PMCID
string
Sentences
string
ner
list
PMC11683130
AGT is an important part of the renin-angiotensin system (RAS).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "AGT", "is", "an", "important", "part", "of", "the", "renin-angiotensin", "system...
PMC11397654
Five calixarene, four calixarene, and four calixarene derivatives were prepared and characterised by spectroscopic analyses, with the X-ray structure of one calixarene derivative also obtained.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC10874773
lanceolatumNie, Ding, Lei, Pan, & Zhao, 2021124NeodunnianinI. dunnianumFukuyama & Huang, 2005 Seco-prezizaane-type sesquiterpenes found in Illicium plants.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "lanceol...
PMC7039683
The line is the median scoring SNP, the box contains the middle-scoring two quartiles, and the whisker represent the top and lower quartiles.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tok...
PMC11657695
To investigate whether KCNA2 overexpression in ES is linked to a key process in tumour development, we compared the RNA sequencing transcriptional profiles of the A-673 cell line transfected with a pool of five siRNA against KCNA2 (siRNA KCNA2) or with a control siRNA (siRNA CT, GSE246854).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellL...
PMC11543885
Different amounts of streptavidin beads (20, 60, 200 μL) were used for the pull-down experiments as indicated.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Different", "amounts", ...
PMC11791203
To explore the potential involvement of apoptosis in cytotoxicity, in silico docking studies were performed on critical proteins, involved in apoptosis, such as Caspase-3, Caspase-9, Cox-2 and Bax.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11740399
Annexin V/PI staining (E) supported combination therapy enhances the percentage of cell apoptosis. (
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Annexin", "V/PI", "staining", "(", "E", ")", "su...
PMC9919300
Hence, this study was designed to evaluate the first stage of NAFLD, which is NAFL in HepG2 cell lines, and its treatment with curcumin and andrographolide separately and in association.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", ...
PMC9739791
Conventional Pt(IV) prodrugs that are capable of activation under irradiation consist of a platinum core, its equatorial ligands, and axial ligands–light-sensitive small molecules.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC8343815
The cytotoxicity of AuNRs and AuNPs on HeLa cells in the presence and absence of 6-MV X-ray was investigated using the MTT assay.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ ...
PMC11388384
The microscope, cameras, and hardware were controlled through the NIS-Elements software (Nikon), and data were analyzed using Fiji, Trackmate, SaSpt, and ExTrack as required for the experiment (24, 37, 54–56).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9429973
At a time when the importance of diversity and inclusivity are increasingly recognized in society, enhancing ethnic diversity in blood donors may reflect a positive force for healthcare and social equality.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC8316344
Ferritin heavy chain 1 (FTH1) and ferritin light chain (FTL) are heavy and light chain of ferritin consisting 24 subunits, which is critical for iron storage .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11574029
T24 and 5637 cells were infected with lentiviral solutions to establish stable NOTCH3 knockdown, SPP1 overexpression, and matched control cell lines.
[ { "tags": [ "B-CellLine", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens"...
PMC11803149
Aged CD8 TCR-T cells are unable to accumulate efficiently in tumors and have higher tendency to become terminally exhausted T cells with lower expression of endothelial PAS domain-containing protein 1 (Epas1) compared to young cells.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC10656496
Meaningful perturbations of these small populations are more difficult to investigate with typical clinical trial designs.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Meaningful", "perturbations", "of", "these", "small", ...
PMC11786767
B–D: Line scanning analysis reveals a change in biotin-DHPE distribution.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "B", "–", "D", ":", "Line", "scanning", "analysis", "reveals", "a", ...
PMC11754436
Finally, the GSE126209 dataset was used to verify the change in expression of the aforementioned predicted target genes.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Finally", ",", "the", "GSE126209"...
PMC11680982
For 200 nM CDK4/6i + 100 nM ET: HER2-low vs. HER2-0, P = 0.003.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "For", "200", "nM", "CDK4/6i", "+", ...
PMC9429973
Updated data will be presented at the meeting.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Updated", "data", "will", "be", "presented", "at", "the", "meeting", "." ] } ]
PMC10578720
The observed changes in other metabolites associated with glucose metabolism are shown in Supplemental Figure S6, http://links.lww.com/HC9/A588.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "observed", "changes", "in", "ot...
PMC11694346
Fluorogenic techniques capitalize on the unique reactivity of biothiols with specific fluorogenic probes, resulting in enhanced fluorescence signals that enable sensitive and selective detection.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tok...
PMC11363012
High variability in the levels of all quantified compounds was observed in these cell populations from all five tissues.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "High", "variability", "in", "the"...
PMC10652261
Carrot orange powder.
[ { "tags": [ "O", "O", "O", "O" ], "tokens": [ "Carrot", "orange", "powder", "." ] } ]
PMC11673128
Conversely, the AS4 cell line, whose resistance against crizotinib is mediated by on-target mechanisms, failed to show evidence of CD47 upregulation (Figure 2B), whereas lorlatinib (100 nM) caused increased CD47 expression (Figure 2C).
[ { "tags": [ "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9429973
A systematic literature review of iMCD reported a three-fold increased prevalence of malignancy in iMCD patients (19%) compared to age-matched controls (6%).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11627060
Upon the tracking dye (bromophenol blue) advancing 1 cm from the bottom end, the current is deactivated, the power supply is removed, and the gel is subsequently stained with 0.5 μg/mL ethidium bromide in sterile distilled water within a plastic tray for 30–45 min.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11470999
Immunoblotting following biotin‐immunoprecipitation in B16 and A375 cells further confirmed the interaction between PF and CIP2A (Figure 3E).
[ { "tags": [ "O", "O", "O", "O", "B-CellLine", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Immunoblotting", ...
PMC11116779
Sections were viewed and photographed in a 120 kV JEM-1400 Flash Transmission Electron Microscope (TEM) (Jeol Ltd., Tokyo, Japan) equipped with CMOS camera Matataki and TEM Center software (Jeol Ltd.) at a magnification ranging between 2,500 and 50,000×.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11643361
Within the domain of metal complexes, some coordination compounds with the tri-dentate scorpionate ligand were found to exhibit interesting anticancer activity .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Within", "th...
PMC10507284
Also, we observe that the individuals with TROAP overexpression mainly focus on several vital pathway components, such as cell cycle, DNA replication, and so on (Figure 4D).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC10165258
Images without cells were acquired using a binocular microscope (Nikon SMZ18) with a digital single-lens reflex camera (D7000, Nikon).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ ...
PMC8193046
In terms of retrospective molecular docking experiments, rare exceptions are ABCB5 , ABCB6 , or ABCC10 , .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "In", "terms", "of", "retrospective", "...
PMC11787381
The test is also widely used to assess anxiety like and exploratory behaviors.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "test", "is", "also", "widely", "used", "to", "assess", "anxiet...
PMC8735881
We were intrigued to know the anti-HIV activity of the CMI constructs in terms of their dual-functional destinations.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "We", "were", "intrigued", "to", "know"...
PMC11021472
Next, we co-infected BL cells with the circZDHHC11 and the miR-150 overexpression vectors and analyzed potential effects on growth in a GFP competition assay.
[ { "tags": [ "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ],...
PMC11574029
N Enrichment of NOTCH3 at two binding sites in the SPP1 promoter detected by ChIP-qPCR.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "N", "Enrichment", "of", "NOTCH3", "at", "two", "binding", ...
PMC10728200
Our data revealed that a single treatment with IM or RSL3 significantly inhibited the GIST cell activity (Fig. 5A).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Our", "data", "re...
PMC9429973
Fragment analysis was analyzed through Peak Scanner Software (Thermo Fisher).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Fragment", "analysis", "was", "analyzed", "through", "Peak", "Scanner", "Software", ...
PMC10988555
The CoCp complexes 1–4 were obtained in moderate-high yields (54 to 78%), in the same order of magnitude as the analogous RuCp complexes with triphenylphosphane and bidentate N,N-heteroaromatic ligands.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC10582049
For the analysis, we have used transcriptome profiling data obtained using bulk RNA sequencing.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "For", "the", "analysis", ",", "we", "have", "used", "...
PMC11575040
MicroRNAs (miRNAs) and long noncoding RNAs (lncRNAs) are non-protein-coding RNA molecules that play a key role in tumor development by interacting with cellular chromatins and proteins to regulate genes involved in cell proliferation, motility, invasiveness, and angiogenesis .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11655536
CD138+ cells were selected and treated with HA at indicated concentration for 48 h. Cell viability was assessed with CCK-8 kit.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "CD138", "+",...
PMC10589262
However, in GIST cells, 30N12 treatment did not change the phosphorylation levels of effector molecules, indicating that PM-localized MT-KIT was also insufficient to activate downstream signaling (Fig. 2B).Fig.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC8759873
The molecular weight of the VHL protein is 28 -30 KD, including 213 amino acids, called p30 or pVHLL protein; the VHL gene can also encode a protein with a molecular weight of 19 KD, called pl9 or pVHLS protein.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11786704
EDS spectrum showing the element distribution of C, O and Ca. (
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "EDS", "spectrum", "showing", "the", "element", "distribution", "of", "C", ...
PMC9429973
The intervention also included a preparatory course for the caregiver ambassadors and available support during the intervention.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "intervention", "also", "included", "a", ...
PMC10798140
The percentage cell viability was calculated using the following equation.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "percentage", "cell", "viability", "was", "calculated", "using", "the", "following", "equa...
PMC9429973
The UK National Registry for chronic myeloid leukaemia (CML) patients (ptn) is a web-based PBCR, initially established as a regional registry in 2010, then expanded nationally in 2015.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9786247
Bovine MDMs respond to C. burnetii infection with an early (3 h p.i.)
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Bovine", "MDMs", "respond", "to", "C.", "burnetii", "infect...
PMC11655536
We first verified the knockdown of TFE3 expression at the protein level.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "We", "first", "verified", "the", "knockdown", "of", "TFE3", "expression", "at", ...
PMC8540692
Animal studies showed that NaBu and other short chain fatty acids exert widespread influence on key neurological and behavioral processes and may be involved in critical phases of neurodevelopmental and neurodegenerative disorders .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC8978939
Protein levels for both variants were significantly lower than those for VHL-WT-Venus ( Figure 1A ).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Protein", "levels", "for", "both", "variants", "were",...
PMC10758402
DMF exerts inhibitory effects on the cellular response to type I IFN by, in part, reducing IFN production through the modulation of NFκB (27).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC6450504
p < .05, ***p < .0005, ****p < .0001, two-way ANOVA with Tukey’s multiple comparisons test. (
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9429973
Image: Summary/Conclusion: Predicting VTE in hospitalized COVID-19 patients cannot be relied on pre-COVID era developed VTE risk scores.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Image", ":", "Sum...
PMC11766309
A–L) YKT6 expression in various tumor stages in the indicated tumor types.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "A", "–", "L", ")", "YKT6", "expression", "in", "vario...
PMC11015054
m6A is a common modification of mRNA in eukaryotes, it has been shown that cancer progression is influenced by methylation of m6A, , and changes in RNA methylation are abnormal in a variety of malignant tumors, playing the key role in migration, invasion,regulating tumor immunosuppression, and chemotherapy resistance. ,
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC8389560
The concentration and purity of the total RNA were determined spectrophotometrically at 260/280 nm.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "concentration", "and", "purity", "of", "the", "total", "R...
PMC8740518
Animal experimentation was performed under project license (No. 2019-02-010) granted by the Institutional Animal Care and Ethics Committee of Zhejiang Cancer Hospital, in compliance with national or institutional guidelines for the care and use of animals.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9429973
PRO instruments, including the EORTC QLQ-C30 (Global Health and Physical Functioning) and the EQ-5D-5L visual analog scale (VAS), were administered at baseline (prior to treatment), Day 50, Day 100, Day 150, and Month 9, then every 3 months up to 24 months or time of EFS event, whichever occurred first.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC5833712
However, also other mechanisms may explain the dominant growth inhibitory effect of ERβ such as: formation of ERα:ERβ heterodimer in the presence of E2 and that ERβ dictates the activity of the heterodimer, competition with ERα for binding to sites on DNA within target genes or competition for interaction with coregulatory proteins (Fig. S5).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC6450504
Cells were treated with the free drug, 0% and 0.5% PEIPOS at 2.5 nM of PTX concentration and incubated for 24 h continuously at 37 °C in complete media.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11806106
Further, the properties of the agonist, like affinity to the receptor, and somehow efficacy for the receptor activation, determine the activation speed of the receptor.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9429973
pneumonias trains was 40%, while the proportion of Enterobacteriaceae strains, susceptible to extended-spectrum cephalosporins and carbapenems, reached only 8.8%.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ ...
PMC10329237
The migration rate of A549 cells exposed to LOS (0.2 mM)+PFD and LOS (0.5 mM)+PFD was lower than those exposed to PFD alone.
[ { "tags": [ "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ],...
PMC8662250
Cells were washed three times with phosphate‐buffered saline (PBS), detached with trypsin/ethylene diamine tetraacetic acid (EDTA), and dependently on the experiment plated in 6‐well plates, 96‐well plates, or 10 cm diameter Petri dish and allowed to adhere for further 24 h. The Caco‐2 cells were randomly divided into eight groups: 1) vehicle group, 2–4) 0.1, 1, 10 ng/ml SP group, 5–7) 10 ng/ml SP plus 10, 10, 10 M CBD, and 8) 10 ng/ml SP with 10 M CBD plus 9 nM GW9662 antagonist PPAR‐γ.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11765988
HIV infection does increase the risk for HL, while the majority of the patients are also EBV positive .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "HIV", "infection", "does", "incre...
PMC11638255
Quantifications were normalized using internal controls: ACTB (F: AGAAAATCTGGCACCACACC and R: AGAGGCGTACAGGGATAGCA) for ISG15 and S100A8, and GUSB (F: TGGTGCGTAGGGACAAGAAC and R: CCAAGGATTTGGTGTGAGCG) for MT1X.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11798926
Lysates from two wells were combined for each replicate (1,000 μL total).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Lysates", "from", "two", "wells", "were", "combined", "for", "ea...
PMC11194678
Cells were seeded on coverslips placed in 12-well plates.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Cells", "were", "seeded", "on", "coverslips", "placed", "in", "12-well", "plates", "." ] } ]
PMC8358006
h Gene ontology and pathway enrichment significance (−log10 (P value) values) are not correlated for GO terms shared between 1172 GSDs marked genes and 388 random selected genes. (
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11574029
From the TCGA database (https://tcga-data.nci.nih.gov/tcga/) and the GEO database (https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE37815,https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE13507), we downloaded the mRNA expression profiles of BLCA patients.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC7812570
HEK293T cells were cotransfected with GPI-FluIgG03 or GPI-m36.4 and the HIV-1 provirus NL4-3 (left) or THRO.c/2626 (right).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ ...
PMC11488203
Western blot analysis was performed as described elsewhere .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Western", "blot", "analysis", "was", "performed", "as", "described", "elsewhere", "." ] } ]
PMC9895440
10 μg/ml human IgG1 or 10 μg/ml anti-CTLA4 blocking antibody (ipilimumab) was added.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "10", "μg/ml", "human", "IgG1", "or", "10", "μg/ml", "...
PMC11575040
A Venn diagram depicting the identification process of miR-1270, which was found to interact with LINC00094 through TargetScan prediction and to be upregulated in cells with LINC00094 knockdown along with si-LINC00094-2 and si-LINC00094-3 transfection through small RNA profiling.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11585254
For panels B and C, the EC50 and Emax values were analyzed by one-way ANOVA followed by Dunnett’s multiple comparison test.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "For", ...
PMC11467800
In conclusion, utilizing a zebrafish larval xenograft model, we demonstrated that phenotypically plastic cancer cells exhibit superior cellular dynamics compared to the cells they originate from.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC10810426
At 2 and 4 hpi, CA was readily detected in the nuclear fractions (Fig 1A).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "At", "2", "and", "4", "hpi", ","...
PMC11228511
All primers used in the experiments are listed in SI Appendix, Table S2.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "All", "primers", "used", "in", "the", "experiments", "are", "lis...
PMC11799620
The aqueous extract was kept at −20°C until use.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "aqueous", "extract", "was", "kept", "at", "−20", "°", "C", "until", "use...
PMC9429973
Virological data was obtained by nasopharyngeal swabs, which were collected routinely, then Sanger sequencing of the hemagglutinin gene was performed for phylogenetic and mutational analysis.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11224020
N = 2, n = 6) and were analyzed by ordinary one-way ANOVA; ****P < 0.0001.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "N", ...
PMC11775197
Binding of PPARs to ligands prompts binding to co-repressor proteins and heterodimerization with the retinoic acid X receptor.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Binding", "of", "PPARs", "to", "ligand...
PMC11388384
Sender and receiver cell lines were built as described previously (16).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Sender", "and", "receiver", "cell", "lines", "were", "built", "as", "...
PMC11394730
The primary cause of QUE’s anti-proliferation effect was cell cycle arrest in the G1 phase despite a low QUE dose with a slight cytotoxic effect.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ...
PMC10957991
Further, TRPV4-mediated calcium influx seems to be essential for the integrity of cell–cell junctions in the skin keratinocytes.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Further", ",", "T...
PMC6600592
H NMR and C NMR spectra were recorded on Bruker AVANCE III HD600 (H/C, 600MHz/150MHz) spectrometer (Bruker, Bremerhaven, Germany) using TMS as an internal standard.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11792766
The slides were imaged at 10× magnification using BioTek's Cytation 3 Cell Imaging Multi‐Mode Reader.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "slides", "were", "imaged", "at", "10...
PMC11742431
Analysis of PD‐L1, Furin, and Survivin expression levels. (
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Analysis", "of", "PD‐L1", ",", "Furin", ",", "and", "Survivin", "expression", "levels...
PMC9429973
Moreover, our data suggest that CD200 expression had no significant effect on lymphocyte subsets in patients.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Moreover", ",", "our", "data", "suggest", "...
PMC4360730
These relationships are either explicit or inferred.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "These", "relationships", "are", "either", "explicit", "or", "inferred", "." ] } ]
PMC11779605
Bemarituzumab (humanized monoclonal antibody against FGFR2-IIIb) is approved for FGFR2-IIIb-overexpressing and HER2-negative metastatic and locally advanced gastric and gastroesophageal adenocarcinoma in combination with modified FOLFOX6 (fluoropyrimidine, leucovorin, and oxaliplatin) based on the FIGHT trial (35).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11190062
Cells were washed twice in flow buffer and analyzed using LSR II (BD Biosciences) and FACS Diva software (BD Biosciences).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ ...
PMC11564322
p < 0.05, ###p < 0.001 vs. the respective peptide alone mRNA expression of mTOR and cMYC genes in the leukemia cell lines.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11297139
As EWS/FLI1 is a major driver oncogene in Ewing’s sarcoma, we further examined whether ARID1A LLPS-dependent upregulated cREs are co-localized with EWS/FLI1 nucleation sites in Ewing’s sarcoma.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC10114490
White bar equals 75 μm.
[ { "tags": [ "O", "O", "O", "O", "O", "O" ], "tokens": [ "White", "bar", "equals", "75", "μm", "." ] } ]
PMC10818573
Therefore, we introduced a labeled probe in addition to the normal RPA assay, and only the reverse primer was labeled.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Therefore", ...