source stringlengths 31 203 | text stringlengths 28 2k |
|---|---|
https://en.wikipedia.org/wiki/Medical%20imaging | Medical imaging is the technique and process of imaging the interior of a body for clinical analysis and medical intervention, as well as visual representation of the function of some organs or tissues (physiology). Medical imaging seeks to reveal internal structures hidden by the skin and bones, as well as to diagnose and treat disease. Medical imaging also establishes a database of normal anatomy and physiology to make it possible to identify abnormalities. Although imaging of removed organs and tissues can be performed for medical reasons, such procedures are usually considered part of pathology instead of medical imaging.
Measurement and recording techniques that are not primarily designed to produce images, such as electroencephalography (EEG), magnetoencephalography (MEG), electrocardiography (ECG), and others, represent other technologies that produce data susceptible to representation as a parameter graph versus time or maps that contain data about the measurement locations. In a limited comparison, these technologies can be considered forms of medical imaging in another discipline of medical instrumentation.
As of 2010, 5 billion medical imaging studies had been conducted worldwide. Radiation exposure from medical imaging in 2006 made up about 50% of total ionizing radiation exposure in the United States. Medical imaging equipment is manufactured using technology from the semiconductor industry, including CMOS integrated circuit chips, power semiconductor devices, sensors such as image sensors (particularly CMOS sensors) and biosensors, and processors such as microcontrollers, microprocessors, digital signal processors, media processors and system-on-chip devices. , annual shipments of medical imaging chips amount to 46million units and .
Medical imaging is often perceived to designate the set of techniques that noninvasively produce images of the internal aspect of the body. In this restricted sense, medical imaging can be seen as the solution to mathem |
https://en.wikipedia.org/wiki/List%20of%20integrals%20of%20rational%20functions | The following is a list of integrals (antiderivative functions) of rational functions.
Any rational function can be integrated by partial fraction decomposition of the function into a sum of functions of the form:
which can then be integrated term by term.
For other types of functions, see lists of integrals.
Miscellaneous integrands
Integrands of the form xm(a x + b)n
Many of the following antiderivatives have a term of the form ln |ax + b|. Because this is undefined when x = −b / a, the most general form of the antiderivative replaces the constant of integration with a locally constant function. However, it is conventional to omit this from the notation. For example,
is usually abbreviated as
where C is to be understood as notation for a locally constant function of x. This convention will be adhered to in the following.
(Cavalieri's quadrature formula)
Integrands of the form xm / (a x2 + b x + c)n
For
Integrands of the form xm (a + b xn)p
The resulting integrands are of the same form as the original integrand, so these reduction formulas can be repeatedly applied to drive the exponents m and p toward 0.
These reduction formulas can be used for integrands having integer and/or fractional exponents.
Integrands of the form (A + B x) (a + b x)m (c + d x)n (e + f x)p
The resulting integrands are of the same form as the original integrand, so these reduction formulas can be repeatedly applied to drive the exponents m, n and p toward 0.
These reduction formulas can be used for integrands having integer and/or fractional exponents.
Special cases of these reductions formulas can be used for integrands of the form by setting B to 0.
Integrands of the form xm (A + B xn) (a + b xn)p (c + d xn)q
The resulting integrands are of the same form as the original integrand, so these reduction formulas can be repeatedly applied to drive the exponents m, p and q toward 0.
These reduction formulas can be used for integrands having integer and/or fractio |
https://en.wikipedia.org/wiki/Lists%20of%20integrals | Integration is the basic operation in integral calculus. While differentiation has straightforward rules by which the derivative of a complicated function can be found by differentiating its simpler component functions, integration does not, so tables of known integrals are often useful. This page lists some of the most common antiderivatives.
Historical development of integrals
A compilation of a list of integrals (Integraltafeln) and techniques of integral calculus was published by the German mathematician (also spelled Meyer Hirsch) in 1810. These tables were republished in the United Kingdom in 1823. More extensive tables were compiled in 1858 by the Dutch mathematician David Bierens de Haan for his Tables d'intégrales définies, supplemented by Supplément aux tables d'intégrales définies in ca. 1864. A new edition was published in 1867 under the title Nouvelles tables d'intégrales définies.
These tables, which contain mainly integrals of elementary functions, remained in use until the middle of the 20th century. They were then replaced by the much more extensive tables of Gradshteyn and Ryzhik. In Gradshteyn and Ryzhik, integrals originating from the book by Bierens de Haan are denoted by BI.
Not all closed-form expressions have closed-form antiderivatives; this study forms the subject of differential Galois theory, which was initially developed by Joseph Liouville in the 1830s and 1840s, leading to Liouville's theorem which classifies which expressions have closed-form antiderivatives. A simple example of a function without a closed-form antiderivative is , whose antiderivative is (up to constants) the error function.
Since 1968 there is the Risch algorithm for determining indefinite integrals that can be expressed in term of elementary functions, typically using a computer algebra system. Integrals that cannot be expressed using elementary functions can be manipulated symbolically using general functions such as the Meijer G-function.
Lists of integrals |
https://en.wikipedia.org/wiki/James%20Joseph%20Sylvester | James Joseph Sylvester (3 September 1814 – 15 March 1897) was an English mathematician. He made fundamental contributions to matrix theory, invariant theory, number theory, partition theory, and combinatorics. He played a leadership role in American mathematics in the later half of the 19th century as a professor at the Johns Hopkins University and as founder of the American Journal of Mathematics. At his death, he was a professor at Oxford University.
Biography
James Joseph was born in London on 3 September 1814, the son of Abraham Joseph, a Jewish merchant. James later adopted the surname Sylvester when his older brother did so upon emigration to the United States.
At the age of 14, Sylvester was a student of Augustus De Morgan at the University of London. His family withdrew him from the University after he was accused of stabbing a fellow student with a knife. Subsequently, he attended the Liverpool Royal Institution.
Sylvester began his study of mathematics at St John's College, Cambridge in 1831, where his tutor was John Hymers. Although his studies were interrupted for almost two years due to a prolonged illness, he nevertheless ranked second in Cambridge's famous mathematical examination, the tripos, for which he sat in 1837. However, Sylvester was not issued a degree, because graduates at that time were required to state their acceptance of the Thirty-nine Articles of the Church of England, and Sylvester could not do so because he was Jewish. For the same reason, he was unable to compete for a Fellowship or obtain a Smith's prize. In 1838, Sylvester became professor of natural philosophy at University College London and in 1839 a Fellow of the Royal Society of London. In 1841, he was awarded a BA and an MA by Trinity College Dublin. In the same year he moved to the United States to become a professor of mathematics at the University of Virginia, but left after less than four months. A student who had been reading a newspaper in one of Sylvester's lec |
https://en.wikipedia.org/wiki/List%20of%20integrals%20of%20irrational%20functions | The following is a list of integrals (antiderivative functions) of irrational functions. For a complete list of integral functions, see lists of integrals. Throughout this article the constant of integration is omitted for brevity.
Integrals involving r =
Integrals involving s =
Assume x2 > a2 (for x2 < a2, see next section):
Here where the positive value of is to be taken.
Integrals involving u =
Integrals involving R =
Assume (ax2 + bx + c) cannot be reduced to the following expression (px + q)2 for some p and q.
Integrals involving S =
References
(Several previous editions as well.)
Irrational functions |
https://en.wikipedia.org/wiki/Distributed%20memory | In computer science, distributed memory refers to a multiprocessor computer system in which each processor has its own private memory. Computational tasks can only operate on local data, and if remote data are required, the computational task must communicate with one or more remote processors. In contrast, a shared memory multiprocessor offers a single memory space used by all processors. Processors do not have to be aware where data resides, except that there may be performance penalties, and that race conditions are to be avoided.
In a distributed memory system there is typically a processor, a memory, and some form of interconnection that allows programs on each processor to interact with each other. The interconnect can be organised with point to point links or separate hardware can provide a switching network. The network topology is a key factor in determining how the multiprocessor machine scales. The links between nodes can be implemented using some standard network protocol (for example Ethernet), using bespoke network links (used in for example the transputer), or using dual-ported memories.
Programming distributed memory machines
The key issue in programming distributed memory systems is how to distribute the data over the memories. Depending on the problem solved, the data can be distributed statically, or it can be moved through the nodes. Data can be moved on demand, or data can be pushed to the new nodes in advance.
As an example, if a problem can be described as a pipeline where data x is processed subsequently through functions f, g, h, etc. (the result is h(g(f(x)))), then this can be expressed as a distributed memory problem where the data is transmitted first to the node that performs f that passes the result onto the second node that computes g, and finally to the third node that computes h. This is also known as systolic computation.
Data can be kept statically in nodes if most computations happen locally, and only changes on edges have to |
https://en.wikipedia.org/wiki/List%20of%20integrals%20of%20trigonometric%20functions | The following is a list of integrals (antiderivative functions) of trigonometric functions. For antiderivatives involving both exponential and trigonometric functions, see List of integrals of exponential functions. For a complete list of antiderivative functions, see Lists of integrals. For the special antiderivatives involving trigonometric functions, see Trigonometric integral.
Generally, if the function is any trigonometric function, and is its derivative,
In all formulas the constant a is assumed to be nonzero, and C denotes the constant of integration.
Integrands involving only sine
Integrands involving only cosine
Integrands involving only tangent
Integrands involving only secant
Integrands involving only cosecant
Integrands involving only cotangent
Integrands involving both sine and cosine
An integral that is a rational function of the sine and cosine can be evaluated using Bioche's rules.
Integrands involving both sine and tangent
Integrand involving both cosine and tangent
Integrand involving both sine and cotangent
Integrand involving both cosine and cotangent
Integrand involving both secant and tangent
Integrand involving both cosecant and cotangent
Integrals in a quarter period
Using the beta function one can write
Integrals with symmetric limits
Integral over a full circle
See also
Trigonometric integral
Trigonometric functions
Trigonometry |
https://en.wikipedia.org/wiki/Dispatch%20table | In computer science, a dispatch table is a table of pointers or memory addresses to functions or methods. Use of such a table is a common technique when implementing late binding in object-oriented programming.
Perl implementation
The following shows one way to implement a dispatch table in Perl, using a hash to store references to code (also known as function pointers).
# Define the table using one anonymous code-ref and one named code-ref
my %dispatch = (
"-h" => sub { return "hello\n"; },
"-g" => \&say_goodbye
);
sub say_goodbye {
return "goodbye\n";
}
# Fetch the code ref from the table, and invoke it
my $sub = $dispatch{$ARGV[0]};
print $sub ? $sub->() : "unknown argument\n";
Running this Perl program as perl greet -h will produce "hello", and running it as perl greet -g will produce "goodbye".
JavaScript implementation
Following is a demo of implementing dispatch table in JavaScript:
var thingsWeCanDo = {
doThisThing : function() { /* behavior */ },
doThatThing : function() { /* behavior */ },
doThisOtherThing : function() { /* behavior */ },
default : function() { /* behavior */ }
};
var doSomething = function(doWhat) {
var thingToDo = thingsWeCanDo.hasOwnProperty(doWhat) ? doWhat : "default"
thingsWeCanDo[thingToDo]();
}
Virtual method tables
In object-oriented programming languages that support virtual methods, the compiler will automatically create a dispatch table for each object of a class containing virtual methods. This table is called a virtual method table or vtable, and every call to a virtual method is dispatched through the vtable.
See also
Branch table
References
Diomidis Spinellis (2003). Code Reading: The Open Source Perspective. Boston, MA: Addison-Wesley.
Method (computer programming)
Articles with example Perl code |
https://en.wikipedia.org/wiki/List%20of%20integrals%20of%20exponential%20functions | The following is a list of integrals of exponential functions. For a complete list of integral functions, please see the list of integrals.
Indefinite integral
Indefinite integrals are antiderivative functions. A constant (the constant of integration) may be added to the right hand side of any of these formulas, but has been suppressed here in the interest of brevity.
Integrals of polynomials
Integrals involving only exponential functions
Integrals involving the error function
In the following formulas, is the error function and is the exponential integral.
Other integrals
where (Note that the value of the expression is independent of the value of , which is why it does not appear in the integral.)
where
and is the upper incomplete gamma function.
when , , and
when , , and
The below formulae were proved by Toyesh Prakash Sharma (for ):
In 2023, Toyesh Prakash Sharma and Etisha Sharma found:
Definite integrals
The last expression is the logarithmic mean.
(the Gaussian integral)
(see Integral of a Gaussian function)
(the operator is the Double factorial)
(appears in several models of extended superstring theory in higher dimensions)
( is the modified Bessel function of the first kind)
where is the Polylogarithm.
where is the Euler–Mascheroni constant which equals the value of a number of definite integrals.
Finally, a well known result,
where is the Kronecker delta.
See also
Gradshteyn and Ryzhik
References
Toyesh Prakash Sharma, Etisha Sharma, "Putting Forward Another Generalization Of The Class Of Exponential Integrals And Their Applications.," International Journal of Scientific Research in Mathematical and Statistical Sciences, Vol.10, Issue.2, pp.1-8, 2023.
Further reading
Toyesh Prakash Sharma, https://www.isroset.org/pdf_paper_view.php?paper_id=2214&7-ISROSET-IJSRMSS-05130.pdf
External links
Wolfram Mathematica Online Integrator
Exp |
https://en.wikipedia.org/wiki/List%20of%20integrals%20of%20inverse%20hyperbolic%20functions | The following is a list of indefinite integrals (antiderivatives) of expressions involving the inverse hyperbolic functions. For a complete list of integral formulas, see lists of integrals.
In all formulas the constant is assumed to be nonzero, and denotes the constant of integration.
For each inverse hyperbolic integration formula below there is a corresponding formula in the list of integrals of inverse trigonometric functions.
The ISO 80000-2 standard uses the prefix "ar-" rather than "arc-" for the inverse hyperbolic functions; we do that here.
Inverse hyperbolic sine integration formulas
Inverse hyperbolic cosine integration formulas
Inverse hyperbolic tangent integration formulas
Inverse hyperbolic cotangent integration formulas
Inverse hyperbolic secant integration formulas
Inverse hyperbolic cosecant integration formulas
Area functions
Integrals of inverse hyperbolic functions |
https://en.wikipedia.org/wiki/List%20of%20integrals%20of%20inverse%20trigonometric%20functions | The following is a list of indefinite integrals (antiderivatives) of expressions involving the inverse trigonometric functions. For a complete list of integral formulas, see lists of integrals.
The inverse trigonometric functions are also known as the "arc functions".
C is used for the arbitrary constant of integration that can only be determined if something about the value of the integral at some point is known. Thus each function has an infinite number of antiderivatives.
There are three common notations for inverse trigonometric functions. The arcsine function, for instance, could be written as sin−1, asin, or, as is used on this page, arcsin.
For each inverse trigonometric integration formula below there is a corresponding formula in the list of integrals of inverse hyperbolic functions.
Arcsine function integration formulas
Arccosine function integration formulas
Arctangent function integration formulas
Arccotangent function integration formulas
Arcsecant function integration formulas
Arccosecant function integration formulas
See also
References
Arc functions |
https://en.wikipedia.org/wiki/List%20of%20integrals%20of%20logarithmic%20functions | The following is a list of integrals (antiderivative functions) of logarithmic functions. For a complete list of integral functions, see list of integrals.
Note: x > 0 is assumed throughout this article, and the constant of integration is omitted for simplicity.
Integrals involving only logarithmic functions
, the logarithmic integral.
Integrals involving logarithmic and power functions
, etc.
Integrals involving logarithmic and trigonometric functions
Integrals involving logarithmic and exponential functions
n consecutive integrations
For consecutive integrations, the formula
generalizes to
See also
References
Milton Abramowitz and Irene A. Stegun, Handbook of Mathematical Functions with Formulas, Graphs, and Mathematical Tables, 1964. A few integrals are listed on page 69.
Logarithmic functions |
https://en.wikipedia.org/wiki/List%20of%20integrals%20of%20hyperbolic%20functions | The following is a list of integrals (anti-derivative functions) of hyperbolic functions. For a complete list of integral functions, see list of integrals.
In all formulas the constant a is assumed to be nonzero, and C
denotes the constant of integration.
Integrals involving only hyperbolic sine functions
Integrals involving only hyperbolic cosine functions
or times The Logistic Function
Other integrals
Integrals of hyperbolic tangent, cotangent, secant, cosecant functions
Integrals involving hyperbolic sine and cosine functions
Integrals involving hyperbolic and trigonometric functions
Exponentials
Hyperbolic functions |
https://en.wikipedia.org/wiki/Nth%20root | In mathematics, taking the nth root is an operation involving two numbers, the radicand and the index or degree. Taking the nth root is written as , where is the radicand and n is the index (also sometimes called the degree). This is pronounced as "the nth root of x". The definition then of an nth root of a number x is a number r (the root) which, when raised to the power of the positive integer n, yields x:
A root of degree 2 is called a square root (usually written without the n as just ) and a root of degree 3, a cube root (written ). Roots of higher degree are referred by using ordinal numbers, as in fourth root, twentieth root, etc. The computation of an th root is a root extraction.
For example, 3 is a square root of 9, since 3 = 9, and −3 is also a square root of 9, since (−3) = 9.
Any non-zero number considered as a complex number has different complex th roots, including the real ones (at most two). The th root of 0 is zero for all positive integers , since . In particular, if is even and is a positive real number, one of its th roots is real and positive, one is negative, and the others (when ) are non-real complex numbers; if is even and is a negative real number, none of the th roots is real. If is odd and is real, one th root is real and has the same sign as , while the other () roots are not real. Finally, if is not real, then none of its th roots are real.
Roots of real numbers are usually written using the radical symbol or radix , with denoting the positive square root of if is positive; for higher roots, denotes the real th root if is odd, and the positive nth root if is even and is positive. In the other cases, the symbol is not commonly used as being ambiguous.
When complex th roots are considered, it is often useful to choose one of the roots, called principal root, as a principal value. The common choice is to choose the principal th root of as the th root with the greatest real part, and when there are two (for real and |
https://en.wikipedia.org/wiki/Reverse%20transcription%20polymerase%20chain%20reaction | Reverse transcription polymerase chain reaction (RT-PCR) is a laboratory technique combining reverse transcription of RNA into DNA (in this context called complementary DNA or cDNA) and amplification of specific DNA targets using polymerase chain reaction (PCR). It is primarily used to measure the amount of a specific RNA. This is achieved by monitoring the amplification reaction using fluorescence, a technique called real-time PCR or quantitative PCR (qPCR). Combined RT-PCR and qPCR are routinely used for analysis of gene expression and quantification of viral RNA in research and clinical settings.
The close association between RT-PCR and qPCR has led to metonymic use of the term qPCR to mean RT-PCR. Such use may be confusing, as RT-PCR can be used without qPCR, for example to enable molecular cloning, sequencing or simple detection of RNA. Conversely, qPCR may be used without RT-PCR, for example to quantify the copy number of a specific piece of DNA.
Nomenclature
The combined RT-PCR and qPCR technique has been described as quantitative RT-PCR or real-time RT-PCR (sometimes even called quantitative real-time RT-PCR), has been variously abbreviated as qRT-PCR, RT-qPCR, RRT-PCR, and rRT-PCR. In order to avoid confusion, the following abbreviations will be used consistently throughout this article:
Not all authors, especially earlier ones, use this convention and the reader should be cautious when following links. RT-PCR has been used to indicate both real-time PCR (qPCR) and reverse transcription PCR (RT-PCR).
History
Since its introduction in 1977, Northern blot has been used extensively for RNA quantification despite its shortcomings: (a) time-consuming technique, (b) requires a large quantity of RNA for detection, and (c) quantitatively inaccurate in the low abundance of RNA content. However, since PCR was invented by Kary Mullis in 1983, RT PCR has since displaced Northern blot as the method of choice for RNA detection and quantification.
RT-PCR has rise |
https://en.wikipedia.org/wiki/Index%20of%20cryptography%20articles | Articles related to cryptography include:
A
A5/1 •
A5/2 •
ABA digital signature guidelines •
ABC (stream cipher) •
Abraham Sinkov •
Acoustic cryptanalysis •
Adaptive chosen-ciphertext attack •
Adaptive chosen plaintext and chosen ciphertext attack •
Advantage (cryptography) •
ADFGVX cipher •
Adi Shamir •
Advanced Access Content System •
Advanced Encryption Standard •
Advanced Encryption Standard process •
Adversary •
AEAD block cipher modes of operation •
Affine cipher •
Agnes Meyer Driscoll •
AKA (security) •
Akelarre (cipher) •
Alan Turing •
Alastair Denniston •
Al Bhed language •
Alex Biryukov •
Alfred Menezes •
Algebraic Eraser •
Algorithmically random sequence •
Alice and Bob •
All-or-nothing transform •
Alphabetum Kaldeorum •
Alternating step generator •
American Cryptogram Association •
AN/CYZ-10 •
Anonymous publication •
Anonymous remailer •
Antoni Palluth •
Anubis (cipher) •
Argon2 •
ARIA (cipher) •
Arlington Hall •
Arne Beurling •
Arnold Cipher •
Array controller based encryption •
Arthur Scherbius •
Arvid Gerhard Damm •
Asiacrypt •
Atbash •
Attribute-based encryption •
Attack model •
Auguste Kerckhoffs •
Authenticated encryption •
Authentication •
Authorization certificate •
Autokey cipher •
Avalanche effect
B
B-Dienst •
Babington Plot •
Baby-step giant-step •
Bacon's cipher •
Banburismus •
Bart Preneel •
BaseKing •
BassOmatic •
BATON •
BB84 •
Beale ciphers •
BEAR and LION ciphers •
Beaufort cipher •
Beaumanor Hall •
Bent function •
Berlekamp–Massey algorithm •
Bernstein v. United States •
BestCrypt •
Biclique attack •
BID/60 •
BID 770 •
Bifid cipher •
Bill Weisband •
Binary Goppa code •
Biometric word list •
Birthday attack •
Bit-flipping attack •
BitTorrent protocol encryption •
Biuro Szyfrów •
Black Chamber •
Blaise de Vigenère •
Bletchley Park •
Blind credential •
Blinding (cryp |
https://en.wikipedia.org/wiki/DNA%20paternity%20testing | DNA paternity testing is the use of DNA profiles to determine whether an individual is the biological parent of another individual. Paternity testing can be especially important when the rights and duties of the father are in issue and a child's paternity is in doubt. Tests can also determine the likelihood of someone being a biological grandparent. Though genetic testing is the most reliable standard, older methods also exist, including ABO blood group typing, analysis of various other proteins and enzymes, or using human leukocyte antigen antigens. The current techniques for paternity testing are using polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP). Paternity testing can now also be performed while the woman is still pregnant from a blood draw.
DNA testing is currently the most advanced and accurate technology to determine parentage. In a DNA paternity test, the result (called the 'probability of parentage) is 0% when the alleged parent is not biologically related to the child, and the probability of parentage is typically 99.99% when the alleged parent is biologically related to the child. However, while almost all individuals have a single and distinct set of genes, rare individuals, known as "chimeras", have at least two different sets of genes, which can result in a false negative result if their reproductive tissue has a different genetic make-up from the tissue sampled for the test.
Paternity or maternity testing for child or adult
The DNA test is performed by collecting buccal (cheek) cells found on the inside of a person's cheek using a buccal or cheek swab. These swabs have wooden or plastic stick handles with a cotton on synthetic tip. The collector rubs the inside of a person's cheek to collect as many buccal cells as possible, which are then sent to a laboratory for testing. Samples from the alleged father or mother and the child would be needed.
Prenatal paternity testing for unborn child
Invasive prenatal pate |
https://en.wikipedia.org/wiki/Trace%20element |
A trace element is a chemical element of a minute quantity, a trace amount, especially used in referring to a micronutrient, but is also used to refer to minor elements in the composition of a rock, or other chemical substance.
In nutrition, trace elements are classified into two groups: essential trace elements, and non-essential trace elements. Essential trace elements are needed for many physiological and biochemical processes in both plants and animals. Not only do trace elements play a role in biological processes but they also serve as catalysts to engage in redox – oxidation and reduction mechanisms. Trace elements of some heavy metals have a biological role as essential micronutrients.
Types
The two types of trace element in biochemistry are classed as essential or non-essential.
Essential trace elements
An essential trace element is a dietary element, a mineral that is only needed in minute quantities for the proper growth, development, and physiology of the organism. The essential trace elements are those that are required to perform vital metabolic activities in organisms. Essential trace elements in human nutrition, and other animals include iron (Fe) (hemoglobin), copper (Cu) (respiratory pigments), cobalt (Co) (Vitamin B12), iodine, manganese (Mn) and zinc (Zn) (enzymes). Although they are essential, they become toxic at high concentrations.
Non-essential trace elements
Non-essential trace elements include silver (Ag), arsenic (As), cadmium (Cd), chromium (Cr), mercury (Hg), lead (Pb), and tin (Sn), and have no known biological function, with toxic effects even at low concentration.
The structural components of cells and tissues that are required in the diet in gram quantities daily are known as bulk elements.
See also
Antinutrient
Bowen's Kale
Geotraces
List of micronutrients
References
Analytical chemistry
Biochemistry
Geochemistry
Nutrition
Physiology |
https://en.wikipedia.org/wiki/Amenorrhea | Amenorrhea is the absence of a menstrual period in a female who has reached reproductive age. Physiological states of amenorrhoea are seen, most commonly, during pregnancy and lactation (breastfeeding). Outside the reproductive years, there is absence of menses during childhood and after menopause.
Amenorrhoea is a symptom with many potential causes. Primary amenorrhea is defined as an absence of secondary sexual characteristics by age 13 with no menarche or normal secondary sexual characteristics but no menarche by 15 years of age. It may be caused by developmental problems, such as the congenital absence of the uterus, failure of the ovary to receive or maintain egg cells, or delay in pubertal development. Secondary amenorrhoea, ceasing of menstrual cycles after menarche, is defined as the absence of menses for three months in a woman with previously normal menstruation, or six months for women with a history of oligomenorrhoea. It is often caused by hormonal disturbances from the hypothalamus and the pituitary gland, premature menopause, intrauterine scar formation, or eating disorders.
Pathophysiology
Although amenorrhea has multiple potential causes, ultimately, it is the result of hormonal imbalance or an anatomical abnormality.
Physiologically, menstruation is controlled by the release of gonadotropin-releasing hormone (GnRH) from the hypothalamus. GnRH acts on the pituitary to stimulate the release of follicle stimulating hormone (FSH) and luteinizing hormone (LH). FSH and LH then act on the ovaries to stimulate the production of estrogen and progesterone which, respectively, control the proliferative and secretary phases of the menstrual cycle. Prolactin also influences the menstrual cycle as it suppresses the release of LH and FSH from the pituitary. Similarly, thyroid hormone also affects the menstrual cycle. Low levels of thyroid hormone stimulate the release of TRH from the hypothalamus, which in turn increases both TSH and prolactin release. This i |
https://en.wikipedia.org/wiki/Vulnerability%20scanner | A vulnerability scanner is a computer program designed to assess computers, networks or applications for known weaknesses. These scanners are used to discover the weaknesses of a given system. They are utilized in the identification and detection of vulnerabilities arising from mis-configurations or flawed programming within a network-based asset such as a firewall, router, web server, application server, etc. Modern vulnerability scanners allow for both authenticated and unauthenticated scans. Modern scanners are typically available as SaaS (Software as a Service); provided over the internet and delivered as a web application. The modern vulnerability scanner often has the ability to customize vulnerability reports as well as the installed software, open ports, certificates and other host information that can be queried as part of its workflow.
Authenticated scans allow for the scanner to directly access network based assets using remote administrative protocols such as secure shell (SSH) or remote desktop protocol (RDP) and authenticate using provided system credentials. This allows the vulnerability scanner to access low-level data, such as specific services and configuration details of the host operating system. It's then able to provide detailed and accurate information about the operating system and installed software, including configuration issues and missing security patches.
Unauthenticated scans is a method that can result in a high number of false positives and is unable to provide detailed information about the assets operating system and installed software. This method is typically used by threat actors or security analyst trying determine the security posture of externally accessible assets.
The CIS Critical Security Controls for Effective Cyber Defense designates continuous vulnerability scanning as a critical control for effective cyber defense.
See also
Browser security
Computer emergency response team
Information security
Internet secu |
https://en.wikipedia.org/wiki/Appetite | Appetite is the desire to eat food items, usually due to hunger. Appealing foods can stimulate appetite even when hunger is absent, although appetite can be greatly reduced by satiety. Appetite exists in all higher life-forms, and serves to regulate adequate energy intake to maintain metabolic needs. It is regulated by a close interplay between the digestive tract, adipose tissue and the brain. Appetite has a relationship with every individual's behavior. Appetitive behaviour also known as approach behaviour, and consummatory behaviour, are the only processes that involve energy intake, whereas all other behaviours affect the release of energy. When stressed, appetite levels may increase and result in an increase of food intake. Decreased desire to eat is termed anorexia, while polyphagia (or "hyperphagia") is increased eating. Dysregulation of appetite contributes to anorexia nervosa, bulimia nervosa, cachexia, overeating, and binge eating disorder.
Role in disease
A limited or excessive appetite is not necessarily pathological. Abnormal appetite could be defined as eating habits causing malnutrition and related conditions such as obesity and its related problems.
Both genetic and environmental factors may regulate appetite, and abnormalities in either may lead to abnormal appetite. Poor appetite (anorexia) can have numerous causes, but may be a result of physical (infectious, autoimmune or malignant disease) or psychological (stress, mental disorders) factors. Likewise, hyperphagia (excessive eating) may be a result of hormonal imbalances, mental disorders (e.g., depression) and others. Dyspepsia, also known as indigestion, can also affect appetite as one of its symptoms is feeling "overly full" soon after beginning a meal. Taste and smell ("dysgeusia", bad taste) or the lack thereof may also effect appetite.
Abnormal appetite may also be linked to genetics on a chromosomal scale, shown by the 1950s discovery of Prader–Willi syndrome, a type of obesity caused b |
https://en.wikipedia.org/wiki/Suction | Suction is the result of air pressure differential between areas.
Removing air from a space results in a pressure differential. Suction pressure is therefore limited by external air pressure. Even a perfect vacuum cannot suck with more pressure than is available in the surrounding environment. Suctions can form on the sea, for example, when a ship founders.
When the pressure in one part of a physical system is reduced relative to another, the fluid in the higher pressure region will exert a force relative to the region of lowered pressure, referred to as pressure-gradient force. Pressure reduction may be static, as in a piston and cylinder arrangement, or dynamic, as in the case of a vacuum cleaner when air flow results in a reduced pressure region.
When animals breathe, the diaphragm and muscles around the rib cage cause a change of volume in the lungs. The increased volume of the chest cavity decreases the pressure inside, creating an imbalance with the ambient air pressure, resulting in suction.
See also
Pump
Vacuum pump
Suction devices used in medicine
Implosion
Suction cup
Suction cupping
References
Physical quantities
Units of pressure
Vacuum |
https://en.wikipedia.org/wiki/Rendezvous%20problem | The rendezvous dilemma is a logical dilemma, typically formulated in this way:
Two people have a date in a park they have never been to before. Arriving separately in the park, they are both surprised to discover that it is a huge area and consequently they cannot find one another. In this situation each person has to choose between waiting in a fixed place in the hope that the other will find them, or else starting to look for the other in the hope that they have chosen to wait somewhere.
If they both choose to wait, they will never meet. If they both choose to walk there are chances that they meet and chances that they do not. If one chooses to wait and the other chooses to walk, then there is a theoretical certainty that they will meet eventually; in practice, though, it may take too long for it to be guaranteed. The question posed, then, is: what strategies should they choose to maximize their probability of meeting?
Examples of this class of problems are known as rendezvous problems. These problems were first introduced informally by Steve Alpern in 1976, and he formalised the continuous version of the problem in 1995. This has led to much recent research in rendezvous search. Even the symmetric rendezvous problem played in n discrete locations (sometimes called the Mozart Cafe Rendezvous Problem) has turned out to be very difficult to solve, and in 1990 Richard Weber and Eddie Anderson conjectured the optimal strategy. In 2012 the conjecture was proved for n = 3 by Richard Weber. This was the first non-trivial symmetric rendezvous search problem to be fully solved. Note that the corresponding asymmetric rendezvous problem has a simple optimal solution: one player stays put and the other player visits a random permutation of the locations.
As well as being problems of theoretical interest, rendezvous problems include real-world problems with applications in the fields of synchronization, operating system design, operations research, and even search and re |
https://en.wikipedia.org/wiki/Rubber-hose%20cryptanalysis | In cryptography, rubber-hose cryptanalysis is a euphemism for the extraction of cryptographic secrets (e.g. the password to an encrypted file) from a person by coercion or torture—such as beating that person with a rubber hose, hence the name—in contrast to a mathematical or technical cryptanalytic attack.
Details
According to Amnesty International and the UN, many countries in the world routinely torture people. It is therefore logical to assume that at least some of those countries use (or would be willing to use) some form of rubber-hose cryptanalysis. In practice, psychological coercion can prove as effective as physical torture. Not physically violent but highly intimidating methods include such tactics as the threat of harsh legal penalties. The incentive to cooperate may be some form of plea bargain, such as an offer to drop or reduce criminal charges against a suspect in return for full co-operation with investigators. Alternatively, in some countries threats may be made to prosecute as co-conspirators (or inflict violence upon) close relatives (e.g. spouse, children, or parents) of the person being questioned unless they co-operate.
In some contexts, rubber-hose cryptanalysis may not be a viable attack because of a need to decrypt data covertly; information such as a password may lose its value if it is known to have been compromised. It has been argued that one of the purposes of strong cryptography is to force adversaries to resort to less covert attacks.
The earliest known use of the term was on the sci.crypt newsgroup, in a message posted 16 October 1990 by Marcus J. Ranum, alluding to corporal punishment:
Although the term is used tongue-in-cheek, its implications are serious: in modern cryptosystems, the weakest link is often the human user. A direct attack on a cipher algorithm, or the cryptographic protocols used, is likely to be much more expensive and difficult than targeting the people who use or manage the system. Thus, many cryptosystem |
https://en.wikipedia.org/wiki/Corporate%20governance | Corporate governance are mechanisms, processes and relations by which corporations are controlled and operated ("governed").
Definitions
"Corporate governance" may be defined, described or delineated in diverse ways, depending on the writer's purpose. Writers focused on a disciplinary interest or context (such as accounting, finance, law, or management) often adopt narrow definitions that appear purpose-specific. Writers concerned with regulatory policy in relation to corporate governance practices often use broader structural descriptions. A broad (meta) definition that encompasses many adopted definitions is "Corporate governance describes the processes, structures, and mechanisms that influence the control and direction of corporations."
This meta definition accommodates both the narrow definitions used in specific contexts and the broader descriptions that are often presented as authoritative. The latter include: the structural definition from the Cadbury Report, which identifies corporate governance as "the system by which companies are directed and controlled" (Cadbury 1992, p. 15); and the relational-structural view adopted by the Organization for Economic Cooperation and Development (OECD) of "Corporate governance involves a set of relationships between a company's management, its board, its shareholders and other stakeholders. Corporate governance also provides the structure through which the objectives of the company are set, and the means of attaining those objectives and monitoring performance are determined" (OECD 2015, p. 9).
Examples of narrower definitions in particular contexts include:
"a system of law and sound approaches by which corporations are directed and controlled focusing on the internal and external corporate structures with the intention of monitoring the actions of management and directors and thereby, mitigating agency risks which may stem from the misdeeds of corporate officers."
"the set of conditions that shapes the ex post bar |
https://en.wikipedia.org/wiki/Sensor | A sensor is a device that produces an output signal for the purpose of sensing a physical phenomenon.
In the broadest definition, a sensor is a device, module, machine, or subsystem that detects events or changes in its environment and sends the information to other electronics, frequently a computer processor.
Sensors are used in everyday objects such as touch-sensitive elevator buttons (tactile sensor) and lamps which dim or brighten by touching the base, and in innumerable applications of which most people are never aware. With advances in micromachinery and easy-to-use microcontroller platforms, the uses of sensors have expanded beyond the traditional fields of temperature, pressure and flow measurement, for example into MARG sensors.
Analog sensors such as potentiometers and force-sensing resistors are still widely used. Their applications include manufacturing and machinery, airplanes and aerospace, cars, medicine, robotics and many other aspects of our day-to-day life. There is a wide range of other sensors that measure chemical and physical properties of materials, including optical sensors for refractive index measurement, vibrational sensors for fluid viscosity measurement, and electro-chemical sensors for monitoring pH of fluids.
A sensor's sensitivity indicates how much its output changes when the input quantity it measures changes. For instance, if the mercury in a thermometer moves 1 cm when the temperature changes by 1 °C, its sensitivity is 1 cm/°C (it is basically the slope assuming a linear characteristic). Some sensors can also affect what they measure; for instance, a room temperature thermometer inserted into a hot cup of liquid cools the liquid while the liquid heats the thermometer. Sensors are usually designed to have a small effect on what is measured; making the sensor smaller often improves this and may introduce other advantages.
Technological progress allows more and more sensors to be manufactured on a microscopic scale as micr |
https://en.wikipedia.org/wiki/Outsourcing | Outsourcing is an agreement in which one company hires another company to be responsible for a planned or existing activity which otherwise is or could be carried out internally, i.e. in-house, and sometimes involves transferring employees and assets from one firm to another. The term outsourcing, which came from the phrase outside resourcing, originated no later than 1981. The concept, which The Economist says has "made its presence felt since the time of the Second World War", often involves the contracting out of a business process (e.g., payroll processing, claims processing), operational, and/or non-core functions, such as manufacturing, facility management, call center/call center support.
The practice of handing over control of public services to private enterprises (privatization), even if conducted on a limited, short-term basis, may also be described as outsourcing.
Outsourcing includes both foreign and domestic contracting, and sometimes includes offshoring (relocating a business function to a distant country) or nearshoring (transferring a business process to a nearby country). Offshoring and outsourcing are not mutually inclusive; one can exist without the other. They can be intertwined (offshore outsourcing), and can be individually or jointly, partially or completely reversed, in methods including those known as reshoring, inshoring, and insourcing.
Terminology
Offshoring is moving the work to a distant country. If the distant workplace is a foreign subsidiary/owned by the company, then the offshore operation is a , sometimes referred to as in-house offshore.
is the practice of hiring an external organization to perform some business functions ('outsourcing') in a country other than the one where the products or services are actually performed, developed or manufactured ('offshore').
Insourcing entails bringing processes handled by third-party firms in-house, and is sometimes accomplished via vertical integration.
Nearshoring refers to outsour |
https://en.wikipedia.org/wiki/Short%20circuit | A short circuit (sometimes abbreviated to short or s/c) is an electrical circuit that allows a current to travel along an unintended path with no or very low electrical impedance. This results in an excessive current flowing through the circuit.
The opposite of a short circuit is an open circuit, which is an infinite resistance (or very high impedance) between two nodes.
Definition
A short circuit is an abnormal connection between two nodes of an electric circuit intended to be at different voltages. This results in an electric current limited only by the Thévenin equivalent resistance of the rest of the network which can cause circuit damage, overheating, fire or explosion. Although usually the result of a fault, there are cases where short circuits are caused intentionally, for example, for the purpose of voltage-sensing crowbar circuit protectors.
In circuit analysis, a short circuit is defined as a connection between two nodes that forces them to be at the same voltage. In an 'ideal' short circuit, this means there is no resistance and thus no voltage drop across the connection. In real circuits, the result is a connection with almost no resistance. In such a case, the current is limited only by the resistance of the rest of the circuit.
Examples
A common type of short circuit occurs when the positive and negative terminals of a battery are connected with a low-resistance conductor, like a wire. With a low resistance in the connection, a high current will flow, causing the delivery of a large amount of energy in a short period of time.
A high current flowing through a battery can cause a rapid increase of temperature, potentially resulting in an explosion with the release of hydrogen gas and electrolyte (an acid or a base), which can burn tissue and cause blindness or even death. Overloaded wires will also overheat causing damage to the wire's insulation, or starting a fire.
In electrical devices, unintentional short circuits are usually caused when a w |
https://en.wikipedia.org/wiki/Thurston%20elliptization%20conjecture | William Thurston's elliptization conjecture states that a closed 3-manifold with finite fundamental group is spherical, i.e. has a Riemannian metric of constant positive sectional curvature.
Relation to other conjectures
A 3-manifold with a Riemannian metric of constant positive sectional curvature is covered by the 3-sphere, moreover the group of covering transformations are isometries of the 3-sphere.
If the original 3-manifold had in fact a trivial fundamental group, then it is homeomorphic to the 3-sphere (via the covering map). Thus, proving the elliptization conjecture would prove the Poincaré conjecture as a corollary. In fact, the elliptization conjecture is logically equivalent to two simpler conjectures: the Poincaré conjecture and the spherical space form conjecture.
The elliptization conjecture is a special case of Thurston's geometrization conjecture, which was proved in 2003 by G. Perelman.
References
For the proof of the conjectures, see the references in the articles on geometrization conjecture or Poincaré conjecture.
William Thurston. Three-dimensional geometry and topology. Vol. 1. Edited by Silvio Levy. Princeton Mathematical Series, 35. Princeton University Press, Princeton, NJ, 1997. x+311 pp. .
William Thurston. The Geometry and Topology of Three-Manifolds, 1980 Princeton lecture notes on geometric structures on 3-manifolds, that states his elliptization conjecture near the beginning of section 3.
Riemannian geometry
3-manifolds
Conjectures that have been proved |
https://en.wikipedia.org/wiki/Unitary%20transformation | In mathematics, a unitary transformation is a transformation that preserves the inner product: the inner product of two vectors before the transformation is equal to their inner product after the transformation.
Formal definition
More precisely, a unitary transformation is an isomorphism between two inner product spaces (such as Hilbert spaces). In other words, a unitary transformation is a bijective function
between two inner product spaces, and such that
Properties
A unitary transformation is an isometry, as one can see by setting in this formula.
Unitary operator
In the case when and are the same space, a unitary transformation is an automorphism of that Hilbert space, and then it is also called a unitary operator.
Antiunitary transformation
A closely related notion is that of antiunitary transformation, which is a bijective function
between two complex Hilbert spaces such that
for all and in , where the horizontal bar represents the complex conjugate.
See also
Antiunitary
Orthogonal transformation
Time reversal
Unitary group
Unitary operator
Unitary matrix
Wigner's theorem
Unitary transformations in quantum mechanics
Linear algebra
Functional analysis
ru:Унитарное преобразование |
https://en.wikipedia.org/wiki/Unary%20coding | Unary coding, or the unary numeral system and also sometimes called thermometer code, is an entropy encoding that represents a natural number, n, with a code of length n + 1 ( or n ), usually n ones followed by a zero (if natural number is understood as non-negative integer) or with n − 1 ones followed by a zero (if natural number is understood as strictly positive integer). For example 5 is represented as 111110 or 11110. Some representations use n or n − 1 zeros followed by a one. The ones and zeros are interchangeable without loss of generality. Unary coding is both a prefix-free code and a self-synchronizing code.
Unary coding is an optimally efficient encoding for the following discrete probability distribution
for .
In symbol-by-symbol coding, it is optimal for any geometric distribution
for which k ≥ φ = 1.61803398879…, the golden ratio, or, more generally, for any discrete distribution for which
for . Although it is the optimal symbol-by-symbol coding for such probability distributions, Golomb coding achieves better compression capability for the geometric distribution because it does not consider input symbols independently, but rather implicitly groups the inputs. For the same reason, arithmetic encoding performs better for general probability distributions, as in the last case above.
Unary code in use today
Examples of unary code uses include:
In Golomb Rice code, unary encoding is used to encode the quotient part of the Golomb code word.
In UTF-8, unary encoding is used in the leading byte of a multi-byte sequence to indicate the number of bytes in the sequence so that the length of the sequence can be determined without examining the continuation bytes.
Instantaneously trained neural networks use unary coding for efficient data representation.
Unary coding in biological networks
Unary coding is used in the neural circuits responsible for birdsong production. The nucleus in the brain of the songbirds that plays a part in both the learning a |
https://en.wikipedia.org/wiki/Subsequence | In mathematics, a subsequence of a given sequence is a sequence that can be derived from the given sequence by deleting some or no elements without changing the order of the remaining elements. For example, the sequence is a subsequence of obtained after removal of elements and The relation of one sequence being the subsequence of another is a preorder.
Subsequences can contain consecutive elements which were not consecutive in the original sequence. A subsequence which consists of a consecutive run of elements from the original sequence, such as from is a substring. The substring is a refinement of the subsequence.
The list of all subsequences for the word "apple" would be "a", "ap", "al", "ae", "app", "apl", "ape", "ale", "appl", "appe", "aple", "apple", "p", "pp", "pl", "pe", "ppl", "ppe", "ple", "pple", "l", "le", "e", "" (empty string).
Common subsequence
Given two sequences and a sequence is said to be a common subsequence of and if is a subsequence of both and For example, if
then is said to be a common subsequence of and
This would be the longest common subsequence, since only has length 3, and the common subsequence has length 4. The longest common subsequence of and is
Applications
Subsequences have applications to computer science, especially in the discipline of bioinformatics, where computers are used to compare, analyze, and store DNA, RNA, and protein sequences.
Take two sequences of DNA containing 37 elements, say:
SEQ1 = ACGGTGTCGTGCTATGCTGATGCTGACTTATATGCTA
SEQ2 = CGTTCGGCTATCGTACGTTCTATTCTATGATTTCTAA
The longest common subsequence of sequences 1 and 2 is:
LCS(SEQ1,SEQ2) = CGTTCGGCTATGCTTCTACTTATTCTA
This can be illustrated by highlighting the 27 elements of the longest common subsequence into the initial sequences:
SEQ1 = AGGTGAGGAG
SEQ2 = CTAGTTAGTA
Another way to show this is to align the two sequences, that is, to position elements of the longest common subsequence in a same column (indicated by the vert |
https://en.wikipedia.org/wiki/Longest%20common%20subsequence | A longest common subsequence (LCS) is the longest subsequence common to all sequences in a set of sequences (often just two sequences). It differs from the longest common substring: unlike substrings, subsequences are not required to occupy consecutive positions within the original sequences. The problem of computing longest common subsequences is a classic computer science problem, the basis of data comparison programs such as the diff utility, and has applications in computational linguistics and bioinformatics. It is also widely used by revision control systems such as Git for reconciling multiple changes made to a revision-controlled collection of files.
For example, consider the sequences (ABCD) and (ACBAD). They have 5 length-2 common subsequences: (AB), (AC), (AD), (BD), and (CD); 2 length-3 common subsequences: (ABD) and (ACD); and no longer common subsequences. So (ABD) and (ACD) are their longest common subsequences.
Complexity
For the general case of an arbitrary number of input sequences, the problem is NP-hard. When the number of sequences is constant, the problem is solvable in polynomial time by dynamic programming.
Given sequences of lengths , a naive search would test each of the subsequences of the first sequence to determine whether they are also subsequences of the remaining sequences; each subsequence may be tested in time linear in the lengths of the remaining sequences, so the time for this algorithm would be
For the case of two sequences of n and m elements, the running time of the dynamic programming approach is O(n × m). For an arbitrary number of input sequences, the dynamic programming approach gives a solution in
There exist methods with lower complexity,
which often depend on the length of the LCS, the size of the alphabet, or both.
The LCS is not necessarily unique; in the worst case, the number of common subsequences is exponential in the lengths of the inputs, so the algorithmic complexity must be at least exponential.
Sol |
https://en.wikipedia.org/wiki/Plone%20%28software%29 | Plone is a free and open source content management system (CMS) built on top of the Zope application server. Plone is positioned as an enterprise CMS and is commonly used for intranets and as part of the web presence of large organizations. High-profile public sector users include the U.S. Federal Bureau of Investigation, Brazilian Government, United Nations, City of Bern (Switzerland), New South Wales Government (Australia), and European Environment Agency. Plone's proponents cite its security track record and its accessibility as reasons to choose Plone.
Plone has a long tradition of development happening in so-called "sprints", in-person meetings of developers over the course of several days, the first having been held in 2003 and nine taking place in 2014. The largest sprint of the year is the sprint immediately following the annual conference. Certain other sprints are considered strategic so are funded directly by the Plone Foundation, although very few attendees are sponsored directly. The Plone Foundation also holds and enforces all copyrights and trademarks in Plone, and is assisted by legal counsel from the Software Freedom Law Center.
History
The Plone project began in 1999 by Alexander Limi, Alan Runyan, and Vidar Andersen. It was made as a usability layer on top of the Zope Content Management Framework. The first version was released in 2001. The project quickly grew into a community, receiving plenty of new add-on products from its users. The increase in community led to the creation of the annual Plone conference in 2003, which is still running today. In addition, "sprints" are held, where groups of developers meet to work on Plone, ranging from a couple of days to a week. In March 2004, Plone 2.0 was released. This release brought more customizable features to Plone, and enhanced the add-on functions. In May 2004, the Plone Foundation was created for the development, marketing, and protection of Plone. The Foundation has ownership rights over th |
https://en.wikipedia.org/wiki/AOLserver | AOLserver is AOL's open source web server. AOLserver is
multithreaded, Tcl-enabled, and used for large scale, dynamic web sites.
AOLserver is distributed under the Mozilla Public License.
AOLserver was originally developed by NaviSoft under the name "NaviServer", but changed names when AOL bought the company in 1995. Philip Greenspun convinced America Online to open-source the program in 1999.
AOLserver was the first HTTP server program to combine multithreading, a built-in scripting language, and the pooling of persistent database connections. For database-backed Web sites, this enabled performance improvements of 100× compared to the standard practices at the time of CGI scripts that opened fresh database connections on every page load. Eventually other HTTP server programs were able to achieve similar performance with a similar architecture.
AOLserver is a key component in the Open Architecture Community System (OpenACS) which is an advanced open-source toolkit for developing web applications.
In September 2007, a port of AOLserver for the iPhone was made available and later forked under the name "Joggame Server". This fork is described on its SourceForge project page as being a spin-off of AOLserver for devices.
NaviServer (also hosted on SourceForge) is a fork of AOLserver.
See also
Comparison of web server software
OpenACS
References
External links
SourceForge Project: AOLserver
Python for AOLserver
AOLserver Wiki
PHP on AOLserver
AOLserver Public License
NaviServer Fork Project Homepage
AOL
Cross-platform software
Free software programmed in C
Free software programmed in Tcl
Free web server software |
https://en.wikipedia.org/wiki/Internet%20Group%20Management%20Protocol | The Internet Group Management Protocol (IGMP) is a communications protocol used by hosts and adjacent routers on IPv4 networks to establish multicast group memberships. IGMP is an integral part of IP multicast and allows the network to direct multicast transmissions only to hosts that have requested them.
IGMP can be used for one-to-many networking applications such as online streaming video and gaming, and allows more efficient use of resources when supporting these types of applications.
IGMP is used on IPv4 networks. Multicast management on IPv6 networks is handled by Multicast Listener Discovery (MLD) which is a part of ICMPv6 in contrast to IGMP's bare IP encapsulation.
Architecture
A network designed to deliver a multicast service using IGMP might use this basic architecture:
IGMP operates between a host and a local multicast router. Switches featuring IGMP snooping also derive useful information by observing these IGMP transactions. Protocol Independent Multicast (PIM) is then used between the local and remote multicast routers to direct multicast traffic from hosts sending multicasts to hosts that have registered through IGMP to receive them.
IGMP operates on the network layer (layer 3), just the same as other network management protocols like ICMP.
The IGMP protocol is implemented on hosts and within routers. A host requests membership to a group through its local router while a router listens for these requests and periodically sends out subscription queries. A single router per subnet is elected to perform this querying function. Some multilayer switches include an IGMP querier capability to allow their IGMP snooping features to work in the absence of an IGMP-capable router in the layer 2 network.
IGMP is vulnerable to some attacks, and firewalls commonly allow the user to disable it if not needed.
Versions
There are three versions of IGMP.
IGMPv1 was defined in 1989. IGMPv2, defined in 1997, improves IGMPv1 by adding the ability for a host to sig |
https://en.wikipedia.org/wiki/Postdigital | Postdigital, in artistic practice, is an attitude that is more concerned with being human, than with being digital, similar to the concept of "undigital" introduced in 1995, where technology and society advances beyond digital limitations to achieve a totally fluid multimediated reality that is free from artefacts of digital computation (quantization noise, pixelation, etc.).
Postdigital is concerned with our rapidly changed and changing relationships with digital technologies and art forms. If one examines the textual paradigm of consensus, one is faced with a choice: either the "postdigital" society has intrinsic meaning, or it is contextualised into a paradigm of consensus that includes art as a totality.
Theory
Giorgio Agamben (2002) describes paradigms as things that we think with, rather than things we think about. Like the computer age, the postdigital is also a paradigm, but as with post-humanism for example, an understanding of postdigital does not aim to describe a life after digital, but rather, attempts to describe the present-day opportunity to explore the consequences of the digital and of the computer age. While the computer age has enhanced human capacity with inviting and uncanny prosthetics, the postdigital may provide a paradigm with which it is possible to examine and understand this enhancement.
In The Future of Art in a Postdigital Age, Mel Alexenberg defines "postdigital art" as artworks that address the humanization of digital technologies through interplay between digital, biological, cultural, and spiritual systems, between cyberspace and real space, between embodied media and mixed reality in social and physical communication, between high tech and high touch experiences, between visual, haptic, auditory, and kinesthetic media experiences, between virtual and augmented reality, between roots and globalization, between autoethnography and community narrative, and between web-enabled peer-produced wikiart and artworks created with alter |
https://en.wikipedia.org/wiki/Crumple%20zone | Crumple zones, crush zones, or crash zones are a structural safety feature used in vehicles, mainly in automobiles, to increase the time over which a change in velocity (and consequently momentum) occurs from the impact during a collision by a controlled deformation; in recent years, it is also incorporated into trains and railcars.
Crumple zones are designed to increase the time over which the total force from the change in momentum is applied to an occupant, as the average force applied to the occupants is inversely related to the time over which it is applied. The physics involved can be expressed by the equation:
where is the force, is the time, is the mass, and is the velocity of the body. In SI units, force is measured in Newtons, time in seconds, mass in kilograms, velocity in metres per second, and the resulting impulse is measured in newton seconds (N⋅s).
Typically, crumple zones are located in the front part of the vehicle, to absorb the impact of a head-on collision, but they may be found on other parts of the vehicle as well. According to a British Motor Insurance Repair Research Centre study of where on the vehicle impact damage occurs, 65% were front impacts, 25% rear impacts, 5% left-side, and 5% right-side. Some racing cars use aluminium, composite/carbon fibre honeycomb, or energy absorbing foam to form an impact attenuator that dissipates crash energy using a much smaller volume and lower weight than road car crumple zones. Impact attenuators have also been introduced on highway maintenance vehicles in some countries.
On September 10, 2009, the ABC News programs Good Morning America and World News showed a U.S. Insurance Institute for Highway Safety crash test of a 2009 Chevrolet Malibu in an offset head-on collision with a 1959 Chevrolet Bel Air sedan. It dramatically demonstrated the effectiveness of modern car safety design over 1950s design, particularly of rigid passenger safety cells and crumple zones.
Early development history
The |
https://en.wikipedia.org/wiki/Kaiser%20window | The Kaiser window, also known as the Kaiser–Bessel window, was developed by James Kaiser at Bell Laboratories. It is a one-parameter family of window functions used in finite impulse response filter design and spectral analysis. The Kaiser window approximates the DPSS window which maximizes the energy concentration in the main lobe but which is difficult to compute.
Definition
The Kaiser window and its Fourier transform are given by:
where:
is the zeroth-order modified Bessel function of the first kind,
is the window duration, and
is a non-negative real number that determines the shape of the window. In the frequency domain, it determines the trade-off between main-lobe width and side lobe level, which is a central decision in window design.
Sometimes the Kaiser window is parametrized by , where .
For digital signal processing, the function can be sampled symmetrically as:
where the length of the window is and N can be even or odd. (see A list of window functions)
In the Fourier transform, the first null after the main lobe occurs at which is just in units of N (DFT "bins"). As α increases, the main lobe increases in width, and the side lobes decrease in amplitude. = 0 corresponds to a rectangular window. For large the shape of the Kaiser window (in both time and frequency domain) tends to a Gaussian curve. The Kaiser window is nearly optimal in the sense of its peak's concentration around frequency
Kaiser–Bessel-derived (KBD) window
A related window function is the Kaiser–Bessel-derived (KBD) window, which is designed to be suitable for use with the modified discrete cosine transform (MDCT). The KBD window function is defined in terms of the Kaiser window of length N+1, by the formula:
This defines a window of length 2N, where by construction dn satisfies the Princen-Bradley condition for the MDCT (using the fact that ): (interpreting n and n + N modulo 2N). The KBD window is also symmetric in the proper manner for the MDCT: dn = d2N |
https://en.wikipedia.org/wiki/Roger%20Cotes | Roger Cotes (10 July 1682 – 5 June 1716) was an English mathematician, known for working closely with Isaac Newton by proofreading the second edition of his famous book, the Principia, before publication. He also invented the quadrature formulas known as Newton–Cotes formulas, and made a geometric argument that can be interpreted as a logarithmic version of Euler's formula. He was the first Plumian Professor at Cambridge University from 1707 until his death.
Early life
Cotes was born in Burbage, Leicestershire. His parents were Robert, the rector of Burbage, and his wife, Grace, née Farmer. Roger had an elder brother, Anthony (born 1681), and a younger sister, Susanna (born 1683), both of whom died young. At first Roger attended Leicester School, where his mathematical talent was recognised. His aunt Hannah had married Rev. John Smith, and Smith took on the role of tutor to encourage Roger's talent. The Smiths' son, Robert Smith, became a close associate of Roger Cotes throughout his life. Cotes later studied at St Paul's School in London and entered Trinity College, Cambridge, in 1699. He graduated BA in 1702 and MA in 1706.
Astronomy
Roger Cotes's contributions to modern computational methods lie heavily in the fields of astronomy and mathematics. Cotes began his educational career with a focus on astronomy. He became a fellow of Trinity College in 1707, and at age 26 he became the first Plumian Professor of Astronomy and Experimental Philosophy. On his appointment to professor, he opened a subscription list in an effort to provide an observatory for Trinity. Unfortunately, the observatory was still unfinished when Cotes died, and was demolished in 1797.
In correspondence with Isaac Newton, Cotes designed a heliostat telescope with a mirror revolving by clockwork. He recomputed the solar and planetary tables of Giovanni Domenico Cassini and John Flamsteed, and he intended to create tables of the moon's motion, based on Newtonian principles. Finally, in 1707 he |
https://en.wikipedia.org/wiki/3DMark | 3DMark is a computer benchmarking tool created and developed by UL, (formerly Futuremark), to determine the performance of a computer's 3D graphic rendering and CPU workload processing capabilities. Running 3DMark produces a 3DMark score, with higher numbers indicating better performance. The 3DMark measurement unit is intended to give a normalized means for comparing different PC hardware configurations (mostly graphics processing units and central processing units), which proponents such as gamers and overclocking enthusiasts assert is indicative of end-user performance capabilities.
Many versions of 3DMark have been released since 1998. Scores cannot be compared across versions as each test is based on a specific version of the DirectX API. 3DMark 11 and earlier versions, being no longer suitable to test modern hardware, have been made available as freeware by providing keys to unlock the full version on the UL website.
Versions
See also
Benchmark (computing)
PCMark
Futuremark
References
External links
3DMark website
UL benchmarks
1998 software
Benchmarks (computing)
Software developed in Finland |
https://en.wikipedia.org/wiki/Design%20choice | In engineering, a design choice is a possible solution to a problem. Given a design task and a governing set of criteria (design specifications), several conceptual designs may be drafted. Each of these preliminary concepts is a potential design choice. Many never advance beyond the preliminary phase; those that are developed to the point at which they could be applied become the pool from which the final selection is made. This process stems from the principle that there is usually no uniquely right way of accomplishing any task. The final selection is often made on a financial basis; i.e., the least expensive design is chosen in a bid process.
In civil engineering, design choices typically derive from basic principles of materials science and structural design. A suspension bridge, for example, uses the fact that steel is extremely efficient in tension, while a prestressed concrete bridge takes advantage of concrete's relatively low cost by weight and its ability to sustain high compressive loading (see compression).
Engineering concepts
Design |
https://en.wikipedia.org/wiki/Polyphase%20quadrature%20filter | A polyphase quadrature filter, or PQF, is a filter bank which splits an input signal into a given number N (mostly a power of 2) of equidistant sub-bands. A factor of N subsamples these sub-bands, so they are critically sampled.
An important application of the polyphase filters (of FIR type) concerns the filtering and decimation of large band (and so high sample rate) input signals, e.g. coming from a high rate ADC, which can not be directly processed by an FPGA or in some case by an ASIC either. Suppose the ADC plus FPGA/ASIC interface implements a demultiplexer of the ADC samples in N internal FPGA/ASIC registers. In that case, the polyphase filter transforms the decimator FIR filter canonic structure in N parallel branches clocked at 1/N of the ADC clock, allowing digital processing when N=Clock(ADC)/Clock(FPGA).
This critical sampling introduces aliasing. Similar to the MDCT time domain alias cancellation the aliasing of polyphase quadrature filters is canceled by neighbouring sub-bands, i.e. signals are typically stored in two sub-bands.
Note that signal in odd subbands is stored frequency inverted.
PQF filters are used in MPEG-1 Audio Layer I and II, Musepack (which was based on MPEG-1 layer II), in MPEG-1 Layer III with an additional MDCT, in MPEG-4 AAC-SSR for the 4 band PQF bank, in MPEG-4 V3 SBR
for the analysis of the upper spectral replicated band, and in DTS.
PQF has an advantage over the very similar stacked quadrature mirror filter (QMF). Delay and computational effort are much lower.
A PQF filter bank is constructed using a base filter, which is a low-pass at fs/4N. This lowpass is modulated by N cosine functions and converted to N band-passes with a bandwidth of fs/2N.
The base lowpass is typically a FIR filter with a length of 10*N ... 24*N taps. Note that it is also possible to build PQF filters using recursive IIR filters.
Computation
There are different formulas possible. Most of them are based on the MDCT but are slightly modified.
Ref |
https://en.wikipedia.org/wiki/Specified%20load | In civil engineering, specified loads are the best estimate of the actual loads a structure is expected to carry. These loads come in many different forms, such as people, equipment, vehicles, wind, rain, snow, earthquakes, the building materials themselves, etc. Specified Loads also known as Characteristic loads in many cases.
Buildings will be subject to loads from various sources. The principal ones can be classified as live loads (loads which are not always present in the structure), dead loads (loads which are permanent and immovable excepting redesign or renovation) and wind load, as described below. In some cases structures may be subject to other loads, such as those due to earthquakes or pressures from retained material. The expected maximum magnitude of each is referred to as the characteristic load.
Dead loads are those representing the self weight of the building; their magnitude can be estimated on the basis of material densities and component sizes.
Dead loads are those due to the self weight of the structure and any permanent fittings and finishes. It is generally possible to quantify the magnitude of dead loads with a reasonable degree of confidence.
Imposed loads are those associated with occupation and use of the building; their magnitude is less clearly defined and is generally related to the use of the building.
A good example of specified loads would be the following simplified floor to ceiling sandwich load table (based on the National Building Code of Canada standards):
Floor Finish (Terrazzo) per 10 mm thickness = 0.24 kN/m^2
Reinforced Concrete per 10 mm thickness = 0.24 kN/m^2
Mechanical Services = 0.14 kN/m^2
Electrical Services = 0.10 kN/m^2
Floor Area (110 mm thickness) = 8 m^2
Total Dead Load = (0.24 + 11*0.24 + 0.14 + 0.10)*8 = 24.96 kN
In order to design to these loads, one would need to convert them to design loads by applying Load factors or, more generally, a form of safety factors to them. In the case of limit states d |
https://en.wikipedia.org/wiki/Quadrature%20mirror%20filter | In digital signal processing, a quadrature mirror filter is a filter whose magnitude response is the mirror image around of that of another filter. Together these filters, first introduced by Croisier et al., are known as the quadrature mirror filter pair.
A filter is the quadrature mirror filter of if .
The filter responses are symmetric about :
In audio/voice codecs, a quadrature mirror filter pair is often used to implement a filter bank that splits an input signal into two bands. The resulting high-pass and low-pass signals are often reduced by a factor of 2, giving a critically sampled two-channel representation of the original signal. The analysis filters are often related by the following formula in addition to quadrate mirror property:
where is the frequency, and the sampling rate is normalized to .
This is known as power complementary property.
In other words, the power sum of the high-pass and low-pass filters is equal to 1.
Orthogonal wavelets – the Haar wavelets and related Daubechies wavelets, Coiflets, and some developed by Mallat, are generated by scaling functions which, with the wavelet, satisfy a quadrature mirror filter relationship.
Relationship to other filter banks
The earliest wavelets were based on expanding a function in terms of rectangular steps, the Haar wavelets. This is usually a poor approximation, whereas Daubechies wavelets are among the simplest but most important families of wavelets. A linear filter that is zero for “smooth” signals, given a record of points is defined as
It is desirable to have it vanish for a constant, so taking the order , for example,
And to have it vanish for a linear ramp, so that
A linear filter will vanish for any , and this is all that can be done with a fourth-order wavelet. Six terms will be needed to vanish a quadratic curve, and so on, given the other constraints to be included. Next an accompanying filter may be defined as
This filter responds in an exactly opposite manne |
https://en.wikipedia.org/wiki/Forklift | A forklift (also called industrial truck, lift truck, jitney, hi-lo, fork truck, fork hoist, and forklift truck) is a powered industrial truck used to lift and move materials over short distances. The forklift was developed in the early 20th century by various companies, including Clark, which made transmissions, and Yale & Towne Manufacturing, which made hoists. Since World War II, the use and development of the forklift truck have greatly expanded worldwide. Forklifts have become an indispensable piece of equipment in manufacturing and warehousing. In 2013, the top 20 manufacturers worldwide posted sales of $30.4 billion, with 944,405 machines sold.
History
The middle nineteenth century through the early 20th century saw the developments that led to today's modern forklifts. The forerunners of the modern forklift were manually-powered hoists that were used to lift loads. In 1906, the Pennsylvania Railroad introduced battery-powered platform trucks for moving luggage at their Altoona, Pennsylvania, train station. World War I saw the development of different types of material-handling equipment in the United Kingdom by Ransomes, Sims & Jefferies of Ipswich. This was in part due to the labor shortages caused by the war. In 1917, Clark in the United States began developing and using powered tractor and powered lift tractors in their factories. In 1919, the Towmotor Company, and Yale & Towne Manufacturing in 1920, entered the lift truck market in the United States. Continuing development and expanded use of the forklift continued through the 1920s and 1930s. The introduction of hydraulic power and the development of the first electric power forklifts, along with the use of standardized pallets in the late 1930s, helped to increase the popularity of forklift trucks.
The start of World War II, like World War I before, spurred the use of forklift trucks in the war effort. Following the war, more efficient methods for storing products in warehouses were being implement |
https://en.wikipedia.org/wiki/Ultimate%20tensile%20strength | Ultimate tensile strength (also called UTS, tensile strength, TS, ultimate strength or in notation) is the maximum stress that a material can withstand while being stretched or pulled before breaking. In brittle materials the ultimate tensile strength is close to the yield point, whereas in ductile materials the ultimate tensile strength can be higher.
The ultimate tensile strength is usually found by performing a tensile test and recording the engineering stress versus strain. The highest point of the stress–strain curve is the ultimate tensile strength and has units of stress. The equivalent point for the case of compression, instead of tension, is called the compressive strength.
Tensile strengths are rarely of any consequence in the design of ductile members, but they are important with brittle members. They are tabulated for common materials such as alloys, composite materials, ceramics, plastics, and wood.
Definition
The ultimate tensile strength of a material is an intensive property; therefore its value does not depend on the size of the test specimen. However, depending on the material, it may be dependent on other factors, such as the preparation of the specimen, the presence or otherwise of surface defects, and the temperature of the test environment and material.
Some materials break very sharply, without plastic deformation, in what is called a brittle failure. Others, which are more ductile, including most metals, experience some plastic deformation and possibly necking before fracture.
Tensile strength is defined as a stress, which is measured as force per unit area. For some non-homogeneous materials (or for assembled components) it can be reported just as a force or as a force per unit width. In the International System of Units (SI), the unit is the pascal (Pa) (or a multiple thereof, often megapascals (MPa), using the SI prefix mega); or, equivalently to pascals, newtons per square metre (N/m2). A United States customary unit is pounds per |
https://en.wikipedia.org/wiki/Quotient%20space%20%28topology%29 | In topology and related areas of mathematics, the quotient space of a topological space under a given equivalence relation is a new topological space constructed by endowing the quotient set of the original topological space with the quotient topology, that is, with the finest topology that makes continuous the canonical projection map (the function that maps points to their equivalence classes). In other words, a subset of a quotient space is open if and only if its preimage under the canonical projection map is open in the original topological space.
Intuitively speaking, the points of each equivalence class are or "glued together" for forming a new topological space. For example, identifying the points of a sphere that belong to the same diameter produces the projective plane as a quotient space.
Definition
Let be a topological space, and let be an equivalence relation on The quotient set is the set of equivalence classes of elements of The equivalence class of is denoted
The construction of defines a canonical surjection As discussed below, is a quotient mapping, commonly called the canonical quotient map, or canonical projection map, associated to
The quotient space under is the set equipped with the quotient topology, whose open sets are those subsets whose preimage is open. In other words, is open in the quotient topology on if and only if is open in Similarly, a subset is closed if and only if is closed in
The quotient topology is the final topology on the quotient set, with respect to the map
Quotient map
A map is a quotient map (sometimes called an identification map) if it is surjective and is equipped with the final topology induced by The latter condition admits two more-elementary phrasings: a subset is open (closed) if and only if is open (resp. closed). Every quotient map is continuous but not every continuous map is a quotient map.
Saturated sets
A subset of is called saturated (with respect to ) if i |
https://en.wikipedia.org/wiki/AspectJ | AspectJ is an aspect-oriented programming (AOP) extension created at PARC for the Java programming language. It is available in Eclipse Foundation open-source projects, both stand-alone and integrated into Eclipse. AspectJ has become a widely used de facto standard for AOP by emphasizing simplicity and usability for end users. It uses Java-like syntax, and included IDE integrations for displaying crosscutting structure since its initial public release in 2001.
Simple language description
All valid Java programs are also valid AspectJ programs, but AspectJ lets programmers define special constructs called aspects. Aspects can contain several entities unavailable to standard classes. These are:
Extension methods Allow a programmer to add methods, fields, or interfaces to existing classes from within the aspect. This example adds an acceptVisitor (see visitor pattern) method to the Point class:
aspect VisitAspect {
void Point.acceptVisitor(Visitor v) {
v.visit(this);
}
}
Pointcuts Allow a programmer to specify join points (well-defined moments in the execution of a program, like method call, object instantiation, or variable access). All pointcuts are expressions (quantifications) that determine whether a given join point matches. For example, this point-cut matches the execution of any instance method in an object of type Point whose name begins with set:
pointcut set() : execution(* set*(..) ) && this(Point);
Advices Allow a programmer to specify code to run at a join point matched by a pointcut. The actions can be performed before, after, or around the specified join point. Here, the advice refreshes the display every time something on Point is set, using the pointcut declared above:
after () : set() {
Display.update();
}
AspectJ also supports limited forms of pointcut-based static checking and aspect reuse (by inheritance). See the AspectJ Programming Guide for a more detailed description of the language.
AspectJ compatibility and implementations |
https://en.wikipedia.org/wiki/Abel%27s%20theorem | In mathematics, Abel's theorem for power series relates a limit of a power series to the sum of its coefficients. It is named after Norwegian mathematician Niels Henrik Abel.
Theorem
Let the Taylor series
be a power series with real coefficients with radius of convergence Suppose that the series
converges.
Then is continuous from the left at that is,
The same theorem holds for complex power series
provided that entirely within a single Stolz sector, that is, a region of the open unit disk where
for some fixed finite . Without this restriction, the limit may fail to exist: for example, the power series
converges to at but is unbounded near any point of the form so the value at is not the limit as tends to 1 in the whole open disk.
Note that is continuous on the real closed interval for by virtue of the uniform convergence of the series on compact subsets of the disk of convergence. Abel's theorem allows us to say more, namely that is continuous on
Stolz sector
The Stolz sector has explicit formulaand is plotted on the right for various values.
The left end of the sector is , and the right end is . On the right end, it becomes a cone with angle , where .
Remarks
As an immediate consequence of this theorem, if is any nonzero complex number for which the series
converges, then it follows that
in which the limit is taken from below.
The theorem can also be generalized to account for sums which diverge to infinity. If
then
However, if the series is only known to be divergent, but for reasons other than diverging to infinity, then the claim of the theorem may fail: take, for example, the power series for
At the series is equal to but
We also remark the theorem holds for radii of convergence other than : let
be a power series with radius of convergence and suppose the series converges at Then is continuous from the left at that is,
Applications
The utility of Abel's theorem is that it allows us to find the lim |
https://en.wikipedia.org/wiki/Information%20privacy | Information privacy is the relationship between the collection and dissemination of data, technology, the public expectation of privacy, contextual information norms, and the legal and political issues surrounding them. It is also known as data privacy or data protection.
Data privacy is challenging since attempts to use data while protecting an individual's privacy preferences and personally identifiable information. The fields of computer security, data security, and information security all design and use software, hardware, and human resources to address this issue.
Authorities
Laws
Authorities by country
Information types
Various types of personal information often come under privacy concerns.
Cable television
This describes the ability to control what information one reveals about oneself over cable television, and who can access that information. For example, third parties can track IP TV programs someone has watched at any given time. "The addition of any information in a broadcasting stream is not required for an audience rating survey, additional devices are not requested to be installed in the houses of viewers or listeners, and without the necessity of their cooperations, audience ratings can be automatically performed in real-time."
Educational
In the United Kingdom in 2012, the Education Secretary Michael Gove described the National Pupil Database as a "rich dataset" whose value could be "maximised" by making it more openly accessible, including to private companies. Kelly Fiveash of The Register said that this could mean "a child's school life including exam results, attendance, teacher assessments and even characteristics" could be available, with third-party organizations being responsible for anonymizing any publications themselves, rather than the data being anonymized by the government before being handed over. An example of a data request that Gove indicated had been rejected in the past, but might be possible under an improved version |
https://en.wikipedia.org/wiki/Dissipative%20system | A dissipative system is a thermodynamically open system which is operating out of, and often far from, thermodynamic equilibrium in an environment with which it exchanges energy and matter. A tornado may be thought of as a dissipative system. Dissipative systems stand in contrast to conservative systems.
A dissipative structure is a dissipative system that has a dynamical regime that is in some sense in a reproducible steady state. This reproducible steady state may be reached by natural evolution of the system, by artifice, or by a combination of these two.
Overview
A dissipative structure is characterized by the spontaneous appearance of symmetry breaking (anisotropy) and the formation of complex, sometimes chaotic, structures where interacting particles exhibit long range correlations. Examples in everyday life include convection, turbulent flow, cyclones, hurricanes and living organisms. Less common examples include lasers, Bénard cells, droplet cluster, and the Belousov–Zhabotinsky reaction.
One way of mathematically modeling a dissipative system is given in the article on wandering sets: it involves the action of a group on a measurable set.
Dissipative systems can also be used as a tool to study economic systems and complex systems. For example, a dissipative system involving self-assembly of nanowires has been used as a model to understand the relationship between entropy generation and the robustness of biological systems.
The Hopf decomposition states that dynamical systems can be decomposed into a conservative and a dissipative part; more precisely, it states that every measure space with a non-singular transformation can be decomposed into an invariant conservative set and an invariant dissipative set.
Dissipative structures in thermodynamics
Russian-Belgian physical chemist Ilya Prigogine, who coined the term dissipative structure, received the Nobel Prize in Chemistry in 1977 for his pioneering work on these structures, which have dynamical re |
https://en.wikipedia.org/wiki/Anatomical%20snuffbox | The anatomical snuff box or snuffbox or foveola radialis is a triangular deepening on the radial, dorsal aspect of the hand—at the level of the carpal bones, specifically, the scaphoid and trapezium bones forming the floor. The name originates from the use of this surface for placing and then sniffing powdered tobacco, or "snuff." It is sometimes referred to by its French name tabatière.
Structure
Boundaries
The medial border (ulnar side) of the snuffbox is the tendon of the extensor pollicis longus.
The lateral border (radial side) is a pair of parallel and intimate tendons, of the extensor pollicis brevis and the abductor pollicis longus. (Accordingly, the anatomical snuffbox is most visible, having a more pronounced concavity, during thumb extension.)
The proximal border is formed by the styloid process of the radius
The distal border is formed by the approximate apex of the schematic snuffbox isosceles triangle.
The floor of the snuffbox varies depending on the position of the wrist, but both the trapezium and primarily the scaphoid can be palpated.
Neurovascular anatomy
Deep to the tendons which form the borders of the anatomical snuff box lies the radial artery, which passes through the anatomical snuffbox on its course from the normal radial pulse detecting area, to the proximal space in between the first and second metacarpals to contribute to the superficial and deep palmar arches. In the anatomical snuffbox, the radial artery is closely related (<2 mm) with the superficial branch of radial nerve near the styloid process of radius in 48%, while in 24% the radial artery is closely related to the lateral cutaneous nerve of forearm. The cephalic vein arises within the anatomical snuffbox, while the dorsal cutaneous branch of the radial nerve can be palpated by stroking along the extensor pollicis longus with the dorsal aspect of a fingernail.
Clinical significance
The radius and scaphoid articulate deep to the snuffbox to form the basis of the wrist |
https://en.wikipedia.org/wiki/Saccharomyces%20cerevisiae | Saccharomyces cerevisiae () (brewer's yeast or baker's yeast) is a species of yeast (single-celled fungus microorganisms). The species has been instrumental in winemaking, baking, and brewing since ancient times. It is believed to have been originally isolated from the skin of grapes. It is one of the most intensively studied eukaryotic model organisms in molecular and cell biology, much like Escherichia coli as the model bacterium. It is the microorganism behind the most common type of fermentation. S. cerevisiae cells are round to ovoid, 5–10 μm in diameter. It reproduces by budding.
Many proteins important in human biology were first discovered by studying their homologs in yeast; these proteins include cell cycle proteins, signaling proteins, and protein-processing enzymes. S. cerevisiae is currently the only yeast cell known to have Berkeley bodies present, which are involved in particular secretory pathways. Antibodies against S. cerevisiae are found in 60–70% of patients with Crohn's disease and 10–15% of patients with ulcerative colitis, and may be useful as part of a panel of serological markers in differentiating between inflammatory bowel diseases (e.g. between ulcerative colitis and Crohn's disease), their localisation and severity.
Etymology
"Saccharomyces" derives from Latinized Greek and means "sugar-mould" or "sugar-fungus", saccharon (σάκχαρον) being the combining form "sugar" and myces (μύκης) being "fungus". cerevisiae comes from Latin and means "of beer". Other names for the organism are:
Brewer's yeast, though other species are also used in brewing
Ale yeast
Top-fermenting yeast
Baker's yeast
Ragi yeast, in connection to making tapai
Budding yeastThis species is also the main source of nutritional yeast and yeast extract.
History
In the 19th century, bread bakers obtained their yeast from beer brewers, and this led to sweet-fermented breads such as the Imperial "Kaisersemmel" roll,
which in general lacked the sourness created by the |
https://en.wikipedia.org/wiki/Leading-edge%20extension | A leading-edge extension (LEX) is a small extension to an aircraft wing surface, forward of the leading edge. The primary reason for adding an extension is to improve the airflow at high angles of attack and low airspeeds, to improve handling and delay the stall. A dog tooth can also improve airflow and reduce drag at higher speeds.
Leading-edge slat
A leading-edge slat is an aerodynamic surface running spanwise just ahead of the wing leading edge. It creates a leading edge slot between the slat and wing which directs air over the wing surface, helping to maintain smooth airflow at low speeds and high angles of attack. This delays the stall, allowing the aircraft to fly at a higher angle of attack. Slats may be made fixed, or retractable in normal flight to minimize drag.
Dogtooth extension
A dogtooth is a small, sharp zig-zag break in the leading edge of a wing. It is usually used on a swept wing, to generate a vortex flow field to prevent separated flow from progressing outboard at high angle of attack. The effect is the same as a wing fence. It can also be used on straight wings in a drooped leading edge arrangement.
Many high-performance aircraft use the dogtooth design, which induces a vortex over the wing to control boundary layer spanwise extension, increasing lift and improving resistance to stall. Some of the best-known uses of the dogtooth are in the stabilizer of the F-15 Eagle and the wings of the F-4 Phantom II, F/A-18 Super Hornet, CF-105 Arrow, F-8U Crusader, and the Ilyushin Il-62. Where the dogtooth is added as an afterthought, as for example on the Hawker Hunter and some variants of the Quest Kodiak, the dogtooth is created by adding an extension to the outer section of the leading edge.
Leading-edge cuff
A leading edge cuff (or wing cuff) is a fixed aerodynamic device employed on fixed-wing aircraft to introduce a sharp discontinuity in the leading edge of the wing in the same way as a dogtooth. It also typically has a slightly drooped lea |
https://en.wikipedia.org/wiki/Vortex%20generator | A vortex generator (VG) is an aerodynamic device, consisting of a small vane usually attached to a lifting surface (or airfoil, such as an aircraft wing) or a rotor blade of a wind turbine. VGs may also be attached to some part of an aerodynamic vehicle such as an aircraft fuselage or a car. When the airfoil or the body is in motion relative to the air, the VG creates a vortex, which, by removing some part of the slow-moving boundary layer in contact with the airfoil surface, delays local flow separation and aerodynamic stalling, thereby improving the effectiveness of wings and control surfaces, such as flaps, elevators, ailerons, and rudders.
Method of operation
Vortex generators are most often used to delay flow separation. To accomplish this they are often placed on the external surfaces of vehicles and wind turbine blades. On both aircraft and wind turbine blades they are usually installed quite close to the leading edge of the aerofoil in order to maintain steady airflow over the control surfaces at the trailing edge. VGs are typically rectangular or triangular, about as tall as the local boundary layer, and run in spanwise lines usually near the thickest part of the wing. They can be seen on the wings and vertical tails of many airliners.
Vortex generators are positioned obliquely so that they have an angle of attack with respect to the local airflow in order to create a tip vortex which draws energetic, rapidly moving outside air into the slow-moving boundary layer in contact with the surface. A turbulent boundary layer is less likely to separate than a laminar one, and is therefore desirable to ensure effectiveness of trailing-edge control surfaces. Vortex generators are used to trigger this transition. Other devices such as vortilons, leading-edge extensions, and leading-edge cuffs, also delay flow separation at high angles of attack by re-energizing the boundary layer.
Examples of aircraft which use VGs include the ST Aerospace A-4SU Super Skyhawk an |
https://en.wikipedia.org/wiki/Negative%20resistance | In electronics, negative resistance (NR) is a property of some electrical circuits and devices in which an increase in voltage across the device's terminals results in a decrease in electric current through it.
This is in contrast to an ordinary resistor in which an increase of applied voltage causes a proportional increase in current due to Ohm's law, resulting in a positive resistance. While a positive resistance consumes power from current passing through it, a negative resistance produces power. Under certain conditions it can increase the power of an electrical signal, amplifying it.
Negative resistance is an uncommon property which occurs in a few nonlinear electronic components. In a nonlinear device, two types of resistance can be defined: 'static' or 'absolute resistance', the ratio of voltage to current , and differential resistance, the ratio of a change in voltage to the resulting change in current . The term negative resistance means negative differential resistance (NDR), . In general, a negative differential resistance is a two-terminal component which can amplify, converting DC power applied to its terminals to AC output power to amplify an AC signal applied to the same terminals. They are used in electronic oscillators and amplifiers, particularly at microwave frequencies. Most microwave energy is produced with negative differential resistance devices. They can also have hysteresis and be bistable, and so are used in switching and memory circuits. Examples of devices with negative differential resistance are tunnel diodes, Gunn diodes, and gas discharge tubes such as neon lamps, and fluorescent lights. In addition, circuits containing amplifying devices such as transistors and op amps with positive feedback can have negative differential resistance. These are used in oscillators and active filters.
Because they are nonlinear, negative resistance devices have a more complicated behavior than the positive "ohmic" resistances usually encountered in |
https://en.wikipedia.org/wiki/Differintegral | In fractional calculus, an area of mathematical analysis, the differintegral is a combined differentiation/integration operator. Applied to a function ƒ, the q-differintegral of f, here denoted by
is the fractional derivative (if q > 0) or fractional integral (if q < 0). If q = 0, then the q-th differintegral of a function is the function itself. In the context of fractional integration and differentiation, there are several legitimate definitions of the differintegral.
Standard definitions
The four most common forms are:
The Riemann–Liouville differintegralThis is the simplest and easiest to use, and consequently it is the most often used. It is a generalization of the Cauchy formula for repeated integration to arbitrary order. Here, .
The Grunwald–Letnikov differintegralThe Grunwald–Letnikov differintegral is a direct generalization of the definition of a derivative. It is more difficult to use than the Riemann–Liouville differintegral, but can sometimes be used to solve problems that the Riemann–Liouville cannot.
The Weyl differintegral This is formally similar to the Riemann–Liouville differintegral, but applies to periodic functions, with integral zero over a period.
The Caputo differintegralIn opposite to the Riemann-Liouville differintegral, Caputo derivative of a constant is equal to zero. Moreover, a form of the Laplace transform allows to simply evaluate the initial conditions by computing finite, integer-order derivatives at point .
Definitions via transforms
The definitions of fractional derivatives given by Liouville, Fourier, and Grunwald and Letnikov coincide. They can be represented via Laplace, Fourier transforms or via Newton series expansion.
Recall the continuous Fourier transform, here denoted :
Using the continuous Fourier transform, in Fourier space, differentiation transforms into a multiplication:
So,
which generalizes to
Under the bilateral Laplace transform, here denoted by and defined as , differentiation transforms int |
https://en.wikipedia.org/wiki/End-to-end%20principle | The end-to-end principle is a design framework in computer networking. In networks designed according to this principle, guaranteeing certain application-specific features, such as reliability and security, requires that they reside in the communicating end nodes of the network. Intermediary nodes, such as gateways and routers, that exist to establish the network, may implement these to improve efficiency but cannot guarantee end-to-end correctness.
The essence of what would later be called the end-to-end principle was contained in the work of Paul Baran and Donald Davies on packet-switched networks in the 1960s. Louis Pouzin pioneered the use of the end-to-end strategy in the CYCLADES network in the 1970s. The principle was first articulated explicitly in 1981 by Saltzer, Reed, and Clark. The meaning of the end-to-end principle has been continuously reinterpreted ever since its initial articulation. Also, noteworthy formulations of the end-to-end principle can be found before the seminal 1981 Saltzer, Reed, and Clark paper.
A basic premise of the principle is that the payoffs from adding certain features required by the end application to the communication subsystem quickly diminish. The end hosts have to implement these functions for correctness. Implementing a specific function incurs some resource penalties regardless of whether the function is used or not, and implementing a specific function in the network adds these penalties to all clients, whether they need the function or not.
Concept
The fundamental notion behind the end-to-end principle is that for two processes communicating with each other via some communication means, the reliability obtained from that means cannot be expected to be perfectly aligned with the reliability requirements of the processes. In particular, meeting or exceeding very high-reliability requirements of communicating processes separated by networks of nontrivial size is more costly than obtaining the required degree of relia |
https://en.wikipedia.org/wiki/Gibbs%20free%20energy | In thermodynamics, the Gibbs free energy (or Gibbs energy as the recommended name; symbol ) is a thermodynamic potential that can be used to calculate the maximum amount of work, other than pressure-volume work, that may be performed by a thermodynamically closed system at constant temperature and pressure. It also provides a necessary condition for processes such as chemical reactions that may occur under these conditions. The Gibbs free energy is expressed as
where p is pressure, T is the temperature, U is the internal energy, V is volume, H is the enthalpy, and S is the entropy.
The Gibbs free energy change , measured in joules in SI) is the maximum amount of non-volume expansion work that can be extracted from a closed system (one that can exchange heat and work with its surroundings, but not matter) at fixed temperature and pressure. This maximum can be attained only in a completely reversible process. When a system transforms reversibly from an initial state to a final state under these conditions, the decrease in Gibbs free energy equals the work done by the system to its surroundings, minus the work of the pressure forces.
The Gibbs energy is the thermodynamic potential that is minimized when a system reaches chemical equilibrium at constant pressure and temperature when not driven by an applied electrolytic voltage. Its derivative with respect to the reaction coordinate of the system then vanishes at the equilibrium point. As such, a reduction in is necessary for a reaction to be spontaneous under these conditions.
The concept of Gibbs free energy, originally called available energy, was developed in the 1870s by the American scientist Josiah Willard Gibbs. In 1873, Gibbs described this "available energy" as
The initial state of the body, according to Gibbs, is supposed to be such that "the body can be made to pass from it to states of dissipated energy by reversible processes". In his 1876 magnum opus On the Equilibrium of Heterogeneous Substan |
https://en.wikipedia.org/wiki/Markov%27s%20inequality | In probability theory, Markov's inequality gives an upper bound for the probability that a non-negative function of a random variable is greater than or equal to some positive constant. It is named after the Russian mathematician Andrey Markov, although it appeared earlier in the work of Pafnuty Chebyshev (Markov's teacher), and many sources, especially in analysis, refer to it as Chebyshev's inequality (sometimes, calling it the first Chebyshev inequality, while referring to Chebyshev's inequality as the second Chebyshev inequality) or Bienaymé's inequality.
Markov's inequality (and other similar inequalities) relate probabilities to expectations, and provide (frequently loose but still useful) bounds for the cumulative distribution function of a random variable.
Statement
If is a nonnegative random variable and , then the probability
that is at least is at most the expectation of divided by :
Let (where ); then we can rewrite the previous inequality as
In the language of measure theory, Markov's inequality states that if is a measure space, is a measurable extended real-valued function, and , then
This measure-theoretic definition is sometimes referred to as Chebyshev's inequality.
Extended version for nondecreasing functions
If is a nondecreasing nonnegative function, is a (not necessarily nonnegative) random variable, and , then
An immediate corollary, using higher moments of supported on values larger than 0, is
Proofs
We separate the case in which the measure space is a probability space from the more general case because the probability case is more accessible for the general reader.
Intuition
where is larger than or equal to 0 as the random variable is non-negative and is larger than or equal to because the conditional expectation only takes into account of values larger than or equal to which r.v. can take.
Hence intuitively , which directly leads to .
Probability-theoretic proof
Method 1:
From the definition of expectation:
H |
https://en.wikipedia.org/wiki/Frank%20Ramsey%20%28mathematician%29 | Frank Plumpton Ramsey (; 22 February 1903 – 19 January 1930) was a British philosopher, mathematician, and economist who made major contributions to all three fields before his death at the age of 26. He was a close friend of Ludwig Wittgenstein and, as an undergraduate, translated Wittgenstein's Tractatus Logico-Philosophicus into English. He was also influential in persuading Wittgenstein to return to philosophy and Cambridge. Like Wittgenstein, he was a member of the Cambridge Apostles, the secret intellectual society, from 1921.
Life
Ramsey was born on 22 February 1903 in Cambridge where his father Arthur Stanley Ramsey (1867–1954), also a mathematician, was President of Magdalene College. His mother was Mary Agnes Stanley (1875–1927). He was the eldest of two brothers and two sisters, and his brother Michael Ramsey, the only one of the four siblings who was to remain Christian, later became Archbishop of Canterbury. He entered Winchester College in 1915 and later returned to Cambridge to study mathematics at Trinity College. There he became a student of John Maynard Keynes, and an active member in the Apostles. In 1923, he received his bachelor's degree in mathematics, passing his examinations with the result of first class with distinction, and was named Senior Wrangler (top of his class). Easy-going, simple and modest, Ramsey had many interests besides his mathematical and scientific studies. Even as a teenager Ramsey exhibited both a profound ability and, as attested by his brother, an extremely diverse range of interests:
In 1923, Ramsey was befriended by Geoffrey and Margaret Pyke, then on the point of founding the Malting House School in Cambridge; the Pykes took Ramsey into their family, taking him on holiday and asking him to be the godfather of their young son. Margaret found herself to be the object of his affection, Ramsey recording in his diary:
One afternoon I went out alone with her on Lake Orta and became filled with desire and we came back a |
https://en.wikipedia.org/wiki/Gel%20electrophoresis%20of%20nucleic%20acids | Nucleic acid electrophoresis is an analytical technique used to separate DNA or RNA fragments by size and reactivity. Nucleic acid molecules which are to be analyzed are set upon a viscous medium, the gel, where an electric field induces the nucleic acids (which are negatively charged due to their sugar-phosphate backbone) to migrate toward the anode (which is positively charged because this is an electrolytic rather than galvanic cell). The separation of these fragments is accomplished by exploiting the mobilities with which different sized molecules are able to pass through the gel. Longer molecules migrate more slowly because they experience more resistance within the gel. Because the size of the molecule affects its mobility, smaller fragments end up nearer to the anode than longer ones in a given period. After some time, the voltage is removed and the fragmentation gradient is analyzed. For larger separations between similar sized fragments, either the voltage or run time can be increased. Extended runs across a low voltage gel yield the most accurate resolution. Voltage is, however, not the sole factor in determining electrophoresis of nucleic acids.
The nucleic acid to be separated can be prepared in several ways before separation by electrophoresis. In the case of large DNA molecules, the DNA is frequently cut into smaller fragments using a DNA restriction endonuclease (or restriction enzyme). In other instances, such as PCR amplified samples, enzymes present in the sample that might affect the separation of the molecules are removed through various means before analysis. Once the nucleic acid is properly prepared, the samples of the nucleic acid solution are placed in the wells of the gel and a voltage is applied across the gel for a specified amount of time.
The DNA fragments of different lengths are visualized using a fluorescent dye specific for DNA, such as ethidium bromide. The gel shows bands corresponding to different nucleic acid molecules populat |
https://en.wikipedia.org/wiki/Business%20Operating%20System%20%28software%29 | The Business Operating System, or BOS, was initially developed as an early cross-platform operating system, originally for Intel 8080 and Motorola 6800 microprocessors and then for actual businesses and business models. The technology was used in Zilog Z80-based computers and later for most microcomputers of the 1980s. The system was developed by CAP Ltd, a British company that later became one of the world's largest Information Technology consulting firms. BOS and BOS applications were designed to be platform-independent.
Via a management buyout (MBO) in 1981, BOS was spun off to three interlinked companies, MPSL (MicroProducts Software Ltd) which looked after the sales and marketing of BOS, MPPL (MicroProducts Programming Ltd) which looked after both the development of BOS and various horizontal software packages, and MicroProducts Training Ltd. BOS was distributed on a global basis, mainly to the United States and the British Commonwealth, by a variety of independent and MPSL-owned companies.
A popular version was implemented on the Sage/Stride 68000 family based computers, and sold well in Australia. The Sage itself was initially developed using UCSD Pascal and p-code, so it fitted well with the basic BOS design.
The small BOS dealer/distributor network as well as the system's command-line interface contributed to its decline, especially as this was at a time when graphical user interfaces (GUIs) were becoming popular. In 2013, the system was provided with an integrated GUI in order to provide a "simple to use" solution, which "learned" from its user's input.
MPSL developed numerous products for BOS, generally targeting horizontal markets, leaving vertical (industry-specific) markets to independent software vendors (ISVs). Examples of MPSL developed software include BOS/Finder (database), BOS/Planner (spreadsheet), BOS/Writer (word processor) and BOS/AutoClerk (report generator). Companies sold various BOS accounting software suites in the UK and United Sta |
https://en.wikipedia.org/wiki/Power-line%20communication | Power-line communication (also known as power-line carrier), abbreviated as PLC, carries data on a conductor that is also used simultaneously for AC electric power transmission or electric power distribution to consumers.
In the past, powerlines were solely used for transmitting electricity. But with the advent of advanced networking technologies, including broadband, there's a push for utility and service providers to find cost-effective and high-performance solutions. It's only recently that businesses have started to seriously consider using powerlines for data networking. The possibility of using powerlines as a universal medium to transmit not just electricity or control signals, but also high-speed data and multimedia, is now under investigation.
A wide range of power-line communication technologies are needed for different applications, ranging from home automation to Internet access which is often called broadband over power lines (BPL). Most PLC technologies limit themselves to one type of wires (such as premises wiring within a single building), but some can cross between two levels (for example, both the distribution network and premises wiring). Typically transformers prevent propagating the signal, which requires multiple technologies to form very large networks. Various data rates and frequencies are used in different situations.
A number of difficult technical problems are common between wireless and power-line communication, notably those of spread spectrum radio signals operating in a crowded environment. Radio interference, for example, has long been a concern of amateur radio groups.
Basics
Power-line communications systems operate by adding a modulated carrier signal to the wiring system. Different types of power-line communications use different frequency bands. Since the power distribution system was originally intended for transmission of AC power at typical frequencies of 50 or 60 Hz, power wire circuits have only a limited ability to |
https://en.wikipedia.org/wiki/Nitrogen%20dioxide | Nitrogen dioxide is a chemical compound with the formula and is one of several nitrogen oxides. is an intermediate in the industrial synthesis of nitric acid, millions of tons of which are produced each year for use (primarily in the production of fertilizers). At higher temperatures, nitrogen dioxide is a reddish-brown gas. It can be fatal if inhaled in large quantities. The LC50 (median lethal dose) for humans has been estimated to be 174 ppm for a 1-hour exposure. Nitrogen dioxide is a paramagnetic, bent molecule with C2v point group symmetry.
It is included in the NOx family of atmospheric pollutants.
Properties
Nitrogen dioxide is a reddish-brown gas with a pungent, acrid odor above and becomes a yellowish-brown liquid below . It forms an equilibrium with its dimer, dinitrogen tetroxide (), and converts almost entirely to below .
The bond length between the nitrogen atom and the oxygen atom is 119.7 pm. This bond length is consistent with a bond order between one and two.
Unlike ozone () the ground electronic state of nitrogen dioxide is a doublet state, since nitrogen has one unpaired electron, which decreases the alpha effect compared with nitrite and creates a weak bonding interaction with the oxygen lone pairs. The lone electron in also means that this compound is a free radical, so the formula for nitrogen dioxide is often written as .
The reddish-brown color is a consequence of preferential absorption of light in the blue region of the spectrum (400–500 nm), although the absorption extends throughout the visible (at shorter wavelengths) and into the infrared (at longer wavelengths). Absorption of light at wavelengths shorter than about 400 nm results in photolysis (to form , atomic oxygen); in the atmosphere the addition of the oxygen atom so formed to results in ozone.
Preparation
Nitrogen dioxide typically arises via the oxidation of nitric oxide by oxygen in air (e.g. as result of corona discharge):
+
Nitrogen dioxide is formed in m |
https://en.wikipedia.org/wiki/A/UX | A/UX is a Unix-based operating system from Apple Computer for Macintosh computers, integrated with System 7's graphical interface and application compatibility. It is Apple's first official Unix-based operating system, launched in 1988 and discontinued in 1995 with version 3.1.1. A/UX requires select 68k-based Macintosh models with an FPU and a paged memory management unit (PMMU), including the Macintosh II, SE/30, Quadra, and Centris series.
Described by InfoWorld as "an open systems solution with the Macintosh at its heart", A/UX is based on UNIX System V Release 2.2, with features from System V Releases 3 and 4 and BSD versions 4.2 and 4.3. It is POSIX- and System V Interface Definition (SVID)-compliant and includes TCP/IP networking since version 2. Having a Unix-compatible, POSIX-compliant operating system enabled Apple to bid for large contracts to supply computers to U.S. federal government institutes.
Features
A/UX provides a graphical user interface including the familiar Finder windows, menus, and controls. The A/UX Finder is a customized version of the System 7 Finder, adapted to run as a Unix process and designed to interact with the underlying Unix file systems. A/UX includes the CommandShell terminal program, which offers a command-line interface to the underlying Unix system. An X Window System server application (called MacX) with a terminal program can also be used to interface with the system and run X applications alongside the Finder. Alternatively, the user can choose to run a fullscreen X11R4 session without the Finder.
Apple's compatibility layer allows A/UX to run Macintosh System 7.0.1, Unix, and hybrid applications. A hybrid application uses functions from both the Macintosh toolbox and the Unix system. For example, it can run a Macintosh application which calls Unix system functions, or a Unix application which calls Macintosh Toolbox functions (such as QuickDraw), or a HyperCard stack graphical frontend for a command-line Unix applica |
https://en.wikipedia.org/wiki/Direct%20proof | In mathematics and logic, a direct proof is a way of showing the
truth or falsehood of a given statement by a straightforward combination of
established facts, usually axioms, existing lemmas and theorems, without making any further assumptions. In order to directly prove a conditional statement of the form "If p, then q", it suffices to consider the situations in which the statement p is true. Logical deduction is employed to reason from assumptions to conclusion. The type of logic employed is almost invariably first-order logic, employing the quantifiers for all and there exists. Common proof rules used are modus ponens and universal instantiation.
In contrast, an indirect proof may begin with certain hypothetical scenarios and then proceed to eliminate the uncertainties in each of these scenarios until an inescapable conclusion is forced. For example, instead of showing directly p ⇒ q, one proves its contrapositive ~q ⇒ ~p (one assumes ~q and shows that it leads to ~p). Since p ⇒ q and ~q ⇒ ~p are equivalent by the principle of transposition (see law of excluded middle), p ⇒ q is indirectly proved. Proof methods that are not direct include proof by contradiction, including proof by infinite descent. Direct proof methods include proof by exhaustion and proof by induction.
History and etymology
A direct proof is the simplest form of proof there is. The word ‘proof’ comes from the Latin word probare, which means “to test”. The earliest use of proofs was prominent in legal proceedings. A person with authority, such as a nobleman, was said to have probity, which means that the evidence was by his relative authority, which outweighed empirical testimony. In days gone by, mathematics and proof was often intertwined with practical questions – with populations like the Egyptians and the Greeks showing an interest in surveying land. This led to a natural curiosity with regards to geometry and trigonometry – particularly triangles and rectangles. These were the shapes |
https://en.wikipedia.org/wiki/Binary%20number | A binary number is a number expressed in the base-2 numeral system or binary numeral system, a method of mathematical expression which uses only two symbols: typically "0" (zero) and "1" (one).
The base-2 numeral system is a positional notation with a radix of 2. Each digit is referred to as a bit, or binary digit. Because of its straightforward implementation in digital electronic circuitry using logic gates, the binary system is used by almost all modern computers and computer-based devices, as a preferred system of use, over various other human techniques of communication, because of the simplicity of the language and the noise immunity in physical implementation.
Negative numbers are commonly represented in binary using two's complement.
History
The modern binary number system was studied in Europe in the 16th and 17th centuries by Thomas Harriot, Juan Caramuel y Lobkowitz, and Gottfried Leibniz. However, systems related to binary numbers have appeared earlier in multiple cultures including ancient Egypt, China, and India. Leibniz was specifically inspired by the Chinese I Ching.
Egypt
The scribes of ancient Egypt used two different systems for their fractions, Egyptian fractions (not related to the binary number system) and Horus-Eye fractions (so called because many historians of mathematics believe that the symbols used for this system could be arranged to form the eye of Horus, although this has been disputed). Horus-Eye fractions are a binary numbering system for fractional quantities of grain, liquids, or other measures, in which a fraction of a hekat is expressed as a sum of the binary fractions 1/2, 1/4, 1/8, 1/16, 1/32, and 1/64. Early forms of this system can be found in documents from the Fifth Dynasty of Egypt, approximately 2400 BC, and its fully developed hieroglyphic form dates to the Nineteenth Dynasty of Egypt, approximately 1200 BC.
The method used for ancient Egyptian multiplication is also closely related to binary numbers. In this meth |
https://en.wikipedia.org/wiki/Eosinophil | Eosinophils, sometimes called eosinophiles or, less commonly, acidophils, are a variety of white blood cells and one of the immune system components responsible for combating multicellular parasites and certain infections in vertebrates. Along with mast cells and basophils, they also control mechanisms associated with allergy and asthma. They are granulocytes that develop during hematopoiesis in the bone marrow before migrating into blood, after which they are terminally differentiated and do not multiply. They form about 2 to 3% of white blood cells in the body.
These cells are eosinophilic or "acid-loving" due to their large acidophilic cytoplasmic granules, which show their affinity for acids by their affinity to coal tar dyes: Normally transparent, it is this affinity that causes them to appear brick-red after staining with eosin, a red dye, using the Romanowsky method. The staining is concentrated in small granules within the cellular cytoplasm, which contain many chemical mediators, such as eosinophil peroxidase, ribonuclease (RNase), deoxyribonucleases (DNase), lipase, plasminogen, and major basic protein. These mediators are released by a process called degranulation following activation of the eosinophil, and are toxic to both parasite and host tissues.
In normal individuals, eosinophils make up about 1–3% of white blood cells, and are about 12–17 micrometres in size with bilobed nuclei. While eosinophils are released into the bloodstream, they reside in tissue. They are found in the medulla and the junction between the cortex and medulla of the thymus, and, in the lower gastrointestinal tract, ovaries, uterus, spleen, and lymph nodes, but not in the lungs, skin, esophagus, or some other internal organs under normal conditions. The presence of eosinophils in these latter organs is associated with disease. For instance, patients with eosinophilic asthma have high levels of eosinophils that lead to inflammation and tissue damage, making it more difficult |
https://en.wikipedia.org/wiki/Bootstrap%20Protocol | The Bootstrap Protocol (BOOTP) is a computer networking protocol used in
Internet Protocol networks to automatically assign an IP address to network devices from a configuration server. The BOOTP was originally defined in published in 1985.
While some parts of BOOTP have been effectively superseded by the Dynamic Host Configuration Protocol (DHCP), which adds the feature of leases, parts of BOOTP are used to provide service to the DHCP protocol. DHCP servers also provide the legacy BOOTP functionality.
When a network-connected computer boots up, its IP stack broadcasts BOOTP network messages requesting an IP-address assignment. A BOOTP configuration-server replies to the request by assigning an IP address from a pool of addresses, which is preconfigured by an administrator.
BOOTP is implemented using the User Datagram Protocol (UDP) for transport protocol, port number 67 is used by the (DHCP) server for receiving client-requests and port number 68 is used by the client for receiving (DHCP) server responses. BOOTP operates only on IPv4 networks.
Historically, BOOTP has also been used for Unix-like diskless workstations to obtain the network location of their boot image, in addition to the IP address assignment. Enterprises used it to roll out a pre-configured client (e.g., Windows) installation to newly installed PCs.
Initially requiring the use of a boot floppy disk to establish the initial network connection, manufacturers of network cards later embedded the protocol in the BIOS of the interface cards as well as system boards with on-board network adapters, thus allowing direct network booting.
History
The BOOTP was first defined in September 1985 as a replacement for the Reverse Address Resolution Protocol (RARP), published in June 1984. The primary motivation for replacing RARP with BOOTP is that RARP was a link layer protocol. This made implementation difficult on many server platforms, and required that a server be present on each individual IP subnet. |
https://en.wikipedia.org/wiki/Methylene%20blue | Methylthioninium chloride, commonly called methylene blue, is a salt used as a dye and as a medication. As a medication, it is mainly used to treat methemoglobinemia by chemically reducing the ferric iron in hemoglobin to ferrous iron. Specifically, it is used to treat methemoglobin levels that are greater than 30% or in which there are symptoms despite oxygen therapy. It has previously been used for treating cyanide poisoning and urinary tract infections, but this use is no longer recommended.
Methylene blue is typically given by injection into a vein. Common side effects include headache and vomiting. While use during pregnancy may harm the baby, not using it in methemoglobinemia is likely more dangerous.
Methylene blue was first prepared in 1876, by Heinrich Caro. It is on the World Health Organization's List of Essential Medicines.
Uses
Methemoglobinemia
Methylene blue is employed as a medication for the treatment of methemoglobinemia, which can arise from ingestion of certain pharmaceuticals, toxins, or broad beans in those susceptible. Normally, through the NADH- or NADPH-dependent methemoglobin reductase enzymes, methemoglobin is reduced back to hemoglobin. When large amounts of methemoglobin occur secondary to toxins, methemoglobin reductases are overwhelmed. Methylene blue, when injected intravenously as an antidote, is itself first reduced to leucomethylene blue, which then reduces the heme group from methemoglobin to hemoglobin. Methylene blue can reduce the half life of methemoglobin from hours to minutes. At high doses, however, methylene blue actually induces methemoglobinemia, reversing this pathway.
Methylphen
Cyanide poisoning
Since its reduction potential is similar to that of oxygen and can be reduced by components of the electron transport chain, large doses of methylene blue are sometimes used as an antidote to potassium cyanide poisoning, a method first successfully tested in 1933 by Dr. Matilda Moldenhauer Brooks in San Francisco, alth |
https://en.wikipedia.org/wiki/Permutation%20matrix | In mathematics, particularly in matrix theory, a permutation matrix is a square binary matrix that has exactly one entry of 1 in each row and each column and 0s elsewhere. Each such matrix, say , represents a permutation of elements and, when used to multiply another matrix, say , results in permuting the rows (when pre-multiplying, to form ) or columns (when post-multiplying, to form ) of the matrix .
Definition
Given a permutation of m elements,
represented in two-line form by
there are two natural ways to associate the permutation with a permutation matrix; namely, starting with the m × m identity matrix, , either permute the columns or permute the rows, according to . Both methods of defining permutation matrices appear in the literature and the properties expressed in one representation can be easily converted to the other representation. This article will primarily deal with just one of these representations and the other will only be mentioned when there is a difference to be aware of.
The m × m permutation matrix P = (pij) obtained by permuting the columns of the identity matrix , that is, for each i, if j = (i) and otherwise, will be referred to as the column representation in this article. Since the entries in row i are all 0 except that a 1 appears in column (i), we may write
where , a standard basis vector, denotes a row vector of length m with 1 in the jth position and 0 in every other position.
For example, the permutation matrix P corresponding to the permutation is
Observe that the jth column of the identity matrix now appears as the (j)th column of P.
The other representation, obtained by permuting the rows of the identity matrix , that is, for each j, pij = 1 if i = (j) and otherwise, will be referred to as the row representation.
Properties
The column representation of a permutation matrix is used throughout this section, except when otherwise indicated.
Multiplying times a column vector g will permute the rows of the |
https://en.wikipedia.org/wiki/Echo | In audio signal processing and acoustics, an echo is a reflection of sound that arrives at the listener with a delay after the direct sound. The delay is directly proportional to the distance of the reflecting surface from the source and the listener. Typical examples are the echo produced by the bottom of a well, by a building, or by the walls of an enclosed room and an empty room. A true echo is a single reflection of the sound source.
The word echo derives from the Greek ἠχώ (ēchō), itself from ἦχος (ēchos), "sound". Echo in the Greek folk story is a mountain nymph whose ability to speak was cursed, leaving her able only to repeat the last words spoken to her. Some animals use echo for location sensing and navigation, such as cetaceans (dolphins and whales) and bats in a process known as echolocation. Echoes are also the basis of Sonar technology.
Acoustic phenomenon
Acoustic waves are reflected by walls or other hard surfaces, such as mountains and privacy fences. The reason of reflection may be explained as a discontinuity in the propagation medium. This can be heard when the reflection returns with sufficient magnitude and delay to be perceived distinctly.
When sound, or the echo itself, is reflected multiple times from multiple surfaces, the echo is characterized as a reverberation.
The human ear cannot distinguish echo from the original direct sound if the delay is less than 1/10 of a second. The velocity of sound in dry air is approximately 343 m/s at a temperature of 25 °C. Therefore, the reflecting object must be more than from the sound source for echo to be perceived by a person located at the source. When a sound produces an echo in two seconds, the reflecting object is away. In nature, canyon walls or rock cliffs facing water are the most common natural settings for hearing echoes. The strength of echo is frequently measured in dB sound pressure level (SPL) relative to the directly transmitted wave. Echoes may be desirable (as in sonar) or undesi |
https://en.wikipedia.org/wiki/Crimson | Crimson is a rich, deep red color, inclining to purple.
It originally meant the color of the kermes dye produced from a scale insect, Kermes vermilio, but the name is now sometimes also used as a generic term for slightly bluish-red colors that are between red and rose. It is the national color of Nepal.
History
Crimson (NR4) is produced using the dried bodies of a scale insect, Kermes, which were gathered commercially in Mediterranean countries, where they live on the kermes oak, and sold throughout Europe. Kermes dyes have been found in burial wrappings in Anglo-Scandinavian York. They fell out of use with the introduction of cochineal, also made from scale insects, because although the dyes were comparable in quality and color intensity, ten to twelve times as much kermes is needed to produce the same effect as cochineal.
Carmine is the name given to the dye made from the dried bodies of the female cochineal, although the name crimson is sometimes applied to these dyes too. Cochineal appears to have been brought to Europe by the Spaniard Hernán Cortés during the conquest of the Aztec Empire and the name 'carmine' is derived from the French carmin. It was first described by Pietro Andrea Mattioli in 1549. The pigment is also called cochineal after the insect from which it is made.
Alizarin (PR83) is a pigment that was first synthesized in 1868 by the German chemists Carl Gräbe and Carl Liebermann and replaced the natural pigment madder lake. Alizarin crimson is a dye bonded onto alum which is then used as a pigment and mixed with ochre, sienna and umber. It is not totally colorfast.
Etymology
The word crimson has been recorded in English since 1400, and its earlier forms include cremesin, crymysyn and cramoysin (cf. cramoisy, a crimson cloth). These were adapted via Old Spanish from the Medieval Latin cremesinus (also kermesinus or carmesinus), the dye produced from Kermes scale insects, and can be traced back to Arabic qirmizi (قرمزي) ("red") (), also borr |
https://en.wikipedia.org/wiki/Programming%20Research%20Group | The Programming Research Group (PRG) was part of the Oxford University Computing Laboratory (OUCL) in Oxford, England, along with the Numerical Analysis Group, until OUCL became the Department of Computer Science in 2011.
The PRG was founded by Christopher Strachey (1916–1975) in 1965. It was originally located at 45 Banbury Road.
After Strachey's untimely death, C.A.R. Hoare, FRS took over the leadership in 1977. The PRG ethos is summed up by the following quotation from Strachey, found and promulgated by Tony Hoare after he arrived at the PRG:
The PRG moved to 8–11 Keble Road in 1984. During the later 1980s and early 1990s, some members of the PRG were housed at 2 South Parks Road, including Joseph Goguen (who was at the PRG during 1988–1996). Tony Hoare retired in 1999 and the PRG was led by Samson Abramsky from 2000. The PRG continued until the renaming of the Oxford University Computing Laboratory to the Department of Computer Science on 1 June 2011, under the leadership of Bill Roscoe, a former member of the PRG.
The PRG was a centre of excellence in the field of formal methods, playing a leading role in the development of the Z notation (initiated by a visit of Jean-Raymond Abrial) and CSP (together with the associated Occam programming language). It won Queen's Awards with IBM and Inmos for work in this area.
References
External links
PRG website (Archive.org, 2010)
Educational institutions established in 1965
1965 establishments in England
2011 disestablishments in England
Educational institutions disestablished in 2011
Departments of the University of Oxford
Formal methods organizations
Computer science institutes in the United Kingdom
Oxford University Computing Laboratory |
https://en.wikipedia.org/wiki/Construction | Construction is a general term meaning the art and science to form objects, systems, or organizations, and comes from Latin constructio (from com- "together" and struere "to pile up") and Old French construction. To construct is the verb: the act of building, and the noun is construction: how something is built, the nature of its structure.
In its most widely used context, construction covers the processes involved in delivering buildings, infrastructure, industrial facilities, and associated activities through to the end of their life. It typically starts with planning, financing, and design, and continues until the asset is built and ready for use; construction also covers repairs and maintenance work, any works to expand, extend and improve the asset, and its eventual demolition, dismantling or decommissioning.
The construction industry contributes significantly to many countries' gross domestic products (GDP). Global expenditure on construction activities was about $4 trillion in 2012. In 2022, expenditure on the construction industry exceeded $11 trillion a year, equivalent to about 13 percent of global GDP. This spending was forecast to rise to around $14.8 trillion in 2030.
Although the construction industry promotes economic development and brings many non-monetary benefits to many countries, it is one of the most hazardous industries. For example, about 20% (1,061) of US industry fatalities in 2019 happened in construction.
History
The first huts and shelters were constructed by hand or with simple tools. As cities grew during the Bronze Age, a class of professional craftsmen, like bricklayers and carpenters, appeared. Occasionally, slaves were used for construction work. In the Middle Ages, the artisan craftsmen were organized into guilds. In the 19th century, steam-powered machinery appeared, and, later, diesel- and electric-powered vehicles such as cranes, excavators and bulldozers.
Fast-track construction has been increasingly popular in the 21st |
https://en.wikipedia.org/wiki/Project%20manager | A project manager is a professional in the field of project management. Project managers have the responsibility of the planning, procurement and execution of a project, in any undertaking that has a defined scope, defined start and a defined finish; regardless of industry. Project managers are first point of contact for any issues or discrepancies arising from within the heads of various departments in an organization before the problem escalates to higher authorities, as project representative.
Project management is the responsibility of a project manager. This individual seldom participates directly in the activities that produce the result, but rather strives to maintain the progress, mutual interaction and tasks of various parties in such a way that reduces the risk of overall failure, maximizes benefits, and minimizes costs.
Overview
A project manager is the person responsible for accomplishing the project objectives. Key project management responsibilities include
defining and communicating project objectives that are clear, useful and attainable
procuring the project requirements like workforce, required information, various agreements and material or technology needed to accomplish project objectives
managing the constraints of the project management triangle, which are cost, time, scope and quality
A project manager is a client representative and has to determine and implement the exact needs of the client, based on knowledge of the organization they are representing. An expertise is required in the domain the project managers are working to efficiently handle all the aspects of the project. The ability to adapt to the various internal procedures of the client and to form close links with the nominated representatives, is essential in ensuring that the key issues of cost, time, quality and above all, client satisfaction, can be realized.
Project management key topics
to specify the reason why a project is important
to specify the quality of the |
https://en.wikipedia.org/wiki/Construction%20delay | Construction delays are situations where project events occur at a later time than expected due to causes related to the client, consultant, and contractor etc. In residential and light construction, construction delays are often the result of miscommunication between contractors, subcontractors, and property owners. These types of misunderstandings and unrealistic expectations are usually avoided through the use of detailed critical path schedules, which specify the work, and timetable to be used, but most importantly, the logical sequence of events which must occur for a project to be completed.
Incidence and impact of delays
In more complex projects, problems will arise that are not foreseen in the original contract, and so other legal construction forms are subsequently used, such as change orders, lien waivers, and addenda. In construction projects, besides other projects where a schedule is being used to plan work, delays are likely to happen all the time. Delays in construction projects are frequently expensive, since there is usually a construction loan involved which charges interest, management staff dedicated to the project whose costs are time dependent, and ongoing inflation in wage and material prices.
Analysis of delays
What is being delayed determines if a project, or some other deadline such as a milestone, will be completed late. Before analyzing construction delays, a clear understanding of the general types is necessary. There are four basic ways to categorize delays:
Critical or Non-Critical
Excusable or Non-Excusable
Concurrent or Non-Concurrent
Compensable or Non-Compensable
Before determining the impact of a delay on the project, one must determine whether the delay is critical or non-critical. Additionally, all delays are either excusable or non-excusable. Both excusable and non-excusable delays can be defined as either concurrent or non-concurrent. Delays can be further broken down into compensable or non-compensable delays.
Manage |
https://en.wikipedia.org/wiki/Mathematical%20table | Mathematical tables are lists of numbers showing the results of a calculation with varying arguments. Trigonometric tables were used in ancient Greece and India for applications to astronomy and celestial navigation, and continued to be widely used until electronic calculators became cheap and plentiful, in order to simplify and drastically speed up computation. Tables of logarithms and trigonometric functions were common in math and science textbooks, and specialized tables were published for numerous applications.
History and use
The first tables of trigonometric functions known to be made were by Hipparchus (c.190 – c.120 BCE) and Menelaus (c.70–140 CE), but both have been lost. Along with the surviving table of Ptolemy (c. 90 – c.168 CE), they were all tables of chords and not of half-chords, that is, the sine function. The table produced by the Indian mathematician Āryabhaṭa (476–550 CE) is considered the first sine table ever constructed.
Āryabhaṭa's table remained the standard sine table of ancient India. There were continuous attempts to improve the accuracy of this table, culminating in the discovery of the power series expansions of the sine and cosine functions by Madhava of Sangamagrama (c.1350 – c.1425), and the tabulation of a sine table by Madhava with values accurate to seven or eight decimal places.
Tables of common logarithms were used until the invention of computers and electronic calculators to do rapid multiplications, divisions, and exponentiations, including the extraction of nth roots.
Mechanical special-purpose computers known as difference engines were proposed in the 19th century to tabulate polynomial approximations of logarithmic functions – that is, to compute large logarithmic tables. This was motivated mainly by errors in logarithmic tables made by the human computers of the time. Early digital computers were developed during World War II in part to produce specialized mathematical tables for aiming artillery. From 1972 onwards, |
https://en.wikipedia.org/wiki/Calculation | A calculation is a deliberate mathematical process that transforms one or more inputs into one or more outputs or results. The term is used in a variety of senses, from the very definite arithmetical calculation of using an algorithm, to the vague heuristics of calculating a strategy in a competition, or calculating the chance of a successful relationship between two people.
For example, multiplying 7 by 6 is a simple algorithmic calculation. Extracting the square root or the cube root of a number using mathematical models is a more complex algorithmic calculation.
Statistical estimations of the likely election results from opinion polls also involve algorithmic calculations, but produces ranges of possibilities rather than exact answers.
To calculate means to determine mathematically in the case of a number or amount, or in the case of an abstract problem to deduce the answer using logic, reason or common sense. The English word derives from the Latin , which originally meant a pebble (from Latin ), for instance the small stones used as a counters on an abacus (, ). The abacus was an instrument used by Greeks and Romans for arithmetic calculations, preceding the slide-rule and the electronic calculator, and consisted of perforated pebbles sliding on iron bars.
Calculation is a prerequisite for computation.
See also
Calculus (disambiguation) — list of general methods of calculation by application area
Complexity class — theoretical notion to categorize calculability
Cost accounting — business application of calculation
List of algorithms — fully formalized, computer-executable methods of calculation
Mental calculation — performing arithmetics using one's brain only
References
External links
"The Lifting of the Veil in the Operations of Calculation" is a manuscript, from the 18th-century, in Arabic, by Ibn al-Banna' al-Marrakushi, about calculation processes
Elemen |
https://en.wikipedia.org/wiki/William%20Jones%20%28mathematician%29 | William Jones, FRS (16751 July 1749) was a Welsh mathematician, most noted for his use of the symbol (the Greek letter Pi) to represent the ratio of the circumference of a circle to its diameter. He was a close friend of Sir Isaac Newton and Sir Edmund Halley. In November 1711, he became a Fellow of the Royal Society, and was later its vice-president.
Biography
William Jones was born the son of Siôn Siôr (John George Jones) and Elizabeth Rowland in the parish of Llanfihangel Tre'r Beirdd, about west of Benllech on the Isle of Anglesey in Wales. He attended a charity school at Llanfechell, also on the Isle of Anglesey, where his mathematical talents were spotted by the local landowner Lord Bulkeley, who arranged for him to work in a merchant's counting-house in London. His main patrons were the Bulkeley family of north Wales, and later the Earl of Macclesfield.
Jones initially served at sea, teaching mathematics on board Navy ships between 1695 and 1702, where he became very interested in navigation and published A New Compendium of the Whole Art of Navigation in 1702, dedicated to a benefactor John Harris. In this work he applied mathematics to navigation, studying methods of calculating position at sea. After his voyages were over he became a mathematics teacher in London, both in coffee houses and as a private tutor to the son of the future Earl of Macclesfield and also the future Baron Hardwicke. He also held a number of undemanding posts in government offices with the help of his former pupils.
Jones published Synopsis Palmariorum Matheseos in 1706, a work which was intended for beginners and which included theorems on differential calculus and infinite series. This used for the ratio of circumference to diameter, following earlier abbreviations for the Greek word periphery (περιφέρεια) by William Oughtred and others. His 1711 work Analysis per quantitatum series, fluxiones ac differentias introduced the dot notation for differentiation in calculus.
He w |
https://en.wikipedia.org/wiki/Healing | With physical trauma or disease suffered by an organism, healing involves the repairing of damaged tissue(s), organs and the biological system as a whole and resumption of (normal) functioning. Medicine includes the process by which the cells in the body regenerate and repair to reduce the size of a damaged or necrotic area and replace it with new living tissue. The replacement can happen in two ways: by regeneration in which the necrotic cells are replaced by new cells that form "like" tissue as was originally there; or by repair in which injured tissue is replaced with scar tissue. Most organs will heal using a mixture of both mechanisms.
Within surgery, healing is more often referred to as recovery, and postoperative recovery has historically been viewed simply as restitution of function and readiness for discharge. More recently, it has been described as an energy‐requiring process to decrease physical symptoms, reach a level of emotional well‐being, regain functions, and re‐establish activities
Healing is also referred to in the context of the grieving process.
In psychiatry and psychology, healing is the process by which neuroses and psychoses are resolved to the degree that the client is able to lead a normal or fulfilling existence without being overwhelmed by psychopathological phenomena. This process may involve psychotherapy, pharmaceutical treatment or alternative approaches such as traditional spiritual healing.
Regeneration
In order for an injury to be healed by regeneration, the cell type that was destroyed must be able to replicate. Cells also need a collagen framework along which to grow. Alongside most cells there is either a basement membrane or a collagenous network made by fibroblasts that will guide the cells' growth. Since ischaemia and most toxins do not destroy collagen, it will continue to exist even when the cells around it are dead.
Example
Acute tubular necrosis (ATN) in the kidney is a case in which cells heal completely by regen |
https://en.wikipedia.org/wiki/Bone%20healing | Bone healing, or fracture healing, is a proliferative physiological process in which the body facilitates the repair of a bone fracture.
Generally, bone fracture treatment consists of a doctor reducing (pushing) displaced bones back into place via relocation with or without anaesthetic, stabilizing their position to aid union, and then waiting for the bone's natural healing process to occur.
Adequate nutrient intake has been found to significantly affect the integrity of the fracture repair. Age, bone type, drug therapy and pre-existing bone pathology are factors that affect healing. The role of bone healing is to produce new bone without a scar as seen in other tissues which would be a structural weakness or deformity.
The process of the entire regeneration of the bone can depend on the angle of dislocation or fracture. While the bone formation usually spans the entire duration of the healing process, in some instances, bone marrow within the fracture has healed two or fewer weeks before the final remodelling phase.
While immobilization and surgery may facilitate healing, a fracture ultimately heals through physiological processes. The healing process is mainly determined by the periosteum (the connective tissue membrane covering the bone). The periosteum is one source of precursor cells that develop into chondroblasts and osteoblasts that are essential to the healing of bone. Other sources of precursor cells are the bone marrow (when present), endosteum, small blood vessels, and fibroblasts.
Primary healing
Primary healing (also known as direct healing) requires a correct anatomical reduction which is stable, without any gap formation. Such healing requires only the remodeling of lamellar bone, the Haversian canals and the blood vessels without callus formation. This process may take a few months to a few years.
Contact healing
When the gap between the bone ends is less than 0.01 mm, and interfragmentary strain is less than 2%, contact healing can occur. In |
https://en.wikipedia.org/wiki/D.%20R.%20Fulkerson | Delbert Ray Fulkerson (; August 14, 1924 – January 10, 1976) was an American mathematician who co-developed the FordFulkerson algorithm, one of the most well-known algorithms to solve the maximum flow problem in networks.
Early life and education
D. R. Fulkerson was born in Tamms, Illinois, the third of six children of Elbert and Emma Fulkerson. Fulkerson became an undergraduate at Southern Illinois University. His academic career was interrupted by military service during World War II. Having returned to complete his degree after the war, he went on to do a Ph.D. in mathematics at the University of Wisconsin–Madison under the supervision of Cyrus MacDuffee, who was a student of L. E. Dickson. Fulkerson received his Ph.D. in 1951.
Career
After graduation, Fulkerson joined the mathematics department at the RAND Corporation. In 1956, he and L. R. Ford Jr. described the Ford–Fulkerson algorithm. In 1962 they produced a book-length description of their method.
In 1971 he moved to Cornell University as the Maxwell Upson Professor of Engineering. He was diagnosed with Crohn's disease and was limited in his teaching. In despair, he committed suicide in 1976.
Fulkerson was the supervisor of Jon Folkman at RAND and Tatsuo Oyama at GRIPS. After Folkman committed suicide in 1969, Fulkerson blamed himself for failing to notice Folkman's suicidal behaviors.
In 1979, the renowned Fulkerson Prize was established which is now awarded every three years for outstanding papers in discrete mathematics jointly by the Mathematical Programming Society and the American Mathematical Society.
See also
Out-of-kilter algorithm
List of people diagnosed with Crohn's disease
References
External links
Delbert Ray Fulkerson prize
Fulkerson biography at Cornell
Biography of D. R. Fulkerson from the Institute for Operations Research and the Management Sciences
20th-century American mathematicians
Combinatorialists
1924 births
1976 suicides
University of Wisconsin–Madison College of Lette |
https://en.wikipedia.org/wiki/John%20Wallis | John Wallis (; ; ) was an English clergyman and mathematician, who is given partial credit for the development of infinitesimal calculus.
Between 1643 and 1689 he served as chief cryptographer for Parliament and, later, the royal court. He is credited with introducing the symbol ∞ to represent the concept of infinity. He similarly used 1/∞ for an infinitesimal. John Wallis was a contemporary of Newton and one of the greatest intellectuals of the early renaissance of mathematics.
Biography
Educational background
Cambridge, M.A., Oxford, D.D.
Grammar School at Tenterden, Kent, 1625–31.
School of Martin Holbeach at Felsted, Essex, 1631–2.
Cambridge University, Emmanuel College, 1632–40; B.A., 1637; M.A., 1640.
D.D. at Oxford in 1654
Family
On 14 March 1645 he married Susanna Glynde ( – 16 March 1687). They had three children:
Anne Blencoe (4 June 1656 – 5 April 1718), married Sir John Blencowe (30 November 1642 – 6 May 1726) in 1675, with issue
John Wallis (26 December 1650 – 14 March 1717), MP for Wallingford 1690–1695, married Elizabeth Harris (d. 1693) on 1 February 1682, with issue: one son and two daughters
Elizabeth Wallis (1658–1703), married William Benson (1649–1691) of Towcester, died with no issue
Life
John Wallis was born in Ashford, Kent. He was the third of five children of Reverend John Wallis and Joanna Chapman. He was initially educated at a school in Ashford but moved to James Movat's school in Tenterden in 1625 following an outbreak of plague. Wallis was first exposed to mathematics in 1631, at Felsted School (then known as Martin Holbeach's school in Felsted); he enjoyed maths, but his study was erratic, since "mathematics, at that time with us, were scarce looked on as academical studies, but rather mechanical" (Scriba 1970). At the school in Felsted, Wallis learned how to speak and write Latin. By this time, he also was proficient in French, Greek, and Hebrew. As it was intended he should be a doctor, he was sent in 1632 to Emmanu |
https://en.wikipedia.org/wiki/David%20Chaum | David Lee Chaum (born 1955) is an American computer scientist, cryptographer, and inventor. He is known as a pioneer in cryptography and privacy-preserving technologies, and widely recognized as the inventor of digital cash. His 1982 dissertation "Computer Systems Established, Maintained, and Trusted by Mutually Suspicious Groups" is the first known proposal for a blockchain protocol. Complete with the code to implement the protocol, Chaum's dissertation proposed all but one element of the blockchain later detailed in the Bitcoin whitepaper. He has been referred to as "the father of online anonymity", and "the godfather of cryptocurrency".
He is also known for developing ecash, an electronic cash application that aims to preserve a user's anonymity, and inventing many cryptographic protocols like the blind signature, mix networks and the Dining cryptographers protocol. In 1995 his company DigiCash created the first digital currency with eCash. His 1981 paper, "Untraceable Electronic Mail, Return Addresses, and Digital Pseudonyms", laid the groundwork for the field of anonymous communications research.
Life and career
Chaum is Jewish and was born to a Jewish family in Los Angeles. He gained a doctorate in computer science from the University of California, Berkeley in 1982. Also that year, he founded the International Association for Cryptologic Research (IACR), which currently organizes academic conferences in cryptography research. Subsequently, he taught at the New York University Graduate School of Business Administration and at the University of California, Santa Barbara (UCSB). He also formed a cryptography research group at CWI, the Dutch National Research Institute for Mathematics and Computer Science in Amsterdam. He founded DigiCash, an electronic cash company, in 1990.
Chaum received the Information Technology European Award for 1995. In 2004, he was named an IACR Fellow. In 2010, at the RSA Conference, he was honored with the RSA Award for Excelle |
https://en.wikipedia.org/wiki/Extended%20Display%20Identification%20Data | Extended Display Identification Data (EDID) and Enhanced EDID (E-EDID) are metadata formats for display devices to describe their capabilities to a video source (e.g., graphics card or set-top box). The data format is defined by a standard published by the Video Electronics Standards Association (VESA).
The EDID data structure includes manufacturer name and serial number, product type, phosphor or filter type (as chromaticity data), timings supported by the display, display size, luminance data and (for digital displays only) pixel mapping data.
DisplayID is a VESA standard targeted to replace EDID and E-EDID extensions with a uniform format suited for both PC monitor and consumer electronics devices.
Background
EDID structure (base block) versions range from v1.0 to v1.4; all these define upwards-compatible 128-byte structures. Version 2.0 defined a new 256-byte structure but it has been deprecated and replaced by E-EDID which supports multiple extension blocks. HDMI versions 1.0–1.3c use E-EDID v1.3.
Before Display Data Channel (DDC) and EDID were defined, there was no standard way for a graphics card to know what kind of display device it was connected to. Some VGA connectors in personal computers provided a basic form of identification by connecting one, two or three pins to ground, but this coding was not standardized.
This problem is solved by EDID and DDC, as it enables the display to send information to the graphics card it is connected to. The transmission of EDID information usually uses the Display Data Channel protocol, specifically DDC2B, which is based on I²C-bus (DDC1 used a different serial format which never gained popularity). The data is transmitted via the cable connecting the display and the graphics card; VGA, DVI, DisplayPort and HDMI are supported.
The EDID is often stored in the monitor in the firmware chip called serial EEPROM (electrically erasable programmable read-only memory) and is accessible via the I²C-bus at address . The EDI |
https://en.wikipedia.org/wiki/Phosphodiesterase | A phosphodiesterase (PDE) is an enzyme that breaks a phosphodiester bond. Usually, phosphodiesterase refers to cyclic nucleotide phosphodiesterases, which have great clinical significance and are described below. However, there are many other families of phosphodiesterases, including phospholipases C and D, autotaxin, sphingomyelin phosphodiesterase, DNases, RNases, and restriction endonucleases (which all break the phosphodiester backbone of DNA or RNA), as well as numerous less-well-characterized small-molecule phosphodiesterases.
The cyclic nucleotide phosphodiesterases comprise a group of enzymes that degrade the phosphodiester bond in the second messenger molecules cAMP and cGMP. They regulate the localization, duration, and amplitude of cyclic nucleotide signaling within subcellular domains. PDEs are therefore important regulators of signal transduction mediated by these second messenger molecules.
History
These multiple forms (isoforms or subtypes) of phosphodiesterase were isolated from rat brain using polyacrylamide gel electrophoresis in the early 1970s by Weiss and coworkers, and were soon afterward shown to be selectively inhibited by a variety of drugs in brain and other tissues, also by Weiss and coworkers.
The potential for selective phosphodiesterase inhibitors to be used as therapeutic agents was predicted in the 1970s by Weiss and coworkers. This prediction has now come to pass in a variety of fields (e.g. sildenafil as a PDE5 inhibitor and Rolipram as a PDE4 inhibitor).
Nomenclature and classification
The PDE nomenclature signifies the PDE family with an Arabic numeral, then a capital letter denotes the gene in that family, and a second and final Arabic numeral then indicates the splice variant derived from a single gene (e.g., PDE1C3: family 1, gene C, splicing variant 3).
The superfamily of PDE enzymes is classified into 11 families, namely PDE1-PDE11, in mammals. The classification is based on:
amino acid sequences
substrate specifici |
https://en.wikipedia.org/wiki/Easter%20egg%20%28media%29 | An Easter egg is a message, image, or feature hidden in software, a video game, a film, or another — usually electronic — medium. The term used in this manner was coined around 1979 by Steve Wright, the then-Director of Software Development in the Atari Consumer Division, to describe a hidden message in the Atari video game Adventure, in reference to an Easter egg hunt. The earliest known video game Easter egg is in the 1973 video game Moonlander, in which the player tries to land a Lunar module on the moon; if the player opts to fly the module horizontally through several of the game's screens, they encounter a McDonald's restaurant, and if they land next to it the astronaut will visit it instead of standing next to the ship. The earliest known Easter egg in software in general is one placed in the "make" command for PDP-6/PDP-10 computers sometime in October 1967–October 1968, wherein if the user attempts to create a file named "love" by typing "make love", the program responds "not war?" before proceeding.
Origin
The use of the term "Easter egg" to describe secret features in video games originates from the 1980 video game Adventure for the Atari 2600 game console, programmed by employee Warren Robinett. At the time, Atari did not include programmers' names in the game credits, both to prevent competitors from poaching its developers as well as to deny developers a means to bargain with the management of the new owners, Warner Communications. Robinett, who disagreed with his supervisor over this lack of acknowledgment, secretly programmed the message "Created by Warren Robinett" to appear only if a player moves their avatar over a specific pixel (dubbed the "Gray Dot") during a certain part of the game and enters a previously "forbidden" part of the map where the message can be found. When Robinett left Atari, he did not inform the company of the acknowledgment that he included in the game. Shortly after his departure, the "Gray Dot" and his message were discov |
https://en.wikipedia.org/wiki/Constructive%20analysis | In mathematics, constructive analysis is mathematical analysis done according to some principles of constructive mathematics.
Introduction
The name of the subject contrasts with classical analysis, which in this context means analysis done according to the more common principles of classical mathematics. However, there are various schools of thought and many different formalizations of constructive analysis. Whether classical or constructive in some fashion, any such framework of analysis axiomatizes the real number line by some means, a collection extending the rationals and with an apartness relation definable from an asymmetric order structure. Center stage takes a positivity predicate, here denoted , which governs an equality-to-zero . The members of the collection are generally just called the real numbers. While this term is thus overloaded in the subject, all the frameworks share a broad common core of results that are also theorems of classical analysis.
Constructive frameworks for its formulation are extensions of Heyting arithmetic by types including , constructive second-order arithmetic, or strong enough topos-, type- or constructive set theories such as , a constructive counter-part of . Of course, a direct axiomatization may be studied as well.
Logical preliminaries
The base logic of constructive analysis is intuitionistic logic, which means that the principle of excluded middle is not automatically assumed for every proposition. If a proposition is provable, this exactly means that the non-existence claim being provable would be absurd, and so the latter cannot also be provable in a consistent theory. The double-negated existence claim is a logically negative statement and implied by, but generally not equivalent to the existence claim itself. Much of the intricacies of constructive analysis can be framed in terms of the weakness of propositions of the logically negative form , which is generally weaker than . In turn, also an implication can g |
https://en.wikipedia.org/wiki/WASTE | WASTE is a peer-to-peer and friend-to-friend protocol and software application developed by Justin Frankel at Nullsoft in 2003 that features instant messaging, chat rooms, and file browsing/sharing capabilities. The name WASTE is a reference to Thomas Pynchon's novel The Crying of Lot 49. In the novel, W.A.S.T.E. is (among other things) an underground postal service.
In 2003, less than 24 hours after its release, WASTE was removed from distribution by AOL, Nullsoft's parent company. The original page was replaced with a statement claiming that the posting of the software was unauthorized and that no lawful rights to it were held by anyone who had downloaded it, in spite of the original claim that the software was released under the terms of the GNU General Public License.
Several developers have modified and upgraded the WASTE client and protocol. The SourceForge edition is considered by many to be the official development branch, but there are several forks.
Description
WASTE is a decentralized chat, instant messaging and file sharing program and protocol. It behaves similarly to a virtual private network by connecting to a group of trusted computers, as determined by the users. This kind of network is commonly referred to as a darknet. It uses strong encryption to ensure that third parties cannot decipher the messages being transferred. The same encryption is used to transmit and receive instant messages, chat, and files, maintain the connection, and browse and search.
WASTE networks
WASTE networks are decentralized (see social networks), meaning there is no central hub or server that everyone connects to. Peers must connect to each other individually. Normally, this is accomplished by having individuals sharing their RSA public keys, ensuring that their computers are accessible via the appropriate ports (one or more parties must have an IP address and port that can be reached by the other), and entering the IP address and port of someone on the network |
https://en.wikipedia.org/wiki/La%20G%C3%A9om%C3%A9trie | La Géométrie was published in 1637 as an appendix to Discours de la méthode (Discourse on the Method), written by René Descartes. In the Discourse, he presents his method for obtaining clarity on any subject. La Géométrie and two other appendices, also by Descartes, La Dioptrique (Optics) and Les Météores (Meteorology), were published with the Discourse to give examples of the kinds of successes he had achieved following his method (as well as, perhaps, considering the contemporary European social climate of intellectual competitiveness, to show off a bit to a wider audience).
The work was the first to propose the idea of uniting algebra and geometry into a single subject and invented an algebraic geometry called analytic geometry, which involves reducing geometry to a form of arithmetic and algebra and translating geometric shapes into algebraic equations. For its time this was ground-breaking. It also contributed to the mathematical ideas of Leibniz and Newton and was thus important in the development of calculus.
The text
This appendix is divided into three "books".
Book I is titled Problems Which Can Be Constructed by Means of Circles and Straight Lines Only. In this book he introduces algebraic notation that is still in use today. The letters at the end of the alphabet, viz., , , , etc. are to denote unknown variables, while those at the start of the alphabet, , , , etc. denote constants. He introduces modern exponential notation for powers (except for squares, where he kept the older tradition of writing repeated letters, such as, ). He also breaks with the Greek tradition of associating powers with geometric referents, with an area, with a volume and so on, and treats them all as possible lengths of line segments. These notational devices permit him to describe an association of numbers to lengths of line segments that could be constructed with straightedge and compass. The bulk of the remainder of this book is occupied by Descartes's solution to "the l |
https://en.wikipedia.org/wiki/Rapid%20application%20development | Rapid application development (RAD), also called rapid application building (RAB), is both a general term for adaptive software development approaches, and the name for James Martin's method of rapid development. In general, RAD approaches to software development put less emphasis on planning and more emphasis on an adaptive process. Prototypes are often used in addition to or sometimes even instead of design specifications.
RAD is especially well suited for (although not limited to) developing software that is driven by user interface requirements. Graphical user interface builders are often called rapid application development tools. Other approaches to rapid development include the adaptive, agile, spiral, and unified models.
History
Rapid application development was a response to plan-driven waterfall processes, developed in the 1970s and 1980s, such as the Structured Systems Analysis and Design Method (SSADM). One of the problems with these methods is that they were based on a traditional engineering model used to design and build things like bridges and buildings. Software is an inherently different kind of artifact. Software can radically change the entire process used to solve a problem. As a result, knowledge gained from the development process itself can feed back to the requirements and design of the solution. Plan-driven approaches attempt to rigidly define the requirements, the solution, and the plan to implement it, and have a process that discourages changes. RAD approaches, on the other hand, recognize that software development is a knowledge intensive process and provide flexible processes that help take advantage of knowledge gained during the project to improve or adapt the solution.
The first such RAD alternative was developed by Barry Boehm and was known as the spiral model. Boehm and other subsequent RAD approaches emphasized developing prototypes as well as or instead of rigorous design specifications. Prototypes had several advantages ove |
https://en.wikipedia.org/wiki/Coherence%20%28physics%29 | In physics, coherence expresses the potential for two waves to interfere. Two monochromatic beams from a single source always interfere. Physical sources are not strictly monochromatic: they may be partly coherent. Beams from different sources are mutually incoherent.
When interfering, two waves add together to create a wave of greater amplitude than either one (constructive interference) or subtract from each other to create a wave of minima which may be zero (destructive interference), depending on their relative phase. Constructive or destructive interference are limit cases, and two waves always interfere, even if the result of the addition is complicated or not remarkable.
Two waves with constant relative phase will be coherent. The amount of coherence can readily be measured by the interference visibility, which looks at the size of the interference fringes relative to the input waves (as the phase offset is varied); a precise mathematical definition of the degree of coherence is given by means of correlation functions. More generally, coherence describes the statistical similarity of a field (electromagnetic field, quantum wave packet etc.) at two points in space or time.
Qualitative concept
Coherence controls the visibility or contrast of interference patterns. For example visibility of the double slit experiment pattern requires that both slits be illuminated by a coherent wave as illustrated in the figure. Large sources without collimation or sources that mix many different frequencies will have lower visibility.
Coherence contains several distinct concepts. Spatial coherence describes the correlation (or predictable relationship) between waves at different points in space, either lateral or longitudinal. Temporal coherence describes the correlation between waves observed at different moments in time. Both are observed in the Michelson–Morley experiment and Young's interference experiment. Once the fringes are obtained in the Michelson interferomete |
https://en.wikipedia.org/wiki/Room%20temperature | Colloquially, room temperature is a range of air temperatures that most people prefer for indoor settings. These temperatures feel comfortable to people wearing typical indoor clothing. Human comfort can extend beyond this range depending on humidity, air circulation and other factors.
In certain fields, like science and engineering, and within a particular context, room temperature can mean different agreed-upon ranges. In contrast, ambient temperature is the actual temperature, as measured by a thermometer, of the air (or other medium and surroundings) in any particular place. The ambient temperature (e.g. an unheated room in winter) may be very different from an ideal room temperature.
Food or beverages may be served at "room temperature", meaning neither heated nor cooled.
Comfort temperatures
The American Heritage Dictionary of the English Language identifies room temperature as around , while the Oxford English Dictionary states that it is "conventionally taken as about ".
Ideal room temperature varies vastly depending on the surrounding climate. Studies from Indonesia have shown that the range of comfortable temperature falls between for local residents. Studies from Nigeria show a comfortable temperature range of , comfortably cool and comfortably warm . A field study conducted in Hyderabad, India returned a comfort band of with a mean of . A study conducted in Jaipur, India among healthy young men showed that the neutral thermal comfort temperature was analyzed to be , although a range of was found.
Owing to variations in humidity and (likely) clothing, recommendations for summer and winter may vary; a suggested typical range for summer is , with that for winter being . Some studies have suggested that thermal comfort preferences of men and women may differ significantly, with women on average preferring higher ambient temperatures.
In the recent past it was common for house temperatures to be kept below the comfort level; a 1978 UK study found a |
https://en.wikipedia.org/wiki/Carbon%20copy | Before the development of photographic copiers, a carbon copy was the under-copy of a typed or written document placed over carbon paper and the under-copy sheet itself (not to be confused with the carbon print family of photographic reproduction processes). When copies of business letters were so produced, it was customary to use the acronym "CC" or "cc" before a colon and below the writer's signature to inform the principal recipient that carbon copies had been made and distributed to the parties listed after the colon. With the advent of word processors and e-mail, "cc" is used as a merely formal indication of the distribution of letters to secondary recipients.
Process
A sheet of carbon paper is placed between two or more sheets of paper. The pressure applied by the writing implement (pen, pencil, typewriter or impact printer) to the top sheet causes pigment from the carbon paper to reproduce the similar mark on the copy sheet(s). More than one copy can be made by stacking several sheets with carbon paper between each pair. Four or five copies is a practical limit. The top sheet is the original and each of the additional sheets is called a carbon copy.
History
While carbon paper was invented by Pellegrino Turri in 1801, it was not widely used for copying until typewriters became common. Carbon copies were in wide use between the 1870s and 1980s, largely for administrative tasks.
Use
The use of carbon copies declined with the advent of photocopying and electronic document creation and distribution (word processing). Carbon copies are still sometimes used in special applications: for example, in manual receipt books which have a multiple-use sheet of carbon paper supplied, so that the user can keep an exact copy of each receipt issued, although even here carbonless copy paper is often used to the same effect.
It is still common for a business letter to include, at the end, a list of names preceded by the abbreviation "CC", indicating that the named persons |
https://en.wikipedia.org/wiki/Planktology | Planktology is the study of plankton, various small drifting plants, animals and microorganisms that inhabit bodies of water. Planktology topics include primary production, energy flow and the carbon cycle.
Plankton drive the "biological pump", a process by which the ocean ecosystem transports carbon from the surface euphotic zone to the ocean's depths. Such processes are vital to carbon dioxide sinks, one of several possibilities for countering global warming. Modern planktology includes behavioral aspects of drifting organisms, engaging modern in situ imaging devices.
Some planktology projects allow the public to participate online, such as the Long-term Ecosystem Observatory.
Notable planktologists
Karl Banse
Sayed ElSayed
Paul Falkowski
Gotthilf Hempel
Victor Hensen
Uwe Kils
Johannes Krey
Jürgen Lenz
Vivienne Cassie Cooper
External links
Victor Hensen biography
Gotthilf Hempel
Paul Falkowski homepage
Subfields of zoology |
https://en.wikipedia.org/wiki/Standard%20state | In chemistry, the standard state of a material (pure substance, mixture or solution) is a reference point used to calculate its properties under different conditions. A superscript circle ° (degree symbol) or a Plimsoll (⦵) character is used to designate a thermodynamic quantity in the standard state, such as change in enthalpy (ΔH°), change in entropy (ΔS°), or change in Gibbs free energy (ΔG°). The degree symbol has become widespread, although the Plimsoll is recommended in standards, see discussion about typesetting below.
In principle, the choice of standard state is arbitrary, although the International Union of Pure and Applied Chemistry (IUPAC) recommends a conventional set of standard states for general use. The standard state should not be confused with standard temperature and pressure (STP) for gases, nor with the standard solutions used in analytical chemistry. STP is commonly used for calculations involving gases that approximate an ideal gas, whereas standard state conditions are used for thermodynamic calculations.
For a given material or substance, the standard state is the reference state for the material's thermodynamic state properties such as enthalpy, entropy, Gibbs free energy, and for many other material standards. The standard enthalpy change of formation for an element in its standard state is zero, and this convention allows a wide range of other thermodynamic quantities to be calculated and tabulated. The standard state of a substance does not have to exist in nature: for example, it is possible to calculate values for steam at 298.15 K and , although steam does not exist (as a gas) under these conditions. The advantage of this practice is that tables of thermodynamic properties prepared in this way are self-consistent.
Conventional standard states
Many standard states are non-physical states, often referred to as "hypothetical states". Nevertheless, their thermodynamic properties are well-defined, usually by an extrapolation from some |
https://en.wikipedia.org/wiki/Biological%20interaction | In ecology, a biological interaction is the effect that a pair of organisms living together in a community have on each other. They can be either of the same species (intraspecific interactions), or of different species (interspecific interactions). These effects may be short-term, or long-term, both often strongly influence the adaptation and evolution of the species involved. Biological interactions range from mutualism, beneficial to both partners, to competition, harmful to both partners. Interactions can be direct when physical contact is established or indirect, through intermediaries such as shared resources, territories, ecological services, metabolic waste, toxins or growth inhibitors. This type of relationship can be shown by net effect based on individual effects on both organisms arising out of relationship.
Several recent studies have suggested non-trophic species interactions such as habitat modification and mutualisms can be important determinants of food web structures. However, it remains unclear whether these findings generalize across ecosystems, and whether non-trophic interactions affect food webs randomly, or affect specific trophic levels or functional groups.
History
Although biological interactions, more or less individually, were studied earlier, Edward Haskell (1949) gave an integrative approach to the thematic, proposing a classification of "co-actions", later adopted by biologists as "interactions". Close and long-term interactions are described as symbiosis; symbioses that are mutually beneficial are called mutualistic.
The term symbiosis was subject to a century-long debate about whether it should specifically denote mutualism, as in lichens or in parasites that benefit themselves. This debate created two different classifications for biotic interactions, one based on the time (long-term and short-term interactions), and other based on the magnitud of interaction force (competition/mutualism) or effect of individual fitness, accordi |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.