PMCID string | Sentences string | ner list |
|---|---|---|
PMC11683130 | AGT is an important part of the renin-angiotensin system (RAS). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"AGT",
"is",
"an",
"important",
"part",
"of",
"the",
"renin-angiotensin",
"system... |
PMC11397654 | Five calixarene, four calixarene, and four calixarene derivatives were prepared and characterised by spectroscopic analyses, with the X-ray structure of one calixarene derivative also obtained. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC10874773 | lanceolatumNie, Ding, Lei, Pan, & Zhao, 2021124NeodunnianinI. dunnianumFukuyama & Huang, 2005 Seco-prezizaane-type sesquiterpenes found in Illicium plants. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"lanceol... |
PMC7039683 | The line is the median scoring SNP, the box contains the middle-scoring two quartiles, and the whisker represent the top and lower quartiles. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tok... |
PMC11657695 | To investigate whether KCNA2 overexpression in ES is linked to a key process in tumour development, we compared the RNA sequencing transcriptional profiles of the A-673 cell line transfected with a pool of five siRNA against KCNA2 (siRNA KCNA2) or with a control siRNA (siRNA CT, GSE246854). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellL... |
PMC11543885 | Different amounts of streptavidin beads (20, 60, 200 μL) were used for the pull-down experiments as indicated. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Different",
"amounts",
... |
PMC11791203 | To explore the potential involvement of apoptosis in cytotoxicity, in silico docking studies were performed on critical proteins, involved in apoptosis, such as Caspase-3, Caspase-9, Cox-2 and Bax. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11740399 | Annexin V/PI staining (E) supported combination therapy enhances the percentage of cell apoptosis. ( | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Annexin",
"V/PI",
"staining",
"(",
"E",
")",
"su... |
PMC9919300 | Hence, this study was designed to evaluate the first stage of NAFLD, which is NAFL in HepG2 cell lines, and its treatment with curcumin and andrographolide separately and in association. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9739791 | Conventional Pt(IV) prodrugs that are capable of activation under irradiation consist of a platinum core, its equatorial ligands, and axial ligands–light-sensitive small molecules. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC8343815 | The cytotoxicity of AuNRs and AuNPs on HeLa cells in the presence and absence of 6-MV X-ray was investigated using the MTT assay. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
... |
PMC11388384 | The microscope, cameras, and hardware were controlled through the NIS-Elements software (Nikon), and data were analyzed using Fiji, Trackmate, SaSpt, and ExTrack as required for the experiment (24, 37, 54–56). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9429973 | At a time when the importance of diversity and inclusivity are increasingly recognized in society, enhancing ethnic diversity in blood donors may reflect a positive force for healthcare and social equality. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC8316344 | Ferritin heavy chain 1 (FTH1) and ferritin light chain (FTL) are heavy and light chain of ferritin consisting 24 subunits, which is critical for iron storage . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11574029 | T24 and 5637 cells were infected with lentiviral solutions to establish stable NOTCH3 knockdown, SPP1 overexpression, and matched control cell lines. | [
{
"tags": [
"B-CellLine",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens"... |
PMC11803149 | Aged CD8 TCR-T cells are unable to accumulate efficiently in tumors and have higher tendency to become terminally exhausted T cells with lower expression of endothelial PAS domain-containing protein 1 (Epas1) compared to young cells. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC10656496 | Meaningful perturbations of these small populations are more difficult to investigate with typical clinical trial designs. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Meaningful",
"perturbations",
"of",
"these",
"small",
... |
PMC11786767 | B–D: Line scanning analysis reveals a change in biotin-DHPE distribution. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"B",
"–",
"D",
":",
"Line",
"scanning",
"analysis",
"reveals",
"a",
... |
PMC11754436 | Finally, the GSE126209 dataset was used to verify the change in expression of the aforementioned predicted target genes. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Finally",
",",
"the",
"GSE126209"... |
PMC11680982 | For 200 nM CDK4/6i + 100 nM ET: HER2-low vs. HER2-0, P = 0.003. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"For",
"200",
"nM",
"CDK4/6i",
"+",
... |
PMC9429973 | Updated data will be presented at the meeting. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Updated",
"data",
"will",
"be",
"presented",
"at",
"the",
"meeting",
"."
]
}
] |
PMC10578720 | The observed changes in other metabolites associated with glucose metabolism are shown in Supplemental Figure S6, http://links.lww.com/HC9/A588. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"observed",
"changes",
"in",
"ot... |
PMC11694346 | Fluorogenic techniques capitalize on the unique reactivity of biothiols with specific fluorogenic probes, resulting in enhanced fluorescence signals that enable sensitive and selective detection. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tok... |
PMC11363012 | High variability in the levels of all quantified compounds was observed in these cell populations from all five tissues. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"High",
"variability",
"in",
"the"... |
PMC10652261 | Carrot orange powder. | [
{
"tags": [
"O",
"O",
"O",
"O"
],
"tokens": [
"Carrot",
"orange",
"powder",
"."
]
}
] |
PMC11673128 | Conversely, the AS4 cell line, whose resistance against crizotinib is mediated by on-target mechanisms, failed to show evidence of CD47 upregulation (Figure 2B), whereas lorlatinib (100 nM) caused increased CD47 expression (Figure 2C). | [
{
"tags": [
"O",
"O",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9429973 | A systematic literature review of iMCD reported a three-fold increased prevalence of malignancy in iMCD patients (19%) compared to age-matched controls (6%). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11627060 | Upon the tracking dye (bromophenol blue) advancing 1 cm from the bottom end, the current is deactivated, the power supply is removed, and the gel is subsequently stained with 0.5 μg/mL ethidium bromide in sterile distilled water within a plastic tray for 30–45 min. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11470999 | Immunoblotting following biotin‐immunoprecipitation in B16 and A375 cells further confirmed the interaction between PF and CIP2A (Figure 3E). | [
{
"tags": [
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Immunoblotting",
... |
PMC11116779 | Sections were viewed and photographed in a 120 kV JEM-1400 Flash Transmission Electron Microscope (TEM) (Jeol Ltd., Tokyo, Japan) equipped with CMOS camera Matataki and TEM Center software (Jeol Ltd.) at a magnification ranging between 2,500 and 50,000×. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11643361 | Within the domain of metal complexes, some coordination compounds with the tri-dentate scorpionate ligand were found to exhibit interesting anticancer activity . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Within",
"th... |
PMC10507284 | Also, we observe that the individuals with TROAP overexpression mainly focus on several vital pathway components, such as cell cycle, DNA replication, and so on (Figure 4D). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC10165258 | Images without cells were acquired using a binocular microscope (Nikon SMZ18) with a digital single-lens reflex camera (D7000, Nikon). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
... |
PMC8193046 | In terms of retrospective molecular docking experiments, rare exceptions are ABCB5 , ABCB6 , or ABCC10 , . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"In",
"terms",
"of",
"retrospective",
"... |
PMC11787381 | The test is also widely used to assess anxiety like and exploratory behaviors. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"test",
"is",
"also",
"widely",
"used",
"to",
"assess",
"anxiet... |
PMC8735881 | We were intrigued to know the anti-HIV activity of the CMI constructs in terms of their dual-functional destinations. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"We",
"were",
"intrigued",
"to",
"know"... |
PMC11021472 | Next, we co-infected BL cells with the circZDHHC11 and the miR-150 overexpression vectors and analyzed potential effects on growth in a GFP competition assay. | [
{
"tags": [
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],... |
PMC11574029 | N Enrichment of NOTCH3 at two binding sites in the SPP1 promoter detected by ChIP-qPCR. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"N",
"Enrichment",
"of",
"NOTCH3",
"at",
"two",
"binding",
... |
PMC10728200 | Our data revealed that a single treatment with IM or RSL3 significantly inhibited the GIST cell activity (Fig. 5A). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Our",
"data",
"re... |
PMC9429973 | Fragment analysis was analyzed through Peak Scanner Software (Thermo Fisher). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Fragment",
"analysis",
"was",
"analyzed",
"through",
"Peak",
"Scanner",
"Software",
... |
PMC10988555 | The CoCp complexes 1–4 were obtained in moderate-high yields (54 to 78%), in the same order of magnitude as the analogous RuCp complexes with triphenylphosphane and bidentate N,N-heteroaromatic ligands. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC10582049 | For the analysis, we have used transcriptome profiling data obtained using bulk RNA sequencing. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"For",
"the",
"analysis",
",",
"we",
"have",
"used",
"... |
PMC11575040 | MicroRNAs (miRNAs) and long noncoding RNAs (lncRNAs) are non-protein-coding RNA molecules that play a key role in tumor development by interacting with cellular chromatins and proteins to regulate genes involved in cell proliferation, motility, invasiveness, and angiogenesis . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11655536 | CD138+ cells were selected and treated with HA at indicated concentration for 48 h. Cell viability was assessed with CCK-8 kit. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"CD138",
"+",... |
PMC10589262 | However, in GIST cells, 30N12 treatment did not change the phosphorylation levels of effector molecules, indicating that PM-localized MT-KIT was also insufficient to activate downstream signaling (Fig. 2B).Fig. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC8759873 | The molecular weight of the VHL protein is 28 -30 KD, including 213 amino acids, called p30 or pVHLL protein; the VHL gene can also encode a protein with a molecular weight of 19 KD, called pl9 or pVHLS protein. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11786704 | EDS spectrum showing the element distribution of C, O and Ca. ( | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"EDS",
"spectrum",
"showing",
"the",
"element",
"distribution",
"of",
"C",
... |
PMC9429973 | The intervention also included a preparatory course for the caregiver ambassadors and available support during the intervention. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"intervention",
"also",
"included",
"a",
... |
PMC10798140 | The percentage cell viability was calculated using the following equation. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"percentage",
"cell",
"viability",
"was",
"calculated",
"using",
"the",
"following",
"equa... |
PMC9429973 | The UK National Registry for chronic myeloid leukaemia (CML) patients (ptn) is a web-based PBCR, initially established as a regional registry in 2010, then expanded nationally in 2015. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9786247 | Bovine MDMs respond to C. burnetii infection with an early (3 h p.i.) | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Bovine",
"MDMs",
"respond",
"to",
"C.",
"burnetii",
"infect... |
PMC11655536 | We first verified the knockdown of TFE3 expression at the protein level. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"We",
"first",
"verified",
"the",
"knockdown",
"of",
"TFE3",
"expression",
"at",
... |
PMC8540692 | Animal studies showed that NaBu and other short chain fatty acids exert widespread influence on key neurological and behavioral processes and may be involved in critical phases of neurodevelopmental and neurodegenerative disorders . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC8978939 | Protein levels for both variants were significantly lower than those for VHL-WT-Venus ( Figure 1A ). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Protein",
"levels",
"for",
"both",
"variants",
"were",... |
PMC10758402 | DMF exerts inhibitory effects on the cellular response to type I IFN by, in part, reducing IFN production through the modulation of NFκB (27). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC6450504 | p < .05, ***p < .0005, ****p < .0001, two-way ANOVA with Tukey’s multiple comparisons test. ( | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9429973 | Image: Summary/Conclusion: Predicting VTE in hospitalized COVID-19 patients cannot be relied on pre-COVID era developed VTE risk scores. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Image",
":",
"Sum... |
PMC11766309 | A–L) YKT6 expression in various tumor stages in the indicated tumor types. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"A",
"–",
"L",
")",
"YKT6",
"expression",
"in",
"vario... |
PMC11015054 | m6A is a common modification of mRNA in eukaryotes, it has been shown that cancer progression is influenced by methylation of m6A, , and changes in RNA methylation are abnormal in a variety of malignant tumors, playing the key role in migration, invasion,regulating tumor immunosuppression, and chemotherapy resistance. , | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC8389560 | The concentration and purity of the total RNA were determined spectrophotometrically at 260/280 nm. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"concentration",
"and",
"purity",
"of",
"the",
"total",
"R... |
PMC8740518 | Animal experimentation was performed under project license (No. 2019-02-010) granted by the Institutional Animal Care and Ethics Committee of Zhejiang Cancer Hospital, in compliance with national or institutional guidelines for the care and use of animals. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9429973 | PRO instruments, including the EORTC QLQ-C30 (Global Health and Physical Functioning) and the EQ-5D-5L visual analog scale (VAS), were administered at baseline (prior to treatment), Day 50, Day 100, Day 150, and Month 9, then every 3 months up to 24 months or time of EFS event, whichever occurred first. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC5833712 | However, also other mechanisms may explain the dominant growth inhibitory effect of ERβ such as: formation of ERα:ERβ heterodimer in the presence of E2 and that ERβ dictates the activity of the heterodimer, competition with ERα for binding to sites on DNA within target genes or competition for interaction with coregulatory proteins (Fig. S5). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC6450504 | Cells were treated with the free drug, 0% and 0.5% PEIPOS at 2.5 nM of PTX concentration and incubated for 24 h continuously at 37 °C in complete media. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11806106 | Further, the properties of the agonist, like affinity to the receptor, and somehow efficacy for the receptor activation, determine the activation speed of the receptor. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC9429973 | pneumonias trains was 40%, while the proportion of Enterobacteriaceae strains, susceptible to extended-spectrum cephalosporins and carbapenems, reached only 8.8%. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
... |
PMC10329237 | The migration rate of A549 cells exposed to LOS (0.2 mM)+PFD and LOS (0.5 mM)+PFD was lower than those exposed to PFD alone. | [
{
"tags": [
"O",
"O",
"O",
"O",
"B-CellLine",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],... |
PMC8662250 | Cells were washed three times with phosphate‐buffered saline (PBS), detached with trypsin/ethylene diamine tetraacetic acid (EDTA), and dependently on the experiment plated in 6‐well plates, 96‐well plates, or 10 cm diameter Petri dish and allowed to adhere for further 24 h. The Caco‐2 cells were randomly divided into eight groups: 1) vehicle group, 2–4) 0.1, 1, 10 ng/ml SP group, 5–7) 10 ng/ml SP plus 10, 10, 10 M CBD, and 8) 10 ng/ml SP with 10 M CBD plus 9 nM GW9662 antagonist PPAR‐γ. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11765988 | HIV infection does increase the risk for HL, while the majority of the patients are also EBV positive . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"HIV",
"infection",
"does",
"incre... |
PMC11638255 | Quantifications were normalized using internal controls: ACTB (F: AGAAAATCTGGCACCACACC and R: AGAGGCGTACAGGGATAGCA) for ISG15 and S100A8, and GUSB (F: TGGTGCGTAGGGACAAGAAC and R: CCAAGGATTTGGTGTGAGCG) for MT1X. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11798926 | Lysates from two wells were combined for each replicate (1,000 μL total). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Lysates",
"from",
"two",
"wells",
"were",
"combined",
"for",
"ea... |
PMC11194678 | Cells were seeded on coverslips placed in 12-well plates. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Cells",
"were",
"seeded",
"on",
"coverslips",
"placed",
"in",
"12-well",
"plates",
"."
]
}
] |
PMC8358006 | h Gene ontology and pathway enrichment significance (−log10 (P value) values) are not correlated for GO terms shared between 1172 GSDs marked genes and 388 random selected genes. ( | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11574029 | From the TCGA database (https://tcga-data.nci.nih.gov/tcga/) and the GEO database (https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE37815,https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE13507), we downloaded the mRNA expression profiles of BLCA patients. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC7812570 | HEK293T cells were cotransfected with GPI-FluIgG03 or GPI-m36.4 and the HIV-1 provirus NL4-3 (left) or THRO.c/2626 (right). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
... |
PMC11488203 | Western blot analysis was performed as described elsewhere . | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Western",
"blot",
"analysis",
"was",
"performed",
"as",
"described",
"elsewhere",
"."
]
}
] |
PMC9895440 | 10 μg/ml human IgG1 or 10 μg/ml anti-CTLA4 blocking antibody (ipilimumab) was added. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"10",
"μg/ml",
"human",
"IgG1",
"or",
"10",
"μg/ml",
"... |
PMC11575040 | A Venn diagram depicting the identification process of miR-1270, which was found to interact with LINC00094 through TargetScan prediction and to be upregulated in cells with LINC00094 knockdown along with si-LINC00094-2 and si-LINC00094-3 transfection through small RNA profiling. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11585254 | For panels B and C, the EC50 and Emax values were analyzed by one-way ANOVA followed by Dunnett’s multiple comparison test. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"For",
... |
PMC11467800 | In conclusion, utilizing a zebrafish larval xenograft model, we demonstrated that phenotypically plastic cancer cells exhibit superior cellular dynamics compared to the cells they originate from. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC10810426 | At 2 and 4 hpi, CA was readily detected in the nuclear fractions (Fig 1A). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"At",
"2",
"and",
"4",
"hpi",
","... |
PMC11228511 | All primers used in the experiments are listed in SI Appendix, Table S2. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"All",
"primers",
"used",
"in",
"the",
"experiments",
"are",
"lis... |
PMC11799620 | The aqueous extract was kept at −20°C until use. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"aqueous",
"extract",
"was",
"kept",
"at",
"−20",
"°",
"C",
"until",
"use... |
PMC9429973 | Virological data was obtained by nasopharyngeal swabs, which were collected routinely, then Sanger sequencing of the hemagglutinin gene was performed for phylogenetic and mutational analysis. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11224020 | N = 2, n = 6) and were analyzed by ordinary one-way ANOVA; ****P < 0.0001. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"N",
... |
PMC11775197 | Binding of PPARs to ligands prompts binding to co-repressor proteins and heterodimerization with the retinoic acid X receptor. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Binding",
"of",
"PPARs",
"to",
"ligand... |
PMC11388384 | Sender and receiver cell lines were built as described previously (16). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Sender",
"and",
"receiver",
"cell",
"lines",
"were",
"built",
"as",
"... |
PMC11394730 | The primary cause of QUE’s anti-proliferation effect was cell cycle arrest in the G1 phase despite a low QUE dose with a slight cytotoxic effect. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
... |
PMC10957991 | Further, TRPV4-mediated calcium influx seems to be essential for the integrity of cell–cell junctions in the skin keratinocytes. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Further",
",",
"T... |
PMC6600592 | H NMR and C NMR spectra were recorded on Bruker AVANCE III HD600 (H/C, 600MHz/150MHz) spectrometer (Bruker, Bremerhaven, Germany) using TMS as an internal standard. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11792766 | The slides were imaged at 10× magnification using BioTek's Cytation 3 Cell Imaging Multi‐Mode Reader. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"The",
"slides",
"were",
"imaged",
"at",
"10... |
PMC11742431 | Analysis of PD‐L1, Furin, and Survivin expression levels. ( | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Analysis",
"of",
"PD‐L1",
",",
"Furin",
",",
"and",
"Survivin",
"expression",
"levels... |
PMC9429973 | Moreover, our data suggest that CD200 expression had no significant effect on lymphocyte subsets in patients. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Moreover",
",",
"our",
"data",
"suggest",
"... |
PMC4360730 | These relationships are either explicit or inferred. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"These",
"relationships",
"are",
"either",
"explicit",
"or",
"inferred",
"."
]
}
] |
PMC11779605 | Bemarituzumab (humanized monoclonal antibody against FGFR2-IIIb) is approved for FGFR2-IIIb-overexpressing and HER2-negative metastatic and locally advanced gastric and gastroesophageal adenocarcinoma in combination with modified FOLFOX6 (fluoropyrimidine, leucovorin, and oxaliplatin) based on the FIGHT trial (35). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11190062 | Cells were washed twice in flow buffer and analyzed using LSR II (BD Biosciences) and FACS Diva software (BD Biosciences). | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
... |
PMC11564322 | p < 0.05, ###p < 0.001 vs. the respective peptide alone mRNA expression of mTOR and cMYC genes in the leukemia cell lines. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC11297139 | As EWS/FLI1 is a major driver oncogene in Ewing’s sarcoma, we further examined whether ARID1A LLPS-dependent upregulated cREs are co-localized with EWS/FLI1 nucleation sites in Ewing’s sarcoma. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
... |
PMC10114490 | White bar equals 75 μm. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"White",
"bar",
"equals",
"75",
"μm",
"."
]
}
] |
PMC10818573 | Therefore, we introduced a labeled probe in addition to the normal RPA assay, and only the reverse primer was labeled. | [
{
"tags": [
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O",
"O"
],
"tokens": [
"Therefore",
... |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.