Datasets:
OTAR3088
/
BioData-CellLine_annotated

Dataset card Data Studio Files
xet
Community
1
PMCID
string
Sentences
string
ner
list
PMC10253973
For this reason, the most popular method of studying receptor–ligand interactions remains rooted in molecular mechanics (MM) based on classical mechanics and molecular docking .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11476106
Tables S6 and S7 show comparison of circularity of PDX73 clusters between cluster size categories in each 3D culture condition.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Tables", "S6", "and", ...
PMC11521786
C57BL/6 mice were immunized with HER3-ECD (200 μg) adjuvanted in VSSP (200 μg)/Montanide (intramuscularly (im.), 50 μL).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ...
PMC11725127
The random seed was explicitly set to 0.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "random", "seed", "was", "explicitly", "set", "to", "0", "." ] } ]
PMC9429973
Summary/Conclusion: Taken together, we established a highly clinically relevant PDX in vivo model of acquired resistance to conventional chemotherapy.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Summary/Conclusion", ":...
PMC11637820
Swabs from the deeper portion of the DFU were collected and directly inoculated into sterile culture tubes containing 5 ml of LB broth.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Swabs",...
PMC9429973
Results: Circulating PLT counts and percent CD41 BM cells were elevated >2-fold relative to vehicle 12 hrs post-RKER-050 treatment.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Results", ":", "C...
PMC10975211
Given the therapeutic potential and action mechanisms of buforin IIb against a broad spectrum of microorganisms, the possibility of developing resistance through target modification is unlikely .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9429973
Results: Monocytosis was observed in 4,6 % of CBCs.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Results", ":", "Monocytosis", "was", "observed", "in", "4,6", "%", "of", "CBCs", "." ]...
PMC9429973
D. Rochate, F. Vasconcelos, E. Couto, P. Silva Coelho, L. Leite, R. Branca, S. Roncón, C. Pinho Vaz, A. Campos Bone Marrow Transplantation Service; Cellular Therapy Service, Instituto Português de Oncologia do Porto IPO Porto, Porto, Portugal Background: Allogeneic hematopoietic stem cell transplantation (alloHSCT) is a therapeutic option with curative intent in hematological malignancies.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11787651
C, average points across the peak for histone peptides in each of the three biological replicates by each method.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "C", ",", "average", "p...
PMC9927933
The cBioPortal database (https://www.cbioportal.org/) was used to analyze the gene changes in lung cancer samples.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "cBioPortal", "database", "(", "https://www...
PMC9429973
The most routine first-line treatments are glucocorticoid and IVIG, while patients with severe refractory ITP are often resistant to glucocorticoid or IVIG treatment and respond to TPO-RAs.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11078693
Resuspend the cell pellet into 20 mL fresh media (e.g., RPMI 1640) and transfer back into the original T75 cell culture flask after aspirating off the PBS.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9429973
Transgenic SMARCA4 knockout mice showed significantly lower leukocyte, reticulocyte, and thrombocyte counts and showed lower colony forming capacity compared to Cre-negative control mice.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tok...
PMC7338939
Then the obtained samples were fixed in paraffin 10% and subjected to pathological evaluation and H&E staining.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Then", "the", "obtained", "samples", "...
PMC7961460
For proteomic analysis 8701-BC cells were grown with no serum supplementation.
[ { "tags": [ "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "For", "proteomic", "analysis", "8701-BC", "cells", "were", "grown", "with", "no", ...
PMC11704834
The human LUAD cell line A549 (cat.
[ { "tags": [ "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O" ], "tokens": [ "The", "human", "LUAD", "cell", "line", "A549", "(", "cat", "." ] } ]
PMC11696576
c Viability of healthy T-cells measured by propidium iodide (PI) exclusion.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "c", "Viability", "of", "healthy", "T-cells", "measured", "by", "propidium",...
PMC9780037
On the other hand, electrostatic adsorption of cyt c on DNA induced self-aggregation of the protein .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "On", "the", "other", "hand", ",", "electros...
PMC9583612
SeekOps reported emissions by equipment group in basins A and B. In basin C, SeekOps was unable to measure at the equipment-level due to the operator’s safety policy that sets flight distance restrictions for their drones.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11225860
Fig 1 Alisertib induced polyploidization in Diffuse Large B Cell Lymphoma.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Fig", "1", "Alisertib", "induced", "polyploidization", "in", "Diffuse", "Large", "B", ...
PMC10874773
while at 1 mg/kg, both compounds induced hypothermia (ΔTmax 4.5 ℃, P < 0.001) but no convulsions (Okuyama, Nakamura, & Yamazaki, 1993).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC6034753
Finally, after washing, cells were stained (10 min, RT) with DAPI (1:10000) and viewed by using a Leica (Wetzlar, Germany) TCS SP2 confocal laser-scanning microscope.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11806613
Right, graph showing the changes in CD44 + CD24- and CD44 + CD24 + populations upon OST-01 treatment.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Right", ",", "graph", "showing", ...
PMC8164677
Dose-dependent growth inhibition was evident in all cases except at lowest concentration in the case of both drugs.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Dose-dependent", "growth", "inhibition", "wa...
PMC10761218
The authentication of W. somnifera was carried out by Dr. A. Vijaya Bhaskar Reddy, Botany Department, Osmania University, Hyderabad.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "authe...
PMC11564405
Similarly, CD8 + T cell infiltration density was stratified into low-density (≤ 134 cells/mm) and high-density (> 134 cells/mm) groups.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tok...
PMC9429973
Pelabresib as monotherapy and in combination with RUX led to a significant reduction of MK-, neutrophilic and erythroid progenitors as compared with BL in all pts analyzed.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9429973
Similarly, combination of Ola with ZnSO4 induced G0/G1 arrest in HEL cells (p<0.05).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O" ], "tokens": [ "Similarly", ",", "combination", "of", "Ola", ...
PMC6617630
The median overall survival of patients with DHL/THL DLBCLs treated with R-CHOP has been reported to be 5 to 24 months , and there is an unmet need for alternative therapeutic strategies for this subgroup.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11380329
Cytoscape software was used to analyze and edit the molecular networks.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Cytoscape", "software", "was", "used", "to", "analyze", "and", "edit", "the", "molecu...
PMC11345828
E. Tabulation of dose, AUC, tumor growth inhibition (TGI), and tumor regression.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "E.", "Tabulation", "of", "dose", ",", "AUC"...
PMC3730428
Sub G0/G1 populations were determined using propidium iodide staining (Sigma-Aldrich, Gillingham, UK) as previously described.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Sub", "G0/G1", "populations", "we...
PMC11001582
The top enriched gene sets included all had normalized enrichment score > 0.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "top", "enriched", "gene", "sets", "included", "all", "had", "n...
PMC11367146
The RMSF plot indicates that the docked complex of BCL2 is more stable than undocked protein (Fig. 5D).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "RMSF", "plot", ...
PMC3203927
The permutation method was used to determine whether cytokines as a group was significantly regulated by culture conditions (i.e. 2D and 3D).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ ...
PMC6312945
The aim of the study was to investigate the effects of miRNA-101 and miRNA-345 on HBV replication and liver cancer cell growth.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "aim",...
PMC9429973
Patients filled out RAND SF-36 and FACT-Th6 questionnaires for QoL assessment and FACIT-Fatigue tool for fatigue assessment at baseline and at 3, 6 and 12 months after romiplostim treatment start.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11127909
Thirty-two OS samples were collected from OS patients who underwent chemotherapy (AP, 25 mg/m doxorubicin, 100 mg/m cisplatin) at the Eighth Affiliated Hospital, Sun Yat-sen University, Guangdong, China.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11739504
These findings demonstrate that Kat2b localizes to the cytosol, centrosomes, and basal body during ciliogenesis, suggesting that it plays a potential role in primary cilia formation.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC4485786
Tumor sizes in mm are given as mean ± SD of 7 mice/group with short-term treatment (5 weeks). (
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Tumor", "sizes", ...
PMC8469018
Moreover, the production of ATP, glutathione, as well as NADH and NADPH are disrupted and transformed into oxidized forms and ROS are produced in excess during apoptosis .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9856122
Nineteen aporphine alkaloids were also investigated on Vero cells of monkey kidneys against HSV, and results indicated the selection of three alkaloids namely oliverine HCl, pachystaudine, and oxostephanine as potent inhibitors of HSV .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11247842
NA means the variant is not significant in our analyses Linkage disequilibrium between copy number variants in the GC gene and their flanking variants The LD between tagging SNPs for the GC copy number variant (CNV) reported by Lee et al. and the lead SNPs from the current study with the CNV in Nordic Holstein cattle. “
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11730320
TRG and TRD gene rearrangements initiate at an earlier stage than TRB, with developmental stage-specific enhancers for TRG and TRD activating germline transcription and gene recombination.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11394227
The ER-Tracker Red or Golgi-Tracker Red staining solution was removed by centrifugation at 300× g for 5 min, and the cells were washed with PBS solution twice.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9503685
After the A549 cell line was infected with P. aeruginosa, the effect of antimicrobials on intracellular bacteria as well as the effects in inhibiting the adhesion of P. aeruginosa were investigated.
[ { "tags": [ "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC8750422
Studies have reported that NO is associated with angiogenesis, apoptosis, invasiveness, and metastasis in many carcinomas .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Studies", "have", "reported", "th...
PMC11640476
Estimations for LoB, LoD, and LoQ were based on data derived from the calibration curve “very low confluency” (3.5 × 10–1.8 × 10 cells/cm) after a 4 h incubation.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11413393
We show that MS023 administration and PRMT1 inhibition result in widespread loss of aDMA species including the histone mark H4R3me2a.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "We", "show", "that", "...
PMC11775197
The mechanisms and functions of PPARs in cancer have been extensively studied.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "mechanisms", "and", "functions", "of", "PPARs", "in", "cancer", "have", ...
PMC9429973
Traditional [mean corpuscular volume (MCV), mean corpuscular hemoglobin (MCH), mean corpuscular hemoglobin concentration (MCHC), red blood cell count (RBC), and red cell distribution volume (%RDW)] and new red cell parameters [percentage hypochromic RBCs (%Hypo-He); percentage microcytic RBCs (%Micro-R)] were measured in a Sysmex-XN2000 (Sysmex Corporation, Kobe, Japan), along with iron parameters.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC8633974
All cells were grown in plate format at 37 °C in a 5% CO2 incubator.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "All", "cells", "were", "grown", "in", "plat...
PMC11055443
The findings of the present study showed that the supernatant of MSCs can reduce V. cholerae attachment to the Caco-2 epithelial cell surface by up to 60%.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", ...
PMC9429973
A review of safety data from the nonrandomized safety run-in (Part 1), comparing the safety of Lonca-R to previous Lonca safety data, was completed in January 2022.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC10955424
The IL-6/JAK/STAT3 axis is well known to promote chemoresistance in several cancer types , , .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "IL-6/JAK/STAT3", "axis", "is", "well", "known", "to"...
PMC10631132
Cells with a stellar-like cell morphology can be seen in the fibroblast-derived iPSC MB differentiation group (empty arrows in H).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Cells", "wit...
PMC11720107
Our study is the first that tried to correlate the polyphenolic content of garlic with changes in PPARγ protein expression.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Our", "study", "is", "...
PMC11609529
Further characterization of the functional domains of MAML2 with respect to their ability to form nuclear condensates, transcriptional activation activity, and tumorigenic potential is warranted.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11786767
The original regions of the enlarged images are indicated only in the rightmost panels.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "original", "regions", "of", "the", "enlarged", "images", ...
PMC6901583
b ELISA of CCL2 expression in the GIST882 and GIST-T1 cells stably expressing shcon or shBRD4.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "b", "ELISA", "of", "CCL2", "expression", ...
PMC11792740
Enhancing positive cytokine pathways, such as IL-2/STAT5, while inhibiting negative pathways mediated by TGF-β and IL-10, can rejuvenate exhausted T cells and restore their antitumor functions.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11672617
The CC50 value, which characterizes the cytotoxicity parameters (i.e., the concentration of the compound required for 50% inhibition of cell viability in vitro), was calculated, a logC vs. % inhibition plot was generated, and the data were statistically processed using Excel and GraphPad Prism v.8.0.2 (San Diego, CA, USA, 2019).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11380329
Three different kinds of P were used in this study: raw Egy P was obtained from the Apiary of Department of Bee Research, Plant Protection Research Institute, Agricultural Research Agriculture Research Center at Dokki, Giza, Egypt.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11575040
To determine the expression levels of lncRNAs by using a PCR thermocycler, the following PCR procedure was adopted: 94 °C for 10 min followed by 35 cycles at 94 °C for 1 min, 60 °C for 1 min, and 72 °C for 30 s, with a final extension at 72 °C for 10 min.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11544771
A level of p < 0.05 was considered statistically significant.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "A", "level", "of", "p", "<", "0.05", "was", "considered", "statistically", "significant", ...
PMC7709199
The medium was then exchanged to serum-free DMEM supplemented with 3.6 mM VPA and the cells were transfected by adding DNA:PEI complexes in a 1:1.5 ratio.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11574271
Conversely, inhibition by BMS-777607 of RON activity in J82-oeRON cells results in a downregulation of MMP12 expression (Fig. S1B), which was associated with diminished cell migration and invasion.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11684821
None of the cancer-reactive TCRs tested reacted toward MAIT ligand precursor 5-A-RU (10 μg/mL), whereas the MAIT cell TCR A-F7 in the same assay showed robust recognition of 5-A-RU (Figure 5G).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11746948
A substantial body of research has established a robust link between ferroptosis and a wide spectrum of diseases, including cancer, immunological disorders, neurodegenerative conditions, stroke, and damage to multiple organs.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11541241
TOR played a negative role in regulating cucumber resistance to pathogens.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "TOR", "played", "a", "negative", "role", "in", "regulating", "cucumber", "resistance", ...
PMC6799808
To better evaluate the antitumor activity of G. lucidum, we employed ReishiMax (GLPT), a G. lucidum extract containing 13.5% polysaccharides and 6% triterpenes .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC10809689
Nowadays, MBG453 is the only monoclonal antibody that has demonstrated efficacy and early safety for myelodysplastic syndromes (MDS) and AML in clinical studies .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ...
PMC11594806
It is commonly used to treat OS, particularly in sarcomas.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "It", "is", "commonly", "used", "to", "treat", "OS", ",", "particularly", "in", ...
PMC11588008
Extracellular vesicles are extracellular microtubules that can achieve intercellular dialog through endocytosis and transport proteins, nucleic acids, and other active substances.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Extrace...
PMC11707832
Furthermore, the correlation between MAN2B1 and tumour-associated macrophages indicates possible involvement of MAN2B1 in shaping the tumour microenvironment.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Furthermore", ",", "the", "correl...
PMC10729469
L23105, Thermo Fisher Scientific) followed by MHCII-IA–KLVFFAEDVGSNKGA Aβ tetramer (6 µg) or MHCII-IA–PVSKMRMATPLLMQA control tetramer (6 µg) for 3 h at 37 °C.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11244823
While no anamnestic data were available for the Icelandic horse sera, various parameters were known for the Swiss horse sera.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "While", "no", "an...
PMC11487720
Accordingly, WWOX/TRAF2/p53 is a temperature-sensitive molecular switch controlling the transition between BCD and apoptosis—treatment of localized skin cancer with liquid nitrogen results in downregulating TRAF2 but upregulating WWOX .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC9429973
Interestingly, increased TPO induced HSPC cycling was confined to the Evi1high cell population (n=3, p<0.05).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Interestingly", ",", "increased", ...
PMC6835428
Dispersed on the peritoneum surface are lymphatic lacunae, lined by endothelial cells.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Dispersed", "on", "the", "peritoneum", "surface", "are", "lymphatic", "lacu...
PMC11486946
Shaded areas (d, e, and g) and error bars (f) indicate the SD and SE around the mean, respectively.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ...
PMC7762347
Nowadays blooming of cyanobacteria is increasing all over the world due to anthropogenic activities and climate changes .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Nowadays", "blooming", "of", "cyanobacteria", "is...
PMC8526701
H Indicated cell lines were treated increasing concentration of GSK602 for 24 h. Cleaved PARP and caspase 3 level was analyzed by western blotting.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ ...
PMC9429973
KEGG enrichment analysis revealed that the IL-17 signaling pathway was closely associated with baicalin intervention for aGVHD (Fig 3B).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "KEGG", "enrichment", ...
PMC5173112
For the non-specific IL-8 promoter fragment (nucleotides +2976 to +3132), primers were CAGCCAAAACTCCACAGTCA and TTTGGAGAGCACATAAAAACATC.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "For", "the", "non-specific",...
PMC7215722
We therefore investigated the status of LR under ER stress conditions upon DSS treatment.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "We", "therefore", "investigated", "the", "status", "of", "LR", "...
PMC9545474
Cells were routinely maintained as monolayer cultures in RPMI 1640 medium supplemented with 10 % foetal calf serum, penicillin (100 I.U./mL) and streptomycin (100 μg/mL), sodium pyruvate (1 mM) and L‐glutamine (2 mM).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11756514
Preparation of full-length SP-D was performed as described (34).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Preparation", "of", "full-length", "SP-D", "was", "performed", "as", "described", "(", ...
PMC11592837
Two more washing steps with ice-cold PBS and subsequent blocking with 1% bovine serum albumin (BSA) in PBS followed.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Two", "more"...
PMC11796104
The study participants included 21 patients diagnosed with osteoporosis and 14 control individuals with normal bone mass density.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "study", "participants", "included", ...
PMC5925824
Immature dendritic cells (DCs) were generated by culturing these monocytes in complete RPMI-1640 medium containing 10% FBS in the presence of 1000 IU/ml hGM-CSF and 500 IU/ml hIL-4 for 4 days.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC11638255
Remarkably, the combination group exhibited exceptional tumor control, alluding to the TETA-mediated reinvigoration of effector functions associated with an anti-tumor immune response.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ ...
PMC11656380
This suggests that RAM13 could be a basis for developing peptide-based inhibitors targeting specific protein–protein interactions in NOTCH1 signaling.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "This", "suggests", ...
PMC11488203
Alltogether, these data demonstrated that up-regulation of various miRs in EVs/exosomes of taxol-treated MSC can be associated predominantly with tumor-suppressive effects whilst down-modulated miRs can exhibit multiple effects.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC6461034
Higher INKA scores clearly correlate with lower P‐values (Appendix Fig S6).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Higher", "INKA", "scores", "clearly", "correlate", "with", "lower", "P‐valu...
PMC11128598
Cancer cell lines were treated with the different drugs for 72 h then stained with FITC Apoptosis Detection Kit CE (Immunostep, Salamanca, Spain) according to the manufacturer’s guidelines.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...
PMC8481254
When mice were injected with CA, the dose of CA was 10 mg/kg/day.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "When", "mice", "were", "injected", "with", "CA", ",", "the", ...
PMC11718817
After 24 h of myeloid–spheroid coculture, 1.2 × 10 WT or Il18r CTLs were carefully added to the spheroids on top of the dish.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", ...