PMCID string | Sentences string | ner list |
|---|---|---|
PMC11240052 | Circular RNA 0051240 promotes cell proliferation, migration, and invasion in ovarian cancer through the miR-637/KLK4 axis (20). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Circular",
"RNA",
... |
PMC11323699 | In the first one, mice were treated one day after tumor inoculation with olaparib for 2 weeks followed by 4 weeks of TAX2. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
... |
PMC6901583 | a The indicated cytokines expression in GIST882 cells stably expressing shcon or shBRD4 were analyzed by RT-PCR. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"a",
"The",
"indicated",
"cytokines",
"ex... |
PMC11786767 | Images at different mitotic stages were acquired using an LSM980 confocal microscope with Airyscan2. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Images",
"at",
"different",
"mitotic",
"stages",
"were",
"acquired",
... |
PMC8735881 | As shown in Figure 3(D-F), the TZM-bl cells expressing GPI-scFvs also displayed different resistance to the transmission of the three tested viruses from CEMss-CCR5 cells, and in comparison, GPI-10E8 was still a more effective inhibitor than other constructs in terms of the breadth and potency. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLin... |
PMC11758416 | Figure 2Confirmation of CD32 expression and example gating strategy for L cell death measurement(A) L cells expressing CD32 and control L cells were stained with an anti-CD32 antibody and assessed by flow cytometry.(B) Gating strategy for Annexin V and 7-AAD in a non-stimulated effector T cells sample. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11361748 | Cells were treated with TPA for 30 min and immunostained for PKCα and phospho-PKCα (S657), and for nuclei (DAPI). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
... |
PMC11609529 | These findings indicate that depleting both YM and MAML2 reduces cell proliferation and enhances apoptosis. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"These",
"findings",
"indicate",
"that",
"depleting",
"both",
... |
PMC9429973 | Altered transcription may occur at three-dimensional chromatin level and be orchestrated by a combination of multiple regulatory factors. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Altered",
"transcription",
"may",
"occur",
... |
PMC11806106 | For the NOP FRET sensor the following primers were used: vector+mTurq fwd: TCTCAGACAGAGTGAGGTCAACCGGTGTGAGCAAGGG; vector+mTurq rev: GCCGGAAACAGGGGCTCCATGGTGAATTCCACCACACTGGA; fragment 1 fwd: CCAGTGTGGTGGAATTCACCATGGAGCCCCTGTTTCCG; fragment 1 rev: CCCTTGCTCACCATCCGCGGTCCACTCAGCAGTCTAACGCCTCG; YFP fwd: GTTAGACTGCTGAGTGGACCGCGGATGGTGAGCAAGGGCGAG; YFP rev: GGTCCTTCTCCCTGCTGTTAACCTTGTACAGCTCGTCCATGCC; fragment 2 fwd: GGACGAGCTGTACAAGGTTAACAGCAGGGAGAAGGACCGC; fragment 2 rev: CTCGCCCTTGCTCACACCGGTTGACCTCACTCTGTCTGAGACTTGTACA. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11726183 | The MDS analysis was performed for 100 ns time period comprising 55 414 total atoms including water molecules. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"MDS",
"analysis",
"was",
"perfo... |
PMC9429973 | ELN stratification is based on genetic abnormalities and divides AML in low, intermediate and high risk groups. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"ELN",
"stratification",
"is",
"based",
... |
PMC6450504 | Briefly, HeLa cells were seeded on glass coverslips in 12-well plates at 100,000 cells/well one day before treatment. | [
{
"tags": [
"O",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Briefly",
",",
"HeLa",
"... |
PMC11757131 | The effects of different concentrations of 3-HIB on cell proliferation were tested after 2, 4, 8, 16, 24, and 48 h (Table 1). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11291490 | The reaction was halted by adding 2 M H2SO4 (50 μL/well), and the OD450 was measured using a spectrophotometer (Bio-Rad, USA). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11786600 | These experiments adhered to the guidelines established by the National Institutes of Health concerning the care and use of experimental animals and complying with international ethical standards. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9341513 | In the long term, it may then be possible to predict changes to expression using only input data from healthy cells, plus the coordinates of the rearrangement. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11627060 | Primary rabbit polyclonal antibodies (Bcl-2, Bax, and Caspase-3) and secondary antibodies were obtained from Abcam, USA. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Primary",
"rabbit",
... |
PMC11024707 | Accordingly, the Kruskal-Wallis analyses revealed that there were statistically significant differences between the groups in terms of mi-RNA-106a-5p 2 (p = 0.030), mi-RNA-151a 2 (p = 0.036) and miRNA-28 2 (p = 0.005) values (Table 3). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9429973 | The great majority of pts destined to relapse post-allogeneic stem cell transplant (SCT) will do so within the first 12 months and survival after early relapse is dismal. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11352877 | Under hypoxic conditions, HIF-1α stabilizes (i.e., it is not proteasomally degraded) and translocates to the nucleus, forming a complex with DNA and activating the gene expression necessary for adaptation to low oxygen levels . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11767793 | We measured the UV–Vis absorbance of the supernatants produced during the CF process. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"We",
"measured",
"the",
"UV",
"–",
"Vis",
"absorbance",
... |
PMC4112127 | The viability of vector-transfected control cells was set to 100%, and the viability of BMP3-transfected cells was expressed as a percentage of formazan absorbance compared with that of control cells. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11394112 | We chose the commercially available NSG-SGM3 strain, a previously reported human hematopoietic cell engraftable strain , the recently developed NSG-human IL6 strain, and the F1 strain (NSG-IL6/SGM3). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC8750422 | In addition, hematoxylin and eosin (H&E) staining analysis was performed in lung tissues (Figure 5d). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"In",
"addition",
",",
... |
PMC11237030 | Optical densities (ODs) were measured at 450 nm. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Optical",
"densities",
"(",
"ODs",
")",
"were",
"measured",
"at",
"450",
"nm",
"."
]
... |
PMC11502327 | Deoxyschizandrin is the main active component of Schisandra berries, which has various biological activities such as hypoglycemic, antioxidant and anti-tumor. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Deoxyschizandrin",... |
PMC11750712 | Three patients had no response. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Three",
"patients",
"had",
"no",
"response",
"."
]
}
] |
PMC11240052 | Error bars reprehensive mean+ Standard deviation (SD). *** | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Error",
"bars",
"reprehensive",
"mean+",
"Standard",
"deviation",
"(",
"SD",
")"... |
PMC9454852 | The confocal analysis was then carried out in continuum in the same treatment conditions, and any significant oscillation in the [Ca]i was registered (Figure 5B). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11541409 | Qiu, H., et al., Promising antitumor activity of olverembatinib (HQP1351) in patients (pts) with tyrosine kinase inhibitor- (TKI-) resistant succinate dehydrogenase- (SDH-) deficient gastrointestinal stromal tumor (GIST). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11185260 | In contrast, serum from mice treated with radiation in combination with scL-SMARCB1 showed ALT and AST levels similar to those at baseline. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"In",
... |
PMC10914904 | Interestingly, in cultures of peripheral blood mononuclear cells (PBMCs) from patients with multisystem inflammatory syndrome who have autosomal recessive deficiencies in the OAS/RNase L pathway and in THP-1 monocyte cells depleted of OAS/RNase L, stimulation with synthetic dsRNA exacerbates the production of the inflammatory cytokines IFN-λ1, CXCL10, and IL-6. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11470999 | As shown in Figure 1A, the first‐generation diphenylbutylpiperidine antipsychotic drug PF exhibited the highest inhibitory activity. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"As",
"shown",
"in",
"Figure",
"1A",
",",
... |
PMC4270159 | The effect of the secondary kinase inhibitor alone will also be assessed. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"effect",
"of",
"the",
"secondary",
"kinase",
"inhibitor",
"alone",
"will"... |
PMC9429973 | 65 patients (58%) had a gastrointestinal and chronic liver disorders complicated by IDA, 47 patients (42%) had a gastrointestinal and chronic liver disorders complicated by ACD. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11628309 | Carvajal-Oliveros et al., 2021; De Haas et al., 2019; Hollville et al., 2020; Pinto-Costa et al., 2023; Xiong et al., 2017). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC10604092 | A notable factor identified by the cytokine array using the blood of the SLC-transplanted rats was NGAL. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"A",
"notable",
"factor",
"identified",
"by",
... |
PMC4395774 | In these gene-corrected CTL, function was equivalent to CTL generated similarly from nontransplanted, perforin sufficient, P14 transgenic mice (P14.WT). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
... |
PMC5839394 | SI was calculated as ratio between AgNPs-EPS IC50 values obtained for HB2 and SKBR3. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"SI",
"was",
"calculated",
"as",
"ratio",
"between",
"AgNPs-EPS",
... |
PMC11502962 | The risk stratification based on tumor size, tumor site, and mitotic count is often used to predict the recurrence risk. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"risk"... |
PMC9429973 | CAPTIVATE (PCYC-1142; NCT02910583) is a multicenter phase 2 study of first-line treatment with the all-oral, once-daily, chemotherapy-free regimen of I+V in fit pts with CLL. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC10366908 | EGFR is a type I transmembrane glycoprotein, which is composed of an extracellular ligand-binding domain and an intracellular tyrosine kinase domain . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"EGFR",
"is",... |
PMC10158546 | Cells were fixed and stained with DAPI before imaging for GFP via fluorescence microscopy. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Cells",
"were",
"fixed",
"and",
"stained",
"with",
"DAPI",
"befo... |
PMC11612508 | Another crucial factor and helpful metric for determining electronic charge is the zeta potential, which may be utilized to forecast and manage the stability of colloidal suspensions or emulsions. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11539788 | Additionally, the effects of RNF19A knockdown on promoting cell proliferation, migration and invasion were inhibited by the addition of LY294002, a small-molecule inhibitor of AKT/mTOR signalling. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11389534 | A conditional knockout of UFBP1 in vivo resulted in significantly reduced levels of serum immunoglobulins, specific antibodies and the conversion of activated B cells into plasma cells following immunisation, despite maintaining a normal number of B cells, indicating that the expression of UFBP1 in B cells is required for the production of serum immunoglobulins and the initiation of antibody response. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11756514 | No significant difference between the WT and the different mutants was observed. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"No",
"significant",
"difference",
"between",
"the",
"WT",
"and",
"the",
"differe... |
PMC10748106 | The most similar to Geniposide is Catalpol, although the conformation of the sugar is very different compared to Geniposide. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"most",
"similar",
... |
PMC11704135 | For compound 1, S. epidermidis was inhibited at a concentration of 7.5 mg/mL, while K. pneumoniae, P. aeruginosa, S. haemolyticus and C. albicans were inhibited at a concentration of 15 mg/mL. In contrast, E. coli, MRSA, and P. vulgaris required a concentration of 30 mg/mL to achieve inhibition. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11345828 | We hypothesized that substituting the methyl ether at this position may also improve the IV clearance; however, given the steric constraints of the nearby loop region of Mcl-1 binding site, 4-OEt was the largest ether that was well tolerated in terms of cellular potency. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC10114490 | FNone of the senescence-related gene sets was significantly different between PD and PD iHDF-T according to GSEA (see details in the text). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
... |
PMC10565698 | The results showed that the luminescence signal in the WT group was lower after co-transfection with miR-211-5p and circUSP10-WT than in the control group (circUSP10-WT + miR-NC). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11283030 | Two small interference RNAs (siRNAs) targeting ACLY (siRNA#1 and siRNA#2), a nonsense siRNA control (si-NC) and a luciferase siRNA were constructed by Sangon (Shanghai, China). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11791478 | Animals were removed from the study and euthanized if weight loss >30% (or >20% for 7 days) or study endpoint was reached [MTV of the vehicle control reached ≥1,500 mm or end of study (up to 60 days depending on the model)]. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11604768 | Fig. 3TRE-MPRA results using additional stimuli.a Heatmap of fold change responses in HEK293 cells across ten stimulus conditions relative to untreated cells. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Fig.",
... |
PMC11180402 | Numerous studies have reported that SOX2 plays an important role in the development of various human cancers. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Numerous",
"studies",
"have",
"reported",
"that",... |
PMC10891340 | Premix Ex Taq (Probe qPCR) (Takara, Dalian, China) was used to determine viral genome copies. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Premix",
"Ex",
"T... |
PMC11670954 | The human epithelial Caco-2 cells utilized in this study were obtained from Kunming Cell Bank, Typical Culture Preservation Committee, Chinese Academy of Sciences. | [
{
"tags": [
"O",
"O",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],... |
PMC9429973 | Age of patients enrolled ranged between 19 to 81 years. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Age",
"of",
"patients",
"enrolled",
"ranged",
"between",
"19",
"to",
"81",
"years",
"."
... |
PMC9164404 | injected into the mice bearing PDX. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"injected",
"into",
"the",
"mice",
"bearing",
"PDX",
"."
]
}
] |
PMC10840195 | Fig. 5Twist overexpression in A498 cells basically eliminated the effect of sunitinib on SR-A498 cells. | [
{
"tags": [
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"O"
],
"tokens": [
"Fig.",
"5Twist",
"overexpression",
"in",
"A498",
... |
PMC11536589 | Control mice (No treated) were administered vehicle at the same time points. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Control",
"mice",
"(",
"No",
"treated",
")",
"were",
"administer... |
PMC11686380 | We found that the variant GAP43 protein is unstable in neuronal cells. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"We",
"found",
"that",
"the",
"variant",
"GAP43",
"protein",
"is",
"unstable",
... |
PMC11789597 | A parametric test (Student's t‐test) was used to determine the statistical significance between two groups if the data was normally distributed. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
... |
PMC8873393 | In order to reveal transcriptome landscape for lncRNAs during DNA damage repair process, we first applied cufflinks and scripture to identify novel lncRNAs (Fig. S4A). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC10523483 | Furthermore, knockout of H1.2 diminished the occupancy of NRF2 at ARE regions in GCLC promoter, either under basal condition or tBHP-induced oxidative stress (Fig. 5G); H1.2 overexpression increased NRF2 enrichment at these regions (SI Appendix, Fig. S12). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11397654 | Finally, all the analogues of calixarenes (dihomooxacalixarenes, thiacalixarenes, calixresorcinols, azacalixarenes, calixpyrroles, pillarenes) are described in Section 4. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tok... |
PMC11754784 | Flow cytometry analysis was performed by a CytoFLEX flow cytometer (Beckman Counter, Inc., USA). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Flow",
"cytometry",
"analysis",
"was",
... |
PMC10728200 | J The effect of STUB1 on the ubiquitination modification of the K191 site of GPX4. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"J",
"The",
"effect",
"of",
"STUB1",
"on",
"the",
"ubi... |
PMC9429973 | They were distributed to the following stratification groups: standard risk (56 %), intermediate risk (27 %) and high risk (17 %). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11695546 | The exposing of coconut oil to ozone led to intensify the anti-biofilm role of the oil towards H. pylori. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"exposing",
"of",
"coconut"... |
PMC9325715 | The results indicate the spontaneous nature of the sorption process and the heterogeneous character of the protein surface in terms of binding energies. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
... |
PMC11597291 | The innate, hydrophobic properties of the pristine graphitic lattice of GO nanomaterials raise biosafety and poor biological stability issues, which limit their prospects for biomedical applications. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11750161 | Fresh growth medium containing 20% FBS was added to each well 5 h after transfection. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Fresh",
"growth",
"medium",
"containing",
"20",
"%",
... |
PMC9024365 | M4, CT alone (n = 13), M4, CT w/o SD1 (n = 13), M4, CT w/SD1 (n = 11). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC6684588 | Data are means ± SEM (n = 8–9). ** | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Data",
"are",
"means",
"±",
"SEM",
"(",
"n",
"=",
"8–9",
")",
".",
... |
PMC11052306 | In particular, both dendrimers bearing Cu(NO3)2 complexes 10-G0-[Cu(ONO2)2]4 and 10-G1-[Cu(ONO2)2]8 are highly toxic towards the healthy cell line 142BR. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"In",
"particular",
",",
... |
PMC11764090 | Some transcription factors, such as AP2/ERF, MYB, WRKY, NAC, and bZIP, not only act as calmodulin-binding proteins during cold perception but can also play important roles in the downstream chilling-signaling pathway. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9812014 | Phytochemicals such as alkaloids have a variety of biological and physiological functions and can be utilised as medications on their own . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Phytochemicals",
"such"... |
PMC8164677 | In the case of combinations, cells were treated with increasing concentrations of compounds at constant ratios of their IC50 values using the sequences 0/0 h (cisplatin and wedelolactone were added immediately after seeding), 0/4 h (cisplatin immediately after seeding; wedelolactone 4 h after seeding) and 4/0 h (wedelolactone immediately after seeding; cisplatin 4 h after seeding). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9712534 | Transfection of HeLa cells with the EGFP-TOP2B expression plasmid was performed using a FuGENE6 reagent (Promega, USA) according to the manufacturer’s instructions. | [
{
"tags": [
"O",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11012012 | The Mutu III subline expressed SAP at a low level . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"Mutu",
"III",
"subline",
"expressed",
"SAP",
"at",
"a",
"low",
"level",
"."
]
... |
PMC10748106 | For this reason, we considered all 13 iridoids to perform a QSAR study using molecular descriptors related to the electronic nature of the compounds. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tok... |
PMC11792090 | In summary, SAP UCAR-T cells with low immunogenicity, resistance to immune rejection, and superior survival and proliferation capabilities were successfully constructed both in vitro and in vivo. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11342785 | To create the TPPP-tagBFP-FHA1 and PkAsub-DDX4-FusionRed-PixD/Citrine-PixE constructs, we first fused the PKA substrate sequence "LRRATLVD" to the N-terminus of DDX4-FusionRed-PixD and DDX4-Citrine-PixE, resulting in the PKAsub-DDX4-FusionedRed-PixD and PKAsub-DDX4-Citrine-PixE constructs. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC5854676 | In the case of PEG + MgO in the absence of laser irradiation, measured changes were superficial. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"In",
"the",
"case",
"of",
"PEG",
... |
PMC11279598 | Antioxidant properties of Manuka honey have been attributed to its uniquely high content of polyphenols such as caffeic acid, caffeic acid phenethyl ester (CAPE), chrisin, etc., | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC10728535 | This study was conducted to investigate deregulated genes and signaling pathways involved in cisplatin resistance development in OC. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"This",
"study",
"was",
"conducted",
"t... |
PMC9351137 | Two negative control samples were considered: scramble siRNAs transfected Hela cells and mocktreated HeLa cells (see “Methods”). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"O",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"... |
PMC11583010 | Ab, Antibody; LC, Light Chain; HC, Heavy Chain. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Ab",
",",
"Antibody",
";",
"LC",
",",
"Light",
"Chain",
";",
"H... |
PMC11682172 | During the last wash step, cells were collected in 1.5 ml Eppendorf tubes, centrifuged for 5 min at 1000g, and the presence of residual T cells was excluded by screening for CD3, CD4, and CD8. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11047729 | Their high levels can be found in some vegetable oils and certain types of seeds, nuts, and grains . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Their",
"high",
"levels",
... |
PMC11670954 | However, the inhibition of RhoA can lead to abnormal tight junction function in epithelial cells . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"However",
",",
"the",
"inhibition",
"of",
"RhoA",
... |
PMC8557138 | One such device was used to show the role of phthalimide compounds in reducing angiogenesis by observing the sprouting ability of endothelial cells after treatment (Mercurio et al. 2019). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11757131 | Fatty acid oxidation is an important pathway for cellular energy production (31). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Fatty",
"acid",
"oxidation",
"is",
"an",
"important",
"pathway",
... |
PMC10890055 | As in the previous experiment (Figure 3), the higher sensitivity of L929 compared to hFOB 1.19 cells was shown and the toxic effect at the 60 μmol∙L concentration of Zn was also confirmed for the L929 cell line (Figure 4). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"O",
"B-CellLine",
"I-CellLine",
"O",
"O",
"O",
"O",
"O",
"O"... |
PMC8633974 | Cell vitality 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay performed on the electroporated cells showed no significant change in cell viability; P=0.54 and F=0.77, and partial η of 0.22 (One-way ANOVA, n=3). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC10142392 | This rapid enzymatic degradation of PCL highlights its importance in terms of biodegradation . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"This",
"rapid",
"enzymatic",
"degradation",
"of",
"PCL",
"highlights",
"its... |
PMC11352746 | Its impressive capabilities and wide range of components have opened new avenues of exploration and deepened our understanding of the intricate workings of cells. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
... |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.