Datasets:
OTAR3088
/
BioData-CellLine_annotated

Dataset card Data Studio Files
xet
Community
1
PMCID
string
Sentences
string
ner
list
PMC11457557
This condition is characterized by decreased renal glucose reabsorption and increased glucose excretion.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "This", "condition", "is", "characterized", "by", "decreased", "renal", "glu...
PMC11470999
Celastrol directly binds to CIP2A and promotes its interaction with the E3 ligase CHIP, enhancing CIP2A degradation.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Celastrol", "directly", "binds", "to", ...
PMC9429973
In 2 patients the semen parameters were below the reference ranges in both occasions.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "In", "2", "patients", "the", "semen", "parameters", "were", "bel...
PMC11786600
Both PED2 and PED4 groups showed decreased CD86 fluorescence and increased CD206 fluorescence.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Both", "PED2", "and", "PED4", "groups", "showed", "decreased", "CD86", ...
PMC9429973
During follow-up, 20 pts (12 ET, 5 HT, 2 PV and 1 pre-PMF) presented progressive splenomegaly, after a median of 120 months; in addition, 10 (6 ET, 3 HT, and 1 pre-PMF) of them developed a ≥2 BM fibrosis, after a median of 188 months.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9429973
We have 6 months of observation data on him.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "We", "have", "6", "months", "of", "observation", "data", "on", "him", "." ] } ]
PMC11767725
Dysregulated lipid metabolism contributes to microbial dysbiosis, where lipid-rich psoriatic plaques foster pathogenic taxa such as Staphylococcus aureus while depleting beneficial commensals of Cutibacterium.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tok...
PMC10237474
On day 0, both cell lines were seeded at 0.5x10/mL in a 24-DWP with 4 mL of their respective growth media.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "On", "day", ...
PMC11792888
In this study, we found that scorpion venom increases the cleaved form of AIF, indicating the release of AIF from mitochondria to the cytosol.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ...
PMC10988808
The scale bars represent 50 μm CCDC25 affects the Hippo pathway through YAP.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "scale", "bars", "represent", "50", "μm", "CCDC25", "affects", ...
PMC11711935
The expression of sFRP2 in melasma skin is upregulated, promoting pigmentation .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "expression", "of", "sFRP2", "in", "melasma", "skin", "is", "upregulated",...
PMC11755519
EVs were isolated from medium conditioned from UM-UC-3 cells and CRK-silenced UM-UC-3 cells.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "B-CellLine", "O", "O" ], "tokens": [ "EVs", "were", "isolated", "from", "medium", "conditioned", "fro...
PMC11759543
The red lines indicate median values in each group. (
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "red", "lines", "indicate", "median", "values", "in", "each", "group", ".", "(" ...
PMC11286266
None of the cell lines appear on the list of commonly misidentified cell lines maintained by the International Cell Line Authentication Committee.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "None", "of",...
PMC11713588
This was followed by medicinal chemistry for structure optimization to improve the potency and stability of the compounds.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "This", "was", "followed", "by", "medic...
PMC9429973
DNA sequencing was performed in 25 cases.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "DNA", "sequencing", "was", "performed", "in", "25", "cases", "." ] } ]
PMC10291556
A group of complexes combining a phenanthroline-based ligand, such as 5,6-dimethyl-1,10-phenanthroline (56Me2Phen) (PL), and a 1,2-diaminocycloalkane (DACH) ligand, such as 1S,2S-diaminocyclohexane (SS-DACH) (AL), showed impressive activities against human tumor cell lines.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC10914904
However, further research is needed to determine the precise mechanism by which this noncoding RNA is involved in IgAN.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "However", ",", "further", ...
PMC11739504
In addition, the acetylated α-tubulin level normalized Kat2b was also decreased in the garcinol-treated group compared to that in the control group (Fig. 2h).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC8956657
This illustrates how small mutations within viruses can result in different binding geometries to IMPα with associated functional consequences, and that sequence alignment alone cannot be used with great confidence to predict IMPα binding interfaces.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC5854676
In addition MgO NPs enhanced ultrasound-induced lipid peroxidation in the liposomal membrane.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "In", "addition", "MgO", "NPs", "enhanced", "ultrasound-induced", "lipid", "peroxidatio...
PMC11699178
Studies have revealed that this pathway interacts with the VEGF-B signaling pathway regulated by HIF-1α, jointly participating in the biological behaviors of tumor cells .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tok...
PMC4485786
Analysis of immunohistologic slides was performed in a single-blinded manner.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Analysis", "of", "immunohistologic", "slides", "was", "performed", "in", "a", "single-blinded", ...
PMC10840195
P < 0.05, **P < 0.01, ***P < 0.001 SR-A498 cell biological function in the presence/absence of sunitinib.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O" ],...
PMC11555465
Bladder cancer cells (1×10, no FBS) were inoculated into a 6-well plate at 37°C in a 5% CO2 atmosphere.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11786767
Consistent with previous studies (22, 23), Ki-67 knockdown prompted mitotic chromosome collapse and aggregation (Fig. 5A, as revealed by DAPI counterstaining).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11392912
All the patients included in the study fulfilled the American College of Rheumatology (ACR) criteria for the diagnosis of RA and all participating healthy volunteer has no prior history of inflammatory or joint-related disease.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9351137
Aurora B and α-tubulin were used as positive controls.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Aurora", "B", "and", "α-tubulin", "were", "used", "as", "positive", "controls", "." ] } ]
PMC10571053
Results from one of three independent experiments are shown and results are summarized in Table 1.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Results", "from", "one", "of", "three", "independent",...
PMC9429973
Image: Summary/Conclusion: In conclusion we observed that NSAA required treatment in about 2/3 of cases characterized by more severe cytopenias.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Image", ":",...
PMC10907726
6Autophagy can be reversed by 3-MA. (
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "6Autophagy", "can", "be", "reversed", "by", "3-MA", ".", "(" ] } ]
PMC9429973
Image: Summary/Conclusion: This work showed that the high expression of m7G regulators was correlated with unfavorable prognostic outcomes in MM.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Image",...
PMC11519788
In this study, we have identified that SPOP, which is frequently downregulated in UBC patients, plays a suppressive role in regulating cancer stemness and immunosuppressive TME.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11757131
Therefore, insufficient proliferation of PMECs, which leads to reduced milk production, is a major factor limiting the growth performance of piglets (2).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11806106
The sYFP2-Arr3 was cloned by amplifying the bovine Arrestin3 using PCR with the following primers (sequence 5’ → 3’): fwd: AAAAAAGATATCAGATGGGGGAGAAACCCGG, REV: AAAAAAGCGGCCGCTTAACAGAACTGGTCGTCATAG.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11321678
Scale bars: 100 µm in right F).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Scale", "bars", ":", "100", "µm", "in", "right", "F", ")", "." ] } ]
PMC11721096
The purified compounds were subjected to MS and NMR analyses.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "purified", "compounds", "were", "subjected", "to", "MS", "and", "NMR", "analyses", ...
PMC9429973
Pelabresib as monotherapy and in combination with RUX increased the proportion of CD4 T cells, and more importantly, reduced MK lineage cells compared with BL in both treatment-naïve and RUX relapsed/refractory (r/r) pts.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9479186
Take photographs after PBS washing for three times.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Take", "photographs", "after", "PBS", "washing", "for", "three", "times", "." ] } ]
PMC11767725
For instance, bacteriocins like nisin and pediocin have demonstrated the ability to selectively inhibit C. acnes proliferation.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "For", "instance", ",", "bacteriocins", ...
PMC11075223
The treatment of chronic pulmonary heart disease with modified Mahuang Shengma Decoction could significantly improve the therapeutic effect.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "treatment", "of", "chronic", "p...
PMC6600592
ESIMS: m/z 290.1748 [M + H], 312.1567 [M + Na], calculated for C17H23NO3 (289.38).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "ESIMS",...
PMC9221284
2 × 10 cells (extracted tissues or cell culture) were suspended in 50 μL RIPA (Radio ImmunoPrecipitaion Assay; BioRad) lysis buffer containing 200 mM PMSF (Alpha-Phenyl Methyl Sulfonyl Fluoride, serine protease inhibitor), 100 mM sodium orthovanadate, and a protease inhibitor cocktail (Santa-Cruz Biotech).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11194678
We next performed luciferase reporter assays in vivo to further verify the effects of STAU1 LLPS on translation.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "We", "next", "performed", "luciferase", ...
PMC11680982
Therefore, our data do not address whether the ultimate improvement in the efficacy of neratinib combined with CDK4/6 inhibitor rely on the effects of CDK4/6 inhibitor, endocrine therapy, or both.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11720808
ns, no significant difference; *P < 0.05; **P < 0.01 compared with the control group.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "ns", ",", "no", ...
PMC11401358
Comparing the antioxidant effect of the four peptides, the antioxidant effect of (GAGSGA)2-8 h was found to be significantly stronger than the antioxidant effect of the other groups (Fig. S9).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC6337547
Furthermore, it activates inflammatory response, produces oxygen free radicals, or releases lysosomal enzymes to damage tissue.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Furthermore", ",", "it", "activat...
PMC10840195
They were inoculated in a Transwell chamber and cultured in 10% FBS medium for 24–48 h. After culture, the Transwell chamber was removed.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tok...
PMC10092581
Similarly, all Ag(I) complexes were almost equally or more effective than auranofin in decreasing TrxR activity in intact cells, with [AgCl] being even 2.4 times more effective than the reference gold‐based drug in targeting the selenoenzyme (Figure 3, panel C).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11777207
To determine whether differences in transwell migration were a result of the inflammatory phenotype specific to GM-CSF–derived BMDCs, we cultured bone marrow in the presence of Flt3L to generate BMDCs closer to what is observed in vivo for cDCs (52) and found a comparable defect in migration in αPD-L1 (10F9.G2 and 43H12)–treated BMDCs similar to Ccr7 and Pdl1 BMDCs (Fig. 4B) (19, 26).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC10847511
Firstly, clinical tumor tissues are composed of complex structures that includes not only tumor cells but also mesenchymal cells and immune cells, while cancer cell lines lack such a tumor microenvironment.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11574271
Recently, some studies have also found that altered RON expression in bladder cancer is positively associated with tumor histology grading, larger tumor size, non-papillary contour, and higher tumor staging .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9429973
CRS (77%/80%; grade 3: 3%/0%) were mostly reported during step-up dosing.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "CRS", "(", "77%/80", "%", ";", "grade", ...
PMC6450504
n = 3 independent trials, mean ± SD.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "n", "=", "3", "independent", "trials", ",", "mean", "±", "SD", "." ] } ]
PMC11787355
Up to three weeks following first ACT, we found the TSCM phenotype to remain dominant in vivo with negligible inter-individual differences (Fig. 4h, i).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC10079526
P-value ** ≤ 0.01, *** ≤ 0.005.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "P-value", "*", "*", "≤", "0.01", ",", "*", "*", "*", "≤", "0.005", "." ...
PMC9429973
The mean hospital length of stay for Medicaid patients with ALL was 8.8 (SD 13.17) days (Median was 4 days).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ ...
PMC11144382
These comprised one potential NFI binding site in the human and mouse genomes at positions −2176 to −2163 and −1822 to −1809 upstream of the ATG start site of the CRABP2 and Crabp2 genes, respectively, which were conserved (Figure 4A); and another at positions −238 to −224 and −202 to −188 upstream of the ATG start site of the VCAM1 and Vcam1 genes, respectively, which were conserved (Figure 4A’).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11676169
Increased expression of branched-chain amino acid (BCAA) transaminase 1 (BCAT1) often correlates with tumor aggressiveness and drug resistance in cancer.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ ...
PMC8303372
Due to the differences observed between vehiculated and non-vehiculated drug effects, it is very interesting to monitor cell proliferation in real-time to precisely identify the onset of the toxic event.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC10669966
No. CRL-3043), 94T778 (RRID:CVCL_U613) (Cat.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "No.", "CRL-3043", ")", ",", "94T778", "(", "RRID", ":", "CVCL_U613", ")", ...
PMC11394730
Further investigation revealed that emodin can function as an AhR agonist, raising the levels of both the protein and CYP1A1, its downstream target gene .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ...
PMC11754432
Two-way ANOVA performed; significance denoted by *P < 0.05, **P < 0.01, ***P < 0.001.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ ...
PMC3035438
The average ratios of the transcript levels in CX13 relative to the levels in CstF-64+ were estimated by gel band quantification. (
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", ...
PMC11471157
After completion of the culture process, cell blocks were prepared from the samples using standard methods .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "After", "completion", "of", "the", "culture", ...
PMC11377827
We performed the Real-Time ATP rate assay according to the manufacturer’s instructions using Seahorse XF FluxPak consumables (Agilent Technologies).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "We", "perfor...
PMC11794568
cDNA was reverse transcribed from RNA using a PrimeScript RT kit (Promega, Madison, WI, USA).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "cDNA", "was", "reverse", ...
PMC11394386
Pathway enrichment analysis related to HOTAIR was performed, predicting interactions with RNA-binding proteins (RBPs) using RBPDB (105 proteins) and Encori (60 proteins) databases (Supplementary Table S1).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC10812665
Already after 4 h, strong changes were evident, and they increased over time (16 h), but rather returned towards baseline after 24 h (Figure 2A,B).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11087301
PKD-1 signal is required for the CSCs subpopulation maintenance in pancreatic neuroendocrine malignancies at an intermediate state along the EMT process, thus resulting in a phenotype of CSC along with plasticity and incomplete EMT.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11599565
Panel D: In regular ovarian tissues, some few ChgA-PNMA1 resident cells are noticeable (A-H).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Panel", "D", ":", "In", "regular", ...
PMC11772449
BEL-7404, Huh-7 and PLC/PRF/5 cells were treated with different concentrations of Sora (2.5/5/10/20 μM) and PFD (1/2/4 mM).
[ { "tags": [ "B-CellLine", "O", "B-CellLine", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], ...
PMC10571053
Aim: Ferroptosis is a non-apoptotic form of cell death caused by lethal lipid peroxidation.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Aim", ":", "Ferroptosis", "is", "a", "non-apoptotic", "form...
PMC11791478
Zovodotin contains the auristatin payload ZD02044, and because of its chemical structure and properties, the zovodotin linker–payload has the potential to improve the benefit-to-risk profile of ADCs compared with other auristatin-based linker–payloads (27, 28).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9429973
However, we encourage future prospective clinical studies to address this question with specific and uniform standards or protocol specifications for dose reduction or dose capping in overweight and obese patients with AML.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11714165
For in vivo safety testing, five groups of normal BALB/c nude mice were randomly assigned, ensuring 5 mice per group.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "For", ...
PMC9429973
Intracellular ROS was increased by FAC.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Intracellular", "ROS", "was", "increased", "by", "FAC", "." ] } ]
PMC6102174
Chlorogenic acid analogues (1–3) showed activity against HBV DNA replication with IC50 values of 5.5 (SI > 250.1), 13.7 (SI > 115.0) and 7.3 (SI > 249.9) μM; dicaffeoyl analogues (4–6) significantly inhibited HBV DNA replication with IC50 values of 6.4 μM (SI > 256.1), 9.8 μM (SI > 184.8) and 6.1 μM (SI > 184.8), as well as moderate activity against the secretions of HBsAg and HBeAg; the methylated analogues (7–9) dramatically decreased the activity against HBV DNA replication, with IC50 values of 272.3 (SI > 6.2), 175.3 (SI > 11.2) and 144.7 (SI > 20.2) μM, respectively.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9352806
Table 2KEGG pathwaysCompoundscel01100 Metabolic pathways - C. elegans (nematode)cpd:C00350 Phosphatidylethanolamine;cpd:C00157 Phosphatidylcholine;cpd:C00422 Triacylglycerolcel00564 Glycerophospholipid metabolism - C. elegans (nematode)cpd:C00157 Phosphatidylcholine;cpd:C00350 Phosphatidylethanolaminecel04140 Autophagy - animal - C. elegans (nematode)cpd:C00350 Phosphatidylethanolaminecel00563 Glycosylphosphatidylinositol (GPI)-anchor biosynthesis - C. elegans (nematode)cpd:C00350 Phosphatidylethanolamine KEGG pathway annotation information.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9895440
Source data and exact p-values are provided as a Source Data file.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Source", "data", "and", "exact", "p-values", "are", "provided", "as", "a", ...
PMC9429973
This study analyzed the molecular correlation test results of 207 patients with t (8; 21) AML, and conducted a comprehensive retrospective analysis by 56 gene targeted sequencing, so as to clarify the gene distribution and related pathways involved in t (8; 21) AML patients in Chinese population, as well as the correlation between different gene mutations and chromosome abnormalities.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11519788
Since SPOP-mediated protein degradation relies on the SPOP/CUL3/RBX1 E3 ubiquitin ligase complex 26, depletion of either CUL3 or RBX1 resulted in STAT3 stabilization in 5637 cells (Figure 4F-G).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", ...
PMC11732628
On the next day, the membranes were then incubated with horseradish peroxidase-labeled secondary antibody (cat.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "On", "the", "next", "day", ",", "the", ...
PMC11746942
Additionally, staining of K16 and K17, markers of abnormal differentiation of keratinocytes, revealed reduced proliferation and differentiation following FTY720 treatment (Fig. 1D, E).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC5874706
No additional surface-active agent was used during the nanoformulation process.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "No", "additional", "surface-active", "agent", "was", "used", "during", "the", "nanoformulation", ...
PMC11785489
We recognize that it is optimal to identify expanded clones by nucleotide rather than amino acid sequence, because different ancestral V(D)J nucleotide recombinations can converge to the same amino acid sequence.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11682172
Coronin 1A immunohistochemistry mean-intensity levels are significantly higher in the group of breast cancers from patients who developed brain metastasis (n = 10, Brain Mets) when compared with breast cancers from patients with metastases to organs other than brain (n = 22, Other Mets), p = 0.0035.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11785489
Peptide antigens were subsequently cloned into pHAGE-CMV-Nflag-HA-DEST-IRES-Puro destination vectors using LR clonase (ThermoFisher Scientific Gateway Clonase).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Peptide", "antigens", "were", "subsequently"...
PMC11200978
Samples were transferred to a 96-well round-bottom plate in triplicate for flow cytometry analysis using a Guava EasyCyte Plus microcapillary system (Guava/EMD Millipore, Burlington, MA, USA and ExpressPro Software v5.3.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC10745221
Arginine methylation on histones can affect gene expression, so we hypothesized that SDMA and ADMA on histones may play a role in the mechanism of reversion.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11656657
Both knocked-out 143B cell lines showed a similar GD2 expression in terms of both percentage and MFI level (Fig. 5G), this indicating that silencing of these two genes did not alter the expression of the GD2 target antigen.
[ { "tags": [ "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9000591
Detailed information is provided in Table 4.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Detailed", "information", "is", "provided", "in", "Table", "4", "." ] } ]
PMC11653533
but most commonly known as “sandpaper”, is an evergreen, terrestrial, deciduous, auxiliary timberland habituated tree that develops within the drier sorts of timberland or in rocky places and, in some cases, enduring in cleared land could grow approximately 20 m in stature, contains smooth grey bark which oozed a gummy sap (Amponsah et al., 2013, Mouho et al., 2018).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11222184
Similarly, Debio0932 led to a reduction in LPL gene expression.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Similarly", ",", "Debio0932", "led", "to", "a", "reduction", "in", "LPL", "gene", ...
PMC9429973
Deep responses were seen.
[ { "tags": [ "O", "O", "O", "O", "O" ], "tokens": [ "Deep", "responses", "were", "seen", "." ] } ]
PMC11588085
As cellular plasticity allows tumor cells to adapt and transdifferentiate in response to various signals and stresses present in a heterogeneous environment, the loss of XIST may result in increased tumor heterogeneity as cancer cells are more adaptable to diverse cell types and characteristics.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9786247
The reported ubiquitous distribution of high C. burnetii seroprevalence in cattle herds and the high C. burnetii concentration in bulk tank milk, together with our findings that bovine milk isolates did not display a common pattern that distinguished them from strains identified as of public health concern, point to unpasteurized bovine milk as another potential source of zoonotic human Q fever.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11638255
d Gene set enrichment analysis for TEPA-treated high-infiltrated tumor regions compared to low-infiltrated regions presented as a bar plot.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "d", "Gene", "set", "enrichment", ...
PMC9503685
Nevertheless, these studies with the A549 cell line provide information about a minimum window of activity against bacteria without cytotoxicity to the eukaryotic cells.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ],...