Datasets:
OTAR3088
/
BioData-CellLine_annotated

Dataset card Data Studio Files
xet
Community
1
PMCID
string
Sentences
string
ner
list
PMC11766332
Future research should prioritize the experimental validation of the identified miRNAs and their precise roles in glycosylation pathways, thus furthering their potential as both diagnostic biomarkers and therapeutic targets.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Future", "research", "should", "prioritize", "the", "experimental", "validation", "of", "the", "identified", "miRNAs", "and", "their", "precise", "roles", "in", "glycosylation", "pathways", ",", "thus", "furthering", "their", "potential", "as", "both", "diagnostic", "biomarkers", "and", "therapeutic", "targets", "." ] } ]
PMC9429973
Indications for DOAC use were Atrial Fibrillation (76%), PE(6%), DVT(9%), other(8%).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Indications", "for", "DOAC", "use", "were", "Atrial", "Fibrillation", "(", "76", "%", ")", ",", "PE(6", "%", ")", ",", "DVT(9", "%", ")", ",", "other(8", "%", ")", "." ] } ]
PMC11806613
Gene ontology linked LRP8 downregulation to oxidative stress and glutathione metabolism (Sup.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Gene", "ontology", "linked", "LRP8", "downregulation", "to", "oxidative", "stress", "and", "glutathione", "metabolism", "(", "Sup", "." ] } ]
PMC11352311
Similar to esculin, scopoletin inhibits non-small-cell lung cancer by targeting the PI3K/Akt pathway .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Similar", "to", "esculin", ",", "scopoletin", "inhibits", "non-small-cell", "lung", "cancer", "by", "targeting", "the", "PI3K/Akt", "pathway", "." ] } ]
PMC9429973
In a subgroup of 22 patients, cfDNA was monitored monthly, whereas PET/CT was reassessed after induction therapy to evaluate metabolic tumor response.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "In", "a", "subgroup", "of", "22", "patients", ",", "cfDNA", "was", "monitored", "monthly", ",", "whereas", "PET/CT", "was", "reassessed", "after", "induction", "therapy", "to", "evaluate", "metabolic", "tumor", "response", "." ] } ]
PMC8041314
The complete analytical assessment of the compounds is provided in the Supporting Information.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "complete", "analytical", "assessment", "of", "the", "compounds", "is", "provided", "in", "the", "Supporting", "Information", "." ] } ]
PMC11640476
The linearity of the curves was assessed, yielding an R mean of 0.994 ± 0.002 (mean ± SD).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "linearity", "of", "the", "curves", "was", "assessed", ",", "yielding", "an", "R", "mean", "of", "0.994", "±", "0.002", "(", "mean", "±", "SD", ")", "." ] } ]
PMC11585994
Inhibitory effect of G5-sgc8-siBCL11B nanoparticles in T-ALL. (
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Inhibitory", "effect", "of", "G5-sgc8-siBCL11B", "nanoparticles", "in", "T-ALL", ".", "(" ] } ]
PMC10667689
Furthermore, we analyzed the relative abundance of free fatty acids in the supernatant of cell cultures 48 h after treatment with Gal-9, which showed the most significant alteration in comparison to the control and PMA group in both cell lines.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Furthermore", ",", "we", "analyzed", "the", "relative", "abundance", "of", "free", "fatty", "acids", "in", "the", "supernatant", "of", "cell", "cultures", "48", "h", "after", "treatment", "with", "Gal-9", ",", "which", "showed", "the", "most", "significant", "alteration", "in", "comparison", "to", "the", "control", "and", "PMA", "group", "in", "both", "cell", "lines", "." ] } ]
PMC11401358
Finding a biomaterial with both strong antioxidation and good biocompatibility is challenging, and we screened out a new antioxidation biomaterial, SF, and clarified its antioxidation mechanisms in this study.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Finding", "a", "biomaterial", "with", "both", "strong", "antioxidation", "and", "good", "biocompatibility", "is", "challenging", ",", "and", "we", "screened", "out", "a", "new", "antioxidation", "biomaterial", ",", "SF", ",", "and", "clarified", "its", "antioxidation", "mechanisms", "in", "this", "study", "." ] } ]
PMC6684588
Data are means ± SEM (n = 8). (
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Data", "are", "means", "±", "SEM", "(", "n", "=", "8)", ".", "(" ] } ]
PMC8345486
Experimental A2780cisR and A2780cisKB lines were derived from the A2780cis cell line.
[ { "tags": [ "O", "B-CellLine", "O", "B-CellLine", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O" ], "tokens": [ "Experimental", "A2780cisR", "and", "A2780cisKB", "lines", "were", "derived", "from", "the", "A2780cis", "cell", "line", "." ] } ]
PMC11599565
Despite the inhibition of Notch signaling, there were no significant changes in the morphology of the treated cells; they retained the same “neuronal” morphology observed in untreated cells (Figure SF15B).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Despite", "the", "inhibition", "of", "Notch", "signaling", ",", "there", "were", "no", "significant", "changes", "in", "the", "morphology", "of", "the", "treated", "cells", ";", "they", "retained", "the", "same", "“", "neuronal", "”", "morphology", "observed", "in", "untreated", "cells", "(", "Figure", "SF15B", ")", "." ] } ]
PMC11721587
After heat inactivation of DNase I, 2 μl of RNA was analyzed by one-step RT-qPCR with primers: AGGCCCGGCGCCATTCTATC(F) and AGCAATTGTT-CCAGGAACCA(R).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "After", "heat", "inactivation", "of", "DNase", "I", ",", "2", "μl", "of", "RNA", "was", "analyzed", "by", "one-step", "RT-qPCR", "with", "primers", ":", "AGGCCCGGCGCCATTCTATC(F", ")", "and", "AGCAATTGTT-CCAGGAACCA(R", ")", "." ] } ]
PMC6461034
The pH should be < 3, otherwise use more 20% TFA.Centrifuge for 5 min at 4,000 × g to pellet precipitates and transfer supernatant to a new tube.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "pH", "should", "be", "<", "3", ",", "otherwise", "use", "more", "20", "%", "TFA.Centrifuge", "for", "5", "min", "at", "4,000", "×", "g", "to", "pellet", "precipitates", "and", "transfer", "supernatant", "to", "a", "new", "tube", "." ] } ]
PMC9429973
On the other hand, the profile of accompanying mutations is relatively quiet in this type of leukemia due to strong oncogenic potential of KMT2A rearrangement itself.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "On", "the", "other", "hand", ",", "the", "profile", "of", "accompanying", "mutations", "is", "relatively", "quiet", "in", "this", "type", "of", "leukemia", "due", "to", "strong", "oncogenic", "potential", "of", "KMT2A", "rearrangement", "itself", "." ] } ]
PMC10197932
ROS overproduction in the first minutes could probably activate the Nrf2-mediated response to oxidative stress more efficiently than myeloid cancer cells, upregulating the transcription of numerous ROS-detoxifying enzymes such as glutathione peroxidase 2 (Gpx2) and HO-1 (Heme Oxidase), etc.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "ROS", "overproduction", "in", "the", "first", "minutes", "could", "probably", "activate", "the", "Nrf2-mediated", "response", "to", "oxidative", "stress", "more", "efficiently", "than", "myeloid", "cancer", "cells", ",", "upregulating", "the", "transcription", "of", "numerous", "ROS-detoxifying", "enzymes", "such", "as", "glutathione", "peroxidase", "2", "(", "Gpx2", ")", "and", "HO-1", "(", "Heme", "Oxidase", ")", ",", "etc", "." ] } ]
PMC11699042
In line with this idea, evaluation of DEGs consistency across the different EwS cell lines revealed an overlap of a single gene, mitochondrially encoded tRNA-valine (MT-TV) (Supplementary Fig. 2b and Supplementary Data 4), which is not an EWSR1::FLI1-signature gene.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "In", "line", "with", "this", "idea", ",", "evaluation", "of", "DEGs", "consistency", "across", "the", "different", "EwS", "cell", "lines", "revealed", "an", "overlap", "of", "a", "single", "gene", ",", "mitochondrially", "encoded", "tRNA-valine", "(", "MT-TV", ")", "(", "Supplementary", "Fig.", "2b", "and", "Supplementary", "Data", "4", ")", ",", "which", "is", "not", "an", "EWSR1::FLI1-signature", "gene", "." ] } ]
PMC9960565
Cisplatin (0.094 g, 0.31 mmol; 32 eq. mol) was dispersed in 37 mL of UPW.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Cisplatin", "(", "0.094", "g", ",", "0.31", "mmol", ";", "32", "eq.", "mol", ")", "was", "dispersed", "in", "37", "mL", "of", "UPW", "." ] } ]
PMC9219615
Cells were detached from their vessels and separately seeded into thin-bottomed 96-well plates at a density of 2.5 × 10 cells in 100 μL complete medium and incubated at 37 °C overnight to promote reattachment.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Cells", "were", "detached", "from", "their", "vessels", "and", "separately", "seeded", "into", "thin-bottomed", "96-well", "plates", "at", "a", "density", "of", "2.5", "×", "10", "cells", "in", "100", "μL", "complete", "medium", "and", "incubated", "at", "37", "°", "C", "overnight", "to", "promote", "reattachment", "." ] } ]
PMC11463018
9.
[ { "tags": [ "O", "O" ], "tokens": [ "9", "." ] } ]
PMC10114490
To assess biotransformation activity, a cocktail containing substrates of the major CYP450 enzymes was incubated during 24 h. Production of phase I metabolites was monitored in cell media by liquid chromatography–tandem mass spectrometry (HPLC–MS/MS) as described .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "To", "assess", "biotransformation", "activity", ",", "a", "cocktail", "containing", "substrates", "of", "the", "major", "CYP450", "enzymes", "was", "incubated", "during", "24", "h.", "Production", "of", "phase", "I", "metabolites", "was", "monitored", "in", "cell", "media", "by", "liquid", "chromatography", "–", "tandem", "mass", "spectrometry", "(", "HPLC", "–", "MS/MS", ")", "as", "described", "." ] } ]
PMC4270159
Straussman and colleagues demonstrated that HGF signaling derived from the tumor microenvironment could bypass EGFR inhibition by activation of MET signaling (Straussman et al., 2012, also included for replication in the Reproducibility Project: Cancer Biology), and Harbinski and colleagues, in an approach similar to Wilson and colleagues, showed that multiple growth factor ligands could ‘bypass’ inhibitor-targeted RTKs (Harbinski et al., 2012).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Straussman", "and", "colleagues", "demonstrated", "that", "HGF", "signaling", "derived", "from", "the", "tumor", "microenvironment", "could", "bypass", "EGFR", "inhibition", "by", "activation", "of", "MET", "signaling", "(", "Straussman", "et", "al.", ",", "2012", ",", "also", "included", "for", "replication", "in", "the", "Reproducibility", "Project", ":", "Cancer", "Biology", ")", ",", "and", "Harbinski", "and", "colleagues", ",", "in", "an", "approach", "similar", "to", "Wilson", "and", "colleagues", ",", "showed", "that", "multiple", "growth", "factor", "ligands", "could", "‘", "bypass", "’", "inhibitor-targeted", "RTKs", "(", "Harbinski", "et", "al.", ",", "2012", ")", "." ] } ]
PMC9844987
This approach relies on backpropagation of the contributions of all neurons in the CNN to the input features, nucleotides, and can therefore be used to identify properties or short stretches of DNA indicative of amplifying or attenuating expression variability.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "This", "approach", "relies", "on", "backpropagation", "of", "the", "contributions", "of", "all", "neurons", "in", "the", "CNN", "to", "the", "input", "features", ",", "nucleotides", ",", "and", "can", "therefore", "be", "used", "to", "identify", "properties", "or", "short", "stretches", "of", "DNA", "indicative", "of", "amplifying", "or", "attenuating", "expression", "variability", "." ] } ]
PMC11672142
The onset of these molecular processes is expected to result in cell death, although we cannot discount that increased cellular uptake of DefNEtTrp, in comparison to Trp, NEtTrp, and Def, is in part responsible for the observed cytotoxicity.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "onset", "of", "these", "molecular", "processes", "is", "expected", "to", "result", "in", "cell", "death", ",", "although", "we", "can", "not", "discount", "that", "increased", "cellular", "uptake", "of", "DefNEtTrp", ",", "in", "comparison", "to", "Trp", ",", "NEtTrp", ",", "and", "Def", ",", "is", "in", "part", "responsible", "for", "the", "observed", "cytotoxicity", "." ] } ]
PMC9388315
This diminution in protein levels was seen as dose-dependent significantly compared to lower concentrations (Figure 4(c)), which was for 1.25 mg/ml (P < 0.05), 2.50 mg/ml, and 5 mg/ml (P < 0.001).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "This", "diminution", "in", "protein", "levels", "was", "seen", "as", "dose-dependent", "significantly", "compared", "to", "lower", "concentrations", "(", "Figure", "4(c", ")", ")", ",", "which", "was", "for", "1.25", "mg/ml", "(", "P", "<", "0.05", ")", ",", "2.50", "mg/ml", ",", "and", "5", "mg/ml", "(", "P", "<", "0.001", ")", "." ] } ]
PMC11723210
Two selected regions are illustrated in Figure 3(a1,b1).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Two", "selected", "regions", "are", "illustrated", "in", "Figure", "3(a1,b1", ")", "." ] } ]
PMC10178190
This finding is in contrast to our previous finding that blocking of pERK1/2 phosphorylation correlates with drug resistance upon direct MSC interaction with OC cells .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "This", "finding", "is", "in", "contrast", "to", "our", "previous", "finding", "that", "blocking", "of", "pERK1/2", "phosphorylation", "correlates", "with", "drug", "resistance", "upon", "direct", "MSC", "interaction", "with", "OC", "cells", "." ] } ]
PMC11792090
Construction of UCAR-T cells and validation of GVHD and HVG reactions (A) Schematic representation of the CAR-T cell knockout method. (
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Construction", "of", "UCAR-T", "cells", "and", "validation", "of", "GVHD", "and", "HVG", "reactions", "(", "A", ")", "Schematic", "representation", "of", "the", "CAR-T", "cell", "knockout", "method", ".", "(" ] } ]
PMC11721295
Furthermore, we observed a significant increase in expression of C1QB and C1QC in macrophages in KRAS-driven, but not non–KRAS-driven, lung cancer, recapitulating our findings in the L-iKRAS model (Figure 7, E and F).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Furthermore", ",", "we", "observed", "a", "significant", "increase", "in", "expression", "of", "C1QB", "and", "C1QC", "in", "macrophages", "in", "KRAS-driven", ",", "but", "not", "non", "–", "KRAS-driven", ",", "lung", "cancer", ",", "recapitulating", "our", "findings", "in", "the", "L-iKRAS", "model", "(", "Figure", "7", ",", "E", "and", "F", ")", "." ] } ]
PMC10213199
In the HL 60 cell line, JYL activated proteasome-related functions.
[ { "tags": [ "O", "O", "B-CellLine", "I-CellLine", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "In", "the", "HL", "60", "cell", "line", ",", "JYL", "activated", "proteasome-related", "functions", "." ] } ]
PMC10006224
2Effect of cohesin regulators on the response of cohesin variants to NIPBL KD.a Representative flow cytometry contour plots for chromatin-bound STAG1 and STAG2 in control (gray plots) and KD (colored plots) HeLa cells.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O" ], "tokens": [ "2Effect", "of", "cohesin", "regulators", "on", "the", "response", "of", "cohesin", "variants", "to", "NIPBL", "KD.a", "Representative", "flow", "cytometry", "contour", "plots", "for", "chromatin-bound", "STAG1", "and", "STAG2", "in", "control", "(", "gray", "plots", ")", "and", "KD", "(", "colored", "plots", ")", "HeLa", "cells", "." ] } ]
PMC11594806
This combination exhibited a favorable safety profile, with response rates of 2.4% in colorectal cancer, 4.8% in pancreatic cancer, and 9.5% in non-small-cell lung cancer, and 6-month progression-free survival (PFS) rates of 5.4%, 13.2%, and 16%, respectively .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "This", "combination", "exhibited", "a", "favorable", "safety", "profile", ",", "with", "response", "rates", "of", "2.4", "%", "in", "colorectal", "cancer", ",", "4.8", "%", "in", "pancreatic", "cancer", ",", "and", "9.5", "%", "in", "non-small-cell", "lung", "cancer", ",", "and", "6-month", "progression-free", "survival", "(", "PFS", ")", "rates", "of", "5.4", "%", ",", "13.2", "%", ",", "and", "16", "%", ",", "respectively", "." ] } ]
PMC9503669
The mechanism involved disruption of the Nef-mediated assembly and activation of the multi-kinase complex responsible for the signaling mode of MHC-I downregulation described above.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "mechanism", "involved", "disruption", "of", "the", "Nef-mediated", "assembly", "and", "activation", "of", "the", "multi-kinase", "complex", "responsible", "for", "the", "signaling", "mode", "of", "MHC-I", "downregulation", "described", "above", "." ] } ]
PMC11765243
The following oligonucleotides were used to detect the allele containing the lox-flanked minigene Pik3ca (Lml, lox-minigene-lox): Pik3ca LmLD933A Gentp1 5′-FW: GCTCTTGGGCCTCCACAGGTG Pik3ca LmLD933A Gentp2 5′-RV: ACACGTTCCCGCTTATAGCC For genotyping parental p110α, genomic DNA was extracted from a biopsy of ear tissue, and direct PCR was performed using the REDExtract-N-Amp kit (Sigma-Aldrich; Merck Spain; Ref.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "following", "oligonucleotides", "were", "used", "to", "detect", "the", "allele", "containing", "the", "lox-flanked", "minigene", "Pik3ca", "(", "Lml", ",", "lox-minigene-lox", "):", "Pik3ca", "LmLD933A", "Gentp1", "5′-FW", ":", "GCTCTTGGGCCTCCACAGGTG", "Pik3ca", "LmLD933A", "Gentp2", "5′-RV", ":", "ACACGTTCCCGCTTATAGCC", "For", "genotyping", "parental", "p110α", ",", "genomic", "DNA", "was", "extracted", "from", "a", "biopsy", "of", "ear", "tissue", ",", "and", "direct", "PCR", "was", "performed", "using", "the", "REDExtract-N-Amp", "kit", "(", "Sigma-Aldrich", ";", "Merck", "Spain", ";", "Ref", "." ] } ]
PMC9046263
The extracted DNA was amplified using GoTaq Polymerase (Promega, M3001).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "extracted", "DNA", "was", "amplified", "using", "GoTaq", "Polymerase", "(", "Promega", ",", "M3001", ")", "." ] } ]
PMC11486946
Compound treatment was carried out with the indicated compounds for 1 h (dashed bar), and cells were subsequently stimulated with EGF for 2 min (filled bar).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Compound", "treatment", "was", "carried", "out", "with", "the", "indicated", "compounds", "for", "1", "h", "(", "dashed", "bar", ")", ",", "and", "cells", "were", "subsequently", "stimulated", "with", "EGF", "for", "2", "min", "(", "filled", "bar", ")", "." ] } ]
PMC6617630
a–c WT- MYC, SH, DH, and TH harboring DLBCL cell lines were treated with 3 pharmacological BET bromodomain inhibitors I-BET (a), JQ1 (b), and OTX (c) for 72 h and proliferation was assessed by H-thymidine incorporation assay.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "a", "–", "c", "WT-", "MYC", ",", "SH", ",", "DH", ",", "and", "TH", "harboring", "DLBCL", "cell", "lines", "were", "treated", "with", "3", "pharmacological", "BET", "bromodomain", "inhibitors", "I-BET", "(", "a", ")", ",", "JQ1", "(", "b", ")", ",", "and", "OTX", "(", "c", ")", "for", "72", "h", "and", "proliferation", "was", "assessed", "by", "H-thymidine", "incorporation", "assay", "." ] } ]
PMC11496491
The Read Count value of each gene is the data obtained by statistical analysis and comparison using HTSeq software (Version: HISAT2 2.2.1, daehwankimlab.github.io, https://htseq.readthedocs.io/en/latest/), and the original expression of all genes in the experiment is also measured by Read Count.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "Read", "Count", "value", "of", "each", "gene", "is", "the", "data", "obtained", "by", "statistical", "analysis", "and", "comparison", "using", "HTSeq", "software", "(", "Version", ":", "HISAT2", "2.2.1", ",", "daehwankimlab.github.io", ",", "https://htseq.readthedocs.io/en/latest/", ")", ",", "and", "the", "original", "expression", "of", "all", "genes", "in", "the", "experiment", "is", "also", "measured", "by", "Read", "Count", "." ] } ]
PMC9926039
Therefore, present series of in-silico and in vitro studies wasfirstly designed to investigate whether methadone influences the TLR4 expression in human non-small cell lung carcinoma (NSCLC) A549 cell line.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O" ], "tokens": [ "Therefore", ",", "present", "series", "of", "in-silico", "and", "in", "vitro", "studies", "wasfirstly", "designed", "to", "investigate", "whether", "methadone", "influences", "the", "TLR4", "expression", "in", "human", "non-small", "cell", "lung", "carcinoma", "(", "NSCLC", ")", "A549", "cell", "line", "." ] } ]
PMC11754436
p<0.05, **p<0.01, ***p<0.001, ###p<0.001, the scale is 100 μm.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "p<0.05", ",", "*", "*", "p<0.01", ",", "*", "*", "*", "p<0.001", ",", "#", "#", "#", "p<0.001", ",", "the", "scale", "is", "100", "μm", "." ] } ]
PMC9776316
To further confirm that cJUN is the TF that drives the XRCC4 transcription upon cisplatin exposure, we generated the XRCC4 promoter-luciferase constructs with each individual predicted binding site mutated.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "To", "further", "confirm", "that", "cJUN", "is", "the", "TF", "that", "drives", "the", "XRCC4", "transcription", "upon", "cisplatin", "exposure", ",", "we", "generated", "the", "XRCC4", "promoter-luciferase", "constructs", "with", "each", "individual", "predicted", "binding", "site", "mutated", "." ] } ]
PMC9221284
PCR amplification was performed as follows: denaturation 2 min at 94 °C, 35 cycles (94 °C 15 s, 61 °C 15 s, 72 °C 1 min), 72 °C 2 min.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "PCR", "amplification", "was", "performed", "as", "follows", ":", "denaturation", "2", "min", "at", "94", "°", "C", ",", "35", "cycles", "(", "94", "°", "C", "15", "s", ",", "61", "°", "C", "15", "s", ",", "72", "°", "C", "1", "min", ")", ",", "72", "°", "C", "2", "min", "." ] } ]
PMC11495567
This observation indicates the disruption and/or inhibition of the formation of focal adhesions by PCAIs.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "This", "observation", "indicates", "the", "disruption", "and/or", "inhibition", "of", "the", "formation", "of", "focal", "adhesions", "by", "PCAIs", "." ] } ]
PMC11648299
Review of the patients’ medical records illustrated that all patients were using moisturizers and a prescribed combination of topical corticosteroids/antibiotic creams.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Review", "of", "the", "patients", "’", "medical", "records", "illustrated", "that", "all", "patients", "were", "using", "moisturizers", "and", "a", "prescribed", "combination", "of", "topical", "corticosteroids/antibiotic", "creams", "." ] } ]
PMC11733919
The data are presented as mean ± standard deviation.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "data", "are", "presented", "as", "mean", "±", "standard", "deviation", "." ] } ]
PMC11474209
They excessively proliferate in a water body, resulting in toxicity caused by either the toxins themselves or the accumulation of biomass, which disrupts the coexistence of organisms in the environment .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "They", "excessively", "proliferate", "in", "a", "water", "body", ",", "resulting", "in", "toxicity", "caused", "by", "either", "the", "toxins", "themselves", "or", "the", "accumulation", "of", "biomass", ",", "which", "disrupts", "the", "coexistence", "of", "organisms", "in", "the", "environment", "." ] } ]
PMC10470467
VIMP is a key index for random survival forest to evaluate the importance of variables, which is defined as the difference between the prediction error rate of the new model and the old model after replacing a variable with an arbitrary value, so the higher the VIMP value, the stronger the importance of the variable (11).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "VIMP", "is", "a", "key", "index", "for", "random", "survival", "forest", "to", "evaluate", "the", "importance", "of", "variables", ",", "which", "is", "defined", "as", "the", "difference", "between", "the", "prediction", "error", "rate", "of", "the", "new", "model", "and", "the", "old", "model", "after", "replacing", "a", "variable", "with", "an", "arbitrary", "value", ",", "so", "the", "higher", "the", "VIMP", "value", ",", "the", "stronger", "the", "importance", "of", "the", "variable", "(", "11", ")", "." ] } ]
PMC11770130
StringTie was applied to the bam file for expression quantification and the RNA-seq count data were obtained.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "StringTie", "was", "applied", "to", "the", "bam", "file", "for", "expression", "quantification", "and", "the", "RNA-seq", "count", "data", "were", "obtained", "." ] } ]
PMC7841189
Knockdown of LTBP2 inhibits the activation of the PI3K/Akt pathway in thyroid carcinoma cells.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Knockdown", "of", "LTBP2", "inhibits", "the", "activation", "of", "the", "PI3K/Akt", "pathway", "in", "thyroid", "carcinoma", "cells", "." ] } ]
PMC11658074
We innovatively separated AT-EVs via magnetic beads into CD151-positive and CD151-negative groups, with the former being more rapidly internalized.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "We", "innovatively", "separated", "AT-EVs", "via", "magnetic", "beads", "into", "CD151-positive", "and", "CD151-negative", "groups", ",", "with", "the", "former", "being", "more", "rapidly", "internalized", "." ] } ]
PMC7757104
Transfections were performed with 24 µg oligomers and 24 µl Lipofectamine 2000 diluted in RPMI-1640 medium and Opti-MEM in 10-cm plates in a 5% CO2 incubator at 37°C for 24 h. The transfected cells were collected at 24 h post-transfection for subsequent experiments.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Transfections", "were", "performed", "with", "24", "µg", "oligomers", "and", "24", "µl", "Lipofectamine", "2000", "diluted", "in", "RPMI-1640", "medium", "and", "Opti-MEM", "in", "10-cm", "plates", "in", "a", "5", "%", "CO2", "incubator", "at", "37", "°", "C", "for", "24", "h.", "The", "transfected", "cells", "were", "collected", "at", "24", "h", "post-transfection", "for", "subsequent", "experiments", "." ] } ]
PMC9672323
Moreover, inhibition of the COX‐2 enzyme resulted in a depleted amount of TGF‐β in the tumor microenvironment, suggesting a role for this enzyme in regulatory T cell induction, TGF‐β production, and subsequently cancer progression.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Moreover", ",", "inhibition", "of", "the", "COX‐2", "enzyme", "resulted", "in", "a", "depleted", "amount", "of", "TGF‐β", "in", "the", "tumor", "microenvironment", ",", "suggesting", "a", "role", "for", "this", "enzyme", "in", "regulatory", "T", "cell", "induction", ",", "TGF‐β", "production", ",", "and", "subsequently", "cancer", "progression", "." ] } ]
PMC11489275
These results indicated that patients with lower lymphocyte numbers had a higher risk of death within 1 month.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "These", "results", "indicated", "that", "patients", "with", "lower", "lymphocyte", "numbers", "had", "a", "higher", "risk", "of", "death", "within", "1", "month", "." ] } ]
PMC11471157
Consequently, its performance may not meet the standards required for industrial applications, making this a critical issue to address in the future.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Consequently", ",", "its", "performance", "may", "not", "meet", "the", "standards", "required", "for", "industrial", "applications", ",", "making", "this", "a", "critical", "issue", "to", "address", "in", "the", "future", "." ] } ]
PMC2614416
The present study was designed to employ multidimensional protein identification technology (MudPIT) proteomics, Gene Ontology mapping and directed acyclic graph representations to detect, compare and contrast qualitative and quantitative oxidoreductase enzyme expression profiles of the HepG2 proteome vs. that of a normal human liver.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "present", "study", "was", "designed", "to", "employ", "multidimensional", "protein", "identification", "technology", "(", "MudPIT", ")", "proteomics", ",", "Gene", "Ontology", "mapping", "and", "directed", "acyclic", "graph", "representations", "to", "detect", ",", "compare", "and", "contrast", "qualitative", "and", "quantitative", "oxidoreductase", "enzyme", "expression", "profiles", "of", "the", "HepG2", "proteome", "vs.", "that", "of", "a", "normal", "human", "liver", "." ] } ]
PMC11119602
The predicted structure of the TG2-LC3 complex revealed that the two proteins were interacting via an interface region located on the surface of each protein.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "predicted", "structure", "of", "the", "TG2-LC3", "complex", "revealed", "that", "the", "two", "proteins", "were", "interacting", "via", "an", "interface", "region", "located", "on", "the", "surface", "of", "each", "protein", "." ] } ]
PMC11564322
The 48-h exposure to VGVAPG did not change the PPARγ protein expression significantly in the MEG-A2 cell line (Fig. 8E).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "48-h", "exposure", "to", "VGVAPG", "did", "not", "change", "the", "PPARγ", "protein", "expression", "significantly", "in", "the", "MEG-A2", "cell", "line", "(", "Fig.", "8E", ")", "." ] } ]
PMC7917457
In addition, we observed slightly higher numbers of Trp2-specific CD8 T cells in pooled tumor-draining lymph node samples from PeptiCRAd VALO-mD901-Trp2-treated mice compared to mock- or VALO-mD901-treated tumors (Figure 5B).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "In", "addition", ",", "we", "observed", "slightly", "higher", "numbers", "of", "Trp2-specific", "CD8", "T", "cells", "in", "pooled", "tumor-draining", "lymph", "node", "samples", "from", "PeptiCRAd", "VALO-mD901-Trp2-treated", "mice", "compared", "to", "mock-", "or", "VALO-mD901-treated", "tumors", "(", "Figure", "5B", ")", "." ] } ]
PMC11773391
A375 cells were treated with TMZ and 0.04 μM vMF for 24 h after transfection with the pcDNA3.1‐MGMT plasmid or the pcDNA3.1 empty vector for 24 h. The cell inhibition rate was determined with the MTT assay.
[ { "tags": [ "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "A375", "cells", "were", "treated", "with", "TMZ", "and", "0.04", "μM", "vMF", "for", "24", "h", "after", "transfection", "with", "the", "pcDNA3.1‐MGMT", "plasmid", "or", "the", "pcDNA3.1", "empty", "vector", "for", "24", "h.", "The", "cell", "inhibition", "rate", "was", "determined", "with", "the", "MTT", "assay", "." ] } ]
PMC11011837
Our results, based on semiquantitative lipid assessment, support the hypothesis that phospholipid transformation and synthesis pathways diverge among the four cell lines under study.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Our", "results", ",", "based", "on", "semiquantitative", "lipid", "assessment", ",", "support", "the", "hypothesis", "that", "phospholipid", "transformation", "and", "synthesis", "pathways", "diverge", "among", "the", "four", "cell", "lines", "under", "study", "." ] } ]
PMC9429973
Daratumumab (DARA) is an anti-CD38 monoclonal antibody which enhances response rates and efficacy when added to standard of care regimens, both in newly diagnosed and relapsed and refractory (RR)MM.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Daratumumab", "(", "DARA", ")", "is", "an", "anti-CD38", "monoclonal", "antibody", "which", "enhances", "response", "rates", "and", "efficacy", "when", "added", "to", "standard", "of", "care", "regimens", ",", "both", "in", "newly", "diagnosed", "and", "relapsed", "and", "refractory", "(RR)MM", "." ] } ]
PMC11720107
Garlic prevented oxidative stress and mitigated decreases in CAT and SOD activity in the rat heart induced by the cytostatic agent doxorubicin.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Garlic", "prevented", "oxidative", "stress", "and", "mitigated", "decreases", "in", "CAT", "and", "SOD", "activity", "in", "the", "rat", "heart", "induced", "by", "the", "cytostatic", "agent", "doxorubicin", "." ] } ]
PMC7868205
Transmission (TEM) and scanning (SEM) electron microscopes were used to determine the morphology of AgNPs.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Transmission", "(", "TEM", ")", "and", "scanning", "(", "SEM", ")", "electron", "microscopes", "were", "used", "to", "determine", "the", "morphology", "of", "AgNPs", "." ] } ]
PMC11400680
Furthermore, instance segmentation can also generate bounding boxes and corresponding masks of the objects, meaning both detection and segmentation tasks can be performed simultaneously (19).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Furthermore", ",", "instance", "segmentation", "can", "also", "generate", "bounding", "boxes", "and", "corresponding", "masks", "of", "the", "objects", ",", "meaning", "both", "detection", "and", "segmentation", "tasks", "can", "be", "performed", "simultaneously", "(", "19", ")", "." ] } ]
PMC8992508
Aryl-substituted derivatives of tariquidar Compounds containing an amide or alkylamine group generally displayed higher activity values than the corresponding ester derivatives in the calcein-AM test on P-gp overexpressing cells (MDCK-MDR1 cells).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O" ], "tokens": [ "Aryl-substituted", "derivatives", "of", "tariquidar", "Compounds", "containing", "an", "amide", "or", "alkylamine", "group", "generally", "displayed", "higher", "activity", "values", "than", "the", "corresponding", "ester", "derivatives", "in", "the", "calcein-AM", "test", "on", "P-gp", "overexpressing", "cells", "(", "MDCK-MDR1", "cells", ")", "." ] } ]
PMC11591038
The direct involvements of HIF-1 in APP processing were later confirmed.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "direct", "involvements", "of", "HIF-1", "in", "APP", "processing", "were", "later", "confirmed", "." ] } ]
PMC10988808
I Quantitative analysis of CCDC25.
[ { "tags": [ "O", "O", "O", "O", "O", "O" ], "tokens": [ "I", "Quantitative", "analysis", "of", "CCDC25", "." ] } ]
PMC11244823
The specific band of the immunoblot was then correlated with its molecular weight range in Coomassie blue stained gel for direct band excision.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "specific", "band", "of", "the", "immunoblot", "was", "then", "correlated", "with", "its", "molecular", "weight", "range", "in", "Coomassie", "blue", "stained", "gel", "for", "direct", "band", "excision", "." ] } ]
PMC11422497
shRNA: short hairpin RNA.
[ { "tags": [ "O", "O", "O", "O", "O", "O" ], "tokens": [ "shRNA", ":", "short", "hairpin", "RNA", "." ] } ]
PMC11672617
The results of the flow cytometry analysis and the corresponding histogram are presented in Figure 6 and Figure S3 of the Supplementary Information File.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "results", "of", "the", "flow", "cytometry", "analysis", "and", "the", "corresponding", "histogram", "are", "presented", "in", "Figure", "6", "and", "Figure", "S3", "of", "the", "Supplementary", "Information", "File", "." ] } ]
PMC11144200
The thin-film hydration approach was utilized to prepare maleimide-modified unloaded liposomes .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "thin-film", "hydration", "approach", "was", "utilized", "to", "prepare", "maleimide-modified", "unloaded", "liposomes", "." ] } ]
PMC10329074
The Shapiro–Wilk normality test results showed that the samples did not meet the normality test threshold (P < 0.05), and so the Wilcoxon rank sum test was further employed (Table S2).Table 1Correlation between YBX3 expression and clinicopathological features of ccRCCCharacteristiclevelsLow expression of YBX3High expression of YBX3pn265265T stage, n (%)T1157 (29.6%)114 (21.5%) < 0.001T238 (7.2%)31 (5.8%)T367 (12.6%)112 (21.1%)T43 (0.6%)8 (1.5%)N stage, n (%)N0128 (50.2%)111 (43.5%)0.616N17 (2.7%)9 (3.5%)M stage, n (%)M0219 (44%)201 (40.4%)0.093M132 (6.4%)46 (9.2%)Pathologic stage, n (%)Stage I152 (28.8%)113 (21.4%) < 0.001Stage II34 (6.5%)23 (4.4%)Stage III46 (8.7%)77 (14.6%)Stage IV31 (5.9%)51 (9.7%)Primary therapy outcome, n (%)PD2 (1.4%)9 (6.5%)0.027SD2 (1.4%)3 (2.2%)PR2 (1.4%)0 (0%)CR68 (49.3%)52 (37.7%)Gender, n (%)Female112 (21.1%)74 (14%) < 0.001Male153 (28.9%)191 (36%)Race, n (%)Asian7 (1.3%)1 (0.2%)0.069Black or African American31 (5.9%)25 (4.8%)White225 (43%)234 (44.7%)Age, n (%) < = 60134 (25.3%)130 (24.5%)0.794 > 60131 (24.7%)135 (25.5%)Histologic grade, n (%)G110 (1.9%)4 (0.8%)0.200G2117 (22.4%)110 (21.1%)G399 (19%)107 (20.5%)G432 (6.1%)43 (8.2%)Serum calcium, n (%)Elevated3 (0.8%)7 (1.9%)0.400Low100 (27.5%)103 (28.4%)Normal67 (18.5%)83 (22.9%)Hemoglobin, n (%)Elevated1 (0.2%)4 (0.9%)0.031Low120 (26.7%)141 (31.3%)Normal104 (23.1%)80 (17.8%)Laterality, n (%)Left119 (22.5%)130 (24.6%)0.407Right145 (27.4%)135 (25.5%)OS event, n (%)Alive198 (37.4%)159 (30%) < 0.001Dead67 (12.6%)106 (20%)PFI event, n (%)Alive207 (39.1%)163 (30.8%) < 0.001Dead58 (10.9%)102 (19.2%)DSS event, n (%)Alive223 (43%)188 (36.2%) < 0.001Dead38 (7.3%)70 (13.5%)Age, mean ± SD60.14 ± 12.0960.99 ± 12.20.417(Progressive disease); SD (stable disease); PR (partial response); CR (Compete response); G1 (Grade 1); G2 (Grade 2); G3 (Grade 3); G4 (Grade 4); OS (Overall survival); PFI (Progression Interval); DSS (Disease Free Survival) Correlation between YBX3 expression and clinicopathological features of ccRCC (Progressive disease); SD (stable disease); PR (partial response); CR (Compete response); G1 (Grade 1); G2 (Grade 2); G3 (Grade 3); G4 (Grade 4); OS (Overall survival); PFI (Progression Interval); DSS (Disease Free Survival) In the cohort exhibiting low YBX3 expression data, comprising of 153 males and 112 females, the mean age was 60.14 years (range: 48–73 years).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "Shapiro", "–", "Wilk", "normality", "test", "results", "showed", "that", "the", "samples", "did", "not", "meet", "the", "normality", "test", "threshold", "(", "P", "<", "0.05", ")", ",", "and", "so", "the", "Wilcoxon", "rank", "sum", "test", "was", "further", "employed", "(", "Table", "S2).Table", "1Correlation", "between", "YBX3", "expression", "and", "clinicopathological", "features", "of", "ccRCCCharacteristiclevelsLow", "expression", "of", "YBX3High", "expression", "of", "YBX3pn265265", "T", "stage", ",", "n", "(%)T1157", "(29.6%)114", "(", "21.5", "%", ")", "<", "0.001T238", "(7.2%)31", "(5.8%)T367", "(12.6%)112", "(21.1%)T43", "(0.6%)8", "(1.5%)N", "stage", ",", "n", "(%)N0128", "(50.2%)111", "(43.5%)0.616N17", "(2.7%)9", "(3.5%)M", "stage", ",", "n", "(%)M0219", "(44%)201", "(40.4%)0.093M132", "(6.4%)46", "(9.2%)Pathologic", "stage", ",", "n", "(%)Stage", "I152", "(28.8%)113", "(", "21.4", "%", ")", "<", "0.001Stage", "II34", "(6.5%)23", "(4.4%)Stage", "III46", "(8.7%)77", "(14.6%)Stage", "IV31", "(5.9%)51", "(9.7%)Primary", "therapy", "outcome", ",", "n", "(%)PD2", "(1.4%)9", "(6.5%)0.027SD2", "(1.4%)3", "(2.2%)PR2", "(1.4%)0", "(0%)CR68", "(49.3%)52", "(37.7%)Gender", ",", "n", "(%)Female112", "(21.1%)74", "(", "14", "%", ")", "<", "0.001Male153", "(28.9%)191", "(36%)Race", ",", "n", "(%)Asian7", "(1.3%)1", "(0.2%)0.069Black", "or", "African", "American31", "(5.9%)25", "(4.8%)White225", "(43%)234", "(44.7%)Age", ",", "n", "(", "%", ")", "<", "=", "60134", "(25.3%)130", "(24.5%)0.794", ">", "60131", "(24.7%)135", "(25.5%)Histologic", "grade", ",", "n", "(%)G110", "(1.9%)4", "(0.8%)0.200G2117", "(22.4%)110", "(21.1%)G399", "(19%)107", "(20.5%)G432", "(6.1%)43", "(8.2%)Serum", "calcium", ",", "n", "(%)Elevated3", "(0.8%)7", "(1.9%)0.400Low100", "(27.5%)103", "(28.4%)Normal67", "(18.5%)83", "(22.9%)Hemoglobin", ",", "n", "(%)Elevated1", "(0.2%)4", "(0.9%)0.031Low120", "(26.7%)141", "(31.3%)Normal104", "(23.1%)80", "(17.8%)Laterality", ",", "n", "(%)Left119", "(22.5%)130", "(24.6%)0.407Right145", "(27.4%)135", "(25.5%)OS", "event", ",", "n", "(%)Alive198", "(37.4%)159", "(", "30", "%", ")", "<", "0.001Dead67", "(12.6%)106", "(20%)PFI", "event", ",", "n", "(%)Alive207", "(39.1%)163", "(", "30.8", "%", ")", "<", "0.001Dead58", "(10.9%)102", "(19.2%)DSS", "event", ",", "n", "(%)Alive223", "(43%)188", "(", "36.2", "%", ")", "<", "0.001Dead38", "(7.3%)70", "(13.5%)Age", ",", "mean", "±", "SD60.14", "±", "12.0960.99", "±", "12.20.417(Progressive", "disease", ")", ";", "SD", "(", "stable", "disease", ")", ";", "PR", "(", "partial", "response", ")", ";", "CR", "(", "Compete", "response", ")", ";", "G1", "(", "Grade", "1", ")", ";", "G2", "(", "Grade", "2", ")", ";", "G3", "(", "Grade", "3", ")", ";", "G4", "(", "Grade", "4", ")", ";", "OS", "(", "Overall", "survival", ")", ";", "PFI", "(", "Progression", "Interval", ")", ";", "DSS", "(", "Disease", "Free", "Survival", ")", "Correlation", "between", "YBX3", "expression", "and", "clinicopathological", "features", "of", "ccRCC", "(", "Progressive", "disease", ")", ";", "SD", "(", "stable", "disease", ")", ";", "PR", "(", "partial", "response", ")", ";", "CR", "(", "Compete", "response", ")", ";", "G1", "(", "Grade", "1", ")", ";", "G2", "(", "Grade", "2", ")", ";", "G3", "(", "Grade", "3", ")", ";", "G4", "(", "Grade", "4", ")", ";", "OS", "(", "Overall", "survival", ")", ";", "PFI", "(", "Progression", "Interval", ")", ";", "DSS", "(", "Disease", "Free", "Survival", ")", "In", "the", "cohort", "exhibiting", "low", "YBX3", "expression", "data", ",", "comprising", "of", "153", "males", "and", "112", "females", ",", "the", "mean", "age", "was", "60.14", "years", "(", "range", ":", "48–73", "years", ")", "." ] } ]
PMC11269792
On the one hand, due to the insufficient sample size, the correlation of circAPP with pathological T-staging and poor prognosis of GIST patients has not been established.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "On", "the", "one", "hand", ",", "due", "to", "the", "insufficient", "sample", "size", ",", "the", "correlation", "of", "circAPP", "with", "pathological", "T-staging", "and", "poor", "prognosis", "of", "GIST", "patients", "has", "not", "been", "established", "." ] } ]
PMC11473750
To identify the mutations which may be responsible for delaying tumour formation, the 1929 progeny mice were then mated to BALB/c (BALB/cJAusb) or C57BL/6 (C57BL/6JAusb) mice from Australian BioResources (ABR), Moss Vale and then backcrossed to homozygote TH-MYCN mice which had not received ENU.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "B-CellLine", "O", "O", "B-CellLine", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "To", "identify", "the", "mutations", "which", "may", "be", "responsible", "for", "delaying", "tumour", "formation", ",", "the", "1929", "progeny", "mice", "were", "then", "mated", "to", "BALB/c", "(", "BALB/cJAusb", ")", "or", "C57BL/6", "(", "C57BL/6JAusb", ")", "mice", "from", "Australian", "BioResources", "(", "ABR", ")", ",", "Moss", "Vale", "and", "then", "backcrossed", "to", "homozygote", "TH-MYCN", "mice", "which", "had", "not", "received", "ENU", "." ] } ]
PMC11678368
However, its clinical use is limited by severe side effects, drug resistance, and ineffectiveness against certain types of cancer.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "However", ",", "its", "clinical", "use", "is", "limited", "by", "severe", "side", "effects", ",", "drug", "resistance", ",", "and", "ineffectiveness", "against", "certain", "types", "of", "cancer", "." ] } ]
PMC11694625
The IR absorption bands of the typical functional groups in 3a–3d are very similar.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "IR", "absorption", "bands", "of", "the", "typical", "functional", "groups", "in", "3a–3d", "are", "very", "similar", "." ] } ]
PMC9429973
Results: Between January 2020 and January 2021 at Peking University People’s Hospital, 53 patients switching from rh-TPO to eltrombopag and 43 patients switching from eltrombopag to rh-TPO were enrolled in our study after screen.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Results", ":", "Between", "January", "2020", "and", "January", "2021", "at", "Peking", "University", "People", "’s", "Hospital", ",", "53", "patients", "switching", "from", "rh-TPO", "to", "eltrombopag", "and", "43", "patients", "switching", "from", "eltrombopag", "to", "rh-TPO", "were", "enrolled", "in", "our", "study", "after", "screen", "." ] } ]
PMC3122064
We have recently reported the important protective role of elevated p21 levels in cisplatin-resistant TC cells as compared with p21 levels in cisplatin-sensitive TC cells.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O" ], "tokens": [ "We", "have", "recently", "reported", "the", "important", "protective", "role", "of", "elevated", "p21", "levels", "in", "cisplatin-resistant", "TC", "cells", "as", "compared", "with", "p21", "levels", "in", "cisplatin-sensitive", "TC", "cells", "." ] } ]
PMC11306331
Fifty two hours after transfection, the supernatant was collected and passed through a 0.45 μm filter.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Fifty", "two", "hours", "after", "transfection", ",", "the", "supernatant", "was", "collected", "and", "passed", "through", "a", "0.45", "μm", "filter", "." ] } ]
PMC9874064
Semi-quantitative analysis of apoptosis rates.
[ { "tags": [ "O", "O", "O", "O", "O", "O" ], "tokens": [ "Semi-quantitative", "analysis", "of", "apoptosis", "rates", "." ] } ]
PMC10993311
T1 = ≤ 15 gestational weeks.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "T1", "=", "≤", "15", "gestational", "weeks", "." ] } ]
PMC11738017
The experimental design we adopted allowed us to simultaneously evaluate the impact of incremental doses of sBCMA and membrane BCMA density at variable E:T ratios within time- and dose-dependent TCE exposures.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "experimental", "design", "we", "adopted", "allowed", "us", "to", "simultaneously", "evaluate", "the", "impact", "of", "incremental", "doses", "of", "sBCMA", "and", "membrane", "BCMA", "density", "at", "variable", "E", ":", "T", "ratios", "within", "time-", "and", "dose-dependent", "TCE", "exposures", "." ] } ]
PMC11806613
Quantification of protein expressions are shown on top.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Quantification", "of", "protein", "expressions", "are", "shown", "on", "top", "." ] } ]
PMC10547921
Structure−activity studies with maytansinoids had identified the C3 N-acyl-N-methyl-l-alanyl ester side chain, the C4–C5 epoxide moiety, the C9 carbinol function, and the position of the conjugated C11 and C13 double bonds as critical elements for activity.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Structure−activity", "studies", "with", "maytansinoids", "had", "identified", "the", "C3", "N-acyl-N-methyl-l-alanyl", "ester", "side", "chain", ",", "the", "C4–C5", "epoxide", "moiety", ",", "the", "C9", "carbinol", "function", ",", "and", "the", "position", "of", "the", "conjugated", "C11", "and", "C13", "double", "bonds", "as", "critical", "elements", "for", "activity", "." ] } ]
PMC10198699
Why would an enrichment action succeed in this scenario, but not in the previous scenario?
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Why", "would", "an", "enrichment", "action", "succeed", "in", "this", "scenario", ",", "but", "not", "in", "the", "previous", "scenario", "?" ] } ]
PMC10203589
By IHC, FGF18 protein expression was increased in 20 CRC samples including mucosal, adenocarcinoma, primary, and metastatic cancers compared with normal non-cancerous mucosa.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "By", "IHC", ",", "FGF18", "protein", "expression", "was", "increased", "in", "20", "CRC", "samples", "including", "mucosal", ",", "adenocarcinoma", ",", "primary", ",", "and", "metastatic", "cancers", "compared", "with", "normal", "non-cancerous", "mucosa", "." ] } ]
PMC10079526
In addition, SUMOylation of the methylases DNMT3A and -B and several DNA damage response proteins, including ERCC6, XRCC5, FANCD2 as well as the SMC5/6 complex were also induced by 5-Aza-2’ treatment.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "In", "addition", ",", "SUMOylation", "of", "the", "methylases", "DNMT3A", "and", "-B", "and", "several", "DNA", "damage", "response", "proteins", ",", "including", "ERCC6", ",", "XRCC5", ",", "FANCD2", "as", "well", "as", "the", "SMC5/6", "complex", "were", "also", "induced", "by", "5-Aza-2", "’", "treatment", "." ] } ]
PMC9429973
Febrile neutropenia was 22%.
[ { "tags": [ "O", "O", "O", "O", "O", "O" ], "tokens": [ "Febrile", "neutropenia", "was", "22", "%", "." ] } ]
PMC11607638
Matrix‐Gel (C‐0372) was from Beyotime (Shanghai, China).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Matrix‐Gel", "(", "C‐0372", ")", "was", "from", "Beyotime", "(", "Shanghai", ",", "China", ")", "." ] } ]
PMC8348645
Camellia sinensis is an evergreen, slow-growing, dwarf shrub.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Camellia", "sinensis", "is", "an", "evergreen", ",", "slow-growing", ",", "dwarf", "shrub", "." ] } ]
PMC8875242
Our hPCIS data also suggest that velpatasvir may inhibit intestinal ABCB1.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Our", "hPCIS", "data", "also", "suggest", "that", "velpatasvir", "may", "inhibit", "intestinal", "ABCB1", "." ] } ]
PMC10669128
Among the available liposarcoma cell lines, LPS141 cells are valid candidates to test new anti-cancer drugs, while T449 and T778 are more suitable to study tumor progression and recurrence, as demonstrated by Stratford‘s team.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Among", "the", "available", "liposarcoma", "cell", "lines", ",", "LPS141", "cells", "are", "valid", "candidates", "to", "test", "new", "anti-cancer", "drugs", ",", "while", "T449", "and", "T778", "are", "more", "suitable", "to", "study", "tumor", "progression", "and", "recurrence", ",", "as", "demonstrated", "by", "Stratford‘s", "team", "." ] } ]
PMC11095939
D–F) The effect of Nedd4 KD on quiescent exit in 3T3 cells determined by WB (D), immunofluorescence (IF) staining of Ki67 and Nedd4 (E), and Ki67/PI staining followed by flow cytometry (F) at the indicated time points.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "D", "–", "F", ")", "The", "effect", "of", "Nedd4", "KD", "on", "quiescent", "exit", "in", "3T3", "cells", "determined", "by", "WB", "(", "D", ")", ",", "immunofluorescence", "(", "IF", ")", "staining", "of", "Ki67", "and", "Nedd4", "(", "E", ")", ",", "and", "Ki67/PI", "staining", "followed", "by", "flow", "cytometry", "(", "F", ")", "at", "the", "indicated", "time", "points", "." ] } ]
PMC11301242
Right: co-amplification in chromosome 8 of AML patients.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Right", ":", "co-amplification", "in", "chromosome", "8", "of", "AML", "patients", "." ] } ]
PMC11300085
The silencing of CMKLR1 significantly (P < 0.0001) reverses the chemerin-enhanced invasion, EMT, and RhoA/ROCK1 activation of SK-OV-3 cells.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O" ], "tokens": [ "The", "silencing", "of", "CMKLR1", "significantly", "(", "P", "<", "0.0001", ")", "reverses", "the", "chemerin-enhanced", "invasion", ",", "EMT", ",", "and", "RhoA/ROCK1", "activation", "of", "SK-OV-3", "cells", "." ] } ]
PMC11747885
The 18S rRNA signal intensity remained relatively unchanged, whereas the 28S rRNA showed a greater susceptibility to ROS-induced damage.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "18S", "rRNA", "signal", "intensity", "remained", "relatively", "unchanged", ",", "whereas", "the", "28S", "rRNA", "showed", "a", "greater", "susceptibility", "to", "ROS-induced", "damage", "." ] } ]
PMC11760643
Ca responses were normalised to the baseline recordings using the formula ∆Ca = ∆F/Frest = (F − Frest)/Frest, where F is the F340 nm/380 nm ratio in a well at a particular time point and Frest is the mean fluorescence of a well from 0 to 30 s (prior to ATP or ECS addition).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Ca", "responses", "were", "normalised", "to", "the", "baseline", "recordings", "using", "the", "formula", "∆Ca", "=", "∆F/Frest", "=", "(", "F", "−", "Frest)/Frest", ",", "where", "F", "is", "the", "F340", "nm/380", "nm", "ratio", "in", "a", "well", "at", "a", "particular", "time", "point", "and", "Frest", "is", "the", "mean", "fluorescence", "of", "a", "well", "from", "0", "to", "30", "s", "(", "prior", "to", "ATP", "or", "ECS", "addition", ")", "." ] } ]
PMC11643361
In contrast, complex 34 exhibited a significantly higher cytotoxic effect, outperforming both previous ligands and other complexes.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "In", "contrast", ",", "complex", "34", "exhibited", "a", "significantly", "higher", "cytotoxic", "effect", ",", "outperforming", "both", "previous", "ligands", "and", "other", "complexes", "." ] } ]
PMC11681005
Single‐cell ATAC coverage of the hypoC3 cluster, which binds to FOXA1 in both basal and luminal cells but loses H3K27ac modification and AR binding in basal cells (red box in B). (
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Single‐cell", "ATAC", "coverage", "of", "the", "hypoC3", "cluster", ",", "which", "binds", "to", "FOXA1", "in", "both", "basal", "and", "luminal", "cells", "but", "loses", "H3K27ac", "modification", "and", "AR", "binding", "in", "basal", "cells", "(", "red", "box", "in", "B", ")", ".", "(" ] } ]