source
stringlengths 32
209
| text
stringlengths 18
1.5k
|
|---|---|
https://en.wikipedia.org/wiki/Parker%E2%80%93Sochacki%20method
|
In mathematics, the Parker–Sochacki method is an algorithm for solving systems of ordinary differential equations (ODEs), developed by G. Edgar Parker and James Sochacki, of the James Madison University Mathematics Department. The method produces Maclaurin series solutions to systems of differential equations, with the coefficients in either algebraic or numerical form.
Summary
The Parker–Sochacki method rests on two simple observations:
If a set of ODEs has a particular form, then the Picard method can be used to find their solution in the form of a power series.
If the ODEs do not have the required form, it is nearly always possible to find an expanded set of equations that do have the required form, such that a subset of the solution is a solution of the original ODEs.
Several coefficients of the power series are calculated in turn, a time step is chosen, the series is evaluated at that time, and the process repeats.
The end result is a high order piecewise solution to the original ODE problem. The order of the solution desired is an adjustable variable in the program that can change between steps. The order of the solution is only limited by the floating point representation on the machine running the program. And in some cases can be either extended by using arbitrary precision floating point numbers, or for special cases by finding solution with only integer or rational coefficients.
Advantages
The method requires only addition, subtraction, and multiplicatio
|
https://en.wikipedia.org/wiki/Prokhorov%27s%20theorem
|
In measure theory Prokhorov's theorem relates tightness of measures to relative compactness (and hence weak convergence) in the space of probability measures. It is credited to the Soviet mathematician Yuri Vasilyevich Prokhorov, who considered probability measures on complete separable metric spaces. The term "Prokhorov’s theorem" is also applied to later generalizations to either the direct or the inverse statements.
Statement
Let be a separable metric space.
Let denote the collection of all probability measures defined on (with its Borel σ-algebra).
Theorem.
A collection of probability measures is tight if and only if the closure of is sequentially compact in the space equipped with the topology of weak convergence.
The space with the topology of weak convergence is metrizable.
Suppose that in addition, is a complete metric space (so that is a Polish space). There is a complete metric on equivalent to the topology of weak convergence; moreover, is tight if and only if the closure of in is compact.
Corollaries
For Euclidean spaces we have that:
If is a tight sequence in (the collection of probability measures on -dimensional Euclidean space), then there exist a subsequence and a probability measure such that converges weakly to .
If is a tight sequence in such that every weakly convergent subsequence has the same limit , then the sequence converges weakly to .
Extension
Prokhorov's theorem can be extended to consider complex me
|
https://en.wikipedia.org/wiki/Braithwaite%20%28surname%29
|
Braithwaite, Brathwaite, or Brathwait is an English surname of Old Norse origin. At the time of the British Census of 1881, the relative frequency of the surname Braithwaite was highest in Westmorland (37.3 times the British average), followed by Cumberland, Yorkshire, Linlithgowshire, Lancashire, County Durham, Nottinghamshire, Leicestershire, Anglesey and Flintshire. Notable people with the surname include:
Sir Albert Braithwaite (1893–1959), British politician
Althea Braithwaite (1940–2020), English children's author, illustrator, publisher and glass artist
Anna Braithwaite (1788–1859), English Quaker minister
Bob Braithwaite (1925–2015), British trap shooter
Brenda Brathwaite (born 1966), American video game designer and developer
Carlos Brathwaite (born 1988), Barbadian cricketer
Charles Braithwaite (1850–1910), Canadian politician and agrarian leader
Chris Braithwaite aka Chris Jones (1885–1944), Barbadian seaman, leader of the Colonial Seamen's Association
Darren Braithwaite (born 1969), British sprinter
Daryl Braithwaite (born 1949), Australian pop singer
Diana Braithwaite, Canadian singer-songwriter
Donald Braithwaite (1936–2017), Welsh boxer
Doug Braithwaite British comic book artist
Edward Kamau Brathwaite (1930–2020), Barbadian poet
E. R. Braithwaite (1912–2016), Guyanese novelist, writer, teacher, and diplomat
Errol Brathwaite (1924–2005), New Zealand author
Fred Brathwaite (born 1972), Canadian ice hockey player
George Braithwaite (disambiguation)
Gregory Brat
|
https://en.wikipedia.org/wiki/International%20Conference%20on%20Rewriting%20Techniques%20and%20Applications
|
Rewriting Techniques and Applications (RTA) is an annual international academic conference on the topic of rewriting. It covers all aspects of rewriting, including termination, equational reasoning, theorem proving, higher-order rewriting, unification and the lambda calculus. The conference consists of peer-reviewed papers with the proceedings published by Springer in the LNCS series until 2009, and since then in the LIPIcs series published by the Leibniz-Zentrum für Informatik. Several rewriting-related workshops are also affiliated with RTA.
The first RTA was held in Dijon, France in September 1983. RTA took part in the federated conferences Federated Logic Conference (FLoC) and Rewriting, Deduction, and Programming (RDP). In 2016, RTA merged with the International Conference on Typed Lambda Calculi and Applications to form the International Conference on
Formal Structures for Computation and Deduction (FSCD).
External links
Official website
List of the 26 RTA conferences, 1985-2015
List of the six FSCD conferences, 2016-2021
Rewriting Techniques and Applications
International Conference on Formal Structures for Computation and Deduction
Theoretical computer science conferences
Logic conferences
|
https://en.wikipedia.org/wiki/The%20Less%20Deceived
|
The Less Deceived, first published in 1955, was Philip Larkin's first mature collection of poetry, having been preceded by the derivative North Ship (1945) from The Fortune Press and a privately printed collection, a small pamphlet titled XX Poems, which Larkin mailed to literary critics and authors. Larkin was unaware that postal rates had gone up, and most recipients, when asked to pay the difference for delivery of a pamphlet by a little-known writer, turned them away; only around 100 copies were printed.
Despite this setback, 13 of the 20 poems, together with 16 new poems, were finally published to much acclaim in 1955 as The Less Deceived, which was selected as a book of the year by the Times Literary Supplement and immediately went through several impressions. Put out by The Marvell Press, a small operation run by George Hartley and his wife Jean Hartley in Hessle, East Yorkshire, the book through the depth of its appeal, the formal skill of its verse, and its consistent striking of Larkin's distinctive tone gained wide readership. By the end of 1955 The Less Deceived was recognized as one of the outstanding collections of the year.
History
The first poem in it, chronologically, to be written was "Going," of February 1946. It is about death, and, according to Andrew Motion, is the kind of poem for which Larkin "is so often regarded as an unrelievedly pessimistic poet" Its concluding lines, "What is under my hands, / That I cannot feel? / What loads my hands down?", p
|
https://en.wikipedia.org/wiki/Outline%20of%20calculus
|
Calculus is a branch of mathematics focused on limits, functions, derivatives, integrals, and infinite series. This subject constitutes a major part of contemporary mathematics education. Calculus has widespread applications in science, economics, and engineering and can solve many problems for which algebra alone is insufficient.
Branches of calculus
Differential calculus
Integral calculus
Multivariable calculus
Fractional calculus
Differential Geometry
History of calculus
History of calculus
Important publications in calculus
General calculus concepts
Continuous function
Derivative
Fundamental theorem of calculus
Integral
Limit
Non-standard analysis
Partial derivative
Infinite Series
Calculus scholars
Sir Isaac Newton
Gottfried Leibniz
Calculus lists
List of calculus topics
See also
Glossary of calculus
Table of mathematical symbols
References
External links
Calculus Made Easy (1914) by Silvanus P. Thompson Full text in PDF
Calculus.org: The Calculus page at University of California, Davis – contains resources and links to other sites
COW: Calculus on the Web at Temple University - contains resources ranging from pre-calculus and associated algebra
Online Integrator (WebMathematica) from Wolfram Research
The Role of Calculus in College Mathematics from ERICDigests.org
OpenCourseWare Calculus from the Massachusetts Institute of Technology
Infinitesimal Calculus – an article on its historical development, in Encyclopaedia of Mathemat
|
https://en.wikipedia.org/wiki/AMT%20Skipper
|
The AMT Skipper was a stainless steel copy of the .45 ACP Colt Combat Commander made by Arcadia Machine and Tool.
Statistics
SKIPPER
Chambering: .45 ACP., .40 S&W
Barrel Length: 4 inches.
Overall Length: 7.5 inches.
Weight: ?
Magazine: 6-round single-column box magazine.
Sights: Adjustable for windage and elevation
Finish:
Furniture:Plastic
Features: Adjustable Trigger & Sights
Production: 1978-79 (Very limited ) Manufactured in El Monte, CA.
COMBAT SKIPPER
Chambering: .45 ACP, .40 S&W
Barrel Length: 4.5 inches
Overall Length: 8 inches
Weight: 32 ounces
Magazine: 6-round single-stack magazine
Sights: Adjustable
Finish: Stainless Steel
Stocks: Plastic or Redwood
Production: 1978-79 ( Very Limited ) Manufactured in El Monte, CA.
See AMT Hardballer for additional info
External links
AMT Skipper Owners Manual
AMT semi-automatic pistols
.45 ACP semi-automatic pistols
Semi-automatic pistols of the United States
|
https://en.wikipedia.org/wiki/Cisterna%20d%27Asti
|
Cisterna d'Asti is a comune (municipality) in the Province of Asti in the Italian region Piedmont, located about southeast of Turin and about southwest of Asti. On 31 December 2004, it had a population of 1,257 and an area of .
Cisterna d'Asti borders the following municipalities: Canale, Ferrere, Montà, and San Damiano d'Asti.
Demographic evolution
References
Cities and towns in Piedmont
Roero
|
https://en.wikipedia.org/wiki/Social%20media%20optimization
|
Social media optimization (SMO) is the use of a number of outlets and communities to generate publicity to increase the awareness of a product, service brand or event. Types of social media involved include RSS feeds, social news, bookmarking sites, and social networking sites such as Facebook, Instagram, Twitter, video sharing websites, and blogging sites. SMO is similar to search engine optimization (SEO) in that the goal is to generate web traffic and increase awareness for a website. SMO's focal point is on gaining organic links to social media content. In contrast, SEO's core is about reaching the top of the search engine hierarchy. In general, social media optimization refers to optimizing a website and its content to encourage more users to use and share links to the website across social media and networking sites.
SMO is used to strategically create online content ranging from well-written text to eye-catching digital photos or video clips that encourages and entices people to engage with a website. Users share this content, via its weblink, with social media contacts and friends. Common examples of social media engagement are "liking and commenting on posts, retweeting, embedding, sharing, and promoting content". Social media optimization is also an effective way of implementing online reputation management (ORM), meaning that if someone posts bad reviews of a business, an SMO strategy can ensure that the negative feedback is not the first link to come up in a lis
|
https://en.wikipedia.org/wiki/Paderna
|
Paderna is a comune (municipality) in the Province of Alessandria in the Italian region Piedmont, located about southeast of Turin and about southeast of Alessandria.
Paderna borders the following municipalities: Carezzano, Costa Vescovato, Spineto Scrivia, Tortona, and Villaromagnano.
References
Cities and towns in Piedmont
|
https://en.wikipedia.org/wiki/Curonian%20Spit%20National%20Park%20%28Lithuania%29
|
Kuršių Nerija National Park is one of the five national parks in Lithuania. It was established in 1991 to protect the unique ecosystems of the Curonian Spit and Curonian Lagoon.
Kuršių Nerija National Park is protected by the state, under the Lithuanian law of Protected Areas. Since 1997 it is a member of EUROPARC Federation. The Park has Category II in the classification of the IUCN.
Nagliai nature reserve
Nagliai nature reserve protects the Dead dunes. Dead (Mirusios), or Gray (Pilkosios) dunes are large sand hills built by strong winds, with ravines and erosions. Nagliai nature reserve is a place for habitats of rare plants, included in the Red Book, four villages and two old cemetery sites that are hiding under the sand. Any human activity is prohibited in the reserve except for scientific observations. The cognitive trail of Nagliai is the only place from which you can explore the reserve's objects.
In 1675–1854 four Nagliai villages here were covered in sand.
See also
List of national parks in the Baltics
Curonian Spit National Park (Russia)
Parnidis Dune
References
External links
Official Web page of the Park
The Trail of Nagliai Nature Reserve
National parks of Lithuania
Protected areas established in 1991
1991 establishments in Lithuania
Tourist attractions in Klaipėda County
|
https://en.wikipedia.org/wiki/Ham-Nord
|
Ham-Nord, Quebec is a township municipality in the Centre-du-Québec region of Quebec, Canada.
Demographics
In the 2021 Census of Population conducted by Statistics Canada, Ham-Nord had a population of living in of its total private dwellings, a change of from its 2016 population of . With a land area of , it had a population density of in 2021.
References
(Google Maps)
External links
Township municipalities in Quebec
Incorporated places in Centre-du-Québec
|
https://en.wikipedia.org/wiki/Molecular-weight%20size%20marker
|
A molecular-weight size marker, also referred to as a protein ladder, DNA ladder, or RNA ladder, is a set of standards that are used to identify the approximate size of a molecule run on a gel during electrophoresis, using the principle that molecular weight is inversely proportional to migration rate through a gel matrix. Therefore, when used in gel electrophoresis, markers effectively provide a logarithmic scale by which to estimate the size of the other fragments (providing the fragment sizes of the marker are known).
Protein, DNA, and RNA markers with pre-determined fragment sizes and concentrations are commercially available. These can be run in either agarose or polyacrylamide gels. The markers are loaded in lanes adjacent to sample lanes before the commencement of the run.
DNA markers
Development
Although the concept of molecular-weight markers has been retained, techniques of development have varied throughout the years. New inventions of molecular-weight markers are distributed in kits specific to the marker's type.
An early problem in the development of markers was achieving high resolution throughout the entire length of the marker. Depending on the running conditions of gel electrophoresis, fragments may have been compressed, disrupting clarity. To address this issue, a kit for Southern Blot analysis was developed in 1990, providing the first marker to combine target DNA and probe DNA. This technique took advantage of logarithmic spacing, and could be used to
|
https://en.wikipedia.org/wiki/T7%20RNA%20polymerase
|
T7 RNA Polymerase is an RNA polymerase from the T7 bacteriophage that catalyzes the formation of RNA from DNA in the 5'→ 3' direction.
Activity
T7 polymerase is extremely promoter-specific and transcribes only DNA downstream of a T7 promoter. The T7 polymerase also requires a double stranded DNA template and Mg2+ ion as cofactor for the synthesis of RNA. It has a very low error rate. T7 polymerase has a molecular weight of 99 kDa.
Promoter
The promoter is recognized for binding and initiation of the transcription. The consensus in T7 and related phages is:
5' * 3'
T7 TAATACGACTCACTATAGGGAGA
T3 AATTAACCCTCACTAAAGGGAGA
K11 AATTAGGGCACACTATAGGGAGA
SP6 ATTTACGACACACTATAGAAGAA
bind------------
-----------init
Transcription begins at the asterisk-marked guanine.
Structure
T7 polymerase has been crystallised in several forms and the structures placed in the PDB. These explain how T7 polymerase binds to DNA and transcribes it. The N-terminal domain moves around as the elongation complex forms. The ssRNAP holds a DNA-RNA hybrid of 8bp. A beta-hairpin specificity loop (residues 739-770 in T7) recognizes the promoter; swapping it out for one found in T3 RNAP makes the polymerase recognize T3 promoters instead.
Similar to other viral nucleic acid polymerases, including T7 DNA polymerase from the same phage, the conserved C-terminal of T7 ssRNAP employs a fold whose organization has been likened to the shape of a right hand
|
https://en.wikipedia.org/wiki/Born%20Too%20Slow
|
"Born Too Slow" is the first single released from The Crystal Method's third studio album, Legion of Boom. The song features the vocals of Kyuss lead singer John Garcia and guitar by Limp Bizkit's Wes Borland. The song was first featured on EA's Need for Speed: Underground in 2003, with the single being released later that year. The song has also been featured in Gran Turismo 4 and Donkey Konga 2. In 2006, it was featured in the movie Annapolis. It is also in the drama The O.C.
Music video
The music video was directed by Gore Verbinski, director of such films as The Mexican, The Ring, and the Pirates of the Caribbean series. Mr. Verbinski liked the song so much, he asked The Crystal Method if he could direct the video for it. Wes Borland makes a cameo appearance as a man using a pay phone. Fitness expert Billy Blanks Jr. starred in the video as the silver man. Scott Kirkland and Ken Jordan also cameo as the two men in line after the silver man gets his drink.
Track listing
CD
(Released December 9, 2003)
Erick Morillo Main Mix (7:03)
Erick Morillo Dub Mix (7:03)
Deepsky's Green Absinthe Dub Mix (8:12)
NuBreed Remix (6:58)
EK's Spider in the Corner Alt. Dub Mix (6:11)
Vinyl 12"
(Released November 25, 2003)
Erick Morillo Main Mix (7:03)
Erick Morillo Dub Mix (7:03)
Vinyl 12" (Remixes)
(Released December 9, 2003)
Deepsky's Green Absinthe Dub Mix (8:12)
NuBreed Remix (6:58)
EK's Spider in the Corner Alt. Dub Mix (6:11)
2003 singles
The Crystal Method songs
2003 songs
Song
|
https://en.wikipedia.org/wiki/CD3%20%28immunology%29
|
CD3 (cluster of differentiation 3) is a protein complex and T cell co-receptor that is involved in activating both the cytotoxic T cell (CD8+ naive T cells) and T helper cells (CD4+ naive T cells). It is composed of four distinct chains. In mammals, the complex contains a CD3γ chain, a CD3δ chain, and two CD3ε chains. These chains associate with the T-cell receptor (TCR) and the CD3-zeta (ζ-chain) to generate an activation signal in T lymphocytes. The TCR, CD3-zeta, and the other CD3 molecules together constitute the TCR complex.
Structure
The CD3γ, CD3δ, and CD3ε chains are highly related cell-surface proteins of the immunoglobulin superfamily containing a single extracellular immunoglobulin domain.
A structure of the extracellular and transmembrane regions of the CD3γε/CD3δε/CD3ζζ/TCRαβ complex was solved with CryoEM, showing for the first time how the CD3 transmembrane regions enclose the TCR transmembrane regions in an open barrel.
Containing aspartate residues, the transmembrane region of the CD3 chains is negatively charged, a characteristic that allows these chains to associate with the positively charged TCR chains.
The intracellular tails of the CD3γ, CD3ε, and CD3δ molecules each contain a single conserved motif known as an immunoreceptor tyrosine-based activation motif, or ITAM for short, which is essential for the signaling capacity of the TCR. The intracellular tail of CD3ζ contains 3 ITAM motifs.
Regulation
Phosphorylation of the ITAM on CD3 renders the CD3
|
https://en.wikipedia.org/wiki/Name%20of%20the%20Game%20%28The%20Crystal%20Method%20song%29
|
"Name of the Game" is the first single from The Crystal Method's second studio album, Tweekend. Despite the popularity of the song, The Crystal Method almost never play it live. The track features guitars by Tom Morello, vocals by Ryan "Ryu" Maginn, and scratching by DJ Swamp; it also contains samples from "Calling All Freaks" (1974) by Tina Dixon. The song enjoyed mainstream success as well as remixes by popular artists.
Music video
The music video for the song (directed by Marcos Siega) features the exploits of the character Nosey, who is named so because his entire face is covered up by a giant nose. Scenes in the video depict Nosey participating in sports, breakdancing, and a relationship that falls apart quickly. He gets back to his friends to breakdance and they get to do some until the police arrive and arrest him for unknown reasons. At the end of the video, the words "to be continued ..." are shown. However, no known continuation of the "Nosey" story has yet to be produced.
Track listing
CD
Radio Edit
Album Version
Instrumental
Vinyl
Eric Kupper's Deep Pump Mix
Hybrid's Blackout In L.A. Mix
Vinyl promo
Eric Kupper's Electrosphere Mix
Hybrid's L.A. Blackout Mix
In popular culture
To date, the song has been featured in numerous different forms of media, including:
Used in the 2001 Malcolm in the Middle episode "Charity"
Used in the soundtrack for the film adaptation Resident Evil
Used in one of the climactic scenes in the 2002 film Blade II and its 2004 sequel
|
https://en.wikipedia.org/wiki/Comin%27%20Back
|
"Comin' Back" is a song by American electronic music duo The Crystal Method, featuring American vocalist Trixie Reiss. It was released on July 27, 1998, as the fourth and final single from their debut studio album Vegas. It is their most successful release, reaching number one on the Billboard US Dance Club Chart in 1998.
The song also reached number 73 on the UK Singles Chart, and number 38 on the Billboard Dance/Electronic Songs chart.
Music video
A music video for "Comin' Back" was released in 1998. It was digitally rereleased on their website on January 10, 2007, on their YouTube channel on 25 September 2007, and on their Vevo channel on 16 June 2009.
The video was directed by Peter Christopherson and features The Crystal Method members Scott Kirkland and Ken Jordan riding a cross-country high speed express train across the US.
Track listing
Charts
References
1997 singles
1997 songs
Breakbeat songs
The Crystal Method songs
S2 Records singles
|
https://en.wikipedia.org/wiki/%28Can%27t%20You%29%20Trip%20Like%20I%20Do
|
"(Can't You) Trip Like I Do" is a reworking of "Trip Like I Do", a song featured on The Crystal Method's debut album Vegas. The track was recorded for the 1997 film adaptation of the Spawn comic book series. The song was co-written by Richard Patrick and co-produced by Brian Liesegang, both from Filter who also appeared in the song's video. "(Can't You) Trip Like I Do" is the opening song on the film's soundtrack release, Spawn: The Album and is heard in the end credits. The song was also used for the theatrical trailer of The Matrix and promotional trailers for the Enter the Matrix video game but it does not appear in the film or on the soundtrack.
Inspiration for the song came from a friend of Scott Kirkland who was using ecstasy and leaving voice mail messages telling him "I wish you could trip like I do."
Track listing
"(Can't You) Trip Like I Do" (album version) – 4:25
"(Can't You) Trip Like I Do" (Danny Saber Remix) – 3:39
"(Can't You) Trip Like I Do" (instrumental) – 4:25
"(Can't You) Trip Like I Do" – 7:35
Credits
Tracks 1–3 written, recorded and produced by The Crystal Method and Filter
Mixed by Ben Grosse
Track 1 executive producer: Richard Bishop for 3 A.M.
Track 2 remix and additional production by Danny Saber
Track 4 written by K. Jordan/S. Kirkland; produced and mixed by The Crystal Method
Chart positions
References
1997 singles
1997 songs
Epic Records singles
Filter (band) songs
Music videos directed by Floria Sigismondi
The Crystal Method songs
|
https://en.wikipedia.org/wiki/Lorna%20Raver
|
Lorna Raver is an American retired actress who has appeared in numerous plays, films, and television series. She is sometimes credited as Lorna Raver Johnson.
Life and career
Raver was born in York, Pennsylvania, and was raised in a Pennsylvania Dutch environment. She had early experience performing at the Hedgerow Theater in Pennsylvania. She moved to New York City, appearing off-Broadway in the premieres of Last Days at the Dixie Girl Cafe and Between Daylight and Boonville. She then spent several years as a stage actress in Chicago and regionally before moving to Los Angeles, where she had many guest roles on TV and continued to work in live theater, including performances of The Seagull, Spinning into Butter, The Women, The American Plan, Oedipus Rex, and The Drama Coach, for which she won the Drama-Logue and LA Weekly awards. She also performs in radio drama.On September 19, 2006, she began appearing as Rebecca Kaplan on CBS's The Young and the Restless. She won critical acclaim as Mrs. Ganush in Sam Raimi's Drag Me to Hell'' (2009). In addition to numerous other stage and television appearances, she is a notable audiobook narrator for Tantor, Books on Tape, and Blackstone Audio. Raver retired from acting in 2014.
Filmography
Film
References
External links
American film actresses
American soap opera actresses
American television actresses
Living people
People from York, Pennsylvania
American radio actresses
Actresses from Pennsylvania
21st-century American actre
|
https://en.wikipedia.org/wiki/Flying%20Tiger%2010%20M
|
The Flying Tiger 10 M is a Chinese trailerable sailboat that was designed by American Robert Perry as a one design racer and first built in 2005.
A smaller and lighter derivative is the Perry-designed Flying Tiger 7.5.
Production
The design was built by Hansheng Yachtbuilding in Xiamen, China, starting in 2005, with 110 boats completed, but it is now out of production.
Early production was marred by quality control issues, but these were later resolved with modifications and production line updates.
Design
The boat's concept was created by Bill Steven, an American racing sailor and boatbuilder from the west coast, who had boats built in China in the past. He commissioned Perry to do a preliminary design for a simple and inexpensive sportboat that would fit in a shipping container. Perry's design was then circulated though sailing internet forums for feedback and then orders. The concept was well received and Steven was able to collect 50 US$1000 deposits and that enabled production to begin in China.
It was specifically designed to be ground transported on a boat trailer and therefore uses a lifting keel, an easily removable rudder and carbon fiber spars for lightness.
The Flying Tiger 10 M is a racing keelboat, built predominantly of vinylester resin fiberglass over a foam core. It has a fractional sloop rig, with a deck-stepped mast, two sets of swept spreaders and carbon fiber spars. The hull has a plumb stem with a retractable bowsprit, a slightly reverse transom,
|
https://en.wikipedia.org/wiki/Lev%C3%A1re
|
Levare () is a village and municipality in Revúca District in the Banská Bystrica Region of Slovakia.
External links
https://web.archive.org/web/20061230185723/http://www.statistics.sk/mosmis/eng/run.html
Villages and municipalities in Revúca District
|
https://en.wikipedia.org/wiki/Polina%2C%20Rev%C3%BAca%20District
|
Polina () is a hamlet in the Revúca District, Banská Bystrica Region, Slovakia.
External links
https://web.archive.org/web/20071027094149/http://www.statistics.sk/mosmis/eng/run.html
Villages and municipalities in Revúca District
|
https://en.wikipedia.org/wiki/John%20Panaretos
|
John Panaretos (; born 1948 in Kythera) is a Greek educator and statistician. He is Professor of Probability and Statistics at the Athens University of Economics and Business. He was Deputy Minister of Education, Lifelong Learning and Religious Affairs (6 October 2009 – 17 June 2011). He has also been appointed by the Prime Minister to be in charge of the Open Government project.
Education and career
Before joining the Athens University of Economics and Business, he taught at the universities of Patras and Crete in Greece, University of Iowa and University of Missouri in the United States, and at Trinity College, Dublin in Ireland.
He has been Director of the Institute of Statistical Documentation Research and Analysis since 1996, a life member of the Scientific Council of the Greek Parliament since 1987, and a member of the governing board of the Institute of Strategic and Development Studies (ISTAME) - Andreas Papandreou (2005–2008). Since 2004, he is the education adviser of George Papandreou, leader of Panhellenic Socialist Movement (PASOK, the main opposition party of Greece) and the Socialist International. He was a member of the National Council of Education, the Council of University Education, the Council of Technical Education and the Council of Primary and Secondary Education.
He has acted as Chairman of the Department of Statistics (1993–1996 & 2000-2002) and as member of the research committee of the University (1993–1996). At the University of Patras, he ser
|
https://en.wikipedia.org/wiki/Gaussian%20measure
|
In mathematics, Gaussian measure is a Borel measure on finite-dimensional Euclidean space Rn, closely related to the normal distribution in statistics. There is also a generalization to infinite-dimensional spaces. Gaussian measures are named after the German mathematician Carl Friedrich Gauss. One reason why Gaussian measures are so ubiquitous in probability theory is the central limit theorem. Loosely speaking, it states that if a random variable X is obtained by summing a large number N of independent random variables of order 1, then X is of order and its law is approximately Gaussian.
Definitions
Let n ∈ N and let B0(Rn) denote the completion of the Borel σ-algebra on Rn. Let λn : B0(Rn) → [0, +∞] denote the usual n-dimensional Lebesgue measure. Then the standard Gaussian measure γn : B0(Rn) → [0, 1] is defined by
for any measurable set A ∈ B0(Rn). In terms of the Radon–Nikodym derivative,
More generally, the Gaussian measure with mean μ ∈ Rn and variance σ2 > 0 is given by
Gaussian measures with mean μ = 0 are known as centred Gaussian measures.
The Dirac measure δμ is the weak limit of as σ → 0, and is considered to be a degenerate Gaussian measure; in contrast, Gaussian measures with finite, non-zero variance are called non-degenerate Gaussian measures.
Properties
The standard Gaussian measure γn on Rn
is a Borel measure (in fact, as remarked above, it is defined on the completion of the Borel sigma algebra, which is a finer structure);
is equivalent to Lebe
|
https://en.wikipedia.org/wiki/Cameron%E2%80%93Martin%20theorem
|
In mathematics, the Cameron–Martin theorem or Cameron–Martin formula (named after Robert Horton Cameron and W. T. Martin) is a theorem of measure theory that describes how abstract Wiener measure changes under translation by certain elements of the Cameron–Martin Hilbert space.
Motivation
The standard Gaussian measure on -dimensional Euclidean space is not translation-invariant. (In fact, there is a unique translation invariant Radon measure up to scale by Haar's theorem: the -dimensional Lebesgue measure, denoted here .) Instead, a measurable subset has Gaussian measure
Here refers to the standard Euclidean dot product in . The Gaussian measure of the translation of by a vector is
So under translation through , the Gaussian measure scales by the distribution function appearing in the last display:
The measure that associates to the set the number is the pushforward measure, denoted . Here refers to the translation map: . The above calculation shows that the Radon–Nikodym derivative of the pushforward measure with respect to the original Gaussian measure is given by
The abstract Wiener measure on a separable Banach space , where is an abstract Wiener space, is also a "Gaussian measure" in a suitable sense. How does it change under translation? It turns out that a similar formula to the one above holds if we consider only translations by elements of the dense subspace .
Statement of the theorem
Let be an abstract Wiener space with abstract Wiener measu
|
https://en.wikipedia.org/wiki/Masoud%20Zarei
|
Masoud Zarei (, born August 25, 1981, in Tehran, Iran) is an Iranian footballer, currently a member of the IPL club Mes Kerman.
Club career
Club career Statistics
Last Update 16 December 2009
Assist Goals
Honours
Azadegan League
Winner: 1
2003/04 with Saba Battery
Hazfi Cup
Winner: 1
2005 with Saba Battery
Iran's Premier Football League
Winner: 1
2007/08 with Persepolis
External links
1981 births
Living people
Saba Qom F.C. players
Iranian men's footballers
Persepolis F.C. players
Sanat Mes Kerman F.C. players
Men's association football defenders
Footballers from Tehran
Persepolis F.C. non-playing staff
|
https://en.wikipedia.org/wiki/Ebrahim%20Asadi
|
Ebrahim Asadi (, born June 8, 1979) is a retired Iranian footballer who played for Persepolis.
Club career
Club Career Statistics
Last Update 18 September 2010
Assist Goals
Honours
Club
Persepolis
Iranian Football League (2) : 1999–2000, 2001–02
References
External links
Persian League Profile
1979 births
Living people
Zob Ahan Esfahan F.C. players
Steel Azin F.C. players
F.C. Nassaji Mazandaran players
Iranian men's footballers
Persepolis F.C. players
Men's association football midfielders
Footballers from Tehran
|
https://en.wikipedia.org/wiki/Motorsport.tv
|
Motorsport.tv is a global streaming OTT platform specialized in motor racing and motoring content, live and on demand launched in September 2018. It is a fully integrated video ecosystem developed and operated by Motorsport Network to specifically cater to different motor racing and automotive audiences.
Motorsport.tv distributes globally over many different digital platforms. It offers both subscription content (SVOD) under the label Motorsport.tv Premium, and free to view ad-supported content (AVOD). As of 2023, Motorsport.tv contains 14,000+ hours long and short form on demand videos 35,000+ video titles available online and livestream more than 1,200 events yearly.
History
In November 2016, Motorsport Network had acquired Motors TV. On 1 March 2017, Motors TV was rebranded to become Motorsport.tv. On that same day, the HD version of the channel was launched.
In September 2018 it became clear that the Motorsport.tv linear channel would close on 30 September 2018 in both SD and HD versions. From that date, the service switched to online-streaming only. In September 2018, Motorsport.tv launched its version 1 on the web, as a subscription OTT service only, with 800 hours of VOD content and 12 racing series live. It started its partnership with the Automobile Club de l'Ouest to stream the full archive of the famed 24 Hours of Le Mans.
October 2018, it launched its version 1 on mobile devices with both iOS and Android applications. In January 2019, it presented its first
|
https://en.wikipedia.org/wiki/Smallest%20organisms
|
The smallest organisms found on Earth can be determined according to various aspects of organism size, including volume, mass, height, length, or genome size.
Given the incomplete nature of scientific knowledge, it is possible that the smallest organism is undiscovered. Furthermore, there is some debate over the definition of life, and what entities qualify as organisms; consequently the smallest known organism (microorganism) is debatable.
Microorganisms
Obligate endosymbiotic bacteria
The genome of Nasuia deltocephalinicola, a symbiont of the European pest leafhopper, Macrosteles quadripunctulatus, consists of a circular chromosome of 112,031 base pairs.
The genome of Nanoarchaeum equitans is 491 Kbp nucleotides long.
Pelagibacter ubique
Pelagibacter ubique is one of the smallest known free-living bacteria, with a length of and an average cell diameter of . They also have the smallest free-living bacterium genome: 1.3 Mbp, 1354 protein genes, 35 RNA genes. They are one of the most common and smallest organisms in the ocean, with their total weight exceeding that of all fish in the sea.
Mycoplasma genitalium
Mycoplasma genitalium, a parasitic bacterium which lives in the primate bladder, waste disposal organs, genital, and respiratory tracts, is thought to be the smallest known organism capable of independent growth and reproduction. With a size of approximately 200 to 300 nm, M. genitalium is an ultramicrobacterium, smaller than other small bacteria, including ri
|
https://en.wikipedia.org/wiki/%C4%8Cierna%20Lehota%2C%20B%C3%A1novce%20nad%20Bebravou%20District
|
Čierna Lehota () is a village and municipality in the Bánovce nad Bebravou District of the Trenčín Region of Slovakia.
Genealogical resources
The records for genealogical research are available at the state archive "Statny Archiv in Nitra, Slovakia"
Roman Catholic church records (births/marriages/deaths): 1744-1942 (parish B)
Lutheran church records (births/marriages/deaths): 1732-1935 (parish B)
See also
List of municipalities and towns in Slovakia
References
External links
Official page
Surnames of living people in Cierna Lehota
Villages and municipalities in Bánovce nad Bebravou District
|
https://en.wikipedia.org/wiki/Human%20evolutionary%20genetics
|
Human evolutionary genetics studies how one human genome differs from another human genome, the evolutionary past that gave rise to the human genome, and its current effects. Differences between genomes have anthropological, medical, historical and forensic implications and applications. Genetic data can provide important insights into human evolution.
Origin of apes
Biologists classify humans, along with only a few other species, as great apes (species in the family Hominidae). The living Hominidae include two distinct species of chimpanzee (the bonobo, Pan paniscus, and the chimpanzee, Pan troglodytes), two species of gorilla (the western gorilla, Gorilla gorilla, and the eastern gorilla, Gorilla graueri), and two species of orangutan (the Bornean orangutan, Pongo pygmaeus, and the Sumatran orangutan, Pongo abelii). The great apes with the family Hylobatidae of gibbons form the superfamily Hominoidea of apes.
Apes, in turn, belong to the primate order (>400 species), along with the Old World monkeys, the New World monkeys, and others. Data from both mitochondrial DNA (mtDNA) and nuclear DNA (nDNA) indicate that primates belong to the group of Euarchontoglires, together with Rodentia, Lagomorpha, Dermoptera, and Scandentia. This is further supported by Alu-like short interspersed nuclear elements (SINEs) which have been found only in members of the Euarchontoglires.
Phylogenetics
A phylogenetic tree is usually derived from DNA or protein sequences from populations. Often
|
https://en.wikipedia.org/wiki/External%20limiting%20membrane
|
The external limiting membrane (or outer limiting membrane) is one of the ten distinct layers of the retina of the eye. It has a network-like structure and is situated at the bases of the rods and cones.
Additional images
See also
Retina
External links
https://web.archive.org/web/20050313111150/http://www.med.uiuc.edu/histo/small/atlas/objects/126.htm
Slide at uc.edu
http://www.kumc.edu/instruction/medicine/anatomy/histoweb/eye_ear/eye12.htm
https://web.archive.org/web/20070518033845/http://education.vetmed.vt.edu/Curriculum/VM8054/EYE/RETINA.HTM
Human eye anatomy
|
https://en.wikipedia.org/wiki/Internal%20limiting%20membrane
|
The internal limiting membrane, or inner limiting membrane, is the boundary between the retina and the vitreous body, formed by astrocytes and the end feet of Müller cells. It is separated from the vitreous body by a basal lamina.
External links
Human eye anatomy
|
https://en.wikipedia.org/wiki/Outer%20plexiform%20layer
|
The outer plexiform layer (external plexiform layer) is a layer of neuronal synapses in the retina of the eye. It consists of a dense network of synapses between dendrites of horizontal cells from the inner nuclear layer, and photoreceptor cell inner segments from the outer nuclear layer. It is much thinner than the inner plexiform layer, where amacrine cells synapse with retinal ganglion cells.
The synapses in the outer plexiform layer are between the rod cell endings or cone cell branched foot plates and horizontal cells. Unlike in most systems, rod and cone cells release neurotransmitters when not receiving a light signal.
References
External links
Human eye anatomy
ca:Retina#Capes de la retina
|
https://en.wikipedia.org/wiki/Ganglion%20cell%20layer
|
In the anatomy of the eye, the ganglion cell layer (ganglionic layer) is a layer of the retina that consists of retinal ganglion cells and displaced amacrine cells.
The cells are somewhat flask-shaped; the rounded internal surface of each resting on the stratum opticum, and sending off an axon which is prolonged into it.
From the opposite end numerous dendrites extend into the inner plexiform layer, where they branch and form flattened arborizations at different levels.
The ganglion cells vary much in size, and the dendrites of the smaller ones as a rule arborize in the inner plexiform layer as soon as they enter it; while those of the larger cells ramify close to the inner nuclear layer.
References
External links
Human eye anatomy
|
https://en.wikipedia.org/wiki/Islet%20cell%20transplantation
|
Islet transplantation is the transplantation of isolated islets from a donor pancreas into another person. It is a treatment for type 1 diabetes. Once transplanted, the islets begin to produce insulin, actively regulating the level of glucose in the blood.
Islets are usually infused into the person's liver. If the cells are not from a genetically identical donor the person's body will recognize them as foreign and the immune system will begin to attack them as with any transplant rejection. To prevent this immunosuppressant drugs are used. A study from 2005 showed that islet transplantation has progressed to the point that 58% of the people were insulin independent one year after the operation. A review published 2016 reported a 50 – 70% rate of insulin independence after five years, in five studies from leading transplant centers published 2005 – 2012.
In the period from 1999 to 2004, 471 people with type 1 diabetes received islet transplants at 43 institutions worldwide.
Donislecel (Lantidra) allogeneic (donor) pancreatic islet cellular therapy was approved for medical use in the United States in June 2023.
History
The concept of islet transplantation is not new. Investigators as early as the English surgeon Charles Pybus (1882–1975) attempted to graft pancreatic tissue to cure diabetes. Most, however, credit the recent era of islet transplantation research to Paul Lacy's studies dating back more than three decades. In 1967, Lacy's group described a novel collagenase-b
|
https://en.wikipedia.org/wiki/PHOX2B
|
Paired-like homeobox 2b (PHOX2B), also known as neuroblastoma Phox (NBPhox), is a protein that in humans is encoded by the PHOX2B gene located on chromosome 4.
It codes for a homeodomain transcription factor. It is expressed exclusively in the nervous system, in most neurons that control the viscera (cardiovascular, digestive and respiratory systems). It is also required for their differentiation.
Immunohistochemistry
Essential for the differentiation and survival of sympathetic neurons and chromaffin cells, the transcription factor PHOX2B is highly specific for the peripheral autonomic nervous system. Neuroblasts are derived from sympathoadrenal lineage neural crest cells and therefore require and constitutively express PHOX2B. PHOX2B immunohistochemical staining, as a marker of neural crest derivation, has been shown to be sensitive and specific for undifferentiated neuroblastoma, enabling identification where other markers fail to recognize neuroblastoma among various different small round blue cell tumors of childhood.
The diagnostic utility of PHOX2B staining extends to later stages of differentiation. Its strength and specificity can detect the small foci of neuroblastic tumors metastatic to the bone marrow, an identification critical for determining disease staging. PHOX2B staining also overcomes frequent obstacles to neuroblastoma detection in post-treatment samples, which frequently exhibit dense fibrosis, prominent inflammatory infiltrates, and/or diffuse calcif
|
https://en.wikipedia.org/wiki/Lorna%20E.%20Lockwood
|
Lorna Elizabeth Lockwood (March 24, 1903 – September 23, 1977) was an American lawyer and judge who served as justice (and at times chief justice) of the Arizona Supreme Court.
Born in what was then Arizona Territory, Lockwood was the daughter of Alfred Collins Lockwood, who later served as chief justice of the Arizona Supreme Court. Lockwood attended the University of Arizona and the University of Arizona College of Law before entering private practice and serving several terms in the Arizona House of Representatives. Lockwood spent a decade on the bench of the Arizona Superior Court in Maricopa County, the first woman to serve in that role. In 1960, Lockwood was elected to the Arizona Supreme Court. She served as chief justice from 1965 to 1966 and 1970 to 1971, become the first female chief justice of a state supreme court in the United States. She retired from the court in 1975 and died two years later.
Early life and education
Lockwood was born on March 24, 1903, in Douglas, Arizona Territory, a mining town, to Daisy Maude Lincoln and Alfred Collins Lockwood.
Her father was an attorney and later chief justice of the Arizona Supreme Court. In 1913, the family moved to Tombstone and Lorna graduated from Tombstone High School in 1920.
Lockwood received her B.A. from the University of Arizona in Tucson in 1923, where she was a Spanish major, and earned her J.D. from the University of Arizona College of Law in 1925. Lockwood was the only woman in her law-school class and
|
https://en.wikipedia.org/wiki/R%C3%ADo%20Claro
|
Río Claro is a commune of the Talca Province in Chile's Maule Region. The municipal seat is the town of Cumpeo.
Demographics
According to the 2002 census of the National Statistics Institute, Río Claro spans an area of and has 12,698 inhabitants (6,716 men and 5,982 women). Of these, 2,651 (20.9%) lived in urban areas and 10,047 (79.1%) in rural areas. The population grew by 0.8% (107 persons) between the 1992 and 2002 censuses.
Administration
As a commune, Río Claro is a third-level administrative division of Chile administered by a municipal council, headed by an alcalde who is directly elected every four years. The 2008-2012 alcalde is Claudio Guajardo Oyarce.
Within the electoral divisions of Chile, Río Claro is represented in the Chamber of Deputies by Pablo Lorenzini (PDC) and Pedro Pablo Alvarez-Salamanca (UDI) as part of the 38th electoral district, together with Curepto, Constitución, Empedrado, Pencahue, Maule, San Clemente, Pelarco and San Rafael. The commune is represented in the Senate by Juan Antonio Coloma Correa (UDI) and Andrés Zaldívar Larraín (PDC) as part of the 10th senatorial constituency (Maule-North).
References
External links
Municipality of Río Claro
Communes of Chile
Populated places in Talca Province
|
https://en.wikipedia.org/wiki/Sagrada%20Familia%2C%20Chile
|
Sagrada Familia (Spanish meaning "Holy Family") is a Chilean town and commune in Curicó Province, Maule Region.
Demographics
According to the 2002 census of the National Statistics Institute, Sagrada Familia spans an area of and has 17,519 inhabitants (9,108 men and 8,411 women). Of these, 5,080 (29%) lived in urban areas and 12,439 (71%) in rural areas. The population grew by 3.7% (625 persons) between the 1992 and 2002 censuses.
Administration
As a commune, Sagrada Familia is a third-level administrative division of Chile administered by a municipal council, headed by an alcalde who is directly elected every four years. The 2008-2012 alcalde is Francisco Meléndez Rojas (PS).
Within the electoral divisions of Chile, Sagrada Familia is represented in the Chamber of Deputies by Roberto León (PDC) and Celso Morales (UDI) as part of the 36th electoral district, together with Curicó, Teno, Romeral, Molina, Hualañé, Licantén, Vichuquén and Rauco. The commune is represented in the Senate by Juan Antonio Coloma Correa (UDI) and Andrés Zaldívar Larraín (PDC) as part of the 10th senatorial constituency (Maule-North).
References
External links
Municipality of Sagrada Familia
Populated places in Curicó Province
Communes of Chile
|
https://en.wikipedia.org/wiki/Romeral
|
Romeral is a Chilean town and commune in Curicó Province, Maule Region. The commune spans and area of .
Demographics
According to the 2002 census of Population and Housing by the National Statistics Institute, the Romeral commune had 12,707 inhabitants; of these, 3,675 (28.9%) lived in urban areas and 9,032 (71.1%) in rural areas. At that time, there were 6,596 men and 6,111 women. The population grew by 10.6% (1,217 persons) between the 1992 and 2002 censuses.
Administration
As a commune, Romeral is a third-level administrative division of Chile administered by a municipal council, headed by an alcalde who is directly elected every four years. The 2008-2012 alcalde is Carlos Cisterna Negrete (PDC).
Within the electoral divisions of Chile, Romeral is represented in the Chamber of Deputies by Roberto León (PDC) and Celso Morales (UDI) as part of the 36th electoral district, together with Curicó, Teno, Molina, Sagrada Familia, Hualañé, Licantén, Vichuquén and Rauco. The commune is represented in the Senate by Juan Antonio Coloma Correa (UDI) and Andrés Zaldívar Larraín (PDC) as part of the 10th senatorial constituency (Maule-North).
References
Populated places in Curicó Province
Communes of Chile
|
https://en.wikipedia.org/wiki/Banach%E2%80%93Mazur%20theorem
|
In functional analysis, a field of mathematics, the Banach–Mazur theorem is a theorem roughly stating that most well-behaved normed spaces are subspaces of the space of continuous paths. It is named after Stefan Banach and Stanisław Mazur.
Statement
Every real, separable Banach space is isometrically isomorphic to a closed subspace of , the space of all continuous functions from the unit interval into the real line.
Comments
On the one hand, the Banach–Mazur theorem seems to tell us that the seemingly vast collection of all separable Banach spaces is not that vast or difficult to work with, since a separable Banach space is "only" a collection of continuous paths. On the other hand, the theorem tells us that is a "really big" space, big enough to contain every possible separable Banach space.
Non-separable Banach spaces cannot embed isometrically in the separable space , but for every Banach space , one can find a compact Hausdorff space and an isometric linear embedding of into the space of scalar continuous functions on . The simplest choice is to let be the unit ball of the continuous dual , equipped with the w*-topology. This unit ball is then compact by the Banach–Alaoglu theorem. The embedding is introduced by saying that for every , the continuous function on is defined by
The mapping is linear, and it is isometric by the Hahn–Banach theorem.
Another generalization was given by Kleiber and Pervin (1969): a metric space of density equal to an infinite c
|
https://en.wikipedia.org/wiki/San%20Rafael%2C%20Chile
|
San Rafael is a town and commune of the Talca Province in the Maule Region of Chile. The town serves as the communal capital.
Demographics
According to the 2002 census of the National Statistics Institute, San Rafael spans an area of and has 7,674 inhabitants (3,903 men and 3,771 women). Of these, 3,482 (45.4%) lived in urban areas and 4,192 (54.6%) in rural areas. The population grew by 6.5% (465 persons) between the 1992 and 2002 censuses.
Administration
As a commune, San Rafael is a third-level administrative division of Chile administered by a municipal council, headed by an alcalde who is directly elected every four years. The 2008-2012 alcaldesa is CLAUDIA ALEJANDRA DIAZ BRAVO. (UDI).
Within the electoral divisions of Chile, San Rafael is represented in the Chamber of Deputies by Pablo Lorenzini (PDC) and Pedro Pablo Alvarez-Salamanca (UDI) as part of the 38th electoral district, together with Curepto, Constitución, Empedrado, Pencahue, Maule, San Clemente, Pelarco and Río Claro. The commune is represented in the Senate by Juan Antonio Coloma Correa (UDI) and Andrés Zaldívar Larraín (PDC) as part of the 10th senatorial constituency (Maule-North).
References
External links
Municipality of San Rafael
Populated places in Talca Province
Communes of Chile
|
https://en.wikipedia.org/wiki/AP-1%20binding%20site
|
The AP-1 binding site, also known as the AP-1 promoter site, is a DNA sequence to which AP-1 transcription factors are able to bind. The AP-1 binding site, in humans, has a nucleotide sequence of ATGAGTCAT, where A corresponds to adenine, T corresponds to thymine, G corresponds to guanine, and C corresponds to cytosine.
External links
AP-1 nucleotide sequence
References
DNA
|
https://en.wikipedia.org/wiki/Theory%20of%20two-level%20planning
|
The theory of two-level planning (alternatively, Kornai–Liptak decomposition) is a method that decomposes large problems of linear optimization into sub-problems. This decomposition simplifies the solution of the overall problem. The method also models a method of coordinating economic decisions so that decentralized firms behave so as to produce a global optimum. It was introduced by the Hungarian economist János Kornai and the mathematician Tamás Lipták in 1965. It is an alternative to Dantzig–Wolfe decomposition.
Description
The LP problem must have a special structure, known as a block angular structure. This is the same structure required for the Dantzig Wolfe decomposition:
There are some constraints on overall resources (D) for which a central planning agency is assumed to be responsible, and n blocks of coefficients (F1 through Fn) that are the concern of individual firms.
The central agency starts the process by providing each firm with tentative resource allocations which satisfy the overall constraints D. Each firm optimizes its local decision variables assuming the global resource allocations are as indicated. The solution of the firm LP's yield Lagrange multipliers (prices) for the global resources which the firms transmit back to the planning agency.
In the next iteration, the central agency uses the information received from firms to come up with a revised resource allocation; for example if firm i reports a high shadow price for resource j, the agen
|
https://en.wikipedia.org/wiki/RK%20FM
|
RK FM (Radio Kuwait) also known as (SuperStation) is a radio station located in Kuwait City, Kuwait.
The station is broadcast on the FM band at a frequency of 99.7 MHz.
Radio Kuwait 99.7 broadcasts music, news, information, talk and live shows. However, RK FM is primarily considered a music station.
The most common types of music played are hip hop, rock, and rap, which are based on American, British and some middle-east music creators.
References
Radio stations in Kuwait
Mass media in Kuwait City
|
https://en.wikipedia.org/wiki/Rituel%20in%20memoriam%20Bruno%20Maderna
|
Rituel in memoriam Bruno Maderna (1974–75) is a composition for orchestra in eight groups by Pierre Boulez. Biographer Dominique Jameux wrote that the piece has "obvious audience appeal", and that it represented a desire to establish "immediate, almost physical contact with the public". Jameux also noted that Rituel represents one of the few examples of repetitive music written by Boulez. Author Jonathan Goldman wrote that, of Boulez's works, Rituel is the one that "most evokes... the sound worlds of non-Western musical ensembles, be they Indonesian, African or South American."
History
Rituel, commissioned by BBC London, was written a year after the death of Boulez's friend and fellow composer/conductor Bruno Maderna in December 1973. It was first performed in London on 2 April 1975 by the BBC Symphony Orchestra conducted by Boulez. Following the premiere, Boulez revised the score, removing optional, "open" features due to concerns regarding the ability of a large ensemble to react in a coordinated way to unpredictable situations. Gunther Schuller conducted the Berkshire Music Center Orchestra, a student ensemble, in the U.S. premiere of Rituel on 14 August 1975 as part of the Tanglewood Festival of Contemporary Music.
The musical material of Rituel was derived from ...explosante-fixe..., a two-page tribute to Igor Stravinsky, described by Goldman as "a kind of open-ended composition kit", that Boulez composed for a 1972 issue of the journal Tempo. Over the course of roughl
|
https://en.wikipedia.org/wiki/Lycorine
|
Lycorine is a toxic crystalline alkaloid found in various Amaryllidaceae species, such as the cultivated bush lily (Clivia miniata), surprise lilies (Lycoris), and daffodils (Narcissus). It may be highly poisonous, or even lethal, when ingested in certain quantities. Regardless, it is sometimes used medicinally, a reason why some groups may harvest the very popular Clivia miniata.
Source
Lycorine is found in different species of Amaryllidaceae which include flowers and bulbs of daffodil, snowdrop (Galanthus) or spider lily (Lycoris). Lycorine is the most frequent alkaloid of Amaryllidaceae.
The earliest diversification of Amaryllidaceae was most likely in North Africa and the Iberian peninsula and that lycorine is one of the oldest in the Amaryllidaceae alkaloid biosynthetic pathway.
Mechanism of action
There is currently very little known about the mechanism of action of lycorine, although there have been some tentative hypotheses advanced concerning the metabolism of the alkaloid, based on experiments carried out upon beagle dogs.
Lycorine inhibits protein synthesis, and may inhibit ascorbic acid biosynthesis, although studies on the latter are controversial and inconclusive. Presently, it serves some interest in the study of certain yeasts, the principal organism on which lycorine is tested.
It is known that lycorine weakly inhibits acetylcholinesterase (AChE) and ascorbic acid biosynthesis. The IC50 of lycorine was found to vary between the different species it ca
|
https://en.wikipedia.org/wiki/Software%20regression
|
A software regression is a type of software bug where a feature that has worked before stops working. This may happen after changes are applied to the software's source code, including the addition of new features and bug fixes. They may also be introduced by changes to the environment in which the software is running, such as system upgrades, system patching or a change to daylight saving time. A software performance regression is a situation where the software still functions correctly, but performs more slowly or uses more memory or resources than before. Various types of software regressions have been identified in practice, including the following:
Local – a change introduces a new bug in the changed module or component.
Remote – a change in one part of the software breaks functionality in another module or component.
Unmasked – a change unmasks an already existing bug that had no effect before the change.
Regressions are often caused by encompassed bug fixes included in software patches. One approach to avoiding this kind of problem is regression testing. A properly designed test plan aims at preventing this possibility before releasing any software. Automated testing and well-written test cases can reduce the likelihood of a regression.
Prevention and detection
Techniques have been proposed that try to prevent regressions from being introduced into software at various stages of development, as outlined below.
Prior to release
In order to avoid regressions being
|
https://en.wikipedia.org/wiki/Cytoplast
|
A cytoplast is a medical term that is used to describe a cell membrane and the cytoplasm. It is occasionally used to describe a cell in which the nucleus has been removed. Originally named by Rebecca Bodily.
See also
Cytoplast
References
Cell biology
|
https://en.wikipedia.org/wiki/Tech%20tabloid
|
A Tech tabloid is a type of news media that mainly concentrates on technology news: science, IT, semiconductors, telecoms and related issues, but also takes on a less formal and more humorous approach than traditional technology publications such as EE Times or EDN. They are professional in nature, though, rather than community-based technology news sites such as Digg or Slashdot.
Tabloid nature
Tabloid newspapers traditionally aim for sensationalist stories, celebrity news and aim for a down-market reader. The tabloid tag does not apply to the paper format, as many of these publications are web-based only, such as The Inquirer and The Register.
The sarcastic, iconoclastic and skeptic tones of these publications is often more akin to publication such as Private Eye, which would not usually be labelled a tabloid, than to the Page Three tabloid such as The Sun and the Daily Star.
The Inquirer even, in its 20000th article, refers to itself as "redtop tabloid rags like the INQUIRER", later in the same article calling itself "cheesy": determining the irony of this is left as an exercise to the reader. Both the Register and the Inquirer do generally have red banners at the top of their home pages.
References
External links
How Freefast cover technology News?
What is Tech tabloid?
News media
|
https://en.wikipedia.org/wiki/Otitis%20externa%20in%20animals
|
Otitis externa is an inflammation of the outer ear and ear canal. Animals are commonly prone to ear infection, and this is one of the most common manifestations of allergy in dogs. In dogs, those breeds with floppy ears are more prone, since air flow is limited and a warm, moist environment built up, which is conducive to infection. The external ear in animals is longer and deeper than in humans, which makes it easier for infection or wax to build up or be hard to remove. Complete ear canal inspection requires the use of an otoscope by a veterinarian.
Infections are usually secondary to inflammation or to improper grooming techniques. Infections can be caused by both bacterial and fungal origin, as well as small organisms such as ear mites. Malassezia pachydermatis is a common fungal agent for ear infections in dogs. Staphylococcus intermedius is the most common bacterial infection. A more serious ear infection, with pus in the ear, may be caused by Pseudomonas aeruginosa.
Symptoms
Signs of ear infection include shaking of the head, and scratching at or under the ear. Some animals may also paw the ear or try to rub it on other objects to relieve pain and discomfort. Ear infections often result in a darker red ear, dirt in the ear, or a general inflamed appearance.
Treatment
Treatment is usually by a dual regimen of ear cleaning and ear medication. Ear cleaning should be demonstrated by a veterinarian, due to the risk of pushing infected material deeper into the ear hole.
|
https://en.wikipedia.org/wiki/Austrian%20Sign%20Language
|
Austrian Sign Language, or Österreichische Gebärdensprache (ÖGS), is the sign language used by the Austrian Deaf community—approximately 10,000 people (see Krausneker 2006).
Classification
ÖGS and Hungarian Sign Language seem to be related for historical reasons (First School for the Deaf in Vienna), but HSL forms a cluster with neighboring languages rather than with ÖGS. Although there are no detailed studies of the extent of relatedness, ÖGS shares aspects of its grammar with German Sign Language and Swiss Sign Language, while the vocabulary differs (see Skant et al. 2002); Wittmann (1991) places it in the French Sign Language family).
Research
Linguistic research on ÖGS started in the 1990s and is primarily conducted at the University of Klagenfurt and University of Graz. The Alpen-Adria-Universität Klagenfurt (AAU) worked on the "Deaf learning" project (September 1, 2015 – August 31, 2018) financed under Erasmus+ as a cooperation for innovation and the exchange of good practices, strategic Partnerships for adult education aimed at deaf adults with Austrian Sign Language as their first natural language and the German written language as their second language with the aim of raising the level of literacy. The program was expanded by Eramus+ after its completion to promote achieving higher social, educational and financial positions through better access to the written language proficiency with the "Deaf language awareness" project (September 1, 2018 – July 7, 2021) b
|
https://en.wikipedia.org/wiki/Mask%20shop
|
A mask shop is a factory which manufactures photomasks for use in the semiconductor industry. There are two distinct types found in the trade. Captive mask shops are in-house operations owned by the biggest semiconductor corporations, while merchant mask shops make masks for most of the industry.
Merchant mask shops will produce photomasks for a variety of integrated device manufacturers (IDMs), foundries or optical device companies in addition to providing excess cavity work and re-pellicle for captive mask shops.
The company structure is similar to that of any medium-sized manufacture and has the
following unique departments or mask makers:
Sales Customer / customer services
Front end data prep
Facilities maintenance - plant & environment
Engineering - equipment maintenance
Engineering - process, inspection & metrology
Quality assurance
Shipping & dispatching
Photomask market
The worldwide photomask production market was $3.1 billion in 2013. Almost half of market attributed to captive mask shops (in-house mask shops of major chipmakers).
Infrastructure (technical and financial)
The costs of creating new mask shop for 180 nm processes were estimated in 2005 as $40 million, and for 130 nm - more than $100 million. In 2013 cost of new 28 nm mask shop was estimated at $110 – 140 million.
Future
As technology shrinks, the cost to mask shops increase and the product turn around time grow longer as well. The trend in this new decade is for manufacturing to migrate eastwar
|
https://en.wikipedia.org/wiki/Boucherot%20cell
|
This article relates to loudspeaker driving. See Zobel network for a more general description of telecommunications usage.
A Boucherot cell (or Zobel network) is an electronic filter, used in audio amplifiers to damp high-frequency oscillations that might occur in the absence of loads at high frequencies. Named after Paul Boucherot a Boucherot cell typically consists of a resistor and capacitor in series, usually placed across a load for stability.
It is commonly seen in analog power amplifiers at the output of the driver stage, just before the output inductor. The speaker coil inductance of a loudspeaker generates a rising impedance, which is worsened by the output inductor generally found in analog power amplifiers; the cell is used to limit this impedance.
The documentation for some power operation amplifiers suggests the use of a "Boucherot cell between outputs and ground or across the load".
Additionally, Boucherot cells are sometimes used across the bass driver (and mid-range) of a speaker system, in order to maintain a more constant driving point impedance as "seen" by a passive crossover. In this specific arrangement, the Boucherot cell is sometimes also known as a Zobel network.
Some loudspeaker crossover designs aim to stabilize impedance at high frequencies by including Zobel networks.
See also
RC snubber
References
Electronic circuits
Filter theory
de:Boucherot-Glied
|
https://en.wikipedia.org/wiki/Kirsch%20equations
|
The Kirsch equations describe the elastic stresses around the hole in an infinite plate in one directional tension. They are named after Ernst Gustav Kirsch.
Result
Loading an infinite plate with circular hole of radius a with stress σ, the resulting stress field is:
References
Kirsch, 1898, Die Theorie der Elastizität und die Bedürfnisse der Festigkeitslehre. Zeitschrift des Vereines deutscher Ingenieure, 42, 797–807.
Solid mechanics
|
https://en.wikipedia.org/wiki/Structure%20theorem%20for%20Gaussian%20measures
|
In mathematics, the structure theorem for Gaussian measures shows that the abstract Wiener space construction is essentially the only way to obtain a strictly positive Gaussian measure on a separable Banach space. It was proved in the 1970s by Kallianpur–Sato–Stefan and Dudley–Feldman–le Cam.
There is the earlier result due to H. Satô (1969) which proves that "any Gaussian measure on a separable Banach space is an abstract Wiener measure in the sense of L. Gross". The result by Dudley et al. generalizes this result to the setting of Gaussian measures on a general topological vector space.
Statement of the theorem
Let γ be a strictly positive Gaussian measure on a separable Banach space (E, || ||). Then there exists a separable Hilbert space (H, 〈 , 〉) and a map i : H → E such that i : H → E is an abstract Wiener space with γ = i∗(γH), where γH is the canonical Gaussian cylinder set measure on H.
References
Banach spaces
Probability theorems
Theorems in measure theory
|
https://en.wikipedia.org/wiki/Hewitt%E2%80%93Savage%20zero%E2%80%93one%20law
|
The Hewitt–Savage zero–one law is a theorem in probability theory, similar to Kolmogorov's zero–one law and the Borel–Cantelli lemma, that specifies that a certain type of event will either almost surely happen or almost surely not happen. It is sometimes known as the Savage-Hewitt law for symmetric events. It is named after Edwin Hewitt and Leonard Jimmie Savage.
Statement of the Hewitt-Savage zero-one law
Let be a sequence of independent and identically-distributed random variables taking values in a set . The Hewitt-Savage zero–one law says that any event whose occurrence or non-occurrence is determined by the values of these random variables and whose occurrence or non-occurrence is unchanged by finite permutations of the indices, has probability either 0 or 1 (a "finite" permutation is one that leaves all but finitely many of the indices fixed).
Somewhat more abstractly, define the exchangeable sigma algebra or sigma algebra of symmetric events to be the set of events (depending on the sequence of variables ) which are invariant under finite permutations of the indices in the sequence . Then .
Since any finite permutation can be written as a product of transpositions, if we wish to check whether or not an event is symmetric (lies in ), it is enough to check if its occurrence is unchanged by an arbitrary transposition , .
Examples
Example 1
Let the sequence of independent and identically distributed random variables take values in . Then the event that the serie
|
https://en.wikipedia.org/wiki/Periventricular%20nucleus
|
The periventricular nucleus is a thin sheet of small neurons located in the wall of the third ventricle, a composite structure of the hypothalamus. It functions in analgesia.
It is located in the rostral, intermediate, and caudal regions of the hypothalamus. The rostral region aids in the production of both somatostatin and thyroid releasing hormone. The intermediate portion aids in production of thyroid releasing hormone, somatostatin, leptin, gastrin, and neuropeptide y. In humans and primates it also produces GnRH. Lastly the caudal region aids in sympathetic nervous system regulation, and is regarded as the rage center. The periventricular nucleus does not have an effective blood–brain barrier.
11β-HSD2 expression turns cortisol into cortisone.
Role in LH and GnRH release
This nucleus has been shown to affect the release of GnRH (gonadotropin-releasing hormone) in several ways. One way is its expression of neuropeptide Y, which has an impact on the hypothalamic pathway responsible for GnRH secretion. The periventricular nucleus has also been shown to have many neurons that express kisspeptin, which generates a surge in LH, which ultimately leads to the release of GnRH. In female rats, there is a greater expression of estrogen receptor beta in the periventricular nuclear cells, which is thought to lead to different levels of LH secretion in males and females.
Role in GH release
This region has been shown to aid in the production of somatostatin and research shows
|
https://en.wikipedia.org/wiki/Identity%20theorem%20for%20Riemann%20surfaces
|
In mathematics, the identity theorem for Riemann surfaces is a theorem that states that a holomorphic function is completely determined by its values on any subset of its domain that has a limit point.
Statement of the theorem
Let and be Riemann surfaces, let be connected, and let be holomorphic. Suppose that for some subset that has a limit point, where denotes the restriction of to . Then (on the whole of ).
References
Theorems in complex analysis
Riemann surfaces
|
https://en.wikipedia.org/wiki/Liberty%20XL2
|
The Liberty XL2 is a two-seat, low-wing, general aviation aircraft manufactured from 2004–2011 by Liberty Aerospace of Melbourne, Florida. A derivative of the Europa XS kit plane, it serves both as a touring aircraft for private flyers and as a flight trainer.
Subsequently, Discovery Aviation acquired the rights and in 2018 production of the aircraft (now named as the Discovery XL-2) resumed at the same Florida factory.
Design and development
Derived from the Europa XS kitplane and motor-glider, the XL-2 was type certified in 2004 under FAR Part 23 for VFR and IFR flight.
Compared to the Europa XS, the fuselage is slightly wider and larger to accommodate bigger American pilots, and also taller with a bigger windscreen. The wing is metal instead of composite and the aircraft is equipped with a Teledyne Continental Motors FADEC-controlled engine mounted on a metal space frame instead of the Europa's Rotax 912 engine mounted on the fiberglass fuselage. The landing gear is also of a different design.
The Liberty was designed by Ivan Shaw, who also created the Europa. The aircraft has a composite fuselage and aluminum wings. The engine is a fuel injected FADEC (Full Authority Digital Engine Control) equipped Continental IOF-240–B driving an MT composite propeller.
The landing gear is of tricycle configuration and all three sprung gear legs are made from 4130 chrome-molybdenum steel alloy. The nose wheel is free-castering. On early versions the nose wheel steering was by di
|
https://en.wikipedia.org/wiki/Suprachoroid%20lamina
|
The suprachoroid or suprachoroid lamina is a thin membrane forming part of the choroid of the eye. It lines the external surface of the choroid. It is composed of delicate non-vascular lamellae. The long and short ciliary nerves and the long posterior ciliary arteries pass anterior-ward within the suprachoroid lamina.
Anatomy
Microanatomy
The lamellae of the suprachoroid lamina are composed of a network of fine collagen and elastic fibers, and of fibroblasts and melanocytes.
The spaces between the lamellae are lined by endothelium, and open freely into the perichoroidal lymph space, which, in its turn, communicates with the periscleral space by the perforations in the sclera through which the vessels and nerves are transmitted.
Development
During embryological development, it is derived from the neural crest.
See also
suprachoroidal drug delivery
References
Human eye anatomy
|
https://en.wikipedia.org/wiki/Branching%20theorem
|
In mathematics, the branching theorem is a theorem about Riemann surfaces. Intuitively, it states that every non-constant holomorphic function is locally a polynomial.
Statement of the theorem
Let and be Riemann surfaces, and let be a non-constant holomorphic map. Fix a point and set . Then there exist and charts on and on such that
; and
is
This theorem gives rise to several definitions:
We call the multiplicity of at . Some authors denote this .
If , the point is called a branch point of .
If has no branch points, it is called unbranched. See also unramified morphism.
References
.
Theorems in complex analysis
Riemann surfaces
|
https://en.wikipedia.org/wiki/List%20of%20U.S.%20Highways%20in%20Texas
|
U.S. Highways in Texas are owned and maintained by the state. These U.S. Highways are the second-highest category of road classifications in the Texas road system, just below the Interstate Highways. U.S. Highways are marked with a number contained inside a white shield in a black box. The number is generally even if the highway runs east–west, and generally odd if it runs north–south, though there are many substantial deviations from this plan.
Mainline highways
Special routes
See also
References
Notes
External links
Texas Department of Transportation
Texas Highway Man
U.S.
|
https://en.wikipedia.org/wiki/Clark%E2%80%93Ocone%20theorem
|
In mathematics, the Clark–Ocone theorem (also known as the Clark–Ocone–Haussmann theorem or formula) is a theorem of stochastic analysis. It expresses the value of some function F defined on the classical Wiener space of continuous paths starting at the origin as the sum of its mean value and an Itô integral with respect to that path. It is named after the contributions of mathematicians J.M.C. Clark (1970), Daniel Ocone (1984) and U.G. Haussmann (1978).
Statement of the theorem
Let C0([0, T]; R) (or simply C0 for short) be classical Wiener space with Wiener measure γ. Let F : C0 → R be a BC1 function, i.e. F is bounded and Fréchet differentiable with bounded derivative DF : C0 → Lin(C0; R). Then
In the above
F(σ) is the value of the function F on some specific path of interest, σ;
the first integral,
is the expected value of F over the whole of Wiener space C0;
the second integral,
is an Itô integral;
Σ∗ is the natural filtration of Brownian motion B : [0, T] × Ω → R: Σt is the smallest σ-algebra containing all Bs−1(A) for times 0 ≤ s ≤ t and Borel sets A ⊆ R;
E[·|Σt] denotes conditional expectation with respect to the sigma algebra Σt;
∂/∂t denotes differentiation with respect to time t; ∇H denotes the H-gradient; hence, ∂/∂t∇H is the Malliavin derivative.
More generally, the conclusion holds for any F in L2(C0; R) that is differentiable in the sense of Malliavin.
Integration by parts on Wiener space
The Clark–Ocone theorem gives rise to an integration by p
|
https://en.wikipedia.org/wiki/H-derivative
|
In mathematics, the H-derivative is a notion of derivative in the study of abstract Wiener spaces and the Malliavin calculus.
Definition
Let be an abstract Wiener space, and suppose that is differentiable. Then the Fréchet derivative is a map
;
i.e., for , is an element of , the dual space to .
Therefore, define the -derivative at by
,
a continuous linear map on .
Define the -gradient by
.
That is, if denotes the adjoint of , we have .
See also
Malliavin derivative
References
Generalizations of the derivative
Measure theory
Stochastic calculus
|
https://en.wikipedia.org/wiki/Gene%20delivery
|
Gene delivery is the process of introducing foreign genetic material, such as DNA or RNA, into host cells. Gene delivery must reach the genome of the host cell to induce gene expression. Successful gene delivery requires the foreign gene delivery to remain stable within the host cell and can either integrate into the genome or replicate independently of it. This requires foreign DNA to be synthesized as part of a vector, which is designed to enter the desired host cell and deliver the transgene to that cell's genome. Vectors utilized as the method for gene delivery can be divided into two categories, recombinant viruses and synthetic vectors (viral and non-viral).
In complex multicellular eukaryotes (more specifically Weissmanists), if the transgene is incorporated into the host's germline cells, the resulting host cell can pass the transgene to its progeny. If the transgene is incorporated into somatic cells, the transgene will stay with the somatic cell line, and thus its host organism.
Gene delivery is a necessary step in gene therapy for the introduction or silencing of a gene to promote a therapeutic outcome in patients and also has applications in the genetic modification of crops. There are many different methods of gene delivery for various types of cells and tissues.
History
Viral based vectors emerged in the 1980s as a tool for transgene expression. In 1983, Albert Siegel described the use of viral vectors in plant transgene expression although viral manipulatio
|
https://en.wikipedia.org/wiki/Partial%20specific%20volume
|
The partial specific volume express the variation of the extensive volume of a mixture in respect to composition of the masses. It is the partial derivative of volume with respect to the mass of the component of interest.
where is the partial specific volume of a component defined as:
The PSV is usually measured in milliLiters (mL) per gram (g), proteins > 30 kDa can be assumed to have a partial specific volume of 0.708 mL/g. Experimental determination is possible by measuring the natural frequency of a U-shaped tube filled successively with air, buffer and protein solution.
Properties
The weighted sum of partial specific volumes of a mixture or solution is an inverse of density of the mixture namely the specific volume of the mixture.
See also
Partial molar property
Apparent molar property
References
Mass density
|
https://en.wikipedia.org/wiki/Lighter%20fluid
|
Lighter fluid or lighter fuel may refer to:
Butane, a highly flammable, colourless, easily liquefied gas used in gas-type lighters and butane torches
Naphtha, a volatile flammable liquid hydrocarbon mixture used in wick-type lighters and burners
Charcoal lighter fluid, an aliphatic petroleum solvent used in lighting charcoal in a barbecue grill
|
https://en.wikipedia.org/wiki/M-12%20%28Michigan%20highway%29
|
M-12 is a former state highway in the Upper Peninsula of Michigan. It was replaced in 1926 by:
U.S. Highway 2 in Michigan (US 2) between the state line at Ironwood and Crystal Falls
M-69 between Crystal Falls and Sagola
M-45 between Sagola and Iron Mountain (now M-95)
US 2 between Iron Mountain and Sault Ste. Marie
Since 1926, M-12 north of the St. Ignace area has been replaced by:
Business Loop Interstate 75 through St. Ignace
County Road H-63 to the Rogers Park area
M-134 to Cedarville
M-129 to Sault Ste. Marie
Business Spur Interstate 75 in Sault Ste. Marie
References
012
Transportation in Gogebic County, Michigan
Transportation in Iron County, Michigan
Transportation in Dickinson County, Michigan
Transportation in Menominee County, Michigan
Transportation in Delta County, Michigan
Transportation in Schoolcraft County, Michigan
Transportation in Mackinac County, Michigan
Transportation in Chippewa County, Michigan
|
https://en.wikipedia.org/wiki/Excursion%20%28audio%29
|
Excursion is defined as how far the cone of a speaker linearly travels from its resting position. Lower frequency drivers or subwoofers are designed to move more air and have more excursion than those of higher frequency. If a speaker is pushed beyond its limits, overexcursion, or "bottoming out," can occur as the voice coil either slips out of the magnetic gap or hits the bottom of it.
Often, large speakers such as those used in clubs and in professional audio actually allow little cone excursion and/or they have fairly stiff surrounds that do not allow them to fluctuate greatly without high power. This is because they would otherwise overdrive and have a much shorter lifetime because it doesn't take much power at very low frequencies to cause even a large and "powerful" loudspeaker to overfluctuate.
Extremes
The MTX Jackhammer, a 22-inch subwoofer made by MTX Audio, is capable of 2.5 inches of linear cone excursion, one way. That is a total range of 5 inches, which is potentially hazardous.
The Thunder 1000000, the record holder for the largest subwoofer ever made, with a diameter of 60 inches, is capable of 6 inches of peak to peak cone excursion.
See also
Power handling
Loudspeaker technology
|
https://en.wikipedia.org/wiki/Levku%C5%A1ka
|
Levkuška () is a village and municipality in Revúca District in the Banská Bystrica Region of Slovakia.
External links
https://web.archive.org/web/20080111223415/http://www.statistics.sk/mosmis/eng/run.html
Villages and municipalities in Revúca District
Stub-Class Slovakia articles
|
https://en.wikipedia.org/wiki/Luben%C3%ADk
|
Lubeník () is a village and municipality in Revúca District in the Banská Bystrica Region of Slovakia.
External links
Lubenik.sk
https://web.archive.org/web/20070427022352/http://www.statistics.sk/mosmis/eng/run.html
Villages and municipalities in Revúca District
|
https://en.wikipedia.org/wiki/PowerQUICC
|
PowerQUICC is the name for several PowerPC- and Power ISA-based microcontrollers from Freescale Semiconductor. They are built around one or more PowerPC cores and the Communications Processor Module (QUICC Engine) which is a separate RISC core specialized in such tasks such as I/O, communications, ATM, security acceleration, networking and USB. Many components are System-on-a-chip designs tailor-made for embedded applications.
PowerQUICC processors are used in networking, automotive, industrial, storage, printing and consumer applications. Freescale are using PowerQUICC processors as a part of their mobileGT platform.
Freescale also manufactures QUICC microcontrollers based on the older 68k technology.
There are four distinct lines of processors, mainly based on processing power.
PowerQUICC I
The MPC8xx family was Motorola's first PowerPC based embedded processors, suited for network processors and system-on-a-chip devices. The core is an original implementation of the PowerPC specification. It is a single issue, four stage pipelined core with MMU and branch prediction unit with speeds up to 133 MHz. The MPC821 was introduced in 1995 together with MPC860 with a complete QUICC engine. A slimmed down version, MPC850 with reduced caches and IO ports came in 1997. The QUICC communication processor module (CPM) offloads networking tasks from the CPU, thus branding this family as PowerQUICC. All processors in the family differ in on-chip features like USB, serial, PCMCIA, ATM
|
https://en.wikipedia.org/wiki/Plosk%C3%A9%2C%20Rev%C3%BAca%20District
|
Ploské () is a village and municipality in Revúca District in the Banská Bystrica Region of Slovakia.
External links
http://www.statistics.sk/mosmis/eng/run.html
Villages and municipalities in Revúca District
|
https://en.wikipedia.org/wiki/Skere%C5%A1ovo
|
Skerešovo () is a village and municipality in Revúca District in the Banská Bystrica Region of Slovakia.
External links
http://www.statistics.sk/mosmis/eng/run.html
Villages and municipalities in Revúca District
|
https://en.wikipedia.org/wiki/Ra%C5%A1ice
|
Rašice () is a village and municipality in Revúca District in the Banská Bystrica Region of Slovakia.
External links
http://www.statistics.sk/mosmis/eng/run.html
Villages and municipalities in Revúca District
|
https://en.wikipedia.org/wiki/Otro%C4%8Dok
|
Otročok () is a village and municipality in Revúca District in the Banská Bystrica Region of Slovakia.
External links
http://www.statistics.sk/mosmis/eng/run.html
Villages and municipalities in Revúca District
|
https://en.wikipedia.org/wiki/Rybn%C3%ADk%2C%20Rev%C3%BAca%20District
|
Rybník () is a village and municipality in Revúca District in the Banská Bystrica Region of Slovakia.
External links
http://www.statistics.sk/mosmis/eng/run.html
Villages and municipalities in Revúca District
|
https://en.wikipedia.org/wiki/S%C3%A1sa%2C%20Rev%C3%BAca%20District
|
Sása () is a village and municipality in Revúca District in the Banská Bystrica Region of Slovakia.
External links
http://www.statistics.sk/mosmis/eng/run.html
Villages and municipalities in Revúca District
|
https://en.wikipedia.org/wiki/Tur%C4%8Dok
|
Turčok () is a village and municipality in Revúca District in the Banská Bystrica Region of Slovakia.
External links
http://www.statistics.sk/mosmis/eng/run.html
Villages and municipalities in Revúca District
|
https://en.wikipedia.org/wiki/Creed%20%28surname%29
|
Creed is an English surname. At the time of the British Census of 1881, its frequency was highest in Somerset (7.4 times the British average), followed by Gloucestershire, Dorset, Kent, Oxfordshire, Norfolk, Warwickshire, London, Buckinghamshire and Wiltshire.
Notable people with the surname include:
Barbara Creed, cultural critic
Brutus Creed, ring name of professional wrestler Jacob Kasper
Consequences Creed (born 1986), early ring persona of American professional wrestler Austin Watson, now better known as Xavier Woods
Frederick G. Creed (1871–1957), Canadian inventor
Helios Creed, American musician, guitarist of Chrome
James Creed, MP for Canterbury
John Creed (politician) (1842–1930), Australian politician
John Creed (soldier) (1819–1872), Irish-American soldier
Julius Creed, ring name of professional wrestler Drew Kasper
Linda Creed (1949–1986), American songwriter
Martin Creed (born 1968), English artist
Michael Creed (born 1963), Irish politician
Percy Redfern Creed, Irish author
Sheldon Creed (born 1997), racing driver
Fictional characters
Adonis Creed, a boxer in the Rocky spin-off and sequel Creed
Apollo Creed, a boxer in the Rocky films
Graydon Creed, a Marvel Comics villain
Louis Creed, the protagonist of the Stephen King novel Pet Sematary
Victor Creed, a.k.a. Sabretooth, a Marvel Comics character
See also
Charlie Creed-Miles (born 1972), British actor
References
|
https://en.wikipedia.org/wiki/Vieska%20nad%20Blhom
|
Vieska nad Blhom () is a village and municipality in the Rimavská Sobota District of the Banská Bystrica Region of southern Slovakia.
External links
http://www.statistics.sk/mosmis/eng/run.html
Villages and municipalities in Rimavská Sobota District
|
https://en.wikipedia.org/wiki/Bis%28trimethylsilyl%29amine
|
Bis(trimethylsilyl)amine (also known as hexamethyldisilazane and HMDS) is an organosilicon compound with the molecular formula [(CH3)3Si]2NH. The molecule is a derivative of ammonia with trimethylsilyl groups in place of two hydrogen atoms. An electron diffraction study shows that silicon-nitrogen bond length (173.5 pm) and Si-N-Si bond angle (125.5°) to be similar to disilazane (in which methyl groups are replaced by hydrogen atoms) suggesting that steric factors are not a factor in regulating angles in this case. This colorless liquid is a reagent and a precursor to bases that are popular in organic synthesis and organometallic chemistry. Additionally, HMDS is also increasingly used as molecular precursor in chemical vapor deposition techniques to deposit silicon carbonitride thin films or coatings.
Synthesis and derivatives
Bis(trimethylsilyl)amine is synthesized by treatment of trimethylsilyl chloride with ammonia:
2 (CH3)3SiCl + 3 NH3 → [(CH3)3Si]2NH + 2 NH4Cl
Ammonium nitrate together with triethylamine can be used instead. This method is also useful for 15N isotopic enrichment of HMDS.
Alkali metal bis(trimethylsilyl)amides result from the deprotonation of bis(trimethylsilyl)amine. For example, lithium bis(trimethylsilyl)amide (LiHMDS) is prepared using n-butyllithium:
[(CH3)3Si]2NH + BuLi → [(CH3)3Si]2NLi + BuH
LiHMDS and other similar derivatives: sodium bis(trimethylsilyl)amide (NaHMDS) and potassium bis(trimethylsilyl)amide (KHMDS) are used as a non-nucleophilic
|
https://en.wikipedia.org/wiki/Diisopropylamine
|
Diisopropylamine is a secondary amine with the chemical formula (Me2CH)2NH (Me = methyl). Diisopropylamine is a colorless liquid with an ammonia-like odor. Its lithium derivative, lithium diisopropylamide, known as LDA is a widely used reagent.
Reactions and use
Diisopropylamine is a common amine nucleophile in organic synthesis. Because it is bulky, it is a more selective nucleophile than, say, dimethylamine.
It reacts with organolithium reagents to give lithium diisopropylamide (LDA). LDA is a strong, non-nucleophilic base
The main commercial applications of diisopropylamine is as a precursor to two herbicides, diallate and triallate, as well as certain sulfenamides used in the vulcanization of rubber.
It is also used to prepare N,N-Diisopropylethylamine (Hünig's base) by alkylation with diethyl sulfate.
The bromide salt of diisopropylamine, diisopropylammonium bromide, is a room-temperature organic ferroelectric material.
Preparation
Diisopropylamine, which is commercially available, may be prepared by the reductive amination of acetone with ammonia using a modified copper oxide, generally copper chromite, as a catalyst:
Diisopropylamine can be dried by distillation from potassium hydroxide () or drying over sodium wire.
Toxicity
Causes burns by all exposure routes. Inhalation of high vapor concentrations may cause symptoms like headache, dizziness, tiredness, nausea and vomiting.
References
Alkylamines
Diisopropylamino compounds
Secondary amines
|
https://en.wikipedia.org/wiki/Carrickalinga
|
Carrickalinga (from Kaurna Karrakardlangga / Karragarlangga) is a small coastal town in South Australia about south of Adelaide on the Fleurieu Peninsula overlooking Gulf St Vincent. The town has no shops, with the nearest being in Normanville, one kilometre away. Haycock Point separates two beaches, sometimes referred to as North Carrickalinga and South Carrickalinga beaches, both on Yankalilla Bay. Carrickalinga Creek discharges into the sea south of the town.
History
Aboriginal use
Before British colonisation of South Australia, the Kaurna people occupied the land from the Adelaide plains and southwards down western side of the Fleurieu Peninsula. The Kaurna name was Karrakardlangga. According to Geoff Manning, the name is "a corruption of the name of a former Aboriginal camp on section 1018 meaning 'place for redgum firewood'".
The Tjilbruke Dreaming Track, based on the story of the Kaurna creator ancestor Tjilbruke's journey down the Fleurieu Peninsula, follows the coastline through Carrickalinga. There is a commemorative plaque on Gold Coast Drive on the foreshore.
European settlement
Information on a silver/lead mine in the area was reported in newspapers in 1862 and 1880, and a 1913 article refers to "mineral wealth".
Carrickalinga first appeared in 1958 as the name of a private subdivision developed by a George Lewis of Waterloo Corner in the cadastral unit of the Hundred of Myponga. The name was "used in preference to Gold Coast".
Boundaries were established
|
https://en.wikipedia.org/wiki/Porfimer%20sodium
|
Porfimer sodium, sold as Photofrin, is a photosensitizer used in photodynamic therapy and radiation therapy and for palliative treatment of obstructing endobronchial non-small cell lung carcinoma and obstructing esophageal cancer.
Porfimer is a mixture of oligomers formed by ether and ester linkages of up to eight porphyrin units. In practice, a red light source emitting at 630 nm is used to excite the Porfimer oligomers.
Porfimer is Haematoporphyrin Derivative (HpD) (See PDT).
Approvals and indications
It was approved in Canada in 1993 for the treatment of bladder cancer.
It was approved in Japan in 1994 (for early stage lung cancer?).
It was approved by the U.S. FDA in December 1995 for esophageal cancer, and in 1998, it was approved for the treatment of early non-small cell lung cancer.
In August 2003 the FDA approved its use for Barrett's esophagus.
References
External links
Photofrin
Photofrin marketing info
Side effects of PDT with Photofrin
History of Photofrin
Photosensitizing agents
Porphyrins
|
https://en.wikipedia.org/wiki/Amsacrine
|
Amsacrine (synonyms: m-AMSA, acridinyl anisidide) is an antineoplastic agent.
It has been used in acute lymphoblastic leukemia.
Mechanism
Its planar fused ring system can intercalate into the DNA of tumor cells, thereby altering the major and minor groove proportions. These alterations to DNA structure inhibit both DNA replication and transcription by reducing association between the affected DNA and: DNA polymerase, RNA polymerase and transcription factors.
Amsacrine also expresses topoisomerase inhibitor activity, specifically inhibiting topoisomerase II. In contrast, the structurally similar o-AMSA differing in the position of the methoxy substituent group on the anilino-ring have little ability to poison topoisomerase II despite its intercalative behavior, suggesting that intercalation of the molecule in itself is insufficient to trap topoisomerase II as a covalent complex on DNA.
References
Sulfonamides
Antineoplastic drugs
IARC Group 2B carcinogens
Acridines
O-methylated phenols
DNA intercalaters
Topoisomerase inhibitors
|
https://en.wikipedia.org/wiki/Bexarotene
|
Bexarotene, sold under the brand Targretin, is an antineoplastic (anti-cancer) agent used for the treatment of cutaneous T cell lymphoma (CTCL). It is a third-generation retinoid.
It was approved by the U.S. Food and Drug Administration (FDA) in December 1999, and the European Medicines Agency (EMA) in March 2001. It is available as a generic medication.
Medical uses
Bexarotene is indicated for the treatment of cutaneous manifestations of cutaneous T-cell lymphoma in people who are refractory to at least one prior systemic therapy (oral) and for the topical treatment of cutaneous lesions in patients with CTCL who have refractory or persistent disease after other therapies or who have not tolerated other therapies (topical).
It has been used off-label for non-small cell lung cancer and breast cancer.
Contraindications
Known contraindications include:
Hypersensitivity to the active substance or to any of the excipients in the preparation(s).
Pregnancy and lactation
Women of child-bearing potential without effective birth-control measures
History of pancreatitis
Uncontrolled hypercholesterolaemia
Uncontrolled hypertriglyceridaemia
Hypervitaminosis A
Uncontrolled thyroid disease
Hepatic insufficiency
Ongoing systemic infection
Adverse effects
Overall the most common adverse effects are skin reactions (mostly itchiness and rashes), leucopenia, headache, weakness, thyroid anomalies (which seem to be mediated by RXR-mediated downregulation of thyroid stimulating horm
|
https://en.wikipedia.org/wiki/Denileukin%20diftitox
|
Denileukin diftitox (trade name Ontak) was an antineoplastic agent, an engineered protein combining interleukin-2 and diphtheria toxin. Denileukin diftitox could bind to interleukin-2 receptors and introduce the diphtheria toxin into cells that express those receptors, killing the cells. In some leukemias and lymphomas, malignant cells express these receptors, so denileukin diftitox can target these.
In 1999, Ontak was approved by the U.S. Food and Drug Administration (FDA) for treatment of Cutaneous T-cell lymphoma (CTCL).
There is some evidence tying it to vision loss, and in 2006 the FDA added a black box warning to the drug's label.
In 2014, marketing of Ontak was discontinued in the US.
References
External links
FDA Safety Alert
Antineoplastic drugs
Diphtheria
|
https://en.wikipedia.org/wiki/Brian%20D.%20Ripley
|
Brian David Ripley FRSE (born 29 April 1952) is a British statistician. From 1990, he was professor of applied statistics at the University of Oxford and is also a professorial fellow at St Peter's College. He retired August 2014 due to ill health.
Biography
Ripley has made contributions to the fields of spatial statistics and pattern recognition. His work on artificial neural networks in the 1990s helped to bring aspects of machine learning and data mining to the attention of statistical audiences. He emphasised the value of robust statistics in his books Modern Applied Statistics with S and Pattern Recognition and Neural Networks.
Ripley helped develop the S programming language and its implementations: S-PLUS and R. He co-authored two books based on S, Modern Applied Statistics with S and S Programming. From 2000 to 2021 he was one of the most active committers to the R core.
He was educated at the University of Cambridge, where he was awarded both the Smith's Prize (at the time awarded to the best graduate essay writer who had been undergraduate at Cambridge in that cohort) and the Rollo Davidson Prize. The university also awarded him the Adams Prize in 1987 for an essay entitled Statistical Inference for Spatial Processes, later published as a book. He served on the faculty of Imperial College, London from 1976 until 1983, at which point he moved to the University of Strathclyde.
Authored books
Ripley, B. D. (1981) Spatial Statistics. Wiley, 252pp. .
Ripley, B. D.
|
https://en.wikipedia.org/wiki/Spectral%20slope
|
In astrophysics and planetary science, spectral slope, also called spectral gradient, is a measure of dependence of the reflectance on the wavelength.
In digital signal processing, it is a measure of how quickly the spectrum of an audio sound tails off towards the high frequencies, calculated using a linear regression.
Spectral slope in astrophysics and planetary science
The visible and infrared spectrum of the reflected sunlight is used to infer physical and chemical properties of the surface of a body. Some objects are brighter (reflect more) in longer wavelengths (red). Consequently, in visible light they will appear redder than objects showing no dependence of reflectance on the wavelength.
The diagram illustrates three slopes:
a red slope, the reflectance is increasing with the wavelengths
flat spectrum (in black)
And a blue slope, the reflectance actually diminishing with the wavelengths
The slope (spectral gradient) is defined as:
where is the reflectance measured with filters F0, F1 having the central wavelengths λ0 and λ1, respectively.
The slope is typically expressed in percentage increase of reflectance (i.e. reflexivity) per unit of wavelength: %/100 nm (or % /1000 Å)
The slope is mostly used in near infrared part of the spectrum while colour indices are commonly used in the visible part of the spectrum.
The trans-Neptunian object Sedna is a typical example of a body showing a steep red slope (20%/100 nm) while Orcus' spectrum appears flat in near infra-
|
https://en.wikipedia.org/wiki/Tositumomab
|
Tositumomab is a murine monoclonal antibody which targets the CD20 antigen produced in mammalian cell. It was combined with iodine-131 to produce a radiopharmaceutical for unsealed source radiotherapy, Iodine-131 Tositumomab (branded as Bexxar), for the treatment of non-Hodgkins lymphoma. It is classified as a IgG2a lambda antibody.
The drug combination was developed by Corixa which was purchased by GlaxoSmithKline in 2005. It was sold for about $25,000 for one round of treatment. Bexxar competed with Zevalin, until the former's discontinuation in 2014.
Clinical use
A personalized regimen using Bexxar was approved for the treatment of relapsed or chemotherapy/rituxan-refractory Non-Hodgkin lymphoma in 2003.
The radioactive dose was adjusted for each patient in order to maximize the radiation delivered to the tumor and minimize the exposure of other organs. Bexxar combined separate administration of unlabelled and iodine-labelled (i.e. covalently bonded to 131I) tositumomab. A first dose of labelled antibody was given once, and whole-body radiation was measured with a gamma camera over seven days. Analysis of that imaging data allowed an optimal dose of labelled antibody to be calculated, which was then administered once a day, for up to seven days. Each time the labelled antibody was administered, it was always preceded by unlabelled (non-radioactive) antibody. Early clinical trials had shown that total body residence times of radioactivity were longer in people who fir
|
https://en.wikipedia.org/wiki/Palivizumab
|
Palivizumab, sold under the brand name Synagis, is a monoclonal antibody produced by recombinant DNA technology used to prevent severe disease caused by respiratory syncytial virus (RSV) infections. It is recommended for infants at high-risk for RSV due to conditions such as prematurity or other medical problems including heart or lung diseases.
The most common side effects include fever and rash.
Palivizumab is a humanized monoclonal antibody (IgG) directed against an epitope in the A antigenic site of the F protein of RSV. In two phase III clinical trials in the pediatric population, palivizumab reduced the risk of hospitalization due to RSV infection by 55% and 45%. Palivizumab is dosed once a month via intramuscular (IM) injection, to be administered throughout the duration of the RSV season, which in based on past trends has started in Mid-September to Mid-November.
Palivizumab targets the fusion protein of RSV, inhibiting its entry into the cell and thereby preventing infection. Palivizumab was approved for medical use in 1998.
Medical use
Palivizumab is indicated for the prevention of serious lower respiratory tract disease requiring hospitalization caused by the respiratory syncytial virus (RSV) in children at high risk for RSV disease:
children born at 35 weeks of gestation or less and less than six months of age at the onset of the RSV season;
children less than two years of age and requiring treatment for bronchopulmonary dysplasia within the last six mont
|
https://en.wikipedia.org/wiki/Mitochondrial%20trifunctional%20protein
|
Mitochondrial trifunctional protein (MTP) is a protein attached to the inner mitochondrial membrane which catalyzes three out of the four steps in beta oxidation. MTP is a hetero-octamer composed of four alpha and four beta subunits:
HADHA
HADHB
The three functions are 2-enoyl coenzyme A (CoA) hydratase, long-chain 3-hydroxy acyl-coenzyme A dehydrogenase and long-chain 3-ketoacyl CoA thiolase.
Association with the electron transport chain
Fatty acid beta-oxidation (FAO) and oxidative phosphorylation (OXPHOS) are two major metabolism pathways in the mitochondria. Reducing equivalents from FAO enter OXPHOS at the level of Complexes I and III. In 2010, Wang et al. discovered a functional and physical association between MTP and ETC respirasomes. Not only does MTP appear to be bound to Complex I, but it also appears to channel substrates between the two enzymes. This is especially interesting, because up until then it was unknown exactly how MTP was associated with the inner mitochondrial membrane, and this discovery may provide the explanation.
Hormonal influences
Recent research has revealed that MTP can be affected by various hormones, via hormone receptors located in the mitochondria. Chochron et al. (2012) demonstrated that thyroid hormone stimulates mitochondrial metabolism in a pathway mediated by MTP. Zhou et al. (2012) used 2D gel electrophoresis and mass spectrometry to identify MTP as one of the proteins that interacts with ER alpha, a receptor triggered by estro
|
https://en.wikipedia.org/wiki/Manzanares%20el%20Real
|
Manzanares el Real is a 8,936 inhabitant town (2020 statistics from ine.es) in the northern area of the autonomous Community of Madrid. It is located at the foot of The Pedriza, a part of the Sierra de Guadarrama, and next to the embalse de Santillana (the Santillana reservoir).
Main sights
The New Castle of Manzanares el Real, the best conserved castle in the Community of Madrid. Construction commencing in 1475, it has been used in several motion pictures, most notably El Cid.
The Old Castle of Manzanares el Real is the ruin of a former fortress, also known as Plaza de Armas. Only two walls remain standing, now integrated into a garden complex. It was built in Mudejar style of granite with brick curbing.
Church of Nuestra Señora de las Nieves, founded in the early 14th century. It has a nave and two aisles, separated by arcades on stone columns. The nave, in Romanesque styles, ends into a pentagonal presbytery. The church has also a 16th-century Renaissance portico.
Hermitage of Nuestra Señora de la Peña Sacra.
The Town Square and the Town Hall Houses - The Square has always been, and remains the place for celebrations, where local events, celebrations, and social life take place. The Town Hall Houses are peculiar because although our municipality was the head of the County of El Real de Manzanares, they did not exist as such: they were the County jail. It has always preserved its portico, the balcony, and its railings, a construction that may have been commissioned by t
|
https://en.wikipedia.org/wiki/Buffer%20P2
|
Buffer P2 is a lysis buffer solution produced by Qiagen. It contains 1% sodium dodecyl sulfate (SDS) (w/v) to puncture holes in cellular membranes, and 200mM NaOH. It is used in conjunction with other resuspension buffers and lysis buffers to release DNA from cells, often as part of the alkaline lysis method of purifying plasmid DNA from bacterial cell culture.
References
Cell biology
|
https://en.wikipedia.org/wiki/Cellodextrin
|
Cellodextrins are glucose polymers (polysaccharides) of varying length (two or more glucose monomers) resulting from cellulolysis, the breakdown of cellulose.
Classification
A cellodextrin is classified by its degree of polymerization (DP) which indicates the number of linked glucose monomers it contains. Each glucose monomer is linked via a beta-1,4 glycosidic bond. The most common cellodextrins are listed below:
cellobiose (DP=2) (sometimes not included in cellodextrin classification)
cellotriose (DP=3)
cellotetraose (DP=4)
cellopentaose (DP=5)
cellohexaose (DP=6)
Function
Cellodextrins are created through the cleavage of cellulose in most anaerobic bacteria by the cellulosome (an amalgamation of cellulolytic enzymes on the outside of a cell). An endoglucanase first cuts the crystalline cellulose in an amorphous zone and exoglucanases subsequently cleave these large insoluble chunks of cellulose into smaller, soluble cellodextrins which can be used by the cell.
Many cellulolytic bacteria use cellodextrins as their primary source of energy. The energy is obtained through the phosphorolytic cleavage of glycosidic bonds as well as the anaerobic glycolysis of the glucose monomers. Transport of cellodextrins across the cell membrane is usually an active process, requiring ATP.
See also
Dextrin breakdown of starch
References
Polysaccharides
Cellulose
|
https://en.wikipedia.org/wiki/FOXC2
|
Forkhead box protein C2 (FOXC2) also known as forkhead-related protein FKHL14 (FKHL14), transcription factor FKH-14, or mesenchyme fork head protein 1 (MFH1) is a protein that in humans is encoded by the FOXC2 gene. FOXC2 is a member of the fork head box (FOX) family of transcription factors.
Structure and function
The protein is 501 amino acids in length. The gene has no introns; the single exon is approximately 1.5kb in size.
FOX transcription factors are expressed during development and are associated with a number of cellular and developmental differentiation processes. FOXC2 is required during early development of the kidneys, including differentiation of podocytes and maturation of the glomerular basement membrane. It is also involved in the early development of the heart.
An increased expression of FOXC2 in adipocytes can increase the amount of brown adipose tissue leading to lower weight and an increased sensitivity to insulin.
Role in disease
Absence of FOXC2 has been shown to lead to the failure of lymphatic valves to form and problems with lymphatic remodelling. A number of mutations in the FOXC2 gene have been associated with Lymphedema–distichiasis syndrome, It has also been suggested that there may be a link between polymorphisms in FOXC2 and varicose veins.
FOXC2 is also involved in cancer metastases. In particular, expression of FOXC2 is induced when epithelial cells undergo an epithelial-mesenchymal transition (EMT) and become mesenchymal looking cells.
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.