Datasets:
OTAR3088
/
BioData-CellLine_annotated

Dataset card Data Studio Files
xet
Community
1
PMCID
string
Sentences
string
ner
list
PMC10530622
Oxalate is the ionized form of oxalic acid, can reach systemic circulation through the diet or endogenous metabolism and is a metabolic end-product .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Oxalate", "is", "the", "ionized", "form", "of", "oxalic", "acid", ",", "can", "reach", "systemic", "circulation", "through", "the", "diet", "or", "endogenous", "metabolism", "and", "is", "a", "metabolic", "end-product", "." ] } ]
PMC9780037
In the cytoplasm of cancer cells, cyt c release induces apoptosis.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "In", "the", "cytoplasm", "of", "cancer", "cells", ",", "cyt", "c", "release", "induces", "apoptosis", "." ] } ]
PMC11066331
3 Representative mass spectra of SKOV3scrambled shRNA and SKOV3TUSC3 shRNA cells.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O" ], "tokens": [ "3", "Representative", "mass", "spectra", "of", "SKOV3scrambled", "shRNA", "and", "SKOV3TUSC3", "shRNA", "cells", "." ] } ]
PMC9884169
Knockout of MCT4 leads to the accumulation of intracellular lactic acid, causing excessive intracellular production of ROS .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Knockout", "of", "MCT4", "leads", "to", "the", "accumulation", "of", "intracellular", "lactic", "acid", ",", "causing", "excessive", "intracellular", "production", "of", "ROS", "." ] } ]
PMC9429973
ISS was equally distributed, and all patients hadpreviously been treated with bortezomib and IMIDs, and were refractory to this agents.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "ISS", "was", "equally", "distributed", ",", "and", "all", "patients", "hadpreviously", "been", "treated", "with", "bortezomib", "and", "IMIDs", ",", "and", "were", "refractory", "to", "this", "agents", "." ] } ]
PMC7642379
Gene expression validation of the 38 previously identified differentially expressed genes in 63 human cell lines, identified nine significantly differentially expressed genes between suspension and adherent cell lines. (
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Gene", "expression", "validation", "of", "the", "38", "previously", "identified", "differentially", "expressed", "genes", "in", "63", "human", "cell", "lines", ",", "identified", "nine", "significantly", "differentially", "expressed", "genes", "between", "suspension", "and", "adherent", "cell", "lines", ".", "(" ] } ]
PMC9596868
Data from Fig. 2 and supplementary Fig. 2A–D was analysed in the CompuSyn software, which calculated the combination index (CI) to determine synergism (CI < 1), antagonism (CI > 1) or additive effect (CI = 1) of drug combinations.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Data", "from", "Fig.", "2", "and", "supplementary", "Fig.", "2A", "–", "D", "was", "analysed", "in", "the", "CompuSyn", "software", ",", "which", "calculated", "the", "combination", "index", "(", "CI", ")", "to", "determine", "synergism", "(", "CI", "<", "1", ")", ",", "antagonism", "(", "CI", ">", "1", ")", "or", "additive", "effect", "(", "CI", "=", "1", ")", "of", "drug", "combinations", "." ] } ]
PMC8633974
Maxiprep purified plasmids were transfected into HEK293FT cells using PEI or into ACH2 / U1 leukocytes via TransIT-Jurkat reagent (MirusBio #2120) or TransIT-X2 reagent (MirusBio #6000).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "B-CellLine", "I-CellLine", "I-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Maxiprep", "purified", "plasmids", "were", "transfected", "into", "HEK293FT", "cells", "using", "PEI", "or", "into", "ACH2", "/", "U1", "leukocytes", "via", "TransIT-Jurkat", "reagent", "(", "MirusBio", "#", "2120", ")", "or", "TransIT-X2", "reagent", "(", "MirusBio", "#", "6000", ")", "." ] } ]
PMC9509578
Their results demonstrated the enhanced delivery of a nanoformulation into tumor cells and inhibition of Bcl-2 expression and Notch-1 signaling pathways in human breast cancer MDA-MB-231 cells and in nude BALB/c mice .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "B-CellLine", "O", "O" ], "tokens": [ "Their", "results", "demonstrated", "the", "enhanced", "delivery", "of", "a", "nanoformulation", "into", "tumor", "cells", "and", "inhibition", "of", "Bcl-2", "expression", "and", "Notch-1", "signaling", "pathways", "in", "human", "breast", "cancer", "MDA-MB-231", "cells", "and", "in", "nude", "BALB/c", "mice", "." ] } ]
PMC10317042
Although vorinostat treatment reduced the enrichment of H3K27ac and H3K9ac at the EWSR1 promoter region, a moderate decline in ATAC-seq was observed in the region (Fig. 3C).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Although", "vorinostat", "treatment", "reduced", "the", "enrichment", "of", "H3K27ac", "and", "H3K9ac", "at", "the", "EWSR1", "promoter", "region", ",", "a", "moderate", "decline", "in", "ATAC-seq", "was", "observed", "in", "the", "region", "(", "Fig.", "3C", ")", "." ] } ]
PMC11126803
Experiments were performed in triplicate and at least three repetitions.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Experiments", "were", "performed", "in", "triplicate", "and", "at", "least", "three", "repetitions", "." ] } ]
PMC11365983
Additional details provided in Supplemental methods.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Additional", "details", "provided", "in", "Supplemental", "methods", "." ] } ]
PMC9429973
Recently, attention has been drawn to the composition of platelet glycome in etiopathogenesis of ITP.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Recently", ",", "attention", "has", "been", "drawn", "to", "the", "composition", "of", "platelet", "glycome", "in", "etiopathogenesis", "of", "ITP", "." ] } ]
PMC9429973
T.-D. Tan, L.-W. Chiou Hematology and Medical Oncology, Koo Foundation Sun Yat-Sen Cancer Center, Taipei, Taiwan Background: Hematopoietic stem cell transplantation is a curative treatment for a variety of hematologic malignancies and some benign hematologic diseases.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "T.-D.", "Tan", ",", "L.-W.", "Chiou", "Hematology", "and", "Medical", "Oncology", ",", "Koo", "Foundation", "Sun", "Yat-Sen", "Cancer", "Center", ",", "Taipei", ",", "Taiwan", "Background", ":", "Hematopoietic", "stem", "cell", "transplantation", "is", "a", "curative", "treatment", "for", "a", "variety", "of", "hematologic", "malignancies", "and", "some", "benign", "hematologic", "diseases", "." ] } ]
PMC10933092
mRNAs with decreased mA methylation after TRMT61A knockdown were mostly enriched in cellular processes and binding functions, such as RNA and/or protein binding (Figure 5A and Supplementary Table S4).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "mRNAs", "with", "decreased", "mA", "methylation", "after", "TRMT61A", "knockdown", "were", "mostly", "enriched", "in", "cellular", "processes", "and", "binding", "functions", ",", "such", "as", "RNA", "and/or", "protein", "binding", "(", "Figure", "5A", "and", "Supplementary", "Table", "S4", ")", "." ] } ]
PMC10669966
To discover LPS-subtype-specific therapy targets, we investigated RNA sequenced transcriptomes of 131 clinical LPS tissue samples and compared the data with a transcriptome database that contained 20,218 samples from 95 healthy tissues and 106 cancerous tissue types.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "To", "discover", "LPS-subtype-specific", "therapy", "targets", ",", "we", "investigated", "RNA", "sequenced", "transcriptomes", "of", "131", "clinical", "LPS", "tissue", "samples", "and", "compared", "the", "data", "with", "a", "transcriptome", "database", "that", "contained", "20,218", "samples", "from", "95", "healthy", "tissues", "and", "106", "cancerous", "tissue", "types", "." ] } ]
PMC11731614
Further studies are necessary to understand how these microRNAs modulate target proteins and pathways, either directly or indirectly.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Further", "studies", "are", "necessary", "to", "understand", "how", "these", "microRNAs", "modulate", "target", "proteins", "and", "pathways", ",", "either", "directly", "or", "indirectly", "." ] } ]
PMC6450504
Regardless of the surface modification with bPEI and the initial zeta potential (ZP) values before serum incubation, the ZP of all samples decreased to a value of approximately −5 mV (Figure 1(a)).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Regardless", "of", "the", "surface", "modification", "with", "bPEI", "and", "the", "initial", "zeta", "potential", "(", "ZP", ")", "values", "before", "serum", "incubation", ",", "the", "ZP", "of", "all", "samples", "decreased", "to", "a", "value", "of", "approximately", "−5", "mV", "(", "Figure", "1(a", ")", ")", "." ] } ]
PMC11548041
The anti-tumor effects of aptamer-directed therapies have been reported in several pre-clinical studies.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "anti-tumor", "effects", "of", "aptamer-directed", "therapies", "have", "been", "reported", "in", "several", "pre-clinical", "studies", "." ] } ]
PMC10170482
The mRNA levels of MT-CO1 in 12 HCC tissues and paired adjacent normal tissues around were detected by qPCR.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "mRNA", "levels", "of", "MT-CO1", "in", "12", "HCC", "tissues", "and", "paired", "adjacent", "normal", "tissues", "around", "were", "detected", "by", "qPCR", "." ] } ]
PMC7192625
On the contrary, H3K9me3, followed by active chromatin marks, displayed strong assortativities.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "On", "the", "contrary", ",", "H3K9me3", ",", "followed", "by", "active", "chromatin", "marks", ",", "displayed", "strong", "assortativities", "." ] } ]
PMC11001582
Monthly body weight measurements showed no difference between (GR)400, (PR)400, eGFP and WT mice over the course of the first year of life (Fig. 4a and Extended Data Figs. 5a and 6a).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Monthly", "body", "weight", "measurements", "showed", "no", "difference", "between", "(GR)400", ",", "(PR)400", ",", "eGFP", "and", "WT", "mice", "over", "the", "course", "of", "the", "first", "year", "of", "life", "(", "Fig.", "4a", "and", "Extended", "Data", "Figs.", "5a", "and", "6a", ")", "." ] } ]
PMC11566417
Highlighted GO:BPs are described in Table 4 and include: 1—cytoskeleton organization, 2—cell junction organization, 3—animal organ development, 4—supramolecular fiber organization, and 5—regulation of cell motility To compile and analyze the data from mass spectrometry across the 4 different CM samples, GO-term enrichment was performed.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Highlighted", "GO", ":", "BPs", "are", "described", "in", "Table", "4", "and", "include", ":", "1—cytoskeleton", "organization", ",", "2—cell", "junction", "organization", ",", "3—animal", "organ", "development", ",", "4—supramolecular", "fiber", "organization", ",", "and", "5—regulation", "of", "cell", "motility", "To", "compile", "and", "analyze", "the", "data", "from", "mass", "spectrometry", "across", "the", "4", "different", "CM", "samples", ",", "GO-term", "enrichment", "was", "performed", "." ] } ]
PMC9250505
Histological analyses were performed as previously described.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Histological", "analyses", "were", "performed", "as", "previously", "described", "." ] } ]
PMC10669966
Gene annotation was retrieved from AnnotationHub (snapshotDate: 20 October 2021).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Gene", "annotation", "was", "retrieved", "from", "AnnotationHub", "(", "snapshotDate", ":", "20", "October", "2021", ")", "." ] } ]
PMC9429973
By 10 years, the percentage of CLL patients who transformed in the non-ibr group is 17%, while for the Ibr group is 2% (p = 0.012).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "By", "10", "years", ",", "the", "percentage", "of", "CLL", "patients", "who", "transformed", "in", "the", "non-ibr", "group", "is", "17", "%", ",", "while", "for", "the", "Ibr", "group", "is", "2", "%", "(", "p", "=", "0.012", ")", "." ] } ]
PMC7812570
The expression of CD4, CCR5 or CXCR4 on the surface of TZM-bl cells transduced with a GPI-anchored scFv or m36.4 was detected with a PE-conjugated anti-human CD4 (black), CCR5 (blue), or CXCR4 (cyan) antibody and analyzed by FACS analysis.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "expression", "of", "CD4", ",", "CCR5", "or", "CXCR4", "on", "the", "surface", "of", "TZM-bl", "cells", "transduced", "with", "a", "GPI-anchored", "scFv", "or", "m36.4", "was", "detected", "with", "a", "PE-conjugated", "anti-human", "CD4", "(", "black", ")", ",", "CCR5", "(", "blue", ")", ",", "or", "CXCR4", "(", "cyan", ")", "antibody", "and", "analyzed", "by", "FACS", "analysis", "." ] } ]
PMC11190062
MYC, IRF4, NFKB, and BCL2 were further upregulated at the protein level in response to LPS and CpG ( Figure 2D ).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "MYC", ",", "IRF4", ",", "NFKB", ",", "and", "BCL2", "were", "further", "upregulated", "at", "the", "protein", "level", "in", "response", "to", "LPS", "and", "CpG", "(", "Figure", "2D", ")", "." ] } ]
PMC9019892
While side effects were seen with these drugs, including intracranial haemorrhage, severe headache and risk in secondary tumour induction .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "While", "side", "effects", "were", "seen", "with", "these", "drugs", ",", "including", "intracranial", "haemorrhage", ",", "severe", "headache", "and", "risk", "in", "secondary", "tumour", "induction", "." ] } ]
PMC11351758
A deficiency of mitochondrial protein synthesis has been observed in the drosophila mutant tko25t, characterized by respiratory and oxidative phosphorylation defects that lead to developmental delay and sensitivity to seizures as a result of mechanical stress.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "A", "deficiency", "of", "mitochondrial", "protein", "synthesis", "has", "been", "observed", "in", "the", "drosophila", "mutant", "tko25", "t", ",", "characterized", "by", "respiratory", "and", "oxidative", "phosphorylation", "defects", "that", "lead", "to", "developmental", "delay", "and", "sensitivity", "to", "seizures", "as", "a", "result", "of", "mechanical", "stress", "." ] } ]
PMC11789597
In RPMI 8226 cells, CAV1 knockdown increased the percentage of clusters 5 and 7 and reduced the proportion of clusters 8 and 15 (Figure 5E; Figure S6E, Supporting Information).
[ { "tags": [ "O", "B-CellLine", "I-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "In", "RPMI", "8226", "cells", ",", "CAV1", "knockdown", "increased", "the", "percentage", "of", "clusters", "5", "and", "7", "and", "reduced", "the", "proportion", "of", "clusters", "8", "and", "15", "(", "Figure", "5E", ";", "Figure", "S6E", ",", "Supporting", "Information", ")", "." ] } ]
PMC10470467
In addition, the expression levels of 3 (TIGIT, PD-1, and TIM-3) immune checkpoints were significantly higher in the high-risk group than those in the low-risk group (Figure 4B).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "In", "addition", ",", "the", "expression", "levels", "of", "3", "(", "TIGIT", ",", "PD-1", ",", "and", "TIM-3", ")", "immune", "checkpoints", "were", "significantly", "higher", "in", "the", "high-risk", "group", "than", "those", "in", "the", "low-risk", "group", "(", "Figure", "4B", ")", "." ] } ]
PMC7812570
The assay was performed in triplicate and repeated two times, and representative data are shown.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "assay", "was", "performed", "in", "triplicate", "and", "repeated", "two", "times", ",", "and", "representative", "data", "are", "shown", "." ] } ]
PMC10761218
Despite advancements in medicine, cancer remains the main cause of mortality worldwide .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Despite", "advancements", "in", "medicine", ",", "cancer", "remains", "the", "main", "cause", "of", "mortality", "worldwide", "." ] } ]
PMC11607321
The aim was to assemble the most up-to-date and comprehensive molecular, phenotypic and cancer cell line sample information.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "I-CellLine", "I-CellLine", "O", "O", "O" ], "tokens": [ "The", "aim", "was", "to", "assemble", "the", "most", "up-to-date", "and", "comprehensive", "molecular", ",", "phenotypic", "and", "cancer", "cell", "line", "sample", "information", "." ] } ]
PMC9429973
We measured normal bone marrow of healthy donors and MRD samples from AML patients.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "We", "measured", "normal", "bone", "marrow", "of", "healthy", "donors", "and", "MRD", "samples", "from", "AML", "patients", "." ] } ]
PMC11711127
This has only come to light from careful consideration of transgenic mouse model studies of polyclonal T cell repertoires, rather than monoclonal systems which inaccurately report on more physiological contexts (121).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "This", "has", "only", "come", "to", "light", "from", "careful", "consideration", "of", "transgenic", "mouse", "model", "studies", "of", "polyclonal", "T", "cell", "repertoires", ",", "rather", "than", "monoclonal", "systems", "which", "inaccurately", "report", "on", "more", "physiological", "contexts", "(", "121", ")", "." ] } ]
PMC9429973
Methods: Our cohort included 244 AdvSM pts: 68 pts from our Stanford IRB-approved MPN registry and 176 pts from the phase I EXPLORER (NCT02561988) and phase II PATHFINDER (NCT03580655) studies of avapritinib in AdvSM.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Methods", ":", "Our", "cohort", "included", "244", "AdvSM", "pts", ":", "68", "pts", "from", "our", "Stanford", "IRB-approved", "MPN", "registry", "and", "176", "pts", "from", "the", "phase", "I", "EXPLORER", "(", "NCT02561988", ")", "and", "phase", "II", "PATHFINDER", "(", "NCT03580655", ")", "studies", "of", "avapritinib", "in", "AdvSM", "." ] } ]
PMC11696576
b The 3D binding mode of the compound after 200 ns representative MD simulation is shown.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "b", "The", "3D", "binding", "mode", "of", "the", "compound", "after", "200", "ns", "representative", "MD", "simulation", "is", "shown", "." ] } ]
PMC11721277
Nonetheless, variations in the injected doses can significantly influence the substance’s biodistribution across organs and tissues and the extent of tumor uptake.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Nonetheless", ",", "variations", "in", "the", "injected", "doses", "can", "significantly", "influence", "the", "substance", "’s", "biodistribution", "across", "organs", "and", "tissues", "and", "the", "extent", "of", "tumor", "uptake", "." ] } ]
PMC11627133
Cells were incubated with 500 nM AP3‐RhoBAST (30 min), washed once with ASB and incubated with 100 nM SpyRho (15 min) prior to imaging.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Cells", "were", "incubated", "with", "500", "nM", "AP3‐RhoBAST", "(", "30", "min", ")", ",", "washed", "once", "with", "ASB", "and", "incubated", "with", "100", "nM", "SpyRho", "(", "15", "min", ")", "prior", "to", "imaging", "." ] } ]
PMC11743414
These studies underscore the significance of FHL1.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "These", "studies", "underscore", "the", "significance", "of", "FHL1", "." ] } ]
PMC11525028
Quantification of migration and invasion (right).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Quantification", "of", "migration", "and", "invasion", "(", "right", ")", "." ] } ]
PMC9429973
Initial treatment included fresh frozen plasma on-demand for acute bleeding episodes.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Initial", "treatment", "included", "fresh", "frozen", "plasma", "on-demand", "for", "acute", "bleeding", "episodes", "." ] } ]
PMC11723947
d GO enrichment analyses of cluster 2 genes.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "d", "GO", "enrichment", "analyses", "of", "cluster", "2", "genes", "." ] } ]
PMC10125312
The temperature of all six cell lines irradiated at a fixed power density (3 W/cm) and irradiation time (3 min) are shown in Figure 3.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "temperature", "of", "all", "six", "cell", "lines", "irradiated", "at", "a", "fixed", "power", "density", "(", "3", "W/cm", ")", "and", "irradiation", "time", "(", "3", "min", ")", "are", "shown", "in", "Figure", "3", "." ] } ]
PMC11720107
For the Ornak garlic cultivar, LDH release in BJ cells increased only at the highest concentration (1.000 mg/mL), with a rise of 157.1% compared with the control (Figure 2B).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "For", "the", "Ornak", "garlic", "cultivar", ",", "LDH", "release", "in", "BJ", "cells", "increased", "only", "at", "the", "highest", "concentration", "(", "1.000", "mg/mL", ")", ",", "with", "a", "rise", "of", "157.1", "%", "compared", "with", "the", "control", "(", "Figure", "2B", ")", "." ] } ]
PMC10976516
Some native OVs are known to target stromal components such as CAFs or vascular endothelial cells.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Some", "native", "OVs", "are", "known", "to", "target", "stromal", "components", "such", "as", "CAFs", "or", "vascular", "endothelial", "cells", "." ] } ]
PMC11237030
All images have been acquired using the inverted microscope.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "All", "images", "have", "been", "acquired", "using", "the", "inverted", "microscope", "." ] } ]
PMC11648299
Darier disease is a genodermatosis which manifests as hyperkeratotic papules and superficial erosions mainly in seborrheic skin areas.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Darier", "disease", "is", "a", "genodermatosis", "which", "manifests", "as", "hyperkeratotic", "papules", "and", "superficial", "erosions", "mainly", "in", "seborrheic", "skin", "areas", "." ] } ]
PMC11737091
ccRCC patients with high DBF4 expression exhibit poorer overall survival rates. (
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "ccRCC", "patients", "with", "high", "DBF4", "expression", "exhibit", "poorer", "overall", "survival", "rates", ".", "(" ] } ]
PMC9429973
The clinical data of the Treatment of Persistent/Chronic Pediatric ITP in the Second Affiliated Hospital of Anhui Medical University are retrospectively analyzed to evaluate the efficacy and safety of eltrobopag in the treatment of chronic/persistent ITP in children, and to explore the relevant factors that may affect the efficacy of Erlopapa in children, in order to better guide the clinical application of eltrobopag.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "clinical", "data", "of", "the", "Treatment", "of", "Persistent/Chronic", "Pediatric", "ITP", "in", "the", "Second", "Affiliated", "Hospital", "of", "Anhui", "Medical", "University", "are", "retrospectively", "analyzed", "to", "evaluate", "the", "efficacy", "and", "safety", "of", "eltrobopag", "in", "the", "treatment", "of", "chronic/persistent", "ITP", "in", "children", ",", "and", "to", "explore", "the", "relevant", "factors", "that", "may", "affect", "the", "efficacy", "of", "Erlopapa", "in", "children", ",", "in", "order", "to", "better", "guide", "the", "clinical", "application", "of", "eltrobopag", "." ] } ]
PMC11461833
Western blotting was performed with an anti-HA antibody for HA-tagged progerin expression, with an anti-LaminA/C antibody and with an anti-STXBP5 antibody.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Western", "blotting", "was", "performed", "with", "an", "anti-HA", "antibody", "for", "HA-tagged", "progerin", "expression", ",", "with", "an", "anti-LaminA/C", "antibody", "and", "with", "an", "anti-STXBP5", "antibody", "." ] } ]
PMC11772449
The Loewe additive model assumes that the two drugs are the same to calculate the expected effect.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "Loewe", "additive", "model", "assumes", "that", "the", "two", "drugs", "are", "the", "same", "to", "calculate", "the", "expected", "effect", "." ] } ]
PMC11789597
To determine whether increased levels of these surface molecules by CAV1 knockdown benefit NK cell‐mediated cell cytotoxicity, MM cells were co‐cultured with NK‐92 cells.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O" ], "tokens": [ "To", "determine", "whether", "increased", "levels", "of", "these", "surface", "molecules", "by", "CAV1", "knockdown", "benefit", "NK", "cell‐mediated", "cell", "cytotoxicity", ",", "MM", "cells", "were", "co‐cultured", "with", "NK‐92", "cells", "." ] } ]
PMC10671321
Two EMG studies were performed, one at the age of 14 years in Turkey and one at the age of 18 years in France.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Two", "EMG", "studies", "were", "performed", ",", "one", "at", "the", "age", "of", "14", "years", "in", "Turkey", "and", "one", "at", "the", "age", "of", "18", "years", "in", "France", "." ] } ]
PMC11806182
The inverse-variance weighted (IVW) method was applied as the primary MR approach to estimate causal effects, with complementary sensitivity analyses conducted using MR-Egger regression and the weighted median method to account for potential pleiotropy and heterogeneity.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "inverse-variance", "weighted", "(", "IVW", ")", "method", "was", "applied", "as", "the", "primary", "MR", "approach", "to", "estimate", "causal", "effects", ",", "with", "complementary", "sensitivity", "analyses", "conducted", "using", "MR-Egger", "regression", "and", "the", "weighted", "median", "method", "to", "account", "for", "potential", "pleiotropy", "and", "heterogeneity", "." ] } ]
PMC9429973
The frequency of the homozygous mutation (-675)4G/5G in the PAI-1 gene in group #1 was 1.74 times higher than in group #2.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "frequency", "of", "the", "homozygous", "mutation", "(-675)4G/5", "G", "in", "the", "PAI-1", "gene", "in", "group", "#", "1", "was", "1.74", "times", "higher", "than", "in", "group", "#", "2", "." ] } ]
PMC11345828
Data are reported as follows: chemical shift, multiplicity (s = singlet, d = doublet, t = triplet, q = quartet, br = broad, m = multiplet), integration, coupling constant (Hz).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Data", "are", "reported", "as", "follows", ":", "chemical", "shift", ",", "multiplicity", "(", "s", "=", "singlet", ",", "d", "=", "doublet", ",", "t", "=", "triplet", ",", "q", "=", "quartet", ",", "br", "=", "broad", ",", "m", "=", "multiplet", ")", ",", "integration", ",", "coupling", "constant", "(", "Hz", ")", "." ] } ]
PMC10968586
This becomes clearer considering that, despite promising proof in the field, experimental evidence about OLE and HT bioavailability in humans and animals clearly demonstrates that OLE and HT act as cancer-preventive agents and cytotoxic drugs mainly at concentrations far from plasma levels reachable through nutrition, an aspect often interpreted as marginal that we discuss in detail in this review.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "This", "becomes", "clearer", "considering", "that", ",", "despite", "promising", "proof", "in", "the", "field", ",", "experimental", "evidence", "about", "OLE", "and", "HT", "bioavailability", "in", "humans", "and", "animals", "clearly", "demonstrates", "that", "OLE", "and", "HT", "act", "as", "cancer-preventive", "agents", "and", "cytotoxic", "drugs", "mainly", "at", "concentrations", "far", "from", "plasma", "levels", "reachable", "through", "nutrition", ",", "an", "aspect", "often", "interpreted", "as", "marginal", "that", "we", "discuss", "in", "detail", "in", "this", "review", "." ] } ]
PMC11237030
SS patients with circulating anti-AQP5 antibodies have more severe sicca symptoms, suggesting a potential pathogenic role of these antibodies.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "SS", "patients", "with", "circulating", "anti-AQP5", "antibodies", "have", "more", "severe", "sicca", "symptoms", ",", "suggesting", "a", "potential", "pathogenic", "role", "of", "these", "antibodies", "." ] } ]
PMC11216402
Correlation of 54 healthy GTEx gene expression profiles for each group of GC cell lines in about 11,300 tissue-specific genes. (
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Correlation", "of", "54", "healthy", "GTEx", "gene", "expression", "profiles", "for", "each", "group", "of", "GC", "cell", "lines", "in", "about", "11,300", "tissue-specific", "genes", ".", "(" ] } ]
PMC10040136
These CAFs promote cell migration in vitro and metastasis in vivo .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "These", "CAFs", "promote", "cell", "migration", "in", "vitro", "and", "metastasis", "in", "vivo", "." ] } ]
PMC11473750
Therefore, extensive research has focused on alternative approaches such as indirectly targeting MYCN through protein-binding partners which might serve as alternative therapeutic targets.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Therefore", ",", "extensive", "research", "has", "focused", "on", "alternative", "approaches", "such", "as", "indirectly", "targeting", "MYCN", "through", "protein-binding", "partners", "which", "might", "serve", "as", "alternative", "therapeutic", "targets", "." ] } ]
PMC11345828
The most promising substituents with regards to maintaining efficacy in the NCI-H929 growth inhibition, aqueous solubility, and mouse IV clearance were cyclic oxygen-containing substituents at the 5-position and methyl or ethyl ethers at the 4-position.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "most", "promising", "substituents", "with", "regards", "to", "maintaining", "efficacy", "in", "the", "NCI-H929", "growth", "inhibition", ",", "aqueous", "solubility", ",", "and", "mouse", "IV", "clearance", "were", "cyclic", "oxygen-containing", "substituents", "at", "the", "5-position", "and", "methyl", "or", "ethyl", "ethers", "at", "the", "4-position", "." ] } ]
PMC10899471
BATF2 expression was repressed by miR-939-3p in sarcoma. (
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "BATF2", "expression", "was", "repressed", "by", "miR-939", "-", "3p", "in", "sarcoma", ".", "(" ] } ]
PMC9096373
The protein expression levels of γ-H2AX and apoptosis in the RT group were higher than those in the control group (increased by 296.3% and 98.1%, t=17.35 and 9.65, respectively, P<0.05).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "protein", "expression", "levels", "of", "γ-H2AX", "and", "apoptosis", "in", "the", "RT", "group", "were", "higher", "than", "those", "in", "the", "control", "group", "(", "increased", "by", "296.3", "%", "and", "98.1", "%", ",", "t=17.35", "and", "9.65", ",", "respectively", ",", "P<0.05", ")", "." ] } ]
PMC11367146
The extract was prepared from the dried powder (30 g) with the help of a soxhlet apparatus using methanol (200 ml) at temp.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "extract", "was", "prepared", "from", "the", "dried", "powder", "(", "30", "g", ")", "with", "the", "help", "of", "a", "soxhlet", "apparatus", "using", "methanol", "(", "200", "ml", ")", "at", "temp", "." ] } ]
PMC11599565
In addition, inhibition of MAP4K4 using the small molecule PF-06260933 (MedChemExpress, NJ, USA) enforces the neuroendocrine differentiation of cells in colonic organoids.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "In", "addition", ",", "inhibition", "of", "MAP4K4", "using", "the", "small", "molecule", "PF-06260933", "(", "MedChemExpress", ",", "NJ", ",", "USA", ")", "enforces", "the", "neuroendocrine", "differentiation", "of", "cells", "in", "colonic", "organoids", "." ] } ]
PMC7334607
While examining Figures 2 and 3, we see predictable development of collateral resistance to some drugs, but evolutionary stochasticity and divergence in collateral response between replicates was observed in the response to others.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "While", "examining", "Figures", "2", "and", "3", ",", "we", "see", "predictable", "development", "of", "collateral", "resistance", "to", "some", "drugs", ",", "but", "evolutionary", "stochasticity", "and", "divergence", "in", "collateral", "response", "between", "replicates", "was", "observed", "in", "the", "response", "to", "others", "." ] } ]
PMC11790971
To rank the importance of imaging modalities, the cell line classification performance was compared when using different subsets of imaging modalities, including three single-channel intensity sets (i.e., 2PF, 3PF, THG) and two combinations of modalities (i.e., SLAM intensities, FLIM).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "To", "rank", "the", "importance", "of", "imaging", "modalities", ",", "the", "cell", "line", "classification", "performance", "was", "compared", "when", "using", "different", "subsets", "of", "imaging", "modalities", ",", "including", "three", "single-channel", "intensity", "sets", "(", "i.e.", ",", "2PF", ",", "3PF", ",", "THG", ")", "and", "two", "combinations", "of", "modalities", "(", "i.e.", ",", "SLAM", "intensities", ",", "FLIM", ")", "." ] } ]
PMC11694109
Unfortunately, they were not fully successful.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Unfortunately", ",", "they", "were", "not", "fully", "successful", "." ] } ]
PMC11155445
The synthesized compounds were assessed for their free radical scavenging and antibacterial activity (Fig. 11).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "synthesized", "compounds", "were", "assessed", "for", "their", "free", "radical", "scavenging", "and", "antibacterial", "activity", "(", "Fig.", "11", ")", "." ] } ]
PMC6442998
Gastrointestinal stromal tumors (GIST) are the most frequent sarcoma of the gastrointestinal tract and arise from interstitial cells of Cajal (ICC) or their precursors .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Gastrointestinal", "stromal", "tumors", "(", "GIST", ")", "are", "the", "most", "frequent", "sarcoma", "of", "the", "gastrointestinal", "tract", "and", "arise", "from", "interstitial", "cells", "of", "Cajal", "(", "ICC", ")", "or", "their", "precursors", "." ] } ]
PMC11697703
miRNA inserts were: miR-193b (gain of function: AACTGGCCCTCAAAGTCCCGCTTTTTT), antisense miR-193b (loss of function: AGCGGGACTTTGTGGGCCAGTTTTTTT), miR-365 (gain of function: TAATGCCCCTAAAAATCCTTATTTTTT), antisense miR-365 (loss of function: ATAAGGATTTTTAGGGGCATTATTTTT), or scrambled (control, CCTAAGGTTAAGTCGCCCTCGCTCCGAGGGCGACTTAACCTTAGGTTTTT).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "miRNA", "inserts", "were", ":", "miR-193b", "(", "gain", "of", "function", ":", "AACTGGCCCTCAAAGTCCCGCTTTTTT", ")", ",", "antisense", "miR-193b", "(", "loss", "of", "function", ":", "AGCGGGACTTTGTGGGCCAGTTTTTTT", ")", ",", "miR-365", "(", "gain", "of", "function", ":", "TAATGCCCCTAAAAATCCTTATTTTTT", ")", ",", "antisense", "miR-365", "(", "loss", "of", "function", ":", "ATAAGGATTTTTAGGGGCATTATTTTT", ")", ",", "or", "scrambled", "(", "control", ",", "CCTAAGGTTAAGTCGCCCTCGCTCCGAGGGCGACTTAACCTTAGGTTTTT", ")", "." ] } ]
PMC10452486
Interestingly, incubating cells at reduced temperatures enhances HC dimerization in both HLA-B27 and HLA-A2 .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Interestingly", ",", "incubating", "cells", "at", "reduced", "temperatures", "enhances", "HC", "dimerization", "in", "both", "HLA-B27", "and", "HLA-A2", "." ] } ]
PMC9429973
In this study we assessed the possible factors for incidence of Richter’s transformation.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "In", "this", "study", "we", "assessed", "the", "possible", "factors", "for", "incidence", "of", "Richter", "’s", "transformation", "." ] } ]
PMC8998437
In our previous work, we showed that CCR1 and CCR2B (an isoform of CCR2) mRNA and protein expression levels are upregulated in peripheral blood (PB) B cells upon EBV infection in vitro and in established lymphoblastoid cell lines (LCLs) .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "In", "our", "previous", "work", ",", "we", "showed", "that", "CCR1", "and", "CCR2B", "(", "an", "isoform", "of", "CCR2", ")", "mRNA", "and", "protein", "expression", "levels", "are", "upregulated", "in", "peripheral", "blood", "(", "PB", ")", "B", "cells", "upon", "EBV", "infection", "in", "vitro", "and", "in", "established", "lymphoblastoid", "cell", "lines", "(", "LCLs", ")", "." ] } ]
PMC8751435
Briefly, A549 cells were seeded in 6‐well plates at a density of 1 × 10 cells/well and incubated for 24 h. Then, cells were treated with various concentrations (0, 100, 200, and 400 μg/ml) of CME for 24 h, and then annexin V and PI solution were added.
[ { "tags": [ "O", "O", "B-CellLine", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Briefly", ",", "A549", "cells", "were", "seeded", "in", "6‐well", "plates", "at", "a", "density", "of", "1", "×", "10", "cells/well", "and", "incubated", "for", "24", "h.", "Then", ",", "cells", "were", "treated", "with", "various", "concentrations", "(", "0", ",", "100", ",", "200", ",", "and", "400", "μg/ml", ")", "of", "CME", "for", "24", "h", ",", "and", "then", "annexin", "V", "and", "PI", "solution", "were", "added", "." ] } ]
PMC11657695
The quantitative polymerase chain reaction was realised using SYBR Select Master Mix (ThermoFischer) and primers (see Table 1).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "quantitative", "polymerase", "chain", "reaction", "was", "realised", "using", "SYBR", "Select", "Master", "Mix", "(", "ThermoFischer", ")", "and", "primers", "(", "see", "Table", "1", ")", "." ] } ]
PMC9429973
Results: In total, 256 of 7238 patients (3.5%) were diagnosed with VTE after transplantation.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Results", ":", "In", "total", ",", "256", "of", "7238", "patients", "(", "3.5", "%", ")", "were", "diagnosed", "with", "VTE", "after", "transplantation", "." ] } ]
PMC10656496
Following addition of CT-Glo to cell cultures, cells were agitated for 30 min on a shaker at room temperature.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Following", "addition", "of", "CT-Glo", "to", "cell", "cultures", ",", "cells", "were", "agitated", "for", "30", "min", "on", "a", "shaker", "at", "room", "temperature", "." ] } ]
PMC11467964
Patients in Cluster B had superior clinicopathological characteristics and better OS, but the difference is not significant.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Patients", "in", "Cluster", "B", "had", "superior", "clinicopathological", "characteristics", "and", "better", "OS", ",", "but", "the", "difference", "is", "not", "significant", "." ] } ]
PMC11490153
Overlap between the values indicated no significant difference (P > 0.05).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Overlap", "between", "the", "values", "indicated", "no", "significant", "difference", "(", "P", ">", "0.05", ")", "." ] } ]
PMC11730305
Q1: necrotic cells, Q2: late apoptosis, Q3: primary apoptosis, and Q4: live cells.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Q1", ":", "necrotic", "cells", ",", "Q2", ":", "late", "apoptosis", ",", "Q3", ":", "primary", "apoptosis", ",", "and", "Q4", ":", "live", "cells", "." ] } ]
PMC10809689
Gene symbolForward Primer Seq.
[ { "tags": [ "O", "O", "O", "O", "O" ], "tokens": [ "Gene", "symbolForward", "Primer", "Seq", "." ] } ]
PMC7039683
The resulting scoring function quantifies the degree to which a given test sequence resembles the training set (Ghandi et al., 2014).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "resulting", "scoring", "function", "quantifies", "the", "degree", "to", "which", "a", "given", "test", "sequence", "resembles", "the", "training", "set", "(", "Ghandi", "et", "al.", ",", "2014", ")", "." ] } ]
PMC8316344
E, F TRIB2 decreased labile iron in liver cancer cells.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "E", ",", "F", "TRIB2", "decreased", "labile", "iron", "in", "liver", "cancer", "cells", "." ] } ]
PMC11013014
Moreover, some further insights into the mode of action of the EA analogues suggested a more complex behaviour than the sole inhibition of GSTpi.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Moreover", ",", "some", "further", "insights", "into", "the", "mode", "of", "action", "of", "the", "EA", "analogues", "suggested", "a", "more", "complex", "behaviour", "than", "the", "sole", "inhibition", "of", "GSTpi", "." ] } ]
PMC10747160
Dimeric Griffithsin and other dimeric lectins, such as Cyanovirin-N, are also shown to cause yeast cells to agglutinate, thereby lending further credence to the idea that the inhibitory capabilities of these lectins are tied to their ability to cross-link target proteins .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Dimeric", "Griffithsin", "and", "other", "dimeric", "lectins", ",", "such", "as", "Cyanovirin-N", ",", "are", "also", "shown", "to", "cause", "yeast", "cells", "to", "agglutinate", ",", "thereby", "lending", "further", "credence", "to", "the", "idea", "that", "the", "inhibitory", "capabilities", "of", "these", "lectins", "are", "tied", "to", "their", "ability", "to", "cross-link", "target", "proteins", "." ] } ]
PMC11247842
Both SCS and CM were analysed in Holstein, Jersey, and Nordic Red breeds.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Both", "SCS", "and", "CM", "were", "analysed", "in", "Holstein", ",", "Jersey", ",", "and", "Nordic", "Red", "breeds", "." ] } ]
PMC10745221
Negative controls included an unmethylated protein with a glycine and arginine rich region and Escherichia coli (E. coli) lysate, which does not contain PRMTs .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Negative", "controls", "included", "an", "unmethylated", "protein", "with", "a", "glycine", "and", "arginine", "rich", "region", "and", "Escherichia", "coli", "(", "E.", "coli", ")", "lysate", ",", "which", "does", "not", "contain", "PRMTs", "." ] } ]
PMC11394730
The findings showed that emodin inhibited cancer cells’ epithelial-mesenchymal transition by blocking the ILK/GSK-3β/Slug signaling .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "findings", "showed", "that", "emodin", "inhibited", "cancer", "cells", "’", "epithelial-mesenchymal", "transition", "by", "blocking", "the", "ILK/GSK-3β/Slug", "signaling", "." ] } ]
PMC9429973
Moreover, addition of TASQ to MDS MSC cultures resulted in a significantly higher CFU-F number as well as abolished blocked the excessed adipogenic differentiation.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Moreover", ",", "addition", "of", "TASQ", "to", "MDS", "MSC", "cultures", "resulted", "in", "a", "significantly", "higher", "CFU-F", "number", "as", "well", "as", "abolished", "blocked", "the", "excessed", "adipogenic", "differentiation", "." ] } ]
PMC11244823
The aim of this study was to identify fragments of gD1 which are bound by type 1-specific antibodies.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "aim", "of", "this", "study", "was", "to", "identify", "fragments", "of", "gD1", "which", "are", "bound", "by", "type", "1-specific", "antibodies", "." ] } ]
PMC8540692
The cells were incubated at 37 °C for 30 min, and then run on Muse Cell Analyzer (Merck, Darmstadt, Germany).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "cells", "were", "incubated", "at", "37", "°", "C", "for", "30", "min", ",", "and", "then", "run", "on", "Muse", "Cell", "Analyzer", "(", "Merck", ",", "Darmstadt", ",", "Germany", ")", "." ] } ]
PMC11434983
Specifically, Jun Du et al. synthesized ruthenium(II) polypyridyl complexes combined with EGFR-inhibiting 4-anilinoquinazoline pharmacophores .
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Specifically", ",", "Jun", "Du", "et", "al.", "synthesized", "ruthenium(II", ")", "polypyridyl", "complexes", "combined", "with", "EGFR-inhibiting", "4-anilinoquinazoline", "pharmacophores", "." ] } ]
PMC11564322
Subsequently, the cells were treated with increasing concentrations of VGVAPG or VVGPGA (1–100 nM and 1–100 µM) for 48 h and 72 h by adding 100 µL of a cell suspension with the tested concentration of the peptides and 100 µL of resazurin sodium salt stock (final volume 200 µL).
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "Subsequently", ",", "the", "cells", "were", "treated", "with", "increasing", "concentrations", "of", "VGVAPG", "or", "VVGPGA", "(", "1–100", "nM", "and", "1–100", "µM", ")", "for", "48", "h", "and", "72", "h", "by", "adding", "100", "µL", "of", "a", "cell", "suspension", "with", "the", "tested", "concentration", "of", "the", "peptides", "and", "100", "µL", "of", "resazurin", "sodium", "salt", "stock", "(", "final", "volume", "200", "µL", ")", "." ] } ]
PMC9429973
55% of the patients synchronized the wearable with their own mobile.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "55", "%", "of", "the", "patients", "synchronized", "the", "wearable", "with", "their", "own", "mobile", "." ] } ]
PMC2011258
The cytotoxicity of the conjugate in vitro was tested, in comparison with free vindesine, against sarcoma 791T and other antigenically cross-reactive osteogenic sarcoma-cell lines, and also against tumour cell lines which have no detectable reaction with the monoclonal antibody.
[ { "tags": [ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ], "tokens": [ "The", "cytotoxicity", "of", "the", "conjugate", "in", "vitro", "was", "tested", ",", "in", "comparison", "with", "free", "vindesine", ",", "against", "sarcoma", "791", "T", "and", "other", "antigenically", "cross-reactive", "osteogenic", "sarcoma-cell", "lines", ",", "and", "also", "against", "tumour", "cell", "lines", "which", "have", "no", "detectable", "reaction", "with", "the", "monoclonal", "antibody", "." ] } ]