Datasets:
OTAR3088
/
BioData-CellLine_annotated

Dataset card Data Studio Files
xet
Community
1
PMCID
string
Sentences
string
ner
list
PMC11243198
The mutation of these residues reduced GANT61-GLI1 binding as assessed by surface plasmon resonance and reduced GANT61-mediated Hh-pathway inhibition .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "mutation", "of", "these", "residues", "reduced", "GANT61-GLI1", "binding", "as", "assessed", "by", "surface", "plasmon", "resonance", "and", "reduced", "GANT61-mediated", "Hh-pathway", "inhibition", "." ] } ]
PMC8557138
The hypoxic microenvironment of the tumor induces the expression of Hypoxia-inducible factor (HIF)-1α, which leads to transcriptional upregulation of VEGF-A in the cancer cells (Carmeliet and Jain 2000).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "hypoxic", "microenvironment", "of", "the", "tumor", "induces", "the", "expression", "of", "Hypoxia-inducible", "factor", "(HIF)-1α", ",", "which", "leads", "to", "transcriptional", "upregulation", "of", "VEGF-A", "in", "the", "cancer", "cells", "(", "Carmeliet", "and", "Jain", "2000", ")", "." ] } ]
PMC11696576
At first, ethyl ester GK401 showed weaker inhibition in comparison to GK470, indicating that the small methyl ester group is preferable as a substituent on the thiazolyl ring.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "At", "first", ",", "ethyl", "ester", "GK401", "showed", "weaker", "inhibition", "in", "comparison", "to", "GK470", ",", "indicating", "that", "the", "small", "methyl", "ester", "group", "is", "preferable", "as", "a", "substituent", "on", "the", "thiazolyl", "ring", "." ] } ]
PMC10329237
Effect of BLM, PFD, LOS, and PFD+LOS on EMT- involved proteins in A549 cells According to Figure 4, the epithelial markers’ protein levels such as ZO-1 and E-cadherin were decreased, and the mesenchymal markers including Vimentin, β-Catenin, and α-SMA were dramatically up-regulated in A549 cells after treatment with BLM in comparison with the control.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Effect", "of", "BLM", ",", "PFD", ",", "LOS", ",", "and", "PFD+LOS", "on", "EMT-", "involved", "proteins", "in", "A549", "cells", "According", "to", "Figure", "4", ",", "the", "epithelial", "markers", "’", "protein", "levels", "such", "as", "ZO-1", "and", "E-cadherin", "were", "decreased", ",", "and", "the", "mesenchymal", "markers", "including", "Vimentin", ",", "β-Catenin", ",", "and", "α-SMA", "were", "dramatically", "up-regulated", "in", "A549", "cells", "after", "treatment", "with", "BLM", "in", "comparison", "with", "the", "control", "." ] } ]
PMC9436459
The authors found that an additional step of acetyl reprotection of the crude mixture produced by the Suzuki reaction could improve the yield of diene S28.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "authors", "found", "that", "an", "additional", "step", "of", "acetyl", "reprotection", "of", "the", "crude", "mixture", "produced", "by", "the", "Suzuki", "reaction", "could", "improve", "the", "yield", "of", "diene", "S28", "." ] } ]
PMC10222971
Cells were transferred to an eppendorf and washed with cold PBS in triplicate.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Cells", "were", "transferred", "to", "an", "eppendorf", "and", "washed", "with", "cold", "PBS", "in", "triplicate", "." ] } ]
PMC3931643
Similarly, the pro-apoptotic effects of MLN0128 and AZD8055 were modest in the DLBCL lines that expressed 4EBP1.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Similarly", ",", "the", "pro-apoptotic", "effects", "of", "MLN0128", "and", "AZD8055", "were", "modest", "in", "the", "DLBCL", "lines", "that", "expressed", "4EBP1", "." ] } ]
PMC11528603
Thus, p21 has been regarded as an important factor in cell cycle arrest and apoptosis.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Thus", ",", "p21", "has", "been", "regarded", "as", "an", "important", "factor", "in", "cell", "cycle", "arrest", "and", "apoptosis", "." ] } ]
PMC10761571
Data are stated as mean ± SD.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Data", "are", "stated", "as", "mean", "±", "SD", "." ] } ]
PMC11335267
Additional evidence supporting reduced muscle innervation was indicated by decreased levels of ChAT and the presynaptic vesicle-associated protein synaptobrevin-2 (Fig. 5D and E).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Additional", "evidence", "supporting", "reduced", "muscle", "innervation", "was", "indicated", "by", "decreased", "levels", "of", "ChAT", "and", "the", "presynaptic", "vesicle-associated", "protein", "synaptobrevin-2", "(", "Fig.", "5D", "and", "E", ")", "." ] } ]
PMC10940855
Multiple myeloma cells were tagged with luciferase and luminescence was the readout for multiple myeloma cell expansion.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Multiple", "myeloma", "cells", "were", "tagged", "with", "luciferase", "and", "luminescence", "was", "the", "readout", "for", "multiple", "myeloma", "cell", "expansion", "." ] } ]
PMC10988808
E 293 T cell lysates were prepared by weak RIPA lysis and co-immunoprecipitated by CCDC25 antibody with IgG as negative control.
[ { "tags": [ "B-CellLine", "I-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "E", "293", "T", "cell", "lysates", "were", "prepared", "by", "weak", "RIPA", "lysis", "and", "co-immunoprecipitated", "by", "CCDC25", "antibody", "with", "IgG", "as", "negative", "control", "." ] } ]
PMC8358176
The extrinsic pathway is induced by binding ligand to death receptors, a member of the tumor necrosis factor (TNF) receptor superfamily identified by cysteine-rich domains ( 9 - 11 ).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "extrinsic", "pathway", "is", "induced", "by", "binding", "ligand", "to", "death", "receptors", ",", "a", "member", "of", "the", "tumor", "necrosis", "factor", "(", "TNF", ")", "receptor", "superfamily", "identified", "by", "cysteine-rich", "domains", "(", "9", "-", "11", ")", "." ] } ]
PMC11310713
The researchers have demonstrated efficacy in diverse applications, ranging from bone and cartilage regeneration to neovascularization promotion and targeted cancer therapy.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "researchers", "have", "demonstrated", "efficacy", "in", "diverse", "applications", ",", "ranging", "from", "bone", "and", "cartilage", "regeneration", "to", "neovascularization", "promotion", "and", "targeted", "cancer", "therapy", "." ] } ]
PMC10033453
The study was concluded at day 14.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "study", "was", "concluded", "at", "day", "14", "." ] } ]
PMC11733919
We estimated that the amount of conjugated STV was six molecules for each MNP (Section S1 in the Supporting Information).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "We", "estimated", "that", "the", "amount", "of", "conjugated", "STV", "was", "six", "molecules", "for", "each", "MNP", "(", "Section", "S1", "in", "the", "Supporting", "Information", ")", "." ] } ]
PMC9509578
The use of transferring receptor (TR)-targeted liposomal nanoformulation was found to significantly enhance the delivery of cisplatin across the BBB for the treatment of brain tumors in C6 cells and Wistar rats .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O" ], "tokens": [ "The", "use", "of", "transferring", "receptor", "(TR)-targeted", "liposomal", "nanoformulation", "was", "found", "to", "significantly", "enhance", "the", "delivery", "of", "cisplatin", "across", "the", "BBB", "for", "the", "treatment", "of", "brain", "tumors", "in", "C6", "cells", "and", "Wistar", "rats", "." ] } ]
PMC11502443
Cells were transiently transfected using polyethyleneimine (PEI) with 0.25 μg of plasmid DNA per well (WT human GIP receptor (E354 variant), human GIP receptor E354Q variant, or empty vector (pcDNA3.1+)) as previously described (Bailey and Hay, 2006).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Cells", "were", "transiently", "transfected", "using", "polyethyleneimine", "(", "PEI", ")", "with", "0.25", "μg", "of", "plasmid", "DNA", "per", "well", "(", "WT", "human", "GIP", "receptor", "(", "E354", "variant", ")", ",", "human", "GIP", "receptor", "E354Q", "variant", ",", "or", "empty", "vector", "(", "pcDNA3.1", "+", ")", ")", "as", "previously", "described", "(", "Bailey", "and", "Hay", ",", "2006", ")", "." ] } ]
PMC11678448
Significance analysis was conducted using a two-tailed paired Student’s t-test in GraphPad Prism (version 9.5).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Significance", "analysis", "was", "conducted", "using", "a", "two-tailed", "paired", "Student", "’s", "t-test", "in", "GraphPad", "Prism", "(", "version", "9.5", ")", "." ] } ]
PMC3765139
PK carried out the PCR and conducted the animal experiments.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "PK", "carried", "out", "the", "PCR", "and", "conducted", "the", "animal", "experiments", "." ] } ]
PMC11093197
The relative level of gene expression was normalized using the level of TBP (Hs00427620_m1) or RPLP0 (forward: GTCCTCGTGGAAGGCCC, reverse: AGGAGAGACAGGGAGCTCAG).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "relative", "level", "of", "gene", "expression", "was", "normalized", "using", "the", "level", "of", "TBP", "(", "Hs00427620_m1", ")", "or", "RPLP0", "(", "forward", ":", "GTCCTCGTGGAAGGCCC", ",", "reverse", ":", "AGGAGAGACAGGGAGCTCAG", ")", "." ] } ]
PMC11252553
treated with Taurine solvent, irradiated at 8 Gy, and set for 72 hours, Group XVI.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "treated", "with", "Taurine", "solvent", ",", "irradiated", "at", "8", "Gy", ",", "and", "set", "for", "72", "hours", ",", "Group", "XVI", "." ] } ]
PMC11705862
The importance of a functional SNARE complex for neurotransmission becomes evident when studying neurodegenerative diseases, such as AD or Parkinson’s disease.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "importance", "of", "a", "functional", "SNARE", "complex", "for", "neurotransmission", "becomes", "evident", "when", "studying", "neurodegenerative", "diseases", ",", "such", "as", "AD", "or", "Parkinson", "’s", "disease", "." ] } ]
PMC8345486
To obtain the purified preparation, the crude product was dissolved in benzene (20 mL), the resultant solution was dried over solid MgSO4, filtered, then the filtrate was partly evaporated to a volume ca.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "To", "obtain", "the", "purified", "preparation", ",", "the", "crude", "product", "was", "dissolved", "in", "benzene", "(", "20", "mL", ")", ",", "the", "resultant", "solution", "was", "dried", "over", "solid", "MgSO4", ",", "filtered", ",", "then", "the", "filtrate", "was", "partly", "evaporated", "to", "a", "volume", "ca", "." ] } ]
PMC9429973
We demonstrated that anti-BTN2A1 agonist mAb (107G3B5) significantly enhanced Vγ9Vδ2 T cells mediated apoptosis, in comparison to control condition.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "We", "demonstrated", "that", "anti-BTN2A1", "agonist", "mAb", "(", "107G3B5", ")", "significantly", "enhanced", "Vγ9Vδ2", "T", "cells", "mediated", "apoptosis", ",", "in", "comparison", "to", "control", "condition", "." ] } ]
PMC11593031
Overall, aCGH data confirmed the results of molecular cytogenetics.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Overall", ",", "aCGH", "data", "confirmed", "the", "results", "of", "molecular", "cytogenetics", "." ] } ]
PMC11499381
Splice variant based homodimerization of CTR has also been proposed to regulate cell surface expression of the receptor .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Splice", "variant", "based", "homodimerization", "of", "CTR", "has", "also", "been", "proposed", "to", "regulate", "cell", "surface", "expression", "of", "the", "receptor", "." ] } ]
PMC11676674
Hence, our findings indicate that the C. monspeliensis methanolic leaf extract did not induce chromosomal damage, since it did not exhibit any genotoxic effect in CHO-K1 cells under the experimental conditions, as confirmed by the in vitro CBMN assay.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Hence", ",", "our", "findings", "indicate", "that", "the", "C.", "monspeliensis", "methanolic", "leaf", "extract", "did", "not", "induce", "chromosomal", "damage", ",", "since", "it", "did", "not", "exhibit", "any", "genotoxic", "effect", "in", "CHO-K1", "cells", "under", "the", "experimental", "conditions", ",", "as", "confirmed", "by", "the", "in", "vitro", "CBMN", "assay", "." ] } ]
PMC10969097
The experiment lasted 28 days, with continuous monitoring of the animals’ body weight .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "experiment", "lasted", "28", "days", ",", "with", "continuous", "monitoring", "of", "the", "animals", "’", "body", "weight", "." ] } ]
PMC11711063
Tumor growth and metabolic activity were monitored in parallel by positron emission tomography overlaid on NMR scans (PET‐NMR, see Figure 5H).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Tumor", "growth", "and", "metabolic", "activity", "were", "monitored", "in", "parallel", "by", "positron", "emission", "tomography", "overlaid", "on", "NMR", "scans", "(", "PET‐NMR", ",", "see", "Figure", "5H", ")", "." ] } ]
PMC10818062
One such major destination is the plasma membrane (PM) where PS serves as a regulator for a number of cellular processes including but not limited to signaling, membrane trafficking, and apoptosis.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "One", "such", "major", "destination", "is", "the", "plasma", "membrane", "(", "PM", ")", "where", "PS", "serves", "as", "a", "regulator", "for", "a", "number", "of", "cellular", "processes", "including", "but", "not", "limited", "to", "signaling", ",", "membrane", "trafficking", ",", "and", "apoptosis", "." ] } ]
PMC11752767
Typically derived from CD28 or 4-1BB, these co-stimulatory domains enhanced antitumor cytotoxicity, boosted cytokine production, and improved the proliferation and persistence of CAR-T cells .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Typically", "derived", "from", "CD28", "or", "4", "-", "1BB", ",", "these", "co-stimulatory", "domains", "enhanced", "antitumor", "cytotoxicity", ",", "boosted", "cytokine", "production", ",", "and", "improved", "the", "proliferation", "and", "persistence", "of", "CAR-T", "cells", "." ] } ]
PMC11365427
This process includes the cleavage of downstream signaling molecules, caspase-3, and PARP (Fig. 6E).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "This", "process", "includes", "the", "cleavage", "of", "downstream", "signaling", "molecules", ",", "caspase-3", ",", "and", "PARP", "(", "Fig.", "6E", ")", "." ] } ]
PMC9599726
On the upper panel, Cumming estimation plots display all data points, presented as a swarm plot, and their distribution .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "On", "the", "upper", "panel", ",", "Cumming", "estimation", "plots", "display", "all", "data", "points", ",", "presented", "as", "a", "swarm", "plot", ",", "and", "their", "distribution", "." ] } ]
PMC11676670
Cells were transfected with the plasmid encoding the spliceosomal protein SRSF2 fused with a red fluorescent protein (pTagRFP-C-SRSF2) using Lipofectamine.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Cells", "were", "transfected", "with", "the", "plasmid", "encoding", "the", "spliceosomal", "protein", "SRSF2", "fused", "with", "a", "red", "fluorescent", "protein", "(", "pTagRFP-C-SRSF2", ")", "using", "Lipofectamine", "." ] } ]
PMC11352311
The PPI network data obtained from the STRING database were then analyzed using Cytoscape (Supplementary Table S2), with proteins displayed according to their degree.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "PPI", "network", "data", "obtained", "from", "the", "STRING", "database", "were", "then", "analyzed", "using", "Cytoscape", "(", "Supplementary", "Table", "S2", ")", ",", "with", "proteins", "displayed", "according", "to", "their", "degree", "." ] } ]
PMC11388384
We reasoned that if cytonemes are a major mode of SHH delivery, perturbations to cytoneme number or length in sender cells would have a quantitative impact on SHH signaling gradients.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "We", "reasoned", "that", "if", "cytonemes", "are", "a", "major", "mode", "of", "SHH", "delivery", ",", "perturbations", "to", "cytoneme", "number", "or", "length", "in", "sender", "cells", "would", "have", "a", "quantitative", "impact", "on", "SHH", "signaling", "gradients", "." ] } ]
PMC11782780
They possess an unusual zinc finger and helix-loop-helix motif and control the expression of many downstream target genes by binding DNA.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "They", "possess", "an", "unusual", "zinc", "finger", "and", "helix-loop-helix", "motif", "and", "control", "the", "expression", "of", "many", "downstream", "target", "genes", "by", "binding", "DNA", "." ] } ]
PMC11371747
Drug dilutions were made in medium prior to experiments.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Drug", "dilutions", "were", "made", "in", "medium", "prior", "to", "experiments", "." ] } ]
PMC11535726
From the checklist (Table 2), we decipher that most Kirschsteiniothelia species have been reported from China (23 species), followed by Thailand (14 species), with a few distributed across different countries including Australia, Belgium, Canada, Czechia, France, Germany, Greece, Italy, India, Iran, Mexico, New Zealand, Poland, Russian Federation, Sweden, Switzerland, South Africa, Spain, United Kingdom and USA (Boonmee et al. 2012; Mehrabi et al. 2017; Bao et al. 2018; Rodríguez-Andrade et al. 2020; Jayawardena et al. 2022; Senanayake et al. 2023; Liu et al. 2023b; Yang et al. 2023; de Farias et al. 2024; Louangphan et al. 2024).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "From", "the", "checklist", "(", "Table", "2", ")", ",", "we", "decipher", "that", "most", "Kirschsteiniothelia", "species", "have", "been", "reported", "from", "China", "(", "23", "species", ")", ",", "followed", "by", "Thailand", "(", "14", "species", ")", ",", "with", "a", "few", "distributed", "across", "different", "countries", "including", "Australia", ",", "Belgium", ",", "Canada", ",", "Czechia", ",", "France", ",", "Germany", ",", "Greece", ",", "Italy", ",", "India", ",", "Iran", ",", "Mexico", ",", "New", "Zealand", ",", "Poland", ",", "Russian", "Federation", ",", "Sweden", ",", "Switzerland", ",", "South", "Africa", ",", "Spain", ",", "United", "Kingdom", "and", "USA", "(", "Boonmee", "et", "al.", "2012", ";", "Mehrabi", "et", "al.", "2017", ";", "Bao", "et", "al.", "2018", ";", "Rodríguez-Andrade", "et", "al.", "2020", ";", "Jayawardena", "et", "al.", "2022", ";", "Senanayake", "et", "al.", "2023", ";", "Liu", "et", "al.", "2023b", ";", "Yang", "et", "al.", "2023", ";", "de", "Farias", "et", "al.", "2024", ";", "Louangphan", "et", "al.", "2024", ")", "." ] } ]
PMC10073922
The data revealed that NDRG2 overexpression decreases the viability of A549 cells compared to the control non-transfected cells (p<0.001) and the mock plasmid-transfected group (p=0.002).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "data", "revealed", "that", "NDRG2", "overexpression", "decreases", "the", "viability", "of", "A549", "cells", "compared", "to", "the", "control", "non-transfected", "cells", "(", "p<0.001", ")", "and", "the", "mock", "plasmid-transfected", "group", "(", "p=0.002", ")", "." ] } ]
PMC11792090
Additionally, the treatment with CAR-T cells prolonged the survival of mice ( Figure 6D ).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Additionally", ",", "the", "treatment", "with", "CAR-T", "cells", "prolonged", "the", "survival", "of", "mice", "(", "Figure", "6D", ")", "." ] } ]
PMC9429973
The blood pictures revealed a moderate rouleaux formation in 65.6%, toxic neutrophils in 85%, myelocytes in 37% and reactive lymphocytes in 55.8%.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "blood", "pictures", "revealed", "a", "moderate", "rouleaux", "formation", "in", "65.6", "%", ",", "toxic", "neutrophils", "in", "85", "%", ",", "myelocytes", "in", "37", "%", "and", "reactive", "lymphocytes", "in", "55.8", "%", "." ] } ]
PMC8270637
Transforming growth factor β1 (TGF-β1) can inhibit the immune function of T lymphocytes and promote the occurrence and development of tumors.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Transforming", "growth", "factor", "β1", "(", "TGF-β1", ")", "can", "inhibit", "the", "immune", "function", "of", "T", "lymphocytes", "and", "promote", "the", "occurrence", "and", "development", "of", "tumors", "." ] } ]
PMC10813895
The association of BRCA1/2 mutations with DNA repair deficiency, combined with hormonal influences on mammary gland differentiation and an accelerated aging phenotype, underscores the multifaceted nature of cancer development.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "association", "of", "BRCA1/2", "mutations", "with", "DNA", "repair", "deficiency", ",", "combined", "with", "hormonal", "influences", "on", "mammary", "gland", "differentiation", "and", "an", "accelerated", "aging", "phenotype", ",", "underscores", "the", "multifaceted", "nature", "of", "cancer", "development", "." ] } ]
PMC11768927
While their in vitro data showed efficient killing of the FaDu cells and induction of apoptosis by the virus, systemic injection of virus in vivo had minimal effects on the growth of the xenografted tumors.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "While", "their", "in", "vitro", "data", "showed", "efficient", "killing", "of", "the", "FaDu", "cells", "and", "induction", "of", "apoptosis", "by", "the", "virus", ",", "systemic", "injection", "of", "virus", "in", "vivo", "had", "minimal", "effects", "on", "the", "growth", "of", "the", "xenografted", "tumors", "." ] } ]
PMC8728081
Without this step, the conversion of Kajjali (metacinnabar or β-HgS) to Rasasindura (α-HgS) could not be completed.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Without", "this", "step", ",", "the", "conversion", "of", "Kajjali", "(", "metacinnabar", "or", "β-HgS", ")", "to", "Rasasindura", "(", "α-HgS", ")", "could", "not", "be", "completed", "." ] } ]
PMC10547921
Toshiyuki Shimizu's team found that the TLR7 TM helix is aligned with the TLR7-TLR signal conditioner (UNC93B1) TM3 and TM6 helices and the juxtamembrane region, and the LRR-CT motif interact with the luminal side of the UNC93B1 N-terminal six-helix bundle.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Toshiyuki", "Shimizu", "'s", "team", "found", "that", "the", "TLR7", "TM", "helix", "is", "aligned", "with", "the", "TLR7-TLR", "signal", "conditioner", "(", "UNC93B1", ")", "TM3", "and", "TM6", "helices", "and", "the", "juxtamembrane", "region", ",", "and", "the", "LRR-CT", "motif", "interact", "with", "the", "luminal", "side", "of", "the", "UNC93B1", "N-terminal", "six-helix", "bundle", "." ] } ]
PMC6379402
The data-integration scripts are coded in Matlab.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "data-integration", "scripts", "are", "coded", "in", "Matlab", "." ] } ]
PMC11591052
Its intermediate, 3-phosphoglycerate, is a carbon source for serine, glycine, and cysteine, while another intermediate, pyruvate, is a direct source for alanine production.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Its", "intermediate", ",", "3-phosphoglycerate", ",", "is", "a", "carbon", "source", "for", "serine", ",", "glycine", ",", "and", "cysteine", ",", "while", "another", "intermediate", ",", "pyruvate", ",", "is", "a", "direct", "source", "for", "alanine", "production", "." ] } ]
PMC10854447
In 6a–o, the dimethoxy derivative was the most tolerated for activity.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "In", "6a", "–", "o", ",", "the", "dimethoxy", "derivative", "was", "the", "most", "tolerated", "for", "activity", "." ] } ]
PMC9268620
The buffer was discarded, and a drop of serum was put into a tube.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "buffer", "was", "discarded", ",", "and", "a", "drop", "of", "serum", "was", "put", "into", "a", "tube", "." ] } ]
PMC10778532
After washing with PBS (Gibco, Thermo Fisher Scientific, Inc., Waltham, MA, USA), cells were incubated at 37 °C and 5% CO2.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "After", "washing", "with", "PBS", "(", "Gibco", ",", "Thermo", "Fisher", "Scientific", ",", "Inc.", ",", "Waltham", ",", "MA", ",", "USA", ")", ",", "cells", "were", "incubated", "at", "37", "°", "C", "and", "5", "%", "CO2", "." ] } ]
PMC9429973
84% of patients were penta-drug exposed, 88% were triple-class refractory, 42% were penta-drug refractory, and 99% were refractory to their last LOT.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "84", "%", "of", "patients", "were", "penta-drug", "exposed", ",", "88", "%", "were", "triple-class", "refractory", ",", "42", "%", "were", "penta-drug", "refractory", ",", "and", "99", "%", "were", "refractory", "to", "their", "last", "LOT", "." ] } ]
PMC6450504
An additional pretreatment group was included where cells were pre-incubated with bPEI at 10 µg/mL for 15 min.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "An", "additional", "pretreatment", "group", "was", "included", "where", "cells", "were", "pre-incubated", "with", "bPEI", "at", "10", "µg/mL", "for", "15", "min", "." ] } ]
PMC11001582
f, qPCR analysis of COL6A1 transcript levels normalized to GAPDH at DIV 5 (left panel) and DIV 7 (right panel) in (GR)50, or GFP-treated iNeurons.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "f", ",", "qPCR", "analysis", "of", "COL6A1", "transcript", "levels", "normalized", "to", "GAPDH", "at", "DIV", "5", "(", "left", "panel", ")", "and", "DIV", "7", "(", "right", "panel", ")", "in", "(GR)50", ",", "or", "GFP-treated", "iNeurons", "." ] } ]
PMC10033453
Viability was normalized to the maximum absorbance read per plate as representative of 100%, and background absorbance was subtracted.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Viability", "was", "normalized", "to", "the", "maximum", "absorbance", "read", "per", "plate", "as", "representative", "of", "100", "%", ",", "and", "background", "absorbance", "was", "subtracted", "." ] } ]
PMC9429973
Summary/Conclusion: We identify features of inflammasome-related gene expression in individual cell populations and disease states reflecting the progression from non-CHIP through CHIP to MDS.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Summary/Conclusion", ":", "We", "identify", "features", "of", "inflammasome-related", "gene", "expression", "in", "individual", "cell", "populations", "and", "disease", "states", "reflecting", "the", "progression", "from", "non-CHIP", "through", "CHIP", "to", "MDS", "." ] } ]
PMC9429973
Institute of Medical and Molecular Genetics (INGEMM) La Paz University Hospital, Madrid, Spain.;
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Institute", "of", "Medical", "and", "Molecular", "Genetics", "(", "INGEMM", ")", "La", "Paz", "University", "Hospital", ",", "Madrid", ",", "Spain", ".", ";" ] } ]
PMC8839885
A2780CisR cells were treated with RJY13 in the presence and absence of MS-5 cells and the abilities of 2HE2 and dasatinib to restore platinum sensitivity were monitored.
[ { "tags": [ "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "A2780CisR", "cells", "were", "treated", "with", "RJY13", "in", "the", "presence", "and", "absence", "of", "MS-5", "cells", "and", "the", "abilities", "of", "2HE2", "and", "dasatinib", "to", "restore", "platinum", "sensitivity", "were", "monitored", "." ] } ]
PMC11635519
Finally, these peptide coding sequences were sequenced and compared with the human genome to determine possible GPCR-activating peptides (Figure 1).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Finally", ",", "these", "peptide", "coding", "sequences", "were", "sequenced", "and", "compared", "with", "the", "human", "genome", "to", "determine", "possible", "GPCR-activating", "peptides", "(", "Figure", "1", ")", "." ] } ]
PMC9429973
MDS can develop from clonal hematopoiesis of indeterminate potential (CHIP) and progress through low-risk (LR) to high-risk (HR)-MDS and further to acute myeloid leukemia (AML).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "MDS", "can", "develop", "from", "clonal", "hematopoiesis", "of", "indeterminate", "potential", "(", "CHIP", ")", "and", "progress", "through", "low-risk", "(", "LR", ")", "to", "high-risk", "(HR)-MDS", "and", "further", "to", "acute", "myeloid", "leukemia", "(", "AML", ")", "." ] } ]
PMC11768927
Combining VSV with ICIs, such as anti-PD-L1 antibodies, synergistically enhances the clearance of tumor cells by overcoming immune escape mechanisms, significantly boosting therapeutic efficacy.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Combining", "VSV", "with", "ICIs", ",", "such", "as", "anti-PD-L1", "antibodies", ",", "synergistically", "enhances", "the", "clearance", "of", "tumor", "cells", "by", "overcoming", "immune", "escape", "mechanisms", ",", "significantly", "boosting", "therapeutic", "efficacy", "." ] } ]
PMC10114490
E Intracellular levels of reduced glutathione (GSH) and S-adenosyl-L-methionine (SAM) in diHLC-T and HepG2 cells.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "B-CellLine", "O", "O" ], "tokens": [ "E", "Intracellular", "levels", "of", "reduced", "glutathione", "(", "GSH", ")", "and", "S-adenosyl-L-methionine", "(", "SAM", ")", "in", "diHLC-T", "and", "HepG2", "cells", "." ] } ]
PMC9429973
Sixteen pts (39%) had disease progression and were retreated mostly with 2CDA.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Sixteen", "pts", "(", "39", "%", ")", "had", "disease", "progression", "and", "were", "retreated", "mostly", "with", "2CDA", "." ] } ]
PMC11575040
The role of LINC00094 is to regulate the growth melanoma cell by sponging miR-1270 expression and targeting genes of CD276 and CENPM.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "role", "of", "LINC00094", "is", "to", "regulate", "the", "growth", "melanoma", "cell", "by", "sponging", "miR-1270", "expression", "and", "targeting", "genes", "of", "CD276", "and", "CENPM", "." ] } ]
PMC11754094
c, Data from CRISPRi screening with Nanopore-seq plotted as Z-scores of the frequency of large-deletion events in cells with the indicated gene knocked down.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "c", ",", "Data", "from", "CRISPRi", "screening", "with", "Nanopore-seq", "plotted", "as", "Z-scores", "of", "the", "frequency", "of", "large-deletion", "events", "in", "cells", "with", "the", "indicated", "gene", "knocked", "down", "." ] } ]
PMC8956657
Although several studies demonstrated that ORF4b contributes to innate immune inhibition the mechanisms by which the NLSs facilitate such functions are incompletely understood.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Although", "several", "studies", "demonstrated", "that", "ORF4b", "contributes", "to", "innate", "immune", "inhibition", "the", "mechanisms", "by", "which", "the", "NLSs", "facilitate", "such", "functions", "are", "incompletely", "understood", "." ] } ]
PMC11634027
Membrane was blocked with Intercept Blocking Buffer (LI-COR, 927-70001) for 1 h at room temperature and then incubated with primary antibodies mouse anti-V5 (Invitrogen, R960-25; 1:5000), rabbit anti-FLAG (Sigma-Aldrich, F3165; 1:2000), FluoTag-X2 anti-ALFA antibody (1:2500; NanoTag Biotechnologies, N1502-Li800-L) and mouse anti-GAPDH (1:20,000; Proteintech, 60004-1-IG) overnight at 4°C.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Membrane", "was", "blocked", "with", "Intercept", "Blocking", "Buffer", "(", "LI-COR", ",", "927", "-", "70001", ")", "for", "1", "h", "at", "room", "temperature", "and", "then", "incubated", "with", "primary", "antibodies", "mouse", "anti-V5", "(", "Invitrogen", ",", "R960", "-", "25", ";", "1:5000", ")", ",", "rabbit", "anti-FLAG", "(", "Sigma-Aldrich", ",", "F3165", ";", "1:2000", ")", ",", "FluoTag-X2", "anti-ALFA", "antibody", "(", "1:2500", ";", "NanoTag", "Biotechnologies", ",", "N1502-Li800-L", ")", "and", "mouse", "anti-GAPDH", "(", "1:20,000", ";", "Proteintech", ",", "60004", "-", "1-IG", ")", "overnight", "at", "4", "°", "C", "." ] } ]
PMC11380454
NF-ĸB is also a major mediator of INF-gamma-induced PD-L1 expression 56, 58.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "NF-ĸB", "is", "also", "a", "major", "mediator", "of", "INF-gamma-induced", "PD-L1", "expression", "56", ",", "58", "." ] } ]
PMC6889484
We sought to determine whether A3G-D128K-resistant variants can be selected in culture from a genetically diverse population of viruses derived from patients.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "We", "sought", "to", "determine", "whether", "A3G-D128K-resistant", "variants", "can", "be", "selected", "in", "culture", "from", "a", "genetically", "diverse", "population", "of", "viruses", "derived", "from", "patients", "." ] } ]
PMC11637276
CDM uptake index was calculated with ImageJ. Values represented are normalised mean + SD from N = 3 independent experiments; ****p < 0.0001; Kruskal–Wallis test. (
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "CDM", "uptake", "index", "was", "calculated", "with", "ImageJ.", "Values", "represented", "are", "normalised", "mean", "+", "SD", "from", "N", "=", "3", "independent", "experiments", ";", "*", "*", "*", "*", "p", "<", "0.0001", ";", "Kruskal", "–", "Wallis", "test", ".", "(" ] } ]
PMC7022782
Ultrathin sections for TEM of the same samples obtained by two-dimensional cell culture in vitro were stained with uranyl acetate and lead citrate (Figure 7 and Figure 8).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Ultrathin", "sections", "for", "TEM", "of", "the", "same", "samples", "obtained", "by", "two-dimensional", "cell", "culture", "in", "vitro", "were", "stained", "with", "uranyl", "acetate", "and", "lead", "citrate", "(", "Figure", "7", "and", "Figure", "8)", "." ] } ]
PMC10079526
MG132 (10 µM for 20 h of treatment and 2.5 µM for 4 h of treatment) was used for proteasome inhibition conditions.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "MG132", "(", "10", "µM", "for", "20", "h", "of", "treatment", "and", "2.5", "µM", "for", "4", "h", "of", "treatment", ")", "was", "used", "for", "proteasome", "inhibition", "conditions", "." ] } ]
PMC9118379
PepQuery adopts a peptide-centric strategy, which takes the user’s preselected variant peptide sequences as input to retrieve the highest-scoring variant peptide–spectrum matches (PSMs) and then performs unrestricted modification searching with all of the modifications from Unimod to confirm that the variant PSMs have no other interpretation.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "PepQuery", "adopts", "a", "peptide-centric", "strategy", ",", "which", "takes", "the", "user", "’s", "preselected", "variant", "peptide", "sequences", "as", "input", "to", "retrieve", "the", "highest-scoring", "variant", "peptide", "–", "spectrum", "matches", "(", "PSMs", ")", "and", "then", "performs", "unrestricted", "modification", "searching", "with", "all", "of", "the", "modifications", "from", "Unimod", "to", "confirm", "that", "the", "variant", "PSMs", "have", "no", "other", "interpretation", "." ] } ]
PMC6889484
We determined the extent to which proviral DNAs in target cells transduced with the A3G(DK), A33G(DK), and A3x3G(DK) vectors were hypermutated by PCR amplification and sequencing of a 982-bp proviral DNA fragment (Figure S2; Table 1).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "We", "determined", "the", "extent", "to", "which", "proviral", "DNAs", "in", "target", "cells", "transduced", "with", "the", "A3G(DK", ")", ",", "A33G(DK", ")", ",", "and", "A3x3G(DK", ")", "vectors", "were", "hypermutated", "by", "PCR", "amplification", "and", "sequencing", "of", "a", "982-bp", "proviral", "DNA", "fragment", "(", "Figure", "S2", ";", "Table", "1", ")", "." ] } ]
PMC11792740
These approaches offer a comprehensive assessment of the tumor immune landscape, enhancing our understanding of T-cell dynamics across different TME. (
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "These", "approaches", "offer", "a", "comprehensive", "assessment", "of", "the", "tumor", "immune", "landscape", ",", "enhancing", "our", "understanding", "of", "T-cell", "dynamics", "across", "different", "TME", ".", "(" ] } ]
PMC8345486
Synthesis of 2′-O-(1-pentyn-5-yl)adenosine (21) was performed as described .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Synthesis", "of", "2′-O-(1-pentyn-5-yl)adenosine", "(", "21", ")", "was", "performed", "as", "described", "." ] } ]
PMC10530622
Unlike PH1 or 2, it is not clear how a deficiency in the liver-specific mitochondrial enzyme HOGA encoded by HOGA1 will cause hyperproduction of oxalate.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Unlike", "PH1", "or", "2", ",", "it", "is", "not", "clear", "how", "a", "deficiency", "in", "the", "liver-specific", "mitochondrial", "enzyme", "HOGA", "encoded", "by", "HOGA1", "will", "cause", "hyperproduction", "of", "oxalate", "." ] } ]
PMC10578720
Chronic HBV has been established as a major cause of liver fibrosis.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Chronic", "HBV", "has", "been", "established", "as", "a", "major", "cause", "of", "liver", "fibrosis", "." ] } ]
PMC11627060
Investigational cancer therapeutics face challenges in targeting specific sites within the body due to suboptimal physicochemical properties.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Investigational", "cancer", "therapeutics", "face", "challenges", "in", "targeting", "specific", "sites", "within", "the", "body", "due", "to", "suboptimal", "physicochemical", "properties", "." ] } ]
PMC10994876
This indicates that YAP5SA promotes the progression of the cell cycle by inducing the transition from G1 to the S phase.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "This", "indicates", "that", "YAP5SA", "promotes", "the", "progression", "of", "the", "cell", "cycle", "by", "inducing", "the", "transition", "from", "G1", "to", "the", "S", "phase", "." ] } ]
PMC6182045
Additionally, it was amongst the top quartile of binding to the PG9 bNAb that binds a glycan dependent epitope in the V1/V2 domain (4), the CD4-binding site binding bNAb VRC01 (30), and the V3 glycan dependent bNAb PGT121 (31).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Additionally", ",", "it", "was", "amongst", "the", "top", "quartile", "of", "binding", "to", "the", "PG9", "bNAb", "that", "binds", "a", "glycan", "dependent", "epitope", "in", "the", "V1/V2", "domain", "(", "4", ")", ",", "the", "CD4-binding", "site", "binding", "bNAb", "VRC01", "(", "30", ")", ",", "and", "the", "V3", "glycan", "dependent", "bNAb", "PGT121", "(", "31", ")", "." ] } ]
PMC11476222
Such research can potentially translate into clinical applications for diagnosis and therapeutic development.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Such", "research", "can", "potentially", "translate", "into", "clinical", "applications", "for", "diagnosis", "and", "therapeutic", "development", "." ] } ]
PMC11011837
Notably, when considering the overall metabolic profile, it becomes apparent that Molt-4 stands out as the most distinct among the cell lines.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Notably", ",", "when", "considering", "the", "overall", "metabolic", "profile", ",", "it", "becomes", "apparent", "that", "Molt-4", "stands", "out", "as", "the", "most", "distinct", "among", "the", "cell", "lines", "." ] } ]
PMC9672323
To the best of our knowledge, this is the first study showing the protective effect of piroxicam on PBMCs against glioblastoma tumor cells, reflecting the compensatory effect of this NSAID on the proliferation and activity of T cells in the presence of glioblastoma cell lines.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "To", "the", "best", "of", "our", "knowledge", ",", "this", "is", "the", "first", "study", "showing", "the", "protective", "effect", "of", "piroxicam", "on", "PBMCs", "against", "glioblastoma", "tumor", "cells", ",", "reflecting", "the", "compensatory", "effect", "of", "this", "NSAID", "on", "the", "proliferation", "and", "activity", "of", "T", "cells", "in", "the", "presence", "of", "glioblastoma", "cell", "lines", "." ] } ]
PMC9429973
HR = 0.77 (80% CI: 0.40, 1.48), p-value = 0.61].
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "HR", "=", "0.77", "(", "80", "%", "CI", ":", "0.40", ",", "1.48", ")", ",", "p-value", "=", "0.61", "]", "." ] } ]
PMC10932641
According to the manufacturer’s instructions of the TRIzol, total RNA was extracted and reverse transcribed into complement DNA (cDNA) with the Surescript First-Strand cDNA Synthesis Kit The Reverse Transcription reaction system was kept at 25 ℃ for 5 min, 42 ℃ for 15 min, and 85 ℃ for 5 min, and the resulting product was stored at −20 ℃.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "According", "to", "the", "manufacturer", "’s", "instructions", "of", "the", "TRIzol", ",", "total", "RNA", "was", "extracted", "and", "reverse", "transcribed", "into", "complement", "DNA", "(", "cDNA", ")", "with", "the", "Surescript", "First-Strand", "cDNA", "Synthesis", "Kit", "The", "Reverse", "Transcription", "reaction", "system", "was", "kept", "at", "25", "℃", "for", "5", "min", ",", "42", "℃", "for", "15", "min", ",", "and", "85", "℃", "for", "5", "min", ",", "and", "the", "resulting", "product", "was", "stored", "at", "−20", "℃", "." ] } ]
PMC11574029
Next, we overexpressed SPP1 in T24 and 5637 cells and treated with the PI3K/AKT pathway inhibitor LY294002.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Next", ",", "we", "overexpressed", "SPP1", "in", "T24", "and", "5637", "cells", "and", "treated", "with", "the", "PI3K/AKT", "pathway", "inhibitor", "LY294002", "." ] } ]
PMC9429973
Previous studies have shown an VTE incidence of up to 41% in patients receiving the DFCI protocol and up to 29% with prophylactic anticoagulations.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Previous", "studies", "have", "shown", "an", "VTE", "incidence", "of", "up", "to", "41", "%", "in", "patients", "receiving", "the", "DFCI", "protocol", "and", "up", "to", "29", "%", "with", "prophylactic", "anticoagulations", "." ] } ]
PMC11656048
The detailed measurement was conducted according to the kit instructions.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "detailed", "measurement", "was", "conducted", "according", "to", "the", "kit", "instructions", "." ] } ]
PMC11694066
When comparing the SF50 of PARPi and ATRi found in the JN1 cell line with the corresponding average steady-state or max single-dose plasma concentrations (Css-mean or Csd-max, respectively) dosed in patients enrolled in pharmacokinetic studies and treated at the recommended phase II dose (16–18), we observed that the concentrations that we used in vitro seemed clinically achievable (talazoparib, SF50 ≃ 10 nmol/L, Css-mean = 7 nmol/L; olaparib, SF50 ≃ 1 μmol/L, Css-mean = 1.7 μmol/L; AZD6738, SF50 ≃ 0.5 μmol/L, Csd-max = 4.5 μmol/L; M4344, SF50 ≃ 7 nmol/L, Csd-max = 750 nmol/L)—although no robust conclusion could be drawn at this stage considering the difficulties in comparing in vitro data with exposure in patients.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "When", "comparing", "the", "SF50", "of", "PARPi", "and", "ATRi", "found", "in", "the", "JN1", "cell", "line", "with", "the", "corresponding", "average", "steady-state", "or", "max", "single-dose", "plasma", "concentrations", "(", "Css-mean", "or", "Csd-max", ",", "respectively", ")", "dosed", "in", "patients", "enrolled", "in", "pharmacokinetic", "studies", "and", "treated", "at", "the", "recommended", "phase", "II", "dose", "(", "16–18", ")", ",", "we", "observed", "that", "the", "concentrations", "that", "we", "used", "in", "vitro", "seemed", "clinically", "achievable", "(", "talazoparib", ",", "SF50", "≃", "10", "nmol/L", ",", "Css-mean", "=", "7", "nmol/L", ";", "olaparib", ",", "SF50", "≃", "1", "μmol/L", ",", "Css-mean", "=", "1.7", "μmol/L", ";", "AZD6738", ",", "SF50", "≃", "0.5", "μmol/L", ",", "Csd-max", "=", "4.5", "μmol/L", ";", "M4344", ",", "SF50", "≃", "7", "nmol/L", ",", "Csd-max", "=", "750", "nmol/L)—although", "no", "robust", "conclusion", "could", "be", "drawn", "at", "this", "stage", "considering", "the", "difficulties", "in", "comparing", "in", "vitro", "data", "with", "exposure", "in", "patients", "." ] } ]
PMC9429973
Aims: Our group has developed an in-house anti-CD19 CAR-T cell product, using a safer to LV, foamy virus vector (FV).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Aims", ":", "Our", "group", "has", "developed", "an", "in-house", "anti-CD19", "CAR-T", "cell", "product", ",", "using", "a", "safer", "to", "LV", ",", "foamy", "virus", "vector", "(", "FV", ")", "." ] } ]
PMC4270159
We will also determine the sample size post hoc as described in Power Calculations.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "We", "will", "also", "determine", "the", "sample", "size", "post", "hoc", "as", "described", "in", "Power", "Calculations", "." ] } ]
PMC6642070
DCA is also able to reduce muscle lactate accumulation in both animals and humans .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "DCA", "is", "also", "able", "to", "reduce", "muscle", "lactate", "accumulation", "in", "both", "animals", "and", "humans", "." ] } ]
PMC10898159
LMTK3 increases KIT expression via the speedup of translation rate of KIT transcripts.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "LMTK3", "increases", "KIT", "expression", "via", "the", "speedup", "of", "translation", "rate", "of", "KIT", "transcripts", "." ] } ]
PMC7570809
By this combined approach we also demonstrated that the substitution of the key homocitrulline residue with aspartic acid shifts the receptor binding selectivity from αvβ3 to αvβ5 integrin, thus identifying a novel and selective αvβ5 ligand, named RGDechi15D .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "By", "this", "combined", "approach", "we", "also", "demonstrated", "that", "the", "substitution", "of", "the", "key", "homocitrulline", "residue", "with", "aspartic", "acid", "shifts", "the", "receptor", "binding", "selectivity", "from", "αvβ3", "to", "αvβ5", "integrin", ",", "thus", "identifying", "a", "novel", "and", "selective", "αvβ5", "ligand", ",", "named", "RGDechi15D", "." ] } ]
PMC11730305
The mixture was placed in an ultrasonic bath (SONOREX SUPER RK 514, Berlin, Germany) for 30 min to disperse the particles and then the mixture was transferred to a 100 mL steel autoclave coated with Teflon and heated at a temperature of 180 °C for 3 h. The product was separated by centrifugation at 6000 rpm, washed three times with water and ethanol, and dried at 60 °C for 5 h. Conjugation of Co3O4@Glu with EA was performed as follows: a suspension containing 1.0 gram of the nanoparticles and 1.0 gram of EA was prepared and shaken in an incubator shaker for 18 h (Fig. 1).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "mixture", "was", "placed", "in", "an", "ultrasonic", "bath", "(", "SONOREX", "SUPER", "RK", "514", ",", "Berlin", ",", "Germany", ")", "for", "30", "min", "to", "disperse", "the", "particles", "and", "then", "the", "mixture", "was", "transferred", "to", "a", "100", "mL", "steel", "autoclave", "coated", "with", "Teflon", "and", "heated", "at", "a", "temperature", "of", "180", "°", "C", "for", "3", "h.", "The", "product", "was", "separated", "by", "centrifugation", "at", "6000", "rpm", ",", "washed", "three", "times", "with", "water", "and", "ethanol", ",", "and", "dried", "at", "60", "°", "C", "for", "5", "h.", "Conjugation", "of", "Co3O4@Glu", "with", "EA", "was", "performed", "as", "follows", ":", "a", "suspension", "containing", "1.0", "gram", "of", "the", "nanoparticles", "and", "1.0", "gram", "of", "EA", "was", "prepared", "and", "shaken", "in", "an", "incubator", "shaker", "for", "18", "h", "(", "Fig.", "1", ")", "." ] } ]
PMC5574817
A representative image showing the Western blot analysis of the hERG protein expression in hERG-transfected and non-transfected HEK293 cells.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O" ], "tokens": [ "A", "representative", "image", "showing", "the", "Western", "blot", "analysis", "of", "the", "hERG", "protein", "expression", "in", "hERG-transfected", "and", "non-transfected", "HEK293", "cells", "." ] } ]
PMC11672617
However, it has been demonstrated to stimulate hormesis in response to stress by activating a complex signaling network that specifically alters epigenetic patterns and gene expression, thereby promoting longevity .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "However", ",", "it", "has", "been", "demonstrated", "to", "stimulate", "hormesis", "in", "response", "to", "stress", "by", "activating", "a", "complex", "signaling", "network", "that", "specifically", "alters", "epigenetic", "patterns", "and", "gene", "expression", ",", "thereby", "promoting", "longevity", "." ] } ]