PMCID string | Title string | Sentences string |
|---|---|---|
PMC12738729 | PHLDA1 silencing in IMR-32 human neuroblastoma cells results in ABCB1 overexpression, augments chemoresistance and leads to increased growth of tumors | The percentages of positively stained cells are shown in the graphs below (as means ± SEM, see the Supplementary Table S3 online for the counting results from a given tumor sample). |
PMC12738729 | PHLDA1 silencing in IMR-32 human neuroblastoma cells results in ABCB1 overexpression, augments chemoresistance and leads to increased growth of tumors | Statistical significance was assessed via the two-tailed unpaired Student’s t test. |
PMC12738729 | PHLDA1 silencing in IMR-32 human neuroblastoma cells results in ABCB1 overexpression, augments chemoresistance and leads to increased growth of tumors | No statistically significant differences in PHLDA1-positive or ABCB1-positive cell numbers were found between shC and shP tumors (b, c). |
PMC12738729 | PHLDA1 silencing in IMR-32 human neuroblastoma cells results in ABCB1 overexpression, augments chemoresistance and leads to increased growth of tumors | The ABCB1 protein was detected immunohistochemically in both shC and shP tumors (Fig. 5a, c; Supplementary Fig. S22 online; Supplementary Table S3 online), and similar to our previous results, in PHLDA1-silenced tumors the level of ABCB1 was increased. |
PMC12738729 | PHLDA1 silencing in IMR-32 human neuroblastoma cells results in ABCB1 overexpression, augments chemoresistance and leads to increased growth of tumors | However, compared with the results obtained in our in vitro studies, the differences in ABCB1 levels between the groups were not as intense. |
PMC12738729 | PHLDA1 silencing in IMR-32 human neuroblastoma cells results in ABCB1 overexpression, augments chemoresistance and leads to increased growth of tumors | In shP slices, the mean number of positively stained cells was greater (25.1 cells per field view, Supplementary Table S3 online) than that in shC slices (16 cells per field view, see Fig. 5a, c; Supplementary Table S3 online); however, statistical significance was not reached. |
PMC12738729 | PHLDA1 silencing in IMR-32 human neuroblastoma cells results in ABCB1 overexpression, augments chemoresistance and leads to increased growth of tumors | PHLDA1 is a multifunctional protein involved in many cellular pathways, especially the stress response and apoptosis. |
PMC12738729 | PHLDA1 silencing in IMR-32 human neuroblastoma cells results in ABCB1 overexpression, augments chemoresistance and leads to increased growth of tumors | In recent years, this protein has often been investigated in relation to cancer. |
PMC12738729 | PHLDA1 silencing in IMR-32 human neuroblastoma cells results in ABCB1 overexpression, augments chemoresistance and leads to increased growth of tumors | Our previous study revealed significant upregulation of ABCB1 at the protein level in PHLDA1-silenced IMR-32 neuroblastoma cells via mass spectrometry. |
PMC12738729 | PHLDA1 silencing in IMR-32 human neuroblastoma cells results in ABCB1 overexpression, augments chemoresistance and leads to increased growth of tumors | In the present study, specific transcript and protein levels were measured in PHLDA1-silenced IMR-32 cells via RT‒qPCR and western blotting, respectively. |
PMC12738729 | PHLDA1 silencing in IMR-32 human neuroblastoma cells results in ABCB1 overexpression, augments chemoresistance and leads to increased growth of tumors | The data clearly support our conclusion that the regulation occurs, although indirectly, at the transcriptional level. |
PMC12738729 | PHLDA1 silencing in IMR-32 human neuroblastoma cells results in ABCB1 overexpression, augments chemoresistance and leads to increased growth of tumors | The explanation of the proposed PHLDA1-ABCB1 association is based on available data from other studies as well as our studies. |
PMC12738729 | PHLDA1 silencing in IMR-32 human neuroblastoma cells results in ABCB1 overexpression, augments chemoresistance and leads to increased growth of tumors | First, PHLDA1 can bind and negatively regulate the mitotic aurora A kinase in MDA-MB-231 breast cancer cells. |
PMC12738729 | PHLDA1 silencing in IMR-32 human neuroblastoma cells results in ABCB1 overexpression, augments chemoresistance and leads to increased growth of tumors | Next, we showed that the induction of PHLDA1 expression by an anti-GD2 ganglioside antibody resulted in decreased levels of aurora A kinase, its activating phosphorylation, and the MYCN oncogene in IMR-32 human neuroblastoma cells. |
PMC12738729 | PHLDA1 silencing in IMR-32 human neuroblastoma cells results in ABCB1 overexpression, augments chemoresistance and leads to increased growth of tumors | Moreover, aurora A kinase was shown to directly interact with the MYCN protein to sequester this transcription factor and prevent its ubiquitination as well as proteasomal degradation. |
PMC12738729 | PHLDA1 silencing in IMR-32 human neuroblastoma cells results in ABCB1 overexpression, augments chemoresistance and leads to increased growth of tumors | On the other hand, the ABCB1 gene is directly transcriptionally activated by MYCN as a transcription factor. |
PMC12738729 | PHLDA1 silencing in IMR-32 human neuroblastoma cells results in ABCB1 overexpression, augments chemoresistance and leads to increased growth of tumors | Therefore, high levels of PHLDA1 can inhibit aurora A kinase, leading to a decrease in MYCN levels followed by diminished stimulation of ABCB1 gene transcription. |
PMC12738729 | PHLDA1 silencing in IMR-32 human neuroblastoma cells results in ABCB1 overexpression, augments chemoresistance and leads to increased growth of tumors | Next, we tested how PHLDA1 silencing affects neuroblastoma cells in vivo. |
PMC12738729 | PHLDA1 silencing in IMR-32 human neuroblastoma cells results in ABCB1 overexpression, augments chemoresistance and leads to increased growth of tumors | Our in vivo study provided evidence that the silencing of PHLDA1 in neuroblastoma cells significantly influenced tumor growth dynamics, vascularization, and extracellular matrix composition in the applied model. |
PMC12738729 | PHLDA1 silencing in IMR-32 human neuroblastoma cells results in ABCB1 overexpression, augments chemoresistance and leads to increased growth of tumors | The accelerated growth observed in PHLDA1-silenced tumors aligned with previous studies that implicated PHLDA1 as a tumor suppressor in various cancers. |
PMC12738729 | PHLDA1 silencing in IMR-32 human neuroblastoma cells results in ABCB1 overexpression, augments chemoresistance and leads to increased growth of tumors | The presence of numerous extravasations in shP tumors, which were absent in shC tumors, proved that PHLDA1 silencing may enhance angiogenic processes, leading to a more chaotic and leaky vasculature. |
PMC12738729 | PHLDA1 silencing in IMR-32 human neuroblastoma cells results in ABCB1 overexpression, augments chemoresistance and leads to increased growth of tumors | This can be clinically relevant, as high levels of angiogenic factors are known to be present in advanced stages of human neuroblastoma. |
PMC12738729 | PHLDA1 silencing in IMR-32 human neuroblastoma cells results in ABCB1 overexpression, augments chemoresistance and leads to increased growth of tumors | Additionally, in our previous research, we demonstrated that silencing PHLDA1 led to EGFR overexpression. |
PMC12738729 | PHLDA1 silencing in IMR-32 human neuroblastoma cells results in ABCB1 overexpression, augments chemoresistance and leads to increased growth of tumors | High levels of EGFR were shown to increase development of blood vessels within various in vivo-generated tumors. |
PMC12738729 | PHLDA1 silencing in IMR-32 human neuroblastoma cells results in ABCB1 overexpression, augments chemoresistance and leads to increased growth of tumors | Given this information, the upregulation of EGFR could also be one of the reasons for enhanced angiogenesis in shP tumors. |
PMC12738729 | PHLDA1 silencing in IMR-32 human neuroblastoma cells results in ABCB1 overexpression, augments chemoresistance and leads to increased growth of tumors | Therefore, the inhibition of angiogenesis is a part of the development of therapeutic strategies for treating neuroblastoma. |
PMC12738729 | PHLDA1 silencing in IMR-32 human neuroblastoma cells results in ABCB1 overexpression, augments chemoresistance and leads to increased growth of tumors | It can be concluded that the aberrant blood supply in shP tumors could amplify rapid tumor growth by providing a more extensive, however disorganized, network for nutrient and oxygen delivery. |
PMC12738729 | PHLDA1 silencing in IMR-32 human neuroblastoma cells results in ABCB1 overexpression, augments chemoresistance and leads to increased growth of tumors | Another key finding of this study was the significant change in the ECM composition within PHLDA1-silenced tumors, especially in the accumulation of collagen. |
PMC12738729 | PHLDA1 silencing in IMR-32 human neuroblastoma cells results in ABCB1 overexpression, augments chemoresistance and leads to increased growth of tumors | Changes in the ECM are common in cancers, and increased collagen levels can be related to poor patient prognosis. |
PMC12738729 | PHLDA1 silencing in IMR-32 human neuroblastoma cells results in ABCB1 overexpression, augments chemoresistance and leads to increased growth of tumors | Our analysis of the proteome performed in previously described mass spectrometry experiments revealed that the PCOLCE and COL6A1 proteins were characteristic of shP cells and were not detected in shC cells. |
PMC12738729 | PHLDA1 silencing in IMR-32 human neuroblastoma cells results in ABCB1 overexpression, augments chemoresistance and leads to increased growth of tumors | Moreover, bioinformatics analysis performed via tools implemented in R2 (http://r2.amc.nl, http://r2platform.com) with the Versteeg 88 dataset revealed that high levels of PCOLCE mRNA were significantly correlated with decreased overall and relapse-free survival rates in NB patients (Supplementary Fig. S23, S24 online). |
PMC12738729 | PHLDA1 silencing in IMR-32 human neuroblastoma cells results in ABCB1 overexpression, augments chemoresistance and leads to increased growth of tumors | The increased manifestation of collagen in shP cells observed in histological studies could be correlated with the presence of PCOLCE, which is an important enzyme for ECM reconstruction. |
PMC12738729 | PHLDA1 silencing in IMR-32 human neuroblastoma cells results in ABCB1 overexpression, augments chemoresistance and leads to increased growth of tumors | These data support our findings from the histological staining analyses of shP tumor xenografts. |
PMC12738729 | PHLDA1 silencing in IMR-32 human neuroblastoma cells results in ABCB1 overexpression, augments chemoresistance and leads to increased growth of tumors | The increased collagen deposition and collagen net density in shP tumors suggested that PHLDA1 may play a critical role in regulating ECM remodeling in our in vivo neuroblastoma model. |
PMC12738729 | PHLDA1 silencing in IMR-32 human neuroblastoma cells results in ABCB1 overexpression, augments chemoresistance and leads to increased growth of tumors | This finding is interesting because collagen facilitates metastasis in 3D in vitro models. |
PMC12738729 | PHLDA1 silencing in IMR-32 human neuroblastoma cells results in ABCB1 overexpression, augments chemoresistance and leads to increased growth of tumors | Moreover, an enhanced collagen network was found in metastatic colorectal cancer, suggesting that some of the collagen genes could be used as biomarkers. |
PMC12738729 | PHLDA1 silencing in IMR-32 human neuroblastoma cells results in ABCB1 overexpression, augments chemoresistance and leads to increased growth of tumors | A high level of PCOLCE was correlated with poor outcomes in glioma and gastric cancer. |
PMC12738729 | PHLDA1 silencing in IMR-32 human neuroblastoma cells results in ABCB1 overexpression, augments chemoresistance and leads to increased growth of tumors | Finally, increases in different types of collagens may also be associated with drug resistance. |
PMC12738729 | PHLDA1 silencing in IMR-32 human neuroblastoma cells results in ABCB1 overexpression, augments chemoresistance and leads to increased growth of tumors | Our in vivo model was not aimed at studying the metastasis process; therefore, more research is needed to elucidate the correlation between PHLDA1 and the collagen network. |
PMC12738729 | PHLDA1 silencing in IMR-32 human neuroblastoma cells results in ABCB1 overexpression, augments chemoresistance and leads to increased growth of tumors | Interestingly, while PHLDA1 silencing in vitro was associated with highly increased ABCB1 expression, the differences in ABCB1 levels between shP and shC tumors in vivo were less intense. |
PMC12738729 | PHLDA1 silencing in IMR-32 human neuroblastoma cells results in ABCB1 overexpression, augments chemoresistance and leads to increased growth of tumors | These findings suggest that the tumor microenvironment may modulate the expression of ABCB1 differently than it does in cultured cells or that other compensatory mechanisms, such as ubiquitin-proteasomal degradation of ABCB1, may occur in vivo. |
PMC12738729 | PHLDA1 silencing in IMR-32 human neuroblastoma cells results in ABCB1 overexpression, augments chemoresistance and leads to increased growth of tumors | More data is needed to elucidate this process. |
PMC12738729 | PHLDA1 silencing in IMR-32 human neuroblastoma cells results in ABCB1 overexpression, augments chemoresistance and leads to increased growth of tumors | ABCB1 transporter expression and activity are regulated by several mechanisms. |
PMC12738729 | PHLDA1 silencing in IMR-32 human neuroblastoma cells results in ABCB1 overexpression, augments chemoresistance and leads to increased growth of tumors | Through expression profiling and chromatin immunoprecipitation studies, MYC oncoproteins were shown to coordinately regulate the transcription of specific ABC transporter genes by acting as either activators or repressors. |
PMC12738729 | PHLDA1 silencing in IMR-32 human neuroblastoma cells results in ABCB1 overexpression, augments chemoresistance and leads to increased growth of tumors | Additionally, studies have reported an association between high-level ABCB1 expression and poor clinical outcomes and MYCN amplification. |
PMC12738729 | PHLDA1 silencing in IMR-32 human neuroblastoma cells results in ABCB1 overexpression, augments chemoresistance and leads to increased growth of tumors | Furthermore, the implications of ABCB1 regulation in treatment-resistant neuroblastomas have been studied. |
PMC12738729 | PHLDA1 silencing in IMR-32 human neuroblastoma cells results in ABCB1 overexpression, augments chemoresistance and leads to increased growth of tumors | Rösch et al.. reported that depletion of ABCB1 sensitized neuroblastoma cells to vincristine treatment. |
PMC12738729 | PHLDA1 silencing in IMR-32 human neuroblastoma cells results in ABCB1 overexpression, augments chemoresistance and leads to increased growth of tumors | Moreover, the analysis of gene expression datasets of more than 50 different neuroblastoma cell lines (primary and relapsed) and more than 160 neuroblastoma patient samples from the pediatric precision medicine platform INFORM (Individualized Therapy For Relapsed Malignancies in Childhood) confirmed a pivotal role of ABCB1 specifically in neuroblastoma resistance at relapse. |
PMC12738729 | PHLDA1 silencing in IMR-32 human neuroblastoma cells results in ABCB1 overexpression, augments chemoresistance and leads to increased growth of tumors | With respect to our results, it appears now that PHLDA1 is not the only (although indirect) inhibitor of ABCB1 expression. |
PMC12738729 | PHLDA1 silencing in IMR-32 human neuroblastoma cells results in ABCB1 overexpression, augments chemoresistance and leads to increased growth of tumors | Possibly, based on our currently presented data and previous studies, during chemo-immunotherapy applied in clinics with anti-GD2 ganglioside antibodies and chemotherapeutics, expression of ABCB1 transporter could be decreased, and neuroblastoma tumors might become more sensitive to chemotherapy. |
PMC12738729 | PHLDA1 silencing in IMR-32 human neuroblastoma cells results in ABCB1 overexpression, augments chemoresistance and leads to increased growth of tumors | However, verification of this hypothesis requires further investigation. |
PMC12738729 | PHLDA1 silencing in IMR-32 human neuroblastoma cells results in ABCB1 overexpression, augments chemoresistance and leads to increased growth of tumors | The postulated role of PHLDA1 in the regulation of chemoresistance should be experimentally explored. |
PMC12738729 | PHLDA1 silencing in IMR-32 human neuroblastoma cells results in ABCB1 overexpression, augments chemoresistance and leads to increased growth of tumors | This is important, as so far, ABCB1 inhibitors have failed in clinical trials, probably because systemic ABCB1 inhibition results in a modified body distribution of its many substrates, including drugs, xenobiotics, and other molecules. |
PMC12738729 | PHLDA1 silencing in IMR-32 human neuroblastoma cells results in ABCB1 overexpression, augments chemoresistance and leads to increased growth of tumors | The prognostic value of PHLDA1 was reviewed recently by Durbas in various types of cancer. |
PMC12738729 | PHLDA1 silencing in IMR-32 human neuroblastoma cells results in ABCB1 overexpression, augments chemoresistance and leads to increased growth of tumors | Decreased expression of PHLDA1 is associated with decreased overall survival in patients with breast cancer, gastric adenocarcinoma, or non-small cell lung cancer. |
PMC12738729 | PHLDA1 silencing in IMR-32 human neuroblastoma cells results in ABCB1 overexpression, augments chemoresistance and leads to increased growth of tumors | In contrast, increased expression of PHLDA1 is responsible for decreased overall survival in patients with pancreatic adenocarcinoma, oral squamous cell carcinoma, and glioblastoma. |
PMC12738729 | PHLDA1 silencing in IMR-32 human neuroblastoma cells results in ABCB1 overexpression, augments chemoresistance and leads to increased growth of tumors | Notably, PHLDA1 also plays a role in other than neuroblastoma pediatric tumors, e.g., osteosarcoma, where high PHLDA1 expression is associated with a lower overall survival of osteosarcoma patients. |
PMC12738729 | PHLDA1 silencing in IMR-32 human neuroblastoma cells results in ABCB1 overexpression, augments chemoresistance and leads to increased growth of tumors | These findings indicate that PHLDA1 has different effects on disease prognosis and overall survival, possibly by acting as either a tumor suppressor or an oncogene, depending on the type of tumor. |
PMC12738729 | PHLDA1 silencing in IMR-32 human neuroblastoma cells results in ABCB1 overexpression, augments chemoresistance and leads to increased growth of tumors | Therefore, investigating the role of PHLDA1 in tumors is meaningful both experimentally and clinically. |
PMC12738729 | PHLDA1 silencing in IMR-32 human neuroblastoma cells results in ABCB1 overexpression, augments chemoresistance and leads to increased growth of tumors | In conclusion, our results help to elucidate the relationship between PHLDA1 and ABCB1 in human neuroblastoma. |
PMC12738729 | PHLDA1 silencing in IMR-32 human neuroblastoma cells results in ABCB1 overexpression, augments chemoresistance and leads to increased growth of tumors | Our analyses proved that the silencing of PHLDA1 correlated with the upregulation of ABCB1, which led to increased chemoresistance in shP cells. |
PMC12738729 | PHLDA1 silencing in IMR-32 human neuroblastoma cells results in ABCB1 overexpression, augments chemoresistance and leads to increased growth of tumors | Moreover, we showed that silencing of PHLDA1 in vivo caused changes in tumor growth, morphology, vascularization and ECM structure. |
PMC12738729 | PHLDA1 silencing in IMR-32 human neuroblastoma cells results in ABCB1 overexpression, augments chemoresistance and leads to increased growth of tumors | The upregulation of ABCB1 in PHLDA1-silenced cells was not specific to a single cell line. |
PMC12738729 | PHLDA1 silencing in IMR-32 human neuroblastoma cells results in ABCB1 overexpression, augments chemoresistance and leads to increased growth of tumors | In this work, evidence of a more general mechanism of the induction of ABCB1 following PHLDA1 silencing was presented in vitro in two neuroblastoma cell lines, i.e., IMR-32 and CHP-134. |
PMC12738729 | PHLDA1 silencing in IMR-32 human neuroblastoma cells results in ABCB1 overexpression, augments chemoresistance and leads to increased growth of tumors | Further analysis of the regulation between PHLDA1 and efflux pumps (such as ABCB1and ABCC10) is needed in other neuroblastoma cell lines and for treatment with different cytotoxic drugs to establish whether this mechanism operates more broadly. |
PMC12738729 | PHLDA1 silencing in IMR-32 human neuroblastoma cells results in ABCB1 overexpression, augments chemoresistance and leads to increased growth of tumors | Finally, our results reveal how PHLDA1 affects molecular pathways in both in vitro and in vivo models and provide insight into its role in human neuroblastoma, which can be beneficial for better understanding the tumor biology. |
PMC12738729 | PHLDA1 silencing in IMR-32 human neuroblastoma cells results in ABCB1 overexpression, augments chemoresistance and leads to increased growth of tumors | The IMR-32 human neuroblastoma cell line (CCL-127, ATCC) was cultured in EMEM (M4655, Sigma‒Aldrich) supplemented with 10% FBS (10270106, Gibco), 1% nonessential amino acid solution (NEAA, M7145, Sigma‒Aldrich), 1 mM sodium pyruvate (S8636, Sigma‒Aldrich) and 50 µg/ml gentamicin (G1397, Sigma‒Aldrich). |
PMC12738729 | PHLDA1 silencing in IMR-32 human neuroblastoma cells results in ABCB1 overexpression, augments chemoresistance and leads to increased growth of tumors | The CHP-134 human neuroblastoma cell line (06122002, ECACC) was cultured in RPMI-1640 (R8758, Sigma‒Aldrich) supplemented with 10% FBS and 50 µg/ml gentamicin. |
PMC12738729 | PHLDA1 silencing in IMR-32 human neuroblastoma cells results in ABCB1 overexpression, augments chemoresistance and leads to increased growth of tumors | The HepG2 human hepatoma cell line (HB-8065, ATCC) was cultured in high-glucose DMEM (D6429, Sigma‒Aldrich) supplemented with 10% FBS and 50 µg/ml gentamicin. |
PMC12738729 | PHLDA1 silencing in IMR-32 human neuroblastoma cells results in ABCB1 overexpression, augments chemoresistance and leads to increased growth of tumors | All the cell lines were cultured at 37 °C in an incubator with 5% CO2. |
PMC12738729 | PHLDA1 silencing in IMR-32 human neuroblastoma cells results in ABCB1 overexpression, augments chemoresistance and leads to increased growth of tumors | PHLDA1-silenced IMR-32 cells (shP) and control cells (shC) were generated previously (for details, see. |
PMC12738729 | PHLDA1 silencing in IMR-32 human neuroblastoma cells results in ABCB1 overexpression, augments chemoresistance and leads to increased growth of tumors | shP and shC cells were cultured continuously in EMEM (supplemented with 10% FBS, 1% NEAA, 1 mM sodium pyruvate and 50 µg/ml gentamycin) supplemented with the selective antibiotic 0.5 µg/ml puromycin (sc-108071; Santa Cruz Biotechnology). |
PMC12738729 | PHLDA1 silencing in IMR-32 human neuroblastoma cells results in ABCB1 overexpression, augments chemoresistance and leads to increased growth of tumors | For the CHP-134 neuroblastoma cell line, PHLDA1-silenced S6 and S17 clones of CHP-134 cells elicited with a lentiviral vector, control (the Mock 3 clone), or WT cells were used. |
PMC12738729 | PHLDA1 silencing in IMR-32 human neuroblastoma cells results in ABCB1 overexpression, augments chemoresistance and leads to increased growth of tumors | To assess the levels of PHLDA1 and ABCB1 following PHLDA1 silencing in CHP-134 cells, western blotting was used. |
PMC12738729 | PHLDA1 silencing in IMR-32 human neuroblastoma cells results in ABCB1 overexpression, augments chemoresistance and leads to increased growth of tumors | For protein isolation, the aforementioned groups of CHP-134 cells (2.5 × 10 per well) were cultured in a 6-well plate for 48 h, harvested and lysed with RIPA buffer. |
PMC12738729 | PHLDA1 silencing in IMR-32 human neuroblastoma cells results in ABCB1 overexpression, augments chemoresistance and leads to increased growth of tumors | PHLDA1-overexpressing IMR-32 cells and control cells were generated via plasmid vector transfection as described in detail previously. |
PMC12738729 | PHLDA1 silencing in IMR-32 human neuroblastoma cells results in ABCB1 overexpression, augments chemoresistance and leads to increased growth of tumors | A plasmid containing the ORF of PHLDA1 (Genecopoeia, EX-Z4556-M68) and a control plasmid (Genecopoeia, EX-NEG-M68) were used. |
PMC12738729 | PHLDA1 silencing in IMR-32 human neuroblastoma cells results in ABCB1 overexpression, augments chemoresistance and leads to increased growth of tumors | Transfected cells were cultured in EMEM (with 10% FBS, 1% NEAA, 1 mM sodium pyruvate and 50 µg/ml gentamycin) supplemented with the selective antibiotic 0.5 µg/ml puromycin (sc-108071; Santa Cruz Biotechnology). |
PMC12738729 | PHLDA1 silencing in IMR-32 human neuroblastoma cells results in ABCB1 overexpression, augments chemoresistance and leads to increased growth of tumors | IMR-32 cells (2 × 10 per well) were cultured in 96-well plates for 48 h, and the cells were treated with doxorubicin in triplicate or with water. |
PMC12738729 | PHLDA1 silencing in IMR-32 human neuroblastoma cells results in ABCB1 overexpression, augments chemoresistance and leads to increased growth of tumors | CHP-134 cells (5 × 10 per well) were treated with doxorubicin at concentrations ranging from 1 to 150 nM or with diluent (water) and cultured in a 96-well plate for 48 h, after which the ATP content was measured in PHLDA1-silenced (S6, S17), control (Mock3) and WT cells. |
PMC12738729 | PHLDA1 silencing in IMR-32 human neuroblastoma cells results in ABCB1 overexpression, augments chemoresistance and leads to increased growth of tumors | The intracellular ATP content was measured via an Infinite M200 Reader (Tecan Group Ltd.) via an ATPlite Luminescence ATP Detection Assay (6016947, PerkinElmer) according to the manufacturer’s protocol. |
PMC12738729 | PHLDA1 silencing in IMR-32 human neuroblastoma cells results in ABCB1 overexpression, augments chemoresistance and leads to increased growth of tumors | To isolate total protein fractions, IMR-32 cells (1 × 10 per well) and CHP-134 cells (2.5 × 10 per well) were cultured in a 6-well plate for 48 h, washed twice in cold PBS and lysed in RIPA buffer supplemented with protease (P8340, Sigma‒Aldrich) and phosphatase inhibitors (PhosSTOP, 4906845001, Roche). |
PMC12738729 | PHLDA1 silencing in IMR-32 human neuroblastoma cells results in ABCB1 overexpression, augments chemoresistance and leads to increased growth of tumors | The protein concentration was measured with a Bicinchoninic Acid assay (BCA assay, Bicinchoninic Acid Kit for Protein Determination, B9643, C2284, BCA1; Sigma‒Aldrich). |
PMC12738729 | PHLDA1 silencing in IMR-32 human neuroblastoma cells results in ABCB1 overexpression, augments chemoresistance and leads to increased growth of tumors | Aliquots containing 20–60 µg of total protein lysates were subjected to vertical electrophoresis in polyacrylamide gels via standard SDS‒PAGE procedures and electrotransferred to polyvinylidene difluoride (PVDF) membranes (Millipore Corporation). |
PMC12738729 | PHLDA1 silencing in IMR-32 human neuroblastoma cells results in ABCB1 overexpression, augments chemoresistance and leads to increased growth of tumors | The obtained blots were blocked with 5% nonfat dry milk in TBS containing 0.1% Tween 20 for 1 h and then incubated overnight at 4 °C with primary antibodies (Table 1). |
PMC12738729 | PHLDA1 silencing in IMR-32 human neuroblastoma cells results in ABCB1 overexpression, augments chemoresistance and leads to increased growth of tumors | The next day, the membranes were incubated with secondary antibodies conjugated with HRP for 1 h at RT. |
PMC12738729 | PHLDA1 silencing in IMR-32 human neuroblastoma cells results in ABCB1 overexpression, augments chemoresistance and leads to increased growth of tumors | The immunoreactive bands were detected via a chemiluminescence method (with a luminol reagent, RPN2105 Amersham, Cytiva) on a ChemiDoc device (Bio-Rad laboratories). |
PMC12738729 | PHLDA1 silencing in IMR-32 human neuroblastoma cells results in ABCB1 overexpression, augments chemoresistance and leads to increased growth of tumors | The membranes were stripped with 0.4 M NaOH and incubated with antibodies against α-tubulin, which was used as a reference protein. |
PMC12738729 | PHLDA1 silencing in IMR-32 human neuroblastoma cells results in ABCB1 overexpression, augments chemoresistance and leads to increased growth of tumors | Table 1Antibodies used in this research. |
PMC12738729 | PHLDA1 silencing in IMR-32 human neuroblastoma cells results in ABCB1 overexpression, augments chemoresistance and leads to increased growth of tumors | AntigenHost speciesDilutionVendorCatalog no.ABCB1 (for WB)Rabbit1:1,000Cell Signaling Technology12683ABCB1 (for IHC)Rabbit1:100Cell Signaling Technology13978P21Rabbit1:1,000Cell Signaling Technology2947Cleaved-PARP-1(for IHC)Rabbit1:75Abcamab32064Cleaved caspase 3(for IHC)Rabbit1:50R&D Systems, part of Bio-TechneMAB825-SPPHLDA1 (for WB)Mouse1:1,000Santa Cruz BiotechnologySc-23866PHLDA1 (for IHC and WB)Rabbit1:40 for IHC1:10,000 for WBAbcamab133654α-TubulinRabbit1:4,000Cell Signaling Technology2125Secondary anti-rabbit IgG (for WB)Goat1:2,000–1:4,000Cell Signaling Technology7074Secondary anti-rabbit IgG (for IHC)GoatReady-to-use solutionVector LaboratoriesMP-7451Secondary anti-mouse IgG (for WB)Horse1:3,000Cell Signaling Technology7076 Antibodies used in this research. |
PMC12738729 | PHLDA1 silencing in IMR-32 human neuroblastoma cells results in ABCB1 overexpression, augments chemoresistance and leads to increased growth of tumors | Cleaved-PARP-1 (for IHC) Cleaved caspase 3 (for IHC) 1:40 for IHC 1:10,000 for WB RNA was isolated with TRI-REAGENT (TRI118, Lab Empire) according to the manufacturer’s protocol. |
PMC12738729 | PHLDA1 silencing in IMR-32 human neuroblastoma cells results in ABCB1 overexpression, augments chemoresistance and leads to increased growth of tumors | The concentration and purity of the isolated RNA were determined via a ND-1000 spectrophotometer (NanoDrop), and the A260/280 and A260/230 ratios were calculated. |
PMC12738729 | PHLDA1 silencing in IMR-32 human neuroblastoma cells results in ABCB1 overexpression, augments chemoresistance and leads to increased growth of tumors | The quality of the RNA was verified by electrophoresis in a 1% agarose gel, which included SimplySafe staining. |
PMC12738729 | PHLDA1 silencing in IMR-32 human neuroblastoma cells results in ABCB1 overexpression, augments chemoresistance and leads to increased growth of tumors | One microgram of total RNA was reverse transcribed using 200 units/ml of M-MLV reverse transcriptase (Sigma‒Aldrich) according to the manufacturer’s protocol, using a GenAmp thermocycler (PerkinElmer, Inc.). |
PMC12738729 | PHLDA1 silencing in IMR-32 human neuroblastoma cells results in ABCB1 overexpression, augments chemoresistance and leads to increased growth of tumors | Next, cDNA was amplified in qPCR via the Eco Illumina thermocycler (Illumina) with KAPA SYBR FAST qPCR Master mix (Kapa Biosystems, Inc.) under the following conditions: polymerase activation at 95°C for 10 min, 40 cycles of denaturation at 95°C for 15 sec, and annealing and elongation at 60°C for 30 sec. For normalization of each sample, ribosomal protein S13 (RPS13) cDNA was used. |
PMC12738729 | PHLDA1 silencing in IMR-32 human neuroblastoma cells results in ABCB1 overexpression, augments chemoresistance and leads to increased growth of tumors | Quantification was performed using the “ΔΔCt” relative quantitation method. |
PMC12738729 | PHLDA1 silencing in IMR-32 human neuroblastoma cells results in ABCB1 overexpression, augments chemoresistance and leads to increased growth of tumors | All samples were run in triplicate. |
PMC12738729 | PHLDA1 silencing in IMR-32 human neuroblastoma cells results in ABCB1 overexpression, augments chemoresistance and leads to increased growth of tumors | The experiments were performed three times for quantification of ABCB1 mRNA and four times for quantification of PHLDA1 mRNA. |
PMC12738729 | PHLDA1 silencing in IMR-32 human neuroblastoma cells results in ABCB1 overexpression, augments chemoresistance and leads to increased growth of tumors | ABCB1, PHLDA1 and RPS13 primers used for qPCR were designed via Primer-BLAST (http://www.ncbi.nlm.nih.gov/tools/primer-blast/). |
PMC12738729 | PHLDA1 silencing in IMR-32 human neuroblastoma cells results in ABCB1 overexpression, augments chemoresistance and leads to increased growth of tumors | The sequences of the primers used were as follows: ABCB1 Forward: 5’ GGAAGCCTGAGCTCATTCGAG 3’; Reverse: 5’ TTCAAGATCCATTCCGACCTCGC 3’; PHLDA1 Forward: 5’ CCGGGCAAGACAAGGTTTTGA 3’; Reverse: 5’ CGCAAGTTTTCAGTAGGGTGA 3’; RPS13 Forward: 5’ TGAGAGGAACAGAAAGGATAAGG 3’; Reverse: 5’ ATTTATGCGACCAGGGCAGA 3’. |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.