÿ ª²ÊÊãÿ ªª¸ ªÙòÊ ¢ ¢º²¦UÊ Ãà¬ÈòÊ ¢ÉÊÊÁ¬Áà þÁ¢U ¢ÊàÿÊ øÃÈÁ¸ ¢ÉÊ U USÃʪ¬È¦U ʪàÿ ¬²ÁÃcÐUÊÁ¬Ã ó ¡ªÁ¢U Áàÿ¢ ¬²áÊÁà 387. ¢Ã 1729 »§ÊÀªÈ ÈË 9 Í¢ÉÊ ÊàݧʦUªáÊ ¦USÃ˪ë¿U ÷. üÊË È¦U㺲ݧËÁø ÃÊêÊÿ ¢ÉÊUË ÊU ¦UUÁ¦UÊ ¢ÉÊUË ¬Í¦UÊ¢ ¬²ÁÃcÐUÊÿÊ êà ÁÊþ¦U 388. ¢Ã 1732 ·¸ Öÿc³U ÈË 2 üÊË Í¢ÉÊ ÷^ÔUʦUݧ üÊË È¦U㺲ݧËÁø ÃÊêÊÿ þ¢«UÊÊãÿ ªÎ²Ê ªÙòÊ ¢ÉÊUË üÊË ¦UU¦UÊ ÈþÊã ×ÃÊ Ê¦U ÊSÃÿ üÊË ÉÊÊ˦UÊ ÃSÿ SòÊË ÉÊÙ³U ÃÿÙ ¬ÈòÊ Ù ¬²Õ ¬ÈòÊ ÿÊÙ¦UÊÿ ÃSÿ SòÊË ¡ÙÊ ÁmÃËÿ ¬ÈòÊ ¦UÊÿݧ¦UáÊ ×à ¬²ÁÃcÐUÊ ê ÁÊþ¦U ݧÊÁ¦UÃÊ 389. Ps. p. 4. 390. Ibid., 29. 391. Ibid. p. 174. 392. ¢Ã 1743 ݧÊÁøݧ ÈË 15 ݧ¦U¦U ª¦U üÊË Í¢ÉÊ ÷^ÔUʦUݧ üÊË ¡ªÃݧËÁø ÃÊêÊÿ þ¢«UÊÊãÿ ¢ÉÊUË Ù¬Ê ¬²ÁÃcÐUÊ Ý§Ê¦UÊÁ¬ÃÊ 393. See above, p. 36. 394. ¢Ã 1766 ÊÉÊ ÈË 6 üÊË Í¢ÉÊ ÷^ÔUʦUݧ ¡ªÃݧËÁø ¢ÉÊUË U÷^ÔUʦUݧ üÊË ÿÊÊ ¬²ÁÃcÐUÊ Ý§¦UÊÁ¬ÃÊ 395. Ps., p. 7. 396. Ibid., p. 77. 397. ¢Ã 1773 »§ÊÀªÈáÊ Ê ÊÈÄ ¬Ê ÃÎÃËÿÊ ÁÃÕ üÊË Í¢ÉÊ ---- üÊË ãº²Ý§ËÁø ÃÊêÊÿ þ¢«UÊÊãÿ ÈUÊÁ«ÞUÿÊ ªÙòÊ Ù³U ª¦U ¢ÉÊUË ¿UËU«ÞUª ¬²ÁÃcÐUÊ Ý§¦UÊÁ¬ÃÊ (Temple of Chaudharis, Jaipur). 398. ¢Ã 1783 ÊÊþ Ë 8 È Ê¢þÙU ª¦U ÷^ÔUʦUݧ üÊË ãº²Ý§ËÁø ÃÊêÊÿ UÊ«UÿÊ ªÙòÊ ¢ÉÊUË üÊË Uÿ¦UÊ ¬²ÁÃcÐUÊ Ý§ÊÁ¦UÃÊ ÷Ò¥Ê þÒ¦UÊ¡ Áàÿ¢ ¬²áÊÁà 399. PS., pp. 48 and 56. 400. Ibid., p. 124. 401. Ibid., p. 219. 402. See above, p. 47. 403. PS., p. 48. 404. Ibid., p. 56. 405. See above p. 47. 406. See above p. 47. 407. ¢Ã 1572 Ý§Ê »§ÊªÈáÊ Ë 6 ¦UÁʦU ÷^ÔUʦUݧ¡Ë üÊË ¦UàݧËÁø¡Ë Ý§Ë ¿UòÊË 408. PS., p. 21. 409. Ibid., p. 108. 410. ARRMA, 1934-35, Non. 411. PS., p. 20. 412. üÊË ÷^ÔUʦUݧ¡Ë üÊË 108 üÊË ÿÊݧËÁø¡Ë ÃSÿ ÊÊÿ Ý§Ê üÊË ¬¢øÊ Á¢UÊ Ý§¦UÊÿÊ ø ÞUÊÿÙ ¦UÊÊ ª¦U ¢. 1672 Ý§Ê ÁÁà »§ÊÀªÈáÊ ÈË 5 413. Ajmer Historical and Descriptive, p. 123. 414. See above, p. 48. 415. See above, p. 43. 416. ¢Ã 1814 Ý§Ê ÁÃË Ê·Ê ÞU ÈË 10 Á üÊÙ ÷^ÔUʦUݧ üÊË Á¡ÿݧËÁø UʦUÊ¡ UÙ¦UÊÐU ª¦U äÿ øÃÈʸ ÁݧÿÙ 417. ¢Ã 1852 ÒÊÊþ ÊU ÊÈÄ ¬Ê ÁÃÁÕ ¬¢øÊáÊ ªÈL§Ê¦U ¡¦U UÊȪ¸ Ë¥ÁÿÊ Ã¦UÊ¡Ë ¦UÊÖÿ üÊË Í¢ÉÊ ÷^ÔUʦUݧ üÊË ÷ÈݧËÁøSÃÊêÊÿ ª¢ªÊ ªÙòÊ ¢ÉÊUË ¸Ê ߢ ¬²ÁÃÊ Ý§Ê¦UÊÁ¬ÃÊ 418. UʦUÊc³U ª¦U Áàÿ ©Uà Á¡Áã¦U ÊÊ¢ ªÙcÐUË ¡ÿÙà ÊêÿæU ¢. 1862 Ý§Ê ·¸ ÁÃË ÊÊ ÞU Ê ÝΧcáÊ ¬Ê ÁÃâÿÙ cÐUËÿÊ ¢ªÊ¦U üÊË Í¢ÉÊ ¢lÊêÊÿ ó ¡¦U ¬^ÔU ÊÙÁà ÷^ÔUʦUݧ¡Ë üÊË 108 üÊË ÷ÈݧËÁø¡Ë, ¬¢Á«Uà ݧÊͦUÊ ó ¢ÉÊÊc³Uݧ ÁUà UʦUÙÐU ¬Ê¦UÿÊ ÊUÊ¢ Ý§Ë ªÙcÐUË Ý§Ê Sà üÊË ¬¢ø UÊ¡Ê üÊÊݧ üÊÊÁÝ§Ê Ê¸È¦Uʪ ÷Ê ÁUà ¦UÊÅÿÊ ¬Ê¿U ¬¢øÊ ÃË Ê¦UÙÐUÁà Ëþ Ê¢ªÝ§¦U ÁÃË »§ÊÀªÈ Ë 5 ÝȧøÊáÊ ¬ÊÁ¦UÿÊ (Inscription, Säha Jaina Temple Märoûha). 419. JSAI., p. 351. 421. Sambodhaprakaraîa, Verses 27, 34, 46-49, 61, 63, 68 etc. 422. Saõghapaûûaka, Verses 7, 11, 12, 15, 21 etc. 423. APJLS, No. 119. 424. Ibid., No. 113. 425. APJLS, No. 432. 426. Ibid., No. 278. 427. Ibid., No. 246-248. 428. Ibid., No. 116. 429. Ibid., No. 249. 430. Ibid., No. 337. 431. Ibid., No. 445. 432. JSAI., p. 363. 433. I.A., XX, p. 347. 434. V.S. 1572. 435. JSAI., p. 367.
<urn:uuid:877c6ef2-21cf-451c-9096-fe92261e3dc5>
CC-MAIN-2016-44
http://www.jainworld.com/general/prem/Chapter%20X%20fe.htm
s3://commoncrawl/crawl-data/CC-MAIN-2016-44/segments/1476988725470.56/warc/CC-MAIN-20161020183845-00075-ip-10-171-6-4.ec2.internal.warc.gz
en
0.901965
52,344
3.359375
3
UK-based artist Ed Fairburn commemorates the connection between people and places in his unconventional illustrations. Using hand-picked maps from his collection, he carefully adds hand-drawn portraits to the topography of cities and landscapes, merging human figures with the environment. “At its core, my work is loosely about coexistence,” he tells My Modern Met. Estonian artist Laivi Põder creates portals to bucolic destinations in vibrant illustrations. When we think of three-dimensional fine art, we usually imagine statues in gleaming marble. British artist Alex Chinneck is known for his mind-bending architectural sculptures that effortlessly combine the elements of art, design, and architecture. Whether in the form of an unzipped building, a structure turned on its head, or walls sliding down and cracking open to reveal what’s hidden behind them, his inventive sculptures always manage to challenge our perception of the world around us. A feat that always seems to transform the mundane into something remarkable. A sculptor known simply as Jay is recreating some of the world’s biggest stars through polymer clay. Artist Hossein Behzadi sculpts figures that emerge from interior walls. If you’ve ever walked around an art museum and observed the work of Renaissance and Baroque masters, you’ve probably stood in awe of their impressive style. Artists such as Rembrandt and Caravaggio painted using the chiaroscuro technique, which is a method that uses shadows and a single light source to create depth and drama. Every year since 1993, the Japanese village of Inakadate transforms its fields into living works of art. While preparing for their exhibit A Taste for Impressionism, conservators at the National Galleries Scotland turned to a technique standard... For most of us, it takes time to discover what we truly love. One child in England, however, found his passion at a remarkably young age, and is continuing to wow people with his talent. A 12-year-old named Joe Whale, better known as The Doodle Boy, has become famous for his whimsical doodle art. Paris is one of the ultimate destinations for art and architecture lovers. Designer Ariel Adkins transforms masterpieces into wearable works of art.
<urn:uuid:a1c58199-03ff-42ef-94f6-16bdd4c4aa8c>
CC-MAIN-2022-33
https://mymodernmet.com/category/art/page/2
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882573908.30/warc/CC-MAIN-20220820043108-20220820073108-00276.warc.gz
en
0.963696
475
2.078125
2
At Caxton College we chose to design our own curriculum with creativity at its heart as creativity has been shown to accelerate learning through engaging the left and right sides of the brain simultaneously. While it fulfils the statutory requirements of the 2014 National Curriculum for England, it is enhanced with our skills based Creative Curriculum. The Creative Curriculum is a project-based method of learning through motivational topics such as ‘Incredible Egypt’, ‘Rattle My Bones’ and ‘Chocolate Fairness’. Children become historians, artists, scientists and writers in topics which are designed to spark their natural curiosity and encourage a thirst for learning. Each topic begins with an emotional ‘hook’ such as an inspirational speaker, a workshop or a model-making day. Once the brain is engaged, pupils are motivated and ready to learn. All learning styles and senses are engaged through teacher designed topics and lessons, giving everyone an opportunity to shine, whatever their talent. Topics finish with an ‘exit point’, the final product of the project and the element that makes the learning experience purposeful. Pupils strive to complete projects to a high standard and show a true sense of pride at their achievements. This could be an interactive art gallery, building a town out of junk modelling or attending an Oscars Ceremony! Pupils coming from our Foundation Stage begin Key Stage 1 with a firm grounding in English. All subjects, apart from Spanish Language, Spanish Social Studies and the Valencian language, are taught in English. Some of the activities and amenities described below may have been altered in their timetable or format until the health situation improves.
<urn:uuid:f2bc7a27-304e-4892-8f28-91fc164e082a>
CC-MAIN-2022-33
https://caxtoncollege.com/en/primary/academic/curriculum/
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572127.33/warc/CC-MAIN-20220815024523-20220815054523-00273.warc.gz
en
0.949978
342
2.828125
3
This presidential election has demonstrated clearer than ever just how powerful the media are. Their ability to choose what to show, what not to show, and how to show what they choose to show fashions people’s views and thinking according to their whims. It’s come to a point where they don’t wait for the declaration of the official results of the presidential election in order to report them; they decide them, and even an official denial by Congress will not make them change their reporting. The media didn’t come to prominence overnight. Over the years, they realized the power they have over people’s views and understood that this power is worth a lot of money. This created a link between power, wealth, and the transfer of information. From that moment on, there was no democracy. It’s not as though the people were really the sovereign before, but at least the rulers were somewhat accountable to their constituency because of their desire to keep “serving the people,” namely to be reelected and stay in office. However, once politicians realized that to be reelected, you needn’t serve the people but the people who report to the people, their commitment to their constituency vanished. Instead, politicians started placating the press in order to get favorable coverage. Afterwards, tycoons started buying newspapers and TV channels left and right and became media moguls. They did this not necessarily because the media was such a lucrative business, but because an owner of a newspaper or a TV channel can decide what is written or aired, how, and what conclusions the media stories will promote regarding topics of interest. Now, when politicians want good coverage, they have to pay the media moguls with benefits such as energy production contracts, passing of certain laws, land ownership acts, currency laws, favorable tariffs and customs, lower taxes, and so forth. The rich have many needs that politicians can satisfy. If all it takes is to say or write some nice words about them on television, why not? Everyone benefits, except the public. The recent presidential election has exposed this dismal state more than any prior election, and the whole structure is now falling apart. It is high time it did that. Now the question is what will come instead of the corrupt structure. In the end, there are only two ways: up or down. Right now, the situation is going down fast. The tensions between the two sides are escalating, the media are fueling them, the hatred is unrestrained, and both sides feel that they are fighting for the future of the nation. This is a recipe for war. There is, however, another option: to go up. Going up means canceling the Cancel Culture and accepting that neither side will change. Moreover, only if both sides maintain their positions, something new will come out of the carcass of democracy: a new thinking, a new perception of the world. It is not a compromise; both sides will maintain their views and will not give an inch. However, they will also allow the other side to maintain its position, and both sides will grasp that without the other, they themselves do not exist. The existence of one side enables and defines the existence of the other. Just as there is no heat and you cannot even define heat in the absence of cold, there is also no Right in the absence of Left, and no Left in the absence of Right. Nor can either be defined. Once we come to value the existence of the other side, we can gradually develop positive emotions toward it. However, that will come later. The first step toward mending the American society, after the demise of democracy, is the acceptance of all political views without expecting any of them to change, and without trying to reach a compromise, but simply to accept that all views are genuine and reflect people’s true feelings, and this is what makes them legitimate.
<urn:uuid:ed85545e-efb6-465d-9ba7-93740a61c0c7>
CC-MAIN-2022-33
https://www.michaellaitman.com/politics/the-democracy-that-never-was/
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571989.67/warc/CC-MAIN-20220813232744-20220814022744-00477.warc.gz
en
0.974623
801
1.789063
2
MT-501i SALT Method Emergency Triage Training Tag $0.95 – $28.93 Save money on your training exercises by using paper training tags instead of the more valuable synthetic tags! For more information, see below. Save money on your training exercises by using paper training tags instead of the more valuable synthetic tags! The MT-501i SALT Method Emergency Triage Training Tag - Half the price of the MT-501 triage tag - Printed on recyclable card stock - For CERT and training exercises only - Comes pre-strung with 30″ stretch nylon string to attach to victim - Please note: Bar codes are non functional on the training tags The MT-501i was developed by TACDA/METTAG in conjunction with The Mayo Clinic and Gold Cross Ambulance, and follows the triaging system instructional guidelines suggested by the NHTSA (The National Highway Traffic and Safety Administration.) The MT-501i integrates the S.A.L.T. algorithm which is Sort, Assess, Life-saving interventions, and Treatment/Transport in a simple and quick use format. - Sort – Sort the walking wounded, those calling or waving for help, and those that are not moving. - Assess – Assess to find life-threatening injuries. Note findings with simple yes or no answers. - Life-Saving Interventions – Give necessary interventions to save life. Apply tourniquets, open airways, give breaths, administer medications, within one minute of time. Tear off the perforated sections at the bottom of the tag indicating patient level of triage. - Treatment/Transport – After assessing patients and giving life-saving interventions, transport patients according to urgency of need by noting color coded tear offs at the bottom of the tag which are dead, immediate, expectant, delayed and minimal. The Instructional METTAG MT-501i provides first responders and rescue personnel with the standard triaging features needed for frequent trainings on a prompt and accurate assessment of a Mass Casualty Incident (MCI) victim’s injuries and to easily record the data. In the event of a Mass Casualty Incident (MCI), where multiple victims are injured and require varying degrees of medical attention, it is absolutely imperative that first responders have a quick, easy, and reliable method of assessing victims and assigning them with an appropriate triage or priority status, based on the severity of their injuries. Please note: Bar codes are non-functioning on the training tags. TACDA is a non-profit organization funded primarily by the sales of METTAG triage tags. |Dimensions||8.25 × 4 × 0.5 in| Single, Pack of 50, Pack of 25, Pack of 10
<urn:uuid:e338bbaf-2cfd-4996-b337-0c0cb66f40b3>
CC-MAIN-2022-33
https://tacda.org/product/mt-501i-salt-method-emergency-triage-training-tag/
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882570871.10/warc/CC-MAIN-20220808183040-20220808213040-00266.warc.gz
en
0.886515
599
1.6875
2
- spring-loaded protection tube that ensures metallic contact between bearing and sensor - cable thermometer Ø 4 .. 8mm for bearing, uninsulated stem - it can be use Pt100/A, B, from two to four wire connection, double sensor, Pt1000, Ni1000, KTY, PTC, thermocouples… - temperature range -60…+350°C (T=c. 10sec) - dielectric strength: 1500V, insulation resistance min. 20MΩ - Immersion length Y = depth of hole+ 10mm! Spring compressionis max. 20mm. Uninsulated cable thermometer for bearing, with spring.
<urn:uuid:f52f19d3-b8cc-4754-8c16-785d3ada6a0e>
CC-MAIN-2022-33
https://www.rawet.com/sortiment/s-pruzinou?categoryId=39
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571692.3/warc/CC-MAIN-20220812105810-20220812135810-00073.warc.gz
en
0.777305
146
1.625
2
Welcome to OxyDB! OxyDB is a user-updatable database of information about the Oxytricha trifallax genome sequence, determined at the Washington University Genome Sequencing Center. OxyDB provides information on the genome, genes, and proteins of Oxytricha based on analyses performed at Princeton University, scientific literature published by the Oxytricha research community, and other sources. Please feel free to send comments, suggestions, or questions to us at email@example.com Feature Names Changed The standardized feature names have been changed to replace the underscores with periods, as they are displayed in other lists. The names with the underscores have been added to each gene as an Alias, so it is still possible to find them using this nomenclature. Oxytricha Genome Paper The Oxytricha trifallax genome paper has been published in PLoS Biology. Congratulations to Estienne Swart, Laura Landweber, and all the other contributors who made this project possible! The Oxytricha trifallax Macronuclear Genome: A Complex Eukaryotic Genome with 16,000 Tiny Chromosomes Tantalizing Glimpses into a Fragmented Genome OxyDB is now online OxyDB is the new hub for information about the genes and proteins of the ciliated protozoan Oxytricha trifallax. OxyDB currently displays the most recent gene/protein sequences and functional annotations for this species from the Washington University Genome Sequencing Center, Princeton University, and other sources. In order to keep the information in our database as current as possible, we invite members of the Oxytricha research community to add and update these annotations to reflect published research. Check back here for updates as we continue to develop and improve this website.
<urn:uuid:02bb52d5-c421-42b9-928b-1df19f21bc01>
CC-MAIN-2017-04
http://oxy.ciliate.org/index.php/home/welcome
s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560280221.47/warc/CC-MAIN-20170116095120-00228-ip-10-171-10-70.ec2.internal.warc.gz
en
0.87533
388
1.921875
2
Professor Keith Channon celebrates £113m funding for Oxford’s Biomedical Research Centre Professor Keith Channon, Exeter’s Professorial Fellow in Cardiovascular Medicine and director of Oxford’s Biomedical Research Centre (BRC), has good reason to celebrate. As the BRC prepares to mark the 10th anniversary of its foundation, in April 2017, it has been buoyed by the news that it has been awarded £113.7m from the National Institute of Health Research (NIHR). Professor Channon said: “We were delighted. It was a highly competitive bidding process with no carry-over. We are very proud of our track record. There are 20 BRCs in the country and Oxford is one of the largest, and the only one to successively increase our funding.” Since its inception the BRC has funded 2,000 projects carried out by partnerships between Oxford University and Oxford University Hospitals NHS Foundation Trust. Utilising the talents of 10,000 medical personnel in Oxfordshire’s hospitals and 5,000 on-site researchers, it has led to breakthroughs in whole genome sequencing for rare diseases and cancer, reducing the risk of recurring stroke, replacing bedside paper charts with “early warning” tablet computers and developing an Ebola vaccine. Professor Channon added: “It’s a great privilege to be involved with so many outstanding researchers and clinicians who are working so hard to advance research across the breadth of medicine. For me, it is a fantastic privilege.” To read more about the work of the BRC and a profile of Professor Channon click here.
<urn:uuid:41d52d49-f0e4-4049-8ddd-b06c60230f34>
CC-MAIN-2022-33
https://www.exeter.ox.ac.uk/professor-keith-channon-celebrates-113m-funding-for-oxfords-biomedical-research-centre/
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571246.56/warc/CC-MAIN-20220811073058-20220811103058-00270.warc.gz
en
0.947558
341
1.578125
2
Single-cell RNA-sequencing (scRNA-seq) allows transcript profiling at the level of single cells, enabling cell identity delineation and the study of cell-level heterogeneity of gene expression. Through differential expression (DE) analysis, marker genes can be discovered that define different cell identities, or that are (differentially) associated with a particular developmental process, e.g. the development of a stem cell to a differentiated cell type. First, we show that adopting bulk RNA-seq methods for DE analysis in scRNA-seq data suffers from excess zeros, especially for full-length protocols. We therefore introduce observation weights derived from zero inflated negative binomial (ZINB) models that effectively down-weight excess zeros in the analysis, and unlock bulk RNA-seq tools for DE analysis in single cell applications. Second, we introduce a generalized additive model (GAM) framework for DE analysis downstream of trajectory inference as genes often exhibit nonlinear expression profiles along development. We show how the NB-GAMs provide a powerful approach to assess differences in gene expression along and between lineages of a trajectory.
<urn:uuid:a4764b2a-a5ce-44f0-97a7-e3bcfd27f694>
CC-MAIN-2022-33
https://ww2.amstat.org/meetings/jsm/2019/onlineprogram/AbstractDetails.cfm?abstractid=306518
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572833.78/warc/CC-MAIN-20220817001643-20220817031643-00270.warc.gz
en
0.874346
235
1.859375
2
At a time when Sony was launching its famous Walkman portable audio player to the general public, set to revolutionise the ways in which people listened to music, our founder and Sales Consultant Stuart James was forming the company that is known as DBS Leoch today. Much has changed in the intervening 40 years and the UK battery industry is no exception. Stuart’s Dad, Ron James, was Sales Director for Tungstone Batteries in Market Harborough in the 1970s and 1980s, and helped Stuart to set up the company on 1 July 1979. At the time, there were over 30 battery manufacturers in UK but it’s now down to just one or two. Initially, batteries were difficult to manufacture but as they became increasingly machine-produced, it was more viable to make them anywhere in the world. As more private enterprise was encouraged in countries such as Korea and China, market forces pushed the battery manufacturing bases out to China, the US, Eastern Europe and Far East. When the company started, the leisure battery market was dominated by car batteries and they were used for a range of applications including cars, trucks and agriculture. Stuart was selling one out of every ten batteries sold in the UK and to gain a further competitive edge, became one of the first battery importers in the UK. The trade price of the most popular car battery 40 years ago was around £20, whereas today, the reduced costs of manufacturing have resulted in it retaining its value at around the same price today. As the electrical demands on batteries have got greater with more leisure, alarm, mobile power and energy saving applications, the technology has developed. Conversely, as the UK battery manufacturing market has declined, battery sales have increased as we’ve continued to ‘go electric’ with new cars, boats and battery-powered home appliances. The future of batteries will undoubtedly be driven by the world’s green, renewable and sustainable communities. There is already a clamour for batteries and energy storage sources powered by the wind and sun, and for rapid-charging Lithium batteries to power electric vehicles and other applications. And after that, who knows? Could we see hybrid battery/engine sources powering planes and ships in the future? Whatever the outcomes, DBS Leoch is committed to competing at the forefront of the battery market for the next 40 years and beyond! If you have any questions related to buying leisure batteries, visit our website at www.dbsleoch.co.uk, contact us on 01858 433330 or via email at firstname.lastname@example.org
<urn:uuid:2fa8a591-d6c1-4049-b94a-6407e3f3ad96>
CC-MAIN-2022-33
https://www.leochbattery.co.uk/blog/celebrating-40-years-in-the-battery-business/
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571190.0/warc/CC-MAIN-20220810131127-20220810161127-00073.warc.gz
en
0.976266
541
1.742188
2
This is a transcript from the second episode in our series on how to choose your tech stack. In this episode, Sadek and Nouha discuss how to choose your framework and look into the advantages of some of the most popular and commonly used frameworks. Template-based? Component-based? Your approach will change which framework is best for you. Read through all of the details, but make sure to watch the full video and to subscribe to our channel so that you don't miss the rest of the series! How do I choose my framework and what are the different approaches? 1. You can have a template based approach with Node and Laravel. Pages are files with HTML, DOM, and keys to fetch content from the CMS. Simple and popular. 2. On the other hand, you can have a components approach with React, Vue, Angular. Becoming increasingly popular and evolving very quickly, it allows you to imagine each section on the page as an individual component. Nouha: So we just talked about how to choose a technology stack when you create a website. Basically you have those two blocks. Let's focus on the first one, the frameworks. How do I choose my frameworks? And what are the different approaches? Sadek: Right, it's very complicated because you have a lot of frameworks, but I guess that maybe viewing it as a tree will help. So you have the top of the tree, two things like the kind of the classic, traditional, template-based approach. So, it's basically your pages are files which have HTML or some kinds kind of DOM. And then inside it, you put the keys to say like, okay, I'm fetching directly from the CMS, that's how you put your content inside of your template. It's a viable approach, I like it. It's simple you know, you don't have to learn a lot. It's very popular, I like it for a lot of websites. Actually, for most websites it kind of works, but then you have the other one, the more trending one, and the component approach. And I see why it's popular. There are a lot things that happening there, big communities. You have React, you have Vue, you have Angular as well. And it looks logical when you look at a page to create components for each block. Nouha: By using them you have consistent a consistence design Sadek: Yeah of course, but some people argue that its an overkill for simple websites, but I can see why it's interesting you know. Exactly as you say, like if you have a page you have different sections, inside the sections, well, each section you can imagine it as being one component and this way you don't have huge files. So it makes sense. But the problem with this is that, you know the component frameworks, is that they run on the browser. Nouha: So you have problems with SEO most of the time for that. Sadek: Right, and also it's dependent on where you execute it. So if you use it on a browser on your mobile that might take longer. Or if you don't have a connection, it may become slower. Nouha: And you have two ways of solving that appeared. Gatsby in the Static site generation space and then there is the kind of on-demand server side rendering Sadek: Yeah, so there are Gatsby. Gatsby in the Static site generation space and then there is the kind of on-demand server side rendering. Nouha: So we are talking about React frameworks here, but we actually have the same kind of frameworks.. Sadek: Yeah, like the same exists on the other side of Vue. You have Nuxt.js, Nouha: And Gridsome Nouha: Very similar approaches. And how do they work differently? Static site generators and.. Sadek: So, if you take for instance Gatsby, the approach is simple. Well it's component-oriented so you have your components and all. It will kind of fetch all of the content that exists in the CMS and it will generate pages, okay? It will generate everything on real time. Nouha: And what happens when you want to change the content? Sadek: Like if it's re-published, will it go again? It goes again. It gets documents and then it generates everything. But you might wonder: is it slow? They put so much effort into optimizing it to make it very quick. So that's an approach: Regenerate the whole website. The other approach is that, on-demand, you have a Node server that will render it on the server. So it will render every React app for Next.js on the server and the browser will get it already rendered. This way you don't have to spend time on process on CPU of the users rendering the website. So that's a different approach but the same happens with Nuxt.js. Nouha: With Nuxt.js, yeah. So how do you manage the hosting for those kinds of apps? Sadek: They are pretty different. So if you go for Gatsby, it generates files. So what you need is just to kind of host these files on some file hosting platform, like cheap, there are so many of them. But you need to configure some kind of process that will be triggered. Whenever you have to publish something you need to trigger a process that fetches the content, builds everything, and you know, push it back into that platform. Nouha: You need to have that process. And for Next.js of course you need a Node server, Sadek: Yeah. But you know with Now, you know that the company behind Next.js, they have Now, which is Serverless, which you don't have to think about the server, right? Nouha: Yeah, and we had Guillermo from Zeit in this Studio to explain that. Sadek: Yeah, so you get a request. They have your code. They will deploy it in the right place globally so you can have your page displayed and rendered without you kind of adding more servers, or thinking about how many servers you need. All of that disappears. Nouha: Yeah, okay. Cool. And it's pretty cheap because you just pay for what you use. Gatsby has this system of plugins which is very, very interesting. Sadek: Exactly, exactly. Nouha: And then also another differences between both Sadek: Yeah. Gatsby has this system of plugins which is very, very interesting. So... Nouha: For every user case you have a plugin? Like Image optimization. Sadek: Yeah, for instance image optimization if you need that then you have a plugin you install, you get it almost out of the box. That's a good experience. Next is more open on that. It's not opinionated. I guess they chose to be that way because they want a solution that is like extensible they don't want to make hard decisions on things. It's their way of thinking about things. And, you know, it's viable. You have a huge community that you can ask about things. And they will tell you solutions for your problems as well. Nouha: Yeah, okay. And plugins remind of CMS's, so let's dig more into CMS in the next video
<urn:uuid:508cbd68-44f4-4cca-b594-fcf583295bdc>
CC-MAIN-2022-33
https://prismic.io/blog/how-to-choose-a-tech-stack-frameworks
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571284.54/warc/CC-MAIN-20220811103305-20220811133305-00477.warc.gz
en
0.954067
1,595
1.90625
2
I was looking for something to help my kids to learn and remember some grammar facts – particularly whether certain words are masculine or feminine. Ma grammaire en couleur by Envolée makes this process interactive and (dare I say it) fun! The process is simple – each level starts as a blank picture, like this: In order to colour the picture, the child using the program has to select the right déterminant for each part of the picture. I thought my 9 year old daughter might get bored of this after a few minutes, but she didn’t. She loves it! A friend of mine has her children using the paper version (similar concept but I’m not sure if the pictures are exactly the same), and she said her kids love it too. Who knew that you could get a child to voluntarily do grammar exercises? This program has been a great addition to our learning time. My 9 year old has been using it for her French electronic time for the past few months, working on it for 10-15 minutes per day for 4-5 days per week, except when we were away for summer holidays. There are 50 levels in the program so it has kept her busy for quite a while. The program is geared to Francophone students in grades 1-2, but in my opinion it’s also a good fit for slightly older students in immersion or French as a second language programs. My 8 year old is not quite ready for grammar lessons yet, but I will definitely be holding on to this one for him to use as well in a year or so. Here is a great video demo of the program in action: Many thanks to Envolée for providing a copy of the desktop version for the purposes of this review. As always, opinions expressed are my own and have not been influenced by the publisher in any way.If you're not reading this post in your e-mail, sign up for updates right here and get your free guide to Getting Started Teaching French at Home:
<urn:uuid:934b5fec-c26c-4b04-9c3d-96ce1d8b030f>
CC-MAIN-2022-33
https://frenglishlearning.com/envolees-ma-grammaire-en-couleur-product-review-critique/
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571538.36/warc/CC-MAIN-20220812014923-20220812044923-00477.warc.gz
en
0.962317
417
2.609375
3
If your menstruation is usually on schedule and you are late by even one day, you might be pregnant, notes BabyCenter. However, it is rather common for women to be late in their period even if they are not pregnant. Still, it is best to check with a physician or take an over-the-counter pregnancy test to be sure.Continue Reading Your doctor may require you to undergo several simple tests like urinalysis and a human chorionic gonadotropin, or hCG, blood test to find out if you are pregnant. Home pregnancy tests are designed to work just like the hCG blood test. They can detect the levels of human hCG in the body, a hormone that is only released after fertilization occurs, even if you are one day late. Levels of hCG are more easily detected in concentrated urine, so it is best to take the pregnancy test in the morning before you eat or drink anything, recommends BabyCenter. Aside from missed period, you can also check other bodily signs that might be symptoms of a pregnancy. One symptom is elevated basal temperature, reports Baby Corner. Basal temperature usually spikes during ovulation, but during conception, it stays at elevated levels. Another is unexplained fatigue that often leads to carb cravings. Headaches, cramps and spotting are also telltale signs that you might be expecting.Learn more about Pregnancy
<urn:uuid:d52614ba-49b2-414d-b82c-7fc9116f4a69>
CC-MAIN-2017-04
https://www.reference.com/health/could-pregnant-period-one-day-late-ca2a5b06e3c2184b
s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560281450.93/warc/CC-MAIN-20170116095121-00178-ip-10-171-10-70.ec2.internal.warc.gz
en
0.954605
281
2.296875
2
The Japanese educational system, due to American occupation after the World War II, was heavily influenced by American educational system. The Fundamental Law of Education in Japan was introduced in 1947, changing the educational system to the 6+3+3+4 structure. The current system includes six years of elementary school, three years of Lower secondary school, three years of upper secondary school and, finally, four years of higher education. The last step is not optional and was created for those who are in the academic stream. It is worth to mention that Japanese educational system is known for its impressive results in passing international benchmarking tests. Among the most notable ones is the OECD Program for International Student Assessment (PISA). That is why nearly 97% of junior school children easily pass to high school, which graduates nearly all of them, defining the high level of education in Japan. In contrast, in the US there are around 88% of junior school students who pass to high school and only 70% of them graduate. There are around 3 million students who enrolled in a higher education. It is worth to mention, that there are more than 1, 200 universities and junior colleges in Japan, meaning that Japanese students who wish to pursue tertiary education have all opportunities to succeed. Still, the great number of universities and junior colleges also make the higher education in Japan one of the weakest parts of the whole educational system. The only goal pursued by those who want to get a higher education is to be admitted to the most prestigious school. After the admission, students easily pass through the first three years of an undergraduate program and, generally, use the last year for job hunting. That is why plans to reform were introduced in 1998 by the University Council, an advisory organ to the Ministry of Education, Culture, Sports, Science and Technology (MEXT). The main plan of the reform included limiting the number of credits for undergraduates and stricter grading policies. However, the report was not aimed at such issues as demographics and graduate education Japan is facing today. The report concerning demographic issues was introduced in 2007. In Japan, preschools are not compulsory. The education is provided by kindergartens and day-care centers, taking children from under age 1 up to 5 years old. Preschool education is mainly focused on having the child pass the entrance exam to some private elementary school. The academic year starts in April. There are two periods of vacation: summer vacation in August and winter vacation from the end of December to the beginning of January. The academic year ends in March. It is worth to note that academic year is the same all from elementary school to higher education. Primary Education (Shogakko) A middle school in Japan is compulsory. It includes 6 years of studying and aimed at students from under age 6 to 12 years old. The curriculum of the elementary school includes both regular subjects and some extracurricular activities (festivals, competitions, class trips, etc.). Furthermore, there is a moral education for elementary school, which means that students are taught the importance of personal values. There are no special groupings of students in accordance with their abilities. Also, pupils are not able to skip grades. Teachers of primary schools are required to have a Bachelor’s degree in Primary Education or have a diploma from junior college. Still, the second option is considered to be a second-class certificate. That is why the majority if teachers of elementary school have completed a four-year university degree. Middle Education (Chugakko) From age 12, children proceed to middle schools. The 3 years coming after primary education is increasingly academic. It is explained by the fact that nearly 96% of students who pass through middle school want to continue their education. That is why the main focus of the middle school is preparation for high school entrance examination. There are about 95% of state-funded schools in Japan, while about 5,7% percent of students attend private schools. There are about 40 students in an average class. In comparison to the primary school curriculum, middle school includes integrated study with the goal of stimulating students’ individuality and imagination. Over 80% of teachers in middle schools have a University diploma. Typically, all of them have completed major courses in the subjects that they teach. Secondary Education (Kotogakko) High school is Japan is not compulsory and, what is more, it is not free. Nevertheless, about 94% of students continue their education by entering privately-funded or state-owned institutions. A high schools in Japan welcomes students who reached 15 years and ends when they are 18. After grade 9, students in Japan are divided into two categories: vocational and university entrance. There are also 3 main formats of secondary education: full-time, part-time, or correspondence. The main aim of the secondary school is to prepare students to apply for entrance to universities. Teachers of secondary schools must complete Bachelor’s degree in Education. Also, some of them have a Master’s degree due to the requirement of greater concentration in the teaching subjects in comparison to primary level. Vocational education in Japan was created for students, who choose to enter university. Nearly all of students who have plans to get a higher education almost invariably undergo some vocational training, which is known for its high standards. After passing through vocational studying, students can get the internationally recognized certification. Each year, there are about 3 million students who study at universities and colleges in Japan. Most of them prefer to choose full-study format. All colleges in Japan are private. Still, there are also about 96 national universities and about 39 universities established through local government. If you are looking for the most top-ranking university in Japan, it is always the University of Tokyo. The most popular undergraduate courses in Japan are social sciences, engineering, humanities, and education. By the way, teachers in universities and colleges have to get the first-class teaching certificate. It means, that all the students who want to make a career in teaching at universities, have to study 40 units in the teaching area of specialization and 19 in the area of professional studies. The four-year program includes minimum 124 units. Furthermore, beginning teachers have to take part in a one-year supervised training program.
<urn:uuid:7320a746-ce5a-4c3c-8db7-abcd1b5daeb0>
CC-MAIN-2022-33
https://in-japan.education/japanese-educational-system/
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572127.33/warc/CC-MAIN-20220815024523-20220815054523-00273.warc.gz
en
0.973536
1,295
3.0625
3
by Michael Smith (Veshengro) March 14, 2016 marks the 133rd anniversary of the death of Karl Marx who, together with Friedrich Engels, wrote the Communist Manifesto, and, on his own and together with Engels, many other works that lay the foundation to socialism and communism. Today even top financial experts and economists admit “Marx was right” but still all too many seem to believe that his ideas have no place in our world. No, the capitalists and the bourgeoisie do not like his ideas and ideals and would like to continue with things as they are or would like to turn the clock back to another age even, an age where workers had even fewer rights, if any. The tragic thing is though that Marx's words have been, in later editions of the Communist Manifesto, or to give it it's proper title, “The Manifest of the Communist Party”, deliberately rewritten to instead of “the means of production in the hands of the workers” to read “the means of production in the hands of the state”. If he but knew he would turn in his grave, and that not only once. Today, 133 years after his death, those ideas are as important as they were when they were written and especially the liberation of the workers through ownership of the means of production. However, the parties and the trade unions do not seem to be very much in favor of this idea at all even though they love to quote and misquote Marx and especially, if would seem, the misquoted part where the state is to own the means of production. Only, and only, when the workers truly own the means of production and manage the various businesses as cooperatives are they truly the masters of their own destiny. As long as the means of production are owned by an owner, whether that is an individual, a capitalist entity or the state, the worker is and remains a slave. In order to honor the man, his legacy and his ideals let us implement his Manifest properly and not the falsified version.
<urn:uuid:fab23434-2af3-4b56-a799-a25febfeeab4>
CC-MAIN-2017-04
http://greenreview.blogspot.com/2016/03/karl-marx-133-years-after-his-death.html
s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560280504.74/warc/CC-MAIN-20170116095120-00140-ip-10-171-10-70.ec2.internal.warc.gz
en
0.98668
422
2.46875
2
People everywhere talk about the special effects seen in movies, TV shows and commercials. Animation has gone high-tech and MDC prepares students for exciting careers in special FX, game development, and product design and visualization. Computer animation students learn to use state-of-the-art 3D animation software that is instrumental in creating today's most popular animated feature films. |Estimated tuition cost:| |Estimated time to complete:| This is a pathway program. The AA degree pathway is designed to prepare students to transfer to four-year institutions by providing them with the necessary general education credits and elective courses. Earning an Associate of Arts (AA) degree at MDC guarantees admission into one of the state's public universities where students can complete a bachelor's degree. An advisor will work with you to determine which elective courses will lay the best foundation for your selected major and continued studies.Areas of study in this program include: Multimedia artists and computer animation artists work, in motion picture and television studios, advertising agencies and design studios, software publishers, computer systems design firms and even on their own as freelance artists. Students who pursue studies in this field may find employment in:
<urn:uuid:9fc483af-0cfa-4480-a749-3d19ca4ab8fd>
CC-MAIN-2022-33
https://www.mdc.edu/animation/default.aspx
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882573540.20/warc/CC-MAIN-20220819005802-20220819035802-00468.warc.gz
en
0.945427
251
2
2
Learn How To SEO - It's EASY! Hello and welcome to this SEO tutorial! In this tutorial, you will find the necessary steps for making sure your content is Search Engine Optimized and ready to conquer Google Page 1! Good luck and please, let me know if you have any further questions. 1. Find a Good Keyword - Use Jaaxy the Amazing Keyword Tool A right keyword is what you'll start with when doing your SEO. a) If you go to Jaaxy, try to find one keyword or keyword phrase that has: - over 50 searches and QSR under 100 ('low hanging fruit' keywords) *note: if you are writing a product review, and the product has just been launched, the search volume might be significantly lower than 50. That's understandable because the search will go higher as the product is promoted and advertised after the launch. b) You need only ONE keyword or keyword phrase. Your post will rank for more than just this one keyword anyway, so you need to get just the one and concentrate on it. Put your keyword in: 1. The title of your post 2. H1 tag title in the post's first paragraph 3. In the first paragraph 4. In the last paragraph 5. If it feels natural in the content, you can put it more often 2. Write Good and Long Post To rank high and to rank fast in Google, first of all, you need to write good content. There is no way around it. What does that mean? a) It means, writing a helpful and long post. Yes, you need to do both of those things. Posts of 500 words simply, do not cut it. You are just wasting your time. Add another 500, and you might have something actually to use the SEO rules on. Add another 500, and you'll be in with a great chance. b) Write an exciting Headline, or at the very least, not a boring one. See what your competition is doing and try to do the same or better. c) Write short paragraphs d) Write short sentences e) Bold all the essential words/parts f) Use H1 tag for your title, H2, and H3 for other titles or important parts of the post 3. Use Relevant Images Images are essential for good user experience and also for getting your point across. a) Make sure your images are relevant to what you are writing about b) Images need to be optimized. You can use EWWW plug-in to do that. This plug-in is included already on the new sites here at WA. c) ALT Description - don't miss this one! ALT Description is for the visually impaired people, to include a detailed description of what is on the picture. This is not a place for your keyword (as I have seen it explained on quite a few blogs). Doing the ALT description you are not just aiding your SEO, but also being a decent human being helping out those who cannot see the picture you've uploaded on your blog. 4. Write a Good META Description META description is the bit of text that appears underneath your title in the Google search. a) META is 160 words b) It needs to communicate to your potential reader what is your post about c) I write one or two important words in capital letters (this is not a rule, it's just something I do if it's appropriate for the post) If you have found this tutorial useful, I'd appreciate it if you would give it a LIKE and a COMMENT below :) Thank you :)
<urn:uuid:ca966204-2a4d-4c68-97e7-9d78ee6ea569>
CC-MAIN-2022-33
https://my.wealthyaffiliate.com/training/learn-how-to-seo?a_aid=0632208a
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572286.44/warc/CC-MAIN-20220816090541-20220816120541-00269.warc.gz
en
0.932609
773
1.585938
2
Heathrow has announced it is among the first major airports to achieve carbon neutral status, meaning its emissions are cancelled out by purchasing carbon offsets. This comes as the airport confirmed it is investing £1.8 million throughout 2020 to “kick-start” the restoration of natural UK carbon sinks – such as peatlands, woodlands and farming soils. These include a regenerative farming project at Invergowrie near Dundee, which the airport has supported since 2018, and a new native woodland planting scheme at Ledmore near Ullapool. In partnership with Forest Carbon, the Ledmore project will cover 87.4 hectares and help explore opportunities for woodlands to deliver effective UK carbon offsetting alongside other benefits like boost biodiversity and supporting better soil and water quality. Heathrow is partnering with James Hutton Institute, a Dundee-headquartered research organisation which aims to drive sustainable use of land and natural resources. Zero carbon by mid-2030s The airport – which is the size of a small city – claims to have reduced emissions from its operations by 93 per cent compared with 1990, following investment of more than £100m in energy efficiency and renewable power measures. It will use offsetting as an interim measure to reduce carbon emissions in the short-tern, as it works towards operating a zero carbon airport infrastructure by the mid-2030s. Helaina Black, a senior soil scientist and an honorary associate of the James Hutton Institute in Scotland, said: “We are pleased to be able to support initiatives like Heathrow’s, which will help farmers and other land managers to increase and restore carbon stores in soils and ecosystems. “It is vital that this carbon benefit is realised in the short term to address the climate crisis.” This follows a commitment from the UK aviation industry to achieve net-zero carbon emissions by 2050 by working with governments around the world and through the UN. Early next week, Heathrow will be rolling out its Target Net-Zero action plan to support this commitment. Chief executive John Holland-Kaye added: “Making our infrastructure entirely carbon neutral is a significant milestone and a testament to the determination of our airport to help spearhead a new era of sustainable aviation. “Our sights are now set on working with the global aviation industry to deliver on net-zero by 2050, at the latest. We can and will cut the environmental cost of flying whilst keeping the benefits of travel for future generations.”
<urn:uuid:92f5f4ea-308a-424e-9c14-27b41c3f04bb>
CC-MAIN-2022-33
https://www.scotsman.com/business/heathrow-airport-invests-scottish-carbon-sinks-it-goes-carbon-neutral-1885841
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571993.68/warc/CC-MAIN-20220814022847-20220814052847-00677.warc.gz
en
0.953844
517
2.71875
3
1,564 deaths recorded in the first half of this year, up 17 percent compared with 2013 A United Nations report released on Wednesday finds that civilian casualties in Afghanistan rose sharply in the first half of this year as they increasingly feel the brunt of war. The report by the U.N. Assistance Mission in Afghanistan (UNAMA), compiled as U.S.-led forces withdraw from a 12-year battle with the Taliban and amid a steep decline in security, finds that ground combat—now more than improvised explosive devices—is the leading cause of death and injury to civilians. More than 4,800 civilian casualties were recorded in the first six months of this year. That figure includes 1,564 deaths, up 17 percent compared to the same period the year before. Child casualties associated with ground combat more than doubled—rising 34 percent to 1,071—while two-thirds more women were killed and wounded by ground engagements. “The fight is increasingly taking place in communities, public places and near the homes of ordinary Afghans, with death and injury to women and children in a continued disturbing upward spiral,” said Georgette Gagnon, UNAMA’s Director of Human Rights. Afghanistan’s unrest is increasing amidst the ongoing political crisis, as a disputed presidential election has created a tense stand-off between the two leading candidates, Ashraf Ghani and Abdullah Abdullah. Early results on Monday showed Ghani net 56.44% of the run-off vote on June 14, but Abdullah was quick to reject the outcome and claim it was marred by fraud. Abdullah’s supporters protested in the capital, Kabul, on Tuesday and called on him to form a parallel government. Washington responded by saying it would pull both financial aid and security support if power was seized illegally.
<urn:uuid:d23684a9-383e-4a1d-91c1-ad1764042635>
CC-MAIN-2017-04
http://time.com/2969270/united-nations-report-afghan-war-withdrawal/
s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560279650.31/warc/CC-MAIN-20170116095119-00435-ip-10-171-10-70.ec2.internal.warc.gz
en
0.971195
374
1.96875
2
Struvite (MgNH4PO4.6H2O) solubility and its application to a piggery effluent problem Webb, K.M. and Ho, G.E. (1991) Struvite (MgNH4PO4.6H2O) solubility and its application to a piggery effluent problem. In: Workshop on Appropriate Technology for Environmentally Sustainable Development / conducted for ASEAN delegates by Remote Area Developments Group, 2 July, Perth, Australia pp. 39-45. Struvite (MgNH4P04• 6H20) solution chemistry was studied in order to understand a struvite scaling problem which exists in the pipe network of a series of 4 effluent lagoons at a piggery. Struvite deposits frequently occur in piping from the final effluent pond intended for irrigation purposes, causing severe scaling of the pipe, making irrigation or other end uses of the effluent impossible. The conditional solubility constant (P. = SMg .SNH3-N•SPO.-P, equilibrium S values (M) was determined over the range of pH values (6.8-8.5) and solution concentrations of Mg, NHa-N and P04-P close to field conditions, and at a temperature of 30°C. A comparison of field and laboratory data indicates struvite precipitates from the second lagoon onwards. The solubility data obtained also indicate potential for precipitation as a method of nutrient removal from wastewaters. |Publication Type:||Conference Paper| |Murdoch Affiliation:||School of Biological and Environmental Sciences| |Item Control Page| Downloads per month over past year
<urn:uuid:ae02fb03-672d-47c3-b1b7-6d60d5411000>
CC-MAIN-2017-04
http://researchrepository.murdoch.edu.au/id/eprint/13247/
s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560280410.21/warc/CC-MAIN-20170116095120-00454-ip-10-171-10-70.ec2.internal.warc.gz
en
0.810383
366
2.453125
2
Are GMOs on the White House Menu? Dear Organic Consumer, Ninety percent of mothers and 88 percent of fathers are in favor of labeling GE foods, according to a recent survey by the Mellman Group. But two key parents are holding out: President and Mrs. Obama. Please ask Michelle Obama to remind the President of his campaign promise to label GMOs, and to show his support for GMO labeling by endorsing Prop 37, the California Right to Know Genetically Engineered Food Act. More than 185,000 people have already signed on. We need to reach 200,000 signatures by Oct. 1, so we can deliver the petition to the White House. Just last week, an important new study raised even more questions about the health consequences of GMOs. Given Michelle Obama's stance on organic gardens and healthy school lunches, we have to ask: Would she let her children choose food from a grocery store without knowing whether that food item contained GMO ingredients? When her family sits down to dinner, does the menu include GMO foods? On the campaign trail in 2007, then-candidate Obama promised to support the right to know what's in our food. But President Obama has since sided with Monsanto - not the voters who elected him, not the 90% of people in this country who want GMOs labeled. We are at a critical point in the battle to label GMOs. On Nov. 6, California voters will vote YES or NO on what could become this country's first mandatory GMO labeling bill. We must win this basic right - a right that citizens in nearly 50 other countries already have. Mrs. Obama is the President's closest confidante. So we're calling on her to tell President Obama: Keep your word. Listen to the people, not the corporations. Do the right thing. We may not be able to change the President's mind with a petition. But we promise we'll get his attention and hold him accountable - in an election year - for what he promised us four years ago. Please help us pressure the White House to side with the more than 90% of Americans who want the basic right to know which foods on their grocery shelves contain GMOs, and which don't. P.S. We are raising this money on behalf of Prop 37, in order to print signs and leaflets, mobilize thousands of volunteers, and get out the vote in California. We’re all in this together – please help. Thank you! (Send your news to [email protected], Foodconsumer.org is part of the Infoplus.com ™ news and information network) - FDA Update on Fungal Meningitis Outbreak - A Report (on Fluoridation) from New Zealand - BREAKING: Senate Moves to Preempt Vermont GMO Labeling Law - newsletter 062316 from Organic Consumers Association - Addictive and Toxic: Found in Bread, Pasta Sauce and Salad Dressing - Edward & Sons Trading Company Offers New Organic Foods
<urn:uuid:00e2ad8d-b0fa-4fc0-b113-bca4419c360b>
CC-MAIN-2017-04
http://www.foodconsumer.org/newsite/Politics/Politics/gmos_0929121138.html
s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560279933.49/warc/CC-MAIN-20170116095119-00119-ip-10-171-10-70.ec2.internal.warc.gz
en
0.934413
608
1.6875
2
Suppose the volume of a cylinder (think about the volume of a can) is given by V = πr2h where r is the radius of the cylinder and h is the height of the cylinder. Now suppose the volume of the can is 100 cubic centimeters. How do would you write h as a function of r? What is the measurement of the height if the radius of the cylinder is 2 centimeters? and how would I graph this function? The graph h verses r is also given
<urn:uuid:d6d3b577-5451-4eee-a4a1-a7cfd30868ea>
CC-MAIN-2017-04
https://brainmass.com/math/geometry-and-topology/63280
s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560285315.77/warc/CC-MAIN-20170116095125-00567-ip-10-171-10-70.ec2.internal.warc.gz
en
0.957522
104
3.75
4
APPLIED HOUDINI - DYNAMICS I - INTRODUCTION TO VOLUME SIMULATION AND RENDERING Applied Houdini is a production quality oriented series created by Steven Knipping (vimeo.com/161576184), currently a Senior Rigid Body Destruction / FX Technical Director at Lucasfilm's Industrial Light & Magic (Star Wars: The Force Awakens, Avengers: Age of Ultron, Tomorrowland). Benefit from production proven workflows while also getting an in depth explanation of why things works they way they do. Best of all - each video is crammed with actual information and footnotes instead of gratuitous talking and dead space! In Dynamics I, we will jump right in and tackle a simulation of a vaporizing pig's head. We start with simulation fundamentals such as generating initial volumes as well as what exactly domains, vectors, and voxels are. From there we set up a basic simulation with a few forces, cache it, and render it. Tips and tricks including optimal UI organization and a bare bones workflow setup will also be discussed. Watch it below, right now in full! Want to learn more? Check out the previews for the rest of the Applied Houdini tutorials right here on SideFx.com! Ready to dive in? Get the first three lessons at a big discount when purchased together!
<urn:uuid:72b68874-e785-427f-a2b5-bfee7386f52d>
CC-MAIN-2022-33
https://www.sidefx.com/tutorials/applied-houdini-dynamics-i-introduction-to-volume-simulation-and-rendering/
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572198.93/warc/CC-MAIN-20220815175725-20220815205725-00275.warc.gz
en
0.889307
278
1.640625
2
09 Feb 2022 The COVID-19 pandemic in Indonesia has had devastating effects on people’s health and livelihoods. Many lives were taken and society as whole was challenged. As INS we believe that we must remain united in our shared humanity, and that’s why the INS boards from Indonesia and the Netherlands joined forces to support ‘Rumah Sakit Terapung Ksatria Airlangga’ (RSTKA) in realizing a Covid relief assistance programme for several hospitals and Puskesmas (district clinics) on the islands of Sumenep/Madura in East Java, by donating 10 Oxygen Concentrators (OC’s) through Philips, one of INS’s patrons. The mission of Marco-19 to 15 islands, undertaken by RSTKA from September to mid-October, was an outreach programme to increase awareness on COVID and vaccination, and provide free surgeries to the needy. The oxygen concentrators are being put to use straight away. Marco-19 fared to different remote islands where the needs are high. One of the missions was to visit an island that gets isolated 2 months in a year because of the waves, that can reach 5 meters. The mission resulted in oxygen concentrators being spread across Puskesmas in Madura islands: puskesmas Raas 1 OC, Puskesmas Gayam Sapudi 1 OC, Rumah sakit Abuya in Arjasa 2 OCs, Puskesmas Sapeken 2 OCs, Puskesmas Masalembo 2 OCs, and remaining 2 OCs at the RSTKA floating hospital.
<urn:uuid:7b2936e3-581e-4112-a0d1-a5f487a5dae4>
CC-MAIN-2022-33
https://indonesia-nederland.org/news/covid-relief-response/
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572286.44/warc/CC-MAIN-20220816090541-20220816120541-00265.warc.gz
en
0.940427
339
1.789063
2
We all know that emotional distress is a serious matter, that has the potential to cause long-term effects and sufferings, being problematic for one’s future well-being. What is Emotional Distress? Emotional distress is a feeling of being displeased, annoyed, troubled and having a stressful emotional reaction, that is either caused by someone’s willful bad conduct or negligent behavior. Sometimes, it is even caused due to one’s own actions. It is a response to any accident in an emotional manner. Emotional distress can also be caused through physical reasons. Such as: - Fracture / Broken Bone - Body pain - Car accidents - Physical abuse - Stolen property - Property damages Moreover, it can also be caused by non-physical reasons. Such as: - Verbal abuse These factors can potentially create or even give rise to the hazards of emotional distress. Coverage of Emotional Distress Emotional distress is not easy to determine. It is a non-physical injury, related to psychology, which can be filed for a lawsuit according to law. Such lawsuits of emotional distress by law are considered valid. The case can be presented in civil courts, where they do allow your lawyer to determine a monetary compensation, according to the emotional distress suffered. This amount has to be based on all the evidence, facts and figures presented, from which the jury feels the evidence is enough and reasonable. If the jury decides they are reasonable, then the monetary compensation shall be permitted to the emotional distress victim. On the other hand, certain damages that are related to material. For example; property damages to your vehicle or even stolen property. Materials which are the cause of an individual’s emotional distress. If that material is recovered, the victim can return back to the same emotional condition as they were before the accident. This type of reasoning can be easily compensated on a monetary basis. In other words, for example; if your car is damaged and the damages are creating emotional distress, then financial compensations shall be granted to ease the emotional distress, based on the facts and figures presented. The faults are also considered and calculated. If any accident, in which the victim is also somewhat involved and has become a motivating factor leading to emotional distress, then that will cause a decrease in the victim’s compensation. This comes under the comparative negligence law, where the proportionate faults of all the parties involved are considered and even calculated. If it is calculated that an individual’s fault in the accident is 20%, then there will be a 20% reduction in the individual’s compensation. Check the website http://nowourtimes.com/ to gain a sense of the claims, compensation and determining fault (to tell who is at fault in a car accident) in Oregon. There’s a lot of helpful information there that could give you some assurance. Factors that Determines the Compensation for Emotional Distress There are certain factors that make it easy to determine the compensation for emotional distress. The proofs and evidence are itself the determining factors. Without some sort of proof and evidence, it is impossible to express any emotional distress and will be overruled by the court. The possible evidence which can be presented before the jury, can be certain documentations, witnesses, lawyers and even professionals testifying the validity. - Documentations: The use of medical documentations such as previous and current medical records of diagnosis, reports, medical bills, doctors prescribed medicines, tests and even the documentations of on-going therapy sessions. These are highly supportive in order to avail any compensation necessary for emotional distress. - Witnesses: The compensation of the victim can also be determined through confirmation of the witnesses, as they come in handy. The more witnesses there are, who confirms the victims emotional distress behavior, the better. This helps the jury to understand the severity of the situation as well as the distress, making decisions accordingly. The witnesses can also provide first-hand information of the accident that resulted in emotional distress, if any bodily injuries are involved. - Professionals: This can be the ones who are treating the victim of emotional distress. They can be the doctors, psychologists and even the therapist, or whoever the one qualified, treating the victim. Also, other professionals who are not related to the victim at all, can be brought. They can possibly verify the emotional distress of the victim to be valid or invalid. This will help the jury and the judge to determine whether compensation should be granted to the victim or not. - Lawyers: They act on behalf of the victim and give them full support through-out. They collect all the in-depth evidence and facts from the above. Even try to collect first-hand information from various other sources and present them to the judge and jury, providing a convincing argument. Apart from this, are lawyers even able to determine whether the compensation for a particular emotional distress are suitable or not? Given the situation. - Jury: The jury itself is the biggest factor that will determine whether the emotional distressed victim should be given compensation or not. Their decision is based on the convincing evidence and facts that are presented by the above determinants. It can be problematic if these evidences are not enough. How to Sue for Emotional Distress There are different approaches in order to sue for emotional distress. The cause of emotional distress is either deliberate or negligent. These 2 are approached differently when proceeding to sue for emotional distress. - Deliberate: When caused emotional distress on purpose. - Negligent: When caused emotional distress by carelessness and not intentional. It is necessary to consult before doing so. There are even certain laws where emotional distress is not considered due to the absence of bodily injury. Emotional distress needs to be taken seriously at all times, because leaving it as it is, can create long-term trauma and distort the well-being of any individual. If you are going through such unpleasant experiences and wondering how much can I sue for emotional distress, then it is recommended to consult with professionals before doing so. These situations come with a lengthy process and are not easy to determine without proper evidence and law abidance. Failure to do so can lead to rejection by the civil court, causing further emotional impact on the victim.
<urn:uuid:49af11f4-31dd-4321-9eaa-6abf3b07b51a>
CC-MAIN-2022-33
https://www.nowourtimes.com/compensation-for-emotional-distress-after-a-car-accident/
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571150.88/warc/CC-MAIN-20220810070501-20220810100501-00673.warc.gz
en
0.940277
1,331
2.796875
3
Ukraine: UNHCR concerned by rise in attacks on asylum seekers, refugees This is a summary of what was said by UNHCR spokesperson William Spindler – to whom quoted text may be attributed – at today's press briefing at the Palais des Nations in Geneva. We are extremely concerned at what seems to be an increasing trend in the number and seriousness of racist attacks against asylum seekers, refugees and other foreigners in Ukraine. At the same time, a number of incidents of police violence against people seeking protection in Ukraine have been reported. In the latest incident, an Iraqi asylum seeker who was seeking protection in Ukraine after fleeing his war-torn homeland was killed in Kyiv on 3 June. The motives for this act are not yet known, and a police investigation is currently under way. But the number of attacks and harassment against foreigners in Ukraine in the last few months make it necessary to investigate the motives of this murder carefully, including racist motivations. UNHCR has requested that the Government of Ukraine keep the office informed of the outcome of the investigation. UNHCR first voiced concerns over what appeared as xenophobic acts in Ukraine on 13 July 2001, after a refugee from Rwanda was beaten to death outside his home in Vinnitsa. In March 2005, a former refugee of Iraqi origin, employed by a UNHCR partner organization, was severely beaten in Kyiv by a gang of youngsters. Since then, UNHCR's office in Kyiv has been receiving on a regular basis, first-hand reports of racially motivated incidents, unprovoked attacks, beatings, verbal insults and other acts of xenophobia against refugees and asylum seekers in different regions of Ukraine. There are also regular media reports of attacks and harassment of foreigners in Kyiv, including members of the diplomatic community. UNHCR acknowledges the important steps taken by the Ukrainian authorities to address this problem, including high-profile public statements by the Minister of the Interior. UNHCR also appreciates the openness of the authorities in Kyiv to discuss these problems. UNHCR encourages the Ukrainian authorities to increase their efforts to put an end to these attacks and to ensure that those responsible are brought to justice, as a matter of urgency. UNHCR is working together with other UN agencies, the diplomatic community and human rights organizations in Ukraine to counteract xenophobia and racism. As part of this effort, a number of advocacy activities designed to promote tolerance have been organized and free legal aid to victims of xenophobia and racial violence is provided.
<urn:uuid:e6f9d189-12c3-46b9-8476-a70b74c11f8d>
CC-MAIN-2016-44
http://www.unhcr.org/print/4669266f2.html
s3://commoncrawl/crawl-data/CC-MAIN-2016-44/segments/1476988719155.26/warc/CC-MAIN-20161020183839-00332-ip-10-171-6-4.ec2.internal.warc.gz
en
0.971984
493
1.835938
2
I was bored in school. It's true. I didn't feel like the school system was designed for my learning style. It wasn't until college where I could pursue my passion, making films, that I found my way. Recently on Edutopia.org, we published observations from 8th graders about what they believe creates an engaging learning experience. Their answers were straight-forward and definitive: project-based learning, technology, and an enthusiastic teacher. I couldn't agree more. Today, with the power of the Internet, we are experiencing a force that is revolutionizing education and offering opportunities to reach and engage diverse learners like me. When technology is deployed effectively, it can free up teachers from standing in front of the class and presenting information. We can "flip" the classroom with lectures occurring at home via the Internet and rigorous project-based learning taking place in cooperative groups at school. In this environment, teachers can be guides and coaches to the students. What is more powerful in education than a student who is guided by an adult who truly cares -- someone who knows your name, who encourages you, and is committed to your success in life? By learning about and replicating strategies that work in education, we have the potential to transform our schools. By creating strong cultures of creativity and curiosity, we can engage students as active participants in their own education, rather than passive recipients of facts and formulas. In a world where information is at our fingertips, our greatest challenge is help students learn how to find information, assess its accuracy and apply it to solve problems. All around our country and the world, there are teachers and schools succeeding at the task, many featured on Edutopia. Here is a recent video which shows a once failing middle school in Charlotte, North Carolina, that invested in research-based teaching strategies and is now on the rise. There is no other job more important than education. It is the foundation of our democracy. By seizing on what's working, and recreating those successes from one classroom to the next, we can make it better for everyone.
<urn:uuid:6bc30868-a9e3-4bbf-8c69-5e7cb36023c8>
CC-MAIN-2016-44
https://www.edutopia.org/blog/importance-of-education-george-lucas?page=10
s3://commoncrawl/crawl-data/CC-MAIN-2016-44/segments/1476988720000.45/warc/CC-MAIN-20161020183840-00025-ip-10-171-6-4.ec2.internal.warc.gz
en
0.971938
425
2.8125
3
Please see the rubric below to complete this assignment. You are a reporter for your local media outlet and have scheduled an interview with your local congressman, who sits on the Committee on Ways and Means for the U.S. House of Representatives. The focus of the interview is to get the congressman’s response to the public’s perception that his party is simply playing the role of obstructing the president’s agenda rather than representing the public’s interest and upholding the democratic process. For your paper, develop three questions you would ask, and explain your rationale for asking these questions. Defend your explanation with scholarly resources. For additional details, please refer to the Module One Short Paper Guidelines and Rubric document.
<urn:uuid:70509ee0-f020-4542-bfbc-e7bfc1863385>
CC-MAIN-2022-33
https://homeworkyard.com/short-paper-perception-interview/
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882573760.75/warc/CC-MAIN-20220819191655-20220819221655-00674.warc.gz
en
0.947606
150
2.421875
2
Quetta is the capital of Balochistan and the only metropolitan city of the province. People from all corners of Balochistan visit Quetta for official business, treatment in hospitals and shopping. Bus services from all the districts of Balochistan transport passengers to Quetta on daily basis. Buses from Baloch belt are parked at a make-shift bus stand in Musa colony on Sariab Road. Pashtun belt buses are parked at a similar make-shift arrangement on Spiny road. In 1990s, idea of a bus stand out of Quetta city in Hazar Ganji areas was floated. A bus stand was constructed but it failed due to lack of proper connecting transport facilities with Quetta city. Now, again efforts are being made to shift the bus stands of Quetta to Hazar Ganji. Hazar Ganji is a place located 32 KM from away from center of Quetta city. When this place was used as a Bus Stand, it caused a great deal of inconvenience to the passengers from entire Baloch belt. Passengers used to pay hundreds of rupees as fare to come to Quetta but they were dropped at Hazar Ganji. In order to reach center of the city, which is the obvious destination of commuters, further expenditure were required on other means of transportation such as auto-rickshaws. Bus service that connects Hazar Ganji with Quetta city is very poor in quality and that can’t be used for the purpose. As a result passengers had to pay hundreds of rupees additionally to reach Quetta city and return back to Hazar Ganji for the return trip back home. Increase in travel costs reduced their visits to Quetta and hence their living standard decreased as a result. Due to mounting public pressure, bus stands were moved inside the city closer to the center of Quetta. When current government of Dr. Malik came into power, efforts to relocate all the bus stands back to Hazar Ganji resumed. Union of local traders of the Quetta was lobbying for relocation of bus stands to Hazar Ganji due to their vested interests. Those traders will make millions if bus stands are shifted to Hazar Ganji. These traders obviously don’t care for the inconvenience caused to hundreds of thousands of passengers on daily basis. In order to appease the union of traders Dr. Malik government ordered the shifting of all bus stands to Hazar Ganji last year. As expected, the decision was met with severe opposition and since then the decision has been delayed more than once. At the moment, Dr. Malik has formed a committee which will give an opinion about the feasibility of the shifting of bus stands to Hazar Ganji. Union of traders are intensifying their lobbying efforts to persuade government to take action against the interests of common people and shift the bus stands out of Quetta city in Hazar Ganji. Based on its track record, it’s less likely that Dr. Malik government will care for interests of common people. Normally, Bus stands are located out of city in all developed and planned cities of the world. However that requires a connecting transport system that connects those bus stands with center of city. Unfortunately, that sort of transport system is missing in the case of Quetta. State of intra-city bus service is so abysmal that it can’t be overhauled overnights. In other words no short term solution can be envisaged that would allow people to commute conveniently, back and forth, between Quetta and Hazar Ganji. Traders of Quetta who are lobbying for relocation of bus stands to Hazar Ganji are already running thriving businesses in center of Quetta. They will not run out of money if Bus stands are not shifted to Hazar Ganji. However, poor passengers would bear the brunt economically if the bus stands are relocated to Hazar Ganji. Therefore the interests of common people should be prioritized over those of wealthy traders. As per the announcement of Prime Minister Nawaz Sharif, Dr. Malik only has 10 months in office before PML-N takes over the office. Since coming into power, Dr. Malik and team has miserably failed in providing relief to people of Balochistan. Some disgruntled citizens even go to the extent of calling Dr. Malik government worse than that of Nawab Aslam Raisani. Dr. Malik should avoid taking any step which would earn him more infamy. One of such steps is relocation of Bus stands to Hazar Ganji. Dr. Malik should order establishment of permanent bus stands inside the city so that the spectre of Hazar Ganji bus stand can be buried forever. This will provide much need relief to people of Balochistan who have numerous other grievances. The Balochistan Point Published in The Balochistan Point on February 17, 2015
<urn:uuid:9e246e02-93b4-4009-967a-26489761649a>
CC-MAIN-2022-33
https://thebalochistanpoint.com/editorial-avoid-shifting-of-quetta-bus-stands-to-hazar-ganji/
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571284.54/warc/CC-MAIN-20220811103305-20220811133305-00465.warc.gz
en
0.96651
986
2.515625
3
Litigation is where one party is aggrieved by the negligent actions of another party. The word used to describe an area of law where one party is aggrieved by the negligent (or otherwise) actions of another party and chooses to seek redress by bringing a court case, an arbitration case or a case to a tribunal. Intellectual Property rights are a fast growing area of business and law. The more connected the world becomes the greater the importance of protecting your rights. Like any other form of property, it is important to put provisions in place to safeguard these rights. Similarly, it is important to ensure that you don’t encroach on the Intellectual Property rights of others. We help our clients to protect these rights by providing advice in respect of Trademark and Copyright Law. We are also happy to assist you in sourcing Patent Attorneys, if required. At this firm we are aware that Family Law Proceedings can be stressful and emotionally charged. We take a practical and sensitive approach to Family Law so as to help our clients achieve a satisfactory outcome. We advise on all aspects of Family Law and work closely with your financial advisors and other experts so as to ensure you achieve not only a satisfactory outcome but also the most financially beneficial one. The legal administrative work in transferring property is known as Conveyancing. We have considerable experience in this area and our aim is to ensure that buyers have good legal title to any property they are buying and we will bring them through the process from the time you decide to purchase until your ownership is complete. We will also provide a similar service for people who are selling property to ensure that they are taken through the process from the time they sign contract to the time keys are handed over. Insolvency and debt collection as the name suggests is the pursuit of debtors (those who owe you money) it is a fast growing area. Our team will guide you through the process from warning letters through to advice on the suitability of issuing legal proceedings, the pursuit of creditors through the courts process, explaining that process to you and assisting you after judgment has been obtained by way of installment orders/registration of judgment mortgages where possible. We will set out the payment structure and the likely costs for the different stages, we will ask our clients to consider carefully before they decide to issue proceedings, whether there is a realistic prospect of recovering money. We will not encourage our clients to issue legal proceeding on the collection of debts where there is no prospect of success unless there is some other economic reason for which the client requires the creditor to be pursued. In this regard the firm also acts as agent for several established firms in Ireland by acting as legal agents for non Limerick firms. We will pursue creditors from the District Court through to Circuit and High Court. We at Melvyn Hanley Solicitors know that good working relationships are critical the successful running of a business. Employment law is complex and governed by many pieces of legislation regarding employee’s rights and employer’s duties. We provide our client’s, whether an Employer or Employee, with comprehensive legal advice on a range of employment issues including: “I could not recommend Melvyn Hanley Solicitors highly enough, they were professional, understanding and always on call when I needed advice or to put my mind at ease during a stressful process. I would highly recommend the practice to anyone looking for a advice on any legal matters”
<urn:uuid:5b174d87-e216-479c-b390-9ed0e015b879>
CC-MAIN-2017-04
http://www.melvynhanley.com/
s3://commoncrawl/crawl-data/CC-MAIN-2017-04/segments/1484560280761.39/warc/CC-MAIN-20170116095120-00088-ip-10-171-10-70.ec2.internal.warc.gz
en
0.961804
700
1.53125
2
statistical mechanics, branch of physics that combines the principles and procedures of statistics with the laws of both classical and quantum mechanics, particularly with respect to the field of thermodynamics. It aims to predict and explain the measurable properties of macroscopic systems on the basis of the properties and behaviour of the microscopic constituents of those systems. Statistical mechanics interprets, for example, thermal energy as the energy of atomic particles in disordered states and temperature as a quantitative measure of how energy is shared among such particles. Statistical mechanics draws heavily on the laws of probability so that it does not concentrate on the behaviour of every individual particle in a macroscopic substance but on the average behaviour of a large number of particles of the same kind. The mathematical structure of statistical mechanics was established by the American physicist Josiah Willard Gibbs in his book Elementary Principles in Statistical Mechanics (1902), but two earlier physicists, James Clerk Maxwell of Great Britain and Ludwig E. Boltzmann of Austria, are generally credited with having developed the fundamental principles of the field with their work on thermodynamics. Over the years the methods of statistical mechanics have been applied to such phenomena as Brownian motion (i.e., the random movement of minute particles suspended in a liquid or gas) and electric conduction in solids. They also have been used in relating computer simulations of molecular dynamics to the properties of a wide range of fluids and solids.
<urn:uuid:6a95348e-85a7-4f90-9413-1c531e5ba1aa>
CC-MAIN-2022-33
https://www.britannica.com/science/statistical-mechanics
s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571745.28/warc/CC-MAIN-20220812170436-20220812200436-00478.warc.gz
en
0.938332
283
3.46875
3
GUI Programming Help Can anyone point me to any kind of resources (tutorials, books, websites, etc) to do with programming GUIs in Java, more specifically, the interaction between components and programming events. I have designed a programme, all the GUI work is done, i am now in the process of making it fully functional (adding events to the components) and I am having trouble understanding how to access different containers. For example, i have a menubar which has an option to change the colour of some text, which is in the same frame, nested in a JPanel, within a JLabel. How do I get access to that JLabel, from the menubar, actually from the event that the JMenuItem triggers. In the past, when not dealing with menubars, I have used getParent(), to move through the containers, then using get() methods to access other objects. Is there an easier or more elegant way of doing this? Any help would be great, I can post examples if I have not made myself clear. Bump, any ideas? I was going to put this in the advanced sub-forum, but thought otherwise.. was I wrong? Unfortunately your question is not as easy to answer as anyone would like it to be... You can start by Googling Java key words like: That should give you a good head start... If all your components are in one class, then each component should have an instance field. If the panels are in separate classes, then treat the panels as objects and provide appropriate methods to modify their contents. Look at the Sun Java Tutorial on Swing, about halfway down the main page. BTW, learn about the EventQueue and the event dispatcher thread.
<urn:uuid:5c9f91df-37ba-4e90-81e5-9171182f8c7e>
CC-MAIN-2016-44
http://www.java-forums.org/new-java/18750-gui-programming-help-print.html
s3://commoncrawl/crawl-data/CC-MAIN-2016-44/segments/1476988720380.80/warc/CC-MAIN-20161020183840-00054-ip-10-171-6-4.ec2.internal.warc.gz
en
0.931267
364
2.1875
2