text
stringlengths 0
868k
|
|---|
Local anesthesia and pain control is one of the most important elements of dentistry, and particularly prosthetic dentistry . According to the american dental association, fear of pain is the most important factor preventing patients from visiting their dentists . Different kinds of fear related to previous clinical experience affect patients' attitudes to local anesthesia or dentist20 . Although local anesthesia techniques do not provide pain - free treatment, this pain is generally tolerable . Pain can result from the mechanical trauma of needle introduction into the site of injection, or from the sudden distension of the tissues, resulting from a rapid discharge of the contents of the syringe . Pain can also be caused by the stimulation of the first few drops of the local anaesthetic3,14 . Contrary to prevalent ideas, needle penetration of tissue is not the primary reason for discomfort . Volume and pressure of the local anesthetic being injected causes more distress and/or pain . Administering local anesthetic injection may not only provoke anxiety in patients, but also in the dentist29 . Despite that, administering local anesthesia by injection for pain relief is still the most common method used in dentistry . However, there are several ways to alleviate pain before dental procedures begin, or the often painful nature of the injection in local anesthesia . Transcutaneous electrical nerve stimulation (tens)24, use of intraoral lidocaine patch11 and computerized local anesthesia7 (the wand) are newly developed methods to alleviate the pain and anxiety of dental patients, as alternatives to conventional local anesthesia . The wand (milestone scientific, livingston, nj) is a computer - controlled local anesthesia delivery system that drives local anesthetic from a conventional local anesthetic cartridge through plastic microtubing into a plastic handle to which a luer - lok needle is attached . The computer - controlled flow is initiated by exerting pressure on a foot pedal . The pump allows administration of local anesthetic at two slow but constant rates, and the computer compensates for variation in resistance to flow4 . During needle insertion, continuous positive pressure delivers an anesthetic drip that precedes the needle . The combination of an anesthetic pathway and controlled flow rate results in a virtually imperceptible injection and rapid onset of profound anesthesia . The wand system offers several advantages over conventional syringes, including excellent tactile sensation afforded by a lightweight plastic handle and the ability to rotate the needle as it is introduced into tissues, producing a coring penetration that minimizes needle deflection . Wand devices automatically deliver the anesthetic more slowly and precisely than a conventional syringe, thereby reducing patient discomfort5,15 . Anesthetic solution gently pumped into the soft tissue can be absorbed at the same rate by soft tissue in the wand system . The theory is that when the needle is advanced slowly, the drops of solution anesthetize the tissue ahead of the needle . All techniques of local anesthesia, such as maxillary and mandibular infiltration, mandibular block22, intraligamentary26, and anterior middle superior alveolar (amsa) injection8, and anterior superior alveolar (asa) injection25 can be performed with the wand system . Conventionally, maxillary teeth have been anesthetized by administering an infiltration injection on the buccal or labial aspects of the target tooth . Palatal injections have also been administered by plastic syringe for this objective, but can be painful5,7 . The amsa derives its name from the injection's ability to anesthetize both the anterior and middle superior alveolar nerves57 . The middle superior alveolar (msa) and asa nerves branch from the infraorbital nerve before they exit from the infraorbital foramen . The msa nerve is thought to innervate the maxillary premolars and plays some role in pulpal innervation of the mesiobuccal root of the first molar . The anterior, superior alveolar nerve supplies pulpal innervation to the central and lateral incisors and canines18 . The plexus where the 2 nerves join is the target site for the amsa injection . The 10 maxillary teeth extending from the second premolar to contralateral second premolar, and the associated palatal tissue, can be anesthetised with bilateral amsa injection57 . Wand research is largely attributable to pediatric dentistry1,2,9, restorative dentistry7, endodontics14, periodontology17,26,27, maxillofacial surgery16, comparison of pain perception to the wand and a traditional syringe21,28, influence of anesthetic flow rate delivered by the wand on pain response to the palatal injection23 . The hypothesis of the present study was that the wand anesthesia technique reduces the pain at different phases (needle insertion, delivery of local anesthetic and tooth preparation) versus conventional buccal anesthesia with conventional plastic syringe . Therefore, the study compared pain levels at needle insertion, during delivery of local anesthetic solution and during tooth preparation, for the conventional syringe technique on the buccal or labial aspect on one side, and the amsa technique with wand local anesthesia application on the other side of the maxilla . A 5-point verbal pain rating scale (vrs)12,17 was used on 16 patients who were under prosthodontic treatment in the ondokuz mayis university clinic sixteen adult patients who had partially edentulous states of both left and right maxillary arch, and were to undergo fixed prosthodontic treatment, participated in this study . They ranged in age from 27 to 64, were predominantly women (12 women and 4 men), and were in a good health . Patients were not taking any medication that would alter their pain perception, as determined by a written medical health form and oral questioning . Allergy to lidocaine, mepivacaine, sulphides or articaine, history of significant medical problems, taking central nervous system depressants within 48 hours, pregnancy, or inability to give informed consent, were the exclusion criteria . The human subjects review committee of ondokuz mayis university approved this study (28.11.2005 dated, and 328 numbered), and written, informed consent was obtained from each patient . All patients had previously experienced a conventional syringe, no patients had previously received the wand injection, and all patients had at least one tooth absent both on the left and right maxillary arch . The amsa technique with the wand for half the maxillary arch and conventional plastic syringe anesthesia on mucobuccal fold (control group) for opposite maxillary arch were administered by the same operator . The order of anesthesia techniques was randomly selected, and anesthesia procedures and tooth preparations were completed in the same session (table 1). Vrs (0 no pain, 1 minimal pain, 2 slight pain, 3 moderate pain and 4 severe pain). The pain level descriptions were as follows: no pain, minimal pain, slight pain, moderate pain and severe pain (0, 1, 2, 3, 4). Patients were blindfolded with a commonly used sleeping mask so they would not distinguish which anesthetic delivery system was used . The wand produces audible beeps as the injection is administered . Because the beeping tones cannot be turned off with a switch, the sound were produced during both injection methods (the wand or conventional - control) so the patients were not aware of the method being used . Immediately after needle insertion, delivery of local anesthetic and tooth preparation, patients were asked to remove mask and rate the pain for both conventional and wand injection techniques . No topical anesthetic was used because the wand manufacturer's instructions suggest that topical application is optional . This study was conducted according to a split- mouth design, with both injections given to all patients . For each patient, the amsa technique with single wand injection was used on one side for central incisors, lateral incisors, upper canine, first and second premolars, and the traditional plastic aspirating syringe injection was used on the mucobuccal fold of the related tooth on the opposite side . The amsa injection site is located at a point that bisects the maxillary first and second premolars, and midway between the crest of the free gingival margin and mid - palatine suture . The needle is orientated at a 45 degree angle with the bevel facing the palatal tissue, while rotating the wand needle . All injections were given by the same operator who had had two months experience using the wand at the department of prosthodontics, faculty of dentistry, ondokuz mayis university, turkey . The ampul form of articaine hydrochloride with adrenalin (hoechst marion roussel, deutschland, gmbh, germany) was injected with conventional plastic syringe and 27gauge dental needle . The cartridge form of articaine hydrochloride with adrenaline (hoechst ag, frankfurt, germany) was administered with the computer - controlled anesthesia device (the wand, milestone scientific, livingston, nj, usa), with 27gauge handpiece and needle (milestone scientific). Approximately 0.9 to 1.0 ml local anesthetic was used both for amsa with the wand on one side and control group for each tooth on the other side . Groups were labelled as follows: group (c), pain perception scores at needle insertion for the conventional technique; group (c), pain perception scores for local anesthetic delivery by the conventional technique; group (c), pain perception scores at tooth preparation for the conventional technique; group (w), pain perception scores at needle insertion by the wand technique; group (w), pain perception scores for local anesthetic delivery for the wand technique; and group (w), pain perception scores at tooth preparation for the wand technique . Power analysis were performed to detect adequate sample size using statistical software (pass 2008, ncss, kaysville, ut, usa). Since our variable was an ordinal level, the mann - whitney u test was used to determine the number of times a score from the conventional method is ranked than a score from the wand techniques at 1% significance level . Statistical tests were performed with the statistical software (spss version 12.0; spss inc, chicago, il, usa). Differences in pain rating were analyzed at needle insertion, delivery of local anesthetic and during tooth preparation for conventional versus the wand techniques . Sixteen adult patients aged from 27 to 64 (12 women and 4 men) participated in this study . Median scores, minimum and maximum pain rating values after needle insertion, and delivery of anesthetic and tooth preparation time for both conventional and wand techniques, are shown in table 3 . The wand technique registered a highly significantly lower pain level during the needle insertion phase (z = - 4.064, p<0.01), with the wand technique having a lower pain level compared to the conventional . During the anesthetic solution delivery phase, the pain level for the wand technique was again highly significantly lower than for the conventional technique (z = - 3.897, p<0.01). However, there was no difference between the wand and conventional techniques for pain level during tooth preparation (z = - 0.671, p>0.05). The research hypothesis stated that the wand anesthesia technique reduces the pain at different phases (needle insertion, delivery of local anesthetic and tooth preparation) versus conventional buccal anesthesia with conventional plastic syringe . The wand anesthesia technique reduces the pain compared the conventional anesthesia for needle insertion and anesthetic solution delivery phases (p<0.01), with the exception of tooth preparation phase (p>0.05). The majority of literature on the computer - controlled injection system (the wand) has dealt with the pain of injection with the computer - assisted injection system, compared to injection using a conventional syringe1,2,8l0,l6,2l,27,28 . In general, the results have been favorable1,8,9,16,23,27 for the computer - assisted injection system, with only 2 studies showing no difference2,28, and 1 study showing higher pain ratings10 . Palatal injections are generally considered the most painful injections13; wahl, et al.30 showed that palatal injections caused significantly more pain than other intraoral injections . The authors of18,30 speculated that palatal injection pain might be mainly the result of pressure . The traditional route for administration of anesthesia to the maxillary teeth is supraperiosteal infiltration delivered in the mucobuccal fold near the apex of the tooth to be anesthetized . Although effective in achieving pulpal anesthesia of the neurovascular bundle by diffusion of anesthetic through the porous maxilla, this approach routinely anesthetizes the surrounding tissues (lips, surface of the face), and also affects muscle activity . The patient's natural repose, as well as active facial expressions are temporarily affected, including an distortion of the smile . The patient also experiences the annoying sensation of facial numbness, and the smile line is temporarily invalidated as an esthetic reference for restorative and prosthetic dentistry . An alternative to maxillary infiltration is the infraorbital nerve block injection which, if properly performed, achieves anesthesia of the anterior superior alveolar branch of the trigeminal nerve . This injection site, however, is also close to muscles of expression, and anesthesia of cutaneous fibers of the infraorbital nerve results in a corresponding loss of sensation in the face and the upper lip29 . The palatal approach amsa nerve block can be attempted with a traditional manual syringe, but the precise pressure and volume ratios of the wand are virtually impossible to reproduce5,6 . The clinician can anesthetize several teeth in the maxillary arch, extending from the mesiobuccal root of the first molar to the central incisor, by means of a single palatal infiltration . In addition to profound pulpal anesthesia, palatal soft tissue anesthesia is realized, which also extends from the maxillary first molar to the central incisor and the associated palatal tissues, without numbness to the lips and face, and without interference with the muscles of facial expression for at least 60 min16,25 . During needle insertion with a coring motion, the drops of solution anesthetize the tissue ahead of the needle when the needle is advanced slowly7,15 . The combination of an anesthetic pathway and controlled flow rate results in virtually imperceptible needle insertion and injection, and rapid onset of profound anesthesia28 . The same efficacy of anesthesia was achieved with conventional buccal anesthesia and the palatal approach amsa technique with the wand device25 . The current study was in agreement for tooth preparation, but contradictory for needle insertion and delivery of local anesthetic . Numbness of the lips and face was not observed in the current study for the palatal approach when using the amsa technique with the wand . Another study using the vrs (verbal rating scale) compared computer - controlled and conventional local anesthesia delivery systems for performing scaling and root planing on patients with moderate periodontal disease; amsa injections with the wand were considered less painful than the conventional syringe17 . Two further benefits of the amsa injection technique are that it also eliminates the potential for an intravascular injection because no major vessels are encountered in this region of the palate5, and the palatal bone is porous enough to permit the anesthetic solution to diffuse through the tissues and anesthetize both the anterior and middle branches of the superior alveolar nerve when the injection is deliberately slow and steady . For this reason, the successful deposition of the anesthetic solution through the fibrous tissue is said to be accomplished more easily with the computer - controlled delivery device that regulates the pressure and volume ratio of solution delivered5,7 . The wand system offers several advantages over conventional syringes, including excellent tactile sensation afforded by the lightweight plastic handle and the ability to rotate the needle as it is introduced into tissues, producing a coring penetration that minimizes needle deflection . Presumably, the slow rate of anesthetic flow reduces patient discomfort compared with palatal injections administered with a traditional syringe4 . Decreasing the total amount of anesthetic and vasoconstrictor necessary for maxillary anesthesia, shorthening the total anesthesia time, and diminishing patient - operator anxiety however, the wand's beeping sounds make the injection seem longer and may make the patient feel uncomfortable . Other negative aspects of the wand are frequent breakage of the anesthetic cartridge on activation of the unit, and a separate instrument is required for removing the cartridge from the unit10 . Additionally, 1.4 ml anesthetic solution can be delivered in about 1 min in rapid injection mode, and in 4 min 45 s in slow injection mode9 . Fukayama, et al.8 examined the efficacy of the amsa anesthesia technique using the wand system to assist with the electrical pulp test . Electrical pulp stimulation indicated that the lateral incisors, canines, and first and second premolars were more anesthetized than the central incisors and first molars . They also stated that anesthetic applied via amsa with the wand has a slow onset and further studies are required to evaluate its effectiveness for this reason . However, amsa injection using the wand method seems to both preclude severe injection pain and be very effective for pulpal anesthesia of lateral incisors, canines, and premolars . Pain scores were higher for amsa technique in the central tooth than in other teeth (p<0.05) in another related study16 . In the present study, in two cases of amsa using the wand, pain was at the minimum level (vrs score 1) during tooth preparation of central incisors . The reason for this pain rating could be that the central incisors were innervated from the opposite arch, or alternatively, fukayama, et al.8 and lee, et al.16 stated that the effectiveness of the wand is lower in the central incisors and first molar teeth than lateral incisors, canines, and premolars . Friedman and hochman57 stated that careful needle insertion and slow anesthetic delivery could reduce the sensation of needle insertion . Primosch and brooks23 showed that slow anesthetic delivery produces significantly lower pain scores than fast anesthetic delivery, and the wand decreases the pain for both slow or fast anesthetic delivery rate, but contrary to the manufacturer's claims, it did not eliminate pain elicited by palatal injections in some patients . In the present study, a highly significant (p<0.01) difference for pain rating was obtained between conventional buccal and amsa using the wand injection for needle insertion and anesthetic solution delivery . However, contrary to the manufacturer's claims, pain was not eliminated at slow anesthetic flow rate in this study there have been limited prosthodontic or restorative studies for amsa using wand injection . In one study, amsa was bilaterally applied with the wand and 6 anterior maxillary teeth were prepared . Incisal reduction of these teeth was achieved with reference to the lip, which is not affected by amsa . Bilaterally, the amsa technique using the wand was repeated for tooth sensitivity during the cementation procedure5,6 . As in previous studies, amsa using the wand was also of benefit for lip guidance in the present study . Another benefit of palatal amsa injection using the wand is that it reduces the number of injections, and also the amount of anesthetic solution compared to conventional buccal infiltration anesthesia that applies multiple injections to each tooth . In addition, more teeth can be anesthetized with a single injection, without numbness of lips and face, compared to the conventional technique . The amsa technique administered using the wand in a prosthodontic treatment reduced pain highly significantly more than conventional buccal anesthesia, both in inserting the needle and in the of delivery of local anesthetic . When comparing the anesthesia efficiency of amsa using the wand injection and conventional buccal infiltration techniques, no statistical difference was found . Although the slow anesthetic flow rate proved superior in pain control, the pain score was not zero for the wand, contrary to the manufacturer's claim . Computer - controlled anesthesia using the wand appears advantageous for restorative procedures because more teeth are anesthetized with one palatal injection, and without numbness of lips and face, in contrast to multiple conventional buccal anesthetic injections for each tooth.
|
Chronic obstructive pulmonary disease (copd) is a progressive lung disease which is characterized by airway obstruction and lung parenchyma destruction . Patients may experience dyspnoea or shortness of breath, a persistent cough with sputum production, decreased exercise tolerance and decreased quality of life [1, 2]. Globally, copd is the fourth most common cause of death and is predicted by the world health organisation to be a major health concern in the coming decade . In australia, 1.2 million people are estimated to have moderate - to - severe copd (gold stages ii iv). However, the true number is potentially much higher as copd is commonly underdiagnosed [4, 5]. The total cost of living with copd (including nonmonetary costs) is estimated to be $83 000 aud per person each year [6, 7]. As the severity of copd greatly impacts the cost of care, providing early diagnosis and effective management of the individual is an essential component in reducing its economic impact [5, 810]. Pr is a multidisciplinary approach which incorporates self - management education with exercise training, psychosocial and nutritional support [11, 12]. It is a fundamental part of managing people with copd and has been shown to be effective in improving exercise tolerance, reducing dyspnoea, improving, quality of life and reducing the severity of acute exacerbations [1, 1117]. Although pr has been shown to be effective in managing symptoms and reducing hospital admissions, poor participation and adherence are a current problem among outpatient programs . Factors include difficulty travelling to the program's location [1922], inconvenience of hospital attendance, or difficulty accessing programs . Australia is one of the least densely populated nations (2.7 people per square kilometre) with up to 11.8% of the population residing in outer regional or remote locations . Conducted a study in kyabram (rural victoria) to assess the efficacy of their pr program and noted that patients who lived outside the town centre were more likely to withdraw from pr as the program was conducted within the town hospital . This finding is also supported by de angelis and colleagues who found that transport, travel distance, and related costs were the main reason for nonattendance of a cardiac rehabilitation program . Difficulty in accessing outpatient programs has led to the development of home - based programs . It is well established that home - based pr programs are safe and effective [13, 2931] and are recommended by many international guidelines and reviews [2, 11, 12, 17]. Given the effectiveness of independent home - based pr programs one could ask what additional benefits supervised remote - based programs would provide . The main advantage of supervised remote - based programs is the ability to minimise anxiety in both patient and therapist . This benefit has been shown in remote - based cardiac exercise programs where the use of transtelephonic exercise monitoring (tem) has been used to relieve patients' and trainers' anxiety during exercise [3234]. It is anticipated that a person with copd could exercise to a higher intensity without the risk of undetected adverse events (e.g., exercise - induced oxygen desaturation). Telerehabilitation is an emerging technology used to facilitate the delivery of rehabilitation services at a distance by combining telecommunication and electronic transmission of health information . It has the potential to provide equitable access for people living in rural or remote areas where access to health service is limited . For telerehabilitation to be successful, however, there must be accurate assessment and outcome measurement tools available to therapists [37, 38]. In pr, the pulse oximeter is a noninvasive device which continuously monitors a person's peripheral blood oxygen saturation (spo2) and heart rate (hr). It is used clinically to measure a person's exercise intensity and warn of exercise - induced desaturation . The concept of remote monitoring of physiological data including spo2 and hr for exercise rehabilitation purposes has received attention in the literature . As early as the mid-1980s, physicians were successful at remotely monitoring a patient's electrocardiogram (ecg) through the analogue telephone network during a home - exercise program [40, 41]. However, the majority of electronic healthcare literature on pr has focused on telemonitoring systems [4246] or consultations services [36, 47]. There has been little research using e - health to deliver real - time, live supervision of patients for treatment purposes . This study aimed to develop and verify the use of a remote pulse oximetry system on healthy individuals . Specifically, it aimed to establish the technical feasibility of transmitting pulse oximetry data remotely, to determine the validity of remote measurements when compared to conventional face to face measurements, and to evaluate the participants' perception on the usability of the technology . It was hypothesised that remote pulse oximetry would not only be technically feasible but would also be valid when compared to conventional units and would be easy for participants to use . A favourable result will enable the development of remote pulmonary rehabilitation programs for people living in rural or remote areas . This study was reviewed and granted ethical clearance from the appropriate medical research ethics committee at the university of queensland . Thirty - seven healthy individuals were recruited to participate in a single remote cardiopulmonary exercise session . The following exclusion criteria were applied: cardiovascular, respiratory, metabolic, or orthopaedic conditions that would prevent participation in an exercise program, chronic infectious diseases, pregnancy, and mental or physical impairment . The exercise session was conducted using the ehab telerehabilitation system (v2.0, uniquest, brisbane, australia) which is a computer - based videoconferencing and remote consultation system . Two ehab devices were used, one with the participant and the other with the therapist . The participant and therapist were located in separate rooms . The ehab device with the participant was configured to receive data from a bluetooth pulse oximeter module (onyx ii 9560, nonin medical inc ., plymouth, mn) (figure 1). This information was transmitted by the participant device at a frequency of one hertz via an encrypted data channel to an offsite server via an active server page (asp) web service . The data was subsequently stored in a mysql database on the server . A therapist device retrieved this data via an asp web service to produce a graph of the participant's heart rate and spo2 recordings in near real time . For this study the ehab telerehabilitation system utilised a local wi - fi network connection; however, the connection speed was throttled to 128 kbit / s to ensure compatibility with the 3g / hsdpa mobile network available in remote areas of australia . After written consent was obtained, participants were taken to a room with the ehab device, remote pulse oximeter module, headset, and treadmill . They were asked to remove any nail polish from their index finger on the nondominant hand or jewellery which may disrupt accurate recordings . Participants were given an information sheet with instructions on how to affix the pulse oximeter module to the index finger of their nondominant hand and how to establish a connection with a therapist in another room via the ehab device . Once a videoconference was established, the therapist guided the participant through an exercise session . The modified borg score (mbs) was used to assess the participant's exercise intensity . As per current copd exercise protocols the session began with a warm - up phase (mbs 2/10) for 5 minutes before gradually progressing to a moderate / somewhat severe intensity (mbs 4 - 5/10). The last 5 minutes consisted of a cool - down phase (mbs 2/10). If any adverse signs were observed, the exercise session would be ceased immediately . Interrupted sessions due to technical difficulties were noted, and those participants were asked to repeat the exercise session at a later date . At the conclusion of the exercise session, participants completed a questionnaire about their experience with the remote pulse oximeter module and ehab device by marking on a 100 mm visual analogue scale (vas) and providing any open - ended comments . During each session, the participant ehab device logged heart rate (hr) and spo2 values from the pulse oximeter and time stamped the data . This data was saved into a database stored locally on the computer (dataset #1). The participant device also transmitted the data to the remote therapist device where another time stamp was applied to enable the calculation of transmission latency . This data was saved into a database stored locally on the therapist device (dataset #2). The mean data transmission rate was determined by measuring the bandwidth requirement (kbit / s). The satisfaction questionnaire rated the comfort, quality, and usability of the ehab device and remote pulse oximetry module . The validity of remote pulse oximetry was assessed by comparing the remote measurements (therapist data) with conventional face - to - face measurements (participant data). These were percentage agreement, mean absolute difference (mad), and the bland and altman's limits of agreement method [49, 50]. Percentage agreement was calculated as the proportion of data successfully transferred between participant and therapist . The limits of agreement method enabled the quantification of the agreement between the two data sets in terms of the clinical significance of the transmission error . Specifically, it gave the upper and lower bounds which show the 95% confidence interval for the difference between the remote and conventional measurements (i.e., mean 1.96 sd). When applying the limits of agreement method comparing the two datasets, the average of 10 second intervals of data was used . In terms of clinical significance, the minimum clinically important difference (mcid) was used as a threshold value to represent meaningful and worthwhile change . Remote measurements were classified as valid if the measurement error was lower than the mcid . The mcid for hr, however, varies depending on the individual's exercise tolerance . For the purpose of this study, the manufacturer's device accuracy of 3 beats per minute (bpm) was used as the mcid, which was a conservative estimate . Data was analysed using statistical package for the social sciences (v17.0 spss inc ., chicago, il). A p value of <0.05 was considered to be significant, where applicable . Thirty - seven healthy individuals (14 males and 23 females) completed a total of 15 exercise hours . Participants had a mean age of 30 years and standard deviation of 15 years (range: 18 to 62). There were 34 successfully completed sessions on first attempt confirming the feasibility of the method, while three had to be repeated due to technical difficulties with the bluetooth or wifi connection . The mean (sd) transmission latency of the pulse oximetry data (not the videoconference) between the computers was 2.94 (0.59) seconds . The mean (sd) bandwidth usage for data transmitted was 6.5 (1.0) kbit / s . Of the remaining data, 9.0% was found to be omitted from the therapist device, while 11% was found to consist of duplicated numbers . The mad and limits of agreement between participant and therapist data are shown in table 1 . Overall, participants rated their experience with the remote pulse oximeter and ehab device highly . The mean response to each of the eight questionnaire items is shown in figure 2 . Positive written comments included the following: i would be comfortable using [this device] at home (n = 4) and [the ehab was] simple and easy to use negative comments included worried [remote pulse oximeter] could dislodge during vigorous exercise (n = 5), remote pulse oximeter was uncomfortable (n = 4), and audio or video quality was jumpy (n = 3). However, inconvenience, distance, or availability of pr programs can lead to lack of participation and poor compliance . This study demonstrated the feasibility of a remote pulse oximeter for use during a pr program . Remote measurements of spo2 and hr were valid when compared to conventional face - to - face measurements . These findings provide confidence for the development of a remote pr program . In our study, there was an unexpectedly high mean rate of data omission (9.0%) and duplication (11%) between participant and therapist data . Although these error rates appear comparatively high, they do not necessarily indicate a failure in the data transmission . Rather, the logging of data points by the participant device appears to not be perfectly synchronized with data retrieval from the therapist device . This may be a function of the variable delays that can be present with web service calls which were used in this study to transmit data . Asynchrony in web service responses may have resulted in either repetition of data or omission of single values . Moreover, a visual inspection of the data confirms a random distribution of error throughout the data file . Despite this asynchrony, the mad analysis revealed a small difference (spo2 0.04%; hr 0.21 bpm) in comparison to the mcid of 4% for spo2 and 3 bpm for hr . Similarly, the limits of agreement demonstrated a small difference in comparison to the mcid for spo2 and hr . The upper and lower bounds for spo2 were 0.67 to 0.67% and for hr were 2.90 to 2.89 bpm . Both are within the mcid, and this provides further evidence for the validity of remote measurements . Unlike mad, which analyses the actual difference, the limits of agreement give a conservative estimation of difference through a 95% confidence interval . Clinically, it means 95% of the time of the difference due to measurement error will be within the relevant limits for spo2 and hr . The mad and limits of agreement values show that remote measurements are sufficiently accurate and valid for real - time monitoring purposes . Overall, as indicated by questionnaire responses, participants found the remote pulse oximeter easy to use (mean vas 89/100) and felt confident that they would be able to use it at home (mean vas 87/100). This is similar to literature which has found the ehab device user friendly [5557]. However, some participants (n = 4) stated that the remote pulse oximeter was uncomfortable . Unlike a conventional pulse oximeter, the remote module has the sensor, display and battery unit all incorporated on the fingertip (see figure 1). This creates additional weight compared to a conventional sensor, and it could be a contributing factor to the feeling of instability experience by these participants . Future studies should compare the comfort with other remote pulse oximeters that have the display and battery unit located at the wrist . Furthermore, this needs to be investigated in the copd population as they may be more accustomed to pulse oximetry than healthy adults . Five participants commented that they were worried the remote pulse oximeter could dislodge during vigorous exercise . This could be a result of the weight of the device and high intensity of exercise, where most participants needed to jog or run in order to reach an mbs of 5/10 . Problems with video and audio quality have been identified as key issues in telehealth [5860]. During testing, there were occasional disruptions in audio and video transmissions during the exercise session, and on three occasions, the videoconference unexpectedly exited due to connectivity issues on the wifi network, requiring the call to be reestablished . The low frame rate is likely due to the low bandwidth available (128 kbit / s) on the network connection . However, it should be noted that the remote pulse oximeter only uses a very small bandwidth (6.5 kbit / s) for data transmission and, therefore, is unlikely to have attributed to the reduced video / audio quality . There were several limitations of this study (1) our sample size was small (n = 37) and consisted primarily of young, healthy university students (mean age 30 years). Our healthy participants did not show any clinical changes (e.g., exercise - induced desaturation), and this may have affected the magnitude of error in mad and limits of agreement . Furthermore, the young population may be more confident to use or learn about new technology, and this may have therefore influenced the result of the satisfaction questionnaire . (2) this study was conducted within the university clinic . Although the participant and therapist were in separate rooms, they were in close proximity to each other, with the therapist on call if any difficulties occurred . Whist the ehab system was bandwidth throttled to ensure compatibility with the 3g / hsdpa mobile network, other factors such as mobile network coverage, signal strength, and speed were not assessed, and this may have affected the performance and the latency of transmission . Future studies should include a trial of the remote pulse oximetry system in the home environment with a copd population on the 3g / hsdpa mobile telephone network . A large sample size is required to more rigorously assess the validity and reliability of data transmissions . Furthermore, it has been shown that patients demonstrate more positive views of telecare encounters than their healthcare providers . A therapist questionnaire is therefore required to assess their satisfaction and confidence in safely conducting a remote exercise session . Our pilot study demonstrated that remote pulse oximetry was feasible, and the data transmission method produced valid data at the remote end when compared with conventional face - to - face measures . Although this study was performed on healthy individuals, participants found the ehab device easy to operate and were confident it could be used at home . Further studies are needed to address the technical feasibility and validity in a home environment and the therapist's confidence in conducting a safe exercise program.
|
Acute mountain sickness (ams) occurs during exposure to high altitude (ha) and is a clinical syndrome characterised by headache, insomnia, malaise, and gastrointestinal symptoms . It is common, developing in 1030% at 25003000 meters and in up to 60% of those ascending to around 4500 meters . It causes significant morbidity and is a challenging clinical condition in remote environments . A biochemical marker of ams, particularly one available as a point - of - care test (poc), could have widespread clinical utility . The pathophysiology of ams is not clearly understood but involves alterations in fluid balance, endothelial function, vascular permeability, inflammation, and oxidative stress . The renal response to ha is an important factor in acclimatization, and ha exposure leads to renal arteriole constriction and relative hypoxia [3, 4]. Despite the relative renal hypoxia, ngal (neutrophil gelatinase - associated lipocalin) is a 25 kda peptide, part of the lipocalin family of small soluble proteins . It is produced in a number of human tissues, notably the distal nephron but also in the lung ngal rises rapidly in the nephron in response to a renal insult and an ngal 150 ng / ml following acute kidney injury (aki) is predictive of acute renal failure (arf) well before creatinine has risen . Ngal is also an acute - phase protein, has a role in inflammation [8, 9], and is upregulated in the lung during inflammation [5, 10, 11]. Ngal is also known to rise in conditions associated with oxidative stress [12, 13], and oxidative stress has been implicated in ams [14, 15]. We therefore hypothesised that ngal would increase at ha secondary to these various stimuli and that the magnitude of any increase might relate to the presence of ams . We therefore studied a combined cohort of trekkers from 2 expeditions to ha . In order to clarify the relative contribution of ams, hypoxia or exercise to ngal levels, we also studied a cohort pre- and postexercise at near sea level, and a further cohort exposed to acute normobaric hypoxia . The potential role of inflammation in stimulating ngal was assessed by the measurement of highly sensitive c - reactive protein (hscrp) in a subset of participants . All study protocols were approved by the ministry of defence research ethics committee, whitehall, uk, and satisfied the requirements of the declaration of helsinki . In all studies informed, thirty - two subjects participating in a defence medical services (dms) trekking expedition (trek 1) in the khumbu region of nepal were studied . Blood samples were taken from the antecubital fossa at 3 study altitudes: on day 2 at 3400 m, day 6 at 4270 m, and day 10 at 5150 m (following ascent to everest base camp at 5364 m). All samples in this study were collected immediately following a day trekking (posttrek) to the study altitude . Twenty subjects from a further dms expedition (trek 2) to nepal were also studied . Blood samples were again taken at 3 study altitudes: on day 2 (3400 m), day 6 (4270 m), and day 10 (5150 m) (following ascent to kala patthar (kp), 5643 m). Samples in this study were again collected immediately following a day trekking (posttrek). Additional samples were taken at rest in kathmandu (kat) at 1300 m and at rest the next morning at the 3 study altitudes . As serving members of the military, all subjects were able to fulfil the fitness criteria of their relevant service . This broadly includes an age - adjusted ability to run 1.5 miles in under approximately 11 minutes and to perform an age - adjusted number of sits - ups and push - ups within two blocks of 2 minutes . Fourteen subjects underwent a 3-hour exposure to normobaric hypoxia (fio2 11.6%, equivalent to 4800 m altitude) in a hypoxic chamber . This exposure included a 5-minute step test (step height of 25 cm, 1 complete step every 2 seconds) at 95 minutes . A group of 22 subjects had ngal assayed at rest and after exercise at sl in the uk following ascent from sea level to 1085 m over 6 hours (an equivalent gain in altitude and duration of exercise similar to that experienced on a trekking day in nepal). Two subjects from trek 2 were part of the sl exercise group, but data collection occurred several months apart . Ngal was analysed in the field on a biosite triage point of care monitor (alere ltd, stockport, uk) using a triage ngal test kit . The triage ngal test is a point - of - care, fluorescence - based immunoassay used which gives a rapid (15 minutes) quantitative measurement of ngal in a range from 60 to 1,300 ng / ml . Oxygen saturation (digitally on warm hands at rest) was measured using a nellcor np-20 pulse oximeter (covidian, ma, usa) during trek 1 + 2 and in the hypoxic chamber study at the same time as blood samples were taken . During trek 1 + 2, twice - daily ams scores were assessed using the lake louise score (lls) questionnaire . The lls allocates a score of 0 to 3 (symptom not present to severe) for symptoms of ams (headache, gastrointestinal symptoms, fatigue / weakness, dizzy / light - headedness, and difficulty sleeping). A score of 3 or more in the presence of headache is consistent with ams, a score of 6 or more with severe ams . The commercially available, highly sensitive, immunoturbidimetric assay (roche diagnostics) was used to measure crp in trek 2 at the same time points as ngal . Mg / l and a between - run coefficient of variation between 2.5 and 5.7% . For statistical calculations, the software package spss 14.0 was used . For subjects with a ngal below the limit of detection of the assay (60 ng / ml), a value of 60 ng / ml was assigned for the purposes of statistical analysis . All data were tested for gaussian distribution using the kolmogorov - smirnov test and shapiro wilks statistic . For the analysis of dependent variables that were normally distributed, changes were tested by student's paired t - test . For independent variables that were normally distributed, a within - subjects anova was performed to investigate any serial changes in ngal with ascent at rest and post - trek . A two - way mixed anova with either resting or after trek ngal at each study altitude as the within - subjects factor and the presence of ams (according to the ll score at multiple altitudes) as the between - subjects factor if the mauchly sphericity test was significant, then p values were expressed after multiplication by the greenhouse - geisser epsilon . Correlation analyses for normally distributed data were performed by calculating the pearson coefficient of correlation . A p value <0.05 (two - sided) was considered significant . As the ascent profile and route were closely matched in trek 1 and trek 2, data were combined and analysed as a whole . Taking medication (acetazolamide, dexamethasone) had no apparent effect on ngal values, and therefore these subjects (n = 11) were not excluded from the analysis . Demographic data for the field study (trek 1 + 2), the controls, and the hypoxic chamber study are shown in table 1 . In the 22 subjects ascending to 1085 m in the uk, there was no significant (p = 0.084) rise in ngal following exercise: resting sl ngal was 64 11 (ng / ml, mean sd, range 60104) and postexercise ngal was 71 14 (ng / ml, mean sd, range 60100). Of the 52 subjects, spo2 (%, mean sem) dropped from 97 2 at kat (1300 m) to 84 5 and 79 7 at 4270 and 5150 m, respectively (p <0.001). There was a moderate inverse correlation between ngal and spo2 at 5150 m (r = 0.477, p = 0.001) (figure 1) with a weaker inverse correlation between ngal and spo2 at 4270 m (r = 0.340, p = 0.019). Within the subjects, anova demonstrated a significant change in ngal with ascent both at rest (p = 0.007) and after trek (p = 0.001) (figure 2). Spo2 (%, mean sem) dropped from 99 0.4 at baseline to a nadir of 79 5 (p <0.001). Despite an equivalent drop in spo2 to that seen in trek 1 + 2, ngal (ng / ml, mean sd, range) showed no change between baseline and 180 minutes: 63 26 (2980) versus 67 25 (2784), p = 0.538 . In trek 2, serum creatinine {mol / l, mean sem, (range), (p value versus baseline at kat)} was 78 2 (6395) at baseline; at 3400, 4270 and 5150 m it was 87 3 (72120) (p = 0.001); 84 2 (72104) (p <0.001); and 94 5 (76142) (p <0.001). According to their ll scores at the highest study altitude (5150 m), there were 23 subjects with no ams, 16 subjects with mild ams, and 7 subjects with severe ams . There was a significant difference between ngal depending on the presence or absence of ams at 5150 m (figure 3) with higher values in those with ams and severe ams . A two - way mixed anova revealed a significant change (p = 0.003) in resting ngal with ascent and an interaction with ams at 4270 m (p = 0.017) and 4910 m (p = 0.002 for change in ngal, p = 0.027 for interaction with ams). Hscrp was (mean sem, range): 1.6 0.4 (0.337.53) at baseline; at 3400 m, 4270 m, and 5150 m post - trek: 7 2.9 (0.7847.93) (p = 0.002 versus baseline); 25.7 8.1 (0.58104) (p <0.001 versus baseline); 9 3.2 (0.5644.62) (p = 0.003 versus baseline). At 3400 m, 4270 m, and 5150 m at rest: 6.2 2.9 (1.8725.1) (p = 0.001 versus baseline); 21.6 5.7 (0.4983.9) (p <0.001 versus baseline); and 5.8 2.1 (0.5426.59) (p = 0.012 versus baseline). Ngal at 5150 m, after trek was moderately correlated with hscrp at 5100 m after exercise (rho 0.526, p = 0.036). This is the first report to describe an association between ngal and both the presence and severity of ams at ha . The significant novel findings are that ngal rises in response to sustained hypobaric hypoxia but not acute normobaric hypoxia or near sl exercise and that this rise is related to ams at 5150 m. the rise in ngal following trekking (by day 2 at 3400 m) was to the levels normally associated with the subsequent development of arf (> 150 ng / ml), but this did not occur . Although creatinine rose significantly with altitude, the rise was very modest, and we suspect that a combination of factors other than a simple renal insult is responsible for the increase in ngal at ha . Our data suggest an inverse correlation between spo2 and ngal at 5150 m (and to a lesser extent at 4270 m). Although no such correlation was found at 3400 m, this may still suggest that prolonged renal hypoxia could be a significant drive to ngal release . In addition to renal hypoxia, we suspect that other factors may also contribute to the rise in ngal at ha . The significantly greater ngal in those with severe or mild ams versus those without at 5150 indeed, ngal is an acute - phase protein with a role in inflammation [8, 10, 11]. Exercise stimulates an immune response, and hypoxia is also known to cause a response in immune and endothelial cells with inflammatory markers such as hscrp increasing with ha [1922]. Consistent with this, we saw a significantly higher hscrp at all altitudes compared to baseline . Limited data have suggested hscrp may be associated with ams but we did not demonstrate any evidence to support this . There was a weak correlation between hscrp and ngal at 5150 m but this cannot explain the rise in ngal as a whole . Ngal also rises with oxidative stress [9, 12] which is increased by exercise, and ha - induced oxidative stress has been implicated in ams . As such, it is interesting to note that we found a higher ngal following trekking and in those with ams at the highest altitude . In an attempt to clarify the relative influence of exercise and hypoxia on ngal, we measured ngal before and after exercise of a similar duration (6 hrs) and similar incremental altitude (1085 m) as that experienced daily in nepal and also in a hypoxic chamber . In neither scenario did ngal rise . This may reflect inadequate duration or severity of stimulus but may also reflect that the ngal response is not due to exercise or hypoxia alone but is multifactorial involving hypoxia, oxidative stress, an inflammatory response, and other, as yet unidentified, stimuli . We also acknowledge limitations such as a lack of serum markers of oxidative stress and a lack of resting ngal data in trek 1 . In addition, we did not measure ngal at sl before departure to nepal, although the ngal recorded as a baseline at kat (1300 m) (68 ng / ml) was no different to those recorded at sl in the uk (63 and 64 ng / ml). We also acknowledge the fact that although we measured creatinine in trek 2, we did not continue to monitor it after the cessation of trekking . As a consequence of creatinine rising more slowly in response to a renal insult than ngal, in conclusion, there are several interesting and novel findings that are worthy of further exploration . Ngal rises in response to prolonged hypobaric hypoxia; marked increases in ngal may occur without concomitant arf and the degree of ngal rise at ha is associated with the presence or absence of ams . The fact that ngal does not appear to rise secondary to acute normobaric hypoxia or exercise in isolation suggests that the rise at ha and relation with ams may have common pathways, perhaps related to prolonged hypoxia and an inflammatory response . With the huge and increasing popularity of recreational sports undertaken at both moderate and high altitude assessment of ngal takes a matter of minutes using poc testing, and its use in identifying ams requires further evaluation.
|
When deposited on various substrate surfaces, rod - like, -conjugated, small organic molecules are well - known for their tendency to form highly anisotropic crystal shapes, which are frequently called fibers or needles . Whereas the epitaxial growth has been studied on various substrates, in particular anisotropic surfaces seem favorable to conserve the highly anistropic morphology and optical properties, for example, polarized emission or adsorption provided by a parallel molecular orientation obtained by self - assembly . Consequently, cu(110), tio2(110) and muscovite mica(001) are frequently chosen as a proper fundament to study the epitaxial growth of rod - like small molecules . In this paper, the epitaxial growth of 2,2:6,2-ternaphthalene (nnn) on muscovite mica(001) is reported . As indicated in figure 1a, the molecule is built from three naphthalene units, which are linked together by c the coexistence of needle - like structures and island - like crystallites is verified . Structural analysis reveals two different crystal orientations . Whereas island - like structures are built up by upright standing molecules orientated with a (001) contact plane relative to the muscovite mica substrate (see figure 1b), needles consist of nnn molecules with a (111) lying orientation (see figure 1c). Both crystal configurations provide a well - defined azimuthal alignment, which is discussed based on force field simulations and a recently reported growth model . The azimuthal alignment of island like structures is explained by ledge directed (b) a side view of nnn molecules packed in the observed crystal structure . Each unit cell houses two nnn molecules . Molecules are approximately standing on the s (001) contact plane, which is indicated in blue . (c) a side view along the long molecular axis visualizing the edge - on / flat - on herringbone stacking of nnn . The blue area represents the orientation of the b (111) contact plane where molecules are aligned in almost in lying configuration . This all - aromatic compound could be obtained in high yield by coupling 2 equiv of 2-naphthaleneboronic acid (1) with 1 equiv of 2,6-dibromonaphthalene (2), as described in the supporting information . The final product, 2,2:6,2-ternaphthalene (nnn), was obtained as a colorless product, which appears to be highly insoluble in common solvents and could only be recrystallized from 1,2,4-trichlorobenzene (colorless platelets). The material was checked with gas chromatography and mass spectroscopy and found to be> 99% pure before thermal sublimation . All samples have been fabricated on muscovite mica(001) substrates (spi, structure probe, inc . ). Muscovite mica is a representative of sheet silicate minerals and provides a layered structure of aluminum silicate sheets weakly bound by layers of potassium ions . Each layer is characterized by a high symmetry direction identified by parallel aligned surface grooves . Between the individual sheets, the high symmetry direction alternates by 120 leading to a periodic stacking sequence along direction . Immediately after cleaving, the mica substrates were transferred to the hot wall epitaxy (hwe) chamber . The hwe technique was applied for the deposition of the organic material, which allows us to perform the growth process close to thermodynamic equilibrium, and in further consequence relatively high vapor pressure of the organic deposit in the substrate region can be achieved . Therefore, the requirements concerning vacuum conditions are reduced compared with, for example, molecular beam epitaxy . The source material nnn was purified twice by thermal sublimation before filling it into the quartz tube of the hwe reactor . Muscovite mica substrates were transferred into the deposition chamber via a load lock and subsequently preheated at the deposition temperature (80 c) for 30 min to ensure a stable temperature during the whole deposition process . The deposition was performed thereafter under a base pressure of 9 10 mbar . Optical microscope images have been acquired by a nikon labophot 2a microscope in combination with a nikon type 115 digital camera . Scanning force microscopy (sfm) studies of the deposited organic films were performed using a digital instruments dimension 3100 in the tapping mode . The 10 10 m images have been acquired at scan speeds of 46 m / s using sic tips (masch, hq: nsc15/al bs) exhibiting a cone angle of 40. nominal values for resonance frequency and tip radius are 325 khz and 10 nm, respectively . X - ray diffraction (xrd) measurements were carried out on a philips xpert x - ray diffractometer using cr k radiation (= 2.29) and a secondary graphite monochromator . Please note that the monochromator is transparent for, /2, /3, etc ., so despite the weak intensity of the bremsspektrum, it can give clear bragg peaks due to the scatting on the single crystalline mica substrate . Specular scans were performed in bragg brentano configuration by varying the z - component of the scattering vector q. consequently it is possible to detect lattice planes that are parallel to the sample surface . Pole figures were acquired by measuring at a constant length of q and only varying its direction . The unit cell parameters of nnn, which were used for analysis, are defined by a = 8.148 0.005, b = 5.978 0.005, c = 19.45 0.2, and = 94.6 0.2 describing a monoclinic lattice (p21/a). The unit houses two nnn molecules in planar configuration . The van der waals (vdw) interaction between the organic molecule and the dielectric substrate is modeled by lennard - jones - type potentials . Corresponding parameters are taken from the universal force field implemented in a matlab program . The molecules and substrates are assumed to be rigid where the internal structure of an isolated nnn molecules is determined from the crystal structure . Simulations were performed for the adsorption of a single nnn molecule as well as a crystal stack . By assuming that a single nnn molecule prefers to lie flat on the surface, the energy minimization procedure is simplified in the following way: we consider only four molecular degrees of freedom, the x-, y-, and z - positions of the molecular center of mass and the angle . The angle defines the azimuthal molecular alignment and is probed by rotating the nnn molecule around the z - axis (surface normal). We perform a grid - based optimization to search for the best molecular adsorption geometry using a grid of 81 81 points for the lateral position . The adsorption angle was tested with a step size of = 1. the surface structure of the substrate has been assumed to be the same as in the bulk where the corrugation is about 0.2 . The substrate surface is assumed to be terminated by the tetrahedral layer of muscovite mica . For the simulation of the 7 2 nnn stack, the molecular packing has been deduced from the crystal structure of a (111) orientated nnn crystallite . Due to the presence of flat and edge - on molecules, the adsorption distance has been optimized, yielding a distance of 1.6 of the lowest h atom of edge - on nnn molecules to the substrate surface . Because energetic minima are significantly narrow for the molecular stack, an angular resolution of = 0.5 has been chosen for the calculations . In a first step, nnn was deposited by hot wall epitaxy (hwe) on muscovite mica(001). Whereas the substrate temperature was kept constant at 80 c, the deposition time was continuously increased . Scanning force microscopy was chosen to study the sample morphology versus deposition time, and obtained images (10 10 m) are depicted in figure 2 . As the maximum height scale z0 significantly changes with increasing deposition time, the corresponding values are indicated for each sample . The morphology of all samples is dominated by the presence of several micrometer long needle like structures that are aligned along multiple orientations . As exemplified by the cross - section (1), these fibers reach height levels up to 200 nm and are characterized by similar dimensions in width . A more detailed analysis is provided in figure 2a, plotting the mean needle height versus growth time . As indicated by the solid line, the growth rate can be approximated by a linear fit, yielding a slope of 17.8 1.2 nmmin . Interestingly, the fibers surface coverage is approximately constant for the whole sample series yielding a value of 12.5% . The sfm analysis reveals that flat islands start to nucleate at the side walls of the fibers and continuously fill the substrate surface between the fibers with increasing deposition time . The latter observation is underlined by analyzing the islands surface coverage, which is depicted in figure 2b as a function of growth time . The solid line, which represents a guide for the eye, indicates an asymptotic approach to 85% of the surface area . Again, a representative sample position has been chosen to deduce a cross - section (2), which is presented in the bottom right of figure 2 . As reported for other rod - like molecules, a steplike morphology with height levels in the range of 1.82 nm the obtained value corresponds to approximately one monolayer of upright standing nnn molecules . Contrarily, the step size of the boundary, defined by the islands and the substrate surface, is significantly larger reaching values in the range of 15 nm . These steps are further characterized by straight extensions, which suggest the formation of well - defined crystal facets . Scanning force microscopy (sfm) images showing the sample morphology versus deposition time . All samples are dominated by needle - like structures . With increasing growth time, island - like structures start to nucleate at the needle side walls covering continuously the substrate surface between the fibers . Exemplary cross sections for both morphologies are indicated in the bottom part of the figure . As indicated in part a, the height of the fiber like structures linearly increases with growth time reaching values of some 100 nm . Contrarily, the surface coverage by needles stays approximately constant (part b). Step heights in the center part of the islands approximately correspond to a monolayer of upright standing molecules . In a next step, x - ray diffraction (xrd) has been chosen to study the structural properties of the organic crystallites . In order to obtain sufficient diffraction intensity, a sample with 216 nm high nnn fibers has been selected . Figure 3a reports the acquired specular xrd diffraction pattern, which is dominated by a series of {00n} diffraction peaks . These peaks are characteristic for island - shaped crystal morphologies, built up by approximately standing nnn molecules, and are consequently abbreviated by s - orientations (q001 = 0.324). Arrows in the upper part of figure 3a indicate the positions of (00.2n) diffraction peaks stemming from the muscovite mica(001) substrate . Additionally, a diffraction peak arises at qz = 1.36, which correlates with (111) orientated nnn crystallites, abbreviated as b orientation . The orientation is characteristic for a nearly flat lying molecular configuration and thus explains the presence of needle - like crystallites as revealed by sfm analysis . A more detailed analysis is reported in the supporting information . In order to analyze the azimuthal alignment of the nnn crystallites relative to the muscovite mica(001) substrate, xrd - pf measurements have been performed and are reported in figure 3b . For a profound analysis, xrd - pf have been acquired with a maximum sensitivity to diffraction intensities stemming from the scattering at {202} and {201} netplanes and are depicted in the bottom leftand right part of figure 3b . The diffraction intensities show a distinct azimuthal distribution, which underlines a well - defined epitaxial relationship to the muscovite mica substrate . The obtained symmetry of the diffraction intensities further underlines the presence of an terminated muscovite mica surface, which is characterized by a mirror plane along the [110]mica orientation . The orientation of the substrate has been determined from diffraction patterns stemming from muscovite mica (001) and are indicated by black solid circles . Xrd - pf patterns of the organic crystallites can be constructed by mirror operation from the top hemisphere, sketched by a gray shaded sector . Moreover, the xrd - pf patterns reveal a 2-fold rotational symmetry, which can be understood by an approximately equivalent adsorption energy for 180 turned organic crystallites . Consequently, discrimination between both crystal alignments has been omitted and simulated 2-fold symmetric diffraction spots are labeled identically . Based on these geometrical considerations, only the diffraction spots of a single quadrant have to be analyzed and labeled . (a) specular x - ray diffraction (xrd) spectrum of nnn on muscovite mica(001). Scanning force microscopy images revealed a needle height of 216 nm for the chosen sample . The spectrum is dominated by a series of s (001) diffractions peaks, which are representative for island - like morphologies . (b) xrd pole figure (xrd - pf) analysis of {202} and {201} diffraction peaks, providing information about the azimuthal crystal orientation . As indicated by the simulated pole distribution (bottom), all diffraction spots can be explained by the presence of three differently aligned (001) crystallites, labeled as s13 (red). The mirror symmetry plane of the muscovite mica (001) surface is indicated by a horizontal line, which explains the presence of mirrored s13 * crystallites (blue) with a (001) contact plane . Moreover, xrd - pf reveal a well - defined azimuthal orientation of b1 (111) crystallites (red circles). Again mirror symmetric crystallites b1 * (111) are indicated by blue symbols . Diffraction intensities from the muscovite mica substrate are indicated by black solid filled circles . Diffraction intensities that are characteristic for s - orientated crystallites are located at = 63 (74) in the left (right) xrd - pf, and their azimuthal distribution can be explained by the presence of three crystal orientations labeled as s13 . Consistently, both xrd - pf measurements hint the strongest diffraction intensities originating from s1 crystallites . Diffraction spots, which can be attributed to b * (111)/b (111) crystallites are expected to appear at 51 for both diffraction geometries and are marked by blue / red filled circles . As each quadrant reveals the presence of one diffraction spot, the azimuthal alignment of b orientated fibers again, mirror symmetric crystals are labeled as b1 * and are characterized by a (111) contact plane . Based on the simulated xrd - pf diffraction peaks, the long needle axis (lna) and long molecular axis (lma) orientations of b orientated fibers have been deduced and are presented in figure 4 by solid filled arrows . Whereas the lna coincides with the [110] orientation, the lma can be approximated by the alignment of [101] relative to the muscovite mica substrate . Mirror symmetry of the muscovite mica substrate leads to the generation of two energetically equivalent crystallites . Fibers that are built up by b1 * (111) orientated crystallites (blue) are aligned with their lna (lma) 59.5 (49) relative to the muscovite mica substrate s [110]mica crystallographic orientation . Contrarily, their mirror symmetric twins (b1) can be constructed by flipping the b1 * crystallites upside down (red arrows), azimuthally aligned with their lna (lma) 59.5 (49) relative to [110]mica . In order to verify the lna alignment, which has been constructed based on xrd - pf measurements, optical microscopy has been chosen, and an image of a representative sample area is depicted in figure 4 . The sample morphology is dominated by fibers that are aligned in a v - shaped, herringbone fashion . As indicated by large red and blue arrows, which represent the expected b1 and b1 * lna orientations deduced by xrd - pf analysis nevertheless, additional needle orientations, which are present in minor fraction, can be observed and are marked by small red (b2) and blue (b1 *) arrows, respectively . In order to gain better statistics, a microscopy image of a larger sample area has been chosen to perform a fast fourier transformation (fft) and the obtained pattern is depicted beside . The fft is dominated by two stripes, which are characterized by an enclosing angle that perfectly reflects the lna orientation of b1 and b*1 crystallites (indicated by red and blue arrows). Long needle axis (lna) (left) and long molecular axis (lma) (right) orientations of b1 (red solid filled arrows) and mirror symmetric b1 * (blue solid filled arrows) crystallites, deduced by x - ray pole figure (xrd - pf) measurements . In the outer ring of the lna polar plot, additionally the [110] crystallographic orientations of s13 (red) and it is visualized that the [110] crystallographic direction of s1 crystallites provides the same azimuthal orientation as the lna of b1 fibers . Below, the obtained lna orientations are verified by the observed sample morphology using optical microscopy . Beside b1 and b1 * fibers additionally minor fractions of approximately horizontally aligned crystallites are observed (marked by small red and blue arrows). By using fast fourier transformation (fft) (depicted beside), the dominant fraction of b1 and b1 * crystal orientations is further underlined . In a next step in particular, the azimuthal alignment of their [110] directions has been deduced and is depicted in the outer ring of figure 4 (lna). Because s1 and s1 * crystallites represent the major fraction, they are indicated by large arrows approximately aligned 60 relative to [110]mica . The azimuthal orientation perfectly coincides with the lna of b1 and b1 * crystallites, which already suggests an epitaxial relationship of both crystal types . In order to analyze the latter observation in more detail, the sfm image, which is shown in figure 5, is dominated by two approximately vertically aligned fibers . Between fibers, the presence of an s orientated island can be observed, which is terminated in the bottom part of the image by a sharp l - shaped boundary . The observed boundary shape perfectly correlates with the expected angle between the and [110] crystallographic orientations of an (001) orientated crystallite . The generation of the observed crystal shape can be understood by the formation of (11n) and (11n) side facets, which represent low index planes for n = 1, 0, or 1 . An extracted cross - section of the observed fiber is presented in the left part of figure 5 . The observed fiber is terminated in the right part by a flat plane, which is aligned parallel to the substrate at a height of approximately 100 nm . Contrarily, the left side of the fiber shows a constantly decreasing height level . The slope of the side facet approximately correlates with a 25 nm decrease in height along 100 nm of the needle width (14). The lna of b * type crystallites is defined by their [110] orientation and consequently all crystallographic planes (11n) are aligned parallel to it . Because the angular tilt of 13.8 between the low index planes (110) and (111) perfectly correlates with the observed sfm analysis, the theoretically expected cross - section of a b1 * fiber has been modeled and is depicted below the experimental data . Although, the observed steep height decrease at the fiber side walls is below the resolution limit of the sfm, a termination of the fibers by (001) and (001) facets can be assumed . Scanning force microscopy (sfm) image showing vertically aligned fibers and s orientated islands in between after the deposition of 60 min nnn at 80 c substrate temperature . The island s boundaries correlate with the geometrical alignment of and [110] orientations . The extracted fiber cross - section (top, left) can be explained by the formation of (111), (110) and (001) facets . Based on the observed crystal shapes, their crystallographic orientations relative to each other has been deduced and is visualized by a 3d model below . The epitaxial relationship between fibers and islands is consistent with the structural analysis and can be explained by a nucleation of nnn molecules at the fiber side walls, also called ledge directed epitaxy . Based on the latter analysis, a three - dimensional model of both crystal types has been generated and is depicted in the bottom part of figure 5 . As indicated by the xrd - pf analysis, which is presented in figure 4 (lna), b1 * and s1 * crystallites shared the same azimuth for their crystallographic [110] orientations . In that way, the tilt angle of standing nnn molecules within the s - type crystallite approximately correlates with the tilt angle of the fiber (001) low energy plane . Analogous observations were demonstrated for 6 t fibers and are explained by the nucleation of islands at the sidewalls of already existing needles . Moreover, the latter picture is perfectly consistent with the sfm analysis presented in figure 2, which reports a continuously increasing island coverage for longer deposition times . Such epitaxial alignment based on a geometrical fit between nucleating crystallites and already existing topographic features on the substrate is called ledge directed epitaxy . Based on the latter analysis together with xrd - pf data presented in figure 4 (lna), it can be concluded that the minor fraction of s23 crystallites has most likely nucleated at b - type fibers, which are orientated approximately 30 tilted relative to [110]mica of the muscovite mica substrate . This conclusion is further consistent with the microscopy image, presented in figure 4, revealing the presence of a minor fraction of such fibers (below the detection limit of xrd - pf measurements), which are subsequently labeled by b2 and b2*. In order to understand the observed growth behavior of b1 and b2 fibers on muscovite mica(001), the left part of figure 6 depicts a planar nnn molecule in gas phase . Analogous to 6 t, a planar molecule is characterized by a mirror plane h, which is aligned in the plane of the naphthalene rings, and a 2-fold rotational axis, which is aligned normal to h ., it should be assumed that single nnn molecules tend to adsorb lying flat on the muscovite mica substrate in order to maximize their contact area . In that way, h is orientated parallel to the substrate, and the molecule becomes chiral when adsorbed on an arbitrary surface . Molecules that are intrinsically achiral but obtain a form of 2d chirality when adsorbed on a substrate surface are also called prochiral . Analogous to 6 t, two mirror symmetric nnn enantiomers (sketched as red and blue molecules) can adsorb on the muscovite mica surface, which cannot be brought into congruence by translation and rotation . Taking a top view of the molecular stacking at the contact plane of b - type crystallites, which is depicted in the right panel of figure 6, reveals that (111) orientated fibers are built up by an alternating assembly of only one enantiomer (red) and edge - on nnn molecules . Contrarily, their twin crystallites b * (111) are built up by the mirrored molecular configuration (blue) only . The latter observation further explains the consistent choice of a red and blue color code for molecules and crystallites . Beside a real space model for b1 crystallites, which is deduced by xrd - pf analysis, the right part of figure 6 further includes the proposed geometry of b2 fibers . Based on a growth model that has been deduced for 6 t fibers, it is assumed that two needle orientations, for example, b1 and b2 * can originate from one molecular adsorption site . The existence of these two lna orientations is explained by a mirror symmetric molecular stacking during crystal nucleation . Interestingly, epitaxially grown 6 t on muscovite mica showed a comparable fraction of both stacking types, which explains the observation of four lna orientations . The latter phenomenon is further explained by force field simulations for both crystal types, yielding a similar adsorption energy with a deviation of some millielectronvolts / molecule . Contrarily, xrd - pf analysis revealed that nnn fibers are dominantly present only in one configuration, which reduces the observed lna orientations to two (see the fft in figure 4). Consequently, it can be stated that both crystal types seem to significantly differ concerning their adsorption energy, which should be investigated and underlined by the discussion of force field simulations within the next paragraphs . Molecular symmetry of a planar nnn in gas phase and when adsorbed flat on an arbitrary surface . Due to the presence of a mirror symmetry plane h parallel to the naphthalene rings and a 2-fold rotational axis, aligned normal to it, the nnn molecule in gas phase can be described by the c2h point group . Contrarily, when adsorbed flat on a substrate surface, nnn can form two mirror symmetric enantiomers (sketched by red and blue molecules), which follow c2 symmetry . The right panel depicts a real space model of the discussed crystal orientations (top view). The molecular alignment of nnn within the surface unit cell has been deduced from its bulk structure, oriented with a (111)/(111) contact plane for b / b * crystallites . The orientation of the long molecular axis (lma) or long needle axis (lna) is indicated by blue or red arrows . Taking a closer look at the molecular stacking at the contact plane of b - type crystallites reveals that (111) orientated crystals are alternately assembled by red enantiomers and edge - on nnn molecules . Contrarily, their mirror symmetric twins b * only consist of blue molecular configurations . The real space image of b1 (b1 *) and b2 * (b2) the adsorption energy as a function of the long molecular axis (lma) orientation () is depicted in the top panel in terms of a polar plot . Red and blue arrows indicate the molecular orientation deduced by experiments . At the indicated positions, force field simulations reveal a broad maximum for the corresponding enantiomer . Contrarily, the adsorption site seems less favorable for the mirror symmetric molecule (e 20 mev). A real space model that sketches the lateral position for the molecular adsorption angle at = 57 simulations reveal a preferred alignment of the terminating naphthalene units in the surface corrugations of the muscovite mica substrate (indicated by horizontal lines). Below, an analogous analysis has been done for a 7 2 molecular stack representative for the contact plane of a b (111) crystallite . Simulations reveal a strongly pronounced adsorption maximum at the experimentally observed adsorption angle (red arrow) and a significantly different adsorption energy for a b * crystal with opposite stacking sequence (blue arrow, e 300 mev / molecule). A real space model of the optimized adsorption position is depicted in the right panel . By comparing the alignment of the nnn molecules with the muscovite mica unit cell, an approximately periodic alignment can be recognized along mica/[110]mica for an / terminated surface . In a first step, the optimal adsorption energy of a single nnn molecule has been deduced based on force - field simulations by selecting the most favorable adsorption site for each angle . The angle characterizes the azimuthal alignment of the lma relative to mirror symmetry plane of the muscovite mica substrate surface . The molecules are assumed to adsorb flat on the substrate and the adsorption energy, ead, is defined as the difference between the energies of the isolated subsystems and the energy of the combined system . Therefore, maxima in the ead versus curves evidence the favorable adsorption geometries . To increase the readability, ead curves are presented in figure 7 in terms of a polar plot, where ead = e0 ead . The parameter e0 represents the adsorption energy at the least favorable angle, yielding a value of e0 = 2.49 ev for the isolated molecules . Because nnn molecules can adsorb either in their left- or right - handed configuration, simulations have been performed for both enantiomers and are color coded by red- and blue - filled curves . Simulations yield, for both molecular configurations, multiple adsorption maxima, which are located for the blue marked enantiomer at max, blue = 42, 57, 102, 161, and 178. due to 2-fold rotational symmetry of the nnn molecule, identical values are obtained for ead(+180). Moreover, optimized adsorption positions for the red molecular type are found at max, red = max, blue due to mirror symmetry of the substrate surface . Experimentally obtained adsorption angles are further indicated by a blue (red) arrow at = 49 (131). Both adsorption angles correlate with the broadest maxima obtained by simulations and are importantly consistent with the simulations of the corresponding enantiomer . The fact that beside experimentally observed adsorption geometries force field calculations also yield additional maxima is attributed to the usage of empirical potentials, which in some cases may yield the wrong energetic ordering of competing structure solutions . Nevertheless, it has to be underlined that simulations indicate a significant less favorable adsorption site for the mirror symmetric molecular configuration (20 mev). In general, adsorption energies for both molecular configurations significantly differ, which in further consequence leads to a nonequal distribution or even breakup of both enantiomers depending on the adsorption angle . Contrarily, simulations as well as experimental data that are reported for 6 t indicate a significantly lower energetic splitting between both molecular configurations, which may result from a higher symmetry of the molecule . The latter statement can be understood by the fact that thiophene molecules with an odd ring number, for example, quinquethiophene or septithiophene, are characterized by a mirror symmetry plane when adsorbed on a surface and consequently do not show a prochiral character . Contrarily, the asymmetric alignment of the c c bond between two naphthalene units of nnn inevitably leads to a prochiral behavior when adsorbed on a substrate surface and consequently plays an essential role concerning the energetic separation of both enantiomers at a defined adsorption angle . The experimentally confirmed adsorption position of nnn molecules is further depicted in the right part of figure 7 . For both molecules, an adsorption angle = analogous to calculations for p-6p and 6 t, nnn molecules tend to align their rings in the surface corrugations, which are indicated by vertical solid lines . In order to study the adsorption energetics of a b - type crystallite, a 7 2 molecular stack has been deduced from a (111) orientated crystallite . Analogous to the force field simulations of an isolated molecule, the adsorption energy ead for the stack has been probed depending on the molecular orientation and the adsorption energy at the least favorable adsorption angle is given by e0 = 0.41 ev / molecule . Because the curve calculated for the a b * (111) stack follows the same behavior as discussed for a single molecule (mirror symmetric), only the results for a b contact plane are depicted in order to increase readability . Interestingly, simulations reveal that not only the number of energetically favorable adsorption sites decreases but also the angular acceptance, which becomes visible by well pronounced peaks . Simulations further indicate the presence of two adsorption maxima, which are located at = 12 and 48. again, the experimentally obtained adsorption angle for b1 crystallites is indicated by a red arrow and underlines a nearly perfect agreement . Moreover, it can be recognized that the adsorption energy for a b2 crystal (at + 48) becomes even more unfavorable than that for a single molecule, which is manifested by a much lower value of ead in the range of some 100 mev / molecule . Consequently, force field simulations not only reflect the experimental observations but also explain the dominant fraction of b1 crystallites by a preferred nucleation of their stacking sequence in contrast to b2 crystallites . The observed behavior can be even better understood by analyzing the real space model of the simulated adsorption position at = 48. besides the molecular alignment, also the surface unit cells of the muscovite mica and b crystal have been indicated . Obviously, the unit vector [110] of the nnn crystal stack, which also defines its lna, tends to align parallel to one surface unit vector of the muscovite mica crystal, which is defined by the mica, ([110]mica,) orientation for an () terminated surface . The epitaxial growth of ternaphtalene (nnn) on muscovite mica(001) has been investigated by combining structural (xrd - pf) and morphological (sfm) methods . Consistently, both methods reveal the formation of s (001) orientated nnn island - like structures which have nucleated at the sidewalls of b (111) orientated fibers . It is demonstrated that the latter nnn crystal types tend to align along two dominant directions, which leads to the formation of a v - shaped sample fiber morphology . Because the tilt angle of nnn molecules within s - orientated crystallites correlates with the tilt angle of the fiber side facets, the island nucleation is explained by ledge directed epitaxy . Based on this growth model, it can be understood that both crystal types provide a well - defined azimuthal orientation relative to the muscovite mica substrate . By use of force field simulations, the growth of the fibers is further analyzed . The epitaxial growth of sexithiophene (6 t) on muscovite mica showed the formation of four well - defined fiber orientations, which can be explained by mirror symmetry of the muscovite mica substrate and two differently stacked 6 t crystallites, which can nucleate at a molecular adsorption position . Contrarily, experimental investigations indicate that nnn crystallites tend to stack in a single configuration, which explains the dominant formation of only two fiber orientations . Based on force field simulations, the latter observation is further investigated and explained by significantly different adsorption energies of both crystal types . It is further demonstrated that the observed behavior results from an interplay of the molecular adsorption and lattice match.
|
A-38-year - old female patient consulted to our emergency outpatient clinic with complaints of fever, sore throat, coughing, shivering, chills, joint, and muscle pain, headache, chest pain continuing for nearly 2 weeks and she was hospitalized to investigate the etiology of fever . Physical examination findings were as follows: bp 130/80 mm hg, body temperature, 39.8 c; hr 120/min; moderately well general physical status with full cooperation, markedly hyperemic pharynx, and tonsils, herpetic rashes around her lips, bilaterally diminished respiratory sounds heard over basal segments and tachycardia . Her neck rigidity was evaluated however the kernig, and brudzinsky signs could not be elicited . Laboratory test results were as follows: hb 11 g / dl (12.117.2), mcv 80.8 fl (82.299), wbc 22.10 k / ul (410), neu 90.5% (3773%), esr 92 mm / s (020), procalcitonin 0.8776 ng / ml (<0.1), total protein 5.66 g / dl (6.48.3), albumin 2.9 g / dl (3.55), inr 1.15 (11.5), ferritin 2889 ng / ml (14150). Glucose, creatinine, ast, alt, alp, na, k, complete urinalysis, ana, rf, and ena profile were unremarkable . On thoracal imagings, bilateral hilar lymph nodes of which the largest being 2 cm in diameter, bilateral pleural effusion, and atelectasic areas in the parenchyma surrounding the pleural effusion were observed (figure 1, 2). On abdominal tomograms, no bacterial growth was detected in urine, throat, csf, and blood cultures . Lumbar punction performed because of suspect neck rigidity did not reveal any abnormal cells in csf . Cephtriaxone at daily parenteral doses of 2 g). During follow - up period, rashes, and swelling on her right, and left wrists were detected, so she was consulted to rheumatology clinic, and naproxen sodium therapy was started with the indication of suspect aosd . On physical examination dullness over traube s space however her hyperfebrile state persisted, echocardiograms obtained for the differential diagnosis of infective endocarditis . Posteroanterior chest radiogram costodiaphragmatic sinuses are not distinctly visualized, high - lying diaphragms, and an enlarged mediastinum were observed . Biochemical analysis of the fluid drained by thoracenthesis of the patient whose computed tomograms demonstrated bilateral pleural effusion revealed the presence of 2 gm / dl albumin, 3.34 g / dl protein, 483 u / l ldh (concurrent serum albumin 2.9 gm / dl, total protein 5.99 g / dl, ldh 393 u / l). Antibiotherapy of the patient with pleural effusion (exudate) was discontinued, and methylprednisolone treatment at daily doses of 16 mg was initiated . After initiation of steroid therapy, she maintained an afebrile state, her joint manifestations regressed, and her complaints decreased during her follow - up period . The patient whose pleural effusion completely regressed with steroid therapy discharged to be further followed up by rheumatology outpatient clinic (figure 3). Adult onset still s disease is a disease whose diagnosis can be made by excluding infectious, malign, autoimmune, and autoinflammatory diseases, and in consideration of its characteristic clinical, and laboratory findings . For definitive diagnosis, yamaguchi criteria can be used . Its major criteria consists of higher body temperature at 39c lasting for at least one week, marked nonpruritic macular / maculopapular salmon - colored rashes on the torso or extremities persisting for at least 2 weeks, leukocytosis (> 10.000/ml), and neutrophilia (> 80%). Minor criteria include sore throat, lymphadenopathy, hepatomegaly or splenomegaly, abnormal hepatic function tests (increases in especially ast, alt, and ldh levels), and ana, and rf negativities . For the establishment of diagnosis, 5 diagnostic criteria (including at least 2 major criteria) should be met . In our patient, during approximately 4 weeks up to initiation of steroid therapy, fever exceeding 39c every day, symptoms of arthralgia, marked arthritis of both wrists, leukocytosis, neutrophilia, sore throat, and lymphadenopathies fulfilled the required diagnostic criteria, and pleural exudate seen during the clinical course of the disease was assessed to be associated with the disease . In the adult onset still s disease pleural effusion, transient pulmonary infiltration, and pericarditis can be seen in 3040% of the patients . Affected individuals may complain of mild episodes of coughing, pleuritic chest pain, and shortness of breath . Even in some patients it may progress to acute respiratory distress syndrome (ards) [6, 7]. Rarely, myocarditis, arrhytmias, heart failure, and cardiac tamponade can be seen . Myocarditis, and ards are more frequently seen especially in patients with mas . In the differential diagnosis, infectious diseases (ebv, cmv, hbv, rubella, parvovirus, coxsackie, hiv, subacute bacterial endocarditis, meningococcemia, tuberculosis, syphilis); vasculites (takayasu arteritis, polyarteritis nodosa, serum disease, thrombotic thrombocytopenic purpura); malign diseases (leukemia, lymphoma), connective tissue diseases (ra, sle, mixed connective tissue disease), granulomatous diseases (sarcoidosis, crohn disease); autoinflammatory diseases (kikuchi disease, sweet syndrome), and drug hypersensitivity reactions should be considered . In our patient serological tests, cultures, and imaging modalities were used for differential diagnosis which led to the establishment of the diagnosis of aosd . Higher ferritin levels are among the most important laboratory findings of aosd, however markedly lower glycosylated ferritin levels are detected (<20%). Increased ferritin level is an indicator of the disease activity, and also a serologic marker of treatment response . In our patient ferritin levels may increase as a response of hepatocytes to cytokines as il-18, and il-1b which may be thought to play a role in the pathogenesis of aosd . As the first - line therapy nsaids (especially endomethacin), and corticosteroids are recommended . In cases of severe organ involvement pulsatile high doses of steroids for few days can be used, than daily dose is dropped down to 1 mg / kg . In cases of recurrence or with the intention to decrease steroid dose, methotrexate at a weekly dose of 7.525 mg can be given . Hydroxychloroquine, sulphasalazine, azothioprine, cyclosporine can be used separately or in combination with methotrexate . In recent years, effectiveness of biological agents (infliximab, etanercept, anakinra, and tocilizumab), and ivig therapies have been reported in the treatment patients with serious organ involvement, and mas . Still many characteristic features of aosd are not known, and a standard follow - up or a treatment protocol of the disease is not available . In patients who met diagnostic criteria, pleural effusion which may be seen in the clinical course of the disease should be presumably associated with the disease . Besides regression of pleural effusion can be expected with the treatment of underlying desease, additional locally invasive diagnostic, and/or therapeutic interventions should be avoided.
|
Dual - polymerizing resin cements have been extensively used for placement of indirect restorations and posts . The dual - polymerizing materials were developed to compensate for the lack of polymerization in the absence of light and to represent a combination of auto- and light - polymerizing components . In some clinical situations, such as in dark zones at the apical region and during the cementation of indirect restorations, the severe light attenuation results in low degree of conversion (dc), which can compromise the mechanical properties and consequently the longevity of the indirect restorations.14 modifications in the viscosity of the resin cements allow their use in different clinical situations . The option for low viscosity versions offer some benefits, such as minor thickness of the pellicle that was formed following the restoration placement . The lowest film thickness generates smaller polymerization shrinkage, reducing the possibility of gaps formation and premature marginal leakage.5,6 the difference in the cement formulations that change the viscosity is related to the proportion between resin matrix and filler particle content.7 high volume fraction of fillers can increase the viscosity and the elastic modulus and strength of composites.7,8 low viscosity or flowable resins and resin cements present lower filler loading than regular restorative materials . Most direct dental restorative composites use bisphenol - a - diglycidylether dimethacrylate (bis - gma), which is considered a very viscous monomer, and when mixed with higher filler loadings, it becomes a nearly solid mass and unusable product . Vinyl groups (e.g., ethylene glycol dimethacrylate) are added as a thinner or diluent monomer for uncured pastes, which are considered another approach to change the viscosity of resin - based materials . The filler loading and the viscosity of composites may interfere in the monomer conversion, since they could restrict the mobility of monomers and the propagation of polymerization reaction.7,911 the restorative resin - based materials must reach a high degree of monomer conversion in order to present better clinical performance and longevity and also to reduce the early failures . For the dual - polymerizing resin cements, the self - cure mode should ensure the high level of conversion, especially in the cervical proximal areas, the root canal and in the internal and deep areas of the cavity preparations.1214 several methodologies have been used to analyze the dc of resin - based materials; however, most of them use fourier transform infrared spectroscopy (ftir). Although many researchers have evaluated the polymerization effectiveness to determine the physical and mechanical properties of dental materials,9,15,16 little information is known about the influence of different viscosities of dual - cured resin cements on their physical properties, such as the degree of conversion in situations of self - and dual - polymerization . Thus, the purpose of this study was to measure the dc of two commercially dual - cured resin cements in different viscosities (low and high) when they were light - activated or when the materials were allowed to self - cure solely, after 5 minutes and 24 hours from the mixture of pastes (base and catalyst). The hypothesis tested was that curing mode, evaluation time and viscosity would affect the dc of the resin cements . Two commercial dual - cure resin cements in high and low viscosities were evaluated: variolink ii (ivoclar vivadent, schaan, liechtenstein) and nexus 2 (kerr corp ., orange, ca, usa). The resin cements consist of two paste components that were equally dispensed and mixed together according to manufacturers instructions . After mixing, resin cements (n=5) were applied to the horizontal attenuated total reflectance znse crystal at 45 (fourier transform infrared spectrometer, ft - ir spectrometer 520, nicolet instrument corp, madson, wi, usa) at room temperature . Adhesive tape (3 m, sumar, sp, brazil) was placed on the znse crystal surface to act as a spacer, ensuring standard thickness for all specimens (100120 mm). A mylar strip (quimidrol com . Ltda, joinville, sc, brazil) was placed over the cement and was pressed flat to spread the material on the crystal surface . The spectrum of unpolymerized material was obtained and the cements were either light - cured (dual - polymerizing mode) or allowed to self - cure only (autopolymerizing mode). Each specimen was left on the crystal surface and further spectra were obtained 5 minutes and 24 hours after post mixing . For light - cured groups, a halogen light curing unit (xl 3000, 3 m espe, st . Paul, mn, usa) was used during 40 seconds (600 mw / cm). The light intensity was periodically checked with a radiometer (curing radiometer, model 100, kerr corp ., orange, ca, usa). Spectra were obtained between 4000 cm and 750 cm at a resolution of 4 cm . Monomer conversion was calculated (%) according to the changes in the ratio between the absorbance peaks corresponding to the aliphatic (cc) (1638 cm) and aromatic (1608 cm) carbon double bonds prior to and 5 minutes and 24 hours after polymerization initiation for both curing modes.10 the aromatic peak is used as an internal reference because the intensity does not change during the polymerization reaction.9,11 the effect of curing mode, viscosity and time intervals on the dc were evaluated for each material . Three - way repeated measure analysis of variance (anova) (curing mode, viscosities and evaluation time) was performed and tukey s post - hoc test was used to detect pair wise differences among experimental groups . The data was analyzed using the statistical program sas 9.1 (sas institute, cary, nc, usa) and all statistical testing was performed at a pre - set alpha of 0.05 (p<.05). The statistical analysis of the data showed significant differences in curing mode, viscosity and evaluation time factors for both resin cements (p=.01). There was significant interaction between factors: the curing mode x evaluation time (p=.01). Other double - interactions and the triple - interaction (curing mode x viscosity x evaluation time) were not significant (p>.05). The dc of resin cements was higher when the materials were light - cured and when the low - viscosity versions were used than when self - curing mode and the high - viscosity resin cements were tested, respectively (p<.05). The results of this study showed that the curing mode (auto- and dual - polymerization), the viscosity (low or high) and the evaluation time (5 minutes or 24 hours) influenced the dc of resin cements . Thus, the research hypothesis stating that these factors would result in significant changes in the dc was accepted . As the dc is dependent on the monomeric composition and the concentration and type of the photoinitiator in each product,9,17 the statistical analysis comparing the dc between resin cements the main factors under study (curing mode, viscosities and time intervals) produced similar effects for the resin cements, which presented different formulations regarding the resin matrix composition and type and concentration of filler particles . The variations on the proportion of components of resin matrix and filler particles that produced the low and the high versions caused no difference in behavior between the two cements results.7 a high monomer conversion with cross - linked polymeric network formation is essential for the durability of the resin - based restorations.911 studies have shown the importance of a high dc of resinous materials in order to reach better mechanical properties, since the presence of a high amount of residual methacrylate monomers compromises the hardness, the abrasion and the fracture resistance . Moreover, the low dc can increase the sorption and the solubility, interfering in the color stability and mass loss of the resin cement.2,4,9,14,1720 the resin cements showed significant difference between the evaluation times, 5 minutes and 24 hours from the polymerization initiation, independently of viscosity or curing mode . Thus, the polymerization reaction for both resin cements continued after 5 minutes of the mixing of the base and catalyst pastes . The continuation of the chemical part of the polymerization reaction (benzoyl peroxide + tertiary amines) was primarily responsible for the increase of the dc after 24 hours . Additionally, the percentage of dc increasing after 24 hours was higher for the self - cure mode than the dual cure mode, which ranged from 38.3 to 42.4% and from 26.6 to 28.4%, respectively . The continuation reaction 24 hours after polymerization initiation resulted in a reduction of absorbance peaks that corresponded to the aliphatic carbon double bonds10 and the dual polymerization increased dc, which corroborates with several studies that compared the polymerization modes for resin - based materials.2,11,21,22 for both resin cements used in this study, the direct light - polymerization provided dc that was higher and ranged from 10 to 30% higher than those observed for the self - curing mode . Also, it was higher at 5 minutes (24 to 30%) than for 24 hours (10 to 12%) from the polymerization initiation . The auto - polymerization may be insufficient to result in an adequate dc for the long lasting restorations . Clinically, the low viscosity version ensured higher dc, and 24 hours elapsed time after setting of restoration is appropriate for the final appointment, since the higher dc could better support the final oclusal adjustments, finishing, and polishing procedures . The direct light - polymerization can be considered a limitation of this study, since the light is applied directly to the resin cement layer only at the periphery of restorations . On the other hand, the inner part of indirect restorations is reached by an attenuated light and resin cement may depend only on self - cure activation . Regarding the differences in the dc between high and low viscosities, higher mean values were found for low viscosity versions of both resin cements . Low viscosity materials can be due to lower filler loading and/or higher addition low viscosity diluents monomers . The low viscosity monomer allows better mobility and distribution of free radicals inside the resin material, which can increase the polymerization reaction and the monomer conversion.9 the increase of dc promoted by the low viscosity versions in percentage, following the polymerization mode ranged from 0.9 to 3.1% for the dual - polymerizing groups and ranged from 1.5 to 3.9% for the auto - polymerizing mode, which was the highest percentage among the groups from nexus 2 resin cement . For the variolink ii, dual - polymerizing groups ranged from 1.4 to 2.8%, while the auto - polymerizing mode ranged from 1.7 to 2.4% . The direct light - activation and the low viscosity version were important to provide higher dc for the dual - polymerizing resin cements . Twenty - four hours after seating the indirect restoration is appropriate for final oclusal adjustments, finishing, and polishing procedures, which are capable of generating stress to the resin cement layer.
|
The task force on child health and maternal health for the united nations millennium development goals reiterated the challenges of achieving the goals in its report who's got the power? Transforming health systems for women and children . While the technology and interventions exist to prevent or treat the vast majority of adverse health conditions that affect children and women of reproductive age, many continue to die and even more suffer from ill health [2, 3]. The central challenge to achieving these goals is to provide known interventions to the full population and at the right time when most known adverse outcomes can be prevented . Despite 15 years of the global safe motherhood maternal and child health is connected to social, economic, and environmental conditions . In resource - poor countries, aside from pre - existing risks for poor maternal and child health outcomes, global changes have introduced new risks to the health of women and pregnancy, including alcohol and tobacco use, over nutrition, and micronutrient malnutrition [5, 6]. Because not all the deficits in achieving adequate prenatal care are likely to be solved in the near future, and global factors that lead to increases in risk cannot be reversed, new strategies and policies to improve pregnancy outcome remain a high priority . One emerging policy is the role of preconception care as a complement to prenatal care . This report highlights examples of national programs and projects indicating that such approaches are feasible and acceptable to the population . These case studies on preconception care that were presented at the first national summit on preconception care, atlanta, usa, in 2005, range from a mature program in hong kong, to emerging programs in korea and belgium, and select program enhancement and recovery efforts in china . The family planning association of hong kong (fpahk) was founded in 1950 with an objective to reduce family size . The average number of children per woman declined from 4.5 in 1965 to 0.93 by 2004 . Having achieved a low birth rate, a number of sexual and reproductive health programs have been launched with the objective of improving reproductive outcomes . The pre - pregnancy preparation service was launched in 1998, in response to public demand for preconception care . The service integrates medical, counseling, and education services for couples planning conception to achieve the following outcomes: prevent and treat infections to safeguard the health of both partners and the fetus . Thalassemia is an important hereditary disease in hong kong, because approximately 8% of persons in the local population are heterozygous carriers of mutations for thalassemia . Couples with family history of hereditary diseases are referred for genetic counseling.all women are advised to consume folic acid.help couples understand their health and adjust their lifestyle to optimize pregnancy outcome.identify women who might have difficulty conceiving and to advise them to seek sub - fertility investigations early when indicated . For men, semen analysis is included in the package.help couples prepare for parenthood.help women with pre - existing medical illness understand the best timing for pregnancy, the effect of their illness on their pregnancy, the effect of pregnancy on their illness, the effect on her offspring, the need to adjust medication, and to avoid drugs with known or uncertain teratogenic effects.help women with gynecological diseases understand the impact of their diseases on conception and pregnancy . The role of assisted reproductive technology is discussed if appropriate.counsel couples with coital failure to help them consummate marriage . Prevent and treat infections to safeguard the health of both partners and the fetus . Thalassemia is an important hereditary disease in hong kong, because approximately 8% of persons in the local population are heterozygous carriers of mutations for thalassemia . Identify women who might have difficulty conceiving and to advise them to seek sub - fertility investigations early when indicated . Help women with pre - existing medical illness understand the best timing for pregnancy, the effect of their illness on their pregnancy, the effect of pregnancy on their illness, the effect on her offspring, the need to adjust medication, and to avoid drugs with known or uncertain teratogenic effects . Help women with gynecological diseases understand the impact of their diseases on conception and pregnancy . At the first visit, the woman fills in a health assessment checklist that include preexisting medical conditions and medication being taken, adverse gynecological history and history of abnormal pregnancy outcomes, and risk behaviors . This disc provides detailed information about the objectives of the service; the physical and genital checkup procedures; pregnancy preparation, e.g. Optimal body mass index, balanced diet, regular exercise, quit smoking and avoiding alcohol; fertility regulation including contraception, conception and sub - fertility; and information about the laboratory tests including hiv testing ., a nurse will explain all the normal reports first and then a physician performs the history, physical examination, and counseling to explain any abnormal results . The basic counseling and assessment is provided by non - specialists, although women with complicated problems are seen by specialists in obstetrics and gynecology or an internist . Regular case conferencing is conducted to enhance knowledge of the non - specialists and improve their counseling skills . The service fee is $600 hong kong dollars (usd $75) per couple which includes laboratory tests and one medical consultation . This low service fee is achieved through cost sharing with other sexual and reproductive health programs offered by the fpahk . The continuous flow of clients for the preconception service reflects public support and trust for the service . As may be seen in many emerging economies, south korea is experiencing decreasing birth rates (from 16.3 per 1000 live births in 1994 to 9.8 per 1000 live births in 2004) and decreasing infant mortality rates (from 9.9/1ive births in 1993 to 4.6/live births in 2004). Due to a high rate of unintended pregnancy, an increase in the rate of preterm delivery, a high rate of pregnancy termination following accidental exposure to potential teratogens during pregnancy, and low intake of folic acid, the society of maternal and fetal medicine made a decision to promote and enhance preconception care in south korea . The goals are to enhance primary prevention of birth defects and preterm birth, increase in intended pregnancy, decrease in unnecessary pregnancy termination, and recovery of a higher birth rate in korea to maintain population replacement levels . Education includes lectures for obstetricians and gynecologists as well as for child - bearing age women attending maternity services . Service delivery is clinic - based preconceptional counseling, medical protocol examination by a physician, and follow - up of women who want to have a baby . The preconception counseling clinic, based at the korean motherisk program at samsung cheil hospital, an affiliated university hospital, includes teratogen information service for pregnant and breast feeding women, as well as preconception counseling . The preconception care medical protocol is composed of a physical examination, laboratory tests, and a questionnaire . Of the women served, 40% reported no history of adverse reproductive outcomes, about 30% had history of spontaneous abortion, 13% had maternal disease, 15% had a baby with birth defect, and 2% had family history of genetic disease . However, careful review of medical and behavioral history indicated that 92% of preconception care attendees have at least one risk factor for adverse outcomes . Patients with specific problems such as a previous child with a birth defect are transferred to the department of maternal and fetal medicine . Also, pre - implantation genetic diagnosis is performed in the department of infertility, a service that predates the introduction of preconception care . This service resulted in a substantial reduction in pregnancy loss from 91% in 1995 to 19% to 203 among 260 couples with balanced chromosomal translocation . The korea motherisk program is supported by the samsung chiel hospital and is staffed by three university faculty members and rotating fellows in clinical medicine . Although no consultation fee is charged to the patients, laboratory expenses are paid for by the patients . Depending on family history and other factors and various rationale used for laboratory examinations, the maximum cost of such laboratory examinations can be as high as 150 usd per person . The current challenge is to market it to all women who plan pregnancy, and to assure that the health care system has the capacity to match the demand and expansion of the service to other parts of the country . Organization for birth and childhood), is a belgian governmental organization charged with the protection and promotion of health of women and children . Given the low fertility rates and high rates of birth defects (2 to 3% of all live births) in belgium, o.n.e launched a plan to assess the feasibility of implementation of preconception care in the french speaking part of belgium, the region with a population of 5 million people and about 50,000 births per year . This activity will be implemented through prenatal care, pediatric and gynecology clinics, as well as general practitioners, in partnership with genetic and counselling centers . An ad - hoc committee was formed to propose strategies, activities, financing options, and evaluation methods, starting with the development of evidence - based guidelines based on belgian epidemiological data . The committee proposed that the guidelines would be in accordance with the recommendations of the advisory committee of bioethics of belgium concerning genetic tests . The committee proposed also to organize a campaign targeting both the general public and health care providers to help market preconception care in primary care settings . The proposed guidelines include various serologic tests, screening of endocrine or genetic diseases, and preventive services including promotion of folic acid supplementation . The o.n.e . Developed a sustainable campaign plan to inform and sensitize the population about the benefits of preconception care, directing their efforts to individuals aged 15 to 45 years, health professionals including general practitioners, gynaecologists, paediatricians, midwives and all medical social workers, members of the family planning centres, and school health promotion centers . The first step in the social marketing campaign was the creation of the tools including folders, posters, and letters to professionals . These materials were reviewed by the ad - hoc committee and field tested among a selected group of social workers and the public . The second step will be an information campaign among men and women of reproductive age using posters, folders, and radio and television advertisements . Medical and social workers will also receive folders and posters for distribution to the target population and a letter to inform them about the purpose and methodology of the campaign . Medical practitioners will then receive the guidelines to help them with information to be shared with patients and the laboratory examinations to be conducted . The final step will be the evaluation process to assess behavioral changes both within the community and at provider level . The indicators will include advice received from providers by clients in participating facilities, referral of relevant clients to preconception visits by providers, uptake of preconception visits by clients, and compliance with suggested interventions by clients . The early phase of implementation of preconception care in primary care settings in belgium was a challenge, as it highlighted the need for a strong partnership of all institutions involved in maternal and child health care . A three - pronged approach to reducing mother - to - child transmission of hiv has long been advocated by global initiatives to reduce the burden of hiv / aids, but to our knowledge, never been implemented anywhere . This approach includes reduction of hiv infection among young couples through primary prevention and voluntary hiv counseling and testing (vct), voluntary avoidance of pregnancy by hiv infected couples, and finally antiretroviral treatment of pregnant women who are infected and subsequent management of outcomes in children . The unique premarital medical examination system prevalent in china and late onset of hiv transmission in china provided an opportunity to pilot implementation of the three - pronged strategy in guangxi province . Babu county (population 0.93 million) of hezhou city, guangxi province (population 48.9 million) experienced the fastest increase in reported hiv / aids cases in guangxi province between 1998 (18) and 2002 (629) since the first case was detected in 1997 . The epidemic concentrated among the younger age group (90%, age 2049 years) of the population and predominantly rural farmers (70%). Given the demographics of the affected population and because the condom usage rate was low in this population (std clients 5%, drug users 5%, sex workers 40%), the potential for mother - to - child transmission was evident . To reduce the impact of hiv on women, children and families, the county health department in 2001 embarked on a three - pronged approach embedded in the mandatory premarital medical examination system . A feasibility survey in the region had indicated that the majority of the population and public health community were supportive of the concept . The activities included family and community awareness, preconceptional voluntary hiv counseling and tests for couples (pvct), and vct and antiretroviral therapy to hiv infected pregnant women . To facilitate pvct and the antenatal vct and antiretroviral treatment component, 40 antenatal and maternal / child care clinicians were trained . To facilitate the broad based interventions, 942 medical and public health professionals and barefoot doctors were trained on vct and other prevention approaches . To facilitate the community engagement process, training seminars using a combination of entertainment and educational films and media slides were conducted in middle schools and high schools for students as well as adults in the catchment's area . An one - time pre- and post test (8800 respondents) evaluation using structured questionnaire was conducted in selected locations . The students were required to take educational materials (100,000 copies) to their homes to educate parents and neighbors as part of their homework requirements . Information on hiv and vct opportunities were displayed on the community information blackboard, which is the usual tool for disseminating information on public health, legislative, and social policies to villagers and updated frequently by community volunteers . In the first quarter after launching the program (october to december 2002) an average of 1099 (73%) of the 1500 eligible couples each month sought pvct consultation, and 52% of them (or 38% of eligible couples) accepted hiv testing . By the end of 2003, the pvct consultation rate among eligible couples increased to 77% and hiv testing rate among them reached 80% (or 62% of all eligible couples). The main challenge to this approach was the change of legal requirement of premarital medical examination from mandatory to voluntary status in october 2003 . Our pilot efforts indicate that screening for hiv in the preconception period is feasible and acceptable in this rural community . A combination of testing strategies implemented at various stages before and during pregnancy would help identify all women at risk for hiv - exposed pregnancies . Given that the community is aware of the concept of premarital medical examination, social marketing techniques using family health enhancement as a core benefit, and efforts to regain the conceptual interest of population in preconception care are needed . In october 2003, the longstanding mandatory chinese requirement for couples planning marriage to obtain a premarital health check, a routine physical examination, laboratory tests, and reproductive health education, was removed, and this visit became voluntary . Reported rates of premarital examinations plummeted, and health officials voiced concern that women were not receiving adequate risk assessment and pre - pregnancy education, particularly regarding the benefit of folic acid in preventing neural tube defects . To assess the feasibility of increasing the rate of preconception care uptake, we conducted a pilot social marketing effort in a northern county (mancheng, in hebei province) during february and march, 2004 . We used a three - stage process: 1) ascertain the nature of the problem regarding delivery of preconception care through the use of a series of questionnaires and interviews, 2) develop a test plan to promote preconception care, and 3) evaluate and refine the plan . Overall, 91% of 10,000 questionnaires were completed, and 140 subjects were interviewed, including women of reproductive age, maternal and child health workers, and local government officials . The major obstacles to preconception care included the following: a) lack of systematic organization of these services within the health care system; b) poor coordination between governmental organizations involved in marriage, family planning and health care; c) unclear media messages; and d) the perception of the term voluntary by women to mean unnecessary . The implementation plan included the use of social marketing to solicit government support, coordinate with various government organizations, train maternal child health (mch) workers at all levels, and to market the concept of preconception health care to women of childbearing age . To solicit government support, we established a project coordination committee, including high - level officials from the county project office, the county women's office, the bureaus of health, family planning, and civil administration, and the women's federation . In addition, a series of face - to - face interviews were conducted with government officials, workshops were held in the county, and an official document was issued by the county government . Recommendations were developed for improving coordination among government departments and organizations, including development of an education program that can be presented by the mch institute, the marriage registration office, and the family planning office, whenever women have contact with the system . Such recommendations were shared with all stakeholders . Following the workshop, 95% of women reported that they would be willing to pay up to rmb 100 (us$12) for preconception health care services, and half indicated that more and better health messages were needed . Improving coordination among government agencies, developing training materials targeted to different groups, and promulgating clear, consistent messages concerning the importance of preconception care that are delivered in all settings where women may have contact with the system before pregnancy can create demand for preconception services . The family planning association of hong kong (fpahk) was founded in 1950 with an objective to reduce family size . The average number of children per woman declined from 4.5 in 1965 to 0.93 by 2004 . Having achieved a low birth rate, a number of sexual and reproductive health programs have been launched with the objective of improving reproductive outcomes . The pre - pregnancy preparation service was launched in 1998, in response to public demand for preconception care . The service integrates medical, counseling, and education services for couples planning conception to achieve the following outcomes: prevent and treat infections to safeguard the health of both partners and the fetus . Thalassemia is an important hereditary disease in hong kong, because approximately 8% of persons in the local population are heterozygous carriers of mutations for thalassemia . Couples with family history of hereditary diseases are referred for genetic counseling.all women are advised to consume folic acid.help couples understand their health and adjust their lifestyle to optimize pregnancy outcome.identify women who might have difficulty conceiving and to advise them to seek sub - fertility investigations early when indicated . For men, semen analysis is included in the package.help couples prepare for parenthood.help women with pre - existing medical illness understand the best timing for pregnancy, the effect of their illness on their pregnancy, the effect of pregnancy on their illness, the effect on her offspring, the need to adjust medication, and to avoid drugs with known or uncertain teratogenic effects.help women with gynecological diseases understand the impact of their diseases on conception and pregnancy . The role of assisted reproductive technology is discussed if appropriate.counsel couples with coital failure to help them consummate marriage . Prevent and treat infections to safeguard the health of both partners and the fetus . Thalassemia is an important hereditary disease in hong kong, because approximately 8% of persons in the local population are heterozygous carriers of mutations for thalassemia . Identify women who might have difficulty conceiving and to advise them to seek sub - fertility investigations early when indicated . Help women with pre - existing medical illness understand the best timing for pregnancy, the effect of their illness on their pregnancy, the effect of pregnancy on their illness, the effect on her offspring, the need to adjust medication, and to avoid drugs with known or uncertain teratogenic effects . Help women with gynecological diseases understand the impact of their diseases on conception and pregnancy ., the woman fills in a health assessment checklist that include preexisting medical conditions and medication being taken, adverse gynecological history and history of abnormal pregnancy outcomes, and risk behaviors . This disc provides detailed information about the objectives of the service; the physical and genital checkup procedures; pregnancy preparation, e.g. Optimal body mass index, balanced diet, regular exercise, quit smoking and avoiding alcohol; fertility regulation including contraception, conception and sub - fertility; and information about the laboratory tests including hiv testing ., a nurse will explain all the normal reports first and then a physician performs the history, physical examination, and counseling to explain any abnormal results . The basic counseling and assessment is provided by non - specialists, although women with complicated problems are seen by specialists in obstetrics and gynecology or an internist . Regular case conferencing is conducted to enhance knowledge of the non - specialists and improve their counseling skills . The service fee is $600 hong kong dollars (usd $75) per couple which includes laboratory tests and one medical consultation . This low service fee is achieved through cost sharing with other sexual and reproductive health programs offered by the fpahk . The continuous flow of clients for the preconception service reflects public support and trust for the service . As may be seen in many emerging economies, south korea is experiencing decreasing birth rates (from 16.3 per 1000 live births in 1994 to 9.8 per 1000 live births in 2004) and decreasing infant mortality rates (from 9.9/1ive births in 1993 to 4.6/live births in 2004). Due to a high rate of unintended pregnancy, an increase in the rate of preterm delivery, a high rate of pregnancy termination following accidental exposure to potential teratogens during pregnancy, and low intake of folic acid, the society of maternal and fetal medicine made a decision to promote and enhance preconception care in south korea . The goals are to enhance primary prevention of birth defects and preterm birth, increase in intended pregnancy, decrease in unnecessary pregnancy termination, and recovery of a higher birth rate in korea to maintain population replacement levels . Education includes lectures for obstetricians and gynecologists as well as for child - bearing age women attending maternity services . Service delivery is clinic - based preconceptional counseling, medical protocol examination by a physician, and follow - up of women who want to have a baby . The preconception counseling clinic, based at the korean motherisk program at samsung cheil hospital, an affiliated university hospital, includes teratogen information service for pregnant and breast feeding women, as well as preconception counseling . The preconception care medical protocol is composed of a physical examination, laboratory tests, and a questionnaire . Of the women served, 40% reported no history of adverse reproductive outcomes, about 30% had history of spontaneous abortion, 13% had maternal disease, 15% had a baby with birth defect, and 2% had family history of genetic disease . However, careful review of medical and behavioral history indicated that 92% of preconception care attendees have at least one risk factor for adverse outcomes . Patients with specific problems such as a previous child with a birth defect are transferred to the department of maternal and fetal medicine . Also, pre - implantation genetic diagnosis is performed in the department of infertility, a service that predates the introduction of preconception care . This service resulted in a substantial reduction in pregnancy loss from 91% in 1995 to 19% to 203 among 260 couples with balanced chromosomal translocation . The korea motherisk program is supported by the samsung chiel hospital and is staffed by three university faculty members and rotating fellows in clinical medicine . Although no consultation fee is charged to the patients, laboratory expenses are paid for by the patients . Depending on family history and other factors and various rationale used for laboratory examinations, the maximum cost of such laboratory examinations can be as high as 150 usd per person . Since the establishment of preconception services in 2004 the current challenge is to market it to all women who plan pregnancy, and to assure that the health care system has the capacity to match the demand and expansion of the service to other parts of the country . The o.n.e (office de la naissance et de lenfance = organization for birth and childhood), is a belgian governmental organization charged with the protection and promotion of health of women and children . Given the low fertility rates and high rates of birth defects (2 to 3% of all live births) in belgium, o.n.e launched a plan to assess the feasibility of implementation of preconception care in the french speaking part of belgium, the region with a population of 5 million people and about 50,000 births per year . This activity will be implemented through prenatal care, pediatric and gynecology clinics, as well as general practitioners, in partnership with genetic and counselling centers . An ad - hoc committee was formed to propose strategies, activities, financing options, and evaluation methods, starting with the development of evidence - based guidelines based on belgian epidemiological data . The committee proposed that the guidelines would be in accordance with the recommendations of the advisory committee of bioethics of belgium concerning genetic tests . The committee proposed also to organize a campaign targeting both the general public and health care providers to help market preconception care in primary care settings . The proposed guidelines include various serologic tests, screening of endocrine or genetic diseases, and preventive services including promotion of folic acid supplementation . The o.n.e . Developed a sustainable campaign plan to inform and sensitize the population about the benefits of preconception care, directing their efforts to individuals aged 15 to 45 years, health professionals including general practitioners, gynaecologists, paediatricians, midwives and all medical social workers, members of the family planning centres, and school health promotion centers . The first step in the social marketing campaign was the creation of the tools including folders, posters, and letters to professionals . These materials were reviewed by the ad - hoc committee and field tested among a selected group of social workers and the public . The second step will be an information campaign among men and women of reproductive age using posters, folders, and radio and television advertisements . Medical and social workers will also receive folders and posters for distribution to the target population and a letter to inform them about the purpose and methodology of the campaign . Medical practitioners will then receive the guidelines to help them with information to be shared with patients and the laboratory examinations to be conducted . The final step will be the evaluation process to assess behavioral changes both within the community and at provider level . The indicators will include advice received from providers by clients in participating facilities, referral of relevant clients to preconception visits by providers, uptake of preconception visits by clients, and compliance with suggested interventions by clients . The early phase of implementation of preconception care in primary care settings in belgium was a challenge, as it highlighted the need for a strong partnership of all institutions involved in maternal and child health care . A three - pronged approach to reducing mother - to - child transmission of hiv has long been advocated by global initiatives to reduce the burden of hiv / aids, but to our knowledge, never been implemented anywhere . This approach includes reduction of hiv infection among young couples through primary prevention and voluntary hiv counseling and testing (vct), voluntary avoidance of pregnancy by hiv infected couples, and finally antiretroviral treatment of pregnant women who are infected and subsequent management of outcomes in children . The unique premarital medical examination system prevalent in china and late onset of hiv transmission in china provided an opportunity to pilot implementation of the three - pronged strategy in guangxi province . Pilot experience in babu county in guangxi province is outlined here . Babu county (population 0.93 million) of hezhou city, guangxi province (population 48.9 million) experienced the fastest increase in reported hiv / aids cases in guangxi province between 1998 (18) and 2002 (629) since the first case was detected in 1997 . The epidemic concentrated among the younger age group (90%, age 2049 years) of the population and predominantly rural farmers (70%). Given the demographics of the affected population and because the condom usage rate was low in this population (std clients 5%, drug users 5%, sex workers 40%), the potential for mother - to - child transmission was evident . To reduce the impact of hiv on women, children and families, the county health department in 2001 embarked on a three - pronged approach embedded in the mandatory premarital medical examination system . A feasibility survey in the region had indicated that the majority of the population and public health community were supportive of the concept . The activities included family and community awareness, preconceptional voluntary hiv counseling and tests for couples (pvct), and vct and antiretroviral therapy to hiv infected pregnant women . To facilitate pvct and the antenatal vct and antiretroviral treatment component, 40 antenatal and maternal / child care clinicians were trained . To facilitate the broad based interventions, 942 medical and public health professionals and barefoot doctors were trained on vct and other prevention approaches . To facilitate the community engagement process, training seminars using a combination of entertainment and educational films and media slides were conducted in middle schools and high schools for students as well as adults in the catchment's area . An one - time pre- and post test (8800 respondents) evaluation using structured questionnaire was conducted in selected locations . The students were required to take educational materials (100,000 copies) to their homes to educate parents and neighbors as part of their homework requirements . Information on hiv and vct opportunities were displayed on the community information blackboard, which is the usual tool for disseminating information on public health, legislative, and social policies to villagers and updated frequently by community volunteers . In the first quarter after launching the program (october to december 2002) an average of 1099 (73%) of the 1500 eligible couples each month sought pvct consultation, and 52% of them (or 38% of eligible couples) accepted hiv testing . By the end of 2003, the pvct consultation rate among eligible couples increased to 77% and hiv testing rate among them reached 80% (or 62% of all eligible couples). The main challenge to this approach was the change of legal requirement of premarital medical examination from mandatory to voluntary status in october 2003 . Our pilot efforts indicate that screening for hiv in the preconception period is feasible and acceptable in this rural community . A combination of testing strategies implemented at various stages before and during pregnancy would help identify all women at risk for hiv - exposed pregnancies . Given that the community is aware of the concept of premarital medical examination, social marketing techniques using family health enhancement as a core benefit, and efforts to regain the conceptual interest of population in preconception care are needed . In october 2003, the longstanding mandatory chinese requirement for couples planning marriage to obtain a premarital health check, a routine physical examination, laboratory tests, and reproductive health education, was removed, and this visit became voluntary . Reported rates of premarital examinations plummeted, and health officials voiced concern that women were not receiving adequate risk assessment and pre - pregnancy education, particularly regarding the benefit of folic acid in preventing neural tube defects . To assess the feasibility of increasing the rate of preconception care uptake, we conducted a pilot social marketing effort in a northern county (mancheng, in hebei province) during february and march, 2004 . We used a three - stage process: 1) ascertain the nature of the problem regarding delivery of preconception care through the use of a series of questionnaires and interviews, 2) develop a test plan to promote preconception care, and 3) evaluate and refine the plan . Overall, 91% of 10,000 questionnaires were completed, and 140 subjects were interviewed, including women of reproductive age, maternal and child health workers, and local government officials . The major obstacles to preconception care included the following: a) lack of systematic organization of these services within the health care system; b) poor coordination between governmental organizations involved in marriage, family planning and health care; c) unclear media messages; and d) the perception of the term voluntary by women to mean unnecessary . The implementation plan included the use of social marketing to solicit government support, coordinate with various government organizations, train maternal child health (mch) workers at all levels, and to market the concept of preconception health care to women of childbearing age . To solicit government support, we established a project coordination committee, including high - level officials from the county project office, the county women's office, the bureaus of health, family planning, and civil administration, and the women's federation . In addition, a series of face - to - face interviews were conducted with government officials, workshops were held in the county, and an official document was issued by the county government . Recommendations were developed for improving coordination among government departments and organizations, including development of an education program that can be presented by the mch institute, the marriage registration office, and the family planning office, whenever women have contact with the system . Following the workshop, 95% of women reported that they would be willing to pay up to rmb 100 (us$12) for preconception health care services, and half indicated that more and better health messages were needed . Improving coordination among government agencies, developing training materials targeted to different groups, and promulgating clear, consistent messages concerning the importance of preconception care that are delivered in all settings where women may have contact with the system before pregnancy can create demand for preconception services . As illustrated by the six examples highlighted above, it is evident that preconception care is not just a conceptual debate but a primary approach used to address various health issues and emerging national challenges . As noted so cogently by atrash et al . A healthy baby and a healthy mother are valued hopes and dreams of families and cultural heritages across the world . Further, in the countries such as south korea and hong kong, and others in similar demographic transition, this although adequate prenatal, obstetric, and primary care services can reduce the infant and maternal mortality in high - mortality - developing countries, such countries are not free from emerging risks to maternal and child outcomes . Tobacco and alcohol use rates among women in many developing countries have increased . However, as more women than before have access to education and information, are employed, have personal income and decision making power, and delay pregnancy, there are many opportunities to inform them about the need for preconception care and a healthy reproductive life . Indeed, even a perfectly organized preconception care system is not likely to address other deficits in the reproductive health care system or in an inadequate prenatal care system in developing countries; neither will it lead to rapid positive changes in related indicators . Similar to the arguments in 1990s for and against hiv voluntary counseling services amidst the lack of availability of antiretroviral treatment, or against the attempts to market cell phones where land phones services are inadequate, advocating preconception care as a component of maternal child care services will remain controversial . As such, establishment of preconception care services in fact, introduction to preconception care can complement the efforts to improve prenatal care uptake . Consistent with the conceptual framework of the 2005 bangkok charter on health promotion, preconception care should be seen as a program for the future, a development agenda that is aimed at overall health of the family . Making preconception care available can have transgenerational impact on some women; those who are aware of such opportunities and can access such services . Our responsibility is to provide that opportunity.
|
Pleura is divided into a parietal layer which lines the inner aspect of the chest wall and a visceral layer which covers the interlobar fissures . Fluid collection within the pleural cavity can be assessed with clinical and radiological means . When pleural effusion is detected, the characteristics of the fluid (exudate or transudate) must be revealed using thoracocentesis . Pneumonias and congestive heart failure are the most frequently encountered causes of transudative and exudative effusions, respectively . Accumulating knowledge about cytokines demonstrated their important roles in the pathogenesis of most of the infectious diseases . Interleukins (ils) mediate the reactions of the our organism against foreign antigens and harmful agents . The ils act through autocrine or paracrine rather than endocrine pathways . In various infectious diseases significant alterations in il concentrations of blood, as well as of body fluids, occur . Although il levels in serum and various body fluids have been studied in various diseases, very few researches involving il levels in pleural effusions of children have been conducted [3, 4]. It is already acknowledged that established criteria used for the differentiation between exudative and transudative pleural effusions in adults are not valid for children and further studies are required to determine diagnostic criteria for children . The aim of this study is to compare il levels in exudative and transudative pleural fluids by measuring il levels in pleural effusions developed owing to various etiological factors in childhood . We aimed to examine whether the changes in pleural fluid protein, glucose, and lactate dehydrogenase (ldh) parameters, as well as in il-1, il-2, il-6, and il-8 levels, were significant in differential diagnosis of childhood pleural effusions . The study group consisted of 26 patients admitted in the department of pediatrics, medical faculty, firat university with a diagnosis of pleural effusions . Thoracal ultrasonograms were obtained from patients thought to have pleural effusions in consideration of medical history, physical examination, and chest x - rays . The presence and the amount of pleural fluids were determined and then thoracocentesis was performed . All samples were obtained by thoracentesis at the diagnosis time (table 1, figure 1). The first samples were centrifuged immediately for the measurement of il concentration and the supernatant layers were stored at 70c until testing for cytokines . The second samples were inoculated in aerobic, anaerobic, and lwenstein - jensen media and stained with gram, giemsa, and ziehl - nielsen dyes . The third samples were analysed for protein, glucose, and ldh . As indicators of infection, peripheral leukocyte counts (wbc), erythrocyte sedimentation rate (esr), c - reactive protein (crp) measurements, blood culture, and purified protein derivate (ppd) tests were performed . Pleural effusions were categorized as exudates and transudates according to the clinical and laboratory findings . The cutoff values for the differentiation between the pleural transudates and exudates were determined as follows: protein, 3 g / dl; ldh, 200 iu / l; pleural fluid / serum protein ratio, 0.5; and pleural fluid / serum ldh ratio, 0.6 . Pleural effusions with values above these cutoffs were classified as exudates and those below as transudates . Empyematous effusions were characterised by the presence of gram - positive bacteria in pleural fluid smears, attendant pneumonia with or without bacterial growth in the cultures of pleural fluid samples, and typical glucose (<40 mg / dl) and/or protein (> 5 g / dl) and/or ldh (> 1000 the samples of pleural fluids with higher glucose concentrations (> 40 mg / dl) whose gram - stained smears did not reveal any specific characteristics or bacterial growth were considered as parapneumonic effusions . The patients whose pleural fluid smears revealed afb which could be cultured in lwenstein - jensen media and also responded favorably to the antituberculostatic treatment were acknowledged as cases with tuberculous pleurisy [5, 6, 7]. Pleural fluids preserved at 70c were thawed and il-1, il-2, il-6, and il-8 levels in the samples were measured using enzyme - linked immunosorbent assay (elisa) and il-1, il-2, il-6, and il-8 bender medsystems commercial kits . The clinical and laboratory characteristics of the patients were given as means (standard deviation (sd)). Statistical evaluations between different groups were done with kruskal - wallis variance analysis and post - hoc tukey - scheffe tests using spss 10.0 software programs . In our study group pleural effusions were of exudative (n = 27, 75%) and transudative (n = 9, 25%) type . The ages of the study subjects ranged between 9 months and 14 years . Twelve parapneumonic (44%), 12 empyematous (44%), and 3 (12%) tuberculous pleural effusions were detected in the exudate group (table 1). A statistically significant difference was found between crp values of the exudate (140.2 92.4 mg / dl) and the transudate (9.6 3.2 mg / dl) groups (p <.001) (figure 2). Protein levels in pleural fluids were measured as 5.1 1.2 g / dl and 1.6 0.5 g / dl in the exudate and the transudate groups, respectively (p <.001). Glucose levels in pleural fluids were measured as 53.3 36.6 mg / dl in the exudate group and 83.8 14.7 mg / dl in the transudate group (p <.001) (figure 3). Il-1 levels of pleural fluids in the exudate and the transudate groups were detected as 304.1 127.7 pg / ml and 70.1 23.4 pg / ml, respectively (p <.001). Il-1 levels were demonstrated as 210 43.5 pg / ml in the parapneumonic effusion group, 430.3 69.9 pg / ml in the empyematous effusion group, and 175.3 36.3 pg / ml in the tuberculous effusion groups . Statistically significantly higher values were found in the empyematous group when compared with the parapneumonic and tuberculous pleural effusion groups (p <.001). Il-2 concentrations of pleural fluids were ascertained to be at undetectable levels in 12 (44.4%) and 176.6 173.6 pg / ml in 15 (55.6%) patients in the exudate group . Statistically significant difference was uncovered between the exudate and the transudate groups (p <.001). Statistically significant differences were not revealed between the empyematous group and the other two groups (p>.05). Statistically significantly higher values were recognized in the tuberculous pleural effusion group rather than the parapneumonic effusion group (p <.01). Il-6 levels were detected to be 18589.5 3631.8 pg / ml in the exudate group and 65.6 16.0 pg / ml in the transudate group (p <.001). The corresponding values were 15295.0 22678.1 pg / ml in the parapneumonic effusion group, 20518.0 1410.9 pg / ml in the tuberculous pleural effusion group . In the empyematous group, statistically significantly higher values were obtained when compared with those of the parapneumonic effusion group, while the corresponding values detected in the tuberculous pleural effusion group were also significantly higher than those found in the parapneumonic effusion group (p <.001). Pg / ml in the exudate group and 108.8 92.0 pg / ml in the transudate group (p <.001). The concentrations of il-8 were 1884.5 366.7 in the parapneumonic effusion group, 4789.8 1013.2 pg / ml in the empyematous effusion group and 919.0 9454.5 pg / ml in the tuberculous pleural effusion group . The values were statistically significantly higher in the empyematous group when compared with the other two groups (p <.001) (figure 4). Pleural effusion can be seen due to the intrusion of an infectious agent or an irritating foreign substance inside the pleural cavity or due a direct access of harmful materials or neoplastic cells into the pleural cavity via hematogenous route . It can be observed following pleural trauma or in association with asbestosis related pleural diseases . Pleural effusions are known to develop secondary to trauma, cardiac, renal, collagenous diseases and malignancies besides pneumonia [9, 10, 11]. From 61% to 80% of the cases with pleural effusions empyema is also an important cause of mortality in the developing countries . In the remaining 20%39% of the cases, empyema develops secondary to trauma, malignancies, and renal diseases [5, 12, 13, 14, 15]. In our study group many studies have been conducted concerning the levels of il-1, il-2, il-6, and il-8 in body fluids in various infections . Although many studies investigating the alterations in levels of il according to the exudative or transudative nature of pleural effusions in adults have been performed, similar studies pertaining to children are relatively few [16, 17, 18]. For that reason many studies have analysed il-1 levels in patients with meningitis, sepsis, urinary tract infections, and empyema . Variable results have been obtained dependent on the presence of different etiological agents [17, 18]. In patients with bacterial and tuberculous meningitis, il-1 levels of cerebrospinal fluids were found to be significantly higher than those with aseptic meningitis and in the control group . Umblical plasma levels of il-1 of infected newborns with early - onset sepsis were found to be higher than those of the control group . Il-1 levels in synovial fluids were detected to be higher than those in the pediatric cases with suppurative arthritis due to other causes . Silva - mejias et al have found comparatively higher il-1 levels in the empyema group . Similar to our findings, alexandrakis et al revealed that il-1 levels in pleural effusions were higher in the exudate group compared with those of the transudate group . Naito et al ascertained that il-1 levels in pleural effusions were higher than those found in bacterial infections due to other causes . In accordance with the literature in our study, il-1 levels were nearly 4.5 times higher in the exudate group . Il-2 levels in pleural effusions due to malignancies were reported to be lower than those with tuberculous pleural effusions . Shimokata et al stated that il-2 levels were at undetectable levels in 25% of tuberculous pleural effusions and 75% of cancerous pleural effusions . In our study il-2 levels in pleural fluids were at undetectably lower levels in 44% of the patients in the exudate group while the il-2 levels of the remaining 56% were assessed as 176.6 33.4 pg / ml . However all the patients in the transudate group demonstrated undetectable il-2 levels . In our study a statistically significant difference was not present between the empyema group and the other two groups . However a statistically significant difference was detected between the parapneumonic and the parapneumonic pleural effusion groups . Various studies have been performed concerning the levels of il-6 which is the mediator and the regulator of inflammatory responses in miscellaneous inflammatory processes . Blood il-6 levels were found to be higher in children with mycoplasma pneumoniae infections who stayed febrile for more than 3 days compared with those having shorter febrile episodes . They were also statistically significantly higher in pediatric cases with urinary tract infections when compared with the control groups . Il-6 levels of cerebrospinal fluid in the patients with bacterial meningitis were reported to be significantly higher than the aseptic meningitis and in the control groups . Levels above 100 pg / ml were measured in pediatric cases with viral (14%) but especially with bacterial meningitis (53%). Xirouchaki et al and yokoyama et al reported the levels of il-6 in pleural fluids to be significantly higher in the exudate group rather than the transudate group . They also found il-6 concentrations significantly higher in the tuberculous group rather than the parapneumonic effusion group . In our study not only the levels of il-6 were different between the groups with parapneumonic and empyematous effusions, but at the same time statistically significant differences were found between the empyematous and the parapneumonic or tuberculous pleural effusion groups . Alexandrakis et al measured il-6 levels in serum and pleural fluids and ascertained that serum il-6 levels did not differ significantly between the exudate and the transudate groups . However pleural fluid il-6 levels were detected to be meaningfully higher in the exudate rather than the transudate group . A definite proportion between the serum and pleural fluid il-6 concentrations could not be assessed . However we found il-6 levels in the pleural fluid to be 285 times higher than those detected in the exudate group . Il-8 is the mediator and the regulator of chemotaxis of leukocytes in inflammatory processes . In adults il-8 levels were found to be higher in cases with infectious pleural effusions compared with the patients with noninfectious effusions [3, 26, 27, 28, 29, 30, 31, 32]. Ceyhan et al reported higher levels in empyematous / parapneumonic effusion groups rather than the tuberculous group . However antony et al detected higher levels in cases with parapneumonic effusions unlike those found in the group with tuberculous effusions . Il-8 concentrations in the empyematous group were reported to be higher than those measured in the parapneumonic group . In accordance with this study, in our study the highest levels of il-8 were detected in the empyematous, parapneumonic, and tuberculous pleural effusions in decreasing order . Dlugovitzky et al discovered statistically significantly higher il-8 values in the tuberculous pleural effusion group in contrast with findings in the parapneumonic pleural effusion group . Ashitani et al and broaddus et al found higher levels in the empyema group compared with the other groups . Miller and idell have detected significantly higher levels in the exudate group rather than the transudate group . In this study, similar to the findings of other investigations, il-8 levels in the exudate group were reported to be 28 times higher than those found in the transudate group . This study have shown that for the differentiation between the exudative and transudative pleural effusions, in addition to the parametres such as protein, glucose and ldh, pleural fluid il-1, il-2, il-6, and il-8 levels could be used . Etiological factors can be differentiated by determining pleural fluid il levels . Taking these levels into consideration accordingly, a definitive diagnosis, a successful treatment and reduction in mortality can be achieved.
|
Literature analysis showed few articles about this complication, but no publication has described the management of open patella fracture around total knee arthroplasty . We report a unique case of an open patellar fracture above a total knee arthroplasty, sustained by a 56-year - old female patient . Despite the poor outcome of operative management in patellar periprosthetic fracture, this approach should be considered for acute and post traumatic fractures in young patients with a good remaining bone stock . The demographic changes with a high rate of aging and active population, as well as the improved life expectancy during the last decades have led to an increase in the number of total knee arthroplasties (tka) [1, 2, 3, 4], and consequently a raise of post - operative complications . Among these complications, periprosthetic fracture after tka is the most frequent cause of post - operative pain, and revision surgery . They may occur in the supracondylar region of the femur, followed by the patella, then the proximal tibia [1, 2, 3, 4, 5, 6, 7]. This entity can be very challenging to manage, with unpredictable and poor outcome, especially for displaced fracture or in cases with implant loosening [1, 2, 3, 4, 5, 8]. In this article, we report a unique case of an open periprosthetic patellar fracture that was managed with operative treatment . It also involves a literature analysis with description of the risk factors and treatment options of this uncommon entity . A 56-year - old female underwent a cemented postero - stabilized condylar tka with fixed tibial plateau through an antero - medial approach, in our department . She had severe osteo - arthritis of the left knee with a major stiffness (irreducible flexum at 25). Initial (1) and post operative(2) knee radiographs before, and after the arthroplasty . Three weeks later, the patient tripped and fell off with all her standing height striking the anterior aspect of the left knee with hyper flexion . She was taken to the emergency room with left knee pain and a large skin wound . Physical examination showed a large, deep and longitudinal wound measuring 15 cm in length due to a total breakdown of the suture line (the antero - medial approach performed during the tka) (fig . 3, 4). Fig 3 . A clinical picture showing the open patellar fracture a clinical picture showing the open patellar fracture . Lateral knee radiograph showing the patellar fracture above a total knee arthroplasty, without any signs of implants loosening . Lateral knee radiograph showing the patellar fracture above a total knee arthroplasty, without any signs ofimplants loosening . The knee radiographs showed a short oblique fracture at the inferior pole of the patella without any loosening of the implants or dislocation of the knee: this fracture is classified as type i according to ortigueraet d.j . She urgently received intravenous antibiotic (augmentin, gentamicin), as well as tetanus vaccination . Her fracture was temporarily stabilized in a long - leg plaster splint before she was transported to the operating room . She underwent wound irrigation, debridement of non - viable soft tissue from the wound, open reduction and fixation with a figure - eight cerclage wiring, without any revision of the implants . The wound was closed without any skin tension, after placing an intra - articular drain . Complementary immobilization with a removable knee pad at full extension, for six weeks was prescribed . Post operative knee radiographs post operative knee radiographs she received intra venous antibiotics: augmentin for 2 weeks associated with gentamicin during the first five days, as well as subcutaneous heparin . She was discharged from the hospital after she was instructed to remain non - weight bearing with a follow - up in 2 weeks . At 6 months follow - up, physical examination did not reveal any signs of local or deep infection . Her knee was pain free and she was able to walk without crutches, but she had a mild stiffness: the knee range of motion was 0/60. No antero - posterior or frontal laxities were noted . Clinical pictures at last follow - up showing a clean and dry wound (7), and knee range of motion (8, 9) clinical pictures at last follow - up showing a clean and dry wound (7), and knee range of motion (8, 9). The patient achieved union of the fracture: knee radiographs showed a healed patellar fracture, with hardware in place . Since the late 1960s, total knee arthroplasty has been the most effective treatment for knee osteoarthritis, providing good functional outcomes and improvement in the patient s quality of life . Constant advances in the joint replacement surgery, and especially the total knee arthroplasties have led to an increase in the number of complications following this type of surgery, such as periprosthetic fractures . [1, 2, 3, 4] this entity is very challenging to treat even for the most skilled and experienced surgeons [7, 8, 10]. The femur is the most frequent fracture site, followed by the patella and the tibia [1, 2, 3, 4, 5, 6, 7]. Patella fracture after tka can occur after trauma, or result from a stress fracture due to patella osteonecrosis, which is the most common cause of this type of fracture [1, 2, 3, 4, 5, 8, 10, 11]. Chalidis et al (2007) have reported in a systematic review of a 752 periprosthetic patella fracture that in 88.3% of the cases, the fracture was not associated with a traumatic event, asymptomatic, and discovered during routine follow - up . Many risk factors of these stress fractures have been described in the previous literature [1, 2, 3, 4, 5, 7, 8, 9, 10, 11] including: poor blood supply for patella after tka especially for antero - medial approach, and in case of lateral release or unwarranted fat pad removal: knee replacement surgery is likely to cause disruption of the vascular peri- patellar network especially the medial and the superior lateral genicular arteries.mal-alignment of the femoral and tibial implantspatella resurfacing arthroplastiesan excessive (thickness <15 mm) or asymmetric bone resection during patella resurfacingosteonecrosis due to bone cement polymerization: the heat of polymerization of the polymethylmethacrylate may exceed the coagulation temperature, causing thermal necrosis of the bonethe use of large central fixation peg designs for patellar implant, instead of small peripheral peg design.revision surgeryosteoporosis and bone losshyperflexion of the kneerhumatod arthritis poor blood supply for patella after tka especially for antero - medial approach, and in case of lateral release or unwarranted fat pad removal: knee replacement surgery is likely to cause disruption of the vascular peri- patellar network especially the medial and the superior lateral genicular arteries . Mal - alignment of the femoral and tibial implants patella resurfacing arthroplasties an excessive (thickness <15 mm) or asymmetric bone resection during patella resurfacing osteonecrosis due to bone cement polymerization: the heat of polymerization of the polymethylmethacrylate may exceed the coagulation temperature, causing thermal necrosis of the bone the use of large central fixation peg designs for patellar implant, instead of small peripheral peg design . Osteoporosis and bone loss hyperflexion of the knee open patellar fracture above a total knee arthroplasty is a very uncommon injury, and challenging to treat . To our knowledge, reported a unique case of patellar fracture associated with open knee dislocation after a total knee arthroplasty . It was treated with open reduction and internal fixation of the patella with band tension wiring . Greco et al, reported an open tibial shaft fracture below an ipsilateral tka, managed with intramedullary nailing . Some factors should be considered to succeed in the management of this type of fracture such as displacement of the fracture, function of the extensor mechanism, stability of the patellar implant, remaining bone stock [1, 2, 3, 4, 5, 8, 9, 10, 11, 13]. It includes immobilization by a brace locked in full extension or a cylinder cast in case of non - operative treatment; open reduction and internal fixation, implant revision in case of loosening, partial or total patellectomy, repair of the quadriceps tendon or patellar ligament in case of surgical treatment [4, 5, 7, 8]. The periprosthetic patellar fractures are usually managed by a non - operative treatment especially for type i and ii, because of the high infectious risk of open reduction and internal fixation [13, 14], and consequently a high risk of arthroplasty failure . Literature analysis showed that conservative or non - operative treatment was more successful for the management of non - displaced patella fracture with stable implant and an intact extension mechanism . Ortiguera and berry reported good results in 37 out of 38 peri - prosthetic patellar fractures managed with conservative treatment . Dennis reported a complication rate of 39% of operative treatment (in a series of thirty one patients who sustained a peri- prosthetic patellar fracture). Chalidis s systematic review has shown that open reduction and internal fixation failed in 92% of the cases . In this particular case, we were forced to opt for an internal fixation with a cerclage wiring after intensive wound irrigation, debridement and soft tissue repair . Although no conclusion can be established from a single case report, we think that the successful result in our case can be explained by the relative young age of the patient (56 years old), the good bone stock, the acute and post - traumatic characteristics of the fracture, the early and adequate management necessary to avoid infectious complication . The surgical management may reduce the ability of patella to heal because of the evacuation of peri - fractural hematoma as well as the supplementary disruption of the vascular network around the patella after a knee replacement surgery . Nevertheless, the high failure rate of the operative treatment in the patellar peri - prosthetic fracture can be explained by: the high proportion of stress, atraumatic fracture (88%) due to osteonecrosis which suggests a poor remaining bone stock.the stress fracture, unlike the acute and post traumatic ones, has a higher risk of non-union.the poor outcome of partial or complete patellectomy, which is a type of operative treatment.in our point of view, the post traumatic fractures in young patients are more likely to heal than stress fractures in the elderly . The high proportion of stress, atraumatic fracture (88%) due to osteonecrosis which suggests a poor remaining bone stock . The stress fracture, unlike the acute and post traumatic ones, has a higher risk of non - union . The poor outcome of partial or complete patellectomy, which is a type of operative treatment . In our point of view, the post traumatic fractures in young patients are more likely to heal than stress fractures in the elderly . Peri - prosthetic patella fracture is a very uncommon entity, and challenging to treat, especially the open ones, because of the high risk of infectious complications . Although several previous studies report a high rate of failure and unpredictable results of open reduction for periprosthetic patellar fracture, this approach (especially the internal fixation with a strong and dynamic construct) should be considered in young patients with a good remaining bone stock, who sustained an open or a displaced fracture after a high energy trauma . Orthopaedic surgeons should consider open reduction and internal fixation as a good management alternative for periprosthetic patellar fracture, in case of a post traumatic and acute fracture in young patients with a good bone stock.
|
Near - infrared (nir) radiation can penetrate the skin and the sclera of the eye . The high permeability of nir radiation also allows it to affect tissues deeper within the eye, such as muscles, the lens, and retina . Nir radiation can induce various biological effects,19 and intensive or long - term exposure to nir radiation is a factor in premature aging . Despite the wide prevalence of a variety of ultraviolet (uv) blocking materials, such as sunblock, sunglasses, glasses, films, and umbrellas, that are useful in protecting our tissue against uv exposure, nir cannot be blocked sufficiently.8 consequently, in the absence of suitable protection, nir radiation can induce various kinds of tissue damage and diseases, such as cataracts and photoaging.7,8 the human cornea plays a critical role in refracting light onto the retina and also protects the eye against external agents . Since the epithelial layer of the cornea provides the first line of defense against environmental insults, the structural integrity of this layer is a key component of corneal function.10 although uv - induced corneal damage has been described in many previous studies,1115 the effects induced by nir radiation on the cornea have not been thoroughly investigated . We hypothesized that nir irradiation simulating solar nir radiation that reaches human tissues can induce changes in gene expression . To test this hypothesis, a three - dimensional reconstructed human corneal epithelial model with multilayered, corneal epithelium - like structure was used to simulate the human eye, and we evaluated dna microarray and real - time polymerase chain reaction (pcr) analysis results from normal human corneal epithelial cells exposed to water - filtered broad - spectrum nir irradiation to simulate solar nir radiation that reaches the eye . Nir irradiation was performed with a broadband nir source (titan; cutera, brisbane, ca, usa). The nir device emits an nir spectrum between 1,100 nm and 1,800 nm, with water filtering to remove wavelengths between 1,400 nm and 1,500 nm, and simulates solar nir radiation that reaches the skin of humans on the earth s surface . To avoid thermal effects, the sapphire contact cooling tip was set to a fixed temperature of 20c . In our previous in vitro study, ten rounds at 10 j / cm using continuous energy single irradiation pulses of 4.3 seconds achieved drastic reduction in cell count . The three - dimensional reconstructed human corneal epithelial model (labcyte cornea - model) prepared from enzymatically digested normal human corneal epithelial tissues was purchased from japan tissue engineering corporation, aichi, japan as an in vitro model of corneal tissue.16 cells were cultured in media (assay medium; japan tissue engineering corporation), which was changed every 2 days until the cultures reached subconfluence.16 the subconfluent corneal cells were then subcultured with trypsin and seeded on a cell culture insert containing a microporous membrane with a 0.4 m pore size . Corneal cells were cultivated between the air and liquid interface to form a multilayered, corneal epithelium - like structure . Total rna from the corneal epithelial cells was extracted in qiazol reagent (qiagen nv, venlo, the netherlands) and spin - column purified using a rneasy mini spin column (qiagen nv). The rna was extracted from control and irradiated groups, which consisted of six whole individual three - dimensional reconstructed human corneal epithelial models . The quantity and quality of the rna samples were then measured using uv absorbance (nanodrop technologies, wilmington, de, usa), and the quality was also assessed using an agilent 2100 bioanalyzer series ii (agilent technologies, santa clara, ca, usa). Cy3-labeled crna samples were synthesized using the low input quick amp labeling kit (agilent technologies) according to the manufacturer s instructions . For each time point, 50 ng of total rna was used to generate first - strand cdna . After the denaturation (10 minutes at 65c) and crna synthesis (2 hours at 40c) steps, the reactions were incubated at 70c for 15 minutes to inactivate the affinity - script enzyme (agilent technologies). For labeling reactions, crna samples were each mixed with 6 l of transcription master mix cocktail containing cy3-ctp and incubated at 40c for 2 hours . Labeled crna was quantified on a nanodrop nd-1000 (nanodrop technologies), and quality was also checked by agilent 2100 bioanalyzer series ii . Slides were scanned using the microarray scanner (agilent technologies), and images were processed by the feature extraction software (agilent technologies) with background correction . Data were imported into genespring, and normalization was performed with a 75 percentile shift . After normalization and filtering of the raw data output files, log - fold changes in gene expression in the nir - irradiated group compared with the control group were analyzed using the genespring gx 11.0 software (agilent technologies) to determine the upregulated and downregulated genes, using a twofold change as the cutoff . Upregulated and downregulated genes were further clustered into functional gene groups using the ontology analysis function with the genespring gx 11.0 software . Microarray data were deposited into the minimum information about a microarray experiment (miame)-compliant gene expression omnibus (geo) database (accession number: gse76500, http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=gse76500). Quantitative real - time pcr analysis was achieved using the dna engine opticon 2 system (bio - rad laboratories inc . All six whole individual three - dimensional reconstructed human corneal epithelial tissue culture models were used for quantitative real - time pcr analysis . The primer sequences of epidermal growth factor receptor (egfr), tubulin tyrosine ligase - like family member 5 (ttll5), and pq loop repeat containing 2 (pqlc2) are given in table 1 . Since pqlc was ubiqitously and highly expressed in all samples, pqlc2 was used for normalization . The variant - specific primer sequences for the four egfr variants are given in table 2 . Cdna templates were prepared for each rna sample by reverse transcription reaction using superscript iii (thermo fisher scientific, waltham, ma, usa). Each quantitative pcr (25 l) contained 1 l of cdna template, 1.5 l of forward and reverse primer (10 m each), 7.5 l of 2 master mix, and 3.5 l of nuclease - free water . The thermal cycling conditions included one cycle at 95c for 5 minutes and 40 cycles at 95c for 10 seconds, 60c for 30 seconds, and 68c for 30 seconds . All statistical data are presented as the mean sem, and a p - value of <0.05 was considered to be statistically significant . Nir irradiation was performed with a broadband nir source (titan; cutera, brisbane, ca, usa). The nir device emits an nir spectrum between 1,100 nm and 1,800 nm, with water filtering to remove wavelengths between 1,400 nm and 1,500 nm, and simulates solar nir radiation that reaches the skin of humans on the earth s surface . To avoid thermal effects, the sapphire contact cooling tip was set to a fixed temperature of 20c . In our previous in vitro study, ten rounds at 10 j / cm using continuous energy single irradiation pulses of 4.3 seconds achieved drastic reduction in cell count . The three - dimensional reconstructed human corneal epithelial model (labcyte cornea - model) prepared from enzymatically digested normal human corneal epithelial tissues was purchased from japan tissue engineering corporation, aichi, japan as an in vitro model of corneal tissue.16 cells were cultured in media (assay medium; japan tissue engineering corporation), which was changed every 2 days until the cultures reached subconfluence.16 the subconfluent corneal cells were then subcultured with trypsin and seeded on a cell culture insert containing a microporous membrane with a 0.4 m pore size . Corneal cells were cultivated between the air and liquid interface to form a multilayered, corneal epithelium - like structure . Total rna from the corneal epithelial cells was extracted in qiazol reagent (qiagen nv, venlo, the netherlands) and spin - column purified using a rneasy mini spin column (qiagen nv). The rna was extracted from control and irradiated groups, which consisted of six whole individual three - dimensional reconstructed human corneal epithelial models . The quantity and quality of the rna samples were then measured using uv absorbance (nanodrop technologies, wilmington, de, usa), and the quality was also assessed using an agilent 2100 bioanalyzer series ii (agilent technologies, santa clara, ca, usa). Cy3-labeled crna samples were synthesized using the low input quick amp labeling kit (agilent technologies) according to the manufacturer s instructions . For each time point, 50 ng of total rna was used to generate first - strand cdna . After the denaturation (10 minutes at 65c) and crna synthesis (2 hours at 40c) steps, the reactions were incubated at 70c for 15 minutes to inactivate the affinity - script enzyme (agilent technologies). For labeling reactions, crna samples were each mixed with 6 l of transcription master mix cocktail containing cy3-ctp and incubated at 40c for 2 hours . Labeled crna was quantified on a nanodrop nd-1000 (nanodrop technologies), and quality was also checked by agilent 2100 bioanalyzer series ii . Slides were scanned using the microarray scanner (agilent technologies), and images were processed by the feature extraction software (agilent technologies) with background correction . Data were imported into genespring, and normalization was performed with a 75 percentile shift . After normalization and filtering of the raw data output files, log - fold changes in gene expression in the nir - irradiated group compared with the control group were analyzed using the genespring gx 11.0 software (agilent technologies) to determine the upregulated and downregulated genes, using a twofold change as the cutoff . Upregulated and downregulated genes were further clustered into functional gene groups using the ontology analysis function with the genespring gx 11.0 software . Microarray data were deposited into the minimum information about a microarray experiment (miame)-compliant gene expression omnibus (geo) database (accession number: gse76500, http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=gse76500). Quantitative real - time pcr analysis was achieved using the dna engine opticon 2 system (bio - rad laboratories inc . All six whole individual three - dimensional reconstructed human corneal epithelial tissue culture models were used for quantitative real - time pcr analysis . The primer sequences of epidermal growth factor receptor (egfr), tubulin tyrosine ligase - like family member 5 (ttll5), and pq loop repeat containing 2 (pqlc2) are given in table 1 . Since pqlc was ubiqitously and highly expressed in all samples, pqlc2 was used for normalization . The variant - specific primer sequences for the four egfr variants are given in table 2 . Cdna templates were prepared for each rna sample by reverse transcription reaction using superscript iii (thermo fisher scientific, waltham, ma, usa). Each quantitative pcr (25 l) contained 1 l of cdna template, 1.5 l of forward and reverse primer (10 m each), 7.5 l of 2 master mix, and 3.5 l of nuclease - free water . The thermal cycling conditions included one cycle at 95c for 5 minutes and 40 cycles at 95c for 10 seconds, 60c for 30 seconds, and 68c for 30 seconds . All statistical data are presented as the mean sem, and a p - value of <0.05 was considered to be statistically significant . To elucidate changes in genetic expression induced by exposure to nir irradiation that simulates solar nir radiation that reaches human eye tissues, dna microarray analysis was carried out using rna isolated from control and nir - irradiated corneal epithelial cells . Using ~6.310 probes, we identified 52 upregulated genes and 98 downregulated genes in the nir - irradiated group compared with the control group . Gene ontology analysis of these 150 genes identified 41 upregulated genes that encode proteins with receptor - binding properties (table 3). Quantitative real - time pcr analysis was then performed for the two genes showing the highest degree of upregulation in the dna microarray analysis: egfr and ttll5 . Egfr showed a high degree of upregulation (19.4-fold) relative to control cells, although statistically significant upregulation of egfr and ttll5 was not observed (p=0.5127 and p=0.8273, respectively) (figure 1) using the primer sequences listed in table 1 . Meanwhile, when the expression of egfr variants was assessed in a dna microarray analysis, expression increased by 1.0-fold and 1.3-fold for egfr variants 1 and 3, respectively . Upon inclusion of variant - specific primer sequences for egfr (table 2), quantitative real - time pcr analysis revealed that statistically significant upregulation of variants 1 and 3 was observed (p<0.05), whereas there was no statistically significant upregulation of variants 2 and 4 (p=0.1266 and p=0.5127, respectively) (figure 2). To the best of our knowledge, this is the first study that examines changes in genetic expression in three - dimensional reconstructed corneal epithelial tissue after nir irradiation to simulate solar nir radiation that reaches human eye tissues . The biological effects of sun and uv exposure have been extensively investigated . However, over half of the solar energy is in the nir range, and most of the uv - blocking materials cannot block nir radiation . Moreover, humans are continuously exposed to artificial nir radiation from sources, such as electrical appliances.17,18 despite the prevalence of nir radiation, the need for protective measures against this type of radiation has received less attention than that of uv . Because solar nir radiation is filtered by atmospheric water,19,20 water - filtering in experimental settings is indispensable to provide an accurate simulation of solar nir radiation that reaches human tissues.5 cooling is also recommended when investigating the effects of nir radiation, as nir radiation can increase surface temperatures and induce thermal effects.5 indeed, without water filter or contact cooling, nir irradiation immediately increases the temperature of the superficial layer of culture fluid in a laboratory dish or on skin, as nir radiation is predominantly absorbed by hydrogen bond - containing molecules, such as water and hemoglobin . Meanwhile, as the nir radiation penetrates deeper into the target, its energy can dissipate to the point where insufficient amounts of energy reach target cells in the base of culture dishes or deeper tissues in skin samples . Thus, to accurately investigate the biological effects of solar nir radiation that reaches human tissues, a water - filter that excludes wavelengths between 1,400 nm and 1,500 nm and a cooling system were used in this study.5 a three - dimensional reconstructed human corneal epithelial model was used as an in vitro model of corneal tissue . The corneal epithelial model was proven to have a fully differentiated corneal epidermal tissue including all major corneal epithelial cell layers, such as the basal cell layer, the wing layer, and the superficial cell layer . Cytokeratin-3 is a specific marker of corneal epithelium, and it was expressed in all layers of the corneal epithelial model.16 muc-1 and muc-16, which compose the transmembrane glycoproteins in the surface of the corneal epithelium, were well expressed in the superficial layer of the corneal epithelial model.16 cells in the corneal epithelium are connected by desmosomes, tight junctions, and adherence junctions.16 claudin-1, which is a marker of a tight junction, desmograin-3, which is a marker of desmosome, and e - cadherin, which is a marker of an adherence junction, are localized in the interface between cells at all cell layers, including the superficial layers.16 lamin is an important constituent in the basement membrane at the basal corneal epithelium junction, which is expressed continuously in basal cells of the corneal epithelial model basal layer.16 the basement membrane was smooth like that of the human eye.16 therefore, the corneal epithelial model reproduced many of the characteristics of the native human corneal tissue, and it provides a morphologically relevant means to assess nir effects as an alternative to animal testing . The corneal epithelium, like other epithelial barriers in the human body, is continuously subjected to physical, chemical, and biological insults, which can produce a wound and/or loss of barrier functions . Proper healing of corneal wounds is vital for maintaining a clear, healthy cornea and preserving vision . Corneal epithelium responds rapidly to injury, wherein wound healing occurs by cells migrating as a sheet to cover the defect and reestablish barrier functions.21 in wounded cornea, the epithelium plays a central role, not only as a key cell type in corneal repair, but also as a growth factor source.22 as in other tissues, several growth factors are suggested to play a role in regulating corneal epithelial function and wound healing.21,23 following nir irradiation that simulates solar radiation, microarray analysis of corneal epithelial cell dna in this study showed that egfr was highly expressed, and statistically significant upregulation of egfr variants 1 and 3 was observed (p<0.05) by quantitative real - time pcr . Egfr is a prototypic tyrosine kinase receptor that is part of a larger family of erbb receptors . Erbb2, erbb3, and erbb4 share with egfr characteristics that include extracellular ligand - binding sites, intracellular kinase domains, and tyrosine - rich regions . Egfr activated in response to injury serves as a powerful mediator of corneal epithelial wound healing10 by coordinating multiple extracellular signals generated in response to cell injury.2427 in turn, the levels of egfr and tyrosine kinase activity are major determinant factors for epithelial cell function in tissues and organs.22 echoing this concept is the finding that in some cancer patients, treatment with egfr - specific monoclonal antibodies cetuximab and gefitinib (an egfr kinase inhibitor) resulted in ocular abnormalities, including diffuse punctate keratitis and corneal erosion.2830 thus, maintaining a proper level of egfr signaling is critical for corneal homeostasis.22 ttll5 gene has 32 exons with high expression in heart and skeletal muscle and lower expression in many other tissues, including the eye and brain.31,32 it encodes a 1,281-amino acid protein that is localized to the cytoplasm and nucleus.31 ttll5 is thought to be a key initiator of polyglutamylation in -tubulin33 and has been previously reported to be essential for the correct function of sperm flagella.34 ttll5 plays a role in polyglutamylation of primary cilia in vitro.35 notably, genes involved in the polyglutamylation and deglutamylation of -tubulin have been associated with photoreceptor degeneration in mice.35 in this study, ttll5 showed the high degree of upregulation in the dna microarray analysis, whereas statistically significant upregulation of ttll5 was not observed in quantitative real - time pcr analysis . Further studies are needed to determine if a higher power output or increased treatment frequency may promote significant upregulation of ttll5 . The findings here that egfr expression is significantly upregulated following exposure of corneal epithelial cells to nir irradiation support that solar nir radiation that reaches human tissues can induce corneal cell injury . Although significant egfr expression upregulation occurred after just one treatment at the tested power output, further studies are needed to determine if a higher power output or increased treatment frequency may promote even larger changes in expression . Furthermore, this was a preliminary study based on a fairly small number of samples, so a large - scale study will be needed . Nir irradiation simulating solar nir radiation that reaches human tissues induced upregulated expression of egfr in human corneal cells . Nir radiation represents more than half of solar energy and cannot be sufficiently blocked by eyewear . Moreover, thus, the results of this study indicate that enhanced protection from and avoidance of both uv and nir radiation should be considered to prevent eye damage.
|
Hypertension is a common chronic medical condition affecting people in pakistan and the rest of the world . It is an important modifiable risk factor for cardiovascular morbidity and mortality, particularly for stroke (accounting for 51% of all stroke deaths worldwide), ischemic heart disease (45% of all deaths), chronic kidney disease, congestive heart failure, aortic aneurysm, and peripheral arterial disease . Prevalence of hypertension (systolic blood pressure> 140 mm hg or diastolic blood pressure> 90 mm hg, or on antihypertensive medications) in pakistan has increased from 17% in 1980 to 35% in 2008 in adults aged 18 years and older . The increasing prevalence of hypertension together with a deficient control makes this one of the frequent conditions that require urgent medical attention . The prevalence of uncontrolled hypertension varies around the world, with the lowest prevalence in rural india (3.4% in men and 6.8% in women) and the highest prevalence in poland (68.9% in men and 72.5% in women). However, the control of hypertension was 23% from a community based data in urban population from karachi, pakistan . Uncontrolled hypertension can progress to hypertensive crisis defined as a systolic blood pressure> 180 mm hg or a diastolic blood pressure> 120 mm hg . Hypertensive crisis can be further classified as a hypertensive urgency or hypertensive emergency depending on end - organ involvement including cardiac, renal, and neurologic injury . Hypertensive urgency refers to severe hypertension without evidence of new or worsening end - organ injury while hypertensive emergency refers to a severe hypertension that is associated with new or progressive end - organ damage . Hypertensive crises (76% urgencies, 24% emergencies) represented more than one - fourth of all medical urgencies / emergencies . Hypertensive urgencies frequently present with headache (22%), epistaxis (17%), and psychomotor agitation (10%) and hypertensive emergencies frequently present with chest pain (27%), dyspnea (22%), and neurological deficit (21%). The reason for uncontrolled hypertension in pakistan is high due to lack of awareness, knowledge, adherence, and attitudes of pakistani patients with hypertension . However there is no data on patients with hypertensive crisis from tertiary care hospitals in pakistan . Additionally the number of patients who complicate towards stroke, myocardial infarction, and chronic kidney disease is also not known . Hence, it is essential to have figures on prevalence and clinical presentation from our setup . Therefore, we conducted this study to determine the prevalence of hypertensive crisis, its management, and its outcome in patients presenting to a tertiary care center in karachi . This was a retrospective study conducted at the aga khan university, karachi, pakistan . The aga khan university hospital (akuh) has 563 beds in operation and provides services to over 50,000 hospitalized patients and to over 600,000 outpatients annually . Ethical approval from the ethics review committee of the aga khan university (1985-med - erc-11) was taken for conduct of the study . Adult inpatients (> 18 yrs) presenting to the er who were known hypertensive and had uncontrolled hypertension were included . Controlled blood pressure was defined as systolic blood pressure (sbp) <140 mm hg or diastolic blood pressure (dbp) <90 mm hg . Uncontrolled hypertension was defined as sbp> 140 mm hg and dbp> 90 mm hg in both diabetic and nondiabetic patients who were either aware of their problem or under pharmacological treatment . The sample was drawn using computerized medical record system international classification of diseases-9-coordination and maintenance (icd-9-cm) at health information management system in the hospital . Patients admitted with primary diagnosis of hypertension crisis, uncontrolled hypertension, hypertensive emergency, and hypertensive urgency were selected through the icd-9-cm (i-10: essential (primary) hypertension, i-11: hypertensive heart disease, i-12: hypertensive renal disease, i-13: hypertensive heart and renal disease, and i-15: secondary hypertension). Patients whose medical records did not contain minimal clinical information to allow case classification (hypertensive urgency or emergency) were excluded from the study . Data over a period of 5 years, from year 2005 till year 2010, was used . A sample of 1336 consecutive patients fulfilling the inclusion criterion was selected . All patients gave a general consent on admission; however informed consent was not taken as data was extracted later through icd-9-cm . Data on demographics, comorbid conditions, clinical symptoms, blood pressure readings at subsequent time intervals, length of stay, and antihypertensive drug therapy was recorded by trained data collectors . A history of physician - diagnosed diabetes mellitus (dm), chronic kidney disease (ckd), ischemic heart disease (ihd), and stroke was noted from the patient's medical record file . Dm was defined as fasting plasma glucose 126 mg / dl at a prior visit . Ckd was defined as rise in serum creatinine of> 1.2 mg / dl for 3 months . Blood pressure readings, at different time intervals, were recorded from vital sheets for nursing services . Hypertensive crisis was defined as a systolic blood pressure> 180 mm hg or a diastolic blood pressure> 120 mm hg . Management of patient was assessed by recording the list of medication from the computer generated pharmacy sheet attached inside the medical record file . Antihypertensive treatment was divided into two types: medication given per oral and medications given intravenously . I values where available were recorded using the patient profile viewer, an online hospital database software . Mean length of stay was recorded by calculating the time interval between the patient's admission date / time and discharge date / time from er / ward . Various complications like myocardial infarction, stroke, aortic dissection, acute renal failure, and pulmonary edema developed during the hospital stay were recorded using the discharge summary notes filled by the primary consultant . Myocardial infarction was diagnosed when blood levels of sensitive and specific biomarkers such as cardiac troponin or ckmb are increased in the clinical setting of acute myocardial ischemia with electrocardiographic changes . According to who definition, stroke was defined as a rapidly developing clinical sign of focal (at times global) disturbance of cerebral function, lasting more than 24 hours or leading to death with no apparent cause other than that of vascular origin . Aortic dissection was referred as the condition when a separation has occurred in aortic wall intima as diagnosed on ct scan, causing blood flow into a new false channel composed of the inner and outer layers of the media . Acute renal failure was diagnosed when the plasma urea nitrogen (pun) or serum creatinine did not stabilize within 72 hours . Acute pulmonary edema was defined as alveolar or interstitial edema verified by chest x - ray and/or with o2 saturation <90% on room air prior to treatment accompanied by severe respiratory distress, with crackles over the lungs and orthopnea . A minimum sample size of 237 patients was required to estimate a proportion of 19% of patients with hypertensive crises presenting to er, with bound on error of 5% and alpha of 5% . Mean and standard deviation were used for qualitative variables and frequency and percentage for qualitative variables . Chi - square test was used to compare categorical variables and student's t - test was used to compare quantitative variables . A total of 73,063 hypertensive patients presented to the er between years 2005 and 2010 out of which a sample of 1336 (1.8%) patients was taken for this study . The prevalence (%) of uncontrolled hypertension was 28.9% (387). Prevalence of hypertensive crisis overall was 16.3% (218) and among those with uncontrolled hypertension is 56.3% (218). Mean age (sd) of patients presenting to the er was 56.7 (14.7) and 175% (45.2) of patients were male . Overall, dyslipidemia was the most common comorbidity in patients presenting with uncontrolled hypertension to the er with the prevalence of 43.2% (167) followed by diabetes mellitus, 36.9% (143), and ischemic heart disease, 21.4% (83), and 13.9% (54) of them were smokers . The baseline characteristics of patients overall, with hypertensive crisis and without hypertensive crisis, are given in table 1 . Headache was the most common presenting symptom, 35.7% (138), followed by dyspnea, 32.6% (126), chest pain, 21.4% (83), dizziness, 21.2% (82), vomiting, 17.3% (67), epistaxis, 5.2% (20), and neurologic deficit, 3.6% (14). On comparison of patients with hypertensive crisis with those with no hypertensive crisis the clinical symptoms that were statistically significant were as follows: headache was present in 42.2% (92) versus 27.2% (46) p value = 0.002 and chest pain was present in 17.4% (38) versus 26.6% (45) p value = 0.02 . The mean (sd) systolic blood pressure (sbp) recorded in patients with hypertensive crisis versus no hypertensive crisis in er was 202 (17.971) and 158 (13.387) (p value 0.001). The mean (sd) diastolic blood pressure in patients with hypertensive crisis versus no hypertensive crisis in er was 108 (17.429) mm hg and 87 (14.984) mm hg, respectively, (p value 0.001). The trend of blood pressure recorded in the er is shown in figures 1 and 2 . Antihypertensive medications used in management of patients with hypertensive crisis . Calcium channel blocker was the most widely used oral antihypertensive medication in the er, 35.4% (137). Intravenous (iv) nitrate was the most commonly administered iv medication in er, 22.7% (88). The mean (sd) drop in sbp in patients with hypertensive crisis who received intravenous medications versus oral medications was 53.1 (29) mm hg and 43 (27), respectively (p value = 0.01). The mean drop in dbp in patients with hypertensive crisis who received intravenous versus perioral medications was 25.8 (19) and mm hg and 17.8 (22) mm hg, respectively (p value = 0.006). Comparison of blood pressure trends in patients with and without hypertensive crisis on intravenous or per oral medication is shown in table 2 . The maximum drop in systolic blood pressure and diastolic blood pressure was achieved by sodium nitroprusside: 80 (15) mm hg and 37.5 (7.77) mm hg . Types of intravenous medications and drop in sbp and dbp are shown in table 3 . The total length of stay (in days) for patients with hypertensive crisis was 2.46 (0.164) whereas the total length of stay (in days) for patients without hypertensive crisis was 2.20 (0.158). Overall prevalence (%) of complications was 47.7% (104) in patients with hypertensive crisis . Acute renal failure was the most common complication with the prevalence (%) of 41.3% (43) followed by myocardial infarction 28.8% (30) and pulmonary edema 18.26% (19). Stroke accounted for 6.5% (12) of complications . On comparison of patients with hypertensive crisis and patients without it, myocardial infarction occurred in 7.2% (15) versus 9% (15), stroke occurred in 2.4% (5) versus 4.2% (7), and acute kidney injury occurred in 11.5% (24) versus 11.4% (19) patients, respectively . On further categorization of patients with hypertensive crisis who received intravenous antihypertensive in er versus not receiving intravenous medication, there was no significant difference in the complications in both groups . We have shown in this study on patients presenting to er with hypertensive crisis that the prevalence of hypertensive crisis is high (56.3%). Mean length of stay was longer in patients with hypertensive crisis and acute renal failure was the most common complication in these patients . The incidence of hypertensive crisis was 47.22% in a study conducted in bosnia and 16% in a study conducted in brazil [22, 23]. The reasons for high prevalence of patients with hypertensive crisis in our setup are multiple . Lack of knowledge about control of hypertension and poor compliance to antihypertensive medications is a major issue in pakistan . Also, lack of proper health infrastructure in public sector leading to inability of the poor population to access healthcare adds onto the severity of hypertension in these patients . In previous studies [25, 26], the most frequent clinical sign of patients presenting to the er was headache (22% and 42%) and dizziness was reported among 30% of emergency department patients . This study showed (36%) headache as the most common clinical sign followed by dizziness (21%) which supports the previous findings about the characteristics of hypertensive crisis patients . Complications of hypertensive crisis reported in previous studies conducted in bahrain and italy were acute coronary syndrome (32%), left ventricular heart failure (38%), and stroke (29.3%) and cerebral infarction (24%), pulmonary edema (23%), and hypertensive encephalopathy (16%). However acute renal failure, myocardial infarction, and pulmonary edema are the most common complications in our setup . The reason for high prevalence of acute renal failure in our setup may be the higher number of patients with hypertensive emergency . The most common intravenous medication used to control hypertensive crisis in this study was nitrates . Recommendation for use of intravenous nicardipine was reported by a study conducted in 2005 whereas sodium nitroprusside, because of its direct vasodilator effect and immediate onset of action, was recommended for hypertensive emergency in a subsequent study in 2006 . We observed in this study that sodium nitroprusside was the most potent intravenous antihypertensive in dropping blood pressure . However it was not the most commonly used drug in this study . In a similar study, intravenous labetalol was reported as the most frequently used antihypertensive medication for emergency department patients presenting with hypertensive urgency . This indicates that the use of intravenous nitrate as the most common antihypertensive for management of hypertensive crisis (apart from use in patients with cardiac cause) is not completely in accordance with the recommendations . However in some studies, oral labetalol, beta blockers, diuretics, ace inhibitors, and calcium channel blockers have been recommended . Calcium channel blockers have also been found to be the most common antihypertensives used for management of hypertensive in this population and have been found to have good control rates . Calcium channel is now recommended as a first line antihypertensive in the recent nice guidelines . The reduction in systolic and diastolic blood pressure reported in our study shows a smooth decline in order to avoid risks of potential side effects of a much rapid decline . It is recommended that the initial reduction in mean arterial pressure (map) in case of hypertensive emergency should not be more than 20%25% below the pretreatment blood pressure or that map be reduced within the first 3060 minutes to 110115 mm hg . This can be comparable to our study which reported an overall decrease of blood pressure of about 52 mm hg in sbp from intravenous medication from the time of admission until 2 hours after admission in er . A rapid decline in blood pressure is associated with acute deterioration in renal function, ischemic, cardiac, or cerebral events, and occasional retinal artery occlusion and acute blindness . The goal is to reduce bp by 1015% over a period of 3060 minutes, with the exception of the patient that presents with aortic dissection or acute intracranial bleed . However treatment should be individualized to each patient based on the type and extent of end - organ damage, degree of bp elevation, and the specific side effects that each medication could have on a patient's preexisting comorbidities . The strength of this study is that it is the first study from this region to report figures on prevalence of hypertensive crisis, as well as prevalence of complications as a result of hypertensive crisis among patients . Moreover, this study also reports management of these patients in terms of the treatment received in the er and into the ward and their mean length of stay . However there are limitations in this study; firstly it has limited external validity as the sample is not representative for an entire population . It represents population visiting a single - tertiary care hospital and, hence, it is not representative of the entire population of pakistan . Secondly, compliance issues with the medication regimen have not been taken into consideration; hence, the medications administered to the patients may be misjudged . Thirdly, some patients may also have gotten discharged against medical advice; hence, the optimal length of stay for these patients may not have been achieved . Fourth, this retrospective study cannot strongly give a cause and effect association and we have not reported the hypertensive urgencies and emergencies separately . We did not report data separately on hypertensive emergency and urgency and retinopathy could not be examined and reported in all patients . The prevalence of hypertensive crisis is high in our subjects . Per oral calcium channel blocker and intravenous nitrate are the most commonly administered medications in the er and ward.
|
A basic set of proteins and mrnas are differentially expressed among cell types, temporally and spatially, generating a vast assortment of cell phenotypes and/or activation states within a single tissue . Outlining this protein / mrna portrait is thus crucial for understanding not only the uniqueness characterizing cells, but especially their distinguished functions . This becomes of major relevance when the balance between cell - intrinsic properties and identity cues received and provided by each cell to its neighboring cells then shapes the cell - to - cell cross talk during physiopathological conditions . In the cns, neuroinflammation is the typical consequence of the interchange among different cell types, particularly neurons, astrocytes, oligodendrocytes and microglia, of a variety of cues as neurotransmitters, cytokines, chemokines, toxic metabolites that condition the final protein / mrna profiles of cells, their activation states and functional outcomes [2, 3]. Since neuroinflammation accompanies a large variety of neurodegenerative diseases, there is increasing interest in determining how the different cell phenotypes and cellular interconnectivity might contribute to reduce inflammation and reverse neurodegeneration . Microglia actively participate to the context - dependent, neuroprotective / neurotoxic molecular network that is triggered during neuroinflammation . Among the molecular cues having a key role in this process, extracellular nucleotides are major responsible for intercellular communication and propagation of inflammatory stimuli [57]. This occurs by specific binding to various receptor subtypes, termed ionotropic p2x and metabotropic p2y, which are simultaneously localized on several different cell phenotypes . Among these, the p2y12 receptor subtype belonging to the gi class of g protein - coupled receptors is activated by adp . Two transcript variants apparently encoding the same protein isoform have been identified so far for p2ry12 gene, but the determinants for cell specificity of p2y12 protein expression are still unknown . P2y12 is found on the surface mainly, but not exclusively, of blood platelets, where it acts as blood clotting regulator and target for the treatment of thromboembolisms [9, 10]. In the nervous system, the tissue- and cellular - selective expression of p2y12 exhibits a pattern throughout white and gray matter consistent with astrocyte expression, although it has not been found colocalization between p2y12 and gfap - positive astrocytes in rat brain cortex and nucleus accumbens, despite the abundant presence of p2y12 mrna . Moreover, we previously established in vivo the expression of p2y12 in oligodendrocytes and myelin sheaths of rat cerebral cortex, subcortical areas, and periventricular white matter . This localization is confirmed throughout the corticospinal tract, therefore suggesting high conserved tissue - homogeneity and phenotype - specificity, and a hypothesized role in myelination [1215]. P2y12 is finally observed in brain and spinal cord resident microglia, where it affects activation, chemotaxis [1619] and neuropathic pain, but it is not observed, for example, in peripheral macrophages in spleen [18, 20]. P2y12 expression in primary microglia is variable with postnatal development and shows sexually dimorphic behavior . Through the use of all the available p2y12-immunoreactive antibodies recognizing the c - terminus or the second intracellular loop of the receptor, the aim of the present work is to provide comparative evidence about p2y12 cell specificity in microglia versus oligodendrocytes particularly from the healthy and diseased cns under neuroinflammatory conditions as those sustained during amyotrophic lateral sclerosis (als) and multiple sclerosis (ms). Adult b6.cg-tg (sod1-g93a)1gur / j mice expressing high copy number of mutant human sod1 with a gly93ala substitution (sod1-g93a) were originally obtained from jackson laboratories (bar harbor, me, usa) and housed in our indoor animal facility as described in apolloni and collaborators, . The animals were euthanized, according to the guidelines for preclinical testing and colony management . Also neonatal wistar and adult lewis rats (from charles river laboratories, lc, italy) were housed in our indoor animal facility . Animal procedures were performed according to european guidelines for the use of animals in research (86/609/cee) and the requirements of italian laws (d.l . Ethical procedures were approved by animal welfare office, department of public health and veterinary, nutrition and food safety, general management of animal care and veterinary drugs of the italian ministry of health . All efforts were made to minimize animal suffering and number of animals necessary to produce reliable results . Microglia primary cultures prepared from mouse cortex as previously described were about 98% pure, as verified by immunofluorescence with cd11b (for microglia), glial fibrillary acidic protein (gfap, for astrocytes), neuronal nuclei (neun, for neurons), and smi94 (for oligodendrocytes). Purified cultures of oligodendrocytes were prepared from forebrain of postnatal day 1 - 2 wistar rats, according to minor modifications from a previously described method . After removing the meninges, cortices were minced, digested, and dissociated by passage through 70 m nylon cell strainer (bd biosciences, europe). Cells were plated in dulbecco's modified eagle's medium (dmem) supplemented with 20% heat - inactivated fetal bovine serum (fbs), 4 mm glutamine, 1 mm sodium pyruvate, 50 u / ml penicillin, 50 g / ml streptomycin, and 100 g / ml gentamicin in t75 poly - d - lysine - coated flasks, at about 10 million cells / flask . The cultures were maintained at 37c in a 5% co2 and 95% air atmosphere for 14 days . Mixed glial cultures were then shaken at 200 rpm at 37c for 1 h and 98% pure microglia collected from the supernatant of each flask, as verified by immunofluorescence with gfap, neun, neural / glial antigen 2 (ng2, for oligodendroglial precursor cells), myelin basic protein (mbp, for mature oligodendrocytes), and cd11b . After further shaking at 200 rpm and 37c for 1518 h, the detached cell suspension was finally incubated for 1 h at 37c for differential adhesion of contaminating cells . The non - adherent cells were filtered through 40 m nylon cell strainer (bd biosciences), spun for 10 min at 100 g, resuspended in oligodendroglial precursor cells medium (basal chemically defined medium: dmem, 4 mm l - glutamine, 1 mm sodium pyruvate, 0.1% bovine serum albumin (bsa), 50 g ml apo - transferrin, 5 g ml insulin, 30 nm sodium selenite, 10 nm d - biotin, and 10 nm hydrocortisone) containing 10 ng ml platelet derived growth factor - aa (pdgf - aa) and 10 ng ml basic fibroblast growth factor (bfgf), and seeded at the density of 1 10 cells / cm into poly d, l - ornithine - coated plates . The cells were then induced to differentiate into mature oligodendrocytes when the basal chemically defined medium was added with 15 nm triiodothyronine, 10 ng ml ciliary neurotrophic factor (cntf) and 0,05 mg 10 ml n - acetyl - l - cysteine (nac), for 47 days . A 98% pure population of oligodendrocytes was thus obtained, as verified by immunofluorescence with ng2, mbp, gfap, neun, and cd11b antibodies . Organotypic cerebellar slice cultures were prepared with modifications from previously published protocols [26, 27]. Briefly, cerebella were excised from neonatal wistar rat (810 days old), cut on a mc ilwain tissue chopper (400 m) and parasagittal slices separated into cold hank's balanced salt solution (hbss). Two to three slices were plated on each millicell cm culture inserts (millipore, italy) and kept in organotypic maintenance medium (50% basal medium eagle - bme, 25% hbss, 25% heat - inactivated horse serum, supplemented with 5 mg / ml glucose, 1 mm glutamine, 50 u / ml penicillin, and 50 g / ml streptomycin) at 37c in a 5% co2 and 95% air atmosphere . The medium was changed every 2 days and double immunofluorescence was performed in free floating after 710 days in vitro . Organotypic cultures were washed three times with pbs, fixed with 4% paraformaldehyde for 1 h, rinsed, and blocked for 1 h in phosphate buffered saline (pbs)/10% normal donkey serum (nds)/0.4% triton x-100 . Primary antibodies were incubated for 24 h in pbs/2% nds/0.4% triton x-100 (table 1). The secondary antibodies used for double labelling are cy3-conjugated donkey anti - rabbit igg (1: 100, jackson immunoresearch, europe) or alexa fluor 488-affinipure donkey anti - mouse igg (1: 200, jackson immunoresearch). After rinsing, sections were mounted, covered with fluoromount medium (sigma - aldrich, milan, italy) and a coverslip, and analyzed by confocal microscopy . Microglia and oligodendrocytes were washed three times with pbs, fixed with 4% paraformaldehyde for 10 min (oligodendrocytes) or 20 min (microglia), washed, permeabilized with 0.050.1% triton x-100 for 10 min, rinsed, and blocked for 30 min in pbs/1% bsa . Microglia were stained for about 3 h at 37c in 1% pbs / bsa with 5 g / ml cy2-phalloidin (sigma - aldrich), in combination with primary antibodies against p2y12 receptor, as reported in table 1 . The secondary antibodies used for double labelling are cy3-conjugated donkey anti - rabbit igg (1: 100, jackson immunoresearch) or alexa fluor 488-affinipure donkey anti - mouse igg (1: 200, jackson immunoresearch). Cells were extensively washed and stained with the nucleic acid blue dye, hoechst 33342 (1: 1000). After rinsing, cells were covered with fluoromount medium (sigma - aldrich) and a coverslip and analyzed by confocal microscopy . Animals were anaesthetized by intraperitoneal injection of chloral hydrate (500 mg / kg) and transcardially perfused with pbs followed by 4% paraformaldehyde at ph 7.4 . Tissue samples (mice spinal cord and rat brain) were then postfixed for 1 - 2 days, and cryoprotected in 30% sucrose in pbs at 4c . Mice spinal cords (l3l5) were cut at 30 m thickness with a frozen microtome . Sections were mounted on slide glasses and allowed to air - dry (1 - 2 h). A rectangle was then drawn around the sections with a pap pen (sigma - aldrich). Rat brains were cut at 40 m thickness using a cryostat microtome and sections were processed in free - floating . Double immunofluorescence analysis was performed after blocking in pbs containing 10% nds and 0.3% triton x-100 for 1 h at room temperature . Sections were incubated with different combinations of primary antibodies (table 1), in pbs, 0.3% triton x-100 and 2% nds, for 2448 h at 4c . Finally, sections were washed with pbs and incubated with appropriate fluorescent - conjugated secondary antibodies for 3 h at room temperature . After rinsing, sections were covered with fluoromount medium (sigma - aldrich) and a coverslip and analyzed by confocal microscopy . Tissues supplied by uk multiple sclerosis tissue bank at imperial college, london, were collected postmortem with fully informed consent from both donors and close relatives . Procedures for retrieval, processing, and storage have gained ethical approval from all appropriate committees . The brain tissues analyzed were from 7 neuropathologically confirmed cases of secondary progressive ms (spms). Analysis was performed also on samples from patients who died due to nonneurological diseases (healthy). Cerebral hemispheres were fixed with 4% paraformaldehyde for about two weeks, coronally sliced, and blocked . Individual blocks were cryoprotected in 30% sucrose for one week and frozen by immersion in isopentane precooled on a bed of dry ice . Cryostat sections (3040 m thick) were either stained with luxol fast blue and cresyl fast violet (kluver - barrera staining), in order to detect white matter lesions and their cellularity, or subjected to immunohistochemistry for mbp, in order to distinguish grey matter lesions . Sections were processed in free - floating for double immunofluorescence studies, as described in amadio and collaborators . Immunofluorescence was analyzed by means of a confocal laser scanning microscope (zeiss, lsm700, germany) equipped with four laser lines: 405, 488, 561, and 639 nm . The brightness and contrast of the digital images were adjusted using the zen software (zeiss). Human p2y12 complete cdna was obtained by reverse transcription with enhanced avian rt - pcr kit (sigma - aldrich) from total human brain rna (life technologies, paisley, uk). The obtained cdna was then cloned into the xhoi and xbai sites of the eukaryotic expression vector cs2 + mt to provide n - terminal 6x c - myc epitope - tagged mammalian expression plasmids, which has been validated by dna sequencing . Oligos used for amplification were as follows: forward 5gcctcgagatgcaagccgtcgacaacctc3 and reverse 5gctctagagtttacattggagtctcttc designed on human p2y12 mrna (nm_022788.3). Human embryonic kidney 293 cells (hek 293) and sloan - kettering neuroblastoma sh - sy5y clone (sh - sy5y) cells were grown in dmem supplemented with 10% fbs, 100 unit / ml penicillin, and 100 g / ml streptomycin at 37c in atmosphere containing 5% co2 . One day before transfection, hek293 or sh - sy5y cells were plated and transfection of p2y12-cs2 + mt or cs2 + mt empty vector was performed with lipofectamine 2000 (life technologies), according to manufacturer instructions . Primary rat microglial and oligodendrocyte cells were lysed with trizol (life technologies) and total rna was extracted following the manufacturer's instructions . After dnase treatment (qiagen, hilden, germany), equal amount of total rna (1 g) was subjected to retrotranscription by high capacity rna - to - cdna kit (life technologies) and 50 ng of each cdna were amplified with rat p2y12 specific primers (f: 5-gattgataaccattgacc-3; r: 5-ggtgagaatcatgttagg-3). Amplification products (10 l of 20) were electrophoresed on 2% agarose gel containing ethidium bromide (1 g / ml, sigma aldrich), photographed under uv light using kodak image station 440cf, with molecular imaging software 4.0.1 . In order to isolate total protein extracts, microglia and oligodendrocytes were harvested with ice - cold ripa buffer (pbs, 1% nonidet p-40, 0.5% sodium deoxycholate, and 0.1% sds), added with protease inhibitor cocktail (sigma aldrich). Lysates were kept for 30 min on ice and then centrifuged for 10 min at 14,000 rpm, at 4c . Snap - frozen blocks from cases ms114, ms125, and ms163 supplied by uk multiple sclerosis tissue bank at imperial college in london were homogenized in ripa buffer, added with protease inhibitor cocktail, incubated on ice for 1 h, and centrifuged at 14,000 rpm for 10 min at 4c . Rat brain and mouse brain and spinal cord were homogenized and sonicated in ripa buffer, added with protease inhibitor cocktail, kept for 1 h on ice, and centrifuged at 4c for 10 min at 13,000 rpm . Supernatants were collected and analyzed for protein content by bradford colorimetric assay (biorad, milan, italy). Analysis of protein components was performed by polyacrylamide gel (sds - page) separation (biorad) and transfer onto nitrocellulose membranes (amersham biosciences, cologno monzese, it). After saturation, blots were probed overnight at 4c, with the specified antibody (table 1), and finally incubated for 1 h with hrp - conjugated secondary antibodies and detected on x - ray film (aurogene, rome, italy), using ecl advance western blotting detection kit (amersham biosciences). P2y12 protein was detected with molecular mass comprised between 40 kda (as predicted by amino acid sequence) and 49 - 50 kda (as predicted by the manufacturer data sheet). Analysis was performed with the statistical software package medcalc (medcalc software, mariakerke, belgium). In order to provide wide ranging comparative analysis of p2y12 expression particularly in microglia and oligodendrocytes under neuroinflammatory conditions, we performed immunofluorescence and confocal analysis of receptor expression in primary cortical and organotypic cerebellar cultures, in tissue slices from rat striatum and cerebellum, in spinal cord sections from symptomatic and end stage sod1-g93a als mouse model, finally in autoptic cortical tissue from progressive ms donors . P2y12 receptor is formed by two transcript variants that give rise to identical proteins with 342 amino acids, a secondary structure constituted by seven hydrophobic transmembrane domains connected by three extracellular and three intracellular loops, with four extracellular cysteine residues most likely contributing to the nucleotide binding site (figure 1(a)). The commercially available p2y12 antibodies that we mostly used in our work are raised against the second intracellular loop, and precisely amino acids 125142 (here named intra1, intra2, and intra fl; see red circle in figure 1(a)), and against the c - terminus, here named c - ter (see green oval in figure 1(a)) (see also table 1). In order to validate the use of these different antibodies for p2y12 receptor, we compared them on recombinant p2y12 receptor protein obtained by cloning the complete cdna of the human receptor into the eukaryotic expression vector cs2 + mt, to provide the expression of a n - terminal c - myc tagged fusion protein . After transfection into sh - sy5y and hek293 cell lines, we analyzed total protein extracts by sds - page and western blotting using c - ter, intra1, and intra2 antibodies . Although with different intensities, all the antibodies recognize the myc - p2y12 protein band at the predicted molecular mass of 50 kda . These results confirm the specificity of the used antibodies toward denatured recombinant p2y12 receptor (figure 1(b)). In order to verify the expression of p2y12 mrna in rat primary oligodendrocytes (ol) and microglia (rmg), rt - pcr was performed using specific primers designed on receptor sequence . As shown in figure 1(d), rt - pcr on both rmg and ol reveals the presence of the predicted p2y12 mrna band . Next, we validated the antibodies with protein extracts from dissociated primary cultures or tissues from different species . P2y12 protein is specifically recognized in extracts from human cerebral cortex snap frozen tissue, rat and mouse brain, mouse primary microglia (mmg) and ol (figure 1(c)). No signals are obtained when the immunoreactions are performed in the presence of p2y12 neutralizing peptides, when available from manufacturer (data not shown). In order to establish cell specificity of p2y12 receptor expression, we performed comparative immunofluorescence and confocal analysis in primary dissociated cortical microglia and oligodendrocytes (figures 2(a) and 2(b)), as well as organotypic cerebellar cultures (figure 2(c)). P2y12 is strongly recognized by both c - terminus- and second intracellular loop - recognizing antibodies (red, c - ter, upper left inset; intra fl, upper right inset; intra1, lower right inset and intra2, lower left inset), specifically distinguishing the very heterogeneous morphological features of mouse primary microglia, as shown by double fluorescence and confocal analysis performed with phalloidin (green), a marker for filamentous actin (figure 2(a)). Fan - like cells (insets), elongated rod - like cell bodies with short and tiny branches, asymmetrical hairy cells with miniature processes or lamellipodia are simultaneously observed (c - ter phalloidin hoechst, merged). Likewise, all the p2y12 antibodies (intra2, intra1, c - ter, and intra fl) recognize the multibranched morphology of rat mature oligodendrocytes (figure 2(b), ol, insets, red) in primary cultures, as confirmed by double immunofluorescence and confocal analysis with mbp antibody (ol, intra1-mbp, yellow merged image). In addition, both intra2 and c - ter antibodies distinguish the ng2-positive rat oligodendrocyte precursor cells (opc, merged insets). P2y12 immunoreactivity is confirmed in the ex - vivo system of organotypic rat cerebellar cultures (figure 2(c)). However, differently from mouse microglia and rat oligodendrocyte primary cultures, the second intracellular loop- (red, intra1) and c - terminus - recognizing (red, c - ter) antibodies surprisingly immunoreact with different cell phenotypes when the integrity and cytoarchitecture of the tissue is preserved, as in organotypic cultures . While intra1 antibody (red) exclusively labels mbp - positive fibers (green) and highlights myelin structures, c - ter antibody does not immunoreact with myelinated fibers, being present on cells likely resembling microglia (insets), as also confirmed by colocalization with microglial marker cd11b (data not shown). Results similar to those found with intra1 were also obtained with intra2 antibodies, lots an01/02/04 (data not shown). We next verified if the cell type - specific presence of p2y12 receptor observed in organotypic culture, either in myelin structures or in microglia, respectively, by the use of the second intracellular loop-(intra1) or the c - terminus - recognizing (c - ter) antibody, is also confirmed in rat cerebellar and striatal slice tissues (figure 3). All the antibodies raised against the second intracellular loop (red, intra1, intra2, intra fl) identify the abundant presence of p2y12 receptor only on myelinated fibers from both cerebellum (figures 3(a), 3(b), and 3(c)) and striatum (figures 3(d), 3(e), and 3(f)), as confirmed by colocalization of signals obtained with intra fl and mbp antibodies in cerebellum (+ mbp, inset c2, merged, yellow) and striatum (data not shown); colocalization of signals obtained with intra1 and intra2 with mbp antibodies in cerebellum and striatum (data not shown); immunoreactivity of intra1, intra2, and intra fl antibodies for structures identical to those observed in cerebellum (data not shown) and striatum with mbp antibody (see for instance mbp, inset e1, green); identification by second intracellular loop p2y12 antibodies of structures totally different from both bergmann glia and astrocytes recognized by specific gfap antibody in cerebellum (inset b1, green), and from microglia identified by specific cd11b antibody in cerebellum (+ cd11b, inset c1, merged, green) and striatum (+ cd11b, inset f1, merged, green). Of notice, all the 2nd intracellular loop antibodies are able to describe the specific cytoarchitecture of both cerebellum, where radiant and sparse fibers clearly characterize the lobuli, and of striatum, where white matter is instead organized in distinct bundles . As in organotypic cultures, the c - terminus antibody (red, c - ter) instead recognizes only microglia in rat cerebellum (figures 3(g), 3(h), and 3(i), and insets g1, h1, i1), striatum (figures 3(j), 3(k), and 3(l)) and cerebral cortex slices (data not shown), with a signal more uniformly distributed throughout the whole tissue . By comparing the cd11b and c - ter immunolabelling in the striatum, we furthermore observe that the mutual intensity of signals is cell - selective within the microglia population, with some cells exclusively positive for c - ter (arrow), and others instead showing different grades of cd11b - c - ter colocalization (see for instance orange, yellow and greenish cells in the merged field). Regrettably, double immunofluorescence with c - ter and iba1 microglia marker is not practicable, since both antibodies are raised in the same species . However, no colocalization of signals is ever shown between mbp (green) and c - ter antibodies (+ mbp, inset j1, merged). In order to verify if p2y12 recognized by c - ter antibody exclusively in microglia from rat brain slices could be used as specific microglia marker during neuroinflammation, we validated its use in a typical neuroinflammatory disease such as als and for the first time characterized the presence of p2y12 receptor in sod1-g93a mouse model (figure 4). By immunofluorescence and confocal analysis on lumbar spinal cord sections (l3l5) of wild - type (wt) mice, we first compared the immunoreactive signals obtained with c - ter and specific microglia markers cd11b (red, recognizing ramified microglia) and cd68 (red, recognizing roundish activated microglia). In wt mice, c - ter (green) is abundantly and strongly immunoreacting with the microglia population and colocalizing with the majority of cd11b - positive cells, in both dorsal (dh) and ventral (vh) horns of spinal cord (figure 4(a), left panel, merged yellow signal). All cd11b - positive cells share immunoreactivity for c - ter, as proved by the absence of red cd11b signal . Conversely, not all c - ter - positive cells immunoreact also with cd11b antibody, as proved by the presence of some green c - ter signals . In addition, we never observe colocalization with the rare activated cd68-positive (red) microglia cells present in wt healthy tissue (figure 4(a), right panel, merged and inset). To test if c - ter antibody can further recognize microglia activation during the progression of als, we next examined sod1-g93a spinal cord sections at two different stages of the disease, that is, 20 weeks, a phase when the disease accelerates, and end stage, that is, 23 weeks, when the animals reach the score of 1 accordingly to a behavioral score system . At both stages, sod1-g93a mice show a significant increase in cd68 immunostaining not only when compared to wt mice (figure 4(a)), but also in vh with respect to dh, and this is even more evident at end stage with respect to 20 weeks (red, figure 4(b)). Remarkably, the immunoreactive signal of c - ter (green, figure 4(b)) decreases during disease progression and the effect is pronounced especially in vh, where motor neuron loss, tissue damage, and microglia activation are known to be increased . Particularly at 20 weeks, c - ter - expressing microglia are still ramified in dh, where few cd68-positive cells are present, but start to disappear in vh, where instead cd68-positive cells are increased . At end stage, c - ter staining decreases in dh with respect to 20 weeks and disappears almost completely in vh, concomitantly with a robust increase in cd68 staining . A parallel decrease in c - ter and increase of cd68 immunoreactivities is also confirmed by western blot analysis performed on sod1-g93a lumbar spinal cord homogenates at end stage (figure 4(c)). As in rat organotypic cerebellar cultures (figure 2(b)) and rat cerebellar, striatal, cortical, or mouse spinal cord tissue slices (figures 3 and 4), a similar pattern of p2y12 receptor expression is shown in human frontal cortex autoptic tissue by using c - ter antibody that highlights only microglia uniformly distributed throughout the entire healthy tissue (red), but not mbp - positive myelinated structures (green), as detected by the absence of overlapping immunofluorescent signals (figures 5(a), 5(b), and 5(c), merged and insets a1, c1). On the contrary, intra1 (red, figures 5(d), 5(e), and 5(f)), intra2, and intra fl (data not shown) antibodies recognize exclusively myelinated fibers in tissue from healthy (insets d1, e1, and f1) and progressive ms donors (figures 5(d), 5(e), and 5(f)), as it is found with rat tissue (figures 2 and 3). Moreover, we confirm a decrease of p2y12 receptor signal in proximity to the demyelinating lesion, as detected by loss of mbp - positive fibers (see asterisks). No colocalization of signals is shown with mhc ii - positive microglia (+ mhc ii, inset d3, merged). Importantly, c - ter, intra1 (red, insets a - f2) and intra2, and intra fl (data not shown) antibodies all recognize the presence of p2y12 receptor in integrin ii/3-positive platelets (green) contained in the blood vessels of the analyzed tissues . As observed in als mouse spinal cord where p2y12 receptor detected by c - ter antibody is shown to temporally and regionally decrease in microglia as a function of increasing inflammatory damage (figure 4), we notice that microglia gradually lose immunoreactivity for c - ter antibody (figure 6) in proximity to the demyelinating active cortical lesions of ms expressing augmented positivity for mhc ii [3335]. Moreover, by comparing mhc ii and c - ter signals, we recognize four areas (a d) inside and around the lesion, where microglia express different amount of these proteins . In zone a, at the edge of the lesion, we observe a predominance of c - ter immunoreactivity (red) compared to that of mhc ii (green), as depicted in the merged field by a major occurrence of red signal . In zone b, closer to the lesion, we notice a prevalence of active mhc ii - positive green cells, but still the presence of few red and yellow signals . C and d, apparently in the core or outside the lesion, respectively, where microglia express either almost exclusively mhc ii protein (c) or p2y12 receptor on ramified microglia (d). The interchange among different cell types of molecular cues that condition the cell specificity and the protein profile of each cell characterizes the morphological and functional heterogeneity in particular of microglia within various cns regions, developmental stages [37, 38] and, even more, states of activation during pathological conditions . In the case, for instance, of als, the release of signals from motor neurons apparently denotes one of the earliest phase of the disease, with microglia behaving as an m2 phenotype producing neuroprotective factors to repair motor neurons and preventing them against further injury . As disease rises, motor neurons start releasing alarm signals that in turn convert microglia from beneficial m2 to cytotoxic m1 phenotype, with consequent release of proinflammatory cytokines . For instance, m1 markers are abundantly expressed in normal appearing white matter and throughout active demyelinating ms lesions by activated microglia and macrophages, although in human active ms lesions microglia show an intermediate activation status . In addition, m2 microglia appear fundamental to guide oligodendrocyte remyelination in mice, and a switch from m1- to m2-dominant response occurs in microglia and peripherally derived macrophages when remyelination starts . Only therapeutic procedures that both down - regulate the harmful responses and up - regulate the beneficial responses may hopefully slow pathological progression and provide meaningful hope for treatment . At the same time, the identification of clear markers involved in the m2/m1 microglia transition becomes mandatory for presymptomatic diagnosis, monitoring of disease progression, and efficacy of therapies . Under this perspective, and consistently with previous findings establishing the role of purinergic receptors in the pathogenesis of both als and ms [14, 43], our present work serves this aim, by highlighting the gradual loss of p2y12 immunoreactivity as an early marker of neuroinflammation and microglia metamorphosis . We have indeed demonstrated here that p2y12 receptor protein identified in primary cultures of both microglia (figure 2(a)) [18, 44] and oligodendrocytes (figure 2(b)) by different but p2y12-selective antibodies can be instead recognized in branched microglia exclusively by the use of c - ter antibody (figures 36). This occurs only when the integrity and cytoarchitecture of the tissue is typically preserved in the presence of the least experimental manipulations, that is, in organotypic cultures (figure 2(c)) and tissues slices for instance from rat striatum and cerebellum (figure 3), mouse spinal cord (figure 4), and human cerebral cortex (figures 5 and 6). A similar difference in primary cultured cell versus tissue distribution of a protein was previously demonstrated with large - conductance calcium - activated potassium channel expression, in vascular endothelium . A first implication emerging from these results is that a reliable evidence about selective p2y12 expression in cells of healthy or neuroinflammatory states is genuine only when cell connectivity and tissue architecture are fully preserved . We have indeed shown this, by proving that the antibodies used for p2y12, recognizing either the c - terminus or the second intracellular loop of the receptor (figure 1 and table 1) and immunolabelling, respectively, microglia or myelinated fibers in the cns, are all still able to immunoreact for instance with platelets (figure 5), where the receptor was originally described to be present and to have a role in the processes of activation, aggregation [4649], primary hemostasis, and arterial thrombosis [5055]. A possible explanation for the microglia versus oligodendrocyte selectivity of the p2y12 antibodies might be that gi - coupling, and/or quaternary structure, post - transcriptional modifications, and subcellular localization of p2y12 that remain strictly preserved in platelets, are instead divergent in microglia with respect to oligodendrocytes / myelinated fibers . In this case, a cell - specific network of p2y12 oligomeric interactions and/or a distinct subcellular partitioning might simply mask the recognition sites of the different antibodies on p2y12 protein in different cell types . To support this hypothesis, we know that in platelets p2y12 indeed resides in subcellular lipid raft structures and its partitioning out from rafts causes for instance inactivation and that also the presence of another purinergic receptor, the ionotropic p2x3, in lipid rafts has cell - specific properties shared in cerebellar granule neurons and total brain tissue but not in neuroblastoma cells and dorsal root ganglia and that the specific antagonist clopidogrel inhibits p2y12 by breaking down the homoligomeric complex to single monomers and finally, that hetero - oligomerization of p2y12 is demonstrated with p2y1, p2y2, p2y13, and with adenosine a1, a2a receptors in different cellular backgrounds . All these features might very well explain also why it has not been found colocalization between p2y12 and gfap - positive astrocytes in rat brain cortex and nucleus accumbens, despite the abundant presence of p2y12 mrna and, moreover, why p2y12 is specifically observed in brain and spinal cord resident microglia but is not observed, for example, in peripheral macrophages in spleen [18, 20]. A second implication that emerges from our results is that the morphological metamorphosis that microglia undergo under neuroinflammatory conditions as those triggered during als and ms, can be remarkably highlighted by the progressive reduction of p2y12 immunostaining obtained with c - ter antibody that reacts, also in this case, exclusively with multibranched microglia still present in the tissue (figures 4 and 6). This closely reflects the expression of p2y12 that is robust in the resting / surveillant branched state but dramatically decreased after morphological transition and activation of microglia . Our observations are also in line with the central role played by p2y12 in branched microglia membrane ruffling and inspection of the environment . On the other hand, they depict a morphological / functional state of microglia that only partially overlaps with cd11b and mhc ii immunoreactivities, which are furthermore known to increase during activation but instead highly contrasts with cd68 immunostaining that is totally absent in ramified microglia . In parallel to our results, these last antibodies actually accentuate the progressive transition of microglia from a lesser ramified shape to a significantly more activated amoeboid phenotype (figures 4, 6, and 7), thus suggesting the dual use of c - ter and cd68 antibodies as markers, respectively, for branched resting / surveillant versus roundish / activated microglia . A reduction of c - ter - p2y12 immunostaining that is concomitant to an increase, for instance, of mhc ii / cd11b / cd68 immunoreactivity, could thus become a feasible approach to detect an increasing neuroinflammatory condition . Indeed, p2y12 is considered an essential component and primary site at which nucleotides such as adp act to promote directional microglia movement or chemotaxis at early stages of cns injury . In particular, microglia from mice lacking p2y12 exhibit normal baseline motility but are unable to polarize and to elicit directional branch extension and migration toward nucleotides in vitro, or sites of cortical damage in vivo . These notions are consistent with our results that fail to describe c - ter - p2y12 immunoreactivity on roundish phagocytizing, or polarized migratory microglia . However, we still do not know if reduction / absence of p2y12 c - ter - immunolabelling on activated microglia might be a cause or a consequence of morphological / functional transition or might simply reflect a cell - selective hindrance and lack of access to the immunogenic sites by the antibody . Anyhow, we can assert that the distinctive recognition of multibranched microglia renders the c - ter antibody a novel and useful tool to discriminate among microglia morphological states, thus making p2y12 receptor a selective and early marker for the ramified phase . In parallel to this, we have also proven that all the several antibodies raised against the second intracellular loop of p2y12 (intra1, intra2, and intra fl) can likely be employed as markers for the presence of ms lesions . Although with different intensities, they not only recognize the receptor specifically on myelinated fibers of organotypic cultures (figure 2(c)), tissues slices from rat striatum or cerebellum (figure 3) and human cerebral cortex, but also furthermore highlight the reduction of p2y12 signal that occurs for instance in ms tissue (figure 5) in correlation to the extent of demyelination found in all types of grey matter cortical plaques (i iii) and subcortical white matter . In brief, we have shown here that the presence of p2y12 receptor can be simultaneously identified by the c - terminus and the second intracellular loop antibodies . When this occurs, a condition of intact myelinated fibers and branched / surveillant microglia is represented at once that perhaps signifies a for instance in ms, a decrease in the second intracellular loop immunoreactions accompanied by an increase of c - terminus immunoreactivity will possibly depict the loss of myelin and replacement by ramified microglia that often occur in an inactive plaque . On the contrary, a decrease in c - terminus immunolabelling in the abundant presence of second intracellular loop - positive myelinated fibers would indicate an early active plaque where m1/m2 microglia reactivity starts to take place . By comparative analysis of all the available p2y12-immunoreactive antibodies recognizing the c - terminus or the second intracellular loop of the receptor, we have established here that, under experimental conditions of well - preserved cytoarchitecture and tissue integrity, p2y12 receptor expressed by both ramified microglia or oligodendrocytes / myelinated fibers might serve a dual function as specific marker, respectively, of branched / surveillant microglia as well as demyelinating lesions . We believe that p2y12 identification and modulation might potentially acquire an important predictive value under neuroinflammatory conditions, as those found in als and ms . P2y12 is likely to deserve a key role in the verge of a neuroinflammatory breakdown.
|
Acute kidney injury (aki) requiring dialysis is a serious complication in critically ill patients, bringing increased morbidity, mortality, and costs of care [14]. Aki requiring dialysis is usually considered the most severe form of kidney injury, and these patients have been conventionally regarded as a relatively homogenous group of patients, either when describing epidemiological information or while conducting clinical trials [5, 6]. However, studies examining interventions in dialysis patients (e.g., dialysis modality or frequency have not demonstrated unequivocal survival benefits [79]. It is well recognized that small changes in creatinine (mild - to - moderate aki) independently predict mortality [10, 11]; we also recently reported that patients with aki requiring dialysis represent a wider spectrum of severity of kidney injury, contrary to the prevalent notion . Thus, it can be hypothesized that the degree of elevation of creatinine prior to initiating dialysis may discriminate risk - adjusted mortality, similar to the observations in nondialysis requiring aki . The acute kidney injury network (akin) has issued standard definitions of aki; currently, in these criteria, aki requiring dialysis is classified as stage iii (or severe) aki . The consensus panel also proposed that the examination of natural history of severe aki in icu to be one of the high - priority research areas, with a goal that new information may improve our ability in conducting prospective trials of intervention aki [14, 15]. To date, there are limited studies that have examined the course or progression of aki after icu admission until the point of dialysis initiation . Whether the degree of severity of kidney injury prior to dialysis requirement independently influences mortality risk in aki is not known . In order to facilitate risk stratification that may be useful for the development of prospective studies, which are geared towards early diagnosis or intervention in severe aki, we characterized the spectrum of severity of kidney injury in a cohort of icu patients with aki who required dialysis . We specifically tested the association of creatinine elevation during icu stay, starting with icu admission and prior to dialysis initiation, with the risk of hospital mortality . We also examined the impact of severity of illness upon icu admission on the mortality risk in these patients . We examined a cohort derived from the veterans affairs (va) inpatient evaluation center (ipec); a national quality improvement program which reports risk - adjusted mortality, length of stay, and adherence to evidence - based practices in all va icus, by collecting data electronically from va computer databases . An analytic dataset was formed from the ipec retrospective cohort including all patients (n, 617,927) admitted to all 191 va icus in the usa between october 2001 and september 2006 . We excluded patients with (i) less than three creatinine measurements during the icu stay (n, 204,963), (ii) readmissions to the icu (n, 50,874), (iii) transferred to other hospitals at discharge (n, 14,219), (iv) transplant recipients (n, 317), and (v) those with chronic renal failure defined as prior dialysis (n, 3,862 patients), or international classification of disease-9th clinical modification (icd-9-cm) codes for end - stage renal disease (esrd; 1,388 patients 585.6), or with a calculated glomerular filtration rate (gfr) <15 ml / min/1.73 m (16,571) (gfr estimated by four variable modified diet in renal disease equation); 296 additional patients who required dialysis in icu but had icd-9 codes for advanced ckd / stage v ckd were also excluded (based on random q / a, these codes identified esrd status in those who required dialysis). Thus, 324,999 patients were available for analysis . The analyses were reviewed and approved by the university of cincinnati institutional review board and va r&d committees . Briefly, from each hospital database, a customized program identifies patients whose hospitalization included an icu stay, and extracts administrative data from the index hospitalization that includes icd-9-cm codes representing the reason for admission to the icu, length of stay, and all procedure codes . Measured values of 11 laboratory tests are extracted to estimate severity of illness from a period of time 7 days prior to icu admission through hospital discharge . Mortality is defined at death during hospitalization and is validated using the vital status file at the va national database (austin, tx). Aki was present if there was an increment of serum creatinine by> 0.3 mg / dl (or 1.5 times increase) during the icu stay relative to the creatinine on icu admission . For this analysis, we specifically focused on examining characteristics and outcomes of those aki patients who progressed to new requirement of dialysis (aki - d) during icu stay (part of stage iii aki according to the akin classification system). Dialysis requirement in icu included both intermittent and continuous dialysis, as prescribed by the clinician, and the modality cannot be differentiated based on va electronic records that were available . We categorized aki - d into four groups based on the change in creatinine level after icu admission but prior to initiation of dialysis: group i had an increase in creatinine ranging from 0.3 mg / dl to <2-fold increase, group ii an increase in creatinine 2 times baseline but <3 times, group iii 3-fold increase in creatinine, and group iv included those patients with new dialysis requirement in icu but who experienced a creatinine elevation of <0.3 mg / dl . The purpose of this grouping was to determine an equivalent stage of aki that a patient may experience prior to initiating dialysis based on the standard definitions of aki put forth by the akin . Some patients may have had creatinine values available after dialysis initiation, but these values were not considered for analysis . The study accounts for differences in patient characteristics using a previously validated logistic regression model that predicts mortality risk for each patient from independent predictors (age, thirty - one comorbid disease groups (by icd-9-cm codes), eighty - four mutually exclusive admission diagnoses determined from the icd-9-cm codes denoting the reason for admission to the icu, source of admission (emergency room, outpatient clinics, ward, hospital, operating room, or nursing home), and the worst value of each of the 11 laboratory tests measured within 24 hours of icu admission (sodium, urea, creatinine, bilirubin, albumin, glucose, hematocrit, white blood cell count, pao2, paco2, and ph). Diagnosis and comorbid diseases were included in this model as binary variables, most laboratory values and age were included as cubic splines, and paco2 and ph were treated as a categorical interaction term . The model has been validated across multiple centers with excellent calibration and discrimination (c - statistic = 0.88; brier's = 0.06), and comparable with traditional methods of severity of illness assessment (e.g., apache). From the logistic regression model, a standardized mortality rate for groups can be determined (smr = observed / predicted mortality; where predicted mortality is estimated by the mortality model described above). A more detailed account of development and validation of these variables and risk adjustment methods has been published earlier [16, 19, 20]. Univariate comparison of diagnosis categories, comorbid diseases, and their relationship with laboratory variables was tested by chi - square test and kruskal - wallis test . A two - step logistic regression model determined the independent contribution of patient groups (based on creatinine elevation) to hospital mortality . The first step predicted each individual patient's hospital mortality using the validated method described above . Independent predictors in the second step included the predicted mortality (determined from the first step) and the patient group based on creatinine elevation before dialysis . Based on the predicted mortality, as determined by the mortality model described above, we also estimated the standardized mortality rate (observed / expected mortality) for each of the patient groups under consideration . Risk estimates were expressed as odds ratios (or) and 95% confidence intervals (95% ci). Overall, 21.9% of patients developed aki (71,090/324,999) of whom 2,744 patients experienced severe aki requiring dialysis . 561/2744 (20.4%) patients were admitted to icu from the hospital floors, whereas 2,183/2,744 (79.6%) were either direct admission or admissions from emergency rooms . The median time for aki - d patients to meet the criteria for aki from the time of admission creatinine measurement was 23.4 hours (interquartile range, 12.2, 46.6). The median time to initiation of dialysis in icu after icu admission was 96.0 hours (interquartile range, 33.6, 231.6); median time to dialysis initiation from icu admission was 72 hours in group i, 145.1 hours in group ii, 216.0 hours in group iii, and 14.6 hours in group 4 . When examined from the time when patients reached their peak creatinine value to the time of dialysis initiation, the median time was 43.0, 39.5, and 67.4 hours in groups i, ii, and iii respectively . Figure 1 shows the percentage of patients initiating dialysis by days after icu admission . The proportion of patients in each group is shown in figure 2; of the 2,744 patients who required new dialysis during icu stay, only about a third of patients (31.5%) experienced greater than 3 times increase in serum creatinine prior to dialysis initiation, and a small proportion of patients (11.2%) required dialysis with little or no elevation in serum creatinine (likely for fluid - electrolyte / acid - base disturbances). The baseline comorbid and laboratory characteristics of patients who developed aki requiring dialysis, and their univariate comparison across groups i through iv are shown in table 1 . Group iii patients (those with> 3 times increase in creatinine prior to dialysis) had the lowest levels of creatinine or bun on icu admission . In contrast patients in other groups, who sustained only milder or no elevation in creatinine before dialysis initiation, had significantly higher creatinine and bun levels on icu admission . Table 2 shows the frequency of admission diagnosis categories across four subgroups of patients with aki requiring dialysis . The frequencies of patients admitted with primary icu admission diagnoses of kidney disorders or electrolyte and metabolic disorders significantly varied across four groups and were 24% and 21%, respectively, in group iv (<0.3 mg / dl increase in creatinine before dialysis) compared with only 1.9% and 2.1% in group iii (> 3 times increase in creatinine before dialysis). This suggests that majority of patients in group iv may have been dialyzed for indications other than kidney injury (e.g., for electrolyte or metabolic disturbances). In contrast, cardiothoracic surgery admissions occurred at a higher frequency (26%) among group iii patients (> 3 times increase in creatinine), suggesting that these patients are more likely to have normal renal function on icu admission and hence sustain> 3 times increment in creatinine prior to dialysis requirement . The degree of creatinine elevation prior to dialysis initiation was associated with increase in odds of death . Table 3 shows odds ratios of mortality across all four groups, with group i as reference group . Dialysis patients in group ii had greater odds of death (odds ratio (or), 1.76, 95% confidence intervals (95% ci), 1.40, 2.22)), those in group iii were more than twice likely to die (or 2.20, 95% ci, 1.792.71), whereas patients in group iv were less likely to die compared to group i (or 0.39, 95% ci, 0.29, 0.52). The smr (table 3) confirmed a graded association between the degree of creatinine elevation prior to dialysis initiation and mortality risk . The relationship between creatinine elevation and risk of death remained qualitatively similar even after stratifying patients by level of renal function on icu admission (stratified at creatinine level of 1.2 mg / dl), but the sample size was relatively small in these subgroups (data not shown). Figure 3 shows smr associated with creatinine elevation stratified by severity of illness on icu admission . Dialysis patients in groups ii and iii had a significantly higher smr than those patients in groups i and iv, when predicted mortality was <10% or 1030%; smr was not significantly different across all four groups in patients admitted with> 30% predicted mortality on icu admission . The present study advances our understanding of natural history of progression of acute kidney injury during icu stay, in those patients who require dialysis . The study finds that, in patients with aki requiring dialysis, the risk of mortality is independently associated with the degree of severity of kidney injury sustained during icu stay prior to dialysis initiation and that severity of illness further influences this relationship . Several epidemiological studies have confirmed that icu patients developing aki requiring dialysis experience a high risk of mortality across different clinical settings, including cardiovascular surgery, or in other medical or surgical icus [12, 2123]. It is also observed that the severity of kidney injury, determined by the degree of creatinine elevation, in non - dialysis requiring aki is associated with a graded increase in mortality risk [2, 10]. The present study is one of the first reports to show that in patients who developed aki requiring dialysis, the degree of kidney injury prior to dialysis initiation determines mortality risk, after accounting other major predictors of hospital mortality . It does so by examining a large, diverse, multicenter cohort that includes all icu settings, with an ability to perform electronic data extraction starting (including serial creatinine measurements) from the time of icu admission until the point of dialysis initiation in aki . The results indicate that majority of the aki - d patients sustain mild - to - moderate degrees of creatinine elevation (equivalent of stage i or stage ii aki) prior to dialysis, whereas less than a third of patients require dialysis after sustaining> 3 times increase in serum creatinine during icu stay (or equivalent of stage iii aki). This confirms prior multicenter observations that aki requiring dialysis in icu usually represents a group of patients that sustain acute kidney injury on an underlying renal dysfunction . There were 11% of patients who required dialysis with <0.3 mg / dl increase relative to icu admission . Although the specific indications for dialysis could not be ascertained by electronic data extraction, however, based on the distribution of comorbid conditions and admission diagnoses, it can be suggested that the indications for dialysis in this subgroup may have been for volume overload or electrolyte / metabolic abnormalities rather than the degree of kidney injury . These observations are consistent with our prior experience in cardiac surgery settings, where 1015% of cases were dialyzed for reasons related to volume overload or electrolyte disorders and not azotemia / creatinine elevation . In terms of mortality, however, this group was associated with the lowest risk of death among those who required dialysis consistent with the study hypothesis . Prior large multicenter observations provide only a limited insight into the effects of severity kidney injury prior to dialysis initiation on patient outcome . Somewhat indirect evidence comes from the studies that have reported the impact of baseline chronic kidney disease (ckd) in patients with aki requiring dialysis . For example, a third of patients in a multicenter us cohort (picard cohort; 618 aki cases, 60% of whom required dialysis) had stage iv or worse ckd prior to aki . By multivariate analysis, baseline ckd status conferred 43% lower adjusted odds of in - hospital mortality (or, 0.57, 95% ci, 0.390.84) in aki . Similar observations have been reported in a medicare administrative sample that examined outcomes in aki . Unadjusted mortality rate in patients that were coded for aki requiring dialysis on an underlying ckd was 22% compared to 30% among those with aki requiring dialysis but without underlying ckd [2426]. Our study may offer one of the explanations to the seemingly paradoxical observation that ckd status in aki may confer a protective effect: that is, patients with impaired renal function on icu admission are likely to require dialysis after sustaining milder degrees of kidney injury than those admitted with relatively better renal function and thus experience a lower risk of mortality . Severity of illness on icu admission further modified the relationship between the degree of creatinine elevation and risk - adjusted mortality in aki require dialysis . The degree of kidney injury sustained prior to dialysis did not discriminate mortality risk in those patients with very high severity of illness (> 30% predicted mortality) on icu admission . In contrast, in patients with low - to - moderate severity of illness, it is the degree of injury that determines excess mortality risk rather than dialysis status alone . First, the data indicates that in half of the patients, dialysis was initiated within 96 hours after icu admission, with ~25% of then requiring it in the first 48 hours . Thus, in order to target these patients for early interventions, we need to develop better predictive models that are based on information derived within 24 hours of icu admission; similarly, the development of novel biomarkers that may predict dialysis requirement would need to discriminate acute kidney injury from underlying renal dysfunction at the time of icu admission . Second, it indicates that the efficacy of therapeutic measures in aki requiring dialysis cannot be equitably compared without accounting for both severity of illness on admission and degree of kidney injury sustained before dialysis initiation . For example, given the same predicted mortality or level of renal function on admission, patients in group i or iv could not be optimally compared with group iii in an intervention trial . Finally, it also raises the question that whether early dialysis, as indicated by initiation of therapy after a relatively lower magnitude of rise in creatinine, may offer a survival benefit . The va patient population is predominantly represented by male gender and white race and hence may limit in terms of generalizability of findings to specific demographic subgroups . By way of retrospective design, and lack of standardized criteria to initiate dialysis, the data cannot account for differences in dialysis practices across different centers . We, however, examine a multicenter, diverse cohort of icu patients that records patient level information that is available for automated extraction by computerized methods . Our cohort derivation excluded patients with advanced renal dysfunction on icu admission, and based on the present findings it can be expected that a significant proportion of these patients may have required new dialysis in icu . We still chose to use this criterion to minimize the likelihood of misclassifying patients with dialysis dependent renal failure prior to icu admission but who were not appropriately coded for it . Additionally, we considered the degree of creatinine elevation relative to admission creatinine, which may not reflect a true baseline assessment of renal function; this still allowed us to assess the relationship between magnitude of creatinine elevation and hospital mortality . Another limitation is that we did not have information on modality or frequency of dialysis and hence could account for those variables in the multivariate analyses . The present study relies on the va icu mortality model instead of other traditional methods of measures of severity of illness assessment such as apache criteria . The rationale to do so is because the va icu mortality model is derived from an automated electronic data extraction method, which has been validated across multiple va sites with excellent predictive accuracy and calibration (c - statistic = 0.88) and is comparable with other methods . In summary, within a cohort of patients who develop aki requiring dialysis during icu, the mortality risk is independently associated with the degree of creatinine elevation prior to dialysis initiation . The mortality risk is lowest in those who experience minimal or no elevation in creatinine and may represent less severe acute illness in patients with ckd, or easily reversible fluid - electrolyte or acid - base disturbances . The study also indicates that aki requiring dialysis represents a heterogeneous group of patients, and directly confirms earlier observations that only minority of these cases sustain severe kidney injury prior to dialysis initiation . We interpret the data to suggest that prospective studies aimed at examining therapeutic interventions in aki requiring dialysis (e.g., timing of dialysis initiation) would need to consider both the degree of kidney injury sustained prior to dialysis initiation and overall severity of illness, prior to performing equitable comparisons.
|
Many previous studies have revealed that parents, especially mothers, of children with developmental disabilities such as intellectual disabilities (ids), developmental delay, and physical and sensory handicaps are more likely to show signs of psychological distress or depressive symptoms and to exhibit lower well - being than parents of typically developing children [15]. It is generally accepted that caring for a child who has a developmental disability may involve significant and prolonged periods of time and energy . Since the majority of this increased daily care - giving burden for these children is carried by their parents, they are supposed to have an increased risk for high levels of stress, and thus some cases may be linked to depression [7, 8]. Recently, the mental health needs of adults with i d have also been taken up for discussion . Studies have revealed that psychiatric disorders are more prevalent in people with i d compared within the general population . Specialist psychiatric services for people with i d are available in some countries such as the uk and the usa; however, the provision of high - quality psychiatric services remains a major concern in many countries . . Evidently, the current psychiatric services in japan are not adequate to meet the complex mental health needs of people with i d appropriately, sensitively, and effectively . Failure to provide services that meet the needs of these individuals may lead to problems such as high - level caregiver stress and inappropriate therapy . The paucity of trained psychiatrists and other allied professionals is a major barrier to the development of this subspecialty in many countries . In japan, high - quality psychiatric services for the parents of children with i d are assumed to be not well established . So far, the major portion of resources has been directed to the treatment of and services connected with the children, and not enough attention has been paid to the actual mental condition and needs of the parents . To our knowledge, there have been no reports on a nationwide scale on the mental health and distress of parents having children with developmental disabilities in japan . Since the understanding of the parents' mental health may be essential for providing more appropriate support, we aimed to obtain a clear perspective on the situation facing the parents through this facility - based nationwide study . The current survey included 1,102 institutions and consultation centers for children with developmental disabilities distributing in all prefectures in japan, which were listed in the national register of agencies, organizations, and institutions related to intellectual disabilities and the directory of support centers for individuals with developmental disabilities . In japan, these institutions and centers play a key role in social support networks . Professional workers in these facilities come into contact with children as their clients, and also with the children's guardians, mainly with the mothers, on a daily basis . The questionnaire was written in japanese and was divided into two sections with a total of 47 multiple choice questions . The first section sought information about the characteristics of the facility, such as staff adequacy, the scale of the facility, the health promotion services provided, the ages of their clients, and the clients' main disabilities, namely, i d, pervasive developmental disorder (pdd), profound intellectual and multiple disabilities (pimd), physical disabilities, and others . The second section sought information about the clients' parents, such as signs of mental health distress and their needs, from the professional caregivers' point of view . Also measures taken by the professional caregivers when encountering distressed parents were asked in detail . Questionnaires were mailed in october 2008, with an explanatory letter to the person in charge of each institution or consultation center . When agreement was met to participate in this study, one or more service providers in each facility completed the questionnaire based on all sources of information available . The questionnaire was to be returned unsigned, using the stamped, self - addressed envelope enclosed . For ethical considerations, the information disclosed in the questionnaire was in a form which made it impossible to identify the facility and clients this study was approved and carried out under the supervision of the japan league on developmental disabilities (jidd). The statistical analysis including the chi - squared test was performed with the aid of the statistical package for the social sciences 15.0 (spss japan, inc . ). A two - sided p value of 0.05 or less was considered to be statistically significant . Answers to open - ended questions a total of 460 out of 1,102 facilities replied within four weeks, the response rate being 41.7% . According to the clients' main disabilities, each facility was classified into the following categories: i d, pdd, pimd, physical disability group, and others (table 1). The last group was small in number and diverse in character and also included responders who provided incomplete information; thus, data from this group were omitted from analysis hereafter . Also in table 1, the number of clients (mean persons per facility) as an index of facility scale, their mean age, and proportion of male gender are shown . Their average age (sd) was 44.7 (9.5) years old for the i d group, 53.0 (7.6) for the pdd group, 48.3 (8.4) for the pimd group, and 55.3 (4.9) for the physical disability group . 373 out of the 415 facilities (about 90%) experienced cases with difficulties when communicating with the clients' parents . The percentage was high regardless of the children's disabilities, being concretely highest in the pdd group (96.9%) and lowest in the physical disability group (86.7%). The proportion of such parents, out of the total, was reported to be almost none (5% or less) or few (less than one fourth of the clients) in most of the facilities (table 2). It should be noted that in the i d and pdd groups, about 15% of the facilities responded that about half or more of the parents were difficult to communicate with . In all groups, the characteristics of the i d and pdd groups were similar to each other, while the pimd and physical disability groups resembled each other . In other words, in the i d and pdd groups, slightly more difficulties were experienced with the fathers compared to in the pimd and physical disability groups, where they experienced more difficulties with other family members such as the grandparents and siblings compared to the i d and pdd groups . The primary reason for these difficulties was thought to be the parent's personal condition, such as poor mental health (table 2). This was especially true for the i d and pdd groups [(df = 9) = 41.9, p <0.001]. In the pimd and physical disability groups, the parent's poor socio - economic status and heavy care - giving burden, reflecting the child's level of disability, were considered to be major factors in approximately one - third of the cases . Signs of depression or a depressive state were the most common psychiatric disturbances seen in the parents . Among the four groups, the pdd group most commonly experienced cases which showed signs of depression or a depressive state in parents . The proportion of such parents was approximately 70% of the total [(df = 12) = 65.1, p <0.001]. Well - treated cases were only 5% out of the total; thus, most of these conditions were considered to be not medically well treated . For further analysis, we selected 159 cases where symptoms of depression or a depressive state were reported in a descriptive manner . According to these reports, we asked about the time of the onset, that is, whether it was prior to the birth of the child, when the parent first noticed the child's disability, or after the child had been fully medically diagnosed . Apart from the answer unknown which accounted for approximately half of the cases, prior to the birth of the child was relatively common in the pdd group (22.1%), whereas after the child had been fully medically diagnosed was relatively common in the pimd (23.5%) and physical disability groups (28.6%). When a parent suffered from signs of psychiatric disturbances, more than half of the children experienced maltreatment . Physical neglect was most common in all groups, accounting for about 50% of the cases . In comparison with the other groups, in the pdd group, the child was likely to be emotionally disturbed and confined indoors (32.6%), in the pimd group, the child was mostly confined indoors (33.3%), and in the physical disability group, medical care neglect made the utilization of medical and welfare support impossible (50%) [(df = 12) = 27.6, p = 0.006]. The leading measures were gathering and disclosure of necessary information, discussion among service providers within the facility about ways to deal with the parent, protection of the child by providing a safe environment, making approaches to other family members for cooperation, intensive collaboration with other organizations such as institutions and consultation centers for better community support, and medical support for the parent provided by specialists such as physicians and psychologists . Many factors were reported to affect the mental health of parents . The presence or absence of support from other family members (i.e., a spouse) and the existence (or not) of a medical condition in the parent were major factors (table 5). Practical use (or not) of social support networks, whether the child's level of disability was severe or not, and parent participation in face - to - face family support groups or not were also thought to be influential factors . In all groups, regardless of the child's disability, more direct welfare support for the child was considered to be helpful and thus requested to be improved, in order to meet the mental health needs of the parent . Besides this, in the physical disability group, family support groups, in the pimd group, support (including financial support) for other family members, and in the i d and pdd groups, support for other family members (mainly siblings and the other parent) and medical treatment of the parent's psychiatric disturbance were also emphasized . To fulfill the demanded future role of their facility, respondents expressed the importance of more collaboration with other institutions and consultation centers and the necessity for more special training courses targeting support professionals and recognized the urgent demand for more specialists especially psychologists who can support the mental health needs of both the children and their parents . In the present study, we surveyed institutions and consultation centers for children with developmental disabilities in japan, which play a central role in the social support networks . This facility - based nationwide survey revealed the situation facing the parents of children with i d and other developmental disabilities from the professional caregivers' point of view . Almost all of the facilities experienced difficulties in keeping good relations with the clients' parents, regardless of the children's disabilities, and the majority of service providers noted that the proportion of such parents, out of the total, was roughly between 5 and 25%, and still increasing . The primary reason for these difficulties was thought to be the parent's condition, such as their mental health and background . Also, signs of depression or a depressive state were assumed to be the most common psychiatric disturbance seen . These results suggested that thorough consideration of the parents' mental health needs, especially prevention of depressive conditions and support for parents suffering from them, is urgent - demanded task for facilities . I d, attention - deficit / hyperactivity disorder (ad / hd), and pdd are common developmental disorders, and the latter two are noted to have substantial genetic components . It has been reported that a lifetime prevalence of major mood disorders is higher in parents of children with autism and that the onset for the majority was prior to the birth of their child with autism . Family history studies of autism consistently uncovered a large subgroup with a high incidence of major mood disorders among family members, suggesting the two entities are related clinically and genetically [19, 20]. The findings of the present survey must be interpreted allowing for the limitations of the use of unconfirmed data reported by professional caregivers' who come into contact with children as their clients, and their parents on a day - to - day basis . Evidently, the service providers' perspective on parental mental health was consistent with previous reports from western countries on major mood disorders and pdd . In other words, facilities where the clients were diagnosed as having pdd experienced significantly more cases of parents with signs of a depressive state compared to other facilities, and the onset of depression was considered to be prior to the birth of the child in many of the cases . Although these professional caregivers were well trained and well experienced, only, one - third were physicians, nurses or psychologists . On account of the limitations of these data, we emphasize confirming the diagnoses of psychiatric disturbances through direct contact with the parents by specialists such as psychiatrists is necessary in future studies, for accurate understanding of the overall problem . In japan, there is no official system to check and document the parents' condition including their mental health status . Parents are not accustomed to being asked about their own mental health, so there is a tendency to avoid discussion on matters concerning themselves . This was the major reason why we asked the professional caregivers about the parents' condition, not the parents directly, in this study . But still we judged it to be worthwhile at this moment to summarize the professional caregivers' impression on this issue, since the case in japan has never been described in detail despite of its importance . Because the majority of burden for daily care of handicapped children is typically carried by mothers, particular concern is raised for their adaptation . In the past studies, the psychosocial outcomes in mothers were said to be better predicted by psychosocial factors such as more active social life and family resources . Recent research focusing on parenting stress illustrated the value of the participation of fathers also . Greater marital quality predicted lower parenting stress for both mothers and fathers, while greater social support predicted increased parenting efficacy for fathers . Although the relationship between child characteristics and parental well - being has not reached an invariable agreement, the severity of a child's disability, intellectual functioning, and so forth are generally considered to be risk factors . Since the burden for daily care is mainly carried by the mother, similarly in japan, service providers tend to be in contact with the mother more frequently than other family members . This may be partially the reason why service providers experienced difficulties in communicating with mostly the mothers in this study . The presence of support from other family members, such as a spouse, is considered to be a major influential factor for the mental health of parents in japan also . Practical use of social support networks such as participation in face - to - face family support groups, more financial support for the household, more direct welfare support for the child, and medical treatment of the parent's psychiatric disturbance were reported to be helpful and thus requested to be improved, in order to meet the mental health needs of the parent . We would like to emphasize the fact that although the importance of medical treatment for the parents' psychiatric disturbances was pointed out, it was also realized that these conditions were presently not being medically well treated . This shows that current psychiatric services in japan are not adequate to meet the complex mental health needs of the parents appropriately . To resolve this challenging issue, more intensive collaboration between other child - care facilities and organizations, aiming at the mental health needs of the parents, is demanded . The paucity of trained psychiatrists and other allied professionals also needs to be addressed, and in order to fulfill this, sufficient discussion and research on the establishment of an effective training system for specialists is warranted . Providing direct advice for the parents on the utilization of social support networks is a reliable measure that can be immediately taken . Training more professionals who can properly deal with the parents' mental health needs is an urgent matter that must be tackled . Overall, the present study is the first nationwide survey that examined the professional caregivers' perspective on the mental health of parents of children with developmental disabilities, and it underscores the importance of understanding and supporting the parents' mental health needs, which leads to more appropriate support for children with developmental disabilities.
|
In may 2001, 24 cases of s. typhimurium dt160 salmonellosis were reported in the auckland region compared with an average of four sporadic cases each month with this serotype in the previous 7 months . Raw and undercooked egg consumption was commonly reported by the first 10 case - patients interviewed . A case - control study and environmental investigation were undertaken to identify the vehicle of infection and source of the outbreak . Recognizing the potential for a widely dispersed foodborne outbreak, we expanded the investigation throughout new zealand . We defined a case as diarrhea (3 loose stools in a 24-hour period) or vomiting after april 28, 2001, with a stool specimen positive for s. typhimurium dt160 . Patients were excluded if they had a history of contact with another person with culture - confirmed s. typhimurium dt160 infection, or if they had a history of recent overseas travel . Each case was matched with two controls found from randomly drawn telephone numbers, matching for neighborhood and age (<1, 14, 514,> 14 years). The questionnaire covered symptoms (patients only) and contact with other symptomatic persons, bird or animal contact, and food consumption in the 3-day period before onset of illness (cases and controls). Parents or guardians were interviewed on behalf of children ages <12 years . Stepwise conditional logistic regression analyses were performed, also using sas, to identify the combination of variables that best explained the differences between case - participants and controls . Samples from the drinking water supply of case - patients with a history of recent consumption of nonreticulated water were collected and tested for coliforms and s. enterica by using standard methods (6). Brands of eggs eaten raw within the incubation period were sampled at random from retail displays at the case - patients purchase site . Eggshell surfaces and contents were tested with standard methods (7). Broken or cracked eggs were excluded from analysis . Salmonella isolates were serotyped by using the kauffman - white scheme (8) and s. typhimurium isolates were phage typed by using the laboratory of enteric pathogens method (9). From may to august 2001, a total of 170 case - patients meeting the case definition were identified . Of these, 119 (70%) agreed to participate and were enrolled in the study, along with 235 matched controls . The median age of case - patients was 8 years (range 4 months to 90 years), and 57% were female . The most frequently reported symptoms were diarrhea (97%), abdominal pain (77%), excessive tiredness (67%), and fever (66%). The median duration of illness was 7 days (range 144 days); 17 (15%) patients were hospitalized, and none died . Case - patients and controls did not differ significantly according to age, sex, immunosuppressive therapy, treatment to reduce gastric acidity, or use of antibiotics . All s. typhimurium dt160 isolates were sensitive to ampicillin, cephalothin, chloramphenicol, ciprofloxacin, co - trimoxazole, gentamicin, streptomycin, sulfonamides, tetracycline, and trimethoprim . Four represented different levels of contact with other persons with gastrointestinal illness (i.e., within 28 days of illness onset; within 3 days of onset; within the household; or outside the household). Direct handling of dead wild birds, consumption of fast food, and consumption of food at a large gathering, such as at a party or large barbecue, were also significantly associated with illness . After stepwise regression, contact with a person with gastrointestinal illness in the 28 days before onset of illness in the case - patient (adjusted odds ratio [or] 2.8; 95% confidence interval [ci] 1.4 to 5.4), exposure to dead wild birds (adjusted or 10.5; 95% ci 2.3 to 47.5), and consumption of fast food (adjusted or 1.7; 95% ci 1.0 to 2.9) had independent significant associations with illness . Dt, definitive type; d&v, diarrhea and vomiting; or, odds ratio; ci, confidence interval . Twelve case - patients throughout new zealand indicated that they had drunk water from nonreticulated and untreated water sources . Seven patients used roof - collected rainwater, and one used rainwater plus water from a dam . Four of the five patients who had eaten raw eggs could identify the retail brand and outlet of purchase . These four patients had purchased six different brands of eggs from seven different retail outlets . Samples for two brands were positive for s. thompson, both from shell surface washings . Epidemiologic investigation of an outbreak of s. typhimurium dt160 infection in new from may to august 2001 found that contact with dead wild birds, contact with other persons with gastrointestinal illness, and consumption of fast food were all significantly associated with illness . In addition, s. typhimurium dt160 was found in roof - collected rainwater drunk by five patients . S. typhimurium dt160 had been previously identified as the cause of large numbers of sparrow deaths in new zealand in 2000, and analysis by pulsed - field gel electrophoresis (using the method described by barrett et al . And restriction enzyme xbai) demonstrated that bird and human isolates in 2000 were indistinguishable (4). In our study, information was not collected on exposure to environments contaminated by wild bird feces, such as parks and play areas, a fact that may have underestimated the avian contribution to human illness . S. typhimurium dt160 has previously been recognized as a bird pathogen in canada (11) and in england (12). Before its emergence in new zealand, the human s. typhimurium dt160 infection had only been reported in the context of a 1979 institutional outbreak in the united kingdom, linked to food contamination by sparrow droppings (13). Consumption of undisinfected water has previously been identified as a risk factor for salmonellosis linked to bird transmission (14). This risk factor was not confirmed by our case - control study, despite the finding of s. typhimurium dt160 in roof - collected rainwater . This discrepancy is probably because case - patients and controls were matched by neighborhood, and types of water sources are usually consistent within neighborhoods . The association of illness with contact with another person with gastrointestinal illness is likely underestimated because secondary salmonellosis cases were excluded . Consumption of fast food was associated with illness; however, no single type of food outlet or food was identified . Case - patients were equally likely to have eaten food from chain fast - food restaurants as from family - owned fast - food outlets . Consumption of fast food may have occurred in environments contaminated by bird feces, or the foods themselves may have been contaminated, either during production or by infected foodhandlers (15). Asymptomatic salmonella carriers would not have been excluded from selection as controls, potentially reducing the magnitude of observed associations . Recall may have been influenced by delays between exposure and interview, although participants were asked to refer to a memory aid (personal diary or calendar). The investigation successfully excluded a single common source exposure for this outbreak and instead suggested that multiple exposures contribute to s. typhimurium dt160 infections in new zealand . Strategies for addressing these exposures include routine treatment of roof - collected rainwater, hygienic disposal of dead birds, and promotion of hand - hygiene protocols and sick foodhandler policies in fast - food outlets . The source of this incursion of s. typhimurium dt160 into new zealand remains unknown: bird isolates have been exclusively from nonmigratory birds, s. typhimurium dt160 has not been identified in neighboring countries in the pacific basin, and early case - patients did not have a history of overseas travel.
|
Non - crystallographic symmetry (ncs) is common in macromolecular crystals, occurring in about 1/3 or more of structures in the protein data bank [2, 3, 24]. Though non - crystallographic symmetry increases the complexity of structure determination, in most cases it yields a distinct advantage in this process because it brings with it information on relationships between density in different parts of the crystal and between coordinates in different parts of the structure [4, 1214]. These relationships greatly improve density modification and refinement, two key steps in structure determination . One is simple examination of a model that has more than one copy of a chain . It can be used after molecular replacement has been carried out or after a model has been built . Another approach is to find symmetry relationships among subsets of atoms in a heavy - atom or anomalously scattering atom substructure [11, 17]. These symmetry relationships often reflect non - crystallographic symmetry, and the presence of the ncs can be checked by comparison of the density in the resulting electron density map at ncs - related positions and orientations . This approach can be used near the beginning of a sad, mad, or other structure determination where a substructure is obtained prior to full structure determination . This approach may be difficult to apply if there are only one or two atoms per ncs copy in the substructure and the ncs does not have point - group symmetry . This is because the relative orientations of the ncs - related parts of the substructure are not known in this case . A third approach that can be applied in cases where proper ncs (e.g., a two - fold axis) is present is to search for locations in a map where nearby points related by proper symmetry have similar density . A fourth and very general approach to finding non - crystallographic symmetry is to find patterns of density that are present in more than one part of an electron density map . Used a step - wise procedure of first finding possible c locations with pattern - matching techniques, classifying the locations with rotation - invariant classifiers, and then finding pairs of these locations that have similar patterns of density surrounding them . This method can be fast and effective, but has the potential limitations that the map has to be of high enough quality to locate c positions and that for maximal speed the patterns of density need to be initially represented in a rotation - invariant fashion . Here we present an approach to finding non - crystallographic symmetry by directly searching for patterns of density that are present in more than one place in a map . This approach uses superposition of a cut - out region of the map with the remainder of the map, and therefore can make use of all the local features in a map, not just rotation - invariant ones . In this approach, an fft - based convolution search [5, 16] is used to find orientations and translations that relate parts of a map to other parts of a map . We find that this is a rapid and accurate way to identify ncs, even in a case where the map is poor and the correlation of ncs - related density is low . The approach used here to identify non - crystallographic symmetry from an electron density map has three basic parts . First, a location in the map is found that is likely to be inside the molecule . This is important as it is the local symmetry of the molecule or molecules in the crystal that are of interest, so considering a region inside the molecule is essential for success . The method used to identify such a location in the map is similar to a method commonly used to distinguish macromolecule from solvent in a map . For each grid point in the electron density map, the local rms variation in electron density is calculated . This is done by simply calculating the standard deviation of the density in the map inside a sphere with radius r (typically 10), centered at the grid point in question . Then the grid point in the map with the highest local standard deviation of density is considered the best candidate for a position inside the macromolecule . Additional points likely to be inside the macromolecule can optionally be found by choosing additional grid points with high local variation in density that are well separated (typically at least 15) from previously chosen locations . Next, a search for ncs relating the density near the candidate point inside the macromolecule with density elsewhere in the asymmetric unit of the crystal is carried out . To make the calculation rapid, the resolution of the map used for this calculation may be chosen to be lower than the resolution of the original map (typically a resolution of 4 is used). A sphere of density (typically with a radius of 10) is cut out of the map, centered at this position within the molecule . This sphere of density is the object that is to be compared with density everywhere in the map . Possible rotations of this sphere of density are sampled (typically each rotation differing by about 20 degrees from all others). For each rotation, the density is transformed to the new orientation, and an fft - based convolution search [5, 16] is used to identify non - crystallographic translations that yield a high correlation of density . These rotation / translation pairs that yield high correlation (typically all those at or above 75% of the highest value found) represent a possible set of ncs operators relating the various copies of the molecule in the asymmetric unit of the unit cell . Additionally, the candidate point used to identify ncs and the ncs - related points in the map may be considered approximate centers of regions where ncs applies . They are used below as the starting point for identification of the region where ncs operators apply . Once a set of candidate ncs operators is obtained, the correlation of ncs - related density is examined in the original map, and the ncs operators are refined . This is done using the same approach as has been applied to ncs operators obtained from heavy - atom positions . First the shape and position of the local region that is repeated by ncs (the asymmetric unit of ncs) is found . Then the ncs operators are refined to maximize the correlation of density among these ncs - related regions . The region where ncs applies is assumed to contain the point identified in the first step of our procedure that is within the macromolecule . A region with arbitrary shape surrounding this point is then chosen by sequential addition of new boundary points such that the local correlation of ncs - related density at each point in the region is above a threshold (typically 1/4 of the maximum correlation in the region). The local correlation of density is calculated using map grid points within a sphere (normally with the radius used for identification of the solvent boundary, terwilliger 2000b), centered at the point in question . If the final correlation of ncs - related density (averaged over all pairs of ncs - related points) is above a threshold (typically 0.4) then the ncs operators are considered to represent actual ncs in the crystal and are used in later stages of structure determination . In cases where the starting map is very poor, this threshold may be decreased, increasing the sensitivity of the procedure but also increasing the probability of finding ncs where none is present . The approach used here to identify non - crystallographic symmetry from an electron density map has three basic parts . First, a location in the map is found that is likely to be inside the molecule . This is important as it is the local symmetry of the molecule or molecules in the crystal that are of interest, so considering a region inside the molecule is essential for success . The method used to identify such a location in the map is similar to a method commonly used to distinguish macromolecule from solvent in a map . For each grid point in the electron density map, the local rms variation in electron density is calculated . This is done by simply calculating the standard deviation of the density in the map inside a sphere with radius r (typically 10), centered at the grid point in question . Then the grid point in the map with the highest local standard deviation of density is considered the best candidate for a position inside the macromolecule . Additional points likely to be inside the macromolecule can optionally be found by choosing additional grid points with high local variation in density that are well separated (typically at least 15) from previously chosen locations . Next, a search for ncs relating the density near the candidate point inside the macromolecule with density elsewhere in the asymmetric unit of the crystal is carried out . To make the calculation rapid, the resolution of the map used for this calculation may be chosen to be lower than the resolution of the original map (typically a resolution of 4 is used). A sphere of density (typically with a radius of 10) is cut out of the map, centered at this position within the molecule . This sphere of density is the object that is to be compared with density everywhere in the map . Possible rotations of this sphere of density are sampled (typically each rotation differing by about 20 degrees from all others). For each rotation, the density is transformed to the new orientation, and an fft - based convolution search [5, 16] is used to identify non - crystallographic translations that yield a high correlation of density . These rotation / translation pairs that yield high correlation (typically all those at or above 75% of the highest value found) represent a possible set of ncs operators relating the various copies of the molecule in the asymmetric unit of the unit cell . Additionally, the candidate point used to identify ncs and the ncs - related points in the map may be considered approximate centers of regions where ncs applies . They are used below as the starting point for identification of the region where ncs operators apply . Once a set of candidate ncs operators is obtained, the correlation of ncs - related density is examined in the original map, and the ncs operators are refined . This is done using the same approach as has been applied to ncs operators obtained from heavy - atom positions . First the shape and position of the local region that is repeated by ncs (the asymmetric unit of ncs) is found . Then the ncs operators are refined to maximize the correlation of density among these ncs - related regions . The region where ncs applies is assumed to contain the point identified in the first step of our procedure that is within the macromolecule . A region with arbitrary shape surrounding this point is then chosen by sequential addition of new boundary points such that the local correlation of ncs - related density at each point in the region is above a threshold (typically 1/4 of the maximum correlation in the region). The local correlation of density is calculated using map grid points within a sphere (normally with the radius used for identification of the solvent boundary, terwilliger 2000b), centered at the point in question . If the final correlation of ncs - related density (averaged over all pairs of ncs - related points) is above a threshold (typically 0.4) then the ncs operators are considered to represent actual ncs in the crystal and are used in later stages of structure determination . In cases where the starting map is very poor, this threshold may be decreased, increasing the sensitivity of the procedure but also increasing the probability of finding ncs where none is present . We applied our procedure to finding non - crystallographic symmetry to a structure where an electron density map of moderate quality could be obtained using mad phasing . This structure (gere, pdb entry 1fse,) consists of 6 copies of a protein chain with 74 residues . Figure 1a shows a schematic of the protein structure . Figure 1b, c illustrates the mad - phased electron density map for this structure for corresponding views of chains c and f, respectively, without any density modification or including any information on ncs . It may be seen that this map is of moderate quality in the region of chain c and rather poorer quality in the region of chain f.fig . 1 a ribbon view of 6 chains of gere in crystal structure pdb entry 1fse . B view of experimental mad - phased, non density - modified electron density at a resolution of 2.7 near chain c of gere . The high density - variation location identified by phenix.guess_molecular_centers is marked, and circle with radius approximately 10 centered at this point illustrates the region that is to be cut out and compared to other density in the map . Contours for b d are at 1.5. c as in b, except view is near chain f of gere, shown in grey . D view as in b and c, except that the averaged density based on all 6 ncs - related copies is shown . A created with pymol; b d created with coot a ribbon view of 6 chains of gere in crystal structure pdb entry 1fse . B view of experimental mad - phased, non density - modified electron density at a resolution of 2.7 near chain c of gere . The high density - variation location identified by phenix.guess_molecular_centers is marked, and circle with radius approximately 10 centered at this point illustrates the region that is to be cut out and compared to other density in the map . Contours for b d are at 1.5. c as in b, except view is near chain f of gere, shown in grey . D view as in b and c, except that the averaged density based on all 6 ncs - related copies is shown . A created with pymol; b d created with coot the phenix tool phenix.find_ncs_from-_density was used to carry out the ncs identification . The density map was examined to find locations where the local variation of density was highest using the method phenix.guess_molecular_centers . It can be seen that this point is well within the region of the map with protein - like characteristics (relatively connected and high density). Next, after truncating the resolution of the map to 4, test density corresponding to a sphere of radius 10 of density centered at the point marked in fig . 1b was cut out (the region inside the circle in fig . 1b, except for the change in resolution of the map). The density within all 10 spherical regions in the 4 map was then compared to this test density using an fft - based method, sampling all possible rotations of the test density on a grid . This density correlation procedure correctly identified all 5 regions that had high similarity to the test density . Figure 1c shows one of these related regions of density, the one corresponding to chain f of gere, in the same view as fig . It may be seen that within the 10 sphere the density in fig . 1b, c are similar, though the density near chain f (fig . The shape of the density becomes less similar, as expected because the protein chains surrounding the chain located outside the sphere in fig . 1b have a different arrangement than those outside the sphere in fig . 1c . 1c and the other 4 locations within the asymmetric unit of the density in this crystal were then refined to identify the region over which correlation of density existed and to optimize the correlation of density among all copies of this repeated density . This process yields as well the transformation matrices describing the relationships among all the ncs - related copies in the asymmetric unit of the crystal . The final average pair - wise correlation of density among the 6 copies was 0.53 . 1b) the average correlation to other ncs - related regions was 0.56, while for chain f (fig . Figure 1d shows the average density for all the regions of density that were found to be similar from the same viewpoint as shown in fig . It can be seen that this density has features even more like those expected of a density map of a protein than the individual regions of density (the tubes of density are better - connected). The approach described here for finding ncs in a map can be used in a number of situations . In the phenix crystallographic software, the method phenix.find_ncs_from_density is used during structure solution with phenix.autosol if ncs is expected but cannot be found from heavy - atom sites, and it is used during iterative model - building with phenix.autobuild any time it is expected and has not been identified by any other means . The ncs relationships identified in this way can be used as a powerful addition to the information available for density modification [4, 1214]. These relationships can also be used in model - building, where an incompletely built chain can be built using a more complete ncs - related copy of the same chain as a template [9, 15, 20]. Further they could potentially be used to place copies of entire chains in low - resolution maps . The maps to be analyzed for ncs can be crystallographic maps, maps from electron microscopy, or maps from other sources . The approach described here could also be used to find density that is similar in two different electron density maps . This last application could be useful in automatically finding relationships between molecules in different crystals when carrying out cross - crystal averaging.
|
Putting a halt to the rising trend in overweight prevalence has high priority in public health policy all over the developed world . Prevention, preferably starting at an early age, is considered as the key strategy to achieve this goal, and considerable effort is put into the design of preventive measures . Whereas we know in general terms that overweight is the result of an unbalance between energy intake and energy expenditure, development of effective preventive measures requires a much more specific understanding . Specific dietary habits and (in)activities associated with overweight risk in specific age groups need to be identified and their quantitative contribution to the overweight prevalence in the population needs to be assessed . In addition, we need to know whether the importance of specific behaviors for the development of overweight differs between sub groups in the population . It is well established that children from families with a low socio - economic status and children with overweight parents are at increased risk to develop overweight [39]. It is therefore particularly important to assess the role of behavioral risk factors specifically in these children, since they are the priority target groups for interventions to prevent and reduce overweight . The aim of this study was to identify specific behavioral risk factors for overweight in young children and to assess their quantitative contribution to the prevalence of overweight in the general population and in high risk sub groups . In a large population - based birth cohort, we prospectively investigated associations between dietary habits, screen time and physical activity when the children were 5 and 7 years old and overweight at the age of 8 years . We also assessed the role of these behavioral factors separately in high risk sub groups: children of mothers with overweight and children of mothers with low education . We estimated the reduction of overweight prevalence that could be achieved if the prevalence of risk factors would be reduced . The study population consisted of children who participated in the dutch prevention and incidence of asthma and mite allergy (piama) birth cohort study . The baseline study population consisted of 4146 pregnant women, recruited from the general population in 1996 - 1997 . Postal questionnaires, including questions on the child's lifestyle and health, were sent to the parents during pregnancy, at the child's ages of 3 and 12 months, and yearly thereafter up to the age of 8 years . At the age of 8 years, the children were invited for a medical examination which included measurement of weight and height . The study protocol was approved by the medical ethics committees of the participating institutes, and all parents gave written informed consent . Of the baseline population of 4146 pregnant women, 183 (5%) were lost to follow - up before any data on the child had been collected . Parental completed questionnaires from age 3 months to 8 years were available for 3934, 3817, 3694, 3563, 3518, 3473, 3373, and 3269 children, respectively . When the medical examination of 8-year - old children was planned, 3668 children (93% of 3963) were still in the study, 3522 children were invited and 2214 participated (63% of those invited) and had their weight and height measured . 146 of the 3668 children were not invited for the medical examination, although they were still participating in the study . In the majority of cases the reason for this was that their families had moved and were now living too far away from the study centers where the medical examination was conducted . Complete data on overweight and risk factors were available for 1871 children (47% of the 3963 children in the study at birth). During the medical examination of the 8-year - old children, weight was measured to 0.1 kg and height to 0.1 cm by trained research staff using calibrated measuring equipment . From the weight and height measurements bmi (body mass index: weight (kg)/height (m)) was calculated . Overweight and obesity were defined according to age and gender - specific international standards that use cutoff points equivalent to the 25 kg / m and 30 kg / m cut - offs that are commonly used for adults . The term overweight is used for the total group of children who were overweight, including those who were obese . For physical activity, 3 indicators were selected: time spent walking or cycling to school (3 categories), membership of a sports club (yes / no), and time spent playing outside (3 categories). Screen time (4 categories) included time spent watching television, video's, or at the computer . For dietary intake, 3 indicators were used: fast food consumption, snack consumption, and soft drink consumption . Data on these exposures were obtained from the questionnaires administered at the ages of 5 and 7 years . These questionnaires contained a food frequency questionnaire with 40 different items and 5 answering categories per item (ranging from never in the last month to on 6 - 7 days per week), which was used to construct the dietary exposure variables . For fast food consumption a score was constructed based on the consumption frequencies of chips / french fries and of foods like hamburgers and hot dogs . Snack consumption was based on the reported consumption frequencies of 7 different foods / food groups including pie / cake, muffins, candy bars, sweets, chocolate, biscuits, and crisps . Soft drink consumption was based on the reported frequencies of consumption of 4 types of soft drinks . Each of these variables was based on a number of different items, which differed with respect to their energy content . To be able to add up the different items, total weekly energy intake from each item was calculated based on the reported frequencies, assuming average portion sizes and average energy content per portion . Data on maternal education and maternal weight and height were obtained from the questionnaire completed when the child was 1 year old . Maternal bmi was calculated from reported weight and height and overweight and was defined as a bmi 25 kg / m . The associations between the exposure variables and overweight at the age of 8 years were analysed by logistic regression, adjusted for gender and birth weight . Exposure variables were constructed using the data collected at both the age of 5 and at the age of 7 years in order to obtain a more stable estimate of exposure during the years preceding the measurement of weight and height . Walking / cycling to school, playing outside and screen time were recorded in categories, numbered 1, 2, and 3 for walking / cycling to school, 1, 2, and 3 for playing outside, and 1, 2, 3, and 4 for screen time (see table 1). The data collected at the ages of 5 and 7 years, were combined by taking the mean of the numbers of the categories reported at the ages of 5 and 7 years respectively . This resulted in ordinal variables with 5 categories for walking / cycling to school (ranging from never at ages 5 and 7 to> 1/2 an hour per day at both ages), 5 categories for playing outside (ranging from <1 x per week at ages 5 and 7 to> 3 x per week at both ages) and 7 categories for screen time (ranging from <1/2 an hour per day at ages 5 and 7 to> 2 hours per day at both ages). After having checked for nonlinearity fast food, snack and soft drink consumption at age 57 (the mean of the consumption scores at age 5 and at age 7), were included in the regression analyses as linear variables, but are shown in categories (tertiles) in table 1 . Overweight (including obesity) was used as the outcome measure in the regression analyses . The number of obese children was too small for analyses with fully adjusted regression models, and obesity was therefore not used as outcome measure in these analyses . In previous studies in the piama cohort, breast feeding was investigated in relation to overweight risk and was found to be associated with reduced overweight risk [12, 13]. Although breastfeeding is not the subject of this study, results on breast feeding are shown in the tables for completeness . In additional analyses, the associations of physical activity and diet with overweight were also assessed separately for the exposures at age 5 and at age 7 . Thirteen percent of all the data potentially in the study (3963 participants 20 variables = 79260) were missing and 2092 children (53%) had a missing value on at least 1 of the variables . If data are not missing completely at random (mcar), complete case analysis may lead to biased results [14, 15]. In our dataset several variables (including maternal education and breast feeding) were associated with the probability of a subject having one or more missing values . Missing data were multiple times imputed, using the multivariate imputation by chained equations (mice) procedure [16, 17], that runs under the statistical program r version 2.5.0 . For the multiple imputation we used all the data that were used in the analyses, as well as data on the children's weight and height that were measured and reported by the parents in the yearly questionnaires . . Maternal education and maternal overweight could be confounders of the associations studied but could also be factors in causal pathways . In addition, the analyses were repeated, stratified for maternal education, maternal overweight and gender . Differences between the associations observed in the different sub groups were tested by inclusion of interaction terms in the regression models . For the behavioral risk factors that were found to be statistically significantly associated with overweight, adjusted population attributable risk percentages (par%) were calculated, using the mantel - haenszel approach, as described by benichou . Table 1 shows characteristics of the study population and the prevalence of overweight and obesity in different sub groups . Children with incomplete data on either risk factors or on measured weight and height at 8 years were compared to the children with complete data, with respect to a number of characteristics assessed during the first year of the study (data not shown). Children with incomplete data had, compared to children with complete data, a relatively high prevalence of low maternal education (27.5% versus 19.4%) and of no breast feeding (19.7% versus 15.9%). As expected, in the imputed data the prevalence of these characteristics was somewhat higher (23.6% and 17.9%, see table 1) than in the children with complete data . The prevalence of maternal overweight was similar in children with incomplete data and in children with complete data (24.1% and 26.1%, resp . ). The prevalence of overweight in the children was almost the same in the imputed data and in the complete cases (13.8% and 14.4%, resp .) And the prevalence of obesity was the same in both datasets (2.7%). Table 2 shows the associations between diet, physical activity, screen time and overweight . In the analyses adjusted for gender and birth weight only (model 1), fast food consumption and screen time, sports club membership, active transport to school, playing outside, snack consumption, and soft drink consumption were not associated with overweight . When all risk factors (including breast feeding) were included in the same regression model (model 2), the associations with overweight became somewhat weaker for most factors, indicating some association between the individual risk factors . The association of fast food consumption with overweight lost statistical significance in this analysis whereas the association with screen time remained statistically significant . Surprisingly, an inverse association between snack consumption and overweight was observed . In additional analyses, the analyses shown in table 2 were repeated with the behavioral risk factors measured at age 5 and (separately) with those factors measured at age 7 instead of the variables combining the exposures measured at age 5 and age 7 . For the physical activity indicators and for screen time, results of these analyses were similar to those shown in table 2, showing associations between screen time and overweight (aor (95% ci) at age 5: 1.35 (1.191.53) and aor (95% ci) at age 7: 1.22 (1.081.39)) but not between the physical activity indicators and overweight . Snack consumption at age 5 was not associated with overweight at the age of 8 years (aor (95% ci): 0.87 (0.661.14)), but there was a significant inverse association between snack consumption at age 7 and overweight at the age of 8 years (aor (95% ci) 0.70 (0.540.91)). Low maternal education and especially maternal overweight were strong predictors of childhood overweight (see table 2, model 1). The association between low maternal education and overweight weakened substantially in the model including the behavioral risk factors (an almost 25% change in the regression coefficient from 0.50 to 0.38), indicating that these specific factors explain at least part of the excess overweight prevalence in children of mothers with low education (see table 2, model 3). The association between maternal overweight and overweight in the child weakened only marginally in the model including behavioral risk factors (5% change in regression coefficient from 1.07 to 1.02), indicating that the association between maternal overweight and overweight of the child is only to a limited extent mediated by the behavioral factors studied (see table 2, model 4). The analyses were repeated after stratification for low maternal education, maternal overweight and gender, respectively . In the sub groups with low maternal education and with maternal overweight children of mothers with a low level education had a higher prevalence of high fast food and snack intakes, of> 2 hours screen time per day and of not being member of a sport club than children of more highly educated mothers (see table 3). Children of overweight mothers had a higher prevalence of high fast food intake and of> 2 hours screen time per day (at the age of 5, but not at 7 years) than children of normal weight mothers (see table 3). Girls had a slightly higher prevalence of overweight and slightly less screen time than boys (data not shown). The results suggest that the associations between screen time and overweight were weaker in children of mothers with overweight or low education than in children of mothers with a normal weight or higher level of education (table 4). Interactions between the exposure variables and low maternal education and maternal overweight were not statistically significant, however . For boys and girls these associations were very similar (data not shown). Of the behavioral risk factors studied, only screen time was statistically significantly associated with overweight . Based on the prevalence and adjusted odds ratios for screen time> 1 hr per day (see table 5), we estimated how much screen time contributed to the total prevalence of overweight . Table 5 shows the adjusted population attributable risk percentage (par%) for a screen time of more than 1 hour per day at age 5 and/or age 7 as compared to less than 1 hour at both ages . Of the total overweight prevalence in the low risk sub groups an estimated 17% could be attributed to screen time of> 1 hour per day as compared to 10% in the high risk sub groups . This means that, if all children would reduce their screen time to less than 1 hour per day, the following reductions in overweight prevalence could be achieved: from 18.3% to 16.4% in children of mothers with low education; from 12.4% to 10.3% in children of mothers with higher education from 25.0% to 22.4% in children of overweight mothers and from 10.0% to 8.3% in children of normal weight mothers . All analyses were conducted in a data set containing only complete cases as well as in the imputed data . The odds ratios (95% ci) for screen time, for example, were 1.47 (1.241.75) and 1.41 (1.171.70) in model 1 and model 2, respectively, in the complete case analysis, compared to 1.45 (1.261.66) and 1.39 (1.211.61) in the analysis in the imputed data set . Of 8 different potential behavioral risk factors, only screen time showed consistent and significant associations with overweight . In high risk sub groups of the population, screen time was higher than in low risk sub groups, but the associations between screen time and overweight were weaker (although not significantly weaker) in the high risk sub groups . Important strengths of the study were the prospective design, the large study population, the repeated measurements (at ages 5 and 7) of different behavioral risk factors and the availability of measured (rather than parental reported) data on weight and height.however, a number of limitations have to be considered . Thirteen percent of our data were missing and 53% of the study population had a missing value on 1 or more of the variables used in the analyses . We used multiple imputation to deal with missing data in our study in order to avoid bias due to selective missing of data and to make more efficient use of the available data . Results of the complete case analysis and the analyses in the imputed data sets were similar . Information on the behavioral risk factors was obtained from parental completed questionnaires and we therefore need to address the possibility of misreporting . The questions asked ranged from simple matter - of - fact items (like sports club membership yes / no) to items that are more difficult to observe and recall accurately (like the consumption frequency of a range of different food items). We expect that recalling or reporting problems will not have substantially influenced the data on sports club membership or transport to school and that any misreporting on these items will not have been systematically associated with overweight development . The data on foods and drinks consumption may well have been influenced by reporting bias . Many of the foods included in the dietary variables have a bad reputation in relation to overweight, and selective underreporting by parents of children who were developing overweight may have occurred . Another problem with respect to the diet variables is that data were available on the consumption frequencies of food items, but not on portion sizes . Estimates of the intakes of fast food, snacks and soft drinks and the ranking of children according to their intakes were therefore based on reported consumption frequencies only, and the possibility of misclassification of food intake cannot be excluded . Membership of a sports club and active transportation to school were not associated with overweight in this population . The reason that we did not observe the hypothesized associations might be that in young children the duration and intensity of these activities are usually too low to have a sizeable impact on total activity . If this would be confirmed in further studies, it may have potentially important implications for the allocation of budgets for the prevention of overweight in this age group . In older children and adolescents active transport to school and sports club membership we found some evidence for an inverse relation between playing outside and overweight, but the associations were weak and not statistically significant . Children who played outside 1 x per week seemed to have a higher overweight risk, but such children were a small minority in the study population . Screen time was consistently and significantly associated with overweight and the association was largely independent of other lifestyle factors . A dose - response relationship was observed when it was included as a categorical variable in the regression analysis . Our results thus suggest that, among the indicators of active and sedentary behavior that we studied, screen time is the most important risk factor for overweight in the age group studied . This result is in agreement with the conclusion of a recent study in which the evidence was summarized for six different strategies to prevent or treat pediatric overweight . Our findings on screen time and overweight risk are also in line with the results of a comprehensive meta - analysis on the subject, which observed a statistically significant relationship between tv viewing and body fatness among children and youth . We estimated that a reduction in overweight prevalence of up to 2 percentage points could be achieved if all children would reduce their screen time to less than 1 hour per day . Maximum achievable reduction of prevalence (marp) of 1.5 percentage points that was estimated for watching television> 1 hr / day in a study on 5 - 6 year old german children . Consumption of soft drinks and fast food at ages 57 was not associated with overweight whereas an unexpected inverse association between snack consumption and overweight was observed . Snack consumption at the age of 5 years was not associated with overweight at age 8, but snack consumption at age 7 was inversely associated with overweight at age 8 . As indicated previously, these results may have been influenced by selective underreporting of snack consumption by parents of children who were becoming overweight . Besides selective underreporting, reverse causation may also have played a role, in the sense that parents of children who were becoming overweight really have reduced their children's consumption of specific foods and drinks . The results on fast food, snack and soft drink intakes seem to indicate that in particular the items included in our snack, variable are the kind of foods that come to parents' minds when they think of trying to limit excessive weight gain in their child . The selective underreporting and reverse causation that are likely to be present in our dietary data, make it impossible to judge from our results how diet influences the development of overweight . We hypothesize that these mechanisms might play a role also in other epidemiological studies on diet and overweight . Whereas, on theoretical grounds, it is hard to imagine that food intake is unrelated to weight status, observational studies have generally not produced consistent evidence for the expected associations [20, 2327]. Our results do not provide an answer to the question whether consumption of soft drinks, fast food, and snacks causes overweight but seem to indicate that parents may see reduction of snack consumption as a method to counteract the development of overweight . Further studies into the strategies that parents themselves use to influence their children's weight gain might provide insights that could be useful for the design of preventive strategies . Low maternal education and maternal overweight were found to be strongly associated with overweight in the child . The association between low maternal education and overweight weakened substantially when the behavioral risk factors were included in the model, indicating that these factors explain part of the association . The behavioral risk factors had little influence on the association between maternal overweight and overweight in the child, indicating that other factors, possibly genetic factors, play a more important role in this association . We repeated the regression analyses in sub groups stratified by maternal weight status and maternal education . Whereas in the high risk sub groups, screen time was higher than in low risk sub groups, the associations between screen time and overweight were weaker (although not statistically significantly) in these groups, and the population attributable risk percentage was lower than in the low risk sub groups . As the children of mothers with overweight and/or low education are the children at highest risk to develop overweight, this observation is potentially important for the development of preventive strategies and needs to be clarified in future observational as well as intervention studies . Reduction of screen time should be part of interventions to prevent or reduce overweight in young children and could result in a reduction of overweight prevalence in the order of 2 percentage points in both high and low risk sub groups . Our results also suggest however that interventions aimed to promote sports club membership, active transport to school, and playing outside may have little impact on the prevalence of overweight in this age group . The possibility that, due to reverse causation, associations between food intake and overweight cannot be assessed in observational studies, needs further study.
|
The protection of water supplies and water distribution infrastructure such as reservoirs is of great concern for those defending against bioterrorism . The us military is concerned because there exist multiple biological warfare agents (bwas) that could be intentionally introduced into the water supply which could have serious implications for military operations as well as civilians located within a theater of operations . To protect potable water supplies, the department of defense (dod) seeks to develop a rapid field test that would determine if field supplies of water are safe to drink by the warfighter during a military operation . The us armed services have fielded biological defense systems that are designed to protect against a large scale attack via bwas dispersed through the air . These defensive systems utilize high - efficiency aerosol collectors that impinge the sampled air into a liquid buffer which is tested for bwas using antibody - based handheld assays (hhas). Civilian first responders use similar versions of these antibody - based hhas for testing suspicious powder samples suspected to contain bwas . Depending on which manufacturer of hha is being tested, the technology can be low cost, requires no electrical power, and requires minimal to no sample preparation to test a sample . It was an hha panel manufactured by the dod that first identified bacillus anthracis in the powder that spilled across a desk in senator daschle's office in the hart senate office building in 2001 . Three years later, a dod hha was again used to identify ricin toxin in the mail room of the dirksen senate office building . These instances demonstrate that, when hha technologies are used appropriately by an experienced operator trained to understand what the results mean, they can be a useful tool . Additionally, hhas have proven fast and effective in the laboratory for the detection of francisella tularensis and biotoxins such as staphylococcal enterotoxin b (seb) and microcystins . The dod has initiated an effort called the joint chemical biological and radiological agent water monitor (jcbrawm) program to develop a system which will allow rapid field testing of drinking water supplies used by military personnel . The effectiveness of hhas in detecting biological agents in the air and in powders has resulted in a desire to test these assays to gauge their effectiveness to protect drinking water supplies used by us warfighters . In the present study, hhas from multiple manufacturers were evaluated for their effectiveness at detecting two specific targets, seb and ricin, in multiple water matrices . The hhas were not modified in any way to optimize for the detection of toxins within water supplies despite the fact that they were initially developed to test for concentrated agent collected from high - efficiency aerosol collectors and impinged into a phosphate buffered saline (pbs) solution rather than to test unbuffered water supplies . The ability of the hhas to detect seb and ricin in four different water matrices, representative of waters used by different branches of the armed forces, was evaluated . The four different water matrices were formulated tap water, formulated tap water with 1 mg / l free available chlorine (fac), water treated by reverse osmosis (ro) with 1 mg / l fac, and ro water with 2 mg / l total residual bromine . Suggested health effect levels as used by the us military for ricin and seb are 455 ng / ml and 4.55 ng / ml, respectively . These minimal health effect levels were derived using the tri service standards for field water and based on an average consumption of 10 liters per day for seven days for a 70 kg service member . Therefore, detection of ricin and seb in water at or below the suggested health effect level is desired . Both singleplex (one - line) and multiplex (two - line and two - dot) hha models produced by two manufacturers were evaluated in the present study for the detection of ricin toxin and seb [5, 6]. Active seb (toxin technologies, sarasota, fla, usa) and active ricin whole toxin (vector laboratories, burlington, on, canada) were obtained from the dod's critical reagents program (crp) for use in the present study . Briefly, approximately 500 ml of astm type i deionized water was added to a one - liter volumetric flask to which each stock solution was added to achieve the desired final concentration and the total volume was brought to one liter with deionized water . After 1520 minutes, the ph was assessed and adjusted if needed (with minimal volume change) to 7.67.8 . Once prepared, synthetic tap water was stored at 4c with a shelf life of one week . Briefly, one gram of calcium hypochlorite was added to twenty milliliters of astm type i deionized water and shaken vigorously for one to two minutes . Briefly, approximately five microliters of the chlorine stock solution (supernatant, not solids) was added to 100 ml of the formulated tap water or ro water, which was prepared by running local tap water through a commercial ro unit . The fac was measured using a hach dr 2500 spectrophotometer per manufacturer's instructions, and the fac level was adjusted as needed to achieve the desired fac level of 1 chlorinated water was considered stable for only one day and therefore made fresh daily just prior to use . Briefly, 25 ml of bromine resin was transferred to a 500 ml, 0.20 m filter unit (corning life science, lowell, mass, usa). Total residual bromine in the collected water was measured using a hach dr 2500 spectrophotometer per manufacturer's instructions and adjusted as needed to achieve the desired final concentration of 2 mg / l . Each water type was prepared fresh daily as described above and spiked separately with each target at desired concentrations . After spiking, 100 l of sample was loaded onto the sample well of the hha . The hha was allowed to develop for 15 minutes prior to reading the result by eye . Each challenge concentration was tested a minimum of two independent times with a minimum of three handheld assays per concentration . Limits of detection (lod) were determined for each hha type in each water matrix and defined as the minimum concentration of toxin that could be detected by eye . Samples for circular dichroism (cd) were prepared by spiking ro water containing 1 mg / l fac with seb to a final concentration of 2 g / ml . Control samples received no chlorine . After 24 hours, sodium thiosulfate (0.005% w / v final concentration; fisher scientific catalog number s446) was added to all samples to quench any remaining chlorine prior to analysis by cd . Cd experiments employed a jasco model j-810 spectropolarimeter (jasco analytical instruments, easton, md, usa) equipped with a ptc-423s peltier thermoelectric temperature control system . Cd spectra were obtained for seb at 25c from 260 to 190 nm with a data pitch of 0.5 nm, a band width of 1 nm, a response time of 1 sec, and a scanning speed of 10 nm / min . The cd was carried out on 2 g / ml samples in 1 cm quartz cuvettes and required long - time signal averaging . The concentration of seb was verified for a representative stock solution by uv absorption at 277 nm using an e for seb of 14 . For each sample, the blank - subtracted cd curve for 100 averaged scans was converted to molar ellipticity using a molecular weight of 28,366 daltons and fit with the secondary structure estimation application in jasco's spectra manager (version 1.53.01) software to obtain the fraction of helix, beta sheet, turn, and random coil secondary structure . The percentages reported here were obtained using the reed reference set for the secondary structure calculations . Samples for sds - page were prepared by spiking ro water containing 1 mg / l fac with seb to a final concentration of 2 g / ml . Control samples received no chlorine . After one minute, one hour, and 24 hours, sodium thiosulfate (0.005% w / v final concentration) was added to all samples to quench any remaining chlorine prior to analysis by sds - page . Reducing gel eletrophoresis was carried out using the mini - protean 2 cell and 1020% tris - hcl pager gold precast gels from lonza (rockland, me, usa). Fifty nanograms of seb samples and 1: 20 diluted mark12 unstained standard (invitrogen) were prepared in sds sample buffer, followed by heating at 95c for 5 minutes prior to loading . Running buffer was prepared by dilution from 10x tris / glycine / sds buffer (biorad). Following electrophoresis, the gel was fixed with 50% methanol and 7% acetic acid (both v / v) for a total of 30 minutes . The rapid staining protocol with sypro ruby protein stain (invitrogen) was used for the detection of seb . The gel was washed with a solution of 10% methanol and 7% acetic acid (both v / v) for 30 minutes and imaged and documented with uv light using syngene (frederick, md, usa). All hhas were evaluated for their performance in formulated tap water, formulated tap water with chlorine, ro water with chlorine, and ro water with bromine for the detection of ricin and seb . Each water type was spiked with multiple concentrations of each toxin and loaded onto hhas for testing until the lod was determined for each hha model . It was determined that ricin could be detected down to approximately 1 ng / ml for most hha models in both formulated tap water and formulated tap with chlorine, while exhibiting only slightly higher lods in ro with chlorine for most models . However, in ro with bromine, the lod for ricin increased to 3,000 ng / ml for all models tested . For seb, lods in formulated tap water were low, ranging from 0.9 ng / ml to 12.5 ng / ml . However, in both chlorinated and brominated water, lods increased to 2,500 ng / ml for singleplex hhas and even higher to 5,000 or 10,000 ng / ml for multiplex models . In all cases detection below the suggested health effect level was desired; however, seb was not detected below the suggested health effect level in chlorinated and brominated water and ricin was not detected below that level in brominated water . Due to the increased detection limits observed in chlorinated and brominated water, cd spectroscopy, which assesses the three - dimensional fold of a protein, was performed on samples of untreated seb and seb exposed to chlorine in an effort to evaluate the basis for increased lods (figure 1). For each sample, the individual cd scans were compared prior to averaging to ascertain the structural stability of the sample . Untreated seb at 2 g / ml was determined to contain 14.3% helix, 34.50% sheet, 17.6% turn, and 33.6% random coil (rmsd <0.1%). The cd spectrum of seb treated with 1 mg / l fac was stable over the time of experimentation . The curve - fitting calculation for chlorine - treated seb resulted in 25.9% helix, 0.0% sheet, 0.0% turn, and 74.1 random coil (rmsd <0.1%). Sds - page was also performed to ascertain the overall effect of chemical reaction with chlorine on the molecular weight of seb . For the treated and untreated seb, 1.5 g of seb was loaded per well . As shown in figure 2, for untreated seb, the seb was visible on the gel as a band with a molecular weight of approximately 28 kda for all time points tested . For chlorine - treated seb, no band was visible at the same molecular weight as untreated seb for any of the time points tested . Ricin and seb are considered potential biological threat agents as both can cause illness either by inhalation or ingestion . Seb could potentially be used to attack low - volume water supplies; however, due to the fact that ricin is less toxic by oral ingestion, it may be a less likely threat to drinking water . However, detection of both agents in water is still a concern and technologies capable of detection in water must be investigated . Performance of hhas for air and surfaces is well known; however, the use of hhas for detection of agents in water is less recognized . Therefore, the application of hhas for detection in water was assessed in this study . In formulated tap water, detection of seb and ricin was achieved at or below the suggested health effect levels for each model of hha in almost every case . However, the presence of disinfectants proved problematic with regard to detecting either seb or ricin using all models of hhas . The increased lods observed when disinfectants were present are believed to be due to the degradation of the target or toxins by chlorine and bromine . Therefore, it is likely that protein toxins would also be affected by these strong oxidants . In fact, sodium hypochlorite is known to completely inactivate seb and ricin toxin [11, 12]. Therefore, when exposed to chlorine or bromine, protein toxins could become damaged or denatured causing antibodies present in an antibody - based assay, such as hhas, to no longer bind to the altered antigen as effectively . This decrease in binding efficiency could yield higher lods for the target, such as those observed in the present evaluation . To address this issue, cd spectroscopy and sds - page the cd results for untreated seb were similar to those obtained by singh et al . For seb at 0.5 - 0.6 mg / ml in 10 mm sodium phosphate . The cd results for chlorine - treated seb indicate a significant change in three - dimensional fold resulting in less well - defined structure for the chlorine - treated seb relative to the untreated seb . Based on curve - fitting calculations, the percentage of random coil more than doubled upon treatment with chlorine . The secondary structure percentages obtained from the cd curve - fitting routine may well represent an average of multiple seb - based species in solution, which would be consistent with the sds - page results . The absence of bands for the chlorine - treated seb could occur if the seb was cleaved into smaller peptides that diffuse out of the gel or if multiple higher molecular weight species are formed, with no single species being concentrated enough to be visualized on the gel . In either of these cases, chiral components would be present in the sample and would lead to a measureable cd spectrum . The cd and page results together suggest a major change in seb structure that may result in multiple seb - based antigens, the majority of which are less easily recognized and not bound as effectively as untreated seb by the antibody present on the membrane of the assay . The decreased binding capacity for the seb - based antigen(s) would account for the increased detection limits seen for seb in chlorinated water . These results support the idea that increased lods in disinfected water are caused by disruption in antigen - antibody binding due to degradation of the antigen . In addition to the detection studies reported herein, currently studies are being performed to address whether both ricin and seb remain active, or toxic, after exposure to chlorine and bromine . However, regardless of whether activity remains, the ability to detect the presence of each toxin in disinfected water supplies is important . Presence of these agents could indicate a potential compromise or attack on the water supply, thereby revealing security risks as well as potential health risks . Additionally, it was noted in the present study that chlorine did not impact detection levels of ricin as significantly as detection levels of seb under the test conditions employed . Additional exposure time may be required in order for ricin detection to be affected in the same manner as that observed for seb in chlorinated water . This could be due to a difference in protein structure or stability in chlorinated water between the two toxins . Further tests allowing for prolonged incubation of ricin in chlorinated water prior to detection could address this issue.
|
Osteosarcoma is a common primary malignant bone tumor with complicated pathogenesis and frequent distal metastasis, thus causing higher mortality rates, especially in the teenagers . Epidemiological surveys revealed that nearly 40% of osteosarcoma patients died from misdiagnosis and/or early tumor metastasis, especially toward the lung tissue [24]. Therefore, it is of critical importance to find a simple and effective biological marker for osteosarcoma, in order to make early diagnosis . Current studies have revealed the role of gene mutation in the proliferation of tumor cells . Cell apoptosis - related genes, including vascular epithelial growth factor (vegf) and microrna (mir)-96, were found to be closely correlated with the occurrence and prognosis of osteosarcoma . P15, a novel tumor - suppressor gene, has been reported to play an important regulatory role in the progression of various malignant tumors, such as pulmonary cancer, nasopharynx cancer, and kidney cancer . The fragment loss, point mutation, or methylation of p15 gene may all lead to its abnormal tumor - suppressing function, thus facilitating the malignancy and metastasis of tumor cells . Previous studies have been performed on the pathogenesis and related mechanisms of pulmonary metastasis of osteosarcoma, but the involvement of p15 gene has not been reported . As it is of critical importance for early diagnosis of osteosarcoma to discover a simple but effective biological tumor marker, this study aimed to describe the mechanism of p15 gene mutation in the occurrence and lung metastasis of osteosarcoma in a rat model, as previously described . This study may provide further evidence for developing methods in clinical diagnosis of malignant osteosarcoma . A total of 60 sd rats (both males and females, ages 4~5 weeks, body weight 150~170 g) from the laboratory animal center of harbin medical university, were randomly divided into control and model groups (n=30 each). The osteosarcoma model was prepared as previously reported . In brief, after general anesthesia, 0.5 ml umr-106 cell suspensions (atcc, us, 110 per ml), which were cultivated in dmed containing 10% fetal bovine serum (gibco, usa), were subcutaneously injected into the right forelimb of each rat in the model group . Rats were used for all experiments, and all procedures were approved by the animal ethics committee of harbin medical university . After 0, 1, 2, 4, and 6 weeks of the inoculation, 5 rats from model or control groups were sacrificed to separate osteosarcoma and pulmonary tissues . The tumor volume was approximated as: (short diameter long diameter)/2, as reported elsewhere . The isolated pulmonary tissue was fixed in 10% neutral buffered formalin, followed by xylene dewaxing and gradient ethanol (100%, 95%, 80%, and 70%) hydration . We added 20 g / ml protease k without dnase to incubate at 37c for 15 min, and then it was boiled in citric acid buffer (0.01 m, ph = 6.0) for 20 min after being washed 3 times (5 min each time) with pbs until naturally cooling down to room temperature . Pbs containing 5% normal goat sera was used to block at 37 for 10 min, then the sera was decanted and added to primary antibody . After being washed with pbs for 3 times, secondary antibody containing 1% labeled biotin was applied for incubation at 37c for 15 min . After being washed with pbs for 3 times, 3% horseradish peroxidase - labeled avidin working solution was used for incubation at 37c for15 min . Dab staining was conducted after being washed with pbs 3 times, and then it was washed with tap water, following hematoxylin re - dyeing, drying, and mounting . Sp - ihc staining was used to show the positive expression of tumors cells and metastatic conditions . For a quantitative analysis, 10 randomly selected fields we carefully followed the instructions in the sp - ihc detection kit (shanghai yanhui bio - tech, china). Peripheral blood samples (0.5 ml) were collected from all animals at the same time points, as detailed above . After centrifugation for 10 min at 3000 g, lower blood clots were lysed in pbs buffered - lysing reagents . Total rna were then extracted from blood cells for further synthesis of cdna, which was then used as the template in pcr assay for the analysis of 2 exon of p15 gene . Using specific designed primers (p15-f, 5-tggct ctgac cactc tgc-3; p15-r, 5-agcga attcg ggtgg gaa-3) and internal reference gene -actin (forward, 5-gaaac tacgt tcaag cgatc-3; reverse, 5-ctaga agcat ttgcg gtgga-3), pcr was performed in the following mixture: 1 l 10 reaction buffer, 70 m dntps (4), 100 ng dna templates, 30 ng primers, 100 ng taq dna polymerase, plus ddh2o (up to 10 l). The reaction parameter was: pre - nature at 95c for 5 min, followed by 40 repeating cycles each containing 95c denature for 30 s, 60c annealing for 30 s, and 72c elongation for 30 s. the reaction was ended by final elongation at 72c for 8 min . Agarose gel (1%) electrophoresis was used to visualize pcr fragments lengths, along with -actin - controlled fragments (232 bp). Spss 20.0 software package was used to analyze all collected data, which are presented as meanstandard deviation (sd). Between - group comparison a total of 60 sd rats (both males and females, ages 4~5 weeks, body weight 150~170 g) from the laboratory animal center of harbin medical university, were randomly divided into control and model groups (n=30 each). The osteosarcoma model was prepared as previously reported . In brief, after general anesthesia, 0.5 ml umr-106 cell suspensions (atcc, us, 110 per ml), which were cultivated in dmed containing 10% fetal bovine serum (gibco, usa), were subcutaneously injected into the right forelimb of each rat in the model group . Rats were used for all experiments, and all procedures were approved by the animal ethics committee of harbin medical university . After 0, 1, 2, 4, and 6 weeks of the inoculation, 5 rats from model or control groups were sacrificed to separate osteosarcoma and pulmonary tissues . Morphological changes were observed, along with the measurement of tumor size . The tumor volume was approximated as: (short diameter long diameter)/2, as reported elsewhere . The isolated pulmonary tissue was fixed in 10% neutral buffered formalin, followed by xylene dewaxing and gradient ethanol (100%, 95%, 80%, and 70%) hydration . We added 20 g / ml protease k without dnase to incubate at 37c for 15 min, and then it was boiled in citric acid buffer (0.01 m, ph = 6.0) for 20 min after being washed 3 times (5 min each time) with pbs until naturally cooling down to room temperature . Pbs containing 5% normal goat sera was used to block at 37 for 10 min, then the sera was decanted and added to primary antibody . After being washed with pbs for 3 times, secondary antibody containing 1% labeled biotin was applied for incubation at 37c for 15 min . After being washed with pbs for 3 times, 3% horseradish peroxidase - labeled avidin working solution was used for incubation at 37c for15 min . Dab staining was conducted after being washed with pbs 3 times, and then it was washed with tap water, following hematoxylin re - dyeing, drying, and mounting . Sp - ihc staining was used to show the positive expression of tumors cells and metastatic conditions . For a quantitative analysis, 10 randomly selected fields we carefully followed the instructions in the sp - ihc detection kit (shanghai yanhui bio - tech, china). Peripheral blood samples (0.5 ml) were collected from all animals at the same time points, as detailed above . After centrifugation for 10 min at 3000 g, lower blood clots were lysed in pbs buffered - lysing reagents . Total rna were then extracted from blood cells for further synthesis of cdna, which was then used as the template in pcr assay for the analysis of 2 exon of p15 gene . Using specific designed primers (p15-f, 5-tggct ctgac cactc tgc-3; p15-r, 5-agcga attcg ggtgg gaa-3) and internal reference gene -actin (forward, 5-gaaac tacgt tcaag cgatc-3; reverse, 5-ctaga agcat ttgcg gtgga-3), pcr was performed in the following mixture: 1 l 10 reaction buffer, 70 m dntps (4), 100 ng dna templates, 30 ng primers, 100 ng taq dna polymerase, plus ddh2o (up to 10 l). The reaction parameter was: pre - nature at 95c for 5 min, followed by 40 repeating cycles each containing 95c denature for 30 s, 60c annealing for 30 s, and 72c elongation for 30 s. the reaction was ended by final elongation at 72c for 8 min . Agarose gel (1%) electrophoresis was used to visualize pcr fragments lengths, along with -actin - controlled fragments (232 bp). Spss 20.0 software package was used to analyze all collected data, which are presented as meanstandard deviation (sd). Between - group comparison one week after the inoculation of tumor cells, there were small tumor lesions underneath the skin around the injection sites . As shown in table 1, the average size of these tumors was 4.000.18 (in mm). Abnormally enlarged microvessels can be observed on the surface and in the peripheral muscles of the tumor, even by the naked eye . On the second week, the tumor size increased to 4.000.25 (in mm), with severe edema on the surface and in peripheral tissues . On the fourth and sixth weeks after injection, tumor size continued to grow (17.000.23 and 21.000.31, in mm respectively) but more slowly . A longitudinal dissection of the tumor revealed white and hard tissues with centralized necrosis . Before tumor cell inoculation after the injection of osteosarcoma cells, model rats had significantly elevated tumor cell percentage with the elongation of time . On the first week, most of osteosarcoma and pulmonary tissues showed negative staining for tumor cells . From week 2, positive staining cells began to occur in model rats but not in control rats . On week 6, the tumor positive rates were as high as 85% and 72% in primary and pulmonary tissues, respectively (table 2, figure 1). In a total of 25 peripheral blood samples in osteosarcoma rats, 18 of them (72%) showed mutation in the 2 exon of p15 gene, while control rats had normal gene isoforms (table 3, figure 2). In examining rats from different time points further studies also revealed significant correlation between p15 gene mutation and occurrence of osteosarcoma (r=0.998, p<0.05). One week after the inoculation of tumor cells, there were small tumor lesions underneath the skin around the injection sites . As shown in table 1, the average size of these tumors was 4.000.18 (in mm). Abnormally enlarged microvessels can be observed on the surface and in the peripheral muscles of the tumor, even by the naked eye . On the second week, the tumor size increased to 4.000.25 (in mm), with severe edema on the surface and in peripheral tissues . On the fourth and sixth weeks after injection, tumor size continued to grow (17.000.23 and 21.000.31, in mm respectively) but more slowly . After the injection of osteosarcoma cells, model rats had significantly elevated tumor cell percentage with the elongation of time . On the first week, most of osteosarcoma and pulmonary tissues showed negative staining for tumor cells . From week 2, positive staining cells began to occur in model rats but not in control rats . On week 6, the tumor positive rates were as high as 85% and 72% in primary and pulmonary tissues, respectively (table 2, figure 1). In a total of 25 peripheral blood samples in osteosarcoma rats, 18 of them (72%) showed mutation in the 2 exon of p15 gene, while control rats had normal gene isoforms (table 3, figure 2). In examining rats from different time points further studies also revealed significant correlation between p15 gene mutation and occurrence of osteosarcoma (r=0.998, p<0.05). Due to its unfavorable prognosis, early diagnosis and treatment is of critical importance for preventing metastasis of osteosarcoma lesions . The clinical features of osteosarcoma mainly include bone pain, hypercalcinemia, and osteolysis metastasis . The complication of other organ / tissues, such as the lung, may indicate the metastasis of tumors . The proliferation of primary tumor lesions causes the detachment of tumor cells, which penetrate vessel walls to enter the general lymph or blood circulation system for the invasion of distal tissues, where tumor seeds investigation of the mechanisms underlying the progression and metastasis of osteosarcoma is a popular research topic . Recent studies revealed complicated genetic processes regulating the tumor metastasis, as a hot - spot located in chromosome 9p21 - 22 region affects gene fragment loss or transcriptional abnormalities in various malignant tumors [1719]. P15 gene, as a representative gene in this region, has been shown to have mutants and expression down - regulation in kidney and bladder cancer . In approximately 23% of cancer cells of it has been indicated that single - base mutation occurs in 67, 119, and 135 codons of p15 gene . Due to the methylation of p15 gene, hematopoietic progenitor cells lose the regulation of tgf--mediated growth inhibition, which in turn increased the incidence of malignant bone tumors . Recent evidence suggests the complexity of the abnormal regulation of p15 gene involved in bone tumor metastasis . However, the relationship between p15 gene and lung metastasis of osteosarcoma remains to be determined . This study utilized umr-106 cell line, which is a classical osteosarcoma cell line induced by radioactive phosphorous isotope (32-p), to generate an osteosarcoma rat model by subcutaneous injection . The observation of tumor size and pulmonary tissue damage, along with p15 gene expression at different time points after the injection, showed normal tissue structures and almost no tumor cells in the control group . After the inoculation, the overall survival rate of rats was 83.3%, in which about 48% of cases had pulmonary metastasis, suggesting the effectiveness and usefulness of this model . The tumor cell expression maintained at minimal level with lower mutation rate of p15 gene at 1 week after the inoculation . At 26 weeks, however, abnormal tumor - like structures began to occur in the pulmonary tissues in the model group, along with elevated p15 gene mutation rates over time . The tumor - positive cell percentage in pulmonary tissues increased from 10% to more than 72% at the final time point (6 weeks), suggesting the occurrence of lung metastasis, as consistent with previous reports . Other studies demonstrated the suppressed incidence of esophagus cancer and pharynx squamous carcinoma by the inhibition of p15 gene methylation . Furthermore, p15 expression level was higher in tongue squamous carcinoma without lymph node metastasis, compared to those patients with metastasis, who also had unfavorable prognosis . All these studies point to the importance of p15 gene in inhibiting tumor growth and invasion, both of which are consistent with our results in osteosarcoma . The proliferation of cells is highly dependent on the complete cell cycle, whose disruption or dysfunction may directly affect the tumor growth . P15 gene, as an inhibitory factor in cell - cycle - dependent kinase (cdk), exerts its function mainly on g1 phase of the cell cycle via modulating the n - terminal protein expression of multiple tumor - suppressing factors, thereby inhibiting the abnormal growth of various malignant tumor cells . The correlation between p15 gene mutation in peripheral blood cells and the growth curve of osteosarcoma lesion suggests the invasion of tumor cells via blood circulation into distal sites, in addition to the facilitating role of mutant p15 in the pulmonary metastasis of osteosarcoma . Our results indicate the close correlation between p15 gene mutation and growth of osteosarcoma, and the potentially direct involvement of p15 gene in pulmonary metastasis . Our results suggest the potency of p15 mutant genes as a novel biological marker in early diagnosis of osteosarcoma in clinics, although its detailed molecular mechanism in progression and pulmonary metastasis require further study . Molecular biology research is still required to elucidate the mechanism of mutation location of p15 gene, as well as its role in the metastasis of osteosarcoma to the lung.
|
The term was used by hallopeau in 1889 and is derived from the greek; thrix - hair, tillein - pull out and mania - madness . Scalp is the most common site for pulling hair although other hair bearing areas may be involved . In less severe forms diagnosis is mainly by history and clinical examination, nevertheless, sometimes it is very difficult to differentiate it from other causes of noncicatricial alopecia . Trichoscopy, dermoscopy hair and scalp, is a noninvasive technique for differential diagnosis of various hair and scalp diseases . Here authors evaluated trichoscopic patterns in ttm and authors believe that these patterns are specific to ttm, which can aide in early diagnosis of this chronic condition . This study was carried out on 10 patients attending department of dermatology in a tertiary hospital attached to s. nijalingappa medical college at bagalkot, south india between january 2014 and july 2014 . Ten patients with clinical features of ttm were subjected for a complete history and dermatological examination . Demographic data such as age and gender and clinical variables in terms of site of lesions and disease duration were documented . Dermlite 3 dermoscope (10 magnifications) with both polarized and nonpolarized lights was employed in the study . Sony camera (digital, 14 mega pixels) was attached to save the images . Initially, ultrasound gel was applied either on the faceplate of dermoscopy or on the skin lesions and then lesions were observed through the eyepiece of dermoscopy . Although polarized dermoscopy was employed, ultrasound gel was applied for clarity of images and to lessen distortions associated with light . This study was carried out on 10 patients attending department of dermatology in a tertiary hospital attached to s. nijalingappa medical college at bagalkot, south india between january 2014 and july 2014 . Ten patients with clinical features of ttm were subjected for a complete history and dermatological examination . Demographic data such as age and gender and clinical variables in terms of site of lesions and disease duration were documented . Dermlite 3 dermoscope (10 magnifications) with both polarized and nonpolarized lights was employed in the study . However, only polarized light version was used in our study . Sony camera (digital, 14 mega pixels) was attached to save the images . Initially, ultrasound gel was applied either on the faceplate of dermoscopy or on the skin lesions and then lesions were observed through the eyepiece of dermoscopy . Although polarized dermoscopy was employed, ultrasound gel was applied for clarity of images and to lessen distortions associated with light . Mean age of the patients was 34 years (minimum age 13 years and maximum age 55 years). Mean duration of disease was 19 months (minimum 2 months and maximum 36 months). Most common symptom was patchy loss of hair over the scalp (100%) especially in the frontal area [figure 1] and one patient (10%) had tonsure pattern of hair loss . Four patients agreed to knowingly pulling of hair, and one patient (10%) gave a history of eating them (trichophagia). The most common trichoscopic pattern observed in all patients was decreased hair density and hairs broken at different lengths (100%) [figure 2]. Excoriations are also seen on the forehead trichoscopy showing decreased hair density, trichoptilosis (yellow arrows), tulip hairs (red arrows) and perifollicular whitish areas (red stars) short hair with trichoptilosis (split ends) [figures 25], irregular coiled hairs [figure 3] and upright re - growing hairs were demonstrated in 8 patients (80%) each . The novel diagnostic signs like black dots and flame hair [figure 4], v - sign [figure 3], follicular hemorrhages [figure 5] were observed in 3 patients (30%) each . Tulip hair and hair powder [figure 6] patterns were observed in 1 (10%) patient each . All patients (100%) had the noninflammatory alopecia with follicles having distorted and collapsed inner root sheath [figure 7] in histopathology . Trichoscopy showing coiled hairs (red arrows) and v - hairs or v - sign (yellow arrows) trichoscopy showing flame hairs (red arrows) and black dots (yellow arrows) trichoscopy showing decreased hair density, follicular hemorrhage (black arrow) and trichoptilosis (red arrows) trichoscopy showing tulip hairs (red arrows) and hair powder (yellow arrows) histopathology showing diffuse, noninflammatory alopecia, missing hair shafts (black stars) and inward collapse of outer root sheath (black arrows). Few unaffected follicles are also seen (yellow arrows) (h and e, 4) histopathology showing an irregular, deformed and pigmented shaft characteristic of trichomalacia (h and e, 40) trichotillomania is a chronic impulse control disorder characterized by repetitive hair pulling resulting in alopecia . In young children, it is usually a habit that resolves spontaneously or with minimal treatment . In older age groups, adolescents and adults, seen predominantly in females and evidence of some form of psychological or behavioral stress is often apparent . The favorite site is the easily reached fronto - parietal region of the scalp followed by eyelashes, eyebrows, pubic hair, body hair and facial hair . This results in patchy loss of hair, often in a bizarre or angular pattern, in which the hairs are twisted and broken at various distances from the clinically normal scalp . A hairball, trichobezoar, is a rare accompaniment of ttm in those who also eat the plucked hair (trichophagia). In our study, most of the patients belonged to adolescent, and middle age group and most of them were females . All of them presented with patchy hair loss over the scalp, none of the patients gave a history of hair loss in other areas . Only one patient had a history of eating of pulled hairs, but there were no signs and symptoms of trichobezoar in her . The diagnosis of ttm is often difficult as other hair loss diseases appear similar in clinical manifestations . This difficulty is encountered especially with alopecia areata (aa). As ttm often coexists with aa trichoscopy is a novel diagnostic technique, both simple and noninvasive, can be used as a handy bed side tool for diagnosing common hair and scalp disorder . Several common trichoscopy features of ttm were identified . Decreased hair density, hairs broken at different lengths, short hairs with trichoptilosis (" split ends ") are described in the literature as diagnostic of ttm . Authors observed these findings in all the patients, and this is due to irregular and repetitive pulling of hairs leading to damage to the cuticle . Irregular coiled hairs and upright re - growing hairs are also reported to be seen in ttm . In this study, these findings were demonstrated in 80% of patients . Coiled hair results from hair shaft fracture and coiling of the remaining proximal part which is fixed to the scalp . Black dots are believed to be remnants of hair shafts arising from tapering hairs, broken hairs, and bent hairs . In a study conducted by shim et al . Rakowska et al . Observed that black dots tend to be uniform in size and shape in aa, whereas in ttm and tinea capitis they are variable in diameter and round, oval, irregular in shape . It presents as a red dot corresponding to follicular ostia capped or stuffed with the blood clot and suggests a history of traumatic forced plucking . Recently, flame hairs, v - sign, tulip hairs, and hair powder are described, and authors claim these signs are specific only for ttm . Flame hairs are semi - transparent, wavy and cone - shaped hair residues, which develop as a result of severe mechanical hair pulling and shredding . V - sign is created when two or more hairs emerge from one follicular ostium, which are pulled simultaneously and break at the same length above scalp surface . When hair shafts are almost totally damaged by mechanical manipulation, only a sprinkled hair residue is visible . This finding is referred to as hair powder . In the present study, these trichoscopic patterns were demonstrated in variable frequency . In aa, the common trichoscopic findings are yellow dots, uniform black dots, broken hair, trichoptilosis, upright re - growing hair, and vellus hair . As some of the trichoscopic features are overlapping in ttm and aa, histopathology plays a corroborative role in definitive diagnosis . The histopathological features of ttm include empty follicles, incomplete disrupted follicular anatomy, trichomalacia, and pigment casts without significant inflammation . Collapsed inner root sheath and missing hair shaft indicate the extraction of the hair follicle due to forcible hair pulling . Partially extracted and distorted root sheath material with fragments of pigment can be identified as the germinative follicular epithelium may produce abnormally formed, diminished and distorted hair shaft with irregular pigmentation as a result of trauma . A new trichoscopic pattern was observed by the authors in one patient, in the form of perifollicular whitish areas [figure 2]. Authors believe these whitish areas represent hyperkeratosis that is due to perifollicular damage as a result of repeated hair pulling trichotillomania is often chronic and difficult to treat . Patients may attempt to disguise the condition due to its social implications . Hence trichoscopy, being a noninvasive and in vivo diagnostic technique, can be utilized in this condition as it plays a vital role in the diagnosis of this condition by demonstrating specific trichoscopic patterns . Further studies on trichoscopic patterns correlating with duration of disease and histopathology of ttm are suggested.
|
The prevalence of syphilis in the normal population has decreased significantly since 1977 in korea (1, 2). However, in western countries the incidence of syphilis has risen, mainly in the 20 - 24 age group and its clinical manifestations have been various (3). Sexual activity has become more acceptable in our culture recently, initiating various forms of sex, and as a result, many different clinical conditions of sexually transmitted disease (std) have appeared . It is usually asymptomatic and less frequently presents as proctitis, ulcer and pseudotumors (3, 4). Therefore, it is difficult to diagnose and physicians occasionally might prescribe inappropriate treatments (5, 6). In this paper we describe a case of primary rectal syphilis which was suspected to be rectal cancer . He complained of bowel habit change with tenesmus, mucous discharge, anal pain and intermittent presence of blood in stool . He had a 2 cm sized, firm, non - tender and indurated nodule on the left side of the inguinal area and multiple condyloma acuminatum around the anus . Sigmoidoscopy in our gastrointestinal endoscopy unit showed two indurated masses of 1.5 to 2 cm on the posterior wall of the middle and lower rectum (fig . The masses had a coin like appearance, and each of them had a slightly depressed and ulcerated surface . The vdrl quantitative test was 1:64 and the fta - abs igm and igg test was positive . A human immunodeficiency virus (hiv) the patient was treated with intramuscular penicillin g benzathine (2,400,000 iu im/1 week, thrice). Follow - up sigmoidoscopy after 1 month showed nearly complete regression of the chancre (fig . A repeat biopsy was done and the histologic result showed focal lymphoid hyperplasia . A vdrl quantitative test after 3 months was 1:1 . Most physicians have a tendency to consider rectal ulceration as a neoplasm (7, 8). Similarly in our case symptoms and signs suggested rectal neoplasia and the clinical history did not reveal homosexuality . However, after the vdrl test the patient confessed that he had been raped by a homosexual male . Therefore, when rectal syphilis is suspected (i.e., perianal condyloma acuminatum associated with inguinal lymphadenopathy) the history of sexual intercourse, especially rectal intercourse, has to be taken . A dark - field examination is recommended by many studies (3). In our case, however, a dark - field examination was not performed, because rectal chancre was highly suggested by the clinical history, anorectal lesions, pathologic findings and positive serologic test . Additionally, like other syphilis cases benzathine penicillin therapy induced a rapid regression of the rectal lesions . We believe when a positive serologic syphilis test is associated with ulcerative lesion, additional laboratory tests are not necessary . Inguinal lymphadenopathy need not require an initial biopsy when evidence of regional infection is present . Usually after antibiotic therapy of at least 4 weeks, most physicians might decide whether a biopsy is necessary . In this case, however, the physician did not have experience recognizing rectal syphilis, so he immediately obtained a biopsy specimen from the inguinal lesion . . In western countries the incidence of rectal syphilis is rising, especially in groups of active homosexual males . Bassi et al . Emphasized in his case report that endoscopists should keep in mind the rising incidence of syphilis (3). Therefore an initial physician should encourage his / her patient to inform him / her of the patient's sexual history.
|
The protective effects of vagus nerve during ischemia / reperfusion (i / r) have been suggested (1). Vagus nerve stimulation decreases the inflammation and the injuries resulted from i / r through affecting neutrophils while vagotomy increases these processes (1). Moreover, it has been observed that stimulation of vagus nerve can cause protective effects on gastric injury through releasing prostaglandins, nitric oxide (no) and calcitonin gene related peptide (cgrp) (2). It is probable that vagus nerve exerts its gastric protective effects through releasing the aforementioned mediators . Also, it has been reported that cholinergic activity of the efferent vagus nerve can participate in immunity modulation (3). Another study has shown that nicotine in monocytes not only decreases the production of pre - inflammatory cytokines, but also changes the response to il-10, an anti - inflammatory cytokine (4, 5). Cho et al have shown that alternative stimulation of cervical vagus nerve increases intra - gastric pressure and also causes bleeding ulcers in mucosal glands of stomach, and these effects can be prevented by atropine administration or sub - diaphragmatic vagotomy (6). It has been reported that gastric vagotomy is effective in treating gastric and duodenal ulcers (7). Melatonin as a neurohormone is basically produced in the pineal gland and also in epiphysis, gastrointestinal (gi) mucosa and other organs . Melatonin has several physiological activities such as controlling circadian rhythm, sleep induction, regulation of seasonal reproduction, and improvement of immunity . The most important effect of melatonin is an anti - oxidant effect that protects living organisms against oxidative stress (11). In several studies, the ability of melatonin in decreasing molecular injury has been shown during i / r . Melatonin prevents myocardial infarction, necrotic cell death and renal abnormality after i / r (8, 12), reduces brain edema in ischemia (12), and prevents acute gastric ulcers resulted from stress . These effects can be done through direct reactive oxygen species / reactive nitrogen species (ros / rns) detoxification, increase in anti - oxidative enzymes, and the prevention of electron leakage in mitochondrial inner membrane (11, 13). Melatonin has a role in expression and function of nicotinic acetylcholine receptors and increases the efficacy of beta bungarotoxin - sensitive acetylcholine receptors (14). It has been recognized that intra - cerebral injection of melatonin is effective in prevention of acid and pepsin secretion through cholinergic activity (15). It has been identified that 5ht3 and 5ht2 receptors are involved in stimulatory effects of melatonin in releasing pancreatic enzymes (11). Protective effects of melatonin are not only due to antioxidant activity, but it also activates capsaicin - sensitive afferent fibers (1, 16). Melatonin may have a potential impact on the treatment of peptic ulcer via significant increase in ghrelin expression (17). Melatonin increases the release of pancreatic amylase and proteins through vagus nerve (18). The effects of melatonin on pancreatic enzymes are reversed by vagotomy and administration of capsaicin (18, 19). Intra - lumen administration of melatonin increases plasma cholecystokinin (cck) and antioxidants (11, 19, 20). It has been shown that sensory nerve fibers are involved in protective effects of melatonin in the healing of acute gastric injury and peptic ulcer (16). It has been reported that vagus nerve increases the secretion of bicarbonate from duodenum mucosa through an increase in melatonin secretion (21). Vagal pathways are the most important regulatory pathways in the gastrointestinal tract which is one of the most important sources of melatonin production . In previous studies, both protective and harmful effects of the stimulation of vagus nerve in digestive system have been reported . The role of sensory neurons in protective effects of melatonin in the healing of acute gastric injury and peptic ulcer has been reported . There is no study about the combined effects of melatonin administration and intervention of vagus nerve during gastric i / r injury . Probably, vagus nerve and melatonin have interactions in their protective effects during gastric i / r events so, the present study was performed to examine this interaction during gastric i / r . This study was performed in 42 male wistar rats weighing 180 - 220 g. animals were kept at room temperature 20 - 22 c and 12 hr-12 hr light - dark cycle . Animals had free access to water and food and were randomly divided into 6 groups of 7 rats . Rats were fasted for 12 hr prior to the experiment but had access to water . Experimental groups were: 1) base+i / r+vehicle; 2) base+i / r+melatonin; 3) vagotomy+i / r+vehicle; 4) vagotomy+i / r+melatonin; 5)vagus nerve stimulation+i / r+vehicle; 6)vagus nerve stimulation+i / r+ melatonin . Base, means condition that neither vagus nerve was stimulated nor vagotomy was performed . Animals underwent tracheostomy and were cannulated (in order to prevent probable airway occultation) under anesthesia induced by intraperitoneal pentobarbital (50 mg / kg). After local shaving, a small incision was made in cervical area and branches of cervical vagus nerve were carefully dissected from carotid artery and cut (1). After dissection of vagus nerve, distal end was covered with mineral oil and stimulated with bipolar electrode of a stimulator using 10 volt / msec pulses at the frequencies of 0.625, 1.25, 2.5, 5 or 7.5hz for 30 sec . Stimulations were performed with 2-min intervals (23). In order to ensure the stimulation of vagus nerve, electrocardiogram gastric i / r injury was induced by dissecting celiac artery from the surrounding tissues in rats anesthetized with 50 mg / kg pentobarbital, 30 minutes after dissection of vagus nerve . Then, celiac artery was closed with a microvascular clamp and returned to its place and the area was sutured using 4 - 0 silk . Occlusion was continued for 30 min (18) followed by a 3-h circulation (reperfusion). Melatonin (10 mg / kg) was injected intraperitoneally before reperfusion in groups 5, 6 and 7 (18, 25). Melatonin was dissolved in 1% ethanol, diluted with 0.9% saline, and injected at a final volume of 0.3 ml (18). One part was kept in 10% formalin solution for histopathological assessment and the rest was kept at -70 c for evaluation of oxidant and antioxidant factors (18, 25). Mda level was measured according to hiroshi ohkawa method via reaction with thiobarbituric acid and color formation . Optical absorbance was determined at 532 nm and mda level was reported as nmol / mg protein (26). Glutathione peroxides activity was determined by the method described by valentine and paglia method (20), and enzyme activity was reported as u / mg protein . Superoxide dismutase activity was determined using ransod kit (randox, uk) and enzyme activity was reported as u / mg protein (19). Catalase activity was determined by the method described by mari and reported as u / mg protein (20). The h & e stained sections were examined under low power (40x) to identify the areas of neutrophil aggregates within all tissue blocks . The number of neutrophils was calculated in a semiquantitative manner using the mean value of 20 non - overlapping high power fields (hpf; magnification of 400x; 0.08 mm) by using a 40x objective and a square grid mounted in a 10x microscopic eyepiece . Comparisons among different groups were made by one - way and two - way anova followed by post hoc tukey s test . Animals underwent tracheostomy and were cannulated (in order to prevent probable airway occultation) under anesthesia induced by intraperitoneal pentobarbital (50 mg / kg). After local shaving, a small incision was made in cervical area and branches of cervical vagus nerve were carefully dissected from carotid artery and cut (1). After dissection of vagus nerve, distal end was covered with mineral oil and stimulated with bipolar electrode of a stimulator using 10 volt / msec pulses at the frequencies of 0.625, 1.25, 2.5, 5 or 7.5hz for 30 sec . Stimulations were performed with 2-min intervals (23). In order to ensure the stimulation of vagus nerve, electrocardiogram gastric i / r injury was induced by dissecting celiac artery from the surrounding tissues in rats anesthetized with 50 mg / kg pentobarbital, 30 minutes after dissection of vagus nerve . Then, celiac artery was closed with a microvascular clamp and returned to its place and the area was sutured using 4 - 0 silk . Occlusion was continued for 30 min (18) followed by a 3-h circulation (reperfusion). Melatonin (10 mg / kg) was injected intraperitoneally before reperfusion in groups 5, 6 and 7 (18, 25). Melatonin was dissolved in 1% ethanol, diluted with 0.9% saline, and injected at a final volume of 0.3 ml (18). One part was kept in 10% formalin solution for histopathological assessment and the rest was kept at -70 c for evaluation of oxidant and antioxidant factors (18, 25). Mda level was measured according to hiroshi ohkawa method via reaction with thiobarbituric acid and color formation . Optical absorbance was determined at 532 nm and mda level was reported as nmol / mg protein (26). Glutathione peroxides activity was determined by the method described by valentine and paglia method (20), and enzyme activity was reported as u / mg protein . Superoxide dismutase activity was determined using ransod kit (randox, uk) and enzyme activity was reported as u / mg protein (19). Catalase activity was determined by the method described by mari and reported as u / mg protein (20). The h & e stained sections were examined under low power (40x) to identify the areas of neutrophil aggregates within all tissue blocks . The number of neutrophils was calculated in a semiquantitative manner using the mean value of 20 non - overlapping high power fields (hpf; magnification of 400x; 0.08 mm) by using a 40x objective and a square grid mounted in a 10x microscopic eyepiece . Comparisons among different groups were made by one - way and two - way anova followed by post hoc tukey s test . Mean number of neutrophils in base+ i / r+ melatonin group (23.80.37) was lower than that in base+ i / r+ vehicle group (27.20.37) (p<0.01). Also, this parameter in vagus stimulation + i / r+ vehicle group (450.32) was higher than that in base+ i / r+ vehicle and vagotomy+ i / r+ vehicle groups (27.20.36) (p<0.001). / r+melatonin group (20.6 0.4) in comparison to vagus stimulation+i / r+vehicle group (p<0.001). / r+ melatonin group as compared to base+i / r+ melatonin group (p<0.01). A significant increase in neutrophils count was shown in vagotomy+i / r+melatonin group (260.32) as compared to base+i / r+melatonin group (p<0.05). The number of neutrophils in gastric tissue of the study groups (n=7). ###p<0.001: vagus stimulation+i / r+veh group vs. vagotomy+i / r+veh group . Base: condition that neither vagus was stimulated nor vagotomy was performed; i / r: ischemia / reperfusion; mel: melatonin; veh: vehicle mda level in the study groups is presented in figure 2 . As it is seen, mda level in gastric tissue was lower in base+i / r+melatonin group (4.090.15 nmol / mg protein) in comparison with base+i / r+vehicle group (5.530.11 nmol / mg protein) (p<0.05). Moreover, a significant increase in mda level was shown in vagus stimulation+i/-r+vehicle group (7.310.25 nmol / mg protein) in comparison with base+i / r+vehicle and vagotomy+i/- r+vehicle (5.570.14 nmol / mg protein) groups (p<0.01). / r+vehicle group (p<0.001). Also, mda level was lower in vagus stimulation+i / r+melatonin group (2.48 0.06 nmol / mg protein) in comparison with base+i / r+melatonin group (p<0.01). Mda level was higher in vagotomy+i / r+melatonin group (5.75 0.63 nmol / mg protein) in comparison with base+ i / r+melatonin group (p<0.05). * p<0.05: base+i / r+ mel group vs. base + i / r+ veh group . ##p<0.01: vagus stimulation+i / r+veh group vs. vagotomy+i / r+veh group . A p<0.01: vagus stimulation+i / r+mel group vs. base + i / r+mel group . Base: condition that neither vagus was stimulated nor vagotomy was performed; i / r: ischemia / reperfusion; mel: melatonin; veh: vehicle catalase activity in the study groups are shown in figure 3 . Catalase activity was increased in base+i / r+melatonin group (0.060.003 u / mg protein) in comparison with base+i / r+vehicle group (0.040.003 u / mg protein) (p<0.001). A significant increase in catalase activity was shown in vagus stimulation+ i / r+vehicle group (0.07 0.004 u / mg protein) in comparison with base+i / r+vehicle and vagotomy+i / r+vehicle groups (0.0420.002 u / mg protein) (p<0.001). / r+melatonin group (0.070.004 u / mg protein) in comparison with base+i / r+melatonin group (p<0.05). Catalase activity was lower in vagotomy+i / r+melatonin group (0.040.003 u / mg protein) in comparison with base+i / r+melatonin group (p<0.05). Catalase activity (u / mg protein) in gastric tissue of the study groups (n=7). ***p<0.001: base+i / r+mel group vs. base+i / r+veh group . #base: condition that neither vagus was stimulated nor vagotomy was performed; i / r: ischemia / reperfusion; mel: melatonin; veh: vehicle figure 4 shows glutathione peroxidase activity in the studied groups . A significant increase in gpx activity was shown in gastric tissue of basal+i / r+melatonin group (10.310.37) (p<0.001) in comparison with that in basal+i / r+vehicle group (4.420.57). / r+vehicle group (7.120.31) as compared to that observed in basal+i / r+vehicle and vagotomy+i / r+vehicle groups (4.430.38) (p<0.001). Also, a significant increase in gpx activity was indicated in vagus stimulated+i this parameter was significantly lower in vagotomy+ i / r+melatonin group (4.610.4) as compared to that in basal+i / r+melatonin group (p<0.01). Level of gpx activity (u / mg protein) in gastric tissue of the study groups (n=7) * * * p<0.001: base+i / r+mel group vs. base+i / r+veh group . #b p<0.001: vagotomy + i / r+ mel group vs. base+i / r+mel group . Base: condition that neither vagus was stimulated nor vagotomy was performed; i / r: ischemia / reperfusion; mel: melatonin; veh: vehicle sod activity (u / mg protein) in gastric tissue of studied groups has been shown in figure 5 . As it is seen, this parameter in basal+i / r+melatonin group (0.310.004) was significantly higher (p<0.05) than that in basal+i / r+vehicle group (0.230.016). A significant decrease in sod activity / r+ vehicle group (0.310.004) in comparison with that in vagotomy+i / r+vehicle group (0.360.003) (p<0.05), but it was higher than that in basal+ i / r+vehicle group . This parameter in vagotomy+i / r+melatonin group (0.170.04) was lower than that in basal+i/-r+melatonin group (p<0.05). Superoxide dismutase activity (u / mg protein) in gastric tissue of the study groups (n=7) * p<0.05: base+i / r+mel group vs. base+i / r+veh group . Base: condition that neither vagus was stimulated nor vagotomy was performed; i / r: ischemia / reperfusion; mel: melatonin; veh: vehicle mean number of neutrophils in base+ i / r+ melatonin group (23.80.37) was lower than that in base+ i / r+ vehicle group (27.20.37) (p<0.01). Also, this parameter in vagus stimulation + i / r+ vehicle group (450.32) was higher than that in base+ i / r+ vehicle and vagotomy+ i / r+ vehicle groups (27.20.36) (p<0.001). / r+melatonin group (20.6 0.4) in comparison to vagus stimulation+i / r+vehicle group (p<0.001). / r+ melatonin group as compared to base+i / r+ melatonin group (p<0.01). A significant increase in neutrophils count was shown in vagotomy+i / r+melatonin group (260.32) as compared to base+i / r+melatonin group (p<0.05). The number of neutrophils in gastric tissue of the study groups (n=7). ###p<0.001: vagus stimulation+i / r+veh group vs. vagotomy+i / r+veh group . Base: condition that neither vagus was stimulated nor vagotomy was performed; i / r: ischemia / reperfusion; mel: melatonin; veh: vehicle as it is seen, mda level in gastric tissue was lower in base+i / r+melatonin group (4.090.15 nmol / mg protein) in comparison with base+i / r+vehicle group (5.530.11 nmol / mg protein) (p<0.05). Moreover, a significant increase in mda level was shown in vagus stimulation+i/-r+vehicle group (7.310.25 nmol / mg protein) in comparison with base+i / r+vehicle and vagotomy+i/- r+vehicle (5.570.14 nmol / mg protein) groups (p<0.01). / r+vehicle group (p<0.001). Also, mda level was lower in vagus stimulation+i / r+melatonin group (2.48 0.06 nmol / mg protein) in comparison with base+i / r+melatonin group (p<0.01). Mda level was higher in vagotomy+i / r+melatonin group (5.75 0.63 nmol / mg protein) in comparison with base+ i / r+melatonin group (p<0.05). * p<0.05: base+i / r+ mel group vs. base + i / r+ veh group . #a p<0.01: vagus stimulation+i / r+mel group vs. base + i / r+mel group . Base: condition that neither vagus was stimulated nor vagotomy was performed; i / r: ischemia / reperfusion; mel: melatonin; veh: vehicle catalase activity was increased in base+i / r+melatonin group (0.060.003 u / mg protein) in comparison with base+i / r+vehicle group (0.040.003 u / mg protein) (p<0.001). A significant increase in catalase activity was shown in vagus stimulation+ i / r+vehicle group (0.07 0.004 u / mg protein) in comparison with base+i / r+vehicle and vagotomy+i / r+vehicle groups (0.0420.002 u / mg protein) (p<0.001). / r+melatonin group (0.070.004 u / mg protein) in comparison with base+i / r+melatonin group (p<0.05). Catalase activity was lower in vagotomy+i / r+melatonin group (0.040.003 u / mg protein) in comparison with base+i / r+melatonin group (p<0.05). Catalase activity (u / mg protein) in gastric tissue of the study groups (n=7). ***p<0.001: base+i / r+mel group vs. base+i / r+veh group . ###p<0.001: vagus stimulation+i / r+veh group vs. vagotomy+i / r+veh group . Base: condition that neither vagus was stimulated nor vagotomy was performed; i / r: ischemia / reperfusion; mel: melatonin; veh: vehicle a significant increase in gpx activity was shown in gastric tissue of basal+i / r+melatonin group (10.310.37) (p<0.001) in comparison with that in basal+i / r+vehicle group (4.420.57). / r+vehicle group (7.120.31) as compared to that observed in basal+i / r+vehicle and vagotomy+i / r+vehicle groups (4.430.38) (p<0.001). Also, a significant increase in gpx activity was indicated in vagus stimulated+i this parameter was significantly lower in vagotomy+ i / r+melatonin group (4.610.4) as compared to that in basal+i / r+melatonin group (p<0.01). Level of gpx activity (u / mg protein) in gastric tissue of the study groups (n=7) * * * p<0.001: base+i / r+mel group vs. base+i / r+veh group . ##p<0.01: vagus stimulation+i / r+veh group vs. vagotomy+i / r+veh group . B p<0.001: vagotomy + i / r+ mel group vs. base+i / r+mel group . Base: condition that neither vagus was stimulated nor vagotomy was performed; i / r: ischemia / reperfusion; mel: melatonin; veh: vehicle sod activity (u / mg protein) in gastric tissue of studied groups has been shown in figure 5 . As it is seen, this parameter in basal+i / r+melatonin group (0.310.004) was significantly higher (p<0.05) than that in basal+i / r+vehicle group (0.230.016). A significant decrease in sod activity / r+ vehicle group (0.310.004) in comparison with that in vagotomy+i / r+vehicle group (0.360.003) (p<0.05), but it was higher than that in basal+ i / r+vehicle group . This parameter in vagotomy+i / r+melatonin group (0.170.04) was lower than that in basal+i/-r+melatonin group (p<0.05). Superoxide dismutase activity (u / mg protein) in gastric tissue of the study groups (n=7) * p<0.05: base+i / r+mel group vs. base+i / r+veh group . ##p<0.01: vagus stimulation+i / r+veh group vs. vagotomy+i / r+veh group . Base: condition that neither vagus was stimulated nor vagotomy was performed; i / r: ischemia / reperfusion; mel: melatonin; veh: vehicle the present study was performed to investigate the protective effect of interaction between melatonin and vagus nerve during gastric i / r . The results of this study showed that melatonin administration decreased neutrophils infiltration and mda level and increased sod, cat and gpx activities in gastric tissue . Also, vagus stimulation increased neutrophils infiltration and mda level in gastric tissue while melatonin administration along with vagus stimulation decreased the effect of vagus stimulation in gastric tissue . Finally, vagotomy prevented some of the protective effects of melatonin during gastric i / r . According to the results of this study, melatonin can reduce gastritis during i / r, probably through decreasing the activity of oxidant enzymes and increasing the activity of anti - oxidant enzymes such as sod, cat and gpx . It has also been demonstrated that melatonin decreases mad level (27 - 29). Other probable mechanisms underlying the protective effect of melatonin include an increase in gastric microcirculation (1), a reduction in acid and pepsin secretions (15), a reduction in production of inflammatory cytokines (16) and an increase in the expression of anti - oxidant gene (17, 30 - 32). Moreover, in our study, a stimulation of vagus nerve increased gastritis which was associated with an increase in mda level while vagotomy after i / r was ineffective . It is probable that the stimulation of vagus nerve following gastric i / r aggravated the condition and increased the activity of oxidant enzymes . Since vagotomy in basal condition did not have any effect, it seems that the control of gastritis and the activity of oxidant and anti - oxidant enzymes are not under the control of vagus nerve in basal conditions . It has been demonstrated that the stimulation of vagus nerve increases output of gastric juice and acid (33), and decreases the activity of anti - oxidant enzymes like sod (33). On the other hand, vagotomy showed healing effects on duodenal ulcers (7) similar to the effect of atropine (34). In a study, diaphragmatic vagotomy did not change the activity of catalase in the intestine (35) which was similar to the result of the present study . The results of some studies are not consistent with our data . For example, it has been identified that vagal afferent fibers decrease gastrointestinal tract inflammation through nicotinic receptors leading to a decrease in inflammatory cytokines (16). Cholinergic agonists such as neostigmine decrease superoxide anion and inflammation in i / r (36). Elevation of acetylcholine transferase activity and decrease in acetylcholine esterase inhibitors increase gpx (35, 37). Treatment with acetylcholine esterase inhibitors increases catalase half - life (38). In the present study, melatonin administration affected the outcomes in i / r+vagus stimulation group . Melatonin decreased gastritis and mda level, and increased sod and gpx activity, but not in vagotomy group . These findings show that protective effects of melatonin are probably mediated through vagus nerve . Also, interaction between melatonin and vagus stimulation is suggested since these show a synergic effect in relation with anti - oxidant factors . Regarding this probable interaction, it is suggested that melatonin exerts its gastric protective effect through stimulation of gi tract neurons leading to cgrp release (1). Intra - cerebral injection of melatonin inhibits acid and pepsin secretions through vagus cholinergic activity (15). Melatonin increases the release of amylase and pancreas proteins through vagus nerve (16). Effect of melatonin administration accompanied with vagotomy has not suggested in the release of amylase(18). Studies have shown that intra - lumen administration of melatonin or its precursor induces the release of pancreatic enzymes, while this effect is not shown in isolated pancreas . Moreover, these effects of melatonin are reversed by vagotomy and capsaicin administration (11, 18, 19). It has been reported that melatonin effect is mediated indirectly through the release of cck followed by vagovagal reflex (11, 19, 39). It has been shown that intra - lumen administration of melatonin increases plasma cck level (11, 19) and cck acts through stimulation of vagal afferent fibers in gi tract (40, 41). It has been reported that vagotomy in combination with melatonin administration inhibits the release of pancreas proteins (7, 11, 16). It has been reported that melatonin increases the expression and activity of ach receptors, and synergistic effects are induced during vagus stimulation (42). According to a study, injection of phenylephrine causes melatonin release from mucosa enterochromaffin cells in the presence of normal vagus nerve and sympathetic paths (39). Melatonin increases the release of bicarbonate from gastric mucosa (39) and decreases the release of inflammatory cytokines of gi through increasing vagus activity (16). It is suggested that melatonin is neuroprotective in gastric i / r probably by decreasing gastritis and mda and increasing the activities of cat, sod and gpx . These effects of melatonin are probably mediated by vagus nerve . Moreover, in gastric i / r, melatonin can reverse harmful effects of vagus stimulation . It is suggested that further studies are required to find the mechanisms involved in this interaction.
|
A stratified, multistage probability cluster sampling design was used in this survey (13). Based on socioeconomic characteristics, in the first stage of sampling, 22 counties were randomly selected from each of the 6 regions in china . In the second stage, three townships were randomly selected from each of the selected counties . From each of the townships, 2 residential villages were randomly selected; and 90 households were then randomly sampled from each village for physical examination . One - third of the households were selected to participate in the dietary survey and blood draw . For the present study, we used residents who were living in rural areas and were born between october 1, 1952, and september 30, 1964, as our analytic population . To minimize misclassification of the exposure periods, subjects who were born between october 1, 1958, and september 30, 1959, and between october 1, 1961, and september 30, 1962, were excluded since the exact dates of the start and the end of the chinese famine were not available and not the same across regions . Flow chart on the sampling method in each region * of the 2002 china national nutrition and health survey . * the mainland of china is classified into 6 regions defined by the chinese bureau of statistics according to their socioeconomic development . They are metropolis, general city, type i rural site, type ii rural site, type iii rural site, and type iv rural site . Subjects were categorized into five exposure cohorts: nonexposed cohort, fetal - exposed cohort, early childhood exposed cohort, mid childhood exposed cohort, and late childhood exposed cohort . Subjects who were born between october 1, 1962, and september 30, 1964, were classified as the nonexposed cohort; and subjects who were born between october 1, 1959, and september 30, 1961, were classified as fetal - exposed cohort . Subjects who were born between october 1, 1952, and september 30, 1958, were grouped by every 2 years and were classified into one of the three childhood - exposed cohorts . Mean ages for subjects in nonexposed cohort, fetal - exposed cohort, early childhood exposed cohort, mid childhood exposed cohort, and late childhood exposed cohort were 39, 42, 45, 47, and 49 years, respectively . The chinese famine affected the entire mainland of china, but the severity varied across regions due to different weather conditions, population density, and local policies regarding food shortage (7). As previously described, we used the excess death rate of each province to determine the severity of the famine (7). The excess death rate was calculated as the percentage change in mortality rate from the mean level in 19561958 to the highest value during the period 19591961 (7). An excess death rate of 50% was used as the threshold: regions that had an equal or higher rate than this cutoff were categorized as severely affected famine areas, and otherwise as less severely affected famine areas . We split all five cohorts into severely affected famine areas and less severely affected famine areas . This enabled us to test the hypothesis that the famine effect is stronger in the severely affected famine areas than that in the less severely affected famine areas and to consider both birth cohort effects and regional differences . All subjects were invited for blood collection after an 10 to 14 h overnight fast . The plasma was separated by centrifugation at 3,200 rpm for 1015 min within 1 h of collection, and kept at room temperature without sunshine . Fasting plasma glucose (fpg) concentration was measured using the glucose oxidize enzymatic method within 3 h of plasma preparation . Every tenth sample was measured twice (the correlation coefficient of duplicate measurements was 0.98). We used criteria proposed by the who expert committee on diabetes mellitus (14). Mmol / l, including impaired fasting glucose, impaired glucose tolerance, and type 2 diabetes . In addition, subjects who had been previously diagnosed with type 2 diabetes were added as cases of hyperglycemia and type 2 diabetes . Dietary patterns, economic status, and bmi measured in 2002 were used as measures of the nutritional environment in adulthood and to examine the mismatch between fetal nutrition and adult nutrition . The method for assessing dietary patterns has been described in detail elsewhere (15). Briefly, four dietary patterns were derived through cluster analysis, which were labeled as green water, yellow earth, new affluence, and western adopter . Green water and yellow earth patterns represent the traditional chinese diets in the south and the north, respectively, whereas the other two represent westernized dietary patterns . In this study, we combined the clusters of green water and yellow earth as the traditional dietary pattern, and we combined the clusters of new affluence and western adopter as the affluent / western pattern . Current economic status was assessed by the mean annual income in the year prior to the 2002 cnnhs, which was treated as a dichotomous variable . The mean level of the current sample (2,000 chinese yuan per person per year) was used as a cutoff point for economic status . We used the criteria recommended for chinese adults and classified subjects as overweight if bmi 24 kg / m, or otherwise normal (16). The protocol of the 2002 cnnhs was approved by the ethical committee of the national institute for nutrition and food safety, chinese center for disease control and prevention . Signed consent forms were obtained from all participants . We performed survey analyses with sas 9.2 for windows (sas institute, cary, nc) to estimate statistics for this complex, multistage - designed survey sample . Survey weights were derived from the 2000 china national population census and associated administrative data . Mean fpg differences between the exposed cohorts and the nonexposed cohort were tested by generalized least squares estimation (17). Risks of hyperglycemia and type 2 diabetes among fetal and childhood - exposed subjects, compared with nonexposed subject, were examined with the method of maximum likelihood by using the survey logistic regression model . Interaction between famine exposure cohort (fetal- or childhood - exposed vs. nonexposed) and area (severely affected and less severely affected) was tested by adding a multiplicative factor in the survey logistic regression model . Analyses were adjusted for sex, family history of diabetes, educational level, current smoking, alcohol use, and physical activity level, all assessed in 2002 . To explore whether the associations between fetal exposure to severe famine and hyperglycemia were affected by an improved nutritional environment in later life, we subsequently stratified the analyses by dietary patterns, economic status and bmi in adulthood . The odds ratio of hyperglycemia in the fetal - exposed cohort compared with the nonexposed cohort was calculated within each category of the stratified factor . To distinguish severely and less severely affected famine areas more appropriately, we performed sensitivity analysis by using a more stringent cutoff point, i.e., we used an excess death rate 100% to define the severity of famine . In addition, we performed analyses by using the cohort born during october 1, 1962, to september 30, 1968, as a nonexposed cohort for association analyses, or by excluding participants with a family history of diabetes . Subjects were categorized into five exposure cohorts: nonexposed cohort, fetal - exposed cohort, early childhood exposed cohort, mid childhood exposed cohort, and late childhood exposed cohort . Subjects who were born between october 1, 1962, and september 30, 1964, were classified as the nonexposed cohort; and subjects who were born between october 1, 1959, and september 30, 1961, were classified as fetal - exposed cohort . Subjects who were born between october 1, 1952, and september 30, 1958, were grouped by every 2 years and were classified into one of the three childhood - exposed cohorts . Mean ages for subjects in nonexposed cohort, fetal - exposed cohort, early childhood exposed cohort, mid childhood exposed cohort, and late childhood exposed cohort were 39, 42, 45, 47, and 49 years, respectively . The chinese famine affected the entire mainland of china, but the severity varied across regions due to different weather conditions, population density, and local policies regarding food shortage (7). As previously described, we used the excess death rate of each province to determine the severity of the famine (7). The excess death rate was calculated as the percentage change in mortality rate from the mean level in 19561958 to the highest value during the period 19591961 (7). An excess death rate of 50% was used as the threshold: regions that had an equal or higher rate than this cutoff were categorized as severely affected famine areas, and otherwise as less severely affected famine areas . We split all five cohorts into severely affected famine areas and less severely affected famine areas . This enabled us to test the hypothesis that the famine effect is stronger in the severely affected famine areas than that in the less severely affected famine areas and to consider both birth cohort effects and regional differences . All subjects were invited for blood collection after an 10 to 14 h overnight fast . The plasma was separated by centrifugation at 3,200 rpm for 1015 min within 1 h of collection, and kept at room temperature without sunshine . Fasting plasma glucose (fpg) concentration was measured using the glucose oxidize enzymatic method within 3 h of plasma preparation . Every tenth sample was measured twice (the correlation coefficient of duplicate measurements was 0.98). We used criteria proposed by the who expert committee on diabetes mellitus (14). Mmol / l, including impaired fasting glucose, impaired glucose tolerance, and type 2 diabetes . In addition, subjects who had been previously diagnosed with type 2 diabetes were added as cases of hyperglycemia and type 2 diabetes . Dietary patterns, economic status, and bmi measured in 2002 were used as measures of the nutritional environment in adulthood and to examine the mismatch between fetal nutrition and adult nutrition . The method for assessing dietary patterns has been described in detail elsewhere (15). Briefly, four dietary patterns were derived through cluster analysis, which were labeled as green water, yellow earth, new affluence, and western adopter . Green water and yellow earth patterns represent the traditional chinese diets in the south and the north, respectively, whereas the other two represent westernized dietary patterns . In this study, we combined the clusters of green water and yellow earth as the traditional dietary pattern, and we combined the clusters of new affluence and western adopter as the affluent / western pattern . Current economic status was assessed by the mean annual income in the year prior to the 2002 cnnhs, which was treated as a dichotomous variable . The mean level of the current sample (2,000 chinese yuan per person per year) was used as a cutoff point for economic status . We used the criteria recommended for chinese adults and classified subjects as overweight if bmi 24 kg / m, or otherwise normal (16). The protocol of the 2002 cnnhs was approved by the ethical committee of the national institute for nutrition and food safety, chinese center for disease control and prevention . Signed consent forms were obtained from all participants . We performed survey analyses with sas 9.2 for windows (sas institute, cary, nc) to estimate statistics for this complex, multistage - designed survey sample . Survey weights were derived from the 2000 china national population census and associated administrative data . Mean fpg differences between the exposed cohorts and the nonexposed cohort were tested by generalized least squares estimation (17). Risks of hyperglycemia and type 2 diabetes among fetal and childhood - exposed subjects, compared with nonexposed subject, were examined with the method of maximum likelihood by using the survey logistic regression model . Interaction between famine exposure cohort (fetal- or childhood - exposed vs. nonexposed) and area (severely affected and less severely affected) was tested by adding a multiplicative factor in the survey logistic regression model . Analyses were adjusted for sex, family history of diabetes, educational level, current smoking, alcohol use, and physical activity level, all assessed in 2002 . To explore whether the associations between fetal exposure to severe famine and hyperglycemia were affected by an improved nutritional environment in later life, we subsequently stratified the analyses by dietary patterns, economic status and bmi in adulthood . The odds ratio of hyperglycemia in the fetal - exposed cohort compared with the nonexposed cohort was calculated within each category of the stratified factor . To distinguish severely and less severely affected famine areas more appropriately, we performed sensitivity analysis by using a more stringent cutoff point, i.e., we used an excess death rate 100% to define the severity of famine . In addition, we performed analyses by using the cohort born during october 1, 1962, to september 30, 1968, as a nonexposed cohort for association analyses, or by excluding participants with a family history of diabetes . Basic characteristics of the study population are shown in table 1 . In our main study population (n = 7,874), 1,005 (12.8%) subjects had been exposed to the chinese famine during fetal life, and 4,915 (62.4%) subjects had been exposed during childhood . As compared with the nonexposed individuals, fetal - exposed subjects were 0.9 cm shorter as adults, and childhood - exposed subjects were 1.5 cm shorter (table 1). The prevalence of hyperglycemia among adults in the nonexposed, fetal - exposed, early childhood, mid childhood, and late childhood exposed birth cohorts was 2.4%, 5.7%, 3.9%, 3.4%, and 5.9%, respectively . Basic characteristics of study population according to chinese famine exposure * * data are adjusted means (se). Adjusted factors included sex, educational level, family history of diabetes (only for glucose), current smoking, alcohol use, and physical activity level . Compared with the nonexposed cohort, p <0.05 . In severely affected famine areas, fpg concentration was significantly higher in the fetal - exposed cohort than in the nonexposed cohort with a mean difference of 0.20 no significant difference was observed in the less severely affected famine areas (p for interaction = 0.001, table 2). Compared with nonexposed subjects, fpg was higher in the late childhood exposed cohort in both the severely affected famine areas and less severely affected famine areas . A significant interaction between the exposed cohort and areas was found only for the fetal - exposed cohort (table 2). Concentrations of fasting plasma glucose and prevalence rates of hyperglycemia and type 2 diabetes by birth cohort and severity of the chinese famine area * data are adjusted means (se) for fasting plasma glucose, sex standard prevalence, and odds ratio for hyperglycemia and diabetes . Adjusted factors included sex, education level, family history of diabetes, and current smoking, alcohol use, and physical activity level . Subjects exposed to famine during fetal life in severely affected famine areas had a higher prevalence of hyperglycemia than the nonexposed cohort . The odds ratios were significantly different between the severe and less severe famine areas (table 2), suggesting a stronger famine effect in the severely affected famine areas . Compared with the nonexposed cohort, subjects in the late childhood exposed cohort had a higher risk of hyperglycemia in both severely and less severely affected famine areas, but the odds ratios were not significantly different between the severe and less severe famine areas (table 2). A significantly higher prevalence of type 2 diabetes was observed among subjects exposed in late childhood as compared with the nonexposed cohort (table 1). However, table 2 shows that after stratification of this group by severity of famine exposure, no significant difference of type 2 diabetes risk was observed anymore between different famine cohorts . Stratified analyses by dietary pattern, economic status, and bmi for severely affected famine areas are shown in fig . Figure 2a1 shows that the prevalence of hyperglycemia was highest (18.9%) in subjects in the fetal - exposed cohort and who consumed an affluent / western diet . As compared with the relatively nonexposed cohort, the odds ratio of hyperglycemia in the fetal - exposed cohort was 7.63 (95% ci: 2.4124.1, p = 0.0005) for those who had an affluent / western dietary pattern, and 2.34 (95% ci: 0.826.70, p = 0.112) for those with a traditional dietary pattern . Prevalence of hyperglycemia among birth cohorts according to early life famine exposure and later life dietary patterns (a1 and b1), socioeconomic status (a2 and b2), and bmi (a3 and b3) in severely (column a) and less severely affected famine areas (column b). Figure 2a2 shows that as compared with nonexposed subjects, the odds ratio of hyperglycemia in the fetal - exposed cohort was 6.20 (95% ci: 2.0818.5, p = 0.001) in subjects with a higher adult economic status, and 1.68 (95% ci: 0.505.71, p = 0.404) in subjects with a lower adult economic status . Figure 2a3 shows that overweight subjects in the fetal - exposed cohort had the highest prevalence of hyperglycemia (13.9%). However, the risks of hyperglycemia were largely comparable in these two groups; the odds ratio of hyperglycemia in the fetal - exposed cohort was 3.71 (95% ci: 1.1312.2, p = 0.031) in overweight subjects and 4.37 (95% ci: 1.1516.5, p = 0.030) in normal weight subjects, respectively, compared with the nonexposed cohort . Similar analyses were performed in subjects exposed to less severely affected famine areas during fetal life and childhood (fig . 2, right column, graphs b1, b2, and b3), but did not show consistent associations . When we defined the severely affected famine areas as those with an excess death rate 100%, the prevalence of hyperglycemia among the fetal - exposed cohort in severely affected famine areas increased to 8.1%, but this did not change the associations between fetal exposure to famine and risk of hyperglycemia in adulthood . In addition, neither using subjects who were born between october 1, 1962, and september 30, 1968, as a nonexposed cohort nor excluding subjects with a family history of diabetes materially changed the associations (table 3). Prevalence rate of hyperglycemia by birth cohorts and severity of famine areas: sensitivity analyses all odds ratios used the nonexposed cohort as the reference cohort . Adjusted factors include sex, educational level, family history of diabetes, and current smoking, alcohol use, and physical activity level in 2002 . In this study of a large sample of chinese adults, we found a significant association between severe famine exposure during the fetal period and an increased risk of hyperglycemia in adulthood . This association was stronger in subjects with a western dietary pattern or higher economic status in adulthood . Several mechanisms might explain the associations between fetal famine exposure and risk of diabetes in later life . Exposure to extreme starvation in rats led to poor development of pancreatic -cell mass and function and insulin resistance, which might persist in later life (18). A poor intrauterine environment may also reduce skeletal muscle development (19), which may subsequently lead to insulin resistance in peripheral tissues (20). It has also been suggested that stress suffering from fetal famine exposure could change the setpoint of the hypothalamic - pituitary - adrenal (hpa) axis, which could result in long - term changes in secretion of neuroendocrine mediators of the stress response, and predispose to cardiovascular and metabolic disease in later life (21,22). To our knowledge, thus far three studies have assessed the associations of exposure to famine with measures of glucose intolerance . These studies were performed in the netherlands (the dutch famine study) (4,5), russia (the leningrad siege study) (6), and china (our chinese famine study). The dutch famine study reported higher 2-h glucose and insulin levels among subjects who were exposed to famine during fetal life (4,5), but this association was not observed in the leningrad siege study (6).the inconsistent results might be due to differences in postnatal environmental life exposures . Although the dutch population rapidly developed into a wealthy and rich population after the famine, the leningrad people remained relatively poor . In our study, we observed that fetal exposure to the severe chinese famine increases the risk of hyperglycemia in adulthood, which was exacerbated by an unhealthy adult diet and higher economic status . Our results support the hypothesis that exposure to a nutritionally rich environment modifies the association between fetal famine exposure and disease in later life (1,20,23). The association between fetal famine exposure and hyperglycemia was stronger in participants with an affluent / western dietary pattern . These subjects were, to a large extent, less poor and more highly educated (15), and they have benefited most from dramatically enhanced economic opportunities and have broken away from traditional chinese food patterns (15). Their diet is characterized by a high intake of meat, eggs, dairy, sugary beverages, edible oils, and a low vegetable use (15). Apparently, this nutrition rich environment did not match the fetal starvation environment that people of fetal exposed cohort experienced, which in turn increased the risk of hyperglycemia in later life (1,20,23). Our study used annual mean income as the cutoff to categorize economic status (2,000 chinese yuan / person / year). Subjects in the lower economic group might consume mostly traditional plant foods with little meat . Therefore, the discrepancy between the nutritional environment in adulthood and fetal undernutrition conditions may be less evident for those with a higher economic status . In other words, there was probably greater mismatch between in utero and adulthood environments in the higher economic group, which triggered an increased prevalence of hyperglycemia in the fetal - exposed cohort . Similar results were described in the dutch famine study (4), showing that 2-h glucose concentrations were especially high among people exposed to the famine during fetal life and who became obese in later life . However, the relative risk of hyperglycemia in overweight subjects was not different from that in normal weight subjects . This may be partly due to the increased prevalence of hyperglycemia in the nonexposed cohort in overweight subset . These results therefore indicate that both improving fetal nutritional environmental and controlling bmi in later life are important for prevention of a disturbed glucose metabolism . Childhood nutritional status, particularly during infancy, is another key factor in influencing the propensity to develop disease in adulthood (23). Animal studies have shown that postnatal caloric restriction might hamper -cell development (24) and might disturb glucose metabolism in later life in rats (25). Our study found significantly increased fpg in the early childhood exposed cohort in the severely affected famine areas, but no significant differences in fpg in the less severely affected famine areas . We also observed a higher risk of hyperglycemia among subjects exposed in late childhood in both severely and less severely affected famine areas . These results suggest that famine exposure during childhood may increase the risk of hyperglycemia in later life . However, we cannot exclude a potential cohort effect, such as aging (26). Similar risks of hyperglycemia among subjects exposed during childhood in both famine - exposed areas and nonfamine - exposed areas suggest rather a cohort (older age) effect than a famine effect . However, since almost all rural regions in china were affected by the famine during 19591961, no valid nonfamine - exposed cohort comprising subjects born in the same time period was available . Thus, the association between childhood exposure to famine and risk of hyperglycemia needs to be studied in more detail . First, we assumed that the residents we investigated at the time of the survey were born in the same province and in a similar rural area . However, severe restrictions on migration and relocation in china made our sample quite stable . Migration with permanent resident permission still needed to be approved by authorities on a case - by - case basis in china . According to the 2000 china national population census, 2.68% of the rural population lived in provinces other than the provinces of their birthplaces (27). Our study sample was based on the residence registration system; only subjects with permanent resident permission in local areas were involved in our study . Therefore, we do not expect that intraprovince migration leading to measurement error in the coding of birth place is a major concern in our results (12). Second, subjects in our fetal - exposed cohort may have actually experienced severe famine during both the fetal period and the infancy period because the famine lasted approximately 3 years . It was therefore difficult to distinguish whether the fetal period or the infancy period was more important . However, the early childhood cohort also included subjects exposed to famine in infancy, which did not have a substantial influence on the risk of hyperglycemia . Thus, our results indicate that the fetal period should be considered as the primary critical period . Third, our subjects who experienced severe famine in the fetal period were in their early 40s in 2002, and the cases of type 2 diabetes were few . The small numbers may partly explain why we did not observed significant associations with the risk of type 2 diabetes . We used the excess death rate as an indirect measure of famine exposure . With this method, we could not distinguish death due to famine from death due to unfavorable weather conditions or infections . We also did not have reliable information about individual food availability during the famine period . Therefore, from our data, we cannot conclude that the higher risk of hyperglycemia among subjects exposed to famine is exclusively due to malnutrition in early life . However, nutrition deficiency was highly prevalent during the chinese famine . China's grain output declined by 15% in 1959 and in the following 2 years, and its food supply plunged further to 70% of its 1958 level (8). As almost all foods were delivered through communal kitchens at that time, no social groups were spared from the effects of the famine (9). However, since the famine effect on glucose intolerance did not depend on birth size in the dutch famine study (4), we do not consider the lack of information about individual birth outcomes as a major limitation . In conclusion, we found that exposure to severe famine in fetal life increased the risk of hyperglycemia in adulthood . The mismatched nutrition postnatal environment represented by a western dietary pattern and improved economic status further increased susceptibility to hyperglycemia in those who experienced fetal exposure to famine . Together with previous studies, our study emphasizes that early life environment is critical for the risk of hyperglycemia in adult life.
|
With the goal of discovering the genes that contribute to the risk of common diseases, numerous susceptibility loci have been identified using linkage analysis . Despite replication of many of these linkages in a second sample, some exceptions include tbc1d1, identified as the gene responsible for the obesity linkage on chromosome 4p15 - 14, and hoxb13, identified as the gene responsible for the prostate cancer linkage on chromosome 17q21 - 22 . However, for many other common disease linkage signals, the underlying causal genes and variants await discovery . The expectation that a single gene accounts for a linkage peak may contribute to the difficulty in identifying causal genes . On the contrary attributed a triglyceride linkage on chromosome 7q36 to variants in five genes and christians et al . Found that fine - mapping caused a single quantitative trait locus (qtl) for body size in mice to resolve first into three qtls, then one of those to split into two . Furthermore, the clustering of causal genes may have stymied the multi - group effort to identify type 2 diabetes (t2d) genes on chromosome1q; two strong associations present in populations of european ancestry failed replication and confirmation in other ethnic groups . These examples suggest that abandoned linkage findings might yet reveal susceptibility genes if reappraised while considering the possibility of multiple causal genes . As for other common diseases, the challenge is even greater in african american (aa) populations where both prevalence and genetic diversity are higher, and pathophysiology may differ . Genome wide case - control association studies (gwass) have identified single nucleotide polymorphisms (snps) with small effects on t2d risk, but few of the associated snps, identified primarily in european ancestry populations, are replicated in aas and few snps have been identified in aa populations . In general, the widespread rejection of family studies in favor of gwass has failed to produce the promised prognostic and diagnostic variants for t2d . As a resource for the discovery of genes related to t2d and its complications, the american diabetes association established the genetics of niddm (gennid) study . From 1993 to 2003 we have used this resource to increase understanding of the genetics of t2d by applying linkage and family - based association analysis to the african american (aa) subset of the gennid sample . Genome - wide linkage analysis using genotypes on 5,914 snps identified chromosomal regions that potentially harbor risk genes for t2d and age of t2d diagnosis (aod). The strongest signal for t2d occurred on chromosome 2 at 95121 megabases (mb), with weaker support for aod in the same region and for t2d at 6895 mb . Both t2d and aod also showed linkage on chromosome 13 at 1930 mb, but linkage was limited to t2d on chromosome 7 at 5079 mb and to aod on chromosome 18 at 3165 mb . Other analyses inferred pleiotropy with triglyceride in the chromosome 2p region and pleiotropy with obesity in the chromosome 13 region . Herein we present linkage and association analyses on the aa subset of the gennid sample using genotypes on 9,203 fine - mapping snps added to the genome scan snps used previously . Our first goal was to more precisely localize the t2d susceptibility genes in each of the five chromosomal regions identified in the genome scan (chromosome 2 at 6895 and 95121 mb, chromosome 7 at 5079 mb, chromosome 13 at 1930 mb, and chromosome 18 at 3165 mb). Our second goal was to test for association of the gene - based fine - mapping snps with t2d and aod in order to identify genes related to t2d in aas . The gennid study ascertained families through sibling pairs each with a t2d diagnosis . During phase 1, extended family members were also studied; one site ascertained aas . During phase 2, data collection beyond the sibling pair was limited to parents, or, if parents were unavailable, unaffected siblings; five sites ascertained aas . During phase 3, only affected sibling pairs and trios were studied; 5 additional sites ascertained aas . In total, 1,496 aa members of 580 pedigrees were studied at 10 sites . Data cleaning and re - evaluation of t2d diagnoses by current criteria reduced the analysis sample to 1,344 members of 524 pedigrees; for this study, we selected an informative subset of 1,077 members of 415 pedigrees . T2d diagnoses, originally following national diabetes data group criteria, were re - evaluated using current criteria prior to all analyses; 84 affected and 13 unaffected sample members were re - assigned as unknown . Body mass index (bmi) was computed from height and weight obtained from physical examination . We selected a subset of the sample for fine - mapping by excluding unaffected individuals below age 53, the age by which onset had occurred in 75% of cases, and then any individual, either affected or unaffected, who consequently had no family members in the sample . This sample subset maintained significant lod scores in each of the linkage regions and produced power over 80% to detect association . Power to produce a p - value of 0.00001 was estimated from simulation of 1000 replicates of a snp with minor allele frequency 0.4 and heterozygous effect a 10% increase in penetrance at age 50 for t2d or 3 year increase in aod . For fine - map genotyping, we used snagger (http://snagger.sourceforge.net/) to select tagsnps within genes in the linkage regions on chromosomes 2, 7, 13, and 18 . Using hapmap phase 1 and 2 (http://hapmap.ncbi.nlm.nih.gov), variants in the region were tagged at linkage disequilibrium (ld) r 0.7 . Each snp selected had minor allele frequency> 0.1 and illumina design score> 0.4; snp pairs had minimum spacing of 60 base pairs (bp). The genetic map locations of the snps in centimorgans (cm) were obtained from the rutgers combined linkage - physical map of the human genome (http://compgen.rutgers.edu/maps); locations of snps not mapped directly were estimated using physical positions from ncbi dbsnp build 123 in a smoothing calculation (conway institute bioinformatics service; http://integrin.ucd.ie). Genotyping errors were identified using pedcheck and merlin; we zeroed 4978 genotypes of 710 snps, 74 identified by pedcheck and 4904 by merlin . Genotypes for 24 snps, available on less than 95% of the sample following data cleaning, were retained after confirmation of minimal effects on the results . Multi - point identity by descent (ibd) probabilities were computed at each cm using merlin, treating as haplotypes snp sets with pairwise ld r> 0.7 . We identified 279, 175, 133, and 259 snp sets on chromosomes 2, 7, 13, and 18, respectively . Likelihood analysis, as implemented in jpap, was used for univariate linkage analysis of unadjusted t2d (ut2d), t2d adjusted for bmi (bt2d), and aod and for bivariate association analysis of ut2d and aod . Aod was adjusted for gender and modeled as a normal density with mean, standard deviation, and gender effect as parameters . T2d risk was modeled to account for aod in affected pedigree members, while allowing for censored observations with age, gender, and bmi (for bt2d only) effects and penetrance as parameters . For each trait, additional parameters included heritability, a quantitative trait locus (qtl) effect in linkage analysis, and an additive snp effect in association analysis . We applied variance components linkage analysis using the univariate model for each trait in conjunction with the ibd probabilities . At each cm across the 5 regions, all parameters were estimated for aod while only heritability and qtl effect were estimated for ut2d and bt2d with all other parameters for those traits fixed at estimates obtained upon maximizing the likelihood while correcting the likelihood for the ascertainment of each pedigree through an affected sib pair . The lod score at each cm was computed as the common logarithm of the ratio of the maximized likelihoods with the qtl effect estimated to the maximized likelihood with the qtl effect set to zero . We assessed each fine - mapping snp for association with ut2d and aod by coding the snp genotype as an additive covariate and testing its effect on both traits in a bivariate model . P values were determined using a 2 degree of freedom statistic computed as twice the natural logarithm of the ratio of the maximized likelihood with covariate effects estimated for both t2d and aod to the maximized likelihood with both effects set equal to zero . We controlled for multiple testing separately within each of the 5 linkage regions by specifying a false discovery rate of 0.05 accounting for 1291, 1780, 1819, 1336, and 2977 fine - mapping snps for chromosomes 2p, 2q, 7, 13, and 18, respectively . We tested for an independent effect of each secondary associated snp, conditional on the snp within the same gene that attained the highest significance, by comparing the maximized likelihood estimating t2d and aod covariate effects for both snps simultaneously to the maximized likelihood estimating t2d and aod covariate effects for the most significant snp alone . P <0.05 after bonferroni correction for the number of secondary snps in the gene supported the independence of the secondary snp . We genotyped 9,203 snps within five regions encompassing a total of 133 cm and 128 mb (table 1) and merged them with 244 (36 duplicates) genome scan snps . Spacing between snps averaged 0.0145 cm (13,910 bp) and ranged from 0.0 to 5.3 cm and from 26 bp to 6 mb . To comply with the sample size limitations of the cidr genotyping platform, we selected a subset of the original linkage sample to be informative for both linkage and association . The genotyped subset included 1077 members of 415 pedigrees that ranged from 2 to 11 members (1 to 8 were genotyped). In this subset, aod and bmi differed little from the complete sample, but the unaffected sample members, selected for a minimum age of 53 years, were older (table 2). We previously identified 5 linkage peaks within four chromosomal regions from autosomal scans of t2d and aod; the chromosome 2 region contained 2 peaks separated by 30 mb and the centromere . Using updated genetic map positions for the genome scan snps, we repeated the linkage analyses on the smaller sample: the genome scan lod scores for all 5 peaks (table 3) generally agreed with our published lod scores for bt2d and aod and for ut2d . Upon adding the fine - mapping snps, linkage evidence remained in all 5 regions, but strengthened only on chromosome 2 (table 3). On chromosome 18, only aod supported linkage, although ut2d provided weak support (lod = 2.62) upon elimination of sample members with bmi> 45 . The most remarkable effect of fine - mapping was the splitting of the lod score curves into multiple peaks in all of the regions except on chromosome 18 . Additional evidence that multiple susceptibility genes contribute to the linkage signals derived from the identification of associated snps that reside in multiple genes within each of the 5 regions, including on chromosome 18 (table 4). The number of associated snps ranged from 4 on chromosome 13 to 17 on chromosome 2q; the number of associated genes ranged from 2 on chromosome 13 to 9 on chromosome 7 . Although 20 of the 27 associated genes were identified through a single snp, 5 genes were identified through 2 or 3 snps and arhgap25 and dpp10 were identified by 8 and 10, respectively . However, six associated snp pairs exceeded ld r 0.7: arhgap25 (rs6714065 and rs7605681), ctnna2 (rs968820 and rs1368915), dpp10 (rs843417 and rs1823267, rs10204212 and rs13432035, rs4848376 and rs11694256), and hip1 (rs1179625 and rs1179622). Nevertheless, conditional association analysis supported the independence of two or more snps in arhgap25, polr1b, dpp10, and mtus2 (supplementary table s1). The fine - mapping of five chromosomal regions allowed us not only to confirm our genome scan linkages, but also to infer the presence of multiple t2d susceptibility genes in each of the regions . Two types of evidence supported the presence of multiple susceptibility genes underlying the linkage peaks . First, except chromosome 18, each lod score peak split into at least two peaks when fine - mapping snps were added to the linkage analysis . Second, in every region including chromosome 18, two or more potential susceptibility genes were identified through the association with t2d and aod of fine - mapping snps residing in those genes . In fact, martin et al . Attributed many failures to identify causal variants to the incorrect assumption that a single or a limited number of variants are responsible for a linkage signal . As evidence, they identified variants in five genes that fully accounted for a linkage peak for plasma triglyceride level . If small effects are typical of common disease susceptibility genes, their detection through linkage analysis may be limited to locations where the genes cluster . However, fine - mapping using next generation sequencing may provide sufficient power necessary to detect even isolated genes . Although chromosome 18 failed to show t2d linkage and chromosome 7 failed to show aod linkage, we nevertheless expect that the susceptibility genes residing in all regions both increase t2d risk and decrease aod . Variation between regions in the information available undoubtedly affects the relative strength of the corresponding lod scores for t2d or aod . As evidence, the elimination of t2d cases with bmi> 45 kg / m revealed a weak t2d linkage on chromosome 18 and fine - mapping revealed aod linkages on chromosomes 2p and 2q . The lod scores are generally lower for aod than for t2d as expected since aod reflects onset age imprecisely and the familial correlation of aod may partially result from temporal clustering of t2d diagnoses among relatives . Nevertheless, aod proved sufficiently accurate to produce linkage evidence in 4 of the chromosomal regions . Few of the associated genes have previously been reported to associate with t2d or related traits . The exceptions include grb10 with t2d, nedd4l with diabetic nephropathy, and lipg with lipid metabolism . Novel candidates reported herein include a cytokine (il36b) and genes involved in lipid metabolism (acoxl) and cell - cell and cell - matrix adhesions (magi2, cldn4, ctnna2). Interestingly, the candidates also included genes involved in williams - beuren syndrome (wbscr28, wbscr17, cldn4), whose sufferers have a high prevalence of diabetes and pre - diabetes . Dpp10 is related to dpp4, whose inhibitors are oral anti - hyperglycemics used in t2d therapy, and dpp6, which contributes to a triglyceride linkage, however, unlike dpp4, ddp10 lacks serine protease / dipeptidyl peptidase activity . Support for the functionality of these genes derived from evidence that their expression levels are affected by our associated snps or proxies with high ld . We tested 14 snps in the 5 genes for which expression levels from transformed lymphocytes were measured on a subset of 160 sample members; nominal significance was obtained for one: p = 0.0148 for an effect of rs7579103 on arhgap2 expression levels . In other populations and various tissues, expression levels of arhgap2, aff3, polr1b, hip1, lipg, and nedd4l showed evidence of an effect of an associated snp or its proxy (p<1105). For further insight into the nature of the associations, we haplotyped sets of 1530 fine - mapping snps, each encompassing two or more of the associated snps reported in table 4 . For arhgap25, two haplotypes associated with t2d: the first extended across 4 of the associated snps and contained the risk alleles for all 4; the second extended across 6 associated snps and contained the risk alleles for all 6, but differed from the first haplotype for alleles at other snps . We propose that each haplotype harbors a distinct causal variant, despite sharing associations with the same risk alleles, demonstrating the complexity of disease associations . The advantages include the opportunity to exploit information on local ancestry to localize disease susceptibility genes . As with any such analysis, confirmation of these findings awaits replication in another sample . In summary, linkage and association analysis using genotypes on an additional 9,203 fine - mapping snps added to five chromosomal regions confirmed each linkage and identified potential susceptibility genes in each of the regions.
|
The circadian system organizes the different biological functions in 24 h, such as sleep / activity, temperature, heart rate, glucose level, cortisol production, and oxidative stress . In mammals, this system is organized by a central clock localized in the suprachiasmatic nucleus of the hypothalamus (scn) and in a series of peripheral oscillators such as the liver, lung, adrenal gland, fibroblast cells, and others tissues [2, 4]. The peripheral oscillators are synchronized every day via nervous or humoral signals, and the most important humoral signal is the melatonin hormone, secreted by the pineal gland during the dark hours, and its impairment is associated with different disorders such as insomnia, cardiovascular disease, and cancer . The molecular clock is organized by transcriptional / translational feedback loop of clock genes named clock, bmal1, per13, and cry1 - 2 . At the molecular level, the complex clock - bmal1 stimulates the expression of negative regulators per13 and cry1 - 2, and their protein inhibits the effect of the heterodimer clock / bmal1 [6, 7]. Moreover, the molecular clock has different modulators which give fine tuning of output signals such as rev - erb, a negative regulator of bmal-1 expression [79], sirt1, a regulator of clock - mediated acetylase activity [10, 11], and pgc1, a stimulator of bmal1 expression [12, 13] (see figure 1). This system provides an output signal to genes such as hexokinase, dbp [1517], vegf, steroidogenic enzymes star, 3-hsd, and wee-1, giving a circadian oscillation of physiological functions such as metabolism, angiogenesis, cortisol production [2, 19], and cellular proliferation . The molecular clock can be modified by environmental changes and our modern lifestyle, resulting in physiological alteration and risk of pathologies; for example, during the monkey's pregnancy, the light exposition during night hours induces a lower body temperature and absence of circadian rhythm of temperature in the newborn . In humans, different reports showed that the alterations of the circadian system increased the risks of cancer [2123], preeclampsia, diabetes [3, 25], and mood disorder . Curiously, a large quantity of polymorphisms has been detected in clock genes, which can be influencing the development of diseases through different physiological systems . This review will primarily focus on the hypothesis which states that the variation of genetic components of the circadian system, similar to environmental changes, can affect several physiological systems and produce an elevation of the risk of developing a disease . In recent years, there has been a significant increase in available information from polymorphic variations and epigenetic modification over clock genes and their risk of diseases . The report of health from the united states (2014) showed about 10% of population have a poor health associated with pathologies such as obesity (35.5%), hypercholesterolemia (30%), diabetes (32%), and cancer (6.4%). Curiously, despite its low frequency in population, cancer is the second cause of death in the united states . The above pathologies add the infertility, which affects about 10.9% of women in the united states and 17% of women in other developed countries . During short - stay in the hospital, mood disorder and psychosis are the principal causer of hospital stay during 2014 and represent the third cause of morbidity worldwide . This present research reports the last single nucleotide polymorphism (snp) associated with an elevated risk of developing principal pathologies worldwide such as mood disorder, infertility, cancer, metabolism and diabetes and addictions, and a description of usefulness for a more detailed study in other pathologies . In mammals, the circadian system is a supraphysiological system that regulates biological functions every 24 h such as glucose homeostasis, temperature, blood pressure, tone in the coronary artery, and heart rate . The bmal1/clock complex target genes are related to the circadian expression of metabolic pathways as was observed by hatanaka et al . Through high resolution the author detected a circadian expression of (i) glucose metabolism - related genes such as glut2, por, pck1, and gys2 and (ii) cholesterol metabolism - related genes such as cyp2a4, cyp2a5, cyp4a14, cyp7a1, and cyp2c55; and considering the very important role these systems have in metabolism, any alteration of them can have negative health effects . Today there are several metabolic problems affecting the population, such as obesity, hyperglycemia, dyslipidemia, and hypertension . The cooccurrence of three or more metabolic disorders, including obesity, is defined as metabolic syndrome, showing a prevalence in the united states during 2009 - 2010 of about 22% of adults (21.4626.15). The insulin resistance or type 2 diabetes is one of the most important metabolic diseases currently affecting about 366 million people, causing more than 3.8 million deaths, and showing a rise in the number of affected people as observed in the united states population during 19992010 . Several factors could be increasing the risk of death by diabetes, such as dyslipidemia, hypertension, and obesity, all of which are driving to an elevated risk of cardiovascular disease . A variant of this pathology can also develop during the pregnancy (gestational diabetes mellitus) and is characterized by glucose intolerance in the mother and adverse consequences for her offspring, such as an increase in blood pressure, body mass index (bmi), and body fat and a decrease in hdl levels . At the molecular level, both diseases have in common the impairment of signal transduction of insulin receptors such as pi3kinase / akt and ras / map kinases [42, 45, 46], leading to metabolic dysregulations such as inhibitions of glycogen synthesis, impaired translocation of glut4 to plasmatic membrane, or antilipolytic effects of insulin in white adipose tissue [39, 46]. Meta - analyses from 448 articles reporting shift work and health consequence have detected a strong relationship between shift work, a potent chronodisruptor, and diabetes mellitus type 2 (odd ratio about 1.42 times higher than day workers). However, this is not the only chronodisruption which we are exposed too . In animal models exposed to light / dark patterns similar to shift work, the length of the working day and changes of feeding times induce a modification of the liver weight and plasmatic glucose and a modification of the circadian profile for glucose, insulin, and triglyceride . These findings add to the observation in the circadian disruption in mutant animals, showing alterations of cholesterol metabolism, abolition of the circadian production of glycerol, free fatty acids, and impaired expression of rate - limiting lipolytic enzymes such as lipase, all of which add to increased weight gain, adipocyte hypertrophy, high level of glucose, glucose intolerance, and hypersecretion of insulin [4952]. Polymorphic variations of clock genes can be incrementing the risks of developing a disease similar to chronodisruption by environmental changes as it has been detected in human metabolic disorders (see table 1). For example, the genotyping of clock genes in 346 greek pregnant women and their risk of diabetes was performed, detecting that the polymorphisms of bmal1 rs7950226 and rs11022775 are associated with gestational diabetes mellitus (p = 0.025, or = 1.46 and p = 4.455e 06, or = 2.64, resp . ), while the study of the haplotype analysis of rs7950226/rs11022775 showed a major frequency in women with gestational diabetes mellitus (p = 0.0069, or = 6.96). Similarly, a study performed in subjects from the united kingdom and pakistan reported that cry1 and cry2 polymorphisms rs2292912 and rs12315175, respectively, are associated with diabetes (p = 0.015 and 0.008, resp . ). Moreover, the variant rs12315175 for cry2 has a tendency to elevate the risk at about 5% compared to the variation of cry1 (or = 1.05 and 0.95, resp . ). Also, the authors did not find associations between diabetes and bmal1 polymorphisms rs7950226 and rs11022775, as occurs in gestational diabetes mellitus . Genotyping of 19,000 adults from northern sweden for variants rs8192440 for cry1 and rs11605924 for cry2 is associated with higher level of glucose concentrations at 2 hours (p = 0.06 and p = 0.005, resp . ). Another study genotyping 1304 individuals from 424 british families, containing at least one patient with diabetes type 2 (diabetes in families study collection), demonstrates the relation between bmal1 polymorphisms rs7950226 and rs11022775 and diabetes (p = 0.002), reinforcing what was previously described . Similar relations are observed for bmal2 polymorphism rs7958822 in obese men and women (or 2.2 and 2.7, resp .) And the deletion / insertion of 54 base pair sequences of five repeat alleles on per3 gene (rs57875989) [57, 58]. In contrast, the per2 polymorphism rs7602358 is associated with a protection from type 2 diabetes in the uk population, which suggests that not all polymorphisms are negative for health . At the level of dyslipidemia, an interesting correlation has been detected between small dense ldl level and polymorphism of clock genes . In individuals carrying the polymorphism associated with the clock gene (rs1801260), the genotype tt or tc showed a major level of small dense ldl, which leads to increased triglycerides and increased risk of cardiovascular and obesity diseases, similar to the metabolic syndrome . Likewise, genotyping in the japanese population identified clock gene polymorphism rs1801260 associated with higher odds ratio (or; 1.5) of type 2 diabetes; in contrast, a multicenter study detected the clock polymorphism rs4580704 is associated with prevention of diabetes and cardiovascular disease . The haplotypes of rs10002541 and rs4864546 from clock (cg and tg variations) are associated with abdominal obesity in chinese population (or 0.74 and 1.70, resp .) And polymorphism rs4864546 is associated with low level of hdl / apolipoprotein a1 ratio in spain . Moreover, clock polymorphisms rs12649507 and rs3749474 are associated with higher intake of polyunsaturated fatty acid and fat intake, which can modify the body mass index (bmi). This is an antecedent which, bearing in mind the ideas above, suggests the genetic components of the circadian system as a critical factor in the development of metabolic diseases . In humans, infertility affects about 9% of couples, and about one - third of infertility cases associated with idiopathic male infertility are multifactorial, with 50% due to genetic abnormalities . The circadian system is important during reproduction and development [89, 90]; for example, it is involved in the timing of the lh surge [90, 91], stimulation of ovulation [90, 92], and regulating the level of steroidogenic acute regulatory protein (star) expression and is critical for cholesterol translocation inside mitochondria and sperm count . The genetic factors of clock genes are implicated in the pathogenesis of infertility (see table 2), as it occurs in male partners of infertile couples . The genotyping of male partners detected a correlation between single nucleotide polymorphism of clock rs11932595, rs6811520, and 6850524, with infertility (p <0.05 and or ranged between 1.4 and 1.9). Similarly, the analysis of bmal1 polymorphism rs4757144 in slovenian and serbian caucasian men showed a significant correlation with infertility (p = 0.047), suggesting that clock genes clock and bmal1 contribute to successful fertilization . Mood or affective disorders are important causes of morbidity, where we can highlight depressive pathologies and hypomaniac and maniac disorders as major diseases affecting the population [29, 66], and it can be highlighted that depressive pathologies are the third largest source of morbidity in the world . Curiously, a potent correlation has been detected between mood disorders, sleep / activity, and the circadian system suggesting that the circadian system can be modulating the neuronal activity . During pregnancy, the prevalence of mental illnesses in women is about 8%, suggesting an imbalance between physiology of sleep and/or the circadian system . This can be observed in the onset of a mental disease as has been observed in the impaired circadian production of melatonin during the pregnancy of depressed women (approximately 34 weeks of gestation), which shows an advance onset time of melatonin production of about 40 minutes and a minor production during the dark hours [97, 98]. Moreover, workers who do shift work (circadian disruption) showed decreased alertness, cognitive functions, mood, social and work activities, and health [26, 99], which are associated with an impaired circadian system via melatonin suppression, all of which leads to the appearance of a mood disorder . For this reason, we can say that the circadian system may contribute to the risk of developing a mood disorder and the genetic component of clock genes can be involved in the development of mood pathologies (see table 2). At the genetic component level of the circadian system, a study of 744 people who carry polymorphisms rs2291739 and rs11171856 from tim, a member of the clock gene family which interacts with per1 - 2 proteins [100, 101], showed that they have an elevated risk of developing mood disorders ranging between 19 and 23% (or 1.19 and 1.23, resp . ). Moreover, gene variants of positive regulator clock have also been associated with mood disorders . People who carry the variants rs1801260 and rs11932595 showed a major risk of developing a bipolar disorder ranging between 45 and 37%, respectively, in comparison to a patients without polymorphism (or 1.45 and 1.37, resp . ). In the same study, it was also observed that the polymorphisms rs2291739 and rs11171856 from tim gene are associated with unipolar disease, with a risk ranging between 37 and 40% in comparison to a patient without polymorphism (or 1.37 and 1.40, resp . ). / rs11022779g / rs1122780 t (haplotype) are associated with mood disorders and bipolar disease [29, 66]. It has also been seen that the bipolar pathologies are associated with other genetic variations of bmal1 gene (rs4757144, rs1982350, and rs1481892) and the negative regulator per3 (rs2859387). Curiously, a study performed an indian families reported the bmal1 polymorphisms rs2279287 are associated with seasonal affective disorder . In addition, the gene variant of cry2 gene (rs4132063) and deletion / insertion of 54 base pair sequences on per3 gene (rs57875989) may also be contributing to mood disorders via increased risk of developing bipolar disease . For example, a study in south india showed the prevalence of five repeat homozygotes from rs57875989 is associated with bipolar disease (or 1.72) but not with schizophrenia . At the level of depressive pathologies, a study performed in china compared 485 subjects (control) to 105 patients suffering from a depression disorder . The genotyping for clock genes showed that the variants of cry1 (rs2287161) and cry2 (rs10838524) are correlated to the depression disease with an odds ratio of 1.75 (p = 0.012), which suggests that a patient with the allele has 1.75 times more risk of developing depression . Moreover the authors detected a single nucleotide polymorphism for tef gene, the variant rs738499, is associated with 2.22 times more risk of development of depression (odds ratio of 2.22 . Finally, in a study performed in young adults, the risk of excessive intake of alcohol is minor when the polymorphism of per2 gene rs56013859 is present, suggesting a possible protector role for allelic variation of clock genes in addictions . In fact, this suggests that some polymorphisms are not negative for our health and it is necessary to study them in greater depth . Cellular proliferation is a critical event for the survival and restitution of tissues of all living things and the circadian system is capable of delivering temporary information to the cell cycle [102104]. However, an uncontrolled cellular proliferation and an excessive tissue growth are observed by an altered cellular cycle during cancer, a pathology that showed a higher incidence in patients exposed to an impaired circadian system such as a shiftwork [106, 107]. The cell cycle is a finely regulated process from a cell that is capable of generating multiple cells through a series of cell divisions, including four critical and successive steps named g1 phase (growth phase 1), s phase (synthesis), g2 (growth phase 2), and m phase (mitosis). During the cell cycle, cyclin - dependent kinases (cdk) are critical for the transition between different stages, for example, cdc2 plus cyclin b protein kinase form the complex cdk1 which regulates g2/m transition [108, 109]. During dna replication, there are a number of controls or checkpoints that are critical in the cell cycle when dna damage is detected: the activation of the rad protein, which induces the action of cds 1 proteins, is triggered, as well as chk1 which are involved in cell cycle arrest via action of wee-1 and mik-1 proteins . However, the efficiency of this process changes depending on the time of the day when the lesion occurred . A lesion in the liver, occurring during the last light hours, induced a massive entry to m phase compared to a lesion which occurs early in the morning, which shows that the hour of surgery and the circadian system are critical for liver regeneration . Similarly, oral mucosa is a highly proliferative tissue and it showed a circadian expression of clock genes bmal1, per1, and cry1 and thymidylate synthase activity, critical for dna synthesis during phase s. curiously, the peak of per1 mrna precedes the peak of thymidylate synthase activity, which suggests that the circadian system modulates the cellular proliferation in mucosa . Wee-1 gene regulates cellular proliferation, and its promoter has three conserved sequence cacgtg (e - box) critical for the circadian expression of wee-1 . Its protein is capable of inactivating the cdc2-cyclin b complex via phosphorylation which inhibits transition between g2/m . Curiously, knock - down of bmal1 in carcinoma cells of the colon (c26 cells), fibroblast cells (l929 cell), and intestine epithelial cells (iecs) produces cellular proliferation in vitro and increments the size of tumor cells injected subcutaneously, via the inhibition of apoptosis and the reduction of the time transition between g2/m, reduction of p53 and wee-1 expression . Moreover, the knock - out for clock genes bmal1 y per2 in mice previously exposed to gamma radiation caused in mice hyperplasic growth and development of lymphoma, hepatic carcinomas, ovary tumors, and osteosarcomas via reduction of p53 expression . A precedent that reinforces the idea that clock genes can be modulators of cellular cycle via wee-1 and p53 proteins . At the genetic component level, different studies reveal the importance of the polymorphic variant of clock genes (see table 3) and how the chrono - type modulates the risk of cancer, such as observed in breast cancer, in which the risk is more elevated in premenopausal women (or, 2.43 and 2.55; resp . ). Similarly, women showed evening or night preference such as shown in the case of a study performed on norwegian nurses working in night shift which revealed two polymorphisms associated with breast cancer . The risk is incremented when women spend more time working during night hours, but this risk is higher when women have the alleles for bmal1 rs2290035 (or 1.91), rs969485 (or 1.64), and rs3903529 (or 2.77) or variant rs3750420 (or 1.6) of roreb gene . Similarly, an incremented risk is associated with breast cancer in women from france when they have the allele rs11932595 in clock gene (or = 0.74) or in connecticut (usa) when they have the polymorphisms rs7698022 (or 1.34) and rs1048004 (or, 1.43). Curiously, when norwegian nurses are exposed to shift work during four nights, they showed three times more risk (or 2.75) of developing breast cancer when they were carrying clock polymorphism rs11133373, which suggests that the disruption of endogenous circadian rhythm by polymorphism associated with clock genes increases the risk of cancer . Moreover, clock gene expression is induced in breast tissue from patients with breast cancer; this expression is associated with hypomethylation of clock gene . The silencing of clock gene lowered when women carry polymorphisms associated with cancer such as rs10448004 and rs7698022, which suggests that clock gene is a critical protagonist of cancer development . At level of colorectal cancer, a strong correlation is detected between cancer and the genetic component of the circadian system . For example, a polymorphism in the clock gene (rs1801260) showed a major prevalence in a cancer patient (p <0.0001, or = 1.78 for c - allele) compared to a control patient . Similarly, a screening performed in south carolina, usa, showed that a variation by deletion / insertion of a 54 base pair sequence on per3 gene (rs57875989) is associated with a higher risk of colorectal adenoma formation with odds ratio within 2.15.1 . Moreover, a population study performed on the residents of king county, washington (usa), detected six different types of polymorphism, which are significantly associated with the risk and aggressiveness of prostate cancer . These genetics variants are rs1012477 for per3 (or 1.3), rs7602358 for per2 (or 1.24), and rs2289591 in per1 (or 1.7). Similarly, a genotyping of a patient with prostate cancer showed a strong correlation between cry1 polymorphisms rs7297614, rs1921126, and rs12315175 and fatal prostate cancer (or mean within 1.52) and a study conducted in china showed that the cry2 variant rs1401417 and the deletion / insertion of 54 base pair sequences on per3 gene (rs57875989) were associated with a major risk of developing prostate cancer (or; 1.7 and 1.3, resp . ). A study performed in brazilian patients with pulmonary cancer showed a strong correlation of per3 polymorphism rs228644 and the risk of cancer (or 1.99). Moreover, the authors reported the ancestral haplotypes for per3 rs228729, rs228727, rs707467, rs228644, and rs10462020 are associated with a higher cancer frequency; similarly, a meta - analysis performed by literature search showed that the variant insertion / deletion of per3 rs57875989 is associated with an increase of cancer susceptibility in about 17% or 70% . In a similar way, a soft risk is associated with breast cancer in premenopausal women from india, which suggests there is a relation between per3 and cellular proliferation . The frequency analysis of 1,538 breast cancer cases and 1,605 controls in china for clock gene variants showed the strong associations between three snps in circadian clock genes and the risk of developing breast cancer . The variants for cry1 rs1056560 are correlated to cancer, which elevate the risk in about 11% (or 1.11); per2 rs934945 in about 15% (or 1.15); and clock rs3805151 in about 35% (or 1.35). In contrast, tim protection for breast cancer development is detected in patients that carry the c - allele of rs7302060 (or, 0.54). The g allele of rs2291738 and the c - allele of rs7302060 are associated with reduced risk of breast cancer among estrogen receptor () or progesterone receptor () positive breast cancer cases (or, 0.46 and 0.36, resp . ). The exogenous expression of human clock in cell lines of colorectal carcinoma induces the cellular proliferation in about 28% . In contrast, knock - down of endogenous clock gene expression inhibits the cell proliferation in about 34% . Moreover, exogenous clock inhibits the apoptosis (42% reduction) via inhibition on apoptosis associated proteins expression of bax and bid and the increase of phosphorylation of akt . In vivo experiments by xenograft transplant of colorectal carcinoma cell line transduced with clock increase the tumor volume and tumor weight in about 61% and a 91%, respectively . However, the pharmacological inhibition of cry in human breast cancer by treatment with pharmacological agent ks15 inhibits the proliferation and cell viability by stimulation of wee-1 expression and stimulates the activity of heterodimer complex bmal1:clock [112, 113]. Curiously, two polymorphisms for clock gene cry2, rs11038689 and rs1401417, have a protective action over the mammary cancer, which suggests that not all polymorphisms associated with clock genes are negative for our health . Non - hodgkin's lymphoma is characterized by lymphoproliferation and advanced clinical stages, invasion to other tissues, and death . The estimated deaths from non - hodgkin's lymphoma in the united states amounted to 19,790 during 2015 . Analysis of cry2 variants showed the polymorphisms rs11038689, rs7123390, and rs1401417 increase the risk of lymphoma (or, 2.34; 2.40 and 2.97, resp . ). Moreover, a minor association of clock gene variants and glioma is detected for per1 rs2585405, clock rs11133391, and cry1 rs12315175 (or, 1.16; 1.08 and 1.02, resp . ). Genotyping of han chinese patients diagnosed with primary hepatocellular carcinoma showed an association between single snps of per3 rs228669 and cry1 rs3809236 with odds ratio of 1.41 and 1.26, respectively . These precedents reinforce the idea that clock genes can be modulators of cellular cycle and that modulates the risk of cancer . The circadian system is a supraphysiological system which modulates different physiological systems, and any alteration of this can have a negative impact on human health . Different chronodisruptors have been described in literature such as light / dark pattern and inhibition of melatonin production as occurs in shifts work . However, other factors can be contributing on a minor scale, such as mealtimes or a genetic component . The relevance of the genetic variation of clock genes and how it can interact with the environment is unknown . But it has been described that the genetic component in the population predisposes the development of different pathologies such as diabetes, dyslipidemias, obesity, mood disorders, and addiction, all of which suggest the importance of this system to our health . However, it is also necessary to say that the genetic component could be protecting our health such as in the case of polymorphisms associated with per2 and cry2 genes in diabetes, alcohol intake, and cancer . These findings will need to be implemented and evaluated at the genetic interaction level and also the way in which the environment factors trigger the expression of these pathologies will be examined . Finally, prospective studies are necessary to assess the predictive potential of these markers and to implement early treatment with consequent cost reduction for the health system.
|
Cellular adaptation requires biochemical processes including post - translational mechanisms to modify existing proteins . Catalyzed by opposing kinases and phosphatases, reversible phosphorylation of serine, threonine, and tyrosine residues is now appreciated as a fundamental regulatory mechanism with the majority of phosphorylation (> 99%) occurring on serine and threonine residues [1, 2]. Due to their untapped therapeutic potential, protein phosphatases have been identified as promising targets for xenobiotic manipulation through rational drug design (reviewed in [36]). In particular, the ubiquitously expressed protein phosphatase 2a (pp2a) has been proposed as a target for the treatment of a number of pathologies ranging from neurodegenerative diseases such as alzheimer disease to a variety of neoplasias [79]. Compared to other members of the phosphoprotein phosphatase (ppp) superfamily of serine / threonine phosphatases, a detailed understanding of the mechanism by which pp2a recognizes substrates and mediates site - specific dephosphorylation remains to be developed . Sequence and structural homology of the catalytic subunits of ppp family members has revealed a conserved catalytic mechanism in which a divalent metal cation activates a water molecule to hydrolyze phospho - serine / threonine without the formation of a phosphoenzyme intermediate (reviewed in [1012]). Despite a shared catalytic mechanism, substrate specificity within the ppp family for example, the ppp calcineurin (also known as protein phosphatase 2b) has been shown to interact with two consensus sequences, pxixit and lxvp, found on nonsubstrate - interacting proteins and target substrates (reviewed in [11, 13]). For protein phosphatase-1 (pp1), substrate specificity is conferred by incorporation of pp1-interacting proteins via a conserved docking motif with a general consensus sequence of rvxf (reviewed in [11, 12]). At present, consensus sequences in pp2a substrates have not been identified . This review will focus on our emerging understanding of pp2a substrate specificity, which appears to involve additive effects of multiple discrete interactions . Pp2a is a highly conserved serine / threonine phosphatase which, depending on the tissue of origin and cell type, may account for up to 1% of cellular protein and the majority of serine / threonine phosphatase activity . The physiological functions of pp2a have been implicated in all facets of cellular existence (reviewed in). Further, pp2a functions as a critical tumor suppressor whose interruption leads to proliferative diseases . The heterotrimeric holoenzyme is composed of a catalytic subunit (c) a scaffold subunit (a) and one member of four families of regulatory subunits (b) (figure 1). The diversity of pp2a heterotrimers is achieved through expression of two c subunits, two a subunits and approximately fifteen b subunits in vertebrates . The b subunits are derived from four diverse gene families (b, b, b, and b) that have little sequence similarity between families but maintain high sequence similarity within families . The b family (b55, pr55, ppp2r2) of regulatory subunits consists of four genes (,,,), the b - family (b56, pr61, ppp2r5) is comprised of five isoforms (,,,,), the b family (pr72, ppp2r3) includes three isoforms (/pr72/130, /pr59, /pr48), and the b family (pr93/pr110) is made up of three proteins (sg2na, striatin, and mmob1). There is some controversy as to whether the b family members, most notably sg2na, are bona fide pp2a regulatory subunits that always associate with the ac dimer or whether they are merely regulated by association with the pp2a dimer . Given the large number of pp2a subunits, it is thought that each cell expresses a dozen or more distinct holoenzyme complexes which act on a diverse array of substrates . Pp2a holoenzyme diversity has been the subject of several excellent papers [14, 15, 18]. Like pp1, regulatory subunit incorporation is thought to dictate the substrate specificity of the pp2a complex, however, only recently have molecular studies begun to develop insight into the mechanism by which the regulatory subunit acts . The results from recent studies suggests a multitiered mechanism wherein pp2a substrate specificity arises from (1) subcellular localization of pp2a defined by the b subunit, (2) selective holoenzyme assembly by posttranslational modification, (3) interaction with specific endogenous inhibitors, (4) interactions between the b subunit and phosphosubstrates at sites distant from the active site, and (5) b - subunit residues which infiltrate the catalytic cleft of the c subunit . This paper will provide a summary of these studies and how the understanding of the determinants of pp2a substrate specificity has advanced . The heterotrimeric holoenzyme is targeted to discrete subcellular locales dictated in part by which b - regulatory subunit is incorporated . The localization imparted by the b - regulatory subunit dictates the spatial sphere of influence of the holoenzyme complex for potential substrates . This mechanism of targeting pp2a activity is highlighted by extensive studies of the b family of regulatory subunits . For instance, the b family regulatory subunits target the holoenzyme to different cellular compartments in the brain . Specifically, b and b are primarily cytosolic where as the b-regulatory subunit associates with a detergent - resistant protein fraction consistent with an interaction at the cytoskeleton . Similar diversity has been observed in the b family of regulatory subunits . A c - terminal nuclear export signal common to b, b, and b which, when these regulatory subunits are incorporated into the pp2a holoenzyme, results in cytoplasmic localization of the heterotrimer . B and b isoforms lack a similar sequence and are found primarily in the nucleus . In cardiomyocytes, b interacts with the protein ankyrin - b through its c - terminus which leads to localization at the cardiac m - line . B on the other hand has been shown to target the holoenzyme complex to subnuclear structures in cardiomyocytes where pp2a / b may regulate gene expression . Loss of proper subcellular targeting of pp2a has been implicated in the biogenesis and aggressive phenotype of neoplastic growths . Specifically, a truncated form of b (b), has been isolated from a melanoma cell line wherein the pp2a/b complex is targeted to the trans - golgi network, blunts p53 responsiveness, contributes to genetic instability and increases metastatic motility [2427]. This was first observed in a member of the b family, b. two neuron - specific isoforms of b, b1, and b2, are generated by the use of an alternative 5 exon which results in the production of a divergent n - terminal extension on b2 [28, 29]. The n - terminal extension of b2 directs the holoenzyme complex to the outer mitochondrial membrane (omm) by targeting the mitochondrial translocase complex and forming an abortive complex resistant to import into the mitochondrial matrix [28, 30]. The omm - directed pp2a / b2 complex promotes fragmentation of the mitochondria reticulum and increases cell susceptibility to proapoptotic insults through an unknown mechanism . Alternative splicing of b - regulatory subunits directing subcellular localization of the pp2a holoenzyme has also been observed in both the b and b families . Two b isoforms differ by the inclusion or exclusion an n - terminal nuclear localization signal leading to isoform - specific nuclear or cytoplasmic localization . The murine - specific b family member, b, is also subject to alternative splicing leading to isoform - specific nuclear or cytoplasmic localization through an as yet unidentified mechanism . For example, the interaction between pp2a / b and shugoshin during meiosis is crucial for spatial and temporal regulation of sister chromatid disjunction . During meiosis, the cohesin complexes, which link the arms of bivalent chromosomes and the centromeres of sister chromatids, must be released in a stepwise fashion by the protease separase; the cohesin complex is firstly hydrolyzed along the arms of the bivalent chromosomes for completion of anaphase i and secondly at the centromeres of sister chromatids for completion of anaphase ii . During anaphase i, the centromeric cohesin complex is protected from separase - dependent proteolysis by shugoshin [34, 35]. Shugoshin recruits pp2a / b to the centromere which likely results in dephosphorylation of the cohesin complex leading to protection of the cohesin complex from separase - dependent proteolysis [36, 37]. Through cocrystallization, xu and colleagues, have revealed that dimeric human shugoshin 1 interacts with pp2a / b through a coiled - coil region across a broad composite surface of the c and b subunits . Incorporation of specific regulatory subunits is influenced by reversible posttranslational modification of the c subunit . Many groups have shown that the c - terminus of the c subunit is modified through phosphorylation and methylation on y307 and l309, respectively [3946]. Phosphorylation of y307 is catalyzed by src kinase and is likely opposed by pp2a - catalyzed autodephosphorylation of this phosphotyrosine . Phosphorylation of y307 selectively inhibits recruitment of the b family and some b family members to the dimeric ac complex whereas b recruitment is not effected . Methylation of the c subunit at the c - terminal l309 is catalyzed by the protein phosphatase methyltransferase (ppm1) and is opposed by the phosphatase methylesterase (pme-1) [4751]. Reversible methylation of pp2a is absolutely critical as knocking - out pme-1 in mice changes the phosphoproteome and results in early perinatal lethality . Further, methylation of the c subunit is a dynamic process which plays a role in cellular response to acute stimuli . The recruitment of the b subunit to the ac dimer has been postulated to require methylation of the c subunit for some of the b - subunit families . However, conflicting results have been reported that may reflect differences in experimental design and will be discussed further . Studies wherein pp2a / b is isolated from intact cells have revealed that methylation of the c subunit at l309 is required for incorporation of the b family of regulatory subunits into the holoenzyme complex [39, 40, 42, 44, 54, 55]. Conversely, in vitro assembly of the pp2a / b holoenzyme complex does not require methylation of the c subunit for incorporation of the b family of regulatory subunits [56, 57]. Similarly controversial, the requirement for c subunit l309 methylation was observed to be study - specific in in vitro pp2a / b timer formation [58, 59]. Methylation was dispensable for isolation of the pp2a / b holoenzyme complex from intact cells . The role of methylation of the c subunit in recruitment of b and b families of regulatory subunits is less controversial with methylation of the c subunit being dispensable [44, 54]. For more information, posttranslational modifications which influence formation of the pp2a holoenzyme complex also occur on the b subunit . Pp2a / b negatively regulates the erk map kinase signal transduction pathway . Through formation of a ternary complex of the early response gene product iex-1, b1, and erk, erk mediates its own disinhibition by phosphorylation of b1 on s327 leading to b1 disassociation from the pp2a holoenzyme . Since s327 is conserved among b - subunit family members, it is likely that other b subunits are regulated similarly . Additionally, b is likely phosphorylated on s167 to disrupt the b subunit from the ac dimer in early mitotic stages . However, pp2a / b activity is necessary to resolve the mitotic spindles and conclude mitosis; therefore, autodephosphorylation may occur on b to allow efficient pp2a / b heterotrimer formation and cell cycle progression . Thus, phosphorylation of the b - regulatory subunits also influences holoenzyme assembly and, therefore, substrate specificity . Phosphorylation of the b subunit of heterotrimeric pp2a also potentiates the catalytic activity of the holoenzyme complex . In response to activation of d1 dopamine receptors on striatal neurons, camp - dependent protein kinase a (pka) phosphorylates b at s566 increasing activity of the pp2a/ b holoenzyme towards dopamine- and camp - regulated neuronal phosphoprotein (darpp-32) [64, 65]. Dephosphorylation of t75 on darpp-32 by pp2a / b disinhibits pka - mediated phosphorylation of darpp-32 at t34 which converts darpp-32 into a potent pp1 inhibitor leading to changes in neuronal signaling . This circuit acts to attenuate phospho - t75 inhibition of t34 phosphorylation of darpp-32 . This circuit has been shown to be differentially regulated by psychomotor stimulants and antipsychotics acting on different striatal neuron subpopulations . While assembly of the many trimeric pp2a holoenzymes directs cellular localization and substrate specificity, further regulation is afforded through binding of specific protein inhibitors of pp2a . One such inhibitor set (i2/taf-1) is upregulated during the progression of chronic myelogenous leukemia through bcr / abl activity and results in decreased pp2a activity . An additional pp2a inhibitor is the protein cip2a (cancerous inhibitor of pp2a), overexpression of which is associated with several human malignancies . Cip2a associates with c - myc to protect its phosphorylated s62 from pp2a - directed activity stabilizing the c - myc protein and allowing it to promote oncogenesis . Recently an interplay between the drosophila serine / threonine kinase greatwall (gwl) and pp2a / b was observed during mitotic entry in two separate studies [69, 70]. Pp2a / b activity prevents mitotic entry by maintaining cdc25 in a dephosphorylated and inactive state . Gwl reverses this inhibition through the phosphorylation of s67 of both -endosulfine (ensa) and cyclic adenosine monophosphate-(camp-) regulated phosphoprotein-19 (arpp-19). Phosphorylation converts ensa and arpp-19 into very specific inhibitors of pp2a / b activity and produces activation of cdc25 leading to cell cycle progression . Similar cell cycle regulatory activity has been observed with the mammalian ortholog of gwl, mastl; however, the mastl - pp2a interaction has yet to be characterized . Once targeted to specific subcellular locales, the pp2a holoenzyme must recruit and dephosphorylate target substrates . Recent structural studies have begun to suggest the mechanism by which the regulatory subunit of pp2a mediates initial binding to target substrates . Other -propeller proteins have been shown to bind ligands in the central depression on the top surface of the toroid . Crystallization of pp2a / b revealed a cluster of acidic residues in this depression that is available to recruit potential substrates containing a basic motif . In this same study, the acidic central depression of b was experimentally confirmed to bind the microtubule - associated protein tau, an established pp2a / b substrate . Several conserved aspartate and glutamate residues in b engage in weak, electrostatic interactions across a large basic portion of tau and support dephosphorylation of tau at multiple sites through cycles of binding and unbinding . Structurally divergent b family members may recruit substrates in a similar fashion as the b family . The crystal structure of pp2a / b shows that the b subunit contains 18 stacked -helices which adopt 8 huntingtin elongation a subunit tor- (heat-) like repeats [58, 59]. A portion of these heat - like repeats interact with the a subunit of the holoenzyme to mediate regulatory subunit incorporation into the holoenzyme complex . Like the b subunit, an acidic patch is exposed in the b family of regulatory subunits and may mediate protein - protein interactions and substrate recruitment . Structural studies of pp2a have revealed a conserved loop in the b family of regulatory subunits which infiltrates the catalytic core of the holoenzyme [58, 59] (figure 2(a)). At the tip of this loop is a conserved glutamate residue, e153 (b numbering), which contacts through its carbonyl oxygen the catalytic subunit and through its carboxyl group a cocrystallized microcystin molecule in the active site . Mutational analysis revealed that e153 is an absolute requirement for efficient dephosphorylation of tyrosine hydroxylase (th), a known pp2a / b substrate, as well as other as yet unidentified cellular substrates of this pp2a holoenzyme . Further, it was determined that e153 of b interacts with r37 and r38 of th to mediate dephosphorylation of both s31 and s40 on th . Positively charged residues in the vicinity of target phospho - serine / threonine residues could represent a consensus sequence for b - subunit - mediated dephosphorylation . Further, the infiltrating loop is likely a conformationally dynamic structure which is not sterically hindered by surrounding portions of the a, c, or b subunits . Since r37/38 are important for dephosphorylation of both upstream (s40) and downstream (s31) sites, it appears that the orientation of phosphopeptides relative to the catalytic cleft is not constrained by additional interactions . Collectively, the above observations support a model in which the sites of interaction between the substrate and the b regulatory subunit that are distant and near the active site together control substrate specificity . First, the interaction occurring at sites distant from the active site increases the local substrate concentration . Following this initial substrate recruitment, although divergent in its sequence, an analogous structure from the -propeller fold of the b family of regulatory subunits extends to the catalytic core of the holoenzyme (figure 2(b)). This loop places conserved residues of the b - family subunits very near the holoenzyme active site . Unpublished observations generated in our lab suggests that of these loop residues k87 of b2 may play a similar role as e153 of b in site - specific dephosphorylation of target substrates; however, further characterization of this substrate specificity loop is required . Pp2a is a ubiquitous protein phosphatase responsible for the dephosphorylation of many different intracellular targets . The diverse repertoire of potential substrates for pp2a is imparted by the incorporation of one of fifteen unique b - regulatory subunits . Recent studies have increased our understanding of the mechanisms by which the b subunit imparts specificity to the holoenzyme complex . Through selective incorporation of the b - regulatory subunit, the holoenzyme complex is recruited to discrete subcellular locales which define the sphere of influence for the phosphatase . Secondly, interactions between endogenous inhibitors and specific pp2a heterotrimers further restrict phosphatase activity . As shown for the b family, regulatory subunits mediate low - affinity interactions with substrates to increase the local concentration of substrates . Through a flexible substrate selectivity loop which contacts the catalytic subunit, interactions between the regulatory subunit and phosphosubstrate may mediate multiple nearby dephosphorylation events . With the current structural information available for the pp2a complexes, future high - resolution studies will further define the molecular mechanism of pp2a substrate specificity . As general, inhibitors of pp2a are either clinically irrelevant or toxic, as in the case of the small molecule inhibitor microcystin, novel methods to increase the specificity of pp2a inhibition or activation must be developed . A clearer understanding of the pp2a substrate specificity mechanisms will serve as the foundation for rational drug design of selective inhibitors and activators of specific pp2a holoenzyme complexes.
|
Connectivity is key to understanding activity in neural systems (sporns et al ., 2000). Network connectivity in science and in engineering fields as diverse as mechanics, communication technology, public health, geography and town planning, is studied mathematically using the concepts of graph theory (bollobas, 1998). Recently, graph theory is being applied to brain connectivity (sporns and zwi, 2004; bullmore and sporns, 2009) and its pathologies in alzheimer's disease (stam, 2004; stam et al ., 2007), brain tumors (bartolomei et al ., 2006), epilepsy (ponten et al ., 2007) and, in particular, schizophrenia (bleuler, 1911/1950; friston and frith, 1995; andreasen, 1999; micheloyannis et al ., 2006; applying graph - theoretic concepts to the brain sheds new light on the basic principles of integration and segregation underlying adaptive cognitive processes, and on their disruption in maladaptive states . Schizophrenia has been understood as a cognitive disorder (bleuler, 1911/1950) based on the breakdown of large - scale cortico - cerebellar - thalamic - cortical (andreasen, 1999) or prefronto - temporal circuits (friston and frith, 1995; goldman - rakic and selemon, 1997), or more generally the inability to integrate neural processes in different brain areas, a syndrome termed dysconnectivity (stephan et al . This condition may pare down, in particular, the input to pyramidal cells of the dorsolateral prefrontal and temporal cortex (garey et al . These cells are glutamatergic and receive projections from the thalamus and widespread cortical areas, and hence are likely to be involved in higher - level cognition . Reduced connectivity may thus lead to fragmentation, a loss of coherence in cognitive activity . Graph theory enables us to model the loss of connectivity in simulated neuronal networks and predict the time course of fragmentation . On the face of it, percolation plays an important role in the evolution, growth, and maintenance of a large variety of natural, technological, and social systems (ben avraham and havlin, 2000). It refers to the probability of existence of a path between every pair of nodes in a graph, or equivalently, the graph being connected whilst many previous studies have examined cortical network connectivity in schizophrenia and other disorders, none to our knowledge have employed the concept of percolation, an issue that we presently redress . The percolation function is the cumulative density function (cdf) of percolation as a function of connectivity . It is possible, in principle, to measure the percolation function in living neural tissue, by using progressive lesioning, for instance through the administration of inhibitory neurotransmitters (breskin et al ., observations on human brain functional connectivity may be compared to the theoretical percolation function for random networks (erds and rnyi, 1959). The percolation function cp(n) of a random graph of n vertices and e edges is given by cp(n) = e the presence of a critical threshold motivates us to revisit the notion of cortical dysconnectivity as a sudden breakdown of percolation . There are, however, reasons to assume that the percolation threshold is neither the first, nor the most predominant, critical transition in the development of schizophrenia: brains are not random networks . In both the structural (sporns and zwi, 2004) and functional (salvador et al . 2006) domains, the hallmarks of brain organization include local clustering as expressed in high values for the clustering coefficient (cc), high global connectedness as specified by a short characteristic path length (cpl) (watts and strogatz, 1998), and modularity (murre and sturdy, 1995)a combination characteristic of modular small - world networks (he et al ., 2009). Graph - theoretical studies (murre and sturdy, 1995; watts and strogatz, 1998) showed that small - world and modular networks can secure global connectivity with a small number of connections . For brains configured as modular small - worlds, a few connections will suffice to ensure percolation . Most likely, therefore, percolation is not the crucial bottleneck for brain pathologies such as schizophrenia . We will propose as an alternative theoretical possibility that, instead, brain pathologies are associated with a breakdown in the local organization . In schizophrenia patients, functional connectivity in scalp eeg channels appears to reflect a loss of clustering after correcting for differences in the density of functional connections (micheloyannis et al . The question, therefore, arises, whether fragmentation can be understood as a critical breakdown in the ability of the brain to establish and maintain a modular small - world functional architecture . Here we show by numerical simulations that in neural activity networks, with loss of connectivity a self - organizing small - world neural network cannot sustain its local clustering, well before global connectivity breaks down . The iterated logistic map f(x)= 1 ax is unimodal on [1;1] [1;1] and capable of both periodic and chaotic behavior depending on its control parameter a. in this study, we construct networks of coupled logistic maps, all with parameter a = 1.7 such that the dynamics of a single unit are chaotic under iteration of a randomly chosen initial activation value . A unit x is coupled with coupling strength = 0.4 to any number mi of other units in the network such that its activation value xn + 1 at iteration n + 1 depends on the activation value of itself and all adjacent units at iteration n: in this equation, b(i) is the set of units adjacent to unit i, mi is the number of units adjacent to unit i. the coupling strength is divided by mi, and has a compensation term (1) to make sure that logistic map of an individual unit retains its mapping [1:1] [1:1], and thus functions properly for any numbers of adjacent units . A network of this type can be used to study the buildup and breakdown of modularity resulting from hebbian adaptive structural self - organization . It implements a simple rewiring rule based on synchronization of chaotic activity and rewires at most one connection per iteration, carefully keeping the network's total number of connections constant throughout the process . A single iteration of the network consists of four steps, to be repeated several times after an initial random inception: initialize the network . Randomly establish e connections between v units to create a (v, e) random network, and initialize every unit with a random activation value [1:1]. Though values of v and e are chosen such that a network has a high probability of being connected, this is not required.update units . Synchronously update every unit's activation value from its own and all its adjacent units' activation values according to equation (1).select pivot and candidate . Randomly select one unit from the network (the pivot). From all other units, select the one whose activation value is closest to the pivot's . Then, from the units already adjacent to the pivot, select the one whose activation value is farthest from the pivot's, and cut its connection to keep the number of connections constant . If there is already a connection between the pivot and the candidate, or if the pivot has zero connections, nothing happens and this step is skipped.iteration completed . Randomly establish e connections between v units to create a (v, e) random network, and initialize every unit with a random activation value [1:1]. Though values of v and e are chosen such that a network has a high probability of being connected, this is not required . Synchronously update every unit's activation value from its own and all its adjacent units' activation values according to equation (1). Randomly select one unit from the network (the pivot). From all other units, select the one whose activation value is closest to the pivot's . Then, from the units already adjacent to the pivot, select the one whose activation value is farthest from the pivot's, and cut its connection to keep the number of connections constant . If there is already a connection between the pivot and the candidate, or if the pivot has zero connections, nothing happens and this step is skipped . Networks implementing these iterative steps exhibit development from an initial random configuration to modular small - world configurations (gong and van leeuwen, 2003; van den berg and van leeuwen, 2004; rubinov et al ., 2009b) but as it turns out, both the consistent build - up of connective modularity on one hand, or the loss of structural coherence due to functional fragmentation on the other, are a result of changing dynamic activity depending critically on the number of connections in the network . The influence of these numbers shows a close relationship to the percolation function of random graphs . A common principle for neural network evolution is preferential attachment (barabsi and albert, 1999). This mechanism leads to networks that are scale - free, but not modular small - worlds . Only by combining preferential attachment with adaptive, hebbian rewiring, does a network emerge that is scale - free and also has modular small - world network structure (gong and van leeuwen, 2003). An adaptive rewiring scenario for evolving networks allows networks with initially random or regular structures to develop into modular small - world structures (gong and van leeuwen, 2004; rubinov et al ., 2009b). The scenario requires network units (edges) that produce ongoing, non - random, non - periodic oscillatory activity . These could, for instance, be represented by spiking model neurons (kwok et al ., 2007) or by nonlinear maps as an extremely simplified model of neural mass activity (breakspear et al ., 2003a, b). With these simple units as edges, the vertices of the network represents the couplings of a coupled nonlinear map (kaneko, 1989). Adaptive rewiring operates on this activity according to the general hebbian principle of what fires together wires together (paulsen and sejnowski, 2000). At successive points during the systems ongoing spontaneous activity, connections are added between pairs of synchronously active but hitherto unconnected units, while connections between desynchronized units are removed (see methods). Over time the network gradually assumes a modular, small - world structure (figure 1). Adaptive rewiring leads from an initial random network (left), to modular small - world structure (right) in small iterative steps . Coupled chaotic oscillators intermittently synchronize and desynchronize their activity spontaneously in patterns of great variability . After some time a momentarily synchronized pair of units that are not connected receive a connection, which is removed from a pair that are connected but not synchronized . As this process continues, a modular, small - world structure emerges from an initially random configuration . To obtain a more detailed view of this phase transition, we use the adaptive rewiring scenario with coupled nonlinear maps (kaneko, 1989) with initially randomly structured graphs, for a range of different numbers of vertices v: v = 300, 400, 500,,1000 vertices and numbers of edges e that differ by small steps of 20 . For each combination of v, e, across four million iterations we measured the cc and the cpl every one thousand iterations, resulting in a 4000 point record for each of five runs . The maximum, minimum, and mean values of the last 2000 points in each run were averaged over the five runs as illustrated in figure 3 . Meanwhile a mixture of regular and irregular behavior is established in the network activity that is itself optimal for sustaining the small - world structure . Crucially, whilst low dimensional, ordered, and synchronized activity dominates within modular communities, high dimensional unsynchronized activity in connector hubs ensures that the system does not fragment (rubinov et al . Attractors in the space of possible systems (gong and van leeuwen, 2004), which offers a potential explanation for their ubiquity in biological neural networks at different scales, including the entire brain (barabsi and albert, 1999). In this scenario, connectivity constitutes a critical limit for the evolution to small - world structure (figure 2). When the number of edges is large enough, adaptive rewiring guarantees a robust evolution from random to small - world connectivity . Below this limit, this evolution is frustrated, and fails to reach a stable asymptotic state . With reduced connectivity levels, we first encounter critical fluctuation: intermittently during some episodes, clusterings are formed intermittently, which are annihilated in other episodes . This may reflect the intermittent occurrence of certain symptoms (e.g., delusions) as the brain disease first becomes manifest . For still lower connectivity levels, adaptive rewiring becomes completely ineffective; this may reflect the advanced state of the disease . Self - organization from random to small - world critically in a network of 700 vertices . The self - organization occurs through adaptive rewiring . Whether a small - world emerges depends on the number of edges . We compared the critical limit on the evolution to small - world structures to percolation thresholds of random networks with the same numbers of edges and vertices . Figure 4 shows that the observed minimum cc can be modeled as a linear function of cp(n), with k3 for offset and k4 for amplitude: ccpred = k3 + k4 cp(n). Parameter k3 was in the range [0.107:0.196], parameter k4 in [0.392:0.459] and parameter k1 in [0.001:0.006]. The behavior of these parameters across network sizes was not monotonic (figure 4). Parameter k2 however, the horizontal position of the anchor point, showed a universal scaling law to the anchor point in the percolation function of random graphs, namely (table 1): aswn(n) = arand(n). Note: anchor point arand(n) = n ln(n) for classic random graphs of n vertices; this anchor point indicates the percolation threshold, where the percolation function cp(n) shows the greatest inflection . Aswn(n): anchor point for the small - world networks fitted according to figure 4 . Marquardt algorithm implemented in fityk . Scaling power: the value of h in the equation aswn(n) = arand(n). A common principle for neural network evolution is preferential attachment (barabsi and albert, 1999). This mechanism leads to networks that are scale - free, but not modular small - worlds . Only by combining preferential attachment with adaptive, hebbian rewiring, does a network emerge that is scale - free and also has modular small - world network structure (gong and van leeuwen, 2003). An adaptive rewiring scenario for evolving networks allows networks with initially random or regular structures to develop into modular small - world structures (gong and van leeuwen, 2004; rubinov et al ., 2009b). The scenario requires network units (edges) that produce ongoing, non - random, non - periodic oscillatory activity . These could, for instance, be represented by spiking model neurons (kwok et al ., 2007) or by nonlinear maps as an extremely simplified model of neural mass activity (breakspear et al ., 2003a, b). With these simple units as edges, the vertices of the network represents the couplings of a coupled nonlinear map (kaneko, 1989). Adaptive rewiring operates on this activity according to the general hebbian principle of what fires together wires together (paulsen and sejnowski, 2000). At successive points during the systems ongoing spontaneous activity, connections are added between pairs of synchronously active but hitherto unconnected units, while connections between desynchronized units are removed (see methods). Over time the network gradually assumes a modular, small - world structure (figure 1). Adaptive rewiring leads from an initial random network (left), to modular small - world structure (right) in small iterative steps . Coupled chaotic oscillators intermittently synchronize and desynchronize their activity spontaneously in patterns of great variability . After some time a momentarily synchronized pair of units that are not connected receive a connection, which is removed from a pair that are connected but not synchronized . As this process continues, a modular, small - world structure emerges from an initially random configuration . To obtain a more detailed view of this phase transition, we use the adaptive rewiring scenario with coupled nonlinear maps (kaneko, 1989) with initially randomly structured graphs, for a range of different numbers of vertices v: v = 300, 400, 500,,1000 vertices and numbers of edges e that differ by small steps of 20 . For each combination of v, e, across four million iterations we measured the cc and the cpl every one thousand iterations, resulting in a 4000 point record for each of five runs . The maximum, minimum, and mean values of the last 2000 points in each run were averaged over the five runs as illustrated in figure 3 . Meanwhile a mixture of regular and irregular behavior is established in the network activity that is itself optimal for sustaining the small - world structure . Crucially, whilst low dimensional, ordered, and synchronized activity dominates within modular communities, high dimensional unsynchronized activity in connector hubs ensures that the system does not fragment (rubinov et al . Attractors in the space of possible systems (gong and van leeuwen, 2004), which offers a potential explanation for their ubiquity in biological neural networks at different scales, including the entire brain (barabsi and albert, 1999). In this scenario, connectivity constitutes a critical limit for the evolution to small - world structure (figure 2). When the number of edges is large enough, adaptive rewiring guarantees a robust evolution from random to small - world connectivity . Below this limit, this evolution is frustrated, and fails to reach a stable asymptotic state . With reduced connectivity levels, we first encounter critical fluctuation: intermittently during some episodes, clusterings are formed intermittently, which are annihilated in other episodes . This may reflect the intermittent occurrence of certain symptoms (e.g., delusions) as the brain disease first becomes manifest . For still lower connectivity levels, adaptive rewiring becomes completely ineffective; this may reflect the advanced state of the disease . Self - organization from random to small - world critically in a network of 700 vertices . The self - organization occurs through adaptive rewiring . Whether a small - world emerges depends on the number of edges . We compared the critical limit on the evolution to small - world structures to percolation thresholds of random networks with the same numbers of edges and vertices . Figure 4 shows that the observed minimum cc can be modeled as a linear function of cp(n), with k3 for offset and k4 for amplitude: ccpred = k3 + k4 cp(n). Parameter k3 was in the range [0.107:0.196], parameter k4 in [0.392:0.459] and parameter k1 in [0.001:0.006]. The behavior of these parameters across network sizes was not monotonic (figure 4). Parameter k2 however, the horizontal position of the anchor point, showed a universal scaling law to the anchor point in the percolation function of random graphs, namely (table 1): aswn(n) = arand(n). Note: anchor point arand(n) = n ln(n) for classic random graphs of n vertices; this anchor point indicates the percolation threshold, where the percolation function cp(n) shows the greatest inflection . Aswn(n): anchor point for the small - world networks fitted according to figure 4 . Marquardt algorithm implemented in fityk . Scaling power: the value of h in the equation aswn(n) = arand(n). We propose that important insights into cortical activity and architecture can be obtained by modeling the activity - dependent rewiring of neural connections during development (gong and van leeuwen, 2003; rubinov et al ., 2009b). In our model, network connections evolve in accordance with the principle that the structure rewires in adaptation to spontaneous, on - going activity . This evolution, however, is only guaranteed if there are sufficiently many connections available . If connectivity is reduced below this number, the structure shifts toward randomness; in particular, local clustering is reduced . Andreasen (1999) and friston and frith (1995) considered schizophrenia as fragmentation, understood as the breakdown of integration between widely distributed brain areas (stephan et al ., 2006, 2009). This breakdown can be associated with the loss of connectivity (zalesky et al ., 2011), in particular of input to layer 3 pyramidal cells, an effect which is well - documented (e.g., garey et al . (2011) observed widespread impairment in structural connectivity in schizophrenic patients, involving medial frontal, parietal / occipital and left frontal cortex . It should be observed that the loss of connectivity that may lead to the onset of schizophrenia can be relatively subtle . Across the population, inputs to layer 3 pyramidal cells are substantially reduced during late adolescence, the typical period for the onset of schizophrenia (bourgeois et al ., 1994). Given that brain connectivity is costly, it may well be that in normals, its density hovers just above the critical level (the anchor point in figure 4), but in early schizophrenia it may fall just below this point . The graph - theoretical concept of percolation tells us that a small decline in connectivity can lead to a sudden breakdown of global network coherence . Based on our results, however, we argue that fragmentation in brain pathologies such as schizophrenia may be considered theoretically as a breakdown in the local connectivity structure, prior to the loss of global coherence . The number minimally needed to secure local modularity, and hence to prevent it from shifting toward randomness in structure, is systematically related to, and greater than, that needed to secure global connectivity, even if the system has fallen into entirely random connectivity . This result is of potential importance for understanding the pathophysiological processes that give rise to this disorder . The loss of local clustering in our model is in accordance with observations in schizophrenic patients by micheloyannis et al . Et al . (2006), the clinical group also showed longer path lengths than the controls, whereas in rubinov et al . Nevertheless, we might attribute the discrepancy to the fact that in both studies comparisons were made, for statistical reasons, between networks that were thresholded to have identical connectivity . Whereas the above - mentioned effects of clustering remain relatively unaffected by threshold setting, the differences in path length rapidly disappear for lower thresholds (figure 1 in micheloyannis et al ., 2006). (2003b) reported that although there were no significant increases in the occurrence of nonlinear interdependence between pairs of electrodes in schizophrenia, there was an increase in the co - occurrence in multiple (widespread) instances of nonlinear interdependence . This means that a relatively large number of global connections will have survived thresholding in rubinov's study, leading to their observation of path length shortening . It cannot be concluded from rubinov's study, therefore, that global connectivity is stronger in schizophrenics than in normals; it could, however, be concluded that the global connectivity becomes stronger in schizophrenia relatively to their local connectivity . Such a conclusion would entirely be in accordance with the modularity breakdown observed in our model . Along the lines set out here, a shift in the balance from local to global connectivity is perfectly consistent with an overall loss of connectivity in early schizophrenia . (2003) introduced the notion of overbindingthe formation of excessive connections that are effectively random and, as such, do not enable distinguishing external from internal sources, thus providing conditions favorable for phenomena such as hallucination . A possible objection to our findings is the specific choice of our rewiring algorithm . Note, however, that in the present paper we sought to establish the principled possibility using the simplest possible model, rather than to establish the empirical validity through the most realistic model possible . Note that, as a consequence, the model contains only generic dynamical and adaptive principles . We have discussed elsewhere the robustness of this model (gong and van leeuwen, 2003, 2004; van den berg and van leeuwen, 2004; kwok et al . An important limitation is that the model inevitably makes over - simplifying assumptions . In particular inter - modular connections are physically of longer range than intra - modular ones and, therefore, have a higher metabolic cost and a greater vulnerability . Preliminary analysis of models with more realistic constraints does not appear, however, to affect our conclusions . Clearly, a more differentiated model is needed to address empirical datasets such as (rubinov et al ., 2009a), an important goal of future work . However, it should also be noted that uncovering universal principles such as those reported here has the advantage of being detail invariantthat is, robust across a range of potential constraints, whereas findings arising in detailed models may not be robust to changes in those details . We observed universal scaling behavior in adaptive self - organization of clustered small - world networks: the connectivity needed for these network properties to emerge under hebbian rewiring scales with a universal power = 1.17 to the percolation function in random networks . Note, first, that> 1 might have been expected, given that the requirement to observe clustering and small - world structure are constraints additional to percolation . What is surprising is that these requirements are met with alpha very close to unity; near - linear scaling implies that these additional constraints can be realized with great efficiency . In terms of kolmogorov - complexity, small - worlds are compressible, whereas almost every possible network of n nodes and e edges (or equivalently a bit string of length l = n(n 1) with e ones and l - e zeros) will be incompressible (li and vitnyi, 1993). In this perspective, the ubiquity of small - world structure in real - world networks is quite astonishing: within human brains (sporns and zwi, 2004; stam, 2004; eguluz et al . Bartolomei et al ., 2006; micheloyannis et al ., 2006; ponten et al ., 2007; rubinov et al ., 2009a; bassett et al ., 2010), as well as between them: networks of scientific co - authorship (newman, 2001), collaborating movie actors (watts and strogatz, 1998; amaral et al ., 2000), social networks in general (wasserman and faust, 1994). Here we showed how such a network could arise with minimal connectivity close to random network percolation what is the reason for the universality of the scaling exponent? We may wonder whether the same exponent found in other domains, could help us understand the principle . A study of class graphs in open - source, object - oriented software systems ranging from simple paint programs, peer - to - peer downloaders, racing games, database management software to a complete operating system, showed that the number of links between classes scales to the number of classes with an exact power = 1.17 . The authors found that class graphs are small - world networks at the critical threshold for the breakdown of modularity, which happens when developments to the system are widely dispersed and affect many unrelated classes in apparently distant modules (valverde and sol, 2007). The similarity of this finding to ours supports the view that the scaling exponent reflects a general feature in the emergence and breakdown of modular network structure . The study of self - organizing modular small - world networks casts a new perspective on psychiatric illnesses characterized by disorganized cognition, such as schizophrenia, of which the expression has been attributed to fragmentation a subtle but pernicious disconnection (friston, 1996, p. 644). Rather than a breakdown in global connectivity, we propose that fragmentation is to be understood as a failure to organize the functional connectivity of the brain into a modular small - world structure . This is in accordance with the observed random shift in schizophrenic (micheloyannis et al ., 2006; random networks are considered extremely uneconomical; in terms of cable length, an optimal configuration combines local modules with a limited number of large - scale connections (murre and sturdy, 1995). Even though our model does not consider distance, in terms of network topology it is still the case that information travels efficiently both within locally connected circuits of modular small - world graphs and between their circuits, which makes these networks efficient for transport or communication (latora and marchiori, 2001; bassett et al ., 2010). The scaling observations tell us that fragmentation is a result of a breakdown in local, rather than global structure . With progressive loss of connectivity, ultimately, it may not matter which connections are lost first, the result may be a cascade of changes that lead to the network falling apart . For diagnosis, however, a proper understanding of the early stages of the disease is crucial; loss of modularity might offer a new perspective on the origins of the disease . One simulation consists of one network of v units and e connections, which is randomly initialized and then iterated exactly 4,000,000 times, simultaneously rearranging its connections and activity patterns, according to the adaptive rewiring scenario . The smallest simulation we adopt has v = 300 units and e = 2400 connections . During iteration, its cpl and its cc are taken every 1000th iteration (1000, 2000,, 40,00,000) resulting in a 4000 point record, with a value for cc and a value for cpl at each point . Although the speed of convergence depends on the size of a network, 4, 000, 000 iterations prove to be enough to clearly discern asymptotic behavior for all simulations used in this investigation (figure 3). Evolution under adaptive rewiring of maximum, minimum, and average cluster coefficient and characteristic path length . (a) the values of minimum, maximum and average cc for networks of 700 vertices and edges ranging from [7000, 7020, 7040,,10,000] after extensive adaptive rewiring . Note that beyond 9000 edges, cc - values tighten to a narrow range, indicating strong and consistent clustering behavior . (b) the values of minimum, maximum, and average cpl for networks of 700 vertices and edges ranging from [7000, 7020, 7040,,10,000] after extensive adaptive rewiring . Beyond 9000 edges thus, for 700 vertices, at least 9000 edges are needed for adaptive rewiring to converge to small - world structure . From the 4000 point record, the maximum, minimum, and average values for both cpl and cc are calculated from the last 2000 points . For statistical robustness, we do any single simulation five times, and average the five values over this simulation - quintuple, resulting in a maximum, minimum, and average cc and cpl for the (v = 300, e = 2400) network . We then start a new quintuple of simulations, increasing the number of connections e by 20, generating five networks with v = 300 units and e = 2420 connections, and calculate the maximum, minimum, and average cc and cpl values from these five new simulations . We keep starting new quintuples, repeatedly increasing e by 20, until e = 3300 and the batch of 300-quintuples is complete . From the entire batch, the six cc and cpl values of every (v, e) are taken to graph the asymptotic clustering and path - length behavior of networks of 300 units as it depends on the numbers of connections (figure 4). Gray lines represent minimal, maximal and average observed values for clustering coefficient, the dotted line is the predicted clustering coefficient, ccpred, a linear function of the percolation function cp(n) of a random graph of n vertices: ccpred = k3 + k4 cp(n) fitted with parameters k3 and k4 to the minimum observed clustering; the arrow indicates its anchor point aswn(n) with the corresponding number of edges in parentheses . This process is then repeated for a batch of quintuples of networks with 400 units and numbers of connections 3600, 3620,, 5000 (see figure 4, top - right box). We continue doing this for batches of networks with 500, 600, 700, 800, 900, and 1000 units, with connections increasing by 20, showing asymptotic clustering and path - length behavior depending on connectivity for networks of different sizes (figure 4). Note that although for 300 units, connections ranged from e = 2400 to e = 3300, these numbers are different for larger networks . For each of the eight batches, a phase transition was witnessed for both the cc and the cpl . To pin down the exact location of the steepest inclination in the phase transition of the cc (its center, or anchor point), the percolation function for classic random graphs was function - matched to the minimum cc of every batch . The minimum cluster coefficient was chosen over the average and the maximum cluster coefficient because it has the steepest inclination, which facilitates the fitting best . Macquardt an iterative curve - fitting algorithm which operates by minimizing the summed squares of the residuals, in this case the difference between minimal cc - values of n - edge simulation quintuples on the one hand, and the (erds and rnyi, 1959) percolation function's value for n edges on the other . Macquardt algorithm is sensitive to local minima which makes it inefficient when using completely random initial values . Initial parameters were hand - guessed separately for each of the eight subgraphs in figure 4, after which the algorithm was ran until convergence beyond the program's six - digit resolution, a procedure that was repeated three times with small differences in the hand - guessed initial parameters . The final values did not differ within the program's six - digit resolution over the three repetitions, and convergence was very fast (typically well before 100 iterations). The fits show significant deviations from the data curve, due to intrinsic fluctuations in the data . We, therefore, considered reliable the estimates of the scaling power and other model parameters . Even more reliable estimates could, in principle, be obtained by scaling up the network size to 2000, 5000, and 10,000 vertices, resources permitting, as computation time and data grow nonlinearly with network size . The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest . The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
|
Dysphagia is the subjective awareness of difficulty in the passage of solids or liquids from the oropharynx to the stomach . Dysphagia can be classified into an oropharyngeal or an esophageal location, and it is caused by neuromuscular motility disorders and mechanical obstruction.1) mechanical dysphagia is associated with intrinsic or extrinsic compression, resulting in progressive intolerance to solids . The term, dysphagia aortica, has been used to describe difficulty in swallowing caused by external compression from an ectatic, tortuous, or aneurysmal aorta as a result of age - related degeneration.2) dysphagia aortica is classically seen in elderly women with short stature who have hypertension and kyphosis.3) we report herein a patient with dysphagia associated with an aortic aneurysm . An 86-year - old woman presented with worsening nausea and vomiting . Because of her progressive dysphagia to solids for the last 6 months, she had ingested only semisolids and liquids . Three days before seeking evaluation at our hospital, she had difficulty in swallowing liquids, along with nausea and vomiting . The medical history revealed that she had been diagnosed with primary hypertension, an ascending aortic aneurysm, congestive heart failure, moderate aortic regurgitation, and moderate mitral regurgitation 6 years previously . Because of old age she had undergone vertebroplasty due to multiple compression fractures of the thoracic and lumbar vertebrae 5 years ago . On admission to the hospital the blood pressure was 130/90 mmhg, the pulse rate was 64 beats / min, the respiratory rate was 28 breath / min, the body temperature was 36.0, the height was 1.43 m, and the body weight was 37 kg . The physical examination showed a diastolic murmur at the right upper sternal border and a pansystolic ejection murmur at the left lower sternal border . The laboratory findings were as follows: the white blood cell (wbc) count was 5,100/mm, the hemoglobin was 11.8 g / dl, the platelet count was 151,000/mm, the blood urea nitrogen (bun) was 39.8 mg / dl, the creatinine was 1.5 mg / dl, the total protein was 5.8 g / dl, the albumin was 3.2 g / dl, the lactate dehydrogenase (ldh) was 546 her chest radiograph revealed blunting signs at both costophrenic angles, cardiomegaly with a cardio - thoracic ratio of 0.8, and an enlarged, tortuous aorta (fig . 1). Computed tomography (ct) of the chest demonstrated an enlarged, tortuous aorta (fig . The diameters of the ascending thoracic aorta, the descending thoracic aorta, and the proximal abdominal aorta were 7 cm, 6 cm, and 5.3 cm, respectively . The upper gastrointestinal barium study revealed marked extrinsic compression of the distal esophagus just above the esophagogastric junction (fig . We concluded that the symptoms and the results of the imaging studies were consistent with dysphagia aortica . Although we recommended surgical correction of the aortic aneurysm or percutaneous endoscopic gastrostomy, the patient declined any invasive procedures and she was transferred to a nursing home on the 12 hospital day . The esophagus normally begins on the right side of the thoracic aorta and then descends . Then, the esophagus lies on the left side of the aorta and penetrates the diaphragm through the diaphragmatic histus.4) the aging process and the accompanying degenerative changes with the loss of elasticity causes a dilated, elongated, and distorted aorta, which may result in a so - called reverse c- or reverse s - shaped aorta.3) as a result, the esophagus is pushed and compressed by the aorta against the cardiac chambers, which are anterior in location.5) there is no gold standard diagnostic procedure for dysphagia aortica . The association of suggestive symptoms, such as progressive intolerance to solids with concomitant weight loss along with the results of imaging and other diagnostic studies provide a high index of suspicion.6) the diagnostic work - up includes radiologic, endoscopic, and manometric studies . On a standard chest radiography and ct scan, the enlargement of the aortic arch and the tortuous dilated aorta can be observed . A barium swallow test may show partial esophageal obstruction and pulsatile movement of the barium synchronous with aortic pulsation.7) endoscopy reveals pulsatile extrinsic compression and stenosis of the lower esophagus with proximal dilatation . Esophageal manometry may demonstrate a localized high pressure band with superimposed pounding that is synchronous with the cardiac pulsation.8) however, the typical findings of dysphagia aortica can be inconsistent . The radiographic findings are often inconclusive because a dilated, tortuous thoracic aorta is frequently encountered in elderly patients with dysphagia . Although a ct scan is useful for evaluating not only the aortic lumen, but also the aortic wall,9) occasionally this is of no value in assessing compression of the esophagus by the aorta.2) false negative results are common for barium swallow studies . In addition, the classical manometric features suggestive of dysphagia aortica also occur in normal subjects.8) the differential diagnosis of dysphagia aortica includes various common structural and neuromuscular abnormalities.1) gastroesophageal reflux disease and motility disorders are common causes of dysphagia . The co - existence of these conditions and the lack of sensitivity and specificity of the usual diagnostic tests make it difficult to diagnose dysphagia aortica with certainty . Wilkinson et al.2) demonstrated that a video solid bolus swallow test could be useful in determining the manometric findings that are suspicious for dysphagia aortica when the standard evaluation fails . Mild cases may be treated conservatively, such as avoiding sticky solids and feeding on a liquid diet . The surgical procedures include transposition of the distal esophagus, separation of the distal esophagus from the aorta, esophagomyotomy, division of the right crus of the diaphragm, aortic resection, and repair of an aneurysm . For patients who are not candidates for surgery, insertion of a feeding tube via percutaneous endoscopic gastrostomy (peg) although we did not perform esophageal manometry, the patient's symptoms and imaging studies were consistent with the classic findings of dysphagia aortica . Although the patient declined any invasive procedures, a peg for a feeding tube might have been helpful for nutritional support . Dysphagia aortica is an uncommon type of dysphagia that is caused by extrinsic mechanical compression . It should be differentiated from other causes of dysphagia, such as gastroesophageal reflux disease or motility disorders, because dysphagia aortica often requires surgical intervention that can significantly reduce the morbidity and these interventions can be curative in some situations.
|
From now on, molecular study regarding female sexuality has focused on female sexual hormone, like estrogen receptor (er) and er derivatives.12 but flibanserin is an agent of 5-hydroxytryptamin (5-ht) type 1a receptor and an antagonist of 5-ht type 2a and thus a new molecular entity.3 flibanserin was originally developed as antidepressant drug . In clinical stage 2a as antidepressant, flibanserin could not prove its effectiveness, but almost no sexual function disorder was reported in subjects . For this reason, the arizona sexual experiences scale (asex) was used for making a comparison of the sexual function effectiveness of flibanserin on antidepressant vs. placebo proven in stage 2b studies among four depression programs.4 stage 2b studies have failed to prove its general effectiveness on depression, but in answering this question " how intense is your sexual desire? " In the asex, flibanserin turned out to be more excellent in both placebo and active - comparator . Since then, drug development has changed its directivity toward being a potential medicine for treating hypoactive sexual desire disorder (hsdd). Hsdd is chara or absence of sexual fantasy and sexual desire associated with personal pain in the 4th edition of the diagnostic and statistical manual - text revision (dsm - iv - tr).5 determining lack or absence is done by clinicians by considering the factors influencing sexual activitie such as age and contexts of personal life . Sexual function disorder is not explained well by other axis 1 disorders (except other sexual function disorders) and also it is not that it is caused only by direct physiological effects of materials (i.e., drug overuse, drug) or overall medical status . The dsm-5 completed in 2013 addresses new illness called as female sexual interest / arousal disorder (fsiad), which has both properties of hsdd and another illness of dsm - iv known as female sexual arousal disorder . Flibanserin underwent new drug application (nda) as original drug in 2009 . The two central phase 3 studies (violet6, daisy7) all used e - diary and did not show big statistical improvement compared to placebo in the pre - specified co - primary efficacy endpoint that assessed daily sexual desire . In both violet6 and daisy7 studies, flibanserin showed an increase in satisfying sexual events (sse) and female sexual function index (fsfi) and reduction in female sexual distress scale - revised (fsds - r), but did not show a meaningful increase in e - diary scores compared to placebo . In both studies, the most commonly reported adverse effects in women prescribed with flibanserin include drowsiness (11.8%), vertigo (10.5%), and fatigue (10.3%).67 these studies show a statistically significant improvement in secondary end points that measured sexual desire with other tools known as fsfi compared to placebo . Applicants told that the effectiveness of flibanserin against sexual desire is better explained with fsfi, but most advisory committees did not agree to alteration in the e - diary evaluation method set as the one designed to evaluate sexual desire . The safety consciousness expressed by the advisory committees includes adverse effects such as fatigue and drowsiness as well as drug - drug interactions (ddis) and flibanserinalcohol interactions . Another central stage 3 study is begonia,8 which set sse, fsfi, fsds - r as major evaluation methods rather than using e - diary in the existing viole and daisy studies and reported that flibanserin shows a statistically significant increase in sse and fsfi and reduction in fsds - r compared to placebo . However, many problems with safety were brought up in the second submission, too . Vertigo, drowsiness, and vomiting are the most commonly reported adverse effects, and these occurred 2% to 3%, respectively if using placebo during stage 3 placebo - control premenopausal hsdd, whereas occurred close to 11% in subjects who used flibanserin as 100 mg every night at bedtime . Events matching central nervous system depression (fatigue, drowsiness, and vertigo) occurred close to 21% in subjects who used flibanserin as 100 mg every night at bedtime and this proportion is three times higher than in placebo group . Flibanserin is very difficult to endure if taking in combination with fluconazole and strong cytochrome p450 3a4 (cyp3a4) suppressant and this combination may increase the risk of swoon and symptomatic low blood pressure . And ethanol administered in combination with flibanserin greatly increases the risk of drowsiness, fatigue, orthostatic hypotension, and swoon . Additionally, these studies were limited to general healthy women who did not take benzodiazepines, sleep aid, narcotics and many other drugs . The effectiveness was not so big in general, and considering these concerns, fda refused to approve it again and recommended that additional safety studies are required . According to the latest fda review, there is no data indicating new efficacy . Instead, flibanserin sponsors submitted additional safety data next day including research data proving that there is no obstacle to driving, data comparing the commercialized products and the side effects profile of these products, and analysis clarifying the potential effects of alcohol on side effects.9 despite the trustfulness of highly influential studies, fda product review is not a fundamental comparison, in fact, and so comparison of safety between individual products may be misunderstood . In particular, alcohol interaction study was conducted in 25 healthy volunteers as a sample, among which only two were female . Since the refusal from fda in 2013, a civic group called as even the score was formed to support what was called as " gender equality " in the manner approaching sexual function disorder treatment.10 this group insisted that there is no treatment for women although even 26 items for male sexual function disorder were already approved . This argument was rejected by fda on the ground that there are no approved products for low sexual desire in men and the 26 items for treatment contain various mixtures of testosterone . Despite the fact that flibanserin is supported by consumer advocacy groups and consequently not the first product supported by pharmaceutical companies, fda's argument on gender bias while regulating is worthy of notice in that the range of making efforts against this argument is from campaigns via social media even to letters from the members of the national assembly.11 another noteworthy feature in application for flibanserin to fda is use of the findings on sexual desire reported by patients as primary efficacy variable for approval . Sexual desire can be seen by those who experience it and the results reported by patients can be measured without confounding this concept from others . The results reported by patients have become more important in studies and other drugs that have such results as primary end point have been approved (although none were based on sexual desire). Among all new molecular entities and biological permit applications approved by fda from 2006 to 2010, gnanasakthy et al.12 found that among which, 17% (20 in 116) used the results reported by acknowledged patients as primary outcome in approval labels . The complex element in evaluating flibanserin lies in recalling the frequency of desire and extent of intensity and then measuring with fsfi index four weeks after the daily records of the most intense desires when applying for the primary desire end point first time . Fda raised some concerns about optimizing fsfi as desire assessment tool, including the validity of contents and the period of recall, but the recent advisory committees did not focus on changing the primary end points or consulting the validity of fsfi . The final concern with flibanserin is associated with its use in clinical settings and this was an important issue for the committees . Despite little reliable estimate of hsdd prevalence, this product will be used obviously in women in a broader sense than had been studied so far like others, many will not satisfy the official diagnostic criteria of hsdd, and many will increase the risk of adverse effects or be administering other drugs . The concerns with its use without labeling were reemphasized again by speakers who argued that they need flibanserin, but at the same time, it was reported that those who were diagnosed with cancer or in menopause should be excluded from treatment with flibanserin by labeling when sold . On june 4, 2015, fda called a committee meeting to review the efficacy and safety of flibanserin, and after the meeting, the committee approved flibanserin under the condition that risk management tools should be enforced mandatorily . Despite the presence of many problems with flibanserin, fda finally approved it under the condition that risk evaluation and mitigation strategies (rems) should be enforced for flibanserin . In the future, flibanserin is expected to gradually increase in amount with changes from off - label to on - label . If prescription with flibanserin is determined as necessary, before using it, it is important to check prescription criterion, possible adverse effects after prescription, and precautions during administration . To get a prescription with flibanserin, the first criteria is premenopausal women aged 18 year or more who met the stages of reproductive aging workshop (straw) criteria . The straw criteria are that she has a regular menstrual cycle for 21 to 35 days in the previous twelve months and a normal level of follicle stimulating hormone (fsh). In addition, it should be prescribed if primary diagnosis is hsdd according to dsm - iv - tr criteria or if there is any secondary sexual arousal disorder or female disposition disorder accompanied by hsdd . Besides, its prescription is likely to be considered if the fsds - r (range, 0 - 52) score13 used in clinical studies is 15 points or higher . In addition, in case that sexual desire disorder comes from disease, psychiatric problems, and interpersonal problems or in case that it does so from medications or other substances taken in conjunction, these cases are not the diseases for which medicine is efficacious . Besides, postmenopausal women and sexual desire decline disorder male patients are not adapted during use and i t is not intended for reinforcing sexuality.1415 the adverse effects most common in prescribing flibanserin are reported as vertigo, fatigue, vomiting, insomnia, and mouth dryness . Precautions in prescription include avoiding the use of other substances associated with cyp3a4 and cytochrome p450 2c19 (cyp2c19) which are associated with drug metabolism, for example, administration with ketoconazole as cyp3a4 inhibitor and grapefruit juice and fluconazole as cyp3a4 or cyp2c19 inhibitor, which are likely to increase the risk of orthostatic hypotension side effects . Furthermore, selective serotonin reuptake inhibitors and selective norepinephrine reuptake inhibitors (ssri / snri) may cause anxiety, drowsiness, fatigue, insomnia, and vertigo, if used . So carefulness is required . Alcohol is contraindication because if administered with alcohol, it is highly likely to cause central nervous system depression (fatigue, drowsiness, and vertigo), low blood pressure, and swoon . Hormonal contraceptives are known as weak cyp3a4 inhibitors, and likely to cause side effects such as vertigo, drowsiness, and fatigue if coadministered with flibanserin . Triptans is used for treating migraine as agonist of 5-ht type 1b and 1d receptor and may cause side effects of drowsiness if administered with flibanserin . In addition, if flibanserin is administered to patients with decline in liver failure, increase in concentration of drug in blood is observed and thus it's considered that adverse effects are likely to occur . Besides, taking it with herb extracts and digesters and gastroprotective drugs requiring no doctor prescription is likely to cause the risk of adverse effects and the use of flibanserin to women who are breast - feeding is contraindication . As we discussed above, flibanserin was refused to approve by fda in 2009 for its adverse effects and discordance of its efficacy from different evaluation methods . Most common side effects were central nervous system depression, like fatigue, drowsiness, and vertigo . Ddis with fluconazole, ethanol, and many other drugs were mainly discussed and fda refused to approve it again recommending additional safety data . With the additional profile and analysis which can prove their safety compared with other products, on june 4, 2015, fda finally approved it on the grounds that rems should be enforced, and soon we can get flibanserin on - label under the strict prescription . Flibanserin can be prescribed to premenopausal women aged 18 years or higher who has a regular menstrual cycle, but if liver function fails, if breast - feeding, and if drinking alcohol, the use of flibanserin is contraindication . Also, its administration with fluconazole, ketoconazole, ssri / snri, triptans, hormonal contraceptives, herb extracts, and several other drugs requiring no doctor prescription is prohibited because it is likely to increase the risk of adverse effects . We are waiting for patients' reaction, considering the cost and effectiveness, in countries where flibanserin will be on sale, and more agents like unicenta (uncnt) and melsmon, which proved as having a efficacy of menopausal symptoms, have to be studied as treating for female sexual dysfunction.16
|
Kcm is itself very rare and distinct type of keratoacanthoma which usually occurs over extremities and scalp is unusual site for development of lesion . Treatment is difficult as lesion of kcm present with large raised, rolled borders with peripheral extension . Keratoacanthoma (ka) is a rapidly evolving tumor, composed of keratinizing squamous cells originating in pilosebaceous follicles and resolving spontaneously if left untreated . It is relatively common, especially in whites occurring in middle age while being uncommon in dark - skinned . . It presents as firm, rounded, flesh - colored or reddish papule; with a rapid growth phase becoming 10 - 20 mm and then spontaneous healing taking place over three months . There are three rare clinical variants of solitary ka, namely giant ka, keratoacanthoma centrifugum marginatum (kcm) and subungual ka . In kcm, lesions are large, reaching upto 20 cms . The most common locations are dorsa of hands and legs, lesions on scalp being rare . We report a rare case of kcm occurring on the scalp which is an unusual site . A 62-year - old male, watchman by occupation presented with asymptomatic raised lesion on scalp since one year . Lesion had developed de novo, as a pea sized lesion with gradual increase to cover entire vertex . Cutaneous examination revealed a single, irregular, 12 15 cm, yellowish plaque on vertex of scalp with nodular surface and a central crater [figure 1]. On palpation, the plaque was firm, non - tender, non - indurated and not attached to underlying structure . Ultrasonography of lesion showed ill defined hypo echoic mass involving epidermis, dermis and subcutaneous tissue . A single, irregular, 12 15 cm, yellowish plaque on vertex of scalp with nodular surface and a central crater . Deep punch biopsy revealed exoendophytic, globular, well circumscribed central cup shaped crater, epidermal invagination with marked hyperkeratosis and horn cyst with rich keratin filled crater imparting glassy appearance and well demarcated regular base . . Marked epidermal proliferation with crater formation with horn pearls and inflammatory infiltrate at the base of the lesion was suggestive of a fully developed lesion of kcm . Complete surgical excision with grafting was done successfully with dramatic improvement with no recurrence at 9 months [figure 5]. Exoendophytic, globular, well circumscribed central cup shaped crater, epidermal invagination with marked hyperkeratosis and horn cyst with rich keratin filled crater imparting glassy appearance and well demarcated regular base epidermis forming buttress over the pseudhorn cyst dense nodular lymphocytic infiltrate in the upper dermis surgical excision with grafting the etiology is multifactorial that includes chronic ultraviolet ray exposure, smoking, contact with chemical carcinogens like pitch, mineral oil, tar, trauma and vaccination . The role of human papilloma virus remains inconclusive but in one study, hpv type 6 and 11 were detected within the lesion . It can be localized to any region of the body but is more frequently seen on dorsum of hands and legs . Progressive peripheral extension with a raised rolled - out margin and atrophy at the centre is a characteristic feature of kcm . The margin of the lesion showing multiple comedonal orifices giving rise to a cribriform pattern may represent a unique phenomenon of kcm . It is hypothesized that this typical appearance may arise as a result of sequential involvement of multiple adjacent hair follicles in a centrifugal fashion . Kcm does not show tendency for spontaneous regression, a feature also seen in giant ka, which grows rapidly reaching a size of 5 cm or more and occurring commonly on nose and eyelids . Kcm is differentiated from giant ka by absence of downward vertical spread and destruction of underlying tissue . Nevertheless, in giant ka spontaneous involution takes place after several months, often accompanied by detachment of a large keratotic plaque . The other differential diagnoses include squamous cell carcinoma, lupus vulgaris, botryomycosis, blastomycosis - like pyoderma and pseudoepitheliomatous hyperplasia, hypertrophic lupus erythematosus, atypical mycobacterial infections, or deep fungal infections . There are reports that kcm has been treated successfully with oral retinoids (acitretin, etretinate, or isotretinoin 0.5 - 1 mg / kg / day) which should be given until complete clearance of lesion . Surgical intervention is a preferred mode of therapy keeping in mind that a wide excision is performed to prevent subsequent recurrence . Other treatment modalities successfully used include topical 5-fluorouracil, intralesional injections of interferon alpha, methotrexate, or bleomycin, or mohs micrographic surgery . In kcm, lesions are usually too large for excisional biopsy for diagnosis, but certain characteristic features like clinical behavior, appearance of lesions, histological features (hyperkeratosis and hyperplasia), and cytological features (tumor cells with eosinophilic and glassy cytoplasm, few mitoses) help clinch the correct diagnosis . First time from india we are reporting case of kcm presenting over scalp which is successfully treated with surgical excision without any recurrence.
|
Hydroxyapatite biomaterials are materials that are very widely used in several health purposes, including as a source of calcium for the manufacture of toothpaste and as an important material in the formation / bone repair . The chemical properties of hydroxyapatite are bioactive and compatible with the adjacent bone and teeth . Hydroxyapatite is a calcium phosphate ceramic that is totally biocompatible and nontoxic and becomes an integral part of living bone and teeth tissue [18]. The raw material for the production of hydroxyapatite biomaterial is very easily available and abundant in indonesia . The production process was easy and the cost is also relatively inexpensive if done on a large scale . Among the abundant raw materials are the shells of crabs, which are one of indonesia's main export commodities . Export of crabs commodity by indonesia amounted to 604.215625.000 tons / year without the shell form, while domestic consumption is expected to be so much more, as in makassar, carrying 292.5 tons exported in the form of crab without shell with the main export destination being singapore . If the mass of crab shells 2550% of the total mass, it can be estimated that in 2012 produced the shells of crabs around 151,053.75 to 302,107.5 tons in indonesia and 73.125 to 146.25 tons in makassar (a region of indonesia), there was just from crabs production were exported . This value is of course even more if the crab's consumptions in the country are also taken into account . This suggests the existence of crab shells is abundant in indonesia, including in makassar . As known in indonesia, the shells of crabs have not been used, so it will only be a waste disturbing environment [7, 8]. Crabs shells containing calcium carbonate (caco3) are very abundant; amount 4070%, varies according to the species . Calcium carbonate can be further processed into calcium hydroxyapatite [ca10(po4)6(oh)2] [4, 5]. According to strassler, hydroxyapatite is one of the active ingredient materials that are widely used in toothpaste products for protection against teeth demineralization [1113]. The crystals structure of hydroxyapatite will be better by using cao as a precursor of calcium . However, the use of these compounds also produces carbonate apatite [ca10(po4)6co3] in a fairly large percentage . This is because the calcination process cannot completely eliminate carbon dioxide (co2) in caco3 so that there can be reaction with the precursor phosphate . However, the carbonate apatite heating at a temperature of 700900c for 25 hours, followed by washing using distilled water, the carbonate apatite can be hydroxyapatite [1113]. The instrument were used in this research were glass apparatus, ohaus analytical balance, petri dish, porcelain cup, buchner flask, buchner funnel, vacuum pump sargent - welch co. model 1400, magnetic stirrer, magnetic bar, hotplate idealife, ph meter, furnace thermolyse 6000-barnstead, dessicator, thermometers, spnisosfd oven, stopwatch, shimadzu x - ray diffractometer (xrd) model 6000, x - ray fluorescence (xrf) shimadzu, fourier transform infra - red (ftir) prestige-21 shimadzu, scanning electron microscopy combined with the ability to generate localized chemical information (sem - edxa) variant, and uv - vis shimadzu model 6105 . This is because the carbonate ion compounds are able to inhibit the crystallization process ca10(po4)6(oh)2 so that the results will be dominated by an amorphous phase . If the caco3 burned at temperature calcinations, decomposition reaction of caco3 into cao will occur and co2 emissions are dominant and will be issued as a result of the combustion reaction [1315]. Waste of crabs shells portunus pelagicus species was taken from an exporter crabs company in industry areal, makassar city, south sulawesi province, indonesia . Wahidin hospital, and (nh4)2hpo4 was obtained from fluka chemical, ch3cooh glacial 100%, ch3coona3h2o from merck, (nh4)6mo7o244h2o from aldrich, nh4vo3 from aldrich, hno3 and naf from fluka chem ., (nh4)2c2o4, distilled water, aluminum foil, and whatman filter paper numbers 40 and 42 . The instruments were used in this research that glass as commonly used in laboratories, ohaus analytical balance, petri dish, porcelain cup, buchner flask, buchner funnel, vacuum pump sargent - welch co. model 1400, magnetic stirrer, magnetic bar, hotplate idealife, ph meter, furnace thermolyse 6000 barnstead, dessicator, thermometers, oven spnisosfd, stopwatch, shimadzu x - ray diffractometer (xrd) model 6000, x - ray fluorescence (xrf) shimadzu, fourier transform infrared (ftir) prestige-21 shimadzu, scanning electron microscopy combined with the ability to generate localized chemical information (sem - edxa) variant, and uv - vis shimadzu model 6105 . Crabs shells portunus pelagicus waste was cleaned with distilled water and dried at room temperature . Furthermore, to transform crabs shells into caco3 and then into cao, calcinations were performed on the samples at 1000c temperature for 5 hours at a rate of temperature rise 5c / minute . Calcium oxide (cao) obtaining dominated as result of calcinations and then made suspensions in 100 ml of distilled water with a calcium concentration of 0.3 m. the suspensions reacted by dropwise with a 100 ml 0.2 m of (nh4)2hpo4 solution through the coprecipitation method, at temperatures around 40c while the solution was stirred for 25 hours . The precipitation allowed stand overnight or 24 hours at room temperature, and the precipitate is filtered with a whatman filter paper number 40 and dried at 110c for 5 hours . The pure hydroxyapatite obtained by sintering to the dried precipitate at various temperatures of 500900c for 4 hours [16, 17]. The characterization of the compounds was performed by using x - ray diffraction (xrd), ftir, and sem - edxa . The proven in vitro demineralization of teeth was conducted through evaluating the concentration of phosphate in solution by using the uv - vis spectroscopy . The effectiveness of hydroxyapatite to protection against teeth demineralization was tested in acetate buffer ph 5.0 solutions, with 1 m of acetic acid concentration with the addition of hydroxyapatite in varying concentrations and immersion time . Each of 5 beakers was filled with 300 ml of acetate buffer ph 5.0 with acetic acid concentration of 1 m. an acetate buffer was left without adding anything as a comparison . An acetate buffer was then added 10 ppm of naf left without addition of ca10(po4)6(oh)2 . Other three pieces beaker of acetate buffer containing 10 ppm of naf are adding of ca10(po4)6(oh)2 with variation concentration of 25 ppm, 50 ppm, and 100 ppm . The immersed times of tooth samples in solution are 3, 6, 9, 24, and 48 hours, respectively . Furthermore, the phosphate concentration in each solution was measured by using uv - vis spectrophotometer with the wavelength for phosphate (maks) being 432 nm . The calcinations aim to eliminate the organic component in the shells of crabs and convert caco3 compound which is the dominant compound in the shells of crabs into cao through the elimination of co2 in gas form . Characterizing the calcinations results the results can be seen from the diffraction pattern of the crab shells before and after calcinations at a temperature of 1000c for 5 hours (figure 1). In this figure can be observed changes in the diffraction pattern of crab shells, where the change in the diffraction pattern is due to the chemical change from mixture of caco3 with organic matter to pure cao . The appearance of the sharper peaks in figure 1 after calcinations (b) is a result of the crystallinity of the cao . Identification by ft - ir as shown in figure 2 showed there is a reduction process of -co3 groups and some of ir - spectra were missing after calcinations . The elimination of -co3 groups and organic components can also be seen from the data of mass reduction of sample calcinations . The determinations of calcium contained in sample was conducted by using x - ray fluorescence, where obtained calcium is 66.62% after calcinations . These results are then used to calculate the stoichiometry in determining the number of results calcinations which is needed to react with (nh4)2hpo4 as the precursor phosphate . The precipitation reactions aiming to produce ca10(po4)6(oh)2 used phosphate, (nh4)2hpo4, as the precursor and then reacted with cao as calcinations results . Side results ca10(po4)6co3 also occur as a product of reaction of (nh4)2hpo4 and caco3 presence in the calcinations results . Dried precipitate further sintered on temperature variations of 4001000c for 2 hours; it is intended to determine the optimum temperature where the ca10(po4)6(oh)2 is formed, furthermore characterized by using xrd, ft - ir, and sem - edxa . The diffractograms of each sintering results compounds indicate that the temperature is closely related to the formation of crystals . This is due to the nature of the vibrating atoms moving faster in higher temperatures . The optimum temperature formation of hydroxyapatite was determined by calculation of the probability of the sample phase from the xrd results analysis according to jcpds standard data, which, jcpds; 24 - 0033 is standard data for ca10(po4)6(oh)2; 09 - 0169 for -ca3(po4)2; 29 - 0359 for -ca3(po4)2, 35 - 0180 -ca3(po4)2; 35 - 0180 for ca10(po4)6co3(oh)2 and 19 - 0272 standard data for ca10(po4)6co3(oh)2 . Figures 3 and 4 showed that the temperature is closely associated with the formation of hydroxyapatite phase . In the both graphs it can be seen that the maximum intensity of the phase formation of hydroxyapatite has been found by sintering at temperature of 800c, it means the optimum temperature of hydroxyapatite formation is 800c, and then this result will be used for another application . The formations of hydroxyapatite phase had been dominated at 800c confirmed by percentage probability sample phase (figure 5), in which the percentage of hydroxyapatite phase formed around 46.61%, while phases of -ca3(po4)2 and phase -ca3(po4)2 are 17.76% and 19.37%, respectively . However, also there is still presence of a phase ca10(po4)6co3 and ca10(po4)6co3(oh)2 with a range of 11.84% and 4.43%, respectively, which indicates the presence of carbonates . The x - ray diffractograms of ca10(po4)6(oh)2 synthesized at a 800c temperature sintering can be seen in figure 6, where the peaks of ha are symbolized by the peak of the crystal ca10(po4)6(oh)2, while peak -tkf is symbolized crystalline peaks of -ca3(po4)2, the symbol -tkf for crystalline -ca3(po4)2, aka for ca10(po4)6co3, and akb for ca10(po4)6co3(oh)2 . The highest intensity peak at 31.2572 deg corresponding to crystalline -ca3(po4)2 is seen, the second highest peak intensity is 31.7783, and the third highest peak intensity is 28.0565 crystals suitable for ca10(po4)6(oh)2 . Ftir results showed that the sintering temperature variation affects the absorption band shapes which generally all sintering results showed absorption band of -oh, absorption band 1, 2, 3, and 4 of po4, and co3 groups . Infrared spectra in figure 7 show the -oh groups at 633 cm which are characteristic of hydroxyapatite appearing on the sintering temperatures of 4001000c . Additionally spectrum also showed higher sintering temperature causing the sharper peaks phosphate group (po4) because the nature of the vibrating atoms moves faster at higher temperatures . The ft - ir spectra of sample were sintered at a temperature of 800c (figure 8) showing that hydroxyapatite is the dominant compound formed . The stretching frequencies of po4 group are indicated by 1120.64 cm, 1091.71 cm, 1043.49 cm (3), 993.34 cm, 877.61 cm (1), 603.72 cm, 565.14 cm, (4), and 370.33 cm (2). And a sharp spectrum in the area of 3570.24 cm indicates the presence of free -oh and 3427.51 cm indicating -oh bounded, and this is indicating that the dominant compound is ca10(po4)6(oh)2 . While area of 1654.92 cm, 1458.18 cm, and 1421.54 cm indicates the presence of carbonate groups (co3) it can be identified as ca10(po4)6co3 and ca10(po4)6co3(oh)2 which has not been transformed into ca10(po4)6(oh)2 during the sintering process . The results of characterization by sem - edxa shown in figure 9(a) show that the size of hydroxyapatite formed from the synthesis tends to be small and only a few are large . While figure 9(b) shows that the surface of hydroxyapatite is smooth and nonporous, this shows that hydroxyapatite which has synthesis from crab shells can function well as inhibiting tooth demineralization . While in figure 10 the edxa spectrum shows the composition of the synthesis yield was dominated by oxygen (o) up to 59.52%, calcium (ca) up to 23.76%, and phosphorus (p) up to 13.32% . Demineralization of teeth is a process of decomposition of the crystal of ca10(po4)6(oh)2 due to the acidic conditions by releasing ca and po4 ions . Demineralization of tooth causing increased levels of ca and po4 in saliva in direct contact with the tooth . In vitro, the rate of tooth demineralization can be observed through the concentrations of ca and po4 ions in solutions where the tooth was soaked each unit of time . Therefore, increase of po4 ions concentrations in solution a soaked gear can be one of indicators to measure the rate of tooth demineralization . Figure 11 shows the relationship between the soaking time of teeth versus the increase of the ion po4 levels in solution where the tooth was soaked as well; it appears that with the increasing addition of ca10(po4)6(oh)2 into the acetate buffer equals to the rate of demineralization decrease . It is can be altered by the amount of po4 ions in solutions; however the addition of ca10(po4)6(oh)2 ions showed lower amount of po4 ions compared to solutions without the addition of ca10(po4)6(oh)2 . This proves that the ca10(po4)6(oh)2 were synthesized from the crab shell effective for protection against tooth demineralization . The decrease in the rate of tooth demineralization with the addition of ca10(po4)6(oh)2 can also be observed through analyzing the tooth mass reduction in the fifth variation of acetate buffer solution as shown in table 1 . The greater concentrations of ca10(po4)6(oh)2 in the acetate buffer solution were teeth immersed exhibit the smaller mass of teeth in the solution . Based on these results it is concluded as follows.waste of shells crabs (portunus pelagicus) proved to be used as raw material for the synthesis of ca10(po4)6(oh)2 due to high calcium levels which amounted to 66.62% in addition to the abundant existence as waste.the optimum temperature formation of ca10(po4)6(oh)2 is at 800c.ca10(po4)6(oh)2 were synthesized from waste of shell crabs (portunus pelagicus) in vitro effectively inhibiting the rate of demineralization of the tooth where the greater the addition of ca10(po4)6(oh)2 in the solution, the more the inhibiting demineralization of the tooth or the smaller the rate of tooth demineralization in solution . Waste of shells crabs (portunus pelagicus) proved to be used as raw material for the synthesis of ca10(po4)6(oh)2 due to high calcium levels which amounted to 66.62% in addition to the abundant existence as waste . Ca10(po4)6(oh)2 were synthesized from waste of shell crabs (portunus pelagicus) in vitro effectively inhibiting the rate of demineralization of the tooth where the greater the addition of ca10(po4)6(oh)2 in the solution, the more the inhibiting demineralization of the tooth or the smaller the rate of tooth demineralization in solution.
|
Brain injury is caused by intrinsic or extrinsic factors and it can result in various disabilities such as motor, sensory, behavioral, or cognitive dysfunction depending on the area of the brain lesion1 . Cognitive impairment due to brain injury is an important factor affecting patients independent functions and participation in activities2, interfering with their return to daily living and work3 . It can also influence motivation and the ability to participate in rehabilitation programs and interfere with a return to the community . Therefore, for successful rehabilitation, accurate and comprehensive cognitive assessment and treatment are required4 . For cognitive rehabilitation of patients with brain injury, traditional treatment and computer - based cognitive therapy (vr) technology is gaining recognition as a useful tool for cognitive research, evaluation, and rehabilitation5 . Vr systems allow users to interact in various sensory environments and to obtain real - time feedback on their performance using computer technology6 . The virtual environment offered via vr technology makes it possible for patients to participate in activities in settings and environments similar to those encountered in real life7, 8 . In addition, vr tools can be used to record accurate measurements of the subject s performance9 and to deliver greater therapeutic stimulation to users5 . Vr has been used as a tool to diagnose cognitive impairment and as a vehicle to provide new treatments5 . Although the use of vr in cognitive rehabilitation has been increasing, few systematic reviews have investigated the use of vr programs in cognitive rehabilitation and the overall effect of these programs on cognition . Therefore, this systematic review investigated the different types of vr programs used for cognitive evaluation and interventions for patients with brain injury . Studies using vr programs for cognitive intervention were reviewed according to pico (patient, intervention, comparison, and outcome) methods . (virtual reality or virtual or game based virtual reality or computer based virtual reality) and (stroke or cerebral vascular accident or hemiplegia or brain injury or traumatic brain injury) and (cognition or cognitive or memory or attention or executive function). Inclusion criteria were: (1) subjects over the age of 19 years with brain injury; (2) articles written in english; and (3) studies that used vr in cognitive rehabilitation . Exclusion criteria were: (1) subjects who were animals or children; (2) review articles; and (3) 2d computer - based cognitive rehabilitation . Randomized controlled trials (rcts) and crossover studies were scored on the physiotherapy evidence database (pedro) scale12 . Two authors independently assessed the methodological quality of the included studies, and disagreements were resolved by reaching consensus . Memory assessment was the most common study topic, followed by assessments of executive function and attention . A variety of vr programs were used (table 1table 1.analysis of studies of cognitive assessment using vrauthor, yearassessment areatype of vrbrooks et al . Three were rcts24,25,26, one was a crossover study27, and one was a case report28 . Excepting the case report, four studies were assessed using the pedro scale . Two studies24, 25 scored 4, and the remaining two studies scored 326 and 127, respectively . Table 2table 2.analysis of studies with cognitive interventions using vrstudypatientinterventioncomparisonoutcomenmean agetype of vrintensityoutcome measure(s)findingsakinwuntan et al ., 20102469eg 55 cg 54stisim drive system60 min / day, 3 times / week, total 5 weeksnon - computer based cognitive therapyufov testsignificant within group improvements but no significant difference between two groupscaglio et al ., 201228124midtown madness 290 min / day, 3 times / week, total 5 weeks - fdst, bdst, ravlt - ir, dr, rbmt - ir, dr, corsi s block tapping test, corsi s supraspan test - ir, dr, tmt - a, b, phonemic fluency mmse, adassignificant improvements in ravlt - ir and corsis supraspan - ir, drgrealy et al ., 1999271332.38nonimm - ersive vr exercise bicycle25 min / day, 3 times / week, total 4 weeksno treatmentfdst, bdst, digit symbol test, tmt - a & b, auditory learning test, velt, vilt, logical memory, complex figure testeg showed significant improvements in digit symbol test, velt, vilt compared to cgjacoby et al ., 20132512eg 27.83 cg 30.67irex45 min / day, 34 times / week, total 3 weeksconventional otmet - sv, efpteg showed significant improvements in all outcome measures compared to the cgkim et al ., 20112628eg 66.5 cg 62.0irex30 min / day, 5 times / week, total 4 weekscomputer based cognitive therapyk - mmse, tol, vcpt, acpt, word - color test, fdst, bdst, fvst, bvst, vilt, velt, tmt - asignificant difference between experimental group and control group in vcpt and bvsteg: experimental group, cg: control group, met - sv: multiple errands test - simplified version, efpt: executive function performance test, fdst: forward digit span test, bdst: backward digit span test, tmt - a: trail making test - type a, tmt - b: trail making test - type b, velt: verbal learning test, vilt: visual learning test, ufov: useful field of view test, k - mmse: korean version of the mini - mental status examination, tol: tower of london test, vcpt: visual continuous performance test, acpt: auditory continuous performance test, fvst: forward visual span test, bvst: backward visual span test, ravlt: rey auditory verbal learning test, ir: immediate recall, dr: delayed recall, rbmt - the rivermead behavioural memory test, adas: alzheimer s disease assessment scale presents the characteristics of the five studies . Flowchart of the article search and study selection eg: experimental group, cg: control group, met - sv: multiple errands test - simplified version, efpt: executive function performance test, fdst: forward digit span test, bdst: backward digit span test, tmt - a: trail making test - type a, tmt - b: trail making test - type b, velt: verbal learning test, vilt: visual learning test, ufov: useful field of view test, k - mmse: korean version of the mini - mental status examination, tol: tower of london test, vcpt: visual continuous performance test, acpt: auditory continuous performance test, fvst: forward visual span test, bvst: backward visual span test, ravlt: rey auditory verbal learning test, ir: immediate recall, dr: delayed recall, rbmt - the rivermead behavioural memory test, adas: alzheimer s disease assessment scale in this review, the types of vr programs that have been used in cognitive evaluations of patients with brain injury were identified and studies of cognitive interventions were reviewed according to pico methods . In the included studies, the vr programs could distinguish the cognitive disability of patients in comparisons with healthy subjects . Thus, vr could be used as a new assessment method of the cognitive function of patients with brain injury . Therefore, in contrast to conventional cognitive assessments, vr programs can provide consistently accurate measurements of cognitive function . However, some methodological problems were found in the reviewed articles . In most of the studies, the vr tool used was not compared with a standardized assessment tool, and the inter - rater reliability was not measured . The five studies of cognitive therapy using vr all reported positive effects . In the assessment of cognitive function, the vr interventions resulted in improvements in the areas of memory and attention but not executive function . Ben - yishay et al.29 stated that to effectively raise cognitive function, normal attention is needed . If the ability to concentrate on external information is impaired, memory, problem - solving skills, and appropriate behavior may be difficult . Thus, they suggested that the impairment of attention due to brain injury may interfere with the recovery of other cognitive functions, such as memory, executive function, and planning . The results of this systematic review indicate that the cognitive improvement of attention using vr programs will have a positive impact on the recovery of general cognitive function . The advantage of cognitive rehabilitation using vr is that it provides a variety of environments similar to those encountered in real life30 . The results of this review suggest that patients are more motivated in virtual environments than they are in conventional settings . Therefore, vr programs can be expected to lead to an improvement in cognitive function . In vr interventions, patients can be treated in a safe environment compared to real settings . In addition, vr programs can be tailored to the type of injury and easily adjusted to the level of cognitive disability, the complexity of a task, the reaction conditions, and the characteristics and patterns of feedback30 . As vr systems are constantly evolving and becoming smaller and more easily adjustable, they can be expected to provide specialized therapy in new settings, such as patients homes or clinics . These advantages of vr systems can benefit patients who find it difficult to visit health care organizations5 . The results of this systematic review suggest that vr is an effective cognitive therapy for patients with brain injury compared to control therapy ., there was a significant risk of bias with regard to allocation concealment and blinding . Given the heterogeneity of the included studies, the ability to draw conclusions is limited . Well - designed rcts and blind studies will be needed to provide evidence of the benefits of vr on cognitive function.
|
Despite a considerable progress in malaria control in iran over the past few years that led to significant reduction of cases, the disease still remains a major health problem in south and southeastern parts of the country . 2008, afsharpad et al . 2012) and insecticide resistance of anopheles vectors (enayati et al . 2012) are aggravated by continuous influx of imported cases, mostly with plasmodium falciparum, from neighboring countries of afghanistan and pakistan (zakeri et al . The latest checklists of iranian mosquitoes include 28 anopheles species, identified mostly on the basis of morphological features, and a few by dna - based approaches (azari - hamidian 2007). Maculipennis are known to be responsible for transmission of malaria in the country (manouchehri et al . Some important malaria vectors in iran are assumed to be members of species complexes or species groups, which are often difficult to distinguish morphologically . Application of dna - based approaches has resolved some cryptic species in iranian complex species including an . Fluviatilis, however, the identity of some members are still doubtful or were refuted later (azari - hamidian 2007, naddaf et al . This, to great extent, is due to introduction of molecular markers such as its2 and 28s - d3 genes for discriminating the members of this complex species in india (manonmani et al . Biology, variation in behaviors, and role of this species in malaria transmission in different geographical areas of iran has been extensively reviewed by others (eshghi et al . 1976, edalat 19971998, hanafi - bojd et al . 2012). In an early study comparison of its2 sequence of iranian specimens from various localities in south and southeastern iran revealed only species y, which is presumably species t (naddaf et al . 2003), however, rapd - pcr analysis of same specimens revealed two distinct patterns, separating representatives of fars province from other areas (naddaf et al . Analysis of 28s - d3 gene from same populations corroborated rapd results, fars province specimens showed to be identical to species u in india, while individuals from other areas exhibited heterozygocity at the only base pair position that identifies species u and t (naddaf et al . 2010). In addition, in a separate study based on 28s - d3 analysis, species t and species u were reported from jiroft of fars province and chabahar of sistan va baluchestan province, respectively (mehravaran et al . 2011). The aim of this study was to evaluate cytochrome oxidase i (coi) gene alongside 28s - d3 as a diagnostic tool for identification of an . Coi gene sequences have been extensively used for population studies and resolving evolutionary relationship among closely related species groups of insects (lunt et al . 1996) and anopheline mosquitoes (krzywinski and besansky 2003). Variations in this fragment have been exploited as dna barcodes for identifications of culicidae mosquitoes including an . Fluviatilis mosquitoes originated from different localities in south and southeastern areas of iran including fars, hormozgan, kerman, and sistan va baluchestan provinces . The extraction method and identity of some mosquitoes based on its2 and/or 28-d3 genes were described previously (naddaf et al . All the dna samples were initially subjected to allele specific (as)-pcr based on 28s - d3 gene as described by singh et al . The coi gene was amplified using universal primers, ubc6 (5- gga gga ttt gga aat tga tta gtt cc -3) and ubc9 (5-ccc ggt aaa att aaa ata taa act tc-3), designed by simon et al . Each 25l reaction contained 20 pmol of each primer, 2 mm mg cl2, 10 mm tris - hcl, 50 mm kcl, 150m of dntps, 1u of taq, and 2l of dna . Pcr products were purified using a gel band purification kit (pharmacia, piscataway, nj, usa) according to manufacturer s recommendations and later sequenced using the same primers as used for amplification at seqlab laboratory in germany . The sequences were manually edited and corrected using bioedit software, version 7.1.3.0 (hall 1999) and fragments of 474 bp length were selected for analysis . The distances between groups and between individual sequences were calculated, and phylogenetic tree for iranian sequences was generated using the kimura two parameter (k2p) model of neighbor - joining method in a complete deletion procedure using mega 4 software (tamura et al . The sequence data for the coi gene sequences were submitted to genbank with the accession numbers jx020706-jx020729 . Fluviatilis mosquitoes originated from different localities in south and southeastern areas of iran including fars, hormozgan, kerman, and sistan va baluchestan provinces . The extraction method and identity of some mosquitoes based on its2 and/or 28-d3 genes were described previously (naddaf et al . All the dna samples were initially subjected to allele specific (as)-pcr based on 28s - d3 gene as described by singh et al . The coi gene was amplified using universal primers, ubc6 (5- gga gga ttt gga aat tga tta gtt cc -3) and ubc9 (5-ccc ggt aaa att aaa ata taa act tc-3), designed by simon et al . (each 25l reaction contained 20 pmol of each primer, 2 mm mg cl2, 10 mm tris - hcl, 50 mm kcl, 150m of dntps, 1u of taq, and 2l of dna . Pcr products were purified using a gel band purification kit (pharmacia, piscataway, nj, usa) according to manufacturer s recommendations and later sequenced using the same primers as used for amplification at seqlab laboratory in germany . The sequences were manually edited and corrected using bioedit software, version 7.1.3.0 (hall 1999) and fragments of 474 bp length were selected for analysis . The distances between groups and between individual sequences were calculated, and phylogenetic tree for iranian sequences was generated using the kimura two parameter (k2p) model of neighbor - joining method in a complete deletion procedure using mega 4 software (tamura et al . The sequence data for the coi gene sequences were submitted to genbank with the accession numbers jx020706-jx020729 . All the dna specimens from fars province yield only a product of approximately 375 bp length indicative of species u, whereas specimens from hormozgan, kerman and sistan va baluchestan provinces amplified two bands of 375 bp and 128 bp length . Phylogenetic analysis using coi gene grouped individuals from fars province in two distinct clades separate from other iranian individuals representing populations of hormozgan, kerman, and sistan va baluchestan (fig . The mean distance between iranian and indian groups was 1.66%, while the value between fars group and the group comprising other iranian members was 2.06% . The indian group exhibited the same distance (2.06%) with fars group . The highest distance (3.09%) among iranian individuals was between specimens 930 from fars province and 398 from sistan va baluchestan province . Six individuals belonging to two clades (87, 97, 655, and 928) and (92) from fars province showed 100% identity . In addition, ten individuals from other geographical areas including four from koveh (170, 172, 173, and 186) and one from minab (121) in hormozgan province, two from abchekan (392393) in sistan va baluchestan province, and three from kahnouj in kerman province (815, 836, and 839) were 100% identical . Accurate identification of malaria vectors is not only one of the most basic requisite for success of malaria control programs, but also has become an intriguing issue for understanding speciation process and evolution of anopheles mosquitoes . In absence of cytotaxonomic evidence, rapd - pcr methodology and variation in 28s - d3 gene have resolved two potential sibling species in an . We report further evidence for the occurrence of these two sibling species by coi analysis of mitochondrial dna from the same specimens . Anopheles fluviatilis james is a complex of cryptic species; cytotaxonomic studies of polythene chromosomes has revealed three reproductively isolated species in india known as s, t, and u (subbarao et al . 1994). Application of the first dna - based method using its2 gene identified two putative species of x and y that are presumably equivalent to species s and t, respectively (manonmani et al . Later, a complete as - pcr assay based on variations of 28s - d3 gene against chromosomally examined specimens identified all the members of the complex (singh et al . Fluvialitis mosquitoes of iran . However, the same specimens displayed variations in 28s - d3 gene; the individuals from fars exhibited similarity with species u in india whereas individuals from others areas showed heterozygocity at the single nucleotide position that identifies species u and t. the identity of an . Fluviatilis complex in iran became complicated as the heterozygocity in 28-d3 was not reflected in its2 fragment and individuals from fars province exhibited dual identity of t and u based on its2 and 28s genes, respectively (chen et al . Fluviatilis sibling species were not addressed in their study, however, k2p genetic distances between different species of culicidae were reported to be> 2% . In our study, the mean distance between iranian and indian populations was 1.66%, whereas the value between fars group and the group comprising other iranian individuals was 2.06% . The distance between most individuals from fars province and individuals from other areas was> 2% . Two individuals (9192) from fars province exhibited almost equivalent distance with all other members including those (930, 926, 928, 655, 87, and 97) from the same province . Jf966741, unpublished) that showed a high divergence from other sequences and appeared as an out group beyond an . The results of present study were almost concordant with earlier results obtained by rapd - pcr methodology and 28s - d3 analysis (naddaf et al . This study shows that coi gene can be used as a useful tool along other dna markers like 28-d3 gene for dissolving closely related taxa of an . Fluviatilis mosquitoes (by its2 and 28s - d3 genes) from india, iran, and other geographical areas by this genetic marker can bring more insight into taxonomy of this sibling species . This study shows that coi gene can be used as a useful tool along other dna markers like 28-d3 gene for dissolving closely related taxa of an . Fluviatilis mosquitoes (by its2 and 28s - d3 genes) from india, iran, and other geographical areas by this genetic marker can bring more insight into taxonomy of this sibling species.
|
They are found most commonly in the cranial and peripheral nerves, and occurrence in the omentum is very rare . However, there have been some cases reported to develop serious complications and, if there was malignancy, to cause metastasis or recurrence . We presented a case of schwannoma originating from the great omentum, including histological and immunohistological studies . A 55-year - old man was referred to our department for the treatment of a tumor detected close to the stomach by ultrasound . Medical examination including ultrasound had been regularly performed to follow up his gallbladder stone for the past 6 years . Although he had no complaints and symptoms, the tumor had been increasing in size over one year . Abdominal and endoscopic ultrasound showed a 2.0 1.3 cm cystic mass lateral to the wall of the stomach . Its component included an 11.8 5.7 mm elevated lesion (fig . 1, fig computed tomography scan of the abdomen and pelvis showed a 2.6 1.9 cm cystic mass, which was slightly enhanced, and a gallbladder stone (fig . 3). Magnetic resonance imaging demonstrated a hyperintense mass on t2-weighted image . A distance from the stomach wall laboratory tests, including tumor makers, were normal . Under a perioperative diagnosis of cystic tumor in the abdomen and cholelithiasis, we performed laparoscopic resection with vessel sealing system, which revealed a 2.0 cm mass arising from the great omentum, not adherent to other organs . Grossly, the tumor was configured by a well - encapsulated round mass measuring 30 18 15 mm in diameter (fig . Histologically, the spindle - shaped cells were arranged in interlacing bundles and fascicles, together with varying numbers of tumor cells containing various amounts of light brown or grayish pigment (fig . These alternate with looser antoni b tissue, which is comprised of cells showing clear, vacuolated cytoplasm due to lipid accumulation . Immunohistochemically, most of the neoplastic cells reacted moderately to nse, ncam and s-100 protein (fig . Schwannomas are classified as one kind of the peripheral nerve sheath tumors, of which schwannnoma and neurofibroma are the most frequent . Currently, the most precise determination of the tumor's cell type is established by its immunohistochemical profile, ultrastructural features, or both . A tumor composed of cells with distinctly schwannian characteristics schwannomas are known to mainly arise from the peripheral and caranial nerves, the extremities and the retroperitoneum . They are seldom found in the abdomen, especially the extragastrointestinal tract, of which solitaly schwannoma of the great omentum is an extremely rare tumor . In 303 schwannomas reported by das gupta, one case originated from the retroperitoneum, others from the central nervous system and peripheral nerve . In another review of the literature, stout and of these, 37 were in the stomach, 3 in the small bowel, and none in the omentum and the abdominal cavity . Previously published cases of schwannoma in the omentum were collected from a computerized medical literature search (pubmed). Only 6 cases of schwannoma from the great omentum have been observed (table 1). We can see that more cases of schwannoma from the lesser omentum have been recorded than from the great omentum . It is mentioned that the lesser omentum contains a small amount of nerves in almost equal distribution, the great omentum has a paucity of nervous tissue and anatomically consists of fat and lymphatic tissue . We found a case of malignant schwannoma arising from the omentum which demonstrated peritoneal metastasis, and another reported case of the small intestine emphasized poor prognosis since only 2 of 24 patients survived for more than 5 years . Benign schwannomas are also reported to increase in size and to eventually cause complications by compressing other organs or by causing bleeding in or outside the gastrointestinal tract . Pigmented schwannoma is another type of schwannoma, usually arising from the sympathetic nervous system . Additionally abdominal schwannomas cause diagnostic problems because clinical symptoms are uncharacteristic or misleading even if the tumor is large . Ct imaging typically showed a low attenuation mass, peripheral enhancement and cystic degeneration pattern . Mri disclosed schwannoma of low signal intensity on t1-weighted image and high signal intensity on t2-weighted image . In spite of these characteristic, it is difficult to exclude other abdominal tumors, leiomyomas, lymphomas and unspecified sarcomas etc . While previous cases confirm that the tumor may attain a considerable size, bigger than 5 cm or producing symptoms, our case of a schwannoma which was small and asymptomatic is hardly diagnosed . However this tumor showing progression in size is thought to have potential to behave very aggressively despite benign histological features, which stresses the need of more information on this type of tumor and diagnosis . Consequently, histological analysis of the surgical specimen is necessary for a correct diagnosis, and common treatment for schwannoma is surgery . Therefore laparoscopic resection seemed to be the most adequate method to diagnose and rule out malignant tumor as a minimally invasive surgery . The majority of tumors can be safely resected, the surgeon being careful of the dividing feeder vessels because schwannomas are well known as hypervascular tumors . To our knowledge there are no case reports documenting other treatments, including chemotherapy for schwannomas in the abdominal cavity.
|
Coronary artery disease (cad) is a major public health problem worldwide and the single largest cause of mortality in the united states, responsible for one of every six deaths (aha heart disease and stroke statistics, 2010). Cad is caused by atherosclerosis, which is an inflammatory disease that involves multiple cell types, including circulating cells and cells in the vessel wall . Despite advances in risk factor management on an epidemiological level, various blood markers associated with increased risk for death and cardiovascular endpoints have been identified, but currently very few have been shown to have a diagnostic impact or important clinical implications that would affect patient management . Therefore, there is a great need for innovative biomarkers that can assess risk for cad, assess activity of the atherosclerotic process, and guide evaluation of therapy . Several recent studies have suggested that circulating micrornas could be useful as biomarkers for various human disease states, including cancer, acute myocardial infarction [47], heart failure, and chronic vascular disease [8, 9]. Micrornas (mirnas) are a recently recognized class of short (1925 nt), single - stranded, noncoding rnas that regulate an array of cellular functions through the degradation and translational repression of mrnas that contain complementary sequences . More than 1000 human mirnas have been identified, and, in tissues, mirnas regulate the expression of genes involved in critical cellular processes, including differentiation, growth, proliferation, and apoptosis . Importantly, mirnas are now regarded as rheostats that fine - tune expression of proteins involved in just about every process in human cells . Mirnas have been found in tissues, whole blood, serum, plasma, and other body fluids in a stable form that is protected from endogenous rnase activity [3, 12]. Although the biological function of mirna is yet to be fully understood, tissue levels of specific mirnas have been shown to correlate with pathological development of different diseases . Mirnas function as managers in gene regulatory networks, and they are distinct from other biomarkers because they have a pathogenic role in the disease process and are not merely byproducts of the disease state . Thus, mirna expression signatures in tissues and blood have a potential role in the diagnosis, prognosis, and assessment of therapy . In this study, we sought to compare mirna expression in whole blood of patients with angiographically significant cad to that of healthy aged - matched controls . We performed an initial exploratory microarray analysis in 5 cases and controls and then further examined the most highly expressed mirnas in an additional 15 cases and controls . Study participants were recruited as part of the emory cardiology biobank, consisting of 3492 consecutive patients enrolled prior to undergoing elective or emergent cardiac catheterization across three emory healthcare sites, between 2003 and 2008 . Patients aged 2090 years were interviewed to collect demographic characteristics, medical history, and lifestyle habits . Risk factor prevalence was determined by physician diagnosis and/or treatment for hypertension, hyperlipidemia, and diabetes . Coronary angiograms were evaluated independently by two operators, who made visual estimation of luminal narrowing in multiple segments based on a modified form of the aha / acc classification of the coronary tree . Using these data, significant cad was defined as at least one major epicardial vessel with> 50% stenosis, assessed by quantitative coronary angiography . Additionally, we collected whole blood samples from patients with 2 risk factors for cad, but did not have angiographically significant cad . The study was approved by the institutional review board at emory university, atlanta, ga, usa . All subjects provided written informed consent at the time of enrollment . The healthy subject cohort was a random sample of employees from emory university who were fully employed, productive people . These subjects were aged 18 and older, not taking medications, and had not been hospitalized for at least one year prior to participation . Venous blood samples were drawn via antecubial venipuncture into paxgene blood rna tubes and stored at 20c within 24 hours before rna extraction . Mirna was isolated using the preanalytix paxgene mirna isolation kit (qiagen) according to the manufacturer's protocol . Mirna microarray analysis was performed by asuragen, inc ., which uses the affymetrix manufactured genechip mirna arrays . Once labeled, the mirna targets were hybridized overnight onto the microarrays following which the arrays were washed and stained using streptavidin - phycoerythrin (sape). Expression analysis was performed for all small rnas for homo sapiens (e.g., mirna, small nuclear rnas like snorna and scarna) and separately for sanger mirna registry content (mirbase 11.0, http://microrna.sanger.ac.uk/) for homo sapiens . Mirna reverse transcription was performed using the taqman microrna reverse transcription kit (applied biosystems) at 16c for 30 min, 42c for 30 min, and denaturation of the enzyme at 85c for 5 min . The rt reaction was performed at 37c for 1 hour followed by 5 min at 95c . Taqman microrna assays (applied biosystems) were performed using the 7500 fast real - time pcr system at the 9600 emulation run mode . Ct values were converted into copy numbers (copy no . = 2) and normalized to rnu44 . Unpaired student's t - tests were used to compare data . A p value <.05 (two sided) was considered significant . For analysis of microarray expression data, a two- sample t - test was carried out for every gene, followed by multiplicity correction to control the false discovery rate (fdr) at .05 . We initially performed expression profiling of all small rnas (1770 genes, figure 1) in the whole blood samples . Three mirnas passed the fdr cutoff of 0.05: mir-584 (7.9-fold higher in healthy versus cad patients, p = .000103, t - test), mir-542 - 5p (3.9-fold higher in healthy versus cad pts, p = .000168, t - test), and mir-187 * (2.77-fold higher in healthy versus cad pts, p = 8.1 10, t - test). However, signal intensities for mir-542 - 5p and mir-187 * were very low and not detected in most samples . Separately, we performed an analysis of sanger registry mirnas (848 for homo sapiens) in the whole blood samples, but none of the mirnas passed the fdr cutoff of 0.05 . Ten mirnas passed a fdr cutoff of 0.10, but only one (mir-129 - 5p, 1.57 fold higher in healthy patients, p = .000044) of these mirnas had consistently detectable signal across the 10 blood samples . Although we were able to detect some differences in whole blood mirna levels between healthy subjects and cad patients (mir-584, in particular), our microarray data suggest that, similar to other reports, levels of mirnas in the blood are low and microarrays may lack the sensitivity to adequately identify mirnas that might serve as vascular disease biomarkers . Interestingly, among the mirnas that tended to show consistent differences between healthy and cad blood, mirna expression was generally higher in the blood of healthy subjects, a finding previously observed by others . Next, we performed qrt - pcr on rna isolated from whole blood of another 10 patients with angiographically significant cad and 15 healthy subjects . We evaluated the levels of mirnas that, based on our microarray data, were highly expressed in blood and tended to have different levels of expression between the two groups . This analysis included mir-150, mir-584, mir-21, mir-24, mir-126, mir-92a, mir-34a, mir-19a, mir-145, mir-155, mir-222, mir-378, mir-29a, mir-30e-5p, mir-342, and mir-181d . Among these we found that mir-19a, mir-584, mir-155, mir-222, mir-145, mir-29a, mir-378, mir-342, mir-181d, mir-150, and mir-30e-5p were significantly downregulated in the blood of patients with cad compared to healthy subjects (figure 2). Furthermore, we also assessed expression of these 11 mirnas in a cohort of patients who had 2 risk factors for cad, but did not have angiographically significant cad . We found that there was no difference in whole blood mirna expression of this latter group compared to that in patients with significant cad (not shown), suggesting that these mirnas are markers for vascular inflammation rather than markers specific for significant cad . There has been one report that mirna expression in blood may be influenced by medications . Indeed, one of the mirnas that we found to be downregulated in the blood of patients with cad is mir-155, which is known to target the at1 receptor . Therefore, we assessed the impact of medications on expression of mir-155, mir-145, mir-181d, mir-222, mir-19a, mir-342, mir-29a, mir-30e-5p, and mir-378 . We compared the mirna expression levels in the blood of patients with angiographically significant cad or 2 risk factors for cad but not on acei or arb to that in blood of similar patients who were taking at least one of medications . Interestingly, levels of mir-155, mir-19a, mir-145, mir-222, mir-342, mir-30e-5p, and mir-378 (figure 3) were significantly decreased in patients taking acei or arb compared to those who were not, suggesting that these medications may directly modulate expression of these mirnas, or they may influence inflammatory factors that otherwise regulate their expression . Importantly, we did not find that statin use had a significant effect on the levels of mirnas identified in this study (not shown). Several recent studies have indicated that there is a potential role for circulating mirna levels as valuable biomarkers for different disease processes, including cancer, cardiomyopathy, and acute myocardial infarction . In this study, we wanted to address the hypothesis that mirna expression levels in blood could predict the presence of significant coronary artery disease in human subjects . We identified 11 mirnas whose expression was significantly downregulated in patients with angiographic evidence of significant atherosclerosis compared to healthy subjects that were matched for age and gender . In addition, our data suggest that inhibition of the renin angiotensin system by acei or arb use further influences mirna expression in blood . This study confirms previous reports showing differences in circulating mirna levels of patients with cad compared to those of healthy subjects [8, 16]. Our study differs from the other studies in the content of the group of mirnas that were downregulated in patients with cad . We performed this analysis using the paxgene blood rna system because it provides a way to stabilize rna immediately after sample collection and facilitates storage of the samples for a relatively long period of time without compromising rna integrity [17, 18]. Importantly, mrna profiling of whole blood or peripheral mononuclear cells has been previously applied to cardiovascular disease [19, 20], and a relationship has been identified between mrna levels in whole blood and extent of coronary artery disease . Our study extends this work by providing insight into the whole blood expression of mirnas that are potentially involved in regulating these cad genes . In our qrt - pcr analysis of whole blood samples from cad patients, we found similar changes in expression of mir-155 and mir-145 as what has been reported previously . However, we failed to detect changes in other mirnas that were described in this previous report, namely mir-126 and mir-92a . First, we studied whole blood samples, whereas plasma was studied previously . Thus our mirna profile likely reflects intracellular and extracellular mirnas levels in contrast to exclusively extracellular mirnas that would be detected in plasma . Another difference in our study is that we normalized mirna expression to expression of rnu44, a small nucleolar rna that, based on our microarray analysis, we found to be highly and consistently expressed across blood samples from cad patients and controls . This study confirmed the observation made by others regarding the difficulty of using microarray analysis to profile mirna expression in blood samples . Undoubtedly, this is in part due to the limitation of a relatively small sample size for our microarray analysis, as well as reduced sensitivity of the microarray method compared to qrt - pcr . In addition, principal component analysis of our data suggested that two of the mirna profiles for healthy subjects were actually similar to that of the cad patients, suggesting that these individuals may in fact have subclinical vascular inflammation ., we believe that careful selection of patients and well - matched control subjects from a larger group of well - characterized individuals reduced some of the variability in our qrt - pcr analysis . We can only speculate as to why expression of circulated mirnas is generally decreased in patients with cad . It has been hypothesized that levels of circulating mirnas are decreased in vascular disease because they have been taken up into atherosclerotic lesions . The levels of circulating mirnas may be affected by multiple factors, including transcription, processing and stability of the mirnas within circulating cells, as well as the ability of these cells to release mirnas into the plasma . Circulating mirnas may be delivered to cells in the heart or blood vessels through microvesicles, exosomes, or apoptotic bodies . Because our study assessed mirna expression in whole blood, our findings are likely more reflective of changes in mirna transcription or processing rather than release from the circulating cells . It remains to be determined whether downregulation of mirnas in cad patients is directly involved in inflammation or a compensatory response to this process . Based on our observed changes in mirna expression in response to acei / arb therapy, we believe that circulating mirna levels reflect a compensatory response to inflammation . Further experimental studies are necessary to explore the mechanisms by which cad and therapies affect tissue versus circulating mirna levels . In summary, the present study provides insight into whole blood levels of mirnas in patients with cad compared to healthy subjects and demonstrates their potential utility as biomarkers for vascular disease . Validation of the changes in mirna expression observed here in larger studies will be a necessary step to confirm their candidacy as biomarkers and therapeutic targets . We believe that further elucidation of the role that these mirnas play in the pathogenesis and progression of chronic cad will contribute to our understanding of the disease process and lead to new therapeutic and preventative strategies.
|
Among eusocial insects, paper wasps (hymenoptera: vespidae: polistinae) are notable for the diversity of their nest architecture (jeanne, 1975; wenzel, 1991). Many swarm - founding polistine wasps, including most species of the neotropical tribe epiponini, construct envelopes around their brood combs . Comparative and experimental studies suggest that, among other functions, nest envelopes reduce rates of predation and parasitism on wasp brood (london and jeanne, 1998; smith et al ., 2001). However, little is known about the adaptive significance of variation in the materials that wasps use to construct nest envelopes (hansell 1984; wenzel, 1991; cole et al ., 2001). Polybia emaciata is unusual among the polistine wasps because it uses mud, rather than wood pulp or plant fibers, as the main raw material for nest construction (schremmer, 1984). The genus polybia includes 56 described species; of these, only the other three species in the subgenus pedothoeca, and one species in the subgenus furnariana, share the derived trait of mud nest construction (richards, 1978; jeanne, 1991; cooper, 1993). No other swarm - founding polistine wasps are known to build primarily mud nests, although small amounts of inorganic material are sometimes incorporated into the nest paper of other species (wenzel, 1991). The nest of p. emaciata is otherwise typical of the genus (jeanne, 1975; wenzel, 1991), being phragmocyttarus (comprising horizontal layers of comb that are conjoined and enclosed by a continuous envelope) with a single small entrance hole near the bottom of the nest . Numbers of adults in mature colonies are relatively small for the genus, ranging from fewer than 100 up to about 500 adults (richards, 1978; chadab, 1979; strassmann et al ., 1992). Polybia emaciata nests are hard and much more durable than most paper nests of similar size and shape (rau, 1933; richards, 1978). For example, skutch (1971) noted that nests of this species in costa rica were unlike paper nests in that they persisted for several years . The high durability of p. emaciata construction material suggests that the nest itself may provide greater brood protection than paper nests . If so, we hypothesized that the wasps' defensive responses to vertebrate attacks have changed to take advantage of nest durability . We predicted that the nests' protective properties reduced the need for behavioral defenses by p. emaciata workers, relative to paper - nesting polybia species with similar colony and nest sizes . We tested this prediction by disturbing p. emaciata colonies, and comparing the workers' responses to those of simultaneously observed paper - nesting p. occidentalis colonies in the same location . Chadab (1979) surveyed the defensive responses of swarm - founding paper wasps to vertebrate - like disturbances, including tapping on the nest and/or on the supporting vegetation . The most frequently observed response was for dozens to hundreds of workers to rush out onto the nest envelope, sometimes adopting aposematic postures (see also o'donnell et al ., response was seen in the genera angiopolybia, charterginus, leipomeles, parachartergus, polybia, pseudopolybia, and synoeca, and accords with our observations of what appears to be typical epiponine defensive behavior . Weaker exit - nest responses (either requiring several taps, or involving fewer wasps) were seen in species of leipomeles, metapolybia, and protopolybia . Interspecific variation in mature colony size was not a good predictor of the type of defensive response, as species with colony sizes smaller and larger than p. emaciata performed nest exiting defensive behavior . An attack response often coincides with, or quickly follows, the nest exit response and involves workers flying from the nest, striking the intruder, and attempting to sting (hermann and blum, 1981). When paper - using polybia nests are tapped, some of the workers on the nest surface may immediately perform attacks, while large numbers of workers rush out of the nest entrance and stand in alert posture on the envelope (jeanne, 1981; jeanne et al ., 1992). Further tapping elicits additional attacks . Breathing on the nest surface or into the nest results in immediate attack by several to dozens of workers . We discuss the possible adaptive significance of deviations from the typical nest exit that have been documented in several paper wasp species, including p. emaciata . This study was conducted in and near the town of gamboa, panama province, republic of panama (0907n 7942w; 50 m elevation). Observations and manipulations were conducted during the wet season from 1 august to 15 october 1990 and from 3 to 5 july 1998 . Surveys of eusocial wasp colonies during these periods indicated that p. emaciata was among the most abundant swarm - founding wasps in terms of nest density (s.o'd ., unpublished data). Most of the data presented were collected from four colonies of p. emaciata and five colonies of p. occidentalis that had been moved approximately 0.5 km to 1 km from their natural nesting sites to artificial supports to facilitate observation . All subject colonies were moved into a small area (<0.25 ha), with similar amounts of tree cover (one p. occidentalis colony was additionally sheltered by building eaves). All colonies were in place at least 2 weeks before observations on defense behavior were initiated, and all continued to forage and to raise brood (visible through the nest entrance in the lower combs) throughout the observation period . The p. emaciata observation colonies had nests ranging in size from 9 cm long to 22 cm long . The numbers of adult wasps and colony age probably varied positively with nest size, though we did not measure these variables . We also collected data opportunistically from p. emaciata colonies in situ in 1990 and again in 1998 . These nests were located in the gamboa area on thin tree branches from 1.5 m to 5 m above the ground . We disturbed p. emaciata and p. occidentalis colonies in an effort to evoke defensive behavior, using stimuli that elicited nest exit and attack responses in costa rican p. occidentalis (s.o'd . And we disturbed the polybia nests by first tapping on the side of the outer envelope near the middle of the nest for 30 sec while wearing a full bee suit, and we noted the responses of on - nest and in - nest workers . If there was no attack response to tapping, we blew into the nest entrance for 30 sec . Each polybia observation colony was disturbed 10 times over the course of the study period in 1990 . The in situ nests of p. emaciata were tested once each in a similar fashion . We used a non - parametric wilcoxon test for species differences in the probability of immediate attack responses using the four p. emaciata and five p. occidentalis observation colonies . Trials were pooled within colonies and each colony was used as a single data point in the analysis . All observation and in situ polybia colonies contained brood (larvae and/or pupae were visible in the lower combs) when they were tested . Based on forager traffic and on the numbers of wasps exiting the nests during attacks polybia emaciata only rarely (5 occasions out of 40 trials on the observation nests and 2 occasions out of> 15 trials on in situ nests) exhibited a typical polybia attack response within 30 sec when the nest was tapped . Polybia emaciata workers never rushed out of the nest and onto the nest envelope . In all trials where the wasps did not attack in response to the initial mechanical disturbance (within the first 30 sec), some of the workers on the nest surface flew off the nest and departed; the remainder rapidly entered the nest . After the initial disturbance, the nest surface and the lowest layer of comb (partially visible through the nest entrance, fig . Breathing into the nest entrance did not elicit rapid (within 10 sec) attack responses . After continued disturbance within a trial (breath and tapping), p. emaciata workers often attacked violently . In approximately 75% of trials, several dozen individuals rapidly exited the nest, took flight, and struck and attempted to sting the observer's bee veil . The p. emaciata nests were not abandoned following these attacks, and workers later returned to the nests . In contrast, all 50 nest - tapping trials with p. occidentalis resulted in immediate (within 1 sec) exit - nest and attack responses . The species difference in the per - colony probability of nest exit and attack within 30 sec of disturbance was significant (fig . 2; wilcoxon 2-tailed test, z=2.60, p<0.01). Breathing in or on p. occidentalis nests always elicited immediate attack responses, therefore, habituation to tapping and breathing stimuli was not evident over the course of the study in p. occidentalis . The four p. emaciata observation nests suffered no damage while exposed to nearly daily heavy rains for 3 weeks; four of the p. occidentalis observation nests in the same location were visibly damaged by rain during the same period . Even during heavy downpours, the mud nests repelled water much longer than nearby p. occidentalis nests . During one rain shower, the mud nests did not appear waterlogged until 15 min of rainfall had elapsed, while p. occidentalis nests stopped shedding water and became waterlogged after <5 min . The nest fell 2 m to the ground, with only minor damage to its envelope, and the nest was still occupied by adult wasps when it was collected within 12 h of falling . Rather than exiting and attacking within a few sec of vibrational disturbance, p. emaciata workers usually either departed or fled into the nest interior . Unlike many other paper wasps (s.o'd . And r.l.j ., personal observation), p. emaciata failed to respond aggressively to human breath, even when we blew directly into the nest entrance . Polybia emaciata behavioral responses to nest disturbance were unusual among their congeners, and among paper - nesting epiponini with similar colony sizes (s.o'd and r.l.j . Personal observation; chadab, 1979). However, a few species of paper wasps in other genera exhibit similar responses to human disturbance, which chadab (1979) labeled richards (1978) collected a p. emaciata colony in brazil, and the wasps did not exit the nest until 1.5 h after it was collected . Residents of costa rica from several rural communities reported collecting and moving active p. emaciata colonies without being stung, by placing a finger over the nest entrance and plucking the nest from its attachment point . Chadab (1979) noted that one colony of p. emaciata in ecuador had durable nest paper and exhibited defensive retreat responses like those that we recorded; two other p. emaciata colonies had fragile nests and performed exit - nest and attack behavior when jarred . We did not observe qualitative variation in p. emaciata nest durability in panama (> 50 colonies observed; not all were tested for defensive responses). Predation on swarm - founding wasp nests by bats (jeanne, 1970a), birds (skutch, 1971; windsor, 1976), and primates (vecht, 1967) has been documented . We hypothesize that the unusual defensive response of p. emaciata is a behavioral adaptation to its use of mud in nest construction, which may make the nest more resistant than paper to entry by vertebrate predators . It appears that the wasps initially rely on the nest itself, rather than on exit and attack behavior, to thwart vertebrate predators . We suggest that this represents a special type of architectural defense (hermann and blum, 1981), where the defensive behavior of a species has been modified to exploit the properties of its nest material skutch (1959) observed a red throated caracara (daptrius americanus) removing combs from a p. emaciata nest and feeding on the brood in costa rica . Our subject nests often responded with attack behavior after extended disturbances, suggesting that attack can be effective for this species . When attack did come it was sudden and massive, suggesting that it was coordinated by an alarm pheromone, as has been demonstrated for p. occidentalis (jeanne, 1981). Although army ants are among swarm - founding wasps' most frequent predators in wet tropical habitats, preliminary tests on the reaction to eciton army ants did not suggest that p. emaciata's mud nest is effective in resisting these predators (chadab, 1979; s.o'd . Personal observation). The use of mud as a nesting material may have evolved in response to predation pressure, particularly by vertebrate enemies . Similar advantages against hornet (vespa) predation may have favored the evolution of mud construction in hover wasps of the genus liostenogaster (hansell 1984; turillazzi 1991). However, mud construction appears to provide other benefits . Our observations suggest that p. emaciata mud nests were more water repellent, and more resistant to mechanical damage, than similarly sized paper nests . Even if increases in general durability were the original selective advantage driving the evolution of mud construction, the workers' defensive behavior has apparently been secondarily modified . There is variability in average colony size and in the details of nest architecture among species within the mud - nesting polybia subgenus pedothoeca, and in the independently evolved mud - nester p. furnaria (richards, 1978; carpenter et al ., 2000). Of special value to our understanding of the evolutionary significance of the mud - nesting habit will be field studies on the defensive behaviors of the other mud - nesting polybia species . In particular, such studies could establish whether retreat behavior in response to vertebrate disturbance always accompanies the use of mud in nest building . Useful comparisons of defensive behavior could also be made to epiponine paper - nesters with relatively strong nest paper, such as epipona and chartergus . Retreat behavior in response to vertebrate disturbance is not restricted to mud - nesting species of epiponini . Similar responses to human approach or nest vibration have been observed in paper- and secretion - nesting species (protopolybia emortualis, protopolybia exigua, and protopolybia (formerly pseudochartergus) fuscatus) and in cavity - nesting agelaia cajennensis (jeanne, 1970b; chadab, 1979; carpenter et al ., 2001). Paper - nesting polybia jurenei colonies retreated when their nest tree was rubbed, but exited and attacked when the substrate was jarred (s. o'd . These patterns suggest that retreat behavior has evolved convergently in several lineages of epiponini, perhaps in response to particular types of predators . Photograph of a mud nest of polybia emaciata collected july 1998 in gamboa, panama . Box plots showing the range of probabilities of response to nest disturbance with attack within 30 sec by polybia emaciata and p. occidentalis colonies.
|
Human gliomas represent 50% to 60% of all intracranial tumors . According to the world health organization (who) guidelines, gliomas are histologically classified into four grades: pilocytic astrocytoma (grade i), low - grade diffuse astrocytoma (grade ii), anaplastic astrocytoma (grade iii), and glioblastoma multiforme (gbm, grade iv). Both diagnostic technologies and therapeutic strategies the 5-year survival rates of low - grade (grade i~ii) and high - grade (grade iii~iv) glioma patients in china are 75.4% and 18.2%, respectively . Especially, the median survival time for patients with gbm is still only 12 months . Indeed, early diagnosis and prolonging survival in glioma patients remains a great challenge for clinicians in the field of neurooncology . There have been several prognostic factors for glioma patients, such as age, preoperative duration of symptoms, karnofsky performance status (kps) score, histologic grade, tumor necrosis, surgical resection extent, use of postoperative radiation therapy, and, probably, adjuvant chemotherapy . However, these clinical parameters cannot completely account for the observed variation in survival because of the heterogeneity of glioma patients . Thus, there is an urgent need to further investigate the molecular mechanisms of glioma and to identify the effective prognostic indicators for survival prediction.the dna - base excision repair (ber) pathway is responsible for the repair of exogenous and endogenous alkylating and oxidative dna damage, which may lead to carcinogenesis, cell death, and aging if left unrepaired this pathway involves the recognition and removal of damaged bases by a dna glycosylase, followed by incision of the resulting abasic (ap) site by ap endonuclease, dna synthesis by polymerase, and strand ligation by dna ligase . Thus, the ber pathway is an important candidate for intervention into the cellular responses to dna change . N - methylpurine - dna glycosylase (mpg) as a dna repair enzyme is a main component in the ber pathway . In previous study aimed at understanding the significance of initiating lesions removed by the ber pathway, kaina et al . Identified the over - expression of the human mpg in chinese hamster ovary cells . In the n - alkylpurine repair process, mpg is responsible for the glycolytic removal of the modified base, which leads to the formation of apurinic sites . Although n - alkylpurines have not been found to be directly mutagenic, apurinic sites left by this repair process can block replication and lead to mutation . Mpg also participates in the repair of 8-hydroxyguanine and hypoxanthine . Because of the potential role of dna base lesions in mutagenesis and carcinogenesis, a number of studies have been performed to investigate the association of mpg with various human cancers . (1998) detected the increased mpg gene and protein expression in the breast cancer cells versus normal breast epithelial cells by northern analysis, southern blots, immunofluorescence, immunohistochemistry, and western blot analysis . In 2001, sohn et al . Reported that the expression of mpg was increased in high - risk hpv - infected cervical neoplasias and the intracellular distribution of mpg protein was altered, suggesting a role of mpg in carcinogenesis . In an effort to improve the efficacy of cancer chemotherapy by intervening into the cellular responses to chemotherapeutic change, many researchers have been interested in the effects of mpg in tumor sensitivity to the clinical chemotherapeutic agents . As their results, mpg - overexpressing ovarian cancer, osteosarcoma, and breast cancer cells are significantly more sensitive to the clinical chemotherapeutic agents, suggesting that the overexpression of mpg may be a possible gene therapy approach to sensitize tumor cells to the cell - killing effects of chemotherapeutic alkylating agents . The biological mechanism behind the increase of sensitivity to the chemotherapeutic agents in mpg overexpressing cell lines may be that the balance between glycosylase activity, leading to apurinic sites and formation of strand breaks, and subsequent excision repair processes may play an important role in determining cellular cytotoxicity and resistance to alkylating agents . Of our interests, we focus on the involvement of mpg in human gliomas . Recent study has demonstrated that mpg mrna expression was higher in astrocytic tumor tissues than in brain tissues adjacent to tumor, and mpg protein localization in immunohistochemical study was detected only in the nucleus of all tumor tissues, suggesting an mpg's role in human astrocytic tumors and raise the possibility that the altered mpg expression and intracellular localization could be associated with astrocytic tumorigenesis . Tang et al . Further demonstrated that mpg overexpression, together with the inhibition of ber, could sensitize glioma cells to the alkylating agent . However, little is known about the expression level of mpg in human gliomas with different clinical grades and its prognostic significance . To address this problem, we used quantitative real - time pcr, immunohistochemistry assay, and western blot analysis to investigate the expression pattern of mpg gene and protein in glioma specimens and normal control brain tissues . Next, we analyzed the relationship between mpg expression and the glioma stage as well as the survival of patients . This study was approved by the research ethics committee of the institute for functional neurosurgery p.l.a, tangdu hospital, fourth military medical university, xi'an, p.r . China . Written informed consent a total of 128 formalin - fixed, paraffin - embedded specimens of gliomas resected between 2000 and 2010 were retrieved from the archives of the pathology department of tangdu hospital, fourth military medical university, p.r . All the slides were reevaluated according to who classifications by two pathologists, with differences resolved by careful discussion . A total of 76 males and 52 females (1.46: 1) were enrolled in this study, and the median age was 42 years (range, 1271). Thirty - two of the 128 gliomas were classified as low - grade [18 pilocytic astrocytomas (who i) and 14 diffuse astrocytomas (who ii)], and 96 were classified as high - grade gliomas [38 anaplasia astrocytomas (who iii), and 58 primary glioblastomas (who iv)]. The clinicopathological features, and the treatment strategies of all the patients were indicated in table 1 . Paraffin and snap - frozen sections of nonneoplastic brain tissues from 10 patients with intractable epilepsy were also included as controls . Five - year followup was performed, and all patients had complete followup until death . Overall survival time was calculated from the date of the initial surgical operation to death . Patients, who died of diseases not directly related to their gliomas or due to unexpected events, were excluded from this study . In addition, 20 glioma specimens [5 pilocytic astrocytomas (who i), 3 diffuse astrocytomas (who ii), 3 anaplasia astrocytomas (who iii), and 9 primary glioblastomas (who iv)] were snap - frozen in liquid nitrogen and stored at 80c following surgery for mrna and protein isolation . Total rna purified from all 20 glioma tissues and 10 control brain tissues real - time monitoring of polymerase chain reactions (pcrs) was performed using the abi 7900ht (idaho technology, idaho falls, i d, usa). Cdna was synthesized using random primers and oligo 18dt and superscript ii reverse transcriptase (invitrogen). Gene expression was determined using the sybr green i dye (biogene), which binds preferentially to double - stranded dna, and 10 ng of template . Fluorescence signals, which are proportional to the concentration of the pcr product, are measured at the end of each cycle and immediately displayed on a computer screen, permitting real - time monitoring of the pcr . The reaction is characterized by the point during cycling when amplification of pcr products is first detected, rather than the amount of pcr product accumulated after a fixed number of cycles . The higher the starting quantity of the template, the earlier a significant increase in fluorescence is observed . The threshold cycle is defined as the fractional cycle number at which fluorescence passes a fixed threshold above the baseline . The primers 5-gtc cta gtc cgg cga ctt cc-3 and 5-ctt gtc tgg gca ggc cct ttg c-3 were used to amplify 603-bp transcripts of mpg, and the primers 5-ggt ggc ttt tag gat ggc aag3 and 5-act gga acg gtg aag gtg aca g3 were used to amplify 161-bp transcripts of -actin . The pcr profile consisted of an initial melting step of 1 min at 94c, followed by 38 cycles of 15 s at 94c, 15 s at 56c, and 45 s at 72c, and a final elongation step of 10 min at 72c . Fluorescence data were converted into cycle threshold measurements using the sds system software and exported to microsoft excel . Thermal dissociation plots were examined for biphasic melting curves, indicative of whether primer dimers or other nonspecific products could be contributing to the amplification signal . Twenty glioma tissues and 10 control brain tissues were homogenized in lysis buffer [pbs, 1% nonidet p-40 (np-40), 0.5% sodium deoxycholate, 0.1% sodium dodecyl sulfate (sds), 100 ug / ml aprotinin, 100 g / ml phenylmethylsulfonyl fluoride (pmsf), sodium orthovanadate] at 4c throughout all procedures, and sonicated for 70 s, then add 300 g pmsf per gram of tissue and incubate on ice for 30 min, followed by centrifugation at 15,000 rpm for 20 min at 4c . The protein content was determined according to bradford's method, with bovine serum albumin used as a standard . Protein samples (30 g) were boiled with 2 sample buffer containing 5% -mercaptoethanol for 5 min, separated by size on 15% polyacrylamide gel under sds denaturing conditions, and transferred to a nitrocellulose membrane at 90 v for 2 h. the nitrocellulose membranes were stained with ponceau s to assess the efficiency of transfer . Nonspecific binding was blocked by incubation in block buffer (5% nonfat dry milk, 0.05% tween-20, 1 tris - cl - buffered saline) overnight at 4c, the membranes were hybridized with a mouse monoclonal antibody to mpg (ab55461; abcam), then incubated with a horseradish peroxidase - labeled goat anti - mouse igg (1: 500). The bound secondary antibody was detected by enhanced chemiluminescence (amersham life science, little chalfont, uk). Positive immunoreactive bands were quantified densitometrically (leica q500iw image analysis system) and expressed as ratio of mpg to -actin in optical density units . Immunohistochemical assay was performed using the conventional immunoperoxidase technique according to the protocol of the department of neurosurgery, institute for functional neurosurgery p.l.a, tangdu hospital, fourth military medical university, xi'an, p.r . Briefly, following peroxidase blocking with 0.3% h2o2/methanol for 30 min, specimens were blocked with phosphate - buffered saline (pbs) containing 5% normal horse serum (vector laboratories inc ., all incubations with a mouse monoclonal antibody to mpg (ab55461; abcam) at 1: 500 dilution were carried out overnight at 4c . Then the specimens were briefly washed in pbs and incubated at room temperature with the anti - mouse antibody and avidin - biotin peroxidase (vector laboratories inc ., the specimens were then washed in pbs and color developed by diaminobenzidine solution (dako corporation, carpinteria, ca, usa). After washing with water, specimens were counterstained with meyer's hematoxylin (sigma chemical co., st louis, mo, usa). Nonneoplastic brain tissues were used as control tissues, and nonimmune igg was also used as negative control antibody for immunohistochemical staining . Immunostaining was scored by two independent experienced pathologists, who were blinded to the clinicopathologic parameters and clinical outcomes of the patients . 5% scored 0, 625% scored 1, 2650% scored 2, 5175% scored 3,> 75% scored 4; (2) intensity of stain: colorless scored 0, pallide - flavens scored 1, yellow scored 2, brown scored 3 . The staining score was stratified as (0 score, absent), + (14 score, weak), + + (58 score, moderate), and + + + (912 score, strong) according to the proportion and intensity of positively stained cancer cells . All computations were carried out using the software of spss version13.0 for windows (spss inc, il, usa). Randomized block design anova was used to analyze the statistical difference among different tissue types . In the analysis of glioma morbidity for all patients, we used the kaplan - meier estimator and univariate cox regression analysis to assess the marginal effect of each factor . A spearman's analysis was carried out to analyze the correlation between mpg mrna and protein expression levels . The gene expression of mpg normalized to -actin in 20 glioma and 10 control brain tissues was detected by real - time pcr . As shown in figure 2, the expression levels of mpg gene in human glioma tissues were conspicuously higher than those in control brain tissues (p <0.001). Interestingly, mpg gene expression increased with the advancement of who grades from i to iv (p <0.001). The protein expression of mpg normalized to -actin in 20 glioma and 10 control brain tissues was also detected by western blot analysis . As the results, the expression levels of mpg protein tended to increase from the glioma to the normal tissue (figures 3(a) and 3(c)). Mpg expression was highest in grade iv and lowest in grade i (figures 3(b) and 3(c)), indicating a close correlation of mpg protein expression with who grade . There was a significant positive correlation between the expression of mpg gene and protein expression levels from the same glioma tissues (rs = 0.82, p <0.001). The expression and the subcellular localization of mpg protein in 10 nonneoplastic brain and 128 glioma tissues were detected by immunohistochemistry assay . As shown in figure 4, the positive staining for mpg was mainly observed in the nuclei of tumor cells in glioma tissues, which was consistent with the previous study of wang et al . The representative photographs were shown in figures 4(a) and 4(b). Among the glioma specimens, 102 (79.7%) glioma specimens were positively stained for mpg, whereas its immunoreactivities in nonneoplastic brain sections ranged from undetectable to low (figure 4(c)). Additionally, the immunostaining of mpg in nonneoplastic brain tissues is below detection levels of both real - time pcr and western blot . According to the statistical analysis, the expression level of mpg protein in glioma tissues was significantly higher (p <0.001) than that in nonneoplastic brain tissues, which was consistent with the results of western blot analysis . In addition, mpg expression was not significantly affected by the gender and age (both p> 0.05) of the patients . In contrast, the mpg expression was the closely correlated with who grade, as well as kps . The expression levels of mpg protein in glioma tissues with higher who grade (table 1; p = 0.002) and lower kps (table 1; p = 0.01) were significantly higher than those with lower who grade and higher kps . Moreover, we reviewed clinical information of these mpg - positive or -negative glioma patients . During the follow - up period, 100 of the 128 glioma patients (78.1%) had died (24 from the mpg - negative group and 76 from the mpg - positive group). As determined by the log - rank test, the survival rate of patients with positive mpg staining was lower than those without mpg staining (p <0.001; figure 5(a)). The median survival time of patients with negative expression of mpg could not be estimated by statistical analysis because all patients survived better than the overall median level, and those patients with strong positive (+ + +), moderate positive (+ +), and weak positive (+) of mpg were 9.1 1.5 months, 12.3 1.1 months, and 22.6 2.2 months (log - rank test: p <0.001). Furthermore, figure 5(b) shows the postoperative survival curve of patients with glioma and mpg expression after adjusting for age, gender, who grade, and kps . By multivariate analysis (table 2), the loss of mpg expression was a significant (p <0.001) and independent prognostic indicator for patients with glioma besides age, who grade and kps . The cox - proportional hazards model showed that mpg over - expression was associated with poor overall survival . Because of the dismal survival in the patients with glioma, especially in gbm patients, there is an urgent need to find novel specific and effective prognostic markers in order to apply individualized treatments to specifically target the pathophysiologic and molecular properties of glioma patients . In the current study, we investigated the expression of mpg in 128 cases of human glioma and compared the expression with tumor grade and survival rates of patients . Our data demonstrated that mpg gene and protein were both increased in glioma compared to nonneoplastic brain tissue . We found an increased trend of both mpg protein level and gene level from who grade i to who grade iv glioma . These results suggest that the transcriptional and translational activation of human mpg might participate in the tumorigenesis and progression of glioma . Dna in all somatic and germ cells in the body are continuously exposed to exogenous and endogenous alkylating and oxidative agents that result in damage to dna . If dna damage was not repaired, it may lead to genetic mutation, chromosome aberration, aging, and carcinogenesis . The lack of precise dna repair activities may lead to defective embryogenesis, tissue - specific dysfunction, hypersensitivity to dna - damaging agents, premature senescence, genetic instability, and elevated cancer rates . The repair of dna bases damaged by alkylation is initiated in mammalian cells by mpg, as an alkyladenine dna glycosylase . The majority of repair that is initiated by mpg occurs via short - patch ber, a mechanism whereby only one nucleotide is replaced . The majority of base damage induced by methylation is removed by mpg, including the principal adducts 3-mea and 7-meg . It has been reported that the expression of mpg could be induced by viral damage and a variety of dna - damaging agents . For example, the increased expression of mpg gene was studied in breast cancer, cervical neoplasia, and thymic carcinoma in sv 40 t - antigen - expressing transgenic mice . As previous investigation, mammalian cells actively regulated dna repair enzymes and genes during cell proliferation . Dna repair enzymes are expressed in the cell cycle in a defined temporal pattern relative to the induction of dna replication . In brain cells that are not undergoing dna replication, kim et al . Indicated that mpg expression in the brain was relative high in 1 week after birth, and the level remained low in day 400 mature adults, suggesting that brain tissue is terminally differentiated and nonproliferating tissues . It has been demonstrated that dna repair enzymes play an important role in the carcinogenesis of several cancers . Of our interests, mpg was overexpressed in breast cancer up to 24-fold as compared to normal primary breast epithelium, suggesting the role of mpg in breast carcinogenesis . In astrocytomas, kim et al . In 2003 reported that mpg mrna level was significantly higher than that in tumor - adjacent brain tissues . With the similar results, we in this study also found the upregulation of mpg protein and gene in glioma tissues . Additionally, we provide evidence that mpg protein is found in nuclear localization of the glioma tissues, which was consistent with the results of kim et al . . The nuclear localization of mpg in tumor cells of glioma tissues may be suggestive of a role of mpg in the regulation of cell division and cell cycle . Furthermore, the most important finding of this study was the correlation of mpg expression and survival rates of patients . Kaplan - meier and multivariate analysis both showed a significantly worse overall survival for patients whose tumors had high mpg levels, indicating that high mpg protein level is a marker of poor prognosis for patients with gliomas . This is the first investigation to demonstrate the prognostic value of mpg in human cancers . Our data showed the over - expression of mpg gene and protein in human gliomas and also suggested for the first time that mpg be an unfavorable independent prognostic indicator for glioma patients.
|
The prevalence of overweight and obesity among children and adolescents has widely increased worldwide [1, 2], making it one of the most common chronic disorders in this age group and in adulthood . The use of body mass index (bmi) for age to define being overweight and obese in children and adolescents is well established for both clinical and public health applications, because of their feasibility under clinical settings and in epidemiological studies [3, 4]. In children and adolescents, the natural increases in bmi that occur with age necessitate the use of age - sex - specific thresholds . The most widely used growth charts are the centers for disease control and prevention (cdc-2000), the international task force (iotf), and the 2007 growth references for 5 to 19 year olds produced by the world health organization (who-2007). The cdc-2000 growth charts were developed to evaluate the nutritional status of us children and were originated from five cross - sectional representative surveys carried out in the us between 1963 and 1994 . These growth charts are routinely applied to identify children and adolescents with a bmi greater than the 85th or 95th percentiles following the advice of the us expert committee on childhood obesity . However, the appropriateness of an american dataset for defining overweight in young people from other countries is questionable . The iotf reference also uses age - sex - specific bmi percentiles, and overweight and obesity definition corresponds to an adult bmi of 25 and 30 kg / m, respectively, and reflects values in children tracking to overweight and obesity in adults . This reference is based on six large international cross - sectional representative datasets, identifying the bmi values that extrapolate to childhood . The who-2007 growth references were created to replace the national center for health statistics (nchs) references [10, 11]. This reference was constructed using data from the 1977 nchs / who growth reference (1 to 24 years old) merged with data from the 2006 who child growth standards for preschool children (under 5 years of age) using state - of - the - art statistical methods . Although valuable information has been appearing in the literature or online, such as works from the health behaviour of school - aged children study which is mainly related to social determinants of health and well - being among young people, no systematic review has been conducted to understand the worldwide magnitude of the overweight and obesity problem among the adolescent population . Thus, the objective of this study was to systematically review the literature regarding the prevalence of overweight and obesity in adolescents (1019 years old) of both sexes published in the past 12 academic years (19992011). A systematic literature search was performed which ended on june 7, 2012 (see figure 1). The literature search was conducted in medline and scopus using the following mesh terms: overweight; obesity; prevalence; adolescent . In total, 2537 articles were selected . We also reviewed the data on the prevalence of childhood overweight and obesity on the international obesity task force website at http://www.iaso.org / iotf/. To find the articles included in this review, the following inclusion criteria were used: (1) cross - sectional studies conducted in the last 12 years (19992011)when the original study did not report the survey year, it was not included; (2) national and regional representative samples, but articles published on the prevalence of overweight in towns, urban, or rural areas in a country were excluded; (3) weight and height objectively measured; (4) results presented by sex; (5) and for both overweight and obesity prevalence; (6) the definition of overweight and obesity using the (i) cdc-2000, (ii) iotf, and (iii) who-2007 growth references; and (7) studies written in english, spanish, italian, or portuguese . Moreover, if there were more than one national or regional study in the same country, the most recent one was included in the prevalence tables (except for usa and canada, countries in which the most recent data was not included in the tables due to differences in the representativeness of the samples and the impossibility to calculate a single prevalence of overweight and obesity for adolescents' boys and girls; however, no differences in prevalence were observed between studies as it has been indicated in the discussion). The final number of articles included in this review was 39 articles related to overweight and obesity and also a study on the latest statistics on the prevalence of overweight and obesity in south africa . Potentially relevant papers were selected by (1) screening the titles; (2) screening the abstracts, and (3) if abstracts were not available or did not provide sufficient data, the entire article was retrieved and screened to determine whether it met the inclusion criteria . Full - text articles were assessed by 2 authors (m. m. bibiloni and j. a. tur). Any matter of doubt was discussed by at least two of the reviewers (m. m. bibiloni, a. pons, and j. a. tur). A total of thirty - nine articles and a national health report were eligible according to the inclusion criteria established for this review . Table 1 presents a description of the forty studies selected for this review including the continent and the country where it was performed (and region for not national studies), year of publishing, total number of participants in the study, number of adolescents, age range, proportion of girls, and number and definition for overweight and obesity classification used . Nationally representative data were obtained in twenty - five countries (including northern ireland) [1539], and ten countries were represented only by regional data [40, 42, 44, 45, 47, 5054]. Table 2 shows overweight and obesity prevalence from the twenty - five national studies (one of them including data from northern ireland) that were included in this review according to the continent and the country where it was performed, year of survey, study population, age range, criteria used for classifying overweight and obesity used, and along with total data by sex . There were thirty - two different prevalence levels described in the included articles, because five countries presented data using at least two different criteria for overweight and obesity classification [18, 23, 27, 36, 39]. The iotf cut - off was used to classify overweight and obesity in twenty - three of the twenty - five national studies considered in the present review . In general, the prevalence of overweight plus obesity was higher in america [1820], oceania [38, 39] and europe [3037] and lower in africa [1517] and certain parts of asia [2129] (in china and iran the total prevalence was less than 10% by the iotf cut - offs). Overall, about 30% of american adolescents and 22%25% of european adolescents (excepting the czech republic and italian adolescents' which showed a prevalence of 13.7% and 17.9%, resp .) Were overweight or obese . Among oceanian adolescents the prevalence ranged from 23.2% in australia in 2004 to 34.2% in new zealand in 2007 . In africa, the overall prevalence of overweight and obesity was lower than 20% . Among asian adolescents there was a broad range of overweight plus obesity . Using iotf cut - off, the prevalence of being overweight or obese for asian boys and girls ranged from 5.2% in china in 2002 to 36.4% in bahrain in 2000 . Specific prevalence from all the geographic regions was included in this review from three countries: south africa (nine provinces), usa (fifty two states), and italy (five regions). In europe, data from islands of greece (crete) and italy (sicily and sardinia) [48, 49] and spain (balearic islands' archipelago; and the grand canary island) were also included . On the other hand, regional but not national data was found for eleven countries (italy, brazil, india, jordan, denmark, france, hungary, poland, spain [51, 52], switzerland, and turkey). The iotf cut - off was used to classify overweight and obesity in fourteen of the eighteen selected studies that included regional data . In one study, data was presented using only the who-2007 growth charts and in two studies using only the cdc-2000 growth reference [20, 43]. In south africa and usa, substantial geographic variations in adolescent overweight and obesity prevalence varied in south africa from 13.5% in limpopo to 25.5% in kwazulu - natal . In 2007, overweight and obesity varied in usa from 23.1% in utah and minnesota to 44.5% in mississippi . In 2002, the prevalence of overweight and obesity in southern italy and italian islands was higher among boys . In southern italy, the overweight prevalence among girls also was higher than in the other geographic regions . Comparison between the islands from greece (crete), italy (sicily and sardinia), and spain (balearic islands and grand canary island) which were included in this review showed that crete had the highest prevalence of overweight and obesity despite data were presented using different definition . In spain, using the iotf cut - off (data not shown for balearic islands but given by authors), the prevalence of overweight plus obesity was higher in the grand canary island (29.1%) than in the balearic islands (24.7%). According to national data, the prevalence of overweight among boys was 10% higher than girls in nine countries (canada, qatar, taiwan, cyprus, czech republic, germany, greece, italy, australia, denmark, and hungary) and among girls 10% higher than boys in seven of the twenty - five countries (south africa, seychelles, tunisia, mexico, bahrain, saudi arabia, and sweden). The obesity prevalence was 10% higher among boys in seventeen countries (canada, usa, china, iran, israel, qatar, saudi arabia, taiwan, cyprus, czech republic, germany, greece, italy, portugal, sweden, australia, new zealand, denmark, and hungary) and 10% higher among girls in four of the twenty - five countries (south africa, seychelles, tunisia, and bahrain). The aim of this study was to review systematically the literature on overweight and obesity prevalence among adolescents worldwide . Thirty - nine articles and one national health report that met the inclusion criteria were considered . The overweight and obesity prevalence in the included studies ranged widely . In sixteen of the twenty - three countries with national representative data using the iotf cut - off, overweight and obesity prevalence higher than 20% were found, five countries showed prevalence above 30%, and just in two countries prevalence was lower than 10% . Regarding national data, when prevalence was analysed according to sex, it was observed that boys showed a higher prevalence of overweight in almost half of the countries and a higher prevalence of obesity in almost all countries . These results are consistent with previous studies that pointed out a high prevalence of abdominal obesity among boys . Differences of prevalence of overweight and obesity between genders have been related to geopolitical and cultural conditions . Eight articles compared data between 1980s and/or 1990s with 2000s [16, 19, 20, 22, 28, 32, 37, 50] and pointed out an increased prevalence of overweight and obesity in both sexes over this period . However, among australian adolescents the overweight and obesity prevalence increased significantly among boys but not among girls over the period 19972004 . In the australian national children's nutrition and physical activity survey 2007 (ncnpas07), 25% of boys and 30% of girls aged 9- to 13-year - olds and 25% of boys and 23% of girls aged 14- to 16-year - olds were overweight or obese using the iotf criteria . A comparison of the 1985, 1995, and 2007 australian national surveys of 7- to 15-year - olds indicated that australian children are changing body shape to a more central fat distribution . In usa, overweight and obesity prevalence increased by 3% and 18% among usa girls over this period . However, a cross - sectional analyses of a representative sample (n = 4111) of the usa child and adolescent population (birth through 19 years of age) with data from the national health and nutrition examination survey 2009 - 10 (nhanes) indicated a prevalence of overweight and obesity among adolescents aged 12 through 19 years of 15.2% and 18.4%, respectively . Analyses of trends in obesity prevalence for the last two nhanes surveys (2007 - 08 and 2009 - 10) indicated that the prevalence of obesity in children and adolescents has not changed in 2009 - 10 compared with 2007 - 08 . On the other hand, since 2004 the overweight and obesity trends were stabilized or decreased among german adolescents . In usa, substantial geographic disparities in adolescent overweight and obesity were found, with an apparent shift toward higher prevalence in 2007 for several states . Reported that children in northern europe countries generally tended to have lower overweight and obesity prevalence (1020%) than in southern europe (2035%). Also within the same country, the prevalence and trends of overweight and obesity may not be homogeneous according to different geographic regions . In italy, a north - south gradient in overweight and obesity prevalence among boys but also in overweight prevalence among girls was also reported . A higher prevalence of overweight and obesity has been reported in southern spain in both children and adults . It is important to note that the choice of a reference and a cut - off point will determine the absolute prevalence of overweight and obesity and its trends, and hence different information will be obtained from the papers . Argued that the reference they published, supported by the iotf, is less arbitrary and more international than others and recommended its use in international comparisons . Lately, monasta et al . Suggested that the iotf reference and cut - offs could be preferable to identify overweight and obesity both at individual and population levels because they are at least based on a crude association with ill and health later in life, namely, the definition of overweight and obesity at age 18 years . However, the iotf cut - offs have been not recommended for clinical use when assessing an individual child's growth [9, 6264]. Furthermore, recent findings suggested that a universal bmi classification system for childhood and adolescent overweight and obesity may not correspond to a comparable level of body fatness in all populations . The prevalence estimates may not accurately characterize the population groups most at risk of health disadvantages because the correlation of bmi with adiposity is highly variable and dependent on ethnic group [9, 60, 65, 66]. The comparisons of overweight and obesity prevalence need interpretation with caution due to the difference in survey sampling methods, sample sizes, age range of subjects, quality of data in terms of height and weight measurement, and whether national programmes or strategies to tackle overweight and obesity are in place . Even within the same country, the prevalence and trends of overweight and obesity may not be homogenous in view of different ethnicities, geographic regions, and socioeconomic status . Only articles in english, spanish, italian, and portuguese were included in this review . The results of this review allow the following conclusions: (1) overweight and obesity prevalence is high; (2) obesity is higher among boys, although it is not clear which sex has a higher proportion of adolescents with overweight; (3) despite that there is no consensus about criteria to be used to classify adolescents as overweighed or obese, the most frequently used was the iotf reference . However, the international reference charts for monitoring the secular trends in childhood obesity need to be continually refined and evaluated . The results of this study would contribute to guiding health planners and administrators to develop proper tools for adolescent obesity management.
|
Sacubitril / valsartan is a combination of a neprilysin inhibitor and an angiotensin ii receptor blocker, indicated to decrease the risk of cardiovascular death and hospitalization for heart failure in patients with chronic heart failure.a patient previously stable on atorvastatin developed severe rhabdomyolysis and an elevation of transaminases within 26 days of initiation of sacubitril / valsartan . Rhabdomyolysis is a syndrome characterized by skeletal muscle cell damage, leading to elevated creatine kinase (ck), lactate dehydrogenase (ldh), and aspartate aminotranferase (ast), which can result in severe sequelae, including renal failure, cardiac arrhythmia, hyperthermia and death . Associated elevations in transaminases may be seen, even in the absence of significant liver injury . Clinically, rhabdomyolysis classically presents with muscle pain, weakness and dark, red or tea - colored urine; however, less than 10% of patients will demonstrate all three components of this triad . Rhabdomyolysis may be triggered by hereditary and/or acquired mechanisms, with approximately 75% of initial episodes being a result of acquired causes . In particular, a large number of prescription drugs and drugs of abuse can cause rhabdomyolysis, with statins being one of the top three prescription drugs most commonly responsible for rhabdomyolysis for this syndrome . Myopathy and myositis have been reported in conjunction with all of the currently available statins and are considered to be a class effect of these medications . In addition, it has been recognized that statin - associated muscle complaints are dose - related and drug drug interactions that cause an elevation of statin levels have been identified . Subgroups of patients at greater risk of statin - associated muscle pathology have been identified and include age> 70 years, impaired renal function, and impaired hepatic function . Entresto is a combination of sacubitril, a neprilysin inhibitor, and valsartan, an angiotensin ii receptor blocker (arb), indicated to decrease the risk of cardiovascular death and hospitalization for heart failure in patients with chronic heart failure (new york heart association [nyha] class ii sacubitril / valsartan is usually administered in conjunction with other heart failure drug regimens instead of an angiotensin - converting enzyme inhibitor (acei) or another arb . The commonly occurring (5%) adverse reactions reported are hypotension, hyperkalemia, cough, dizziness, and renal failure [6, 7]. Sacubitril / valsartan has not been associated with rhabdomyolysis and is commonly used in patients who are also receiving statin therapy . A 63-year - old guyanese woman with hypertension, hyperlipidemia, congestive heart failure (chf), atrial fibrillation, and peripheral vascular disease presented to her primary care provider s office with a complaint of an episode of weakness at home associated with general malaise . She was receiving atorvastatin 40 mg daily, carvedilol 25 mg twice daily, digoxin 0.125 mg daily, furosemide 40 mg daily, spironolactone 25 mg daily, rivaroxaban 15 mg daily, and sacubitril / valsartan 24/26 mg twice daily . She was initiated on sacubitril / valsartan 22 days before her clinical presentation and had been on all of her other concurrent medications for more than 1 year . On the review of systems, the patient reported generalized weakness, pain in her knees, and an ill - defined stinging pain in the skin of her arms and legs . Her physical examination was non - focal, with no muscle weakness or tenderness of either the skin or muscles noted . Laboratory tests performed on presentation were significant for elevated ast / alanine aminotransferase (alt) of 351 u / l/131 be having a reaction to her statin therapy prescribed for hyperlipidemia and therefore the atorvastatin was withheld . She was scheduled to return in 4 days for repeat laboratory testing and re - evaluation . When the patient returned in 4 days, she complained of dark urine, generalized weakness, and increased muscle and skin pain throughout her body . She was then found to have rhabdomyolysis, with ck at 58,349 u / l (> 50 the upper limit of normal). Sacubitril / valsartan was stopped at this time as it was the only new medication in her regimen . The ck level decreased steadily and her symptoms resolved over the course of a 5-day hospitalization (fig . 1). Her renal function was preserved throughout and her bilirubin and transaminases briefly increased and also subsequently steadily decreased (figs . 2, 3). Barr virus, hepatitis a, herpes simplex virus, hiv, and cytomegalovirus (cmv). Barr virus, and herpes simplex virus, and had negative hepatitis a and b, hiv, hsv . And cmv tests.fig . Ast aspartate aminotransferase, alt alanine aminotransferase creatine kinase values during and post hospitalization . Ast aspartate aminotransferase, alt alanine aminotransferase by 23 days after her initial presentation, the patient no longer had any muscle or skin pain and her ck and liver function test (lft) levels were completely normalized . The patient has not had any reoccurrence of rhabdomyolysis and elevated transaminases for 46 days, and her bilirubin and transaminase levels also returned to normal (figs . 2, 3). One week later, the patient was started on an alternate statin at a low dose (rosuvastatin 5 mg) and the ck levels and lfts have remained stable . This patient had been on a variety of statins for more than 7 years, including atorvastatin, simvastatin, and rosuvastatin . Her baseline ck and lfts were normal prior to the initiation of sacubitril / valsartan . She had previously experienced two transient elevations in ck, to a maximum of 1608 u / l, while hospitalized for an implantable defibrillator infection and explanation complicated by an acute chf exacerbation and a recurrent chf exacerbation in the 3 years prior to the current admission . Her ck levels returned to normal after her acute illnesses, without change in her lfts . In this case, the immediate cause of her rhabdomyolysis was unknown, but the new medication in her profile seemed to be the likely trigger . Due to the severity of her rhabdomyolysis the naranjo adverse drug reaction probability scale score was 5, making it probable that the adverse drug reaction was precipitated by sacubitril / valsartan . The drug interaction probability scale score was 3, consistent with a possible interaction as a cause for the reaction, with sacubitril / valsartan as the precipitant drug and atorvastatin as the object drug . Of note, one of the concurrent medications, carvedilol, is a p - glycoprotein inhibitor that may increase the serum concentration of atorvastatin, a p - glycoprotein substrate; however, the patient was stable on this combination for 7 years before sacubitril / valsartan was initiated . None of the other medications taken by this patient are known to cause rhabdomyolysis or an elevation in transaminases . A literature search regarding a drug interaction between sacubitril and statins yielded no reports of rhabdomyolysis with statins . As per a recent study, coadministration of sacubitril / valsartan with atorvastatin led to a twofold increase in the maximum concentration (c max) of atorvastatin and its metabolites . In addition, the us and canadian package inserts of sacubitril / valsartan cite in vitro data showing sacubitril inhibiting organic anion transporting polypeptides (oatp) 1b1 and 1b3, resulting in increased c max and area under the curve (auc) of atorvastatin with coadministration of sacubitril / valsartan [6, 7]. The canadian version of the product insert further states that sacubitril / valsartan may increase the systemic exposure of oatp1b1 and oatp1b3 substrates, such as statins . Sacubitril / valsartan increases the c max of atorvastatin and its metabolites by up to twofold, and auc by up to 1.3-fold . The canadian insert recommends that sacubitril / valsartan must be coadministered cautiously with statins, especially simvastatin, a sensitive oatp1b1/1b3 substrate, and a decrease in dose of simvastatin and atorvastatin may be considered when coadministered with sacubitril / valsartan . The interaction between atorvastatin and sacubitril is mentioned in the us product package insert as a theoretical possibility . There is currently no recommendation to increase monitoring or empirically decrease the dose of any statin on initiation of sacubitril / valsartan . A number of medications are known to inhibit oatps and have been shown to increase statin plasma concentrations . Many single nucleotide polymorphisms (snps) have been found within the slco1b1 and/or slco1b3 genes encoding oatp1b1 and oatp1b3 proteins, respectively, and were shown to effect the pharmacokinetics and/or pharmacodynamics of statins [12, 13]. The clinical consequences of the drug interactions may vary based on the genetic variation in oatp - encoding genes and inhibition of oatp function . The slco1b1 * 1b haplotype appears to be associated with enhanced hepatic uptake and reduced plasma concentrations of oatp1b1 substrates . Discontinuation of the statin alone did not result in a decrease in the patient s lfts . It was not until sacubitril / valsartan was also discontinued, and treatment for rhabdomyolysis was initiated, that the patient s symptoms began to improve and her ck and lfts returned to baseline . This could be due to either a direct effect of sacubitril / valsartan or the increased serum concentration of atorvastatin, as described in the literature . Because of the above - stated pharmacodynamics, we believe that the more likely mechanism is the increased serum concentration of atorvastatin . Currently, there is no recommendation regarding the initiation or continuation of statins in patients with nyha class ii iv heart failure as there is insufficient information on which to base recommendations for or against statin treatment . In these patients, the choice of statin dose, and using a statin for cardiovascular risk reduction benefit, must be weighed against adverse effects, drug drug interactions, precautions and contraindications to statin therapy . We would have liked to have arranged slcob testing for the patient but were unable to . Further research will be useful in identifying patients at risk for this adverse reaction, and will likely include genetic testing . This case of severe rhabdomyolysis should stimulate further investigation of the potential negative effects of the initiation of sacubitril / valsartan in patients receiving statin therapy . Since sacubitril / valsartan is targeted for patients with heart failure, we predict that this would comprise a large number of the candidates for treatment . We recommend consideration of obtaining baseline ck levels and lfts and close observation of patients . In this case, rhabdomyolysis developed within 3 weeks of initiation of sacubitril / valsartan and evaluation within a shorter time frame may be appropriate . Future reports of this reaction may help to define high - risk patients, but it should be noted that our patient had no known high - risk characteristics for the development of rhabdomyolysis, except for prior mild elevations of ck during hospitalizations for chf exacerbations . We encourage the reporting of any similar reactions to the us fda, the manufacturer, and the medical community . Eve s. faber, madhavi gavini, ronald ramirez and richard sadovsky declare that they have no conflicts of interest that are directly relevant to the content of this report . A copy of the written consent may be requested for review from the corresponding author.
|
The nlrp3 inflammasome, a member of the nlr family, is a key player in the production of uric acid - mediated il-1 and is an important cytoplasmic protein complex involved in gouty inflammation (12). Although the precise pathogenic mechanism of gout has not been clearly determined, several crucial proteins such as the purinergic receptor p2x ligand - gated ion channel 7 (p2x7r) (345) and caspase activation and recruitment domain 8 (card8) (67) proteins are known to be responsible for the pathogenesis of gout . Recent single - nucleotide polymorphism (snp) studies suggested that genetic alternations of several target molecules such as card8 and p2x7r contribute to the process of nlrp3 inflammasome activation . Genetic variants of card8 were identified to play a role in the pathogenesis of a variety of inflammatory diseases, such as rheumatoid arthritis (ra) (8) and inflammatory bowel disease (ibd) (9). Chen et al . (6) demonstrated a significantly different genotypic distribution of the card8 rs2043211 polymorphism between gout and control patients in the chinese population . Another candidate gene involved in gouty inflammation might be p2x7r, whose protein product binds with atp and induces the efflux of k ions through the p2x7r channel from cells, finally triggering activation of the nlrp3 inflammasome (34). A loss - of - function (1513 a> c) snp of the p2x7r gene affects atp - induced cellular functions such as apoptotic cell death (10) and il-1 release (11). More evidence to support the intimate relationship of p2x7r gene polymorphisms with autoimmune diseases are the demonstrated links between p2x7r polymorphisms and ra and systemic lupus erythematosus (sle) (1213). However, there are no available data linking p2x7r snps with gout . Here, we investigated the association of p2x7r rs3751142 and card8 rs2043211 polymorphisms with the susceptibility and clinical manifestations of gout in the male korean population . A total of 242 male gout patients fulfilled the preliminary criteria for classification of primary gout proposed by the american college of rheumatology (14) and a total of 280 healthy male controls were consecutively enrolled in this study . Clinical and laboratory variables, including age at the time of study, disease onset age, body mass index (bmi), disease duration, and serum uric acid level were identified by individual interviews with each patient and medical record review . Medications including corticosteroids, non - steroidal anti - inflammatory drugs (nsaids), colchicine, allopurinol, and benzbromarone that were used for gout treatment within one month of the study onset were evaluated through medical record reviews . The study protocol was reviewed and approved by the institutional review board / ethics committee at each medical center that participated in this study . Assay reagents for rs3751142(c> a) in the p2x7r gene and rs2043211(a> t) in the card8 gene were designed by applied biosystems (applied biosystems, foster city, ca, usa). The reagents consisted of taqman mgb probes (fam and vic dye - labeled). The reaction in a 10 l total volume was optimized at 0.125 l 40x reagents, 5 l 2x taqman genotyping master mix (applied biosystems) and 2 l 50 ng genomic dna . Pcr conditions included one cycle at 95c for 10 minutes followed by 40 cycles at 95c for 15 seconds and 60c for 1 minute . The pcr was performed using the abi plus (applied biosystems) system and the samples were read and analyzed using abi plus (applied biosystems) software . The reference sequence was based on the sequence of human chromosome 12, 12q24 for the p2rx7 gene, and human chromosome 19, 19q13.33 for the card8 gene . Snp, single nucleotide polymorphism; p2x7r, purinergic receptor p2x ligand - gated ion channel 7; card8, caspase activation and recruitment domain 8 . Clinical parameters are described as the median with interquartile range (iqr) or the number with percent (%). The hardy - weinberg equilibrium for gout patients and controls was assessed using a web - based calculator (http://www.had2know.com/academics/hardy-weinberg-equilibrium-calculator-2-alleles.html) (15). The genotypic frequency of each gene was calculated and assessed using the chi - square and fisher s exact tests, if appropriate . Both kolmogorov - smirnov and shapiro - wilk analyses were tested to identify normality of data distribution, which did not show a normal distribution . The kruskal - wallis test was used to compare parametric parameters such as age, onset age, disease duration, bmi, and serum uric acid among the three genotypes of each gene . Logistic regression analysis adjusted with age was applied to test whether the combined p2x7r rs3751142 and card8 rs2043211 genotype influenced the risk of gout development compared to those in controls . The results are described as the odds ratio (or) with a 95% confidence interval (ci). All patients provided written informed consent, and the protocol of this study was approved by the institutional review board (irb) of daegu catholic university medical center (irb no . The authors assert that all procedures contributing to this work comply with the helsinki declaration of 1975 and its later amendments . A total of 242 male gout patients fulfilled the preliminary criteria for classification of primary gout proposed by the american college of rheumatology (14) and a total of 280 healthy male controls were consecutively enrolled in this study . Clinical and laboratory variables, including age at the time of study, disease onset age, body mass index (bmi), disease duration, and serum uric acid level were identified by individual interviews with each patient and medical record review . Medications including corticosteroids, non - steroidal anti - inflammatory drugs (nsaids), colchicine, allopurinol, and benzbromarone that were used for gout treatment within one month of the study onset were evaluated through medical record reviews . The study protocol was reviewed and approved by the institutional review board / ethics committee at each medical center that participated in this study . Assay reagents for rs3751142(c> a) in the p2x7r gene and rs2043211(a> t) in the card8 gene were designed by applied biosystems (applied biosystems, foster city, ca, usa). The reagents consisted of taqman mgb probes (fam and vic dye - labeled). The reaction in a 10 l total volume was optimized at 0.125 l 40x reagents, 5 l 2x taqman genotyping master mix (applied biosystems) and 2 l 50 ng genomic dna . Pcr conditions included one cycle at 95c for 10 minutes followed by 40 cycles at 95c for 15 seconds and 60c for 1 minute . The pcr was performed using the abi plus (applied biosystems) system and the samples were read and analyzed using abi plus (applied biosystems) software . The reference sequence was based on the sequence of human chromosome 12, 12q24 for the p2rx7 gene, and human chromosome 19, 19q13.33 for the card8 gene . Snp, single nucleotide polymorphism; p2x7r, purinergic receptor p2x ligand - gated ion channel 7; card8, caspase activation and recruitment domain 8 . Clinical parameters are described as the median with interquartile range (iqr) or the number with percent (%). The hardy - weinberg equilibrium for gout patients and controls the genotypic frequency of each gene was calculated and assessed using the chi - square and fisher s exact tests, if appropriate . Both kolmogorov - smirnov and shapiro - wilk analyses were tested to identify normality of data distribution, which did not show a normal distribution . The kruskal - wallis test was used to compare parametric parameters such as age, onset age, disease duration, bmi, and serum uric acid among the three genotypes of each gene . Logistic regression analysis adjusted with age was applied to test whether the combined p2x7r rs3751142 and card8 rs2043211 genotype influenced the risk of gout development compared to those in controls . The results are described as the odds ratio (or) with a 95% confidence interval (ci). Statistical analyses were performed using ibm spss statistics 19.0 software (ibm corp ., armonk, ny, usa). All patients provided written informed consent, and the protocol of this study was approved by the institutional review board (irb) of daegu catholic university medical center (irb no . The authors assert that all procedures contributing to this work comply with the helsinki declaration of 1975 and its later amendments . The mean age was 55.0 (iqr 45.063.0) years for gout patients and 45.0 (iqr 41.053.0) for controls, which was significantly different between two groups (p <0.001). Data were expressed as with interquartile range (iqr) for continuous variables and number (%) for categorical variables . No genotypic deviations of rs3751142(c> a) in the p2x7r gene and rs2043211(a> t) in card8 based on the hardy - weinberg equilibrium were noted for gout or control patients (p> 0.05). Table 3 shows that a frequency difference of alleles and genotypes for rs3751142(c> a) and rs2043211(a> t) was not found between gout or control patients . Under the recessive comparison model (cc vs. ca / aa in p2x7r and aa vs. at / tt in card8), genotypic frequency differences between the two groups were also not detected at each snp (p> 0.05 of both snps). There were no differences of clinical variables according to genotypic distribution of p2x7r rs3751142 and card8 rs2043211 . In a comparison model sub - analysis for onset age (30 vs.> 30 years) and serum uric acid level (7.0 vs.> 7.0 mg / l), genotypic differences of each clinical parameter were not observed at the two snps (data not shown). Rs3751142 (c> a) in p2x7r gene and rs2043211(a> t) in card8 gene . A pair - wise comparison of p2x7r rs3751142 and card8 rs2043211 genotype combinations showed that a trend toward higher risk of gout development was identified in subjects who were heterozygous for the ca p2x7r rs3751142 genotype and recessive homozygous for the tt card8 rs2043211 genotype compared to the cc / aa combination (p = 0.056, or = 2.618, 95% ci 0.975 - 7.031) (table 5). The statistical analysis was performed using logistic regression analysis after adjustment with age . Or, odds ratio; ci, confidence interval . The main objective of this study was to investigate whether genetic variability in the p2x7r rs3751142 and card8 rs2043211 genes was involved in the process of nlrp3 inflammasome activation, which might influence susceptibility for the development of gout . This study identified that card8 rs2043211 was not associated with increased gout risk, which is in contrast to the known difference of genetic distribution of this snp in the chinese and european gout population (67). As far as we know, this study is the first to determine genetic association between the p2x7r snp and gout patients, revealing that p2x7r polymorphism did not increase the risk of gout in our study population . The nlrp3 inflammasome is a cytoplasmic protein complex that activates caspase-1, inducing the maturation and secretion of il-1, which is associated with gout pathogenesis (12). The mechanisms by which signaling pathways activate the nlrp3 inflammasome are not clearly determined; however, it is known that cytoplasmic k efflux from the cell through the p2x7r channel in response to danger signals allows for nlrp3 inflammasome activation (34). Similarly, msu crystals, atp, and asbestos are known to induce inflammasome activation by decreasing intracellular k levels (16). The p2x7r gene is markedly polymorphic and includes at least 12 non - synonymous snps in the coding region (17). P2x7r snps that encode glu496ala or ala348thr substitutions are most commonly found to be associated with il-1 secretion capacity (1117). The loss - of - function (1513 a> c) snp of p2x7r gene induced lower atp - mediated k ion efflux, leading to reduced il-1 levels in monocytes (11). (18) recently suggested the possibility that p2x7r is a key regulator for the production of il-1 by msu crystals during acute gouty arthritis . Human myeloid leukemic kg-1 cells contain several snps of the p2x7r gene (19). Among them, kg-1 cells with rs3751142 a revealed neutral effect on p2x7r function . However, there is no evidence as to whether the p2x7r polymorphism has a potent influence on the development of gout . In our data, a minor allele frequency (maf, a allele) of p2x7r rs3751142 in gout and control patients was 0.132 and 0.161, respectively, which are more compatible to those in the dbsnp rs3751142 (http://www.ncbi.nlm.nih.gov/snp/snp_ref.cgi?locusid05027). This study found that p2x7r rs3751142 was not a genetic risk factor associated with gout susceptibility . The activation of the nlrp3 inflammasome, which is comprised of multiple cytoplasmic proteins including nlrp3, an asc protein, and caspase-1, is completed through the binding of the pyd of nlrp3 with the pyd of asc, which is followed by the recruitment of procaspase-1 by linkages of each card within the two proteins . Card8 was shown to be a negative regulator of nuclear factor-b (nf-b) and caspase-1 activation (2021), which implicates a role in the suppression of nlrp3 inflammasome activation . The rs2043211 snp in exon 5 of the card8 gene is a nonsense mutation resulting in the production of a truncated protein . Although the functional role of polymorphic card8 within the nlrp3 inflammasome is complicated, genetic variants of card8 rs2043211 contribute to an enhanced inflammatory response in inflammatory diseases such as ra and ibd through increased expression of il-1 (8922). Mckinney et al . (7) demonstrated that the prevalence of card8 rs2043211 was different between gout and control patients in the european and polynesian populations (or 1.11, p = 0.023 and or 1.15, p = 0.078, respectively). Another case - control study showed that the maf (a allele) card8 gene was shown to have an increasing trend relative to the t allele in the chinese male population (or = 0.084, p = 0.08) (6). However, our study revealed no association of card8 rs2043211 with the presence of gout in korean study population . The frequency of maf (t allele) is at 0.457 in gout and 0.452 in control patients, which is similar to the frequency in the new zealand polynesian (0.499 in gout and 0.439 in control) and chinese (0.498 in gout and 0.463 in control) patients, whereas a lower frequency of maf was noted in the european population (7). Based on conflicting data for card8 rs2043211 between these three studies, the functional role of the card8 gene in gout susceptibility has not been clearly determined . Therefore, the distinct role of the card8 gene in the pathogenesis of gout should be considered in a diverse ethnic study population . First, the lack of completeness for clinical information of control subjects is an important weakness in our study . This study used genomic dnas provided by the biobank of wonkwang university hospital, korea as control group samples . We were just able to identify a part of demographic data including gender and age . Second, this study did not perform functional analysis for genotypes in each target gene . As shown disparity of genetic susceptibility of gout in several ethnic groups (67), it is important to identify functional performance of each gene to understand the role of p2x7r and card8 snps in our study population . It is noted that the p2x7r and card8 proteins are closely involved in activation of the nlrp3 inflammasome and il-1 expression, which could explain their role in the pathogenesis of gout (12). Our study demonstrated that the p2x7r rs3751142 and card8 rs2043211 genetic variants were not implicated in the development of gout in the male korean population . However, we found that in a pair - wise comparison of the ca / tt p2x7r and card8 genotype combination was shown to have an increased trend for the risk of gout (or = 2.618, p = 0.056). In conclusion, this study provides evidence that the interaction of msu crystal - mediated p2x7r with card8 may be at least in part responsible for the pathogenesis of gout.
|
Isolated involvement of the appendix in crohn's disease is reported to be 0.2% to 1.8%, and is usually associated with ileocaecal crohn's disease in 25% of ileal and 50% of caecal disease . While appendicitis in a patient who was previously diagnosed to have ileocaecal crohn's may be managed with appendicectomy and ileocaecal resection, appendicectomy alone when performed for appendicitis in a patient with unsuspected ileocaecal crohn's disease could lead to postoperative complications including enterocutaneous fistula . A young female patient who underwent appendicectomy elsewhere for acute appendicitis presented to us with a persistent enterocutaneous fistula of 6 weeks duration . She had complained of general ill health and occasional altered bowel habits for 6 months prior to the acute appendicitis presentation . Our investigations, including a ct scan, suggested the possibility of ileocaecal crohn's disease . She underwent excision of the enterocutaneous fistula and ileocaecal resection, and histopathology of the resected specimen confirmed crohn's disease . In the postoperative period she received mesasalazine . When last seen 2 years later during her regular follow - up, she was found to be in good health . The possibility of ileocaecal crohn's disease should be considered in patients presenting with unexplained postoperative enterocutaneous fistula following appendicectomy . A high index of clinical suspicion is required to make a prompt diagnosis and institute appropriate further treatment in form of ileocaecal resection . Crohn's disease is a chronic inflammatory condition that may involve the entire gi tract . Histological features include granuloma, lymphoid aggregates, fissures and ulcers extending into muscularis propria, and transmural inflammation . Crohn's disease has been reported to be the cause of acute appendicitis in 0.2% to 1.8% of all the appendicectomies in some series . Operations described in the literature for crohn's disease of the appendix include appendicectomy with caecectomy and ileocaecal resection . However, patients who undergo appendectomy alone are at the risk of complications including enterocutaneous fistula in 34% to 58% of the cases a 24-year - old unmarried female patient presented to us with a persistent fistula in the right iliac fossa following an appendicectomy done in another hospital 6 weeks previously . On further questioning, she informed us that she had presented to this hospital with a 2-week history of abdominal pain, confined to the right lower abdomen . She complained of general ill health and occasional altered bowel habits for 6 months prior to this acute episode . An enquiry with the doctors who had initially seen her revealed that at the time of presentation for acute appendicitis she was quite unwell with fever, tachycardia, and dehydration . Her abdomen was tender all over with guarding, more pronounced over the right lower half . An x - ray of her abdomen showed a few fluid levels and an ultrasound scan revealed free fluid in the abdomen with an associated right iliac fossa mass . A diagnosis of pelvic peritonitis secondary to acute appendicitis was made by the physicians, and she was taken up for surgery after adequate resuscitation . There was pus in the abdomen with an appendicular mass, and the appendix appeared oedematous, thickened, and congested . The abdomen was closed after placing a drain, which was removed on the 3 post - operative day . In spite of antibiotic administration she was managed conservatively with antibiotics and anti - inflammatory medication and eventually improved, except for a persistent purulent discharge from the wound . She then decided to seek our opinion and was admitted under our care for further investigation and management . The appendicular histopathology was retrieved from the previous hospital and revealed transmural inflammation with granulomas suggestive of crohn's disease . A computerized tomography (ct) scan of the abdomen carried out in our hospital showed pericaecal collection with an inflammatory mass in front of the caecum (fig . The abdomen was surgically explored through the previous incision after excising the fistula leading into the caecum . An inflammatory mass associated with the caecum was noted . The appendicular stump had not healed, and was draining into a cavity which was communicating with the wound, indicating a complex enterocutaneous fistula . A limited right hemicolectomy was carried out and continuity established with a primary anastomosis of macroscopically - appearing healthy bowel of the ascending colon and terminal ileum . A specimen of the resected caecum revealed the cobblestone appearance of the mucosa, strongly suggesting the possibility of underlying caecal crohn's disease (fig . The histology was reported as inflammatory bowel disease (ibd) consistent with crohn's disease (fig . She was referred to a gastroenterologist and was being treated with mesasalazine and a regular annual colonoscopy . When last seen at two years post - surgery she continued to remain in good health . Limited right hemicolectomy specimen showing the cobble stone appearance of the mucosa typical of crohn's disease . Crohn's disease may involve the appendix by extension from the terminal ileum or the caecum and present as an acute or sub - acute appendicitis[15]. Crohn's disease limited to the appendix usually affects young adults in their 20s and 30s, although it is not limited to this age group and can occur at any age . The clinical presentation is variable, with acute right iliac fossa pain suggestive of acute appendicitis in about 85% of patients, and chronic pain and a palpable mass in the right iliac fossa in about 25% of patients . When the preoperative diagnosis is acute appendicitis, crohn's disease should be suspected when an atypical or protracted clinical course is present in a patient prior to the appendicitis, particularly in areas where crohn's disease is prevalent . Crohn's disease is diagnosed by a combination of clinical manifestations and radiological findings including barium studies, showing string strictures, fissures, and fistula in the ileum and caecum . Recently, gray scale sonography and color doppler - flow features have been used in diagnosing crohn's disease . When the disease is located atypically in the appendix, macroscopically, the appendix will be seen to be enlarged, swollen and adherent to the surrounding structures, these findings being secondary to chronic inflammation . Histologically, the disease is characterized by transmural inflammation with thickening of the appendiceal wall, epitheloid granulomas, lymphoid aggregates, and mucosal ulceration . Other histological features are multinucleated giant langherhan's cells, crypt abscess, neural hyperplasia and lymphangiectasia . Differential diagnosis includes the presence of foreign bodies and diverticulitis of the appendix, which also give rise to chronic granulomatous inflammation with induration and fibrosis of the appendiceal wall, and granulomatous disease of unknown aetiology such as appendiceal sarcoidosis, which is rare and often accompanies systemic disease . Differential diagnosis should also include infectious diseases such as tuberculosis, actinomycosis and yersenia infection . A rare fungal infection such as histoplasmosis or blastomycosis, or a parasitic infestation such as schistosomiasis or enterobius vermicularis infestation can elicit an appendiceal granulomatous reaction . The diagnostic difficulty arises when a patient undergoes an appendicectomy for suspected acute appendicitis and the surgeon unexpectedly encounters ileocaecal pathology whose nature is difficult to ascertain in an emergency situation . In view of this, a definitive treatment in the form of ileocaecal resection for conditions like crohn's disease may be difficult to carry out . While a frozen section may be helpful to differentiate some of these conditions it may not always be feasible in an emergency situation . If crohn's disease of the appendix is suspected and is limited to the appendix then appendicectomy alone is a routine surgical procedure with very low intraoperative or postoperative mortality and a low rate of fistula formation.the postoperative enterocutaneous fistula incidence rate in crohn's disease restricted to appendix alone has been reported to be 3.5%, whereas in patients with crohn's disease of the ileocaecal segment, as in our patient, the postoperative enterocutaneous rate rises to 34% to 58% . Weston et al reported that the majority of the patients whose first presentation of crohn's disease simulates appendicitis and who undergo appendicectomy alone leaving the ileocaecal segment in place to be treated medically, returned postoperatively within 3 years with symptoms . A significant percentage (38%) of these patients returned within one year and most of them (77%) were frequently ill with their disease in the interim period . Patients who had an ileocolic resection at the time of the initial operation did not require early reoperation, did not develop short bowel syndrome, and did not have significant postoperative complications . In the postoperative period these patients receive medical therapy to keep the disease quiescent such as salazopyrine, 5-asa, prednisilone, and azothioprine.crohn's disease - related fistula have also been treated with infliximab with some success . Despite improvements in medical therapy, between 70% to 90% of the patients with crohn's disease will eventually require surgical intervention, and approximately half of these will require additional operations . Because of the high risk of reoperations and a relatively young age at the time of first operation, a minimally invasive approach has recently been used to carry out the ileocolic resections . A recent meta - analysis of laparoscopic ileocolic resection has revealed a shorter hospital stay compared to open resection, while the morbidity rates were equal and conversion rates were acceptable . The average interval between surgery and recurrence after appendicectomy for crohn's disease of the appendix is 4 years, after which some claim the recurrence rate to be almost nil . However, others have reported a recurrence rate of 10% over an 8-year follow - up and is much higher in patients with crohn's disease of the appendix associated with ileocaecal crohn's disease . Most authors recommend periodic surveillance visits with radiological and endoscopic examination of the small intestinal and colon for a period of at least 3 years to promptly detect recurrence . However, others claim that patients with crohn's disease should be followed for 10 years, and if disease free by then are considered cured . Crohn's disease of the appendix is usually associated with crohn's disease of the ileum and caecum . Appendicectomy will suffice in those who present subacutely, are diagnosed preoperatively by clinical signs, and radiographic evidence shows that the disease is restricted to the appendix alone . However, in the presence of ileocaecal involvement, resection of the ileocaecal segment may be required to prevent postoperative complications of enterocutaneous fistula . While patients who develop enterocutaneous fistula post - appendicectomy in an unsuspected crohn's disease case have been treated with infliximab with some success, the majority of the patients required ileocaecal resection . Moreover,
|
The random sample comprises 267 caucasian preadolescents (121 girls, 146 boys) and 330 caucasian adolescents (164 girls, 166 boys) of a population belonging to the swedish part of the european youth heart study (eyhs). The eyhs is a cross - sectional school - based study of risk factors for future cardiovascular disease among preadolescents (910 years old) and adolescents (1516 years old). The mean ages in the swedish sample for preadolescents and adolescents were 9.6 years and 15.6 years, respectively . Height, weight, and birth weight were measured by internationally accepted standardised procedures (22). Body mass index (bmi) was calculated as weight / height2 (kg / m). Identification of sexual maturity was assessed according to tanner and whitehouse 1976 . A researcher of the same gender as the child recorded the pubertal stage after brief observation . On account of ethical reasons the direction of one school preferred not to take part in the assessment of sexual maturity . Fifty subjects did therefore not participate in this assessment (3 preadolescent girls, 7 preadolescent boys, 25 adolescent girls, and 15 adolescent boys). The consumption of milk was assessed by an interviewer - mediated 24-hour recall . In preadolescents, a qualitative food record completed the day before the interview with the help of parents served as a checklist for the data obtained during the recall . Dietary data were processed by stormats (version 4.02, rudans lttdata, sweden) and analysed using the swedish national food database (version 99.1). As part of a broad - ranging questionnaire, parents of the participants were asked if their child had a chronic illness or adhered to a special diet . Since under - nourishment is practically non - existent in a nutritionally replete population such as sweden and milk intake accounts in part for daily energy intake, the bmi was taken as proxy for energy intake . Furthermore, bmi is traditionally used to validate energy intake data (23). For the genetic analysis of lp and lnp, genomic dna was isolated from edta whole blood samples from the individuals with the qiaamp dna blood mini kit spin procedure . The dna fragment spanning the -13910-c / t polymorphic site was amplified using a biotinylated forward - primer (5 gggctggcaatacagataagata-3) and an unbiotinylated reverse - primer (5 agcagggctcaaagaacaatcta-3). The applied sequencing primer was: 5-ctttgaggccaggg-3. Sequencing was performed using a psq96 snp reagent kit and a psq 96ma system (pyrosequencing ab) psq 96ma 2.0.1 software . The procedure has been previously described in detail (24, 25). For the determination of socio - economic status (ses) we used the dichotomous variable, below versus above the mean income level in the catchment areas of the sample (below or above the mean in their municipality) on account of the relatively equal distribution of income in sweden (26). For four subjects, data for ses student's t - test was used to determine differences in milk intake (g / d) between lp and lnp subjects . Milk intake (g / d) was somewhat skewed to the right and therefore split in quintiles of milk intake . Stepwise backward multiple linear regression analysis was performed in order to study the relationship between milk intake in quintiles and body height (cm) after adjustments for sex, birth weight (g), father's and mother's height (cm), bmi, tanner stage (15), and ses . The study was approved by the research ethics committees of rebro county council and huddinge university hospital . Parents and 15-year - olds gave specific written informed consent to participate in the study . The variables included in the backward multivariate regression model were: milk intake, lct c> t-13910 polymorphism (lp = ct, tt vs. lnp = cc), sex, birth weight, father's and mother's height, bmi, tanner stage, and ses . Characteristics of preadolescents and adolescents by quintile of milk intake are given in table 2 . Basic characteristics of covariates to body height in the study population of swedish preadolescents and adolescents variables associated to body height by quintiles of milk intake fifty - six (9%) of the subjects of the whole sample were lnp . Where lnp may restrict the intake of milk in these subjects and can thereby have an effect on the dependent variable, body height as well as the exposure variable, i.e. Milk intake . Milk intake tended to be lower in lnp compared to lp but the difference did not reach statistical significance (p=0.067). The studied exposure variables in this model were milk intake in quintiles and the lct c> t-13910 polymorphism, and the outcome variable was body height . The model explained 90% of the observed variance of body height in preadolescents and adolescents (adjusted r = 0.89). Non - significant variables were removed in a stepwise manner by elimination when p(f) 0.10 . Model 1 included the variables: milk intake in quintiles, lct-13910 c> t polymorphism, sex, birth weight, parents height, tanner stage, bmi, and ses . In a first step the variable bmi was eliminated and in a second step ses (table 3). Milk intake (g / d) in quintiles remained significantly different (=0.46; 95% ci: 0.040, 0.87 and p=0.032) in the final model . In addition, the lct c> t-13910 polymorphism (lp vs. lnp), remained significant in the final model (=2.05; 95% ci: 0.18, 3.92 and p=0.032), showing a positive association of lp with height . Main effect by quintiles of milk intake and lct-13910 c> t (exposure variables) on body height in swedish preadolescents and adolescents (n=542); stepwise backward multiple linear regression models were used included variables in model 1: birth weight, sex, mother's and father's height . Bmi, tanner stage, ses excluded variable: bmi (p[f] 0.10). Excluded variables: ses (p[f] 0.10). We found that milk intake and lct c> t-13910 polymorphism, known to modulate milk consumption, were significant contributors to the observed variance of body height in the studied population . We primarily did not expect to find our hypothesis confirmed in a nutritionally replete country with already one of the highest intakes of milk and dairy products per capita in the world . The lct c> t-13910 polymorphism might contribute with a small effect to phenotypic variation in height . As far as we know no genome wide association studies or meta - analysis have been performed previously addressing the question whether lp or lnp affects body height . Increasing evidence suggests that cow's milk consumption exerts a positive effect on longitudinal growth in preadolescents and adolescents, for instance, by affecting the igf - i - axis (8, 11, 2730). But not all studies show a positive effect of milk on height, especially in nordic countries, where average milk intake per capita traditionally is high (31). The lct c> t-13910 polymorphism, known to modulate milk intake (32, 33), remained significant in the final model . By including the lct c> t-13910 polymorphism in our model, we subtract for hidden heritability in an already predominantly lp population (18). In a recent prospective study, evidence of an association between increased infant size at birth and cow milk consumption during pregnancy it is known that lp subjects consume on average more milk than lnp subjects . Where lp might thus lead to an increased susceptibility towards already prenatally programmed increased body sizes, mediated by the higher capacity of lp mothers to consume milk and dairy products . Our study accounts for parental height as regards milk intake and its potential effects on body height and growth in preadolescents and adolescents . Despite the circumstance that body height is a highly heritable complex trait; corrections for parental height continue to be an exception, also shown in recent studies (31). Even twin growth studies have been performed without consideration of parental height (35). It has been demonstrated that at the current stage a simple prediction based on phenotype of relatives obviously outperforms sophisticated genomic predictions as regards body height (36). Limitations of this study are the sample size, and the limits inherent to cross - sectional studies as regards causal inference . Cow's milk is an evolutionary food constructed to promote growth and development in calves and appears to affect growth in human beings also (13, 14, 28). Milk has become a normative food for preadolescents and adolescents beyond weaning age, even in asian populations and developing countries, which traditionally did not have home fare based on domesticated dairy animals (8, 37). The long - term effects of this changed nutritional normative are yet poorly understood, even in western countries . We conclude that actual milk intake and the genetic lp trait is positively associated with body height in preadolescents and adolescents . Nevertheless, higher milk consumption in childhood might exert both negative and positive effects, since greater height has been associated with higher risk of some cancers (29, 3841). This study was supported by grants from rebro lns landstings forskningskommitt and by nyckelfonden, rebro, sweden.
|
Primary hyperparathyroidism (php) is a hypercalcemic disease stemming from an abnormal increase in parathyroid hormone (pth) secretion by one or more parathyroid glands . The hallmark of this condition is the presence of high levels of calcium and high or inappropriate levels of pth . Primary hyperparathyroidism is more common in women than in men and increases with aging in both genders . The goal of parathyroidectomy is the excision of the abnormal parathyroid gland(s), preserving the normal ones in order to achieve and maintain a postoperative normocalcemic state . Success rates for surgical treatment depend on the skill and experience of the surgeon in finding and recognizing the pathologic changes and excising the correct amount of hyperfunctioning parathyroid tissue . The surgical treatment of php has undergone substantive changes since the first successful parathyroidectomy was performed by felix mandl in 1925 . It is now expected that the vast majority of patients will be cured during initial surgical exploration at a low probability of morbidity . The conventional time - honored operation employing general endotracheal anesthesia and bilateral cervical exploration is safe and effective when performed by experienced surgeons . However, recent technical innovations, including improved preoperative localization and availability of rapid intraoperative pth assays (iopth), have yielded focused approaches with excellent outcomes . Sporadic primary hyperparathyroidism is caused by a single enlarged parathyroid gland (parathyroid adenoma) in approximately 85% of the cases, whereas multigland hyperplasia occurs in 15% and parathyroid carcinoma is found in less than 1% of patients . Unlike the previous dogma that required surgical identification of both enlarged and normal parathyroid glands, the current paradigm in many centers is to identify and excise the incident enlarged gland and to confirm operative cure, employing a rapid intraoperative pth assay . Due to the relatively short half - life of pth (4 - 5 min), a dramatic drop in circulating hormone can be detected once the abnormally secreting gland or glands have been removed . A curative drop in pth allows the surgeon to terminate the operation and obviate additional exploration, whereas failure of the pth levels to demonstrate an adequate decrement asks for additional exploration because of the presence of presumed additional hypersecreting gland(s). The aim of the present study was to evaluate our 10-year experience in employing a rapid intraoperative pth assay for php . This is a prospective study on a cohort of operated patients treated at a university referral center . This investigation was approved by the unifesp / epm ethics committee . From june 2000 to april 2011, 96 surgeries for php were performed at hospital so paulo unifesp / epm, so paulo, brazil . These 96 procedures were performed in 91 previous unexplored patients who had at least 6 months of postoperative follow - up with enough reported data to be eligible for the study . The php diagnoses were established in the presence of high levels of calcium and high or inappropriate levels of pth . All patients had their age, gender, symptoms (bone and kidney), preoperative localization tests, serum ionized calcium (ica), serum total calcium and intact pth recorded before parathyroidectomy, as well as iopth dosages . The laboratorial tests were repeated 1 month, 6 months, and in 1-year increments after surgery . A series of 91 consecutive patients with primary hyperparathyroidism underwent parathyroidectomy guided by intraoperative pth at federal university of so paulo, brazil, from june 2000 to april 2011 . Focused parathyroidectomy guided by intraoperative pth was the initial procedure when preoperative localization tests were positive and when there were no suspicion of malignant disease . A bilateral cervical exploration guided by intraoperative pth was performed when preoperative localization tests were negative . A baseline peripheral venous blood sample was obtained just after anesthesia induction as well as 10 minutes after the abnormal parathyroid tissue removal . The intraoperative criterion used to predict successful parathyroidectomy was a decrease in the intact pth levels exceeding 50% from the preincision hormone level . If this criterion was met, surgical exploration of the neck would be completed and the incision closed . Otherwise, further surgical exploration of the neck would have to be carried on . Intraoperative pth was measured using elecsys pth immunoassay (elecsys 1010 system, roche, mannheim, germany). The test is an immunometric assay based on monoclonal antibodies, magnetic particles as solid phase, and ruthenium complex as chemiluminescent label . Total time to perform the assay is 9 minutes; reference values are 1065 pg / ml . To validate the rapid pth assay, 170 samples from the study the iopth accuracy calculation was based on the following definitions: a true - positive (tp) result of iopth was defined as the correct prediction of postoperative normal calcium levels for at least 6 months; true negative (tn) was the correct prediction of incomplete excision by either resection of an additional gland(s) or operative failure; false positive (fp) was the incorrect prediction of normocalcemia with subsequent postoperative persistent hypercalcemia and high pth levels; false negative (fn) was the incorrect prediction of incomplete excision followed by postoperative normocalcemia . Persistent disease was considered when serum calcium and pth levels remained above normal range just after surgery . Recurrence was defined when, after reaching normocalcemic levels, serum calcium and intact pth measurements start to rise to abnormal values at least 6 months after surgery . Serum ionized calcium (1.151.32 mmol / l), serum total calcium (8.510.5 mg / dl) and intact pth (1167 pg / ml), were measured using standard automatic assays . The demographic, clinical, and biochemical aspects of 91 patients with php are shown in table 1 . Among all cohort of 91 patients, 69 (75.8%) had solitary adenoma, 10 (11.0%) had multiple endocrine neoplasia type 1 (men1), 6 (6.6%) had double adenomas, 4 (4.4%) had carcinomas, and 2 (2.2%) patients are still waiting for remedial surgery for multiglandular disease (mgd), 1 of whom had recurrence disease after 10 years of follow - up and the other persistent disease after a false positive iopth (table 2). We had 85 (93.4%) successful parathyroidectomies 6 (6.6%) failed parathyroidectomies in 91 previous unexplored patients, and 5 (100%) successful remedial surgeries . Among the 85 successful patients, 69 (81.2%) had solitary adenoma, 3 (3.5%) had carcinoma, 4 (4.7%) had double adenomas, 8 (9.4%) had men1, and 1 (1.2%) still has mgd (table 2). The mean decay of iopth in the successful group of patients was 80.5% (34.3% to 96.0%). In these 85 patients, we had 80 tp results (67 adenomas, 3 carcinomas, 8 men1 and 2 recurrences we also had 3 cases of double adenoma in which the iopth resulted in a tn value, requiring additional exploration to prevent persistent disease (table 2). There were only 2 fn results among the successful group patients (table 4). The mean decay of iopth in the 80 patients with tp results was 81.7%, with a minimum drop of 55.0% (55.0% to 96.0%). Operative failure of the initial surgery occurred in 6 patients: 2 double adenoma, 2 men1, 1 carcinoma, and 1 mgd who is still waiting for remedial surgery (table 5). Both cases of double adenoma had a tn decay of iopth, but the second adenoma wasnot found during the initial operation . With the aid of new localization exams, successful remedial operations were performed with an iopth tp result . The patient with parathyroid carcinoma developed hypercalcemia and high levels of pth two months after surgery . In search of distant metastasis, this patient underwent a pulmonary computerized tomography and multiple pulmonary nodules were found . For this reason, she was classified as iopth false - positive . In both men1 patients, one patient already had men1 diagnosis at the time of initial surgery and we failed to find the fourth gland . The other patient was first operated as a solitary adenoma and men1 diagnosis surfaced just in the follow - up . There was only one case in the operative failure patients; the iopth had an fp result (table 4). The surgical treatment for primary php has undergone some changes in recent years, evolving from the standard bilateral neck exploration technique to a less time - consuming procedure of unilateral neck exploration . Taking into account the increasing number of asymptomatic and/or oligosymptomatic primary hyperparathyroidism diagnosis in the recent years, the need for a safe and less time - consuming procedure with low perioperative morbidity is clear . Preoperative parathyroid localization imaging study and iopth are essential components of the focused parathyroidectomy that allow the excision of all abnormal parathyroid glands without the examination of the normally secreting glands . The clinical utility of rapid iopth measurements in parathyroidectomy was first reported in 1988 using a modified intact pth irma assay . Since then, rapid assays have been developed by means of radioactive [4, 11, 12] as well as nonradioactive formats [12, 13]. The predominance of a solitary adenoma disease in 85% to 96% of cases of php and the short half - life of intact pth (184) of only 1.4 to 4 minutes [1420] combined with the remaining suppressed normal parathyroid glands after removal of all hyperfunctioning tissue allows the measurement of iopth to evaluate its decline rates . Several studies have demonstrated the utility of iopth monitoring in the treatment of single - gland primary hyperparathyroidism [3, 8, 2127]. Most experts agree that iopth assay is the most useful intraoperative adjunct to assist the surgeon in php surgical treatment [28, 29]. It is worth highlighting the useful employment of preoperative localization imaging study in conjunction with iopth: the former points out where the surgeon should start exploration from, and the latter assures that hypersecretory parathyroid tissue removal was accomplished . The current usual criteria for iopth measurement describe a decrease of 50% or over from either the baseline (preincision) or the highest preincision or preexcision value within 10 minutes following hyperfunctioning parathyroid resection, pointing out surgical cure and predicting normocalcemia . By resorting to those criteria, high accuracy in intraoperative prediction of cure is achieved . Mostly for practice and cost reasons, we have used just two samples as our criteria since we started making use of the iopth: the preincision and 10 minutes postexcision of hyperfunctioning parathyroid . Our series of 96 php consecutive surgeries over 10 years reflects a complex tertiary referral center and has its limitations . Most of these patients were referred specifically due to their severe signs / symptoms and comorbid medical conditions, which are related to their high bone and kidney disease and the 4.4% incidence of carcinoma . Furthermore, all patients were first evaluated by an endocrinologist group specialized in osteometabolic disease who elected the patients for surgical treatment, reflecting the 11% incidence of men1 and the absence of familial hypocalciuric hypercalcemia case in our surgical series . The php diagnose has not been made in a routine practice in most brazilian centers, and many patients have their diagnoses made just after severe signs / symptoms . We have noticed an increase in the percentage of asymptomatic patients over the years in the number of php cases, but probably such increase has not been enough to raise the number of our small solitary adenomas (78.3%). We get an inferior number of successful parathyroidectomy (93.4%) in previous unexplored patients compared to some large series [9, 32], but it can be considered a satisfactory result, taking into account the high number of patients with carcinoma and men1 in our series . On the other hand, we have obtained good results (100%) in 5 successful second surgical explorations so far: first, we removed a second adenoma in three patients (two persistent and one recurrent disease); second, we were able to remove a not found fourth gland in a men1 patient, and finally, we removed three glands in a men1 patient previous operated as an sporadic php . In our series of 91 patients, iopth had true results in 87 patients (95.6%). However, considering our 96 surgical procedures (5 remedial surgeries), iopth was able to obviate or to ask for additional exploration because of the presence of presumed additional hypersecreting gland(s) in 92 (95.8%) procedures . The iopth had a mean decay of 81.7% in the tp patients, and the minimum drop in our series that results in patient cure (operative success) was 55.0% . One of these cases occurred in a ruptured parathyroid cystic adenoma that may have resulted in a substantial elevation of the hormone levels after the preincision sample, and it should be related to an inadequate iopth decay . The second patient had the others three parathyroid glands identified in normal conditions . Based on such scenario, the iopth decay was 50.9%, dropping from 216 pg / dl to 106 pg / dl . As observed by other authors, the fp cases are usually represented by a marginal pth level decrease with a final pth level above the normal range . For these reasons, stricter criteria for the iopth dynamics have been suggested, such as the return of the 10-minute pth to within normal range . However, these stricter criteria were estimated to increase the operative success only by 0.3%, with significant increase in the false negative results, bringing on more unnecessary bilateral neck dissection [9, 33]. Using these stricter criteria in our patients would have brought about 21 (24.7%) unnecessary bilateral dissections, and just one additional diagnose . We classified a patient with parathyroid carcinoma that revealed metastatic pulmonary disease two months after surgery as an fp result because she certainly had metastatic disease at the surgery and iopth (84.1% decay) failed to predict the presence of presumed additional hypersecreting tissue . However, it can be controversial to suppose that iopth has failed in this patient, once iopth was not defined to predict distant disease . All 4 patients with parathyroid carcinoma had very suggestive signals of malignant disease at presentation (very high pth levels, severe hypercalcemia and palpable neck mass) and were not elected to the focused approach . They were submitted to an en bloc tumor resection, removing the parathyroid tumor, the ipsilateral thyroid lobe, and the lymph nodes related to a central neck dissection . During the follow - up period, 2 (2.1%) one patient removed a second adenoma and had a successful remedial surgery with iopth decay of 78.4% . The second patient recurrence occurred almost 10 years after initial surgery and is still waiting for remedial surgery . Published a large series of 1,650 php patients and found 5 (0.3%) recurrent cases . One of our series limitations is the absence of vitamin d dosages, one important factor that should be related to the genesis of php recurrence . The iopth revealed to be an important technological adjunct in the current parathyroid surgery for php.
|
The prevalence of diabetes in the u.s . Has increased (1), and cardiovascular (cv) complications remain the major cause of morbidity and mortality in persons with type 2 diabetes, contributing substantially to increased health care costs (2). As individuals attempt to manage their diabetes, there is increasing recognition that comorbid behavioral problems, including both depressive symptoms and stress, are associated with poor glycemic control, poor lifestyle behaviors, and increased health services utilization (310). We (11) and others (3,4) have shown that these behavioral challenges are associated with inadequate medication adherence, which may be associated with adverse outcomes . Similarly, poor meta - bolic control may worsen depressive symptoms (5), and the relationship appears to be bidirectional (8). The prevalence of these comorbidities and their potential to worsen disease management have led some to develop interventions designed to address comorbid depressive symptoms or stress in persons with diabetes (1214). While many studies have documented the cross - sectional presence of these comorbidities and the effect on glycemic control in subjects with diabetes, only a limited number of studies have examined the potential impact on cv outcomes . Most of these studies have been limited to patients with depression recruited from established health care settings, and the true population - level impact is unknown . Likewise, there has not been adequate comparison of individuals with and without diabetes who have concurrent depressive symptoms and/or elevated levels of perceived stress to examine the unique consequences of behavioral and medical comorbidity . The objective of the present report was to examine the association between the presence of depressive symptoms and/or increased levels of perceived stress, determined at baseline, and risk of incident cv events over 5 years of follow - up in a major national cohort study that used population - based sampling methods, collecting data in the home both in subjects with and without diabetes . The description of the population for this analysis has previously been reported (15). In short, the reasons for geographic and racial differences in stroke (regards) study is a population - based, prospective, longitudinal cohort study of 30,239 subjects aged> 45 years, 45% of whom are male, 55% female, 41% black, 59% white, 55% from the stroke belt it was designed to examine factors associated with the geographic and racial differences in stroke incidence as well as excess stroke mortality in the southeastern u.s . (i.e., stroke belt) relative to the rest of the nation and among blacks relative to whites . The regards study included relevant measures for perceived stress and depressive symptoms and provides a unique opportunity to examine the impact of these behavioral comorbidities in individuals with and without diabetes and the incidence of adverse cv outcomes in a national sample of black and white adults . The regards cohort was recruited between january 2003 and october 2007 and is evaluated by computer - assisted telephone interview every 6 months . The initial recruitment call was used to obtain verbal consent and collect cv history, risk factors, and demographic characteristics, including age, sex, and race (each subject self - reported race, and by design, the study compared only non - hispanic black and white subjects, excluding other racial / ethnic groups). The study also included an in - home visit by a trained health professional for data collection . Participants were asked to provide all prescription and nonprescription medications they had taken in the past 2 weeks, and medication names were recorded during the in - home visit and subsequently coded into drug classes . Written informed consent was obtained during the in - person evaluation . The present analysis included all members of the cohort who had complete follow - up data . A brief physical exam including blood pressure (assessed as the average of two measurements obtained with an aneroid sphygmomanometer after the subject was in the seated position for at least 3 min with both feet on the floor) and blood and urine samples, and an electrocardiogram (ecg) was conducted during an in - home visit by a trained health professional 34 weeks after the telephone interview . Height and weight was measured via standard procedures, and bmi was computed as the body weight in kilograms divided by the square of height in meters (2). All ecgs were read by a trained cardiologist in a centralized ecg reading laboratory at the wake forest university / baptist medical center in winston - salem, nc, using a predefined interpretation protocol (16). Atrial fibrillation was determined to be present if there was a self - reported history (asked as has a doctor or other health professional ever told you that you had atrial fibrillation?) Or if characteristic findings were present on the ecg as defined in the protocol . Left ventricular hypertrophy was defined to be present or absent based on ecg findings using the sokolow - lyon limb lead criteria (17) as specified in the protocol . Hs - crp was determined by particle - enhanced immunonephelometry using the bnii nephelometer (n high sensitivity crp; dade behring, deerfield, il), while total and hdl cholesterol and glucose were measured by colorimetric reflectance spectrophotometry using the ortho clinical vitros 950/irc chemistry system (johnson & johnson clinical diagnostics, new brunswick, nj) in accordance with the national cholesterol education program guidelines (18). Diabetes was defined as self - reported diabetes obtained during the telephone interview or a fasting glucose 126 mg / dl, a nonfasting glucose 200 mg / dl, or the presence of oral hypoglycemic medication or insulin each obtained during the home visit . The primary exposure of interest was the presence, at baseline, of depressive symptoms and/or elevated levels of perceived stress among individuals with diabetes at baseline compared with those without diabetes . The presence of depressive symptoms was assessed using the previously validated four - item center for epidemiologic studies depression (cesd) questionnaire (19). The cesd-4 is derived from the original 20-item cesd (20) and has been found to be highly correlated at 0.87 (19). These questions included responses that ranged from 0 to 12 based on the number of days the subject reported experiencing those feelings in the prior week, with higher scores indicating more depressive symptoms . Subjects with a cesd score 4 were determined to have an elevated level of depressive symptoms . Perceived level of stress was measured using a four - item version of the cohen perceived stress scale (21), a validated and previously used (22) instrument for measuring the perception of personal stress . It measures the extent to which respondents perceive their lives as unpredictable, uncontrollable, and/or overloaded . Subjects with cohen perceived stress scale scores> 4 were determined to have high levels of psychological stress, corresponding to the highest quartile of scores . The primary outcomes of interest were physician - adjudicated cv events including stroke, myocardial infarction (mi)/acute coronary heart disease (chd), and cv death . Living participants or their proxies were contacted every 6 months via telephone to assess new - onset stroke, chd events, and cv mortality . A trained interviewer administered a standardized questionnaire that specifically asks whether, since the last follow - up, they had been hospitalized for stroke or heart disease . Medical records were retrieved for all potential stroke- and chd - related hospitalizations and deaths . For suspected stroke, each event was adjudicated via medical record review by a neurologist - led medical review team . Stroke events were defined following the world health organization definition (23) but also included events with symptoms lasting <24 h with neuroimaging consistent with acute ischemia or hemorrhage and cases where adjudicators agreed that the event was likely a stroke or death related to stroke but information was incomplete for world health organization or clinical classification . After a report of a hospitalization or death that potentially could be related to cvd, medical records were retrieved, and the event was adjudicated by a physician - led medical review team, following published guidelines (24,25). Specifically, medical records were examined for the presence of signs or symptoms suggestive of ischemia; a rising and/or falling pattern in cardiac troponin or creatine phosphokinase - mb over 6 or more hours with a peak value greater than or equal to twice the upper limit of normal (diagnostic cardiac enzymes); and ecg changes consistent with ischemia or mi, guided by the minnesota code and classified as evolving diagnostic, positive, nonspecific, or not consistent with ischemia (26,27). Participant deaths were detected by report of next of kin, online sources (e.g., the social security death index), and the national death index . For information surrounding the circumstances of participant death, proxies or next of kin were interviewed . Additionally, following published guidelines, medical records in the last year of life, death certificates, and autopsy reports were collected and reviewed by the physician - led adjudicators to determine whether the death was a cvd death (24,25). Data on traditional cv risk factors and socioeconomic factors were also collected in order to adjust for potential confounding in our analyses of the relationship between the presence of comorbid behavioral problems, diabetes, and adverse cv outcomes . Additional data collected included the following: annual household income (<$20,000/year, $20,000$35,000/year, $35,000$75,000/year, and> $75,000/year), education level (less than high school education, high school graduate, some college, and college graduate or higher), and health insurance (yes or no). Also collected was a health history including a history of stroke or heart disease (self - reported mi, coronary artery bypass grafting, bypass, angioplasty, stenting, or evidence of myocardial infarction on the study ecg). Smoking behavior was collected and categorized as nonsmoker, past smoker, or current smoker . The current study examined the relationship between comorbid depressive symptoms and/or elevated levels of perceived stress, both measured at baseline, in subjects with and without diabetes and the adjudicated incidence of stroke, acute chd, and cvd death for events occurring through 30 december 2010 . Follow - up time for each participant was calculated from the date of the in - home visit to date of first stroke, acute chd, death, or last telephone follow - up . The analysis cohort for this report was 22,003 after exclusion of participants with a history of stroke or heart disease at baseline (n = 7,164), missing diabetes status at baseline (n = 845), or missing follow - up data (n = 171). The initial analysis compared the demographic, socioeconomic, and cv risk characteristics of subjects with and without diabetes in three groups: 1) those reporting no comorbid depressive symptoms and without elevated levels of perceived stress, 2) those reporting either depressive symptoms or elevated levels of perceived stress, and 3) those reporting both depressive symptoms and elevated levels of perceived stress . Age - adjusted incidence rates were then compared for each type of cv event in individuals with and without diabetes in the same three comparison groups . The longitudinal relationship between baseline behavioral morbidity (i.e., the three comparison groups), in both those with and without diabetes, and subsequent adjudicated cv events during follow - up was then examined in a series of cox proportional hazards models . These models examined the relationships first in an unadjusted (crude) model and then in additional models that incrementally added the following groups of variables: 1) demographic characteristics (race, age, sex, and region [stroke belt vs. non stroke belt]), 2) socioeconomic factors (income, education, and health insurance), and, finally, 3) cv risk factors (current smoking, history of heart disease, left ventricular hypertrophy, atrial fibrillation, bmi, systolic blood pressure, total cholesterol, hs - crp, and statin use). The description of the population for this analysis has previously been reported (15). In short, the reasons for geographic and racial differences in stroke (regards) study is a population - based, prospective, longitudinal cohort study of 30,239 subjects aged> 45 years, 45% of whom are male, 55% female, 41% black, 59% white, 55% from the stroke belt it was designed to examine factors associated with the geographic and racial differences in stroke incidence as well as excess stroke mortality in the southeastern u.s . (i.e., stroke belt) relative to the rest of the nation and among blacks relative to whites . The regards study included relevant measures for perceived stress and depressive symptoms and provides a unique opportunity to examine the impact of these behavioral comorbidities in individuals with and without diabetes and the incidence of adverse cv outcomes in a national sample of black and white adults . The regards cohort was recruited between january 2003 and october 2007 and is evaluated by computer - assisted telephone interview every 6 months . The initial recruitment call was used to obtain verbal consent and collect cv history, risk factors, and demographic characteristics, including age, sex, and race (each subject self - reported race, and by design, the study compared only non - hispanic black and white subjects, excluding other racial / ethnic groups). The study also included an in - home visit by a trained health professional for data collection . Participants were asked to provide all prescription and nonprescription medications they had taken in the past 2 weeks, and medication names were recorded during the in - home visit and subsequently coded into drug classes . Written informed consent was obtained during the in - person evaluation . The present analysis included all members of the cohort who had complete follow - up data . A brief physical exam including blood pressure (assessed as the average of two measurements obtained with an aneroid sphygmomanometer after the subject was in the seated position for at least 3 min with both feet on the floor) and blood and urine samples, and an electrocardiogram (ecg) was conducted during an in - home visit by a trained health professional 34 weeks after the telephone interview . Height and weight was measured via standard procedures, and bmi was computed as the body weight in kilograms divided by the square of height in meters (2). All ecgs were read by a trained cardiologist in a centralized ecg reading laboratory at the wake forest university / baptist medical center in winston - salem, nc, using a predefined interpretation protocol (16). Atrial fibrillation was determined to be present if there was a self - reported history (asked as has a doctor or other health professional ever told you that you had atrial fibrillation?) Or if characteristic findings were present on the ecg as defined in the protocol . Left ventricular hypertrophy was defined to be present or absent based on ecg findings using the sokolow - lyon limb lead criteria (17) as specified in the protocol . Hs - crp was determined by particle - enhanced immunonephelometry using the bnii nephelometer (n high sensitivity crp; dade behring, deerfield, il), while total and hdl cholesterol and glucose were measured by colorimetric reflectance spectrophotometry using the ortho clinical vitros 950/irc chemistry system (johnson & johnson clinical diagnostics, new brunswick, nj) in accordance with the national cholesterol education program guidelines (18). Diabetes was defined as self - reported diabetes obtained during the telephone interview or a fasting glucose 126 mg / dl, a nonfasting glucose 200 mg / dl, or the presence of oral hypoglycemic medication or insulin each obtained during the home visit . The primary exposure of interest was the presence, at baseline, of depressive symptoms and/or elevated levels of perceived stress among individuals with diabetes at baseline compared with those without diabetes . The presence of depressive symptoms was assessed using the previously validated four - item center for epidemiologic studies depression (cesd) questionnaire (19). The cesd-4 is derived from the original 20-item cesd (20) and has been found to be highly correlated at 0.87 (19). These questions included responses that ranged from 0 to 12 based on the number of days the subject reported experiencing those feelings in the prior week, with higher scores indicating more depressive symptoms . Subjects with a cesd score 4 were determined to have an elevated level of depressive symptoms . Perceived level of stress was measured using a four - item version of the cohen perceived stress scale (21), a validated and previously used (22) instrument for measuring the perception of personal stress . It measures the extent to which respondents perceive their lives as unpredictable, uncontrollable, and/or overloaded . Subjects with cohen perceived stress scale scores> 4 were determined to have high levels of psychological stress, corresponding to the highest quartile of scores . The primary outcomes of interest were physician - adjudicated cv events including stroke, myocardial infarction (mi)/acute coronary heart disease (chd), and cv death . Living participants or their proxies were contacted every 6 months via telephone to assess new - onset stroke, chd events, and cv mortality . A trained interviewer administered a standardized questionnaire that specifically asks whether, since the last follow - up, they had been hospitalized for stroke or heart disease . For each positive response, the date and time of each event were recorded . Medical records were retrieved for all potential stroke- and chd - related hospitalizations and deaths . For suspected stroke, each event was adjudicated via medical record review by a neurologist - led medical review team . Stroke events were defined following the world health organization definition (23) but also included events with symptoms lasting <24 h with neuroimaging consistent with acute ischemia or hemorrhage and cases where adjudicators agreed that the event was likely a stroke or death related to stroke but information was incomplete for world health organization or clinical classification . After a report of a hospitalization or death that potentially could be related to cvd, medical records were retrieved, and the event was adjudicated by a physician - led medical review team, following published guidelines (24,25). Specifically, medical records were examined for the presence of signs or symptoms suggestive of ischemia; a rising and/or falling pattern in cardiac troponin or creatine phosphokinase - mb over 6 or more hours with a peak value greater than or equal to twice the upper limit of normal (diagnostic cardiac enzymes); and ecg changes consistent with ischemia or mi, guided by the minnesota code and classified as evolving diagnostic, positive, nonspecific, or not consistent with ischemia (26,27). Participant deaths were detected by report of next of kin, online sources (e.g., the social security death index), and the national death index . For information surrounding the circumstances of participant death, proxies or next of kin additionally, following published guidelines, medical records in the last year of life, death certificates, and autopsy reports were collected and reviewed by the physician - led adjudicators to determine whether the death was a cvd death (24,25). Data on traditional cv risk factors and socioeconomic factors were also collected in order to adjust for potential confounding in our analyses of the relationship between the presence of comorbid behavioral problems, diabetes, and adverse cv outcomes . Additional data collected included the following: annual household income (<$20,000/year, $20,000$35,000/year, $35,000$75,000/year, and> $75,000/year), education level (less than high school education, high school graduate, some college, and college graduate or higher), and health insurance (yes or no). Also collected was a health history including a history of stroke or heart disease (self - reported mi, coronary artery bypass grafting, bypass, angioplasty, stenting, or evidence of myocardial infarction on the study ecg). Smoking behavior was collected and categorized as nonsmoker, past smoker, or current smoker . The current study examined the relationship between comorbid depressive symptoms and/or elevated levels of perceived stress, both measured at baseline, in subjects with and without diabetes and the adjudicated incidence of stroke, acute chd, and cvd death for events occurring through 30 december 2010 . Follow - up time for each participant was calculated from the date of the in - home visit to date of first stroke, acute chd, death, or last telephone follow - up . The analysis cohort for this report was 22,003 after exclusion of participants with a history of stroke or heart disease at baseline (n = 7,164), missing diabetes status at baseline (n = 845), or missing follow - up data (n = 171). The initial analysis compared the demographic, socioeconomic, and cv risk characteristics of subjects with and without diabetes in three groups: 1) those reporting no comorbid depressive symptoms and without elevated levels of perceived stress, 2) those reporting either depressive symptoms or elevated levels of perceived stress, and 3) those reporting both depressive symptoms and elevated levels of perceived stress . Age - adjusted incidence rates were then compared for each type of cv event in individuals with and without diabetes in the same three comparison groups . The longitudinal relationship between baseline behavioral morbidity (i.e., the three comparison groups), in both those with and without diabetes, and subsequent adjudicated cv events during follow - up was then examined in a series of cox proportional hazards models . These models examined the relationships first in an unadjusted (crude) model and then in additional models that incrementally added the following groups of variables: 1) demographic characteristics (race, age, sex, and region [stroke belt vs. non stroke belt]), 2) socioeconomic factors (income, education, and health insurance), and, finally, 3) cv risk factors (current smoking, history of heart disease, left ventricular hypertrophy, atrial fibrillation, bmi, systolic blood pressure, total cholesterol, hs - crp, and statin use). The current study included a total of 22,003 subjects, of whom 42% were black, 58% female, and 56% living in the southeastern u.s . Stroke belt . Among all subjects at baseline, 18.6% subjects (n = 4,090) had diabetes, 10% (n = 2,202) reported increased depressive symptoms, and 28% (n = 6,132) reported elevated levels of stress . Subjects with diabetes were more likely to report either elevated depressive symptoms or stress or both than were subjects without diabetes (36.8% vs. 29.5%; p <0.001). Detailed demographic characteristics for the study group are given in table 1, separated into those with and without diabetes and stratified by the presence of behavioral comorbidities . Among subjects with diabetes, those reporting either increased depressive symptoms or stress or the combination were more likely to be women, black, live in the stroke belt, and have limited income . Subjects reporting either elevated depressive symptoms or stress or both had a higher prevalence of elevated baseline hs - crp values . Across each category of behavioral comorbidity (i.e., none, either elevated depressive symptoms or stress, both elevated), subjects with diabetes had a higher prevalence of elevated baseline hs - crp values, higher mean systolic bp, and greater prevalence of statin use than those without diabetes . Baseline characteristics of regards participants with or without diabetes, by depressive symptom / stress category * p value for comparison of subjects with diabetes vs. subjects with no diabetes . Table 2 provides age - adjusted incidence rates per 1,000 person - years of follow - up for each of the three independent cv outcomes, broken out by the presence of behavioral comorbidities in those with and without diabetes . With respect to individual cv outcomes, the pattern of age - adjusted incidence rates was approximately twofold higher in those with diabetes than in those without diabetes across the range of comorbid behavioral illness . Among individuals with diabetes and one or both behavioral comorbidities, age - adjusted incidence rates were highest for acute chd, followed by cv death, and stroke . Among those without diabetes but with one or more behavioral comorbidities, incidence rates were again highest for acute chd but were followed by stroke and cv death . Event numbers, age - adjusted incidence rates per 1,000 person - years, and crude and adjusted hrs for stroke, acute chd, and cv disease death for individuals with stress or depressive symptoms and with stress and depressive symptoms compared with those with neither, for individuals with and without diabetes crude model adjusted for depressive symptom and stress category . Model 1 adjusted for crude model plus demographic factors (race, sex, age, region). Model 2 adjusted for crude model plus demographic factors plus social and economic factors (income, education, health insurance). Full model adjusted for crude model plus demographic factors, social and economic factors, and risk factors (bmi, total cholesterol, hs - crp, atrial fibrillation, left ventricular hypertrophy, systolic blood pressure, statin use, current cigarette smoking). Table 2 also provides the results of a series of crude and progressively adjusted hazard ratio (hr) models for each of the three independent cv outcomes, demonstrating the progressive impact of comorbidity on acute chd and cv death among subjects with diabetes, relative to those without diabetes, even in fully adjusted models that accounted for demographic, socioeconomic, and cv risk factors . Unlike the pattern for acute chd and cv death, the magnitude of the hrs for stroke was very similar in subjects with one versus both behavioral comorbidities and diabetes . Figure 1 illustrates this significant and progressive pattern of worsening fully adjusted hrs for cv death among those with behavioral comorbidities, relative to those with no behavioral comorbidities, in subjects with diabetes and in comparison with those who do not have diabetes . Among individuals with diabetes, the presence of a single behavioral comorbidity either increased depressive symptoms or stress increased the risk of cv death by 53% relative to individuals with diabetes but without either behavioral comorbidity . Among individuals with diabetes, the presence of both behavioral comorbidities increased depressive symptoms and stress increased the risk of cv death by 115% relative to individuals with neither behavioral comorbidity, even after adjustment for a wide range of demographic and cv risk factors . While there was a pattern of increasing risk of cv death among those with one or both behavioral comorbidities (vs. neither) in subjects without diabetes, the differences were substantially smaller (12% and 27% increases, respectively) and were not statistically significant . Consequences of comorbid diabetes and elevated depressive symptoms and/or stress on cv death during follow - up among participants in the regards study . This article joins a growing body of literature that demonstrates a compelling pattern of augmented risk for cv events or cv death associated with comorbid behavioral illness among individuals with diabetes that far exceeds that observed in individuals with these same illnesses but without diabetes . While several studies have shown that formally diagnosed depression and/or depressive symptoms in subjects who are patients in an existing health care system are associated with incident chd, this is among the first studies to compare the impact of these behavioral comorbidities on cv outcomes and mortality in a population - based sample of subjects with versus without diabetes in the same study . It is the first study to compare the effects of both depressive symptoms and stress together and separately in subjects with versus without diabetes, obtained by population - based sampling rather than recruitment in established health care settings . Further, the regards study has a large sample size; includes oversampling of african americans in the stroke belt region, allowing important racial comparisons; and also includes rich data obtained in the subject s home environment . The study is novel in that, as a community - sampled study, it provides more precise estimates of the population burden and racial disparities associated with these comorbidities and their cv consequences than other studies in which patients were recruited in health care settings . The study provides a much larger sample of african americans and illustrates the greater prevalence of comorbidities among african american women in particular, suggesting the need for more careful screening . Further, cv outcomes and cv death were carefully adjudicated events in the current study; by contrast, no adjudication process occurred in many other studies . Our findings suggest that the adverse consequences observed in individuals with behavioral comorbidities and diabetes are best understood in a larger context or spectrum of linkages between physical and behavioral illness and subsequent outcomes . Elevated levels of stress and depressive symptoms, alone and together, were associated with a pattern of increased hrs for acute coronary disease and cv death in adjusted models both in subjects with and in subjects without diabetes, achieving statistical significance in those with diabetes . Together this pattern suggests the potential for progressive impact of single and multiple behavioral comorbidities on adverse cv outcomes and mortality that is of greatest concern in subjects with comorbid diabetes . There was a significant pattern of increasing hrs for acute chd and cv death in those with diabetes and with one or both behavioral comorbidities (none, stress or depressive symptoms alone, or both together). While diabetes has long been known to increase cv outcomes, our findings suggest that, relative to those individuals with diabetes who have no behavioral comorbidity, those with either depressive symptoms or elevated levels of stress as well as those with both together have progressively increased risks for acute chd events and cv mortality during 5 years of follow - up, even when other risk factors are controlled for . In particular, behavioral comorbidities such as stress or depressive symptoms are not usually screened for in busy primary care practices, and many patients are reluctant to share these symptoms with busy primary care providers . Further, many individuals are reluctant to seek care from mental health providers . Among the demographic group in this study shown to have the highest prevalence of comorbid behavioral disease and diabetes (i.e., black females with limited income in the southeastern u.s . ), there may also be distrust of the traditional health care delivery system . As a result, these comorbidities may go unrecognized and unmanaged . This study therefore provides strong evidence for adverse consequences associated with these comorbidities and suggests the need for more careful research to identify optimal screening and treatment strategies that work in busy primary care practices or other community settings . Interestingly, while the presence of any behavioral comorbidity resulted in important increases in the hr for stroke, the increased hrs for one versus both behavioral comorbidities in subjects with diabetes were the same in fully adjusted models . This may suggest that a different mechanism is operative in the increased relationship of behavioral comorbidities and stroke . These findings build on and expand an established literature that links the cross - sectional and longitudinal presence of stress, depressive symptoms, and/or established depression with cv outcomes and/or mortality including in individuals with comorbid diabetes (10,2832). Because our study measured these symptoms at baseline and then followed patients longitudinally, it suggests the potential for the chronic influence of these behavioral comorbidities in subjects with diabetes to across time lead to adverse cv outcomes . Indeed, the chronic nature of depressive symptoms and stress in individuals with type 2 diabetes has been described by fisher et al . (10,33), who called for a more careful understanding of the conjoint physical and emotional burden in these patients . Further, these authors join our findings in calling for integrating the screening and management of the emotional side of diabetes into regular diabetes care . In addition, hamer et al . (34) demonstrated an association between stress and cv events with hr of 1.5 and with the suggestion that behavioral processes explained the largest proportion of the variance in the hazards model . This raises an important question regarding the mechanism(s) through which behavioral comorbidities result in increased cv events and/or cv death . An early review by plante (35) suggested that stress may lead to depressive symptoms that are subsequently associated with accelerated atherosclerosis, endothelial dysfunction, inflammatory reactions, and interstitial disturbances that may predispose the subject to premature cv disease or death . In the current study, hs - crp levels were elevated in subjects with diabetes relative to those without diabetes, but among subjects with diabetes, there was a clearly progressive pattern of higher hs - crp levels among those with either versus both behavioral comorbidities . These elevated hs - crp levels may suggest a pattern of worsening atherosclerotic disease in subjects with diabetes with one or both behavioral comorbidities relative to those with no comorbidity . A recent article by pizzi et al . (36) supports this and shows that depressive symptoms are associated with progressive longitudinal increases in carotid intima - media thickness relative to those who did not report these symptoms . This progressive pattern of atherosclerosis associated with these symptoms or potentially other behavioral problems might be expected to be more common in subjects with diabetes and therefore contribute to adverse cv outcomes . Behavioral comorbidities may also interfere with self - care behaviors . Among individuals with diabetes, a study by bonnet et al . (37) showed that those with anxiety or depressive symptoms were less likely to engage in healthy behaviors including physical activity, proper eating behaviors, and avoidance of smoking than were those without anxiety or depressive symptoms . Similarly, a meta - analysis by gonzalez et al . (3) that included studies of individuals with depressive symptoms showed that those with depressive symptoms or depression were more likely to be nonadherent with medications as well as with the larger treatment regimen . (38) suggest a stronger relationship between diabetes - related distress and glycemic control than between depressive symptoms and glycemic control, and recent data by this group (39) show that specific reductions in regimen - related distress can result in improvements in medication adherence, physical activity, and glycemic control, all of which may influence cv risk . The scope of the implications from these important associations with cv outcomes should be considered in the context of the recent second diabetes attitudes, wishes and needs (dawn2) study, which shows that these behavioral comorbidities know no geographic or ethnic boundaries and are highly prevalent in subjects with diabetes in multiple countries around the world (6). This suggests the need for additional research to understand the mechanisms by which these behavioral comorbidities are associated with cv outcomes in subjects with diabetes as well as to understand innovative intervention strategies that will not only improve the behavioral comorbidities but will also decrease the risk for cv outcomes . Clearly, more research is needed to understand whether the effective treatment of depressive symptoms and stress can lower cvd events in individuals with diabetes . And, as noted above, more work needs to be done to establish appropriate screening strategies for behavioral comorbidities that can be effectively disseminated in busy primary care settings where most individuals with diabetes are managed . This study is a prospective cohort study and not a randomized clinical trial, and the incident outcomes should be understood as associations with baseline characteristics without clear evidence of causality . By design, included only non - hispanic white and black subjects; extrapolation to other ethnic groups or to other nations should not be undertaken . The current study did not include a measure of diabetes duration, which may have influenced the risk of cv events . The study included data on a large number of cv risk factors that were used to help minimize the influence of confounders; however, there may have been other unmeasured risk factors that were associated with adverse cv outcomes . The presence of elevated stress or depressive symptoms in community - dwelling subjects with diabetes was associated with an increased risk for acute chd or cv death . Moreover, subjects with diabetes who reported both stress and depressive symptoms together had the greatest risk for acute chd and cv death . The presence of either or both behavioral comorbidities in subjects with diabetes was also associated with increased hrs for stroke . Elevated stress and/or depressive symptoms in subjects without diabetes resulted in increased hrs in fully adjusted models that were much smaller in magnitude and not statistically significant . These findings demonstrate the persistent disparities and negative cv impact of these comorbidities at the population level and suggest the need for more careful integration of behavioral screening and management in primary care settings, where most patients with type 2 diabetes are managed.
|
Antineutrophil cytoplasmic antibodies (anca)-associated glomerulonephritis (gn) is characterized by necrotizing and crescentic gn with paucity of immunoglobulin (ig) and complement deposition, which is also known as pauci - immune crescentic gn . Membranous nephropathy (mn) is characterized by the formation of subepithelial immune deposit with resultant changes in glomerular basement membrane (gbm), most notably spike formation . A 48-year - old man presented with marked proteinuria, hypoalbuminemia, and renal dysfunction with positive results for myeloperoxidase (mpo) and anca . Renal biopsy revealed crescents and thick gbm with subepithelial spikes along with igg deposition on immunofluorescent staining . After one - month follow - up, antibody level and renal function did not improve . Coexistence of mn with mpo - anca crescentic gn is very rare and should be managed aggressively . Membranous nephropathy (mn) is characterized by the formation of subepithelial immune deposit with resultant changes in glomerular basement membrane (gbm), most notably spike formation . Approximately 75% of mn represent as primary disease and the rest results from secondary causes, most commonly systemic lupus nephritis (sle), infections such as hepatitis b or c viruses, malignancy, or drugs . Antineutrophil cytoplasmic antibodies (anca)-associated glomerulonephritis (gn) is characterized by necrotizing and crescentic gn with paucity of immunoglobulin (ig) and complement deposition, which is also known as pauci - immune crescentic gn (1 - 3). We report a rare case of mn with myeloperoxidase (mpo)-anca - associated crescentic gn in a 48 year - old - man who was admitted to our institute . A 48-year - old man presented with intermittent puffiness of face and edema of the feet for two months . He did not have fever, hematuria, or breathlessness . On examination, he had bilateral pitting pedal edema (+ +), pulse rate of 98 per minute, and blood pressure of 140/96 mm hg . Cardiovascular and respiratory examinations were unremarkable . On investigation the following laboratory results were reported: hemoglobin, 6.1 gm / dl; white blood cell (wbc) count, 5.6 10/l; platelet count, 2.11 10/l; blood urea nitrogen, 35 mmol / l; serum creatinine, 807 mol / l; random blood sugar, 5.33 mmol / l; total serum protein, 500 g / l; serum albumin, 31 g / l; serum sodium, 132 mmol / l; serum potassium, 4.54 mmol / l; and serum cholesterol, 5.28 mmol / l . Urine analysis showed 3 + albumin with 35 to 40/hpf of red blood cells and 8 to10/hpf of wbc . Results of viral screening for human immunodeficiency virus, hepatitis b and hepatitis c viruses were negative . Serum mpo - anca level was 220 u / ml (normal range, 1 - 5). Serum anti - nuclear antibody (ana), the levels of serum complements c3 and c4 were in normal limits . Chest radiograph revealed normal findings and renal ultrasonography showed right kidney dimension of 8.6 3.4 cm and left kidney dimension of 9.0 4.5 cm, with increased echogenicity and maintained corticomedullary differentiation . Renal biopsy was performed and after paraffin embedding, 3-m - thick sections were prepared and stained by hematoxylin and eosin (h and e), periodic acid schiff, jone s silver methenamine, and gomori s trichrome stains . Histopathologic examination (figures 1 and 2) showed a single core of renal tissue containing 14 glomeruli with surrounding tubules and vessels . Immunofluorescence (if) studies (figure 3) showed fine granular fluorescence (+ 3/4) across 80% to 90% of glomerular capillary walls on staining with anti - human igg . No fluorescence was revealed on staining with anti - human iga, c3, c1q, fibrinogen, and igm antisera . He was diagnosed as a case of mpo - anca - associated crescentic gn with mn . He was treated with intravenous methylprednisolone (500 mg / d) for three days, followed by intravenous cyclophosphamide (500 mg) and oral prednisolone (0.5 mg / kg / d) with antihypertensive drugs . After two - month follow - up, his serum creatinine was 389 mol / l, urine albumin was 3 + with 5 to 7/hpf of rbcs . His renal biopsy revealed crescents and thick gbm with subepithelial spikes along with igg deposition on if staining . Coexistence of anca - gn with mn is very rare (1, 4 - 7). Surindran et al . Detected coexistence of anti - phospholipase a2 receptor antibody (pla2r)-positive mn and anca - gn (9). Ram et al . Reported mn superimposed on churg - strauss syndrome (10). The combination of anti gbm - gn and mn are also reported (11, 12). Nasr et al . And nayak et al . Reported that mn preceded the development of anti gbm in 50% of cases (1, 13). Morizane et al . Have reported a case of mpo - anca - associated gn, which was superimposed on type-3 mpgn . Mn can be classified into primary and secondary forms according to igg subclass . In primary mn, igg4 is positive and in secondary mn, igg1 and igg4 . Speculated that mpo - anca - associated gn might cause secondary mn as both igg1 and igg4 were present in their case (4). The membranous lupus nephritis (ln) with focal or diffuse ln may have crescents with mn . Such mixed patterns of ln have endocapillary proliferation and concomitant subendothelial immune deposits with full - house staining by if . Nasr et al . Reviewed kidney biopsies from january 2000 to february 2008 and concluded that coexistence of mn and anca - associated gn would be coincidental (1). The primary mn is associated with hla - dq1 and pla2r, suggesting genetic predisposition (9, 15). Anca - associated gn is also associated with environmental triggers such as drugs and infections (9). When patient presents as rapidly progressive glomerulonephritis with marked proteinuria, further investigations to rule out possibility of mn with anca associated crescentic gn should be performed and the patient should be managed aggressively.
|
Although enhanced cardiovascular reactivity is generally associated with future development of hypertension and other cardiovascular events [15], there are studies that have failed to show any relationship between reactivity to stress and future elevation of blood pressure [1, 612]. Emerging evidence suggest that some stress tests may be better predictors of future cardiovascular events than other stressors [4, 5, 10]. For example, blood pressure response to arithmetic and star tracing stress tests predicted high blood pressure while reactivity to cold pressor stress test did not [13, 14]. Furthermore, metanalysis of studies that assessed mental stress tests and hypertension development revealed variable success of mental tests in predicting hypertension . Among the different types of mental stressors, cognitive mental stressors were more consistent in predicting hypertension compared to emotion evoking, interview, and public speaking stressors . The inconsistencies in prediction do not appear to be explained by differences in the type (mental, physical, or psychophysical) of stress tests for there is inconsistent predictability even among the types of stressors . Another possible explanation for the inconsistencies in reactivity prediction of adverse cardiovascular outcomes is the interaction of psychosocial factors with cardiovascular responses to acute laboratory stressors . Metanalysis of over 700 studies revealed that chronic (trait) anxiety is associated with decreased cardiovascular reactivity . In contrast, a study of young european population revealed that acute (state) anxiety was associated with significantly increased reactivity to cold pressor test but not mental stress test . These observations, when taken together, suggest that individuals may be inaccurately identified as hyperresponsive if anxiety is not considered as a confounder in the reactivity response to acute laboratory stress tests . Consequently, inaccurate assessment of increased reactivity due to the interaction of anxiety with acute stressors may explain the inconsistent reports of increased risk of hypertension with increased reactivity . This study sought to investigate whether (1) anxiety determined the blood pressure response to stress tests and (2) anxiety differentially influenced blood pressure response to anger recall and cold pressor stress tests in african americans . We chose to study african americans for several reasons: (1) this group is characterized as hyperresponsive to stress [7, 1720], (2) several reports have failed to find increased reactivity in this population [4, 8, 2123], and (3) psychosocial factors, including anxiety, are significantly associated with blood pressure in this population [2429]. We report that state (in the moment) anxiety was significantly associated with blood pressure response to both stressors (anger recall and cold pressor stress tests) in this population . These results support the idea that identification of hyperresponders to acute stress tests among african americans must take into account anxiety levels before determining whether an individual has increased reactivity to acute stress and/or that anxiety may play an important role along with reactivity response in hypertension development . However, our results do not support the idea that anxiety differentially impacts reactivity response to psychological, psychophysical, and physical stressors . A sample of 179 (116 males, 63 females) participants of african descent were recruited to the study . All study procedures and materials were approved by and in compliance with the north carolina central university institutional review board . Eligibility criteria for entry were (1) be 18 to 65 years old (2) being a student or employee at north carolina central university or living in the surrounding regions of durham, orange and wake counties, (3) having no diagnosed cardiovascular disease (self - reported), and (4) not taking any hypertensive medication . These regions of durham, orange, and wake counties make up the north carolina triangle region that is in the stroke belt (e.g., a geographic region with a higher occurrence of stroke). Of these 179, only 50 are reported in the current report; these were selected based on the type of mental stress used . The 50 participants reported here met the following criteria: (1) completed both the trait anxiety scale and the state anxiety scale, and (2) were between the ages of 18 and 40 years old . Study participants were scheduled at either 9 am or 1 pm for the three - hour study protocol . After receiving informed consent, trained staff measured blood pressure by sphygmomanometer method with a ge dinamap pro 100 automatic model and a cuff size appropriate for the body size . Each participant was allowed five minutes to sit quietly before taking the first resting parameters . The dinamap was set to assess systolic blood pressure (sbp) and diastolic blood pressure (dbp) at one - minute intervals for the resting measurements as well as during the two acute stressor tasks . Following resting blood pressure and heart rate measurements, participants were administered the cold pressor test, consisting of submersion of the hand in ice cold water for three minutes followed by a five - minute recovery period . A psychological stressor, anger recall, was given only after blood pressures and heart rate returned to baseline resting values . Anger recall stress consisted of 5 minutes of contemplating an event that evoked anger, 5-minute discussion about the event, and 5-minute recovery period . Cardiovascular reactivity was calculated as the difference between the average baseline prestressor blood pressure and the average change in blood pressure over the 5-minute stress period . The study protocol consisted of state anxiety assessment, resting bp measurement, second resting bp measurement, cold pressor stressor, third resting bp measurement, anger recall stressor, trait anxiety assessment, recording medical history, body mass index measurement, and completing a demographics questionnaire . State anxiety is defined as an acute response to a threatening or challenging situation, while trait anxiety is defined as a stable and enduring tendency to be anxious . Each item is rated on a four - point scale (1 = almost never, 4 = almost always). Items from each subscale are summed to create a total state anxiety score and a total trait anxiety score . Higher scores on the state anxiety subscale indicate greater anxiety at the present time; higher scores on the trait anxiety subscale indicate greater anxiety, in general . The state anxiety subscale has an alpha coefficient of .87, and the trait anxiety has an alpha coefficient of .88, indicating good (since .80 or greater) internal consistency in this sample . Scoring of the psychosocial scales spielberger state trait anxiety inventory utilized scoring protocols documented in prior research as indicated above and were confirmed with factor analysis . Mean, standard deviation, standard error, median, and quartile calculations provide data reductions for sbp, dbp, and other clinical measures with multiple measurements . Regression models, goodness of fit, multivariate parameter estimates, and confidence intervals were evaluated for each stressors impact on sbp, and dbp . Two participants did not complete the cold pressor stressor; thus, the sample size is 48 for the cold pressor cardiovascular reactivity and 50 for the anger recall cardiovascular reactivity . The african american study samples are relatively young (median age of twenty - one years) with normal bmi (median bmi was 26.2 kg / m; normal bmi is 2530 kg / m) and waist circumference normal values of less than 102 for males and 88 cm for females [3335]. This group also had normal cholesterol (less than 200 mg / dl), triglycerides (less than 150 mg / dl), glucose (less than 126 mg / dl), and insulin (<10 miu) levels . This group was normotensive with median systolic (sbp) and diastolic (dbp) blood pressures of 114 and 70 mmhg, respectively . A summary of the cardiovascular reactivity responses to ar and cp is shown in table 2 . Cardiovascular reactivity was defined as the change in cardiovascular parameters (sbp, dbp, mean arterial pressure (map), and heart rate (hr)) following the induction of a stress stimulus compared to baseline cardiovascular parameters . Both the cp stressor and the ar stressor produced significant rises in sbp, dbp, and hr . All of the values returned to baseline during the recovery period except for sbp during the cp recovery period . Repeated measures anova and the multiple comparison test, student - newman - keuls test, verified that the two stressor tasks (cp and ar) produced statistically significant increases (p <0.0001) in the cardiovascular parameters in comparison to the resting measurements . We examined pearson's correlations of state anxiety, trait anxiety, age, bmi, and resting cardiovascular measures with the cardiovascular reactivity parameters . Trait anxiety had a statistically significant, positive correlation with state anxiety (n = 50; pearson's r = 0.47; p <0.001, two - tailed pearson's correlation). State anxiety had statistically significant, positive correlations with cp reactivity response for sbp (average change; n = 48; pearson's r = 0.37; p = 0.01), dbp (average change; n = 48; pearson's r = 0.40; p = 0.005). Similarly, state anxiety was highly correlated with the ar reactivity response for sbp (n = 50; pearson's r = 0.34; p = 0.015) and dbp (n = 50; pearson's r = 0.35; p = 0.013). Specifically, state anxiety was significantly associated with hr change to cp (average change; n = 48; pearson's r = 0.37; p = 0.009) but was not related to hr changes to ar (n = 50; pearson's r = 0.14; p = 0.30). Trait anxiety had a nonsignificant correlation with sbp (n = 48; pearson's r = 0.23; p = 0.12) but a positive, significant correlation for dbp (n = 48; pearson's r = 0.34; p = 0.02) reactivity response to cp . As for ar, trait anxiety was positively and significantly correlated with sbp (n = 50; pearson's r = 0.35; p = 0.012) but was not significantly correlated with dbp (n = 50; pearson's r = 0.23; p = 0.11). Age, bmi, and resting cardiovascular measures had nonsignificant correlations with both cp reactivity and ar reactivity as measured by sbp, dbp, and hr changes . Resting sbp was only associated with map changes with cp and ar stress tests (pearson's r = 0.33; p <0.02 and r = 0.38; p <0.01, resp . ). The following variables were evaluated in the stepwise procedure: state anxiety, trait anxiety, resting cardiovascular measures, body mass index, and age . The variable selection results of the stepwise algorithm suggested the use of state anxiety for a parsimonious model of both cold pressor cardiovascular reactivity as well as anger recall cardiovascular reactivity . Our next step was to evaluate regression models to predict cardiovascular reactivity with state anxiety as the independent variable . The model for predicting the cp increase in sbp (see table 3) had an r of 0.14 and state anxiety as a significant parameter (p = 0.009). State anxiety was also a significant independent variable (p = 0.005) in the model of the cp change in dbp (r = 0.16). Similar results were found with the model for predicting the change in cardiovascular reactivity for the ar stressor as shown in table 4 . State anxiety was a significant parameter for the change in sbp (p = 0.015, r = 0.12) and dbp (p = 0.013, r = 0.12). Each model was scrutinized to verify adherence to the assumptions of regression modeling (linear relationship between independent variables and dependent variables, homoscedasticity of the errors, and errors are independent and normally distributed). Shapiro - wilke statistics did not reject the null hypothesis of normal distribution of the residuals . This study investigated whether anxiety differentially affects cardiovascular reactivity to cold pressor and anger recall stress tests in a sample of young, healthy, community dwelling african american adults, a population prone to develop cardiovascular disease . Importantly, we show that the state (at the moment) anxiety was significantly associated sbp and dbp responses to both cold pressor and anger recall laboratory stress tests in this population . In contrast to blood pressure, state anxiety differentially predicted hr response to cp but not ar . On the other hand, chronic (trait) anxiety was not a significant predictor of reactivity in our statistical models . We interpret these results to mean that the state of anxiety at the time of the stressor must be considered when assessing cardiovascular reactivity to laboratory stress tests . Failure to consider state anxiety as a confounder of reactivity responses may lead to misidentifying some individuals as hyperresponders when compared to others . Misidentification of individuals may contribute in part to the inconsistent findings of increased reactivity in african americans and to the inconsistent prediction of hypertension in those with increased vascular reactivity . Alternatively, these results can be interpreted to mean that the interaction of state anxiety and cardiovascular reactivity may be important determinants of hypertension development in african americans . Anxiety, chronic anxiety in particular, has been linked to the development of disease . Contrary to what would be expected, chronic anxiety has been shown to be negatively associated with cardiovascular reactivity . Although chronic anxiety and cardiovascular reactivity associations have been studied, few studies have investigated the role of state anxiety in determining blood pressure response to stress . White coat response and is effective in predicting ambulatory evening systolic blood pressure in young black males . Studies that have investigated the effect of state anxiety on reactivity did not include african americans [16, 37]. Our study provides evidence that young healthy african americans who are anxious prior to the stress tests are likely to have higher blood pressure responses to the stress . Thus, variability in hyperresponsiveness response to laboratory stress tests in african americans may be due in part to a failure to consider state anxiety as a confounder . Although many studies have shown that enhanced cardiovascular reactivity predicts hypertension development and other cardiovascular events [15], there are several studies that failed to show any relationship between reactivity to stress and hypertension development [1, 612]. The inconsistency may be a consequence of the type of stressors used [4, 5, 38, 39] and the interaction of psychosocial factors with blood pressure response to the stressor [4042]. Psychological stress tests may be better than cold pressor stress tests at predicting future cardiovascular events [4, 5, 22, 43, 44]. This differential effect of stressor type and hypertension development may be a consequence of differential psychosocial factor interaction with stressors . In a study of a european population, psychosocial factors appear to have a greater impact on reactivity to cold pressor than reactivity to mental stress . Our study compares the impact of anxiety on reactivity to cold pressor and anger recall in african americans . Another explanation for the inconsistent findings of increased risk of hypertension development with increased reactivity is the interaction of psychosocial factors with cardiovascular reactivity to promote hypertension development . For example, studies show that hostility, depression, and anger contribute to increased reactivity [40, 45, 46]. Psychosocial factors also are associated with increased incidence of cardiovascular events [4750] as well as the development of cardiovascular disease [51, 52]. We show that the psychosocial factor, anxiety, can influence the reactivity response to acute stress . However, because the study design was cross - sectional, it could not be determined whether state anxiety interaction with cardiovascular response to acute stress predicts hypertension development . This study shows that the current state of anxiety was significantly associated with blood pressure response to laboratory stress tests . Consequently, anxiety levels should be assessed when using acute laboratory stress tests for identification of those with increased cardiovascular reactivity . Further studies are needed to determine whether reactivity normalized to anxiety increases the accuracy in identifying hyperresponders and, subsequently, predicting future hypertension development . These findings need to be validated in a larger cross sectional population of african americans . Additionally, our study design did not allow us to determine whether the impact of anxiety on blood pressure response to acute stressor is unique to anxiety or whether other psychosocial factors similarly influence blood pressure response to acute stress in our cohort . Another limitation of the study is that adrenergic system activation was not measured; consequently, it could not be determined if the two stressors differentially activated the beta or alpha - adrenergic receptor pathways . This information would be helpful in future longitudinal studies that will address how activation of the alpha and beta adrenergic receptors pathways ultimately leads to hypertension development and the attending cardiovascular disease . A longitudinal study design will also help to address the question of whether inclusion of anxiety enhances the ability of increased reactivity to predict future elevations of blood pressure.
|
Sweet's syndrome (ss) presenting in a localized and symmetric pattern is a very rare phenomenon . There have, however, been, a few case reports for the same . Ss per se was first reported in 1964 by robert douglas sweet . Though classically presenting as tender pseudovesicles, ss may demonstrate numerous topographic variations, which could be quite confusing for the diagnosing dermatologist . A 45-year - old farmer from nepal presented to the department of dermatology with complaints of an abrupt onset of an asymptomatic cutaneous eruption involving the neck and both the forearms since the past 5 days . The lesions were smaller earlier which had progressively increased in size over the past 5 days to reach the current status . There were no associated constitutional symptoms and no history of contact with cattle or sheep ., papules and plaques of varying sizes with a striking central umbilication were identified involving the forearms and neck that gave an illusion of vesiculation [figures 13]. Some of the lesions over the neck had a crust overlying the depressed center [figures 4 and 5]. Gram staining of the tissue obtained from one of the papules after needle extirpation was inconclusive . A skin biopsy from these lesions showed absence of epidermal changes with a dense inflammatory neutrophilic dermal infiltrate along with dermal edema as the hallmark finding, without evidence of vasculitis [figures 68]. Laboratory parameters revealed a hemoglobin level of 14 g / dl, a total white blood cell count of 13,000 cells / mm with 89% neutrophils, and a normal peripheral smear . His renal and hepatic profiles were normal, and imaging studies of the abdomen and pelvis were insignificant . The patient was diagnosed as ss and started on 20 mg of prednisolone once daily for 2 weeks and 100 mg of dapsone once at bedtime for 2 weeks . Fleshy pseudovesicles with central umbilication seen on the right forearm of our patient over the left forearm, a plaque with the characteristic central umbilication seen, closely mimicking the lesions encountered in molluscum contagiosum . Furthermore, to note here is the symmetric pattern of lesion arrangement molluscoid pseudovesicles over the nape of the neck juicy plaques with a central depression and an overlying crust seen on the right side of the neck similar lesions on the left side of the neck as seen in figure 4 . To note here again, is the striking symmetric distribution of the nuchal lesions section of the plaque on the right forearm demonstrating dermal edema and a dense dermal inflammatory infiltrate (h and e, 10) same section showing a dense inflammatory infiltrate composed of neutrophils around the blood vessels and also diffusely distributed (h and e, 20) absence of vasculitis on microscopy (h and e, 40) sweet's syndrome is the prototypical neutrophilic dermatosis, generally characterized by fever, an increase in the neutrophilic count along with tender pseudovesicles distributed over the body in an asymmetric manner . Etiologically, three types of ss have been described, namely the idiopathic, paraneoplastic, and the drug - induced type of ss . As mentioned earlier, there have, however, been reports of the occurrence of ss localized to specific sites of the body though, some of which have presented with very unusual morphologic patterns, as shown by sommer et al . Who described palmoplantar pustulosis as the sole finding in a ss patient, verma et al . Demonstrating the occurrence of ss confined to the photo exposed sites alone, verma who elucidated a rare recurrent bullous eruption localized to the flexural aspect of both the forearms in a ss patient and brechtel et al . Who reported a localized facial presentation of ss manifesting as an inflammatory lesion with a central depression superimposed with several pustules on the surface of the plaque . A variant of ss referred to as neutrophilic dermatosis of the dorsal hands (nddh) is a specific entity confined only to the dorsa of the hands and has been extensively reviewed in literature by galaria et al ., takahama and kanbe, cook et al . Nddh usually presents as edematous and violaceous plaques and papulonodules on the radial aspect of the dorsal surface of both hands . Our patient presented with molluscoid pseudovesicles distributed over the neck and forearms only, which is a very rare morphologic pattern witnessed in ss and to the best of our knowledge has not been previously described . Second, our patient lacked the usual constitutional symptoms that herald ss, which made the diagnosis a challenge . Third, as no systemic association with ss could be identified in our patient, he was further sub - classified as a case of idiopathic ss, which again is a rarity in male patients, who usually present with the paraneoplastic or the drug - induced variant of ss . The hallmark finding in our patient was the central depression in all the pseudovesicles examined . The other possibilities, we kept in mind after clinically examining our patient, were, atypical erythema multiforme, histioid leprosy, milker's nodule, cowpox, and ecthyma contagiosum, but these were eventually ruled out . Hence, to conclude, we see that ss is a dermatosis that could be a great mimicker just like leprosy and syphilis and therefore when faced with diagnostic dilemmas in these kinds of atypical presentations, it would be worthwhile considering ss as a differential diagnosis . Idiopathic sweet's syndrome (ss) may even occur in males though highly uncommonthe absence of constitutional symptoms does not necessarily rule out the diagnosis of ssthe plaques encountered in ss could even be asymptomatic.molluscoid lesions seen in ss is a very rare morphologic pattern encountered and to the best of our knowledge is being reported for the 1 time in literaturelocalized patterns of ss are not so rare as previously thought . Idiopathic sweet's syndrome (ss) may even occur in males though highly uncommon the absence of constitutional symptoms does not necessarily rule out the diagnosis of ss the plaques encountered in ss could even be asymptomatic . Molluscoid lesions seen in ss is a very rare morphologic pattern encountered and to the best of our knowledge is being reported for the 1 time in literature localized patterns of ss are not so rare as previously thought.
|
In order to prevent and control microbial proliferation in industrial settings, cleaning and disinfection plans are applied on a regular basis [1, 2]. In food processing plants, the control of microbial contamination generally involves clean - in - place (cip) procedures which consist of running alternated cycles of detergent and disinfectant solutions with water rinses in high turbulence regimes through the plant and pipeline circuits without dismantling or opening the equipment [25]. Biocides are currently used in industrial processes as the most significant countermeasure to control microbial growth and proliferation . Industry moved progressively towards the use of surfactants that are less toxic and more biodegradable . Surfactants are classified according to the ionic physiognomies of their hydrophilic group as anionic, cationic, nonionic, and zwitterionic [6, 8]. Quaternary ammonium compounds (qacs) are cationic surfactants that are commonly used because of their hard - surface cleaning, odor removal and antimicrobial properties . Besides killing bacteria, the chemical nature of qacs can cause modifications on the properties of abiotic surfaces, decreasing their tension and therefore preventing attachment of microorganisms . The antimicrobial mode of action of cationic surfactants is proposed by some authors as a sequence of events: attraction by the negatively charged cell surface; adsorption to the cell wall through the hydrophobic headgroup; reaction with the lipids and proteins that compose the cytoplasmic membrane; and cell penetration and interaction with intracellular constituents [10, 11]. Thus, qacs damage the outer layers of bacteria, thereby promoting the release of intracellular constituents . Antimicrobial efficacy tests require planning of an adequate strategy and should include all the parameters found in real settings . Aspects such as the proper contact time under known water hardness and conditions of high or low soil content should be considered . For an effective cleaning and disinfection plan, the choice of the disinfectant must follow specific criteria such as compatibility with the surfaces to be disinfected, economic constraints, safety in the workplace, toxicological safety, and biological degradability . It should, most of all, target the type of bacteria and the type of soiling . In fact, disinfectants can be seriously affected by the presence of organic matter . Interfering substances have been studied in the last years and included in cleaning and disinfection plans regulated by the authorities such as the european standard en-1276 . However, most of these studies only address the effects of bovine serum albumin (bsa) and water hardness [9, 14, 15, 1921]. Evaluated the bactericidal activity of disinfectants referred in the german veterinary society guidelines as references for testing disinfectants used in dairy and food industries . In order to simulate the conditions found in practice, they used low fat milk as an organic load and reported the significance in choosing an appropriate disinfectant since the inclusion of a challenging substance (organic material) is important to access the proper bactericidal activity . Bessems demonstrated that a qac tested on three microorganisms (pseudomonas aeruginosa, staphylococcus aureus, and candida albicans) had a similar killing rate in the absence of interfering substances and after the inclusion of 17 dh water hardness, a strong reduction of the killing activity was found for the gram - negative bacteria assessed the effect of dried yeast and human serum on the activity of benzalkonium chloride and concluded that the bactericidal activity of the qac was inhibited by solutions of both interfering substances . This work provides information on the influence of potential interfering substances (bovine serum albumin ha) on the antimicrobial activity of two qacs (benzalkonium chloride and cetyltrimethyl ammonium bromide) against bacillus cereus and pseudomonas fluorescens, as they are two major contaminants in the food industry, particularly the dairy industry, and are a known cause of produce spoilage and foodborne illnesses [2, 2226]. Some of the interfering substances used throughout the experiments are proposed in the european standard en-1276 as potential interfering agents in disinfection while the others are extracellular polymeric substances (eps) from the biofilm matrix that have an important role in antimicrobial resistance . The bacteria used in this work were pseudomonas fluorescens atcc 13525 and a bacillus cereus strain, isolated from a disinfectant solution and identified by 16s rrna gene sequencing . Bacterial strains were grown at a temperature of 30 2c and ph 7, with glucose as the main carbon source . Culture medium consisted of 5 gl glucose, 2.5 gl peptone, and 1.25 gl yeast extract in phosphate buffer (pb) (ph 7, 0.025 m). A bacterial suspension was prepared by inoculation of a single colony grown on solid medium into a 1 l flask containing 250 ml of sterile nutrient medium . This bacterial suspension was incubated overnight at the given temperature with agitation (120 rpm). The qacs used throughout the experiments were benzalkonium chloride (bac) and cetyltrimethyl ammonium bromide (ctab) (sigma, portugal). Preliminary studies with a concentration range between 0 and 5000 mgl were initially made . In order to ascertain the behaviour of bacteria to the qac, the selected concentrations for further studies were 3, 5, 10, 20, and 35 mgl . The qacs were used individually and in combination (both chemicals were combined in equal volumes and concentrations). Ha (acros organics, fisher chemical, portugal), and yeast extract ye (merck, portugal). After the growth period, the suspensions were centrifuged (3999 g, 5 minutes), washed two times, and resuspended in pb to a final cell density of approximately 1 10 cellsml . In the case of the consortium, both bacterial suspensions were washed two times resuspended in pb to a final cell density of approximately 1 10 cellsml, and combined in equal volumes to obtain the same cell concentrations of the single species tests . Afterwards, all bacterial suspensions were exposed to several concentrations of qac for a period of 30 minutes . The effects of the chemicals were evaluated by the assessment of the oxygen uptake rate due to glucose oxidation, according to simes et al . . To investigate the influence of interfering substances on the antimicrobial efficacy, the same procedure was followed with the addition of 300 mgl of bsa, alg, ye, or ha to the bacterial suspension, simulating low concentrations of interfering substances according to the european standard en-1276 . Three independent experiments, each with duplicate samples, were performed for each condition tested . The methodology was performed according to johnston et al . For a period of 10 minutes . Bac and ctab were chemically neutralized by a sterile solution of (w / v) 0.1% peptone, 0.5% tween 80, 0.1% sodium thiosulphate, and 0.07% lecithin dissolved in pb . Control experiments were performed to ascertain the effects of the 10-minute exposure to the neutralization solution, and no effects were detected on the respiratory activity of b. cereus and p. fluorescens (data not shown). After the neutralization step, the bacterial suspensions were centrifuged (3999 g, 5 min) and resuspended in the same volume of pb . The respiratory activity was ascertained by measuring oxygen uptake rates in a biological oxygen monitor (yellow springs instruments 5300a). Demonstrated that this procedure is more adequate and rapid than the assessment of colony forming units to characterize the antimicrobial activity of biocides against heterotrophic aerobic bacteria . Samples were placed in the temperature - controlled vessel of the biological oxygen monitor (t = 25 1c) each containing a dissolved oxygen probe connected to a dissolved oxygen meter . Before measuring, the samples were aerated for 10 minutes to ensure oxygen saturation ([o2] = 8.6 mgl). The vessel was closed, and the decrease of oxygen concentration was monitored over time . The initial linear decrease corresponds to the endogenous respiration rate . To determine the oxygen uptake due to substrate oxidation, 12.5 l of a 5 gl glucose solution was added to each vessel . The slope of the initial linear decrease in dissolved oxygen, after glucose injection, corresponds to the total respiration rate . The difference between these two rates is the oxygen uptake rate due to glucose oxidation . The inactivation was calculated using metabolic activities according to the following equation: (1)% inactivation=(mcmt)mc100, where mc is the metabolic activity of the control experiments (without antimicrobial exposure) and mt is the metabolic activity of the bacterial solutions exposed to the antimicrobial . If% inactivation> 0 there was inactivation of the microorganisms whereas if% inactivation <0 there was metabolic potentiation . The mbc for each situation was determined as the lowest concentration of qac or qac combination where no respiratory activity was detected . For each parameter the statistical significance of the results was evaluated using the wilcoxon test (confidence level 95%) to investigate whether the differences between the resulting experimental values could be considered significant . The antibacterial activity of bac, ctab, and their combination was investigated in the absence and in the presence of four selected interfering substances . In the absence of interfering substances bac caused the inactivation of b. cereus at 10 mgl, p. fluorescens at 35 mgl, and the consortium at 20 mgl . Ctab at 20 mgl completely inactivated b. cereus and at 35 mgl inactivated the total population of p. fluorescens and the consortium . The combination of both qacs was synergistic in the inactivation of b. cereus (total inactivation with 3 mgl) and indifferent for p. fluorescens (35 mgl) and the bacterial consortium (35 mgl). The inclusion of the selected interfering substances influenced the antimicrobial activity of the qacs to some extent (figures 13). The inactivation of b. cereus (figure 1) was not affected by the presence of any interfering substances (p> 0.05), except with ha . The antimicrobial action of the qacs against p. fluorescens (figure 2) was not significantly influenced by the presence of most potential interfering substances (p> 0.05), except for ha where interference was observed (p <0.05). The antimicrobial activity of the qacs against the bacterial consortium (figure 3) was affected by the presence of interfering substances . Ha reduced significantly the activity of ctab at higher concentrations (p <0.05). Bsa and ye resulted in a significant reduction of the activity of the combination of qacs (p <0.05). Linear correlations were determined to assess the relationship between qac concentrations and the inactivation data . The effect of increasing qac concentration on bacterial inactivation shows that there are strong linear correlations (r> 0.850) for the control assays, with the exception of b. cereus (this bacterium was inactivated with low qac concentrations). The most extreme cases are the treatments with ctab to p. fluorescens with alg as an interfering substance (r = 0.771) and the bacterial consortium in the presence of ye (r = 0.738). Likewise, this decrease of linear correlation factors was found for p. fluorescens and for the consortium exposed to ha where the lowest correlation factor was 0.153, which was obtained for p. fluorescens treated with ctab . This phenomenon only happened when the qacs were used on p. fluorescens and the bacterial consortium in the presence of ye and ha . The most significant cases of oxygen uptake rate increase were verified for p. fluorescens exposed to bac (5 to 35 mgl) and ctab (3 to 35 mgl) in the presence of ha and combination of qacs (3 to 10 mgl) in the presence of ye . A similar metabolic behaviour was found for the bacterial consortium exposed to bac (3 to 35 mgl) and ctab (5 and 10 mgl) for ha and qac combination (3 to 20 mgl) with ye . The mbc values for the different conditions tested (single and combined qacs, in the absence and presence of potential disinfection interfering substances) are shown in table 1 . The presence of bsa increased the mbc of the combination of qacs for b. cereus (3 to 5 mgl) and the consortium . Alg increased the mbc of bac for the consortium (20 to over 35 mgl) and qacs combination (3 to 5 mgl) for b. cereus . Ye increased the mbc of bac for b. cereus (10 to 20 mgl) and qac combination (3 to 5 mgl). The mbc values for the consortium of cells increased in the presence of ye (bac20 to 35 mgl, ctab35 to over 35 mgl, and qac combination35 to over 35 mgl). Ha increased the mbc for all the scenarios, except of ctab when applied to b. cereus (in this situation the mbc was reduced). The mbc was reduced in other situations such as, for b. cereus, in the presence of alg when using bac and ctab (10 to 5 mgl and 20 to 5 mgl, resp .) And in the presence of ye when using ctab (20 to 3 mgl). Fluorescens inactivation by ctab was reduced by bsa (35 to 20 mgl). Alg also reduced the antimicrobial activity of the combination of qacs against the bacterial consortium (35 to 20 mgl). It is assumed that the organic material can potentially interfere with the antimicrobial agents by chemical and/or ionic interactions [15, 33]. Therefore, it is necessary to know the role of each potential interfering substance in the antimicrobial activity in order to develop effective disinfection strategies . The interfering substances tested are commonly found as residuals in the food industry (from food products and from microbial contaminants, biofilms) [18, 27]. In this study, higher inactivation rates were verified for b. cereus in comparison to p. fluorescens at the same qac concentration . In fact, when b. cereus and p. fluorescens are combined in a 1: 1 bacterial suspension, it is expected that the first is more affected than the second . B. cereus is more susceptible due to the fact that it is a gram - positive bacterium that lacks an outer membrane, which typically provides increased protection to gram - negative bacteria . This fact is corroborated by previous reports which stated that gram - positive bacteria are more susceptible to cationic surfactants than gram - negative bacteria [34, 35]. Bsa was already studied as an interfering substance in disinfection practices [9, 14, 1921, 36]. The negative effect of bsa on the action of biocides against p. fluorescens was demonstrated by simes et al . P. fluorescens treatment with ctab with the addition of 3 gl of bsa resulted in a 10-fold increase on the mbc of this qac [9, 21]. In the present study, the efficacy of the combination of qacs against b. cereus and the cell consortium was also reduced . This effect of bsa as an antimicrobial quencher is apparently due to the strong ability of qacs to react with proteins . Proteins can precipitate in the form of their anions, in this way, the negative - charged protein ions will cling to the positively charged molecules of the cationic compounds . Ctab is a biocide that targets the membrane and has a strong affinity for proteins . Bac is composed of a positively charged hydrophobic headgroup which clings to opposite charged surfaces [8, 37]. Studied the effect of the alkyl chain of bac binding to bsa and dried yeast . Their conclusions were that bac is often inactivated by organic matter, either by adsorption to the bacterial surface or by adsorption to the organic matter in general . These authors also suggested that the reduction in the activity of bac was probably related to more than one physical property of the compounds like the chain length (longer chains result in more adsorption to the bacterial surface). Alg is a common constituent of the extracellular polymeric substances of the biofilm matrix [3840]. A function frequently attributed to eps is their general protective effect on biofilm microorganisms against adverse conditions . The eps matrix delays or prevents antimicrobials from reaching target microorganisms within the biofilm by diffusion limitation and/or chemical interaction with the extracellular proteins and polysaccharides [32, 41]. In this study, alg either potentiated or hindered the antimicrobial activity of the selected qacs . The presence of this interfering substance was not obvious on the inactivation of p. fluorescens . On the other hand, the inactivation of b. cereus by bac and ctab and the consortium by the combination of qacs was easier in the presence of this interfering substance . The bacterial consortium treatments with bac and b. cereus with the combination of qacs were hampered by the presence of alg . Davies et al . Found that the production of alg was triggered by membrane perturbation induced by ethanol stress, nitrogen limitation, attachment to surfaces, or even high oxygen tension [42, 43]. This substance is suggested as one of the main biofilm resistance vectors either by reacting with the antimicrobials or by hindering antimicrobials diffusion to the cells . The antimicrobial interference caused by alg is apparently due to electrostatic interactions between the anionic alg and the cationic - selected qacs . The presence of ye as interfering substance resulted in three different outcomes on the antimicrobial activity of the qacs: (1) no effect / indifference, (2) the respiratory activity reduced, and (3) the respiratory activity potentiated . This interfering substance worked mainly as a hinderer of the antimicrobial activity by increasing the mbc of b. cereus in all cases except for ctab, of p. fluorescens with the combination of qacs, and of the consortium of cells with ctab and the combination of qacs . Ye is listed in the european standard en-1276 as an interfering substance native to the brewery industry . The constituents of ye are very similar to the components of the bacterial cells, thus, it is expected that the antimicrobial agents that target the bacterial cells are also drawn to ye . In a similar study by jon et al . It was shown that the presence of dried yeast decreased the biocidal effectiveness of bac . Humic substances are found ubiquitously in the environment and can be found in the biofilm matrix [2, 46]. Ha reduced the antimicrobial activity of the qacs in most of the cases, although in some cases it promoted the respiratory activity (potentiation). The presence of these compounds had the strongest effect compared to the remaining interfering substances . Studied the sorption mechanisms of anionic and cationic surfactants to natural soils concluding that the dominant sorption mechanism of surfactants to clay is cation exchange . Koopal et al . Also verified the formation of complexes ha - cationic surfactant . Respiratory activity potentiation was verified with the addition of ha to p. fluorescens and ye to the bacterial consortium . It is known that ha participates in cellular metabolism processes such as growth, respiration, photosynthesis, and nitrogen fixation . On the other hand, ha were proposed to replace synthetic surfactants such as sds, tween 80, and triton x-100 in industrial applications such as textile dying or washing . It is therefore possible that the inclusion of humic substances in a solution of qacs may interfere with the chemical characteristics of the solution . The resultant mixture, with an apparent reduced antimicrobial efficacy, seems to potentiate the respiratory activity of the bacteria, particularly of p. fluorescens . As qacs are membrane active agents, their use at sublethal concentrations could improve membrane permeability and consequently the nutrient influx, without compromising the bacterial viability . Also, there is the hypothesis that the potentially interfering agents could be used as nutrients . In fact, it was found that the growth rates of anaerobic and aerobic microorganisms increased when humic substances were added, which stimulated enzyme activity [52, 53]. In a similar way, ha are likely to be used for growth in the same way as ye; these might be broken down to smaller molecules that can be used by cells as a carbon or nitrogen sources . The antimicrobial activity of the tested qacs was enhanced in some cases, where the interfering substances were present . This is an unexpected result due to the recognized potential of alg, bsa, ha, and ye to interfere with disinfection . This effect is probably due to the low concentration of interfering substances tested that caused both respiratory activity reduction and potentiation . Ethylenediamine tetraacetate (edta) was reported as early as 1965 to increase the biocidal effects of bac and chlorhexidine diacetate on pseudomonas aeruginosa . Reported that chitosan (a polysaccharide) potentiated the antimicrobial action of sodium benzoate on spoilage yeasts . In dairy plants, disinfection is potentiated by pre - washes with alkali or enzyme - based cleaning agents . Most of these cases were observed for b. cereus (four occurrences), one was observed for p. fluorescens, and another one was observed for the consortium of cells . The mbc was improved by more than 50% in the cases of b. cereus and less than 30% for p. fluorescens and the consortium of cells . To our knowledge there are no reported cases of antimicrobial agents potentiation by bsa, ye, or alg . Although the exact chemical structure of ha has not yet been determined, ha could be chemically similar to the tested qacs, presenting a positive hydrophilic head and a hydrophobic tail . With this structure ha could act as detergents in conditions such as those observed in the treatment of b. cereus with ctab . The present work shows that increasing qacs concentrations lead to an increase in antimicrobial effectiveness . This is valid mainly when the qacs were applied in the absence of interfering substances . This means that disinfection was concentration dependent, as found for most of the antimicrobial chemicals . However, the linear dependency of inactivation versus concentration is not verified for most of the tests where interfering substances were added . This result evidences that the mathematical modelling of disinfection strategies requires a case - to - case analysis when interfering substances are present . The overall results demonstrate that a disinfection process in the presence of the selected interfering substances can reduce the effectiveness of bac, ctab, and their combination . The bacteria were inactivated equally by all qacs, although in the absence of interfering substances ctab was the most efficient solution . P. fluorescens was the bacterium with the highest resistance to inactivation, followed by the bacterial consortium . The tested interfering substances, referred in the european standard 1276 (bsa and ye), and known eps constituents related with biofilm resistance (alg) resulted in mild interferences on the activity of the qacs . Ha were the interfering substance that resulted in the most severe effect by reducing the activity of qacs, causing, in some circumstances, significant respiratory activity potentiation.
|
Social scientists who explore factors mediating and moderating the relationships between social stressors and mental health, including drinking outcomes, have highlighted modes of coping [1, 2]. These studies have explored behaviors which protect people from being psychologically harmed and cognitive appraisals which influence behaviors such as problem - focused coping or using alcohol to self - medicate distress . However, studies have not considered the characteristics of the stressful situation itself that may make certain coping strategies more or less effective . In particular, psychiatric epidemiologic studies have tended to emphasize microlevel stressors (e.g., stressors in individuals' role domains) and, until recently, have ignored the linkages between macrolevel social forces and the daily stressors in people's lives [79]. However, macrolevel social conditions can affect the magnitude of stressors experienced in people's lives and the extent to which they experience cumulative adversity . This paper focuses on coping with the fallout from one type of macrolevel social stressor: the recent great recession . This economic downturn constituted the most severe economic crisis in the united states since the great depression and had persisting economic effects (e.g., job loss, less desirable working conditions, loss of home, loss of retirement savings, lack of health care access, and social isolation) which have been linked with deleterious drinking outcomes . A key issue involving the effectiveness of alternative modes of coping with stressors derived from macrolevel social forces and protecting against deleterious drinking outcomes is the question of whether individual modes of coping outside of the political realm emphasized in the overall coping literature are most efficacious . Or, alternatively, do stressors engendered by macrolevel social forces require unique forms of coping, that encompass the political realm? With respect to coping strategies employed in the wake of the great recession, politically oriented coping strategies might be of particular relevance due to the impact of governmental decision - making on the state of the economy . Politically oriented coping strategies might include political activism oriented to altering economic policies or support for campaigns by politicians offering solutions to economically based hardships . Scholarly work on the occupy wall street movement, for example, documents involvement by individuals sharing their own economic struggles and collectively gathering to protest their precarious economic situation and uncertain economic future . Earlier work also suggests the salience of activities oriented toward changing politically based social realities such as through the act of voting or by collectively challenging community - level decisions such as school closings . By contrast, the traditional coping literature has emphasized individual, nonpolitical modes of coping, such as emotional acceptance of the stressful situation, blaming one's self for the situation, or taking individual actions such as looking for a job if unemployed . While sociologists have recently accorded greater attention to the prevalence and alcohol - related consequences of macrolevel stressors, they have yet to address the extent to which politically oriented modes of coping may be the most efficacious ways to address problems stemming from macrolevel social forces or events . Prior to the more recent focus on macrolevel stressors, kaplan and liu embraced the idea of collective coping as one means for individuals who maintained stigmatized personal identities to challenge and transform conventional socionormative systems through participation in social movements . Subsequently, thoits more explicitly addressed collective coping within the context of the stress paradigm involving acute and chronic stressors not limited to the specific area of stigmatized statuses . She argued that individuals who find themselves in problematic situations can deliberately work to transform the meaning of their experiences and they can additionally use these experiences as a basis for helping or effecting changes in the lives of others she proposed the concept of transformatory coping to include engagement in collective activist activities with others who share similar problems . For example, parents of autistic children have lobbied governments for social services perceived to aid in their children's development . In sum, (1) collective coping tactics (such as politically oriented coping) represent an unmeasured dimension of coping behaviors beyond that represented in the coping literature to date and (2) collective coping tactics may demonstrate a stronger association between stressors, particularly those stemming from macrolevel social forces, and deleterious drinking outcomes compared to the use of modes of coping previously emphasized in the literature on coping . The present study extends previous work by empirically addressing the extent to which politically oriented coping activities engaged in as a response to a macrolevel social stressor, the great recession, are protective against alcohol - related outcomes compared with coping strategies focused outside of the political realm . We hypothesize that politically oriented coping will be more protective against economic stressors linked with the great recession than nonpolitical modes of coping and will uniquely account for some portion of the associations between economy - related stressors and drinking outcomes . Further, we also examine whether politically oriented coping and coping outside of the political realm are more protective for men versus women in the face of macrolevel engendered stressors such as those involving the economic fallout from the great recession . There is consistent evidence that women are more likely to use support - based coping strategies (e.g., seeking support from others such as partner family and friends) in response to stress in contrast to men and some indication that avoidant coping techniques are associated with greater alcohol consumption among men but not women [1, 2022]. (in contrast, parity by gender in the use of individual active coping strategies and their significance for mental health outcomes is generally reported [1, 21].) However, whether there is a corresponding propensity for men and women to differ in the use of politically oriented coping to offset the alcohol - related effects of economy - related stressors is less certain . Earlier research tended to argue that women were less politically interested, informed, and efficacious compared to men . More recent work has shown that women and men differ in particular modes of participation; women are more likely to vote and engage in individual political actions such as signing petitions or donating money, whereas men are more likely to be engaged in collective forms of action such as group protest activities . Thus, we hypothesize that there will be no overall differences in the extent to which women and men manifest politically oriented coping or in the effect that politically oriented coping has on drinking outcomes . Following a transactional model of stress [4, 25], we model coping as a mediator of the relationship between the stressor (i.e., stressful consequences of the great recession) and the stress response (i.e., drinking outcomes). Data were derived from a study conducted in the united states between june, 2010, and january, 2011, that was undertaken in order to understand life change consequences of the major downturn in the economy known as the great recession . Respondents were selected by a random digit dial (rdd) phone survey of the continental united states, and those who consented to participate in the study were mailed questionnaires . Eligible respondents were selected from the households using the troldahl - carter - bryant method of respondent selection which involves the means to randomly select a respondent from all eligible household members . Respondents were told during the phone screen that a $50 american express gift card would be sent to the eligible respondent if he or she completed the questionnaire . Respondents were mailed an initial survey, a postcard reminder to nonresponders, and a second questionnaire if they still had not responded . Figure 1 encompasses a flow chart characterizing each stage in the data collection process through the completion of the questionnaires . 65.9% (n = 663) of the respondents completing the screening calls returned the questionnaire . The telephone screening cooperation rate and the mail survey response rate were each calculated using the conservative aapor response rate formula 3 . The overall survey response rate is the product of the phone screening cooperation rate (35.5%) and the mail questionnaire return response rate (65.9%) or 16.8% . We acknowledge that this response rate is less than ideal and further address this issue in the discussion of study limitations and note other indicators of the representativeness of the final sample . Selection weights were calculated for each of the cases to weight for the different probability of selection for each case . Poststratification weights were calculated for the dataset to ensure that the distribution of sample cases on important demographic variables (age, race / ethnicity, and gender) conformed to the distribution of these variables in census bureau's 2008 united states population estimates . It should be noted that estimates of alcohol consumption for the present sample did appear to conform to national estimates preweighting . For example, the average number of drinks consumed in the past month on days when one drank for the present sample is 2.16, versus the estimated average of 2.10 reported by the centers for disease control and prevention's behavioral risk factor surveillance system for 2010 (by gender, the averages are 2.35 for men and 1.89 for women in the present sample versus 2.43 for men and 1.81 for women in the cdc estimates; by race / ethnicity, the averages are 2.16 for non - hispanic whites, 2.08 for asians, 2.12 for african americans, and 2.72 for hispanics in the present sample versus 2.26 for non - hispanic whites, 2.41 for asians, 2.19 for african americans, and 2.68 for hispanics in the cdc data). It should additionally be noted that the respondents included in this sample reported an overall higher level of education than the general population based on 2008 census estimates . Analysis of variance revealed no significant variation by education in either the outcomes or support coping, avoidant coping, or politically oriented coping . Respondents with less than a high school degree are found to be marginally less likely (p <0.10) to use active coping strategies compared to those with a college degree or postcollege training . Given this discrepancy as well as the fact that education is generally protective against problem drinking predictor variables are economy - related stressors, coping strategies enacted outside of the political realm (i.e., active coping, support coping, and avoidant coping), politically oriented coping, and gender . The sociodemographic characteristics of age, education, and race / ethnicity are controlled in all analyses . To assess past - month drinking patterns, we use the quantity - frequency - variability index (qfv) developed by cahalan et al . . Frequency of drinking is measured as a count of the days on which alcohol was consumed in the past 30 days, and quantity of drinking is measured as the average number of drinks consumed on those days . Variability is calculated by the greatest number of drinks consumed on any one day in the past 30 days . Scores are calculated by multiplying responses to the quantity, frequency, and variability questions (= 0.87). As with the current data, this index tends to approximate a continuous scale, and ample evidence supports its use as such (see fitzgerald and mulford for a review). Our measure of problematic drinking is the 10-item bmast (= 0.74), which is a count measure of difficulties related to alcohol use over the past year . Respondents were asked to indicate yes or no in response to 10 items such as having an accident, losing a close friend, spouse, or loved one, being hospitalized, having trouble at work, and soliciting professional help because of one's drinking . The bmast is one of the most widely used tools for assessing alcohol dependence and problems . It correlates strongly with the full - length mast and evidence of its reliability and validity is widely available [31, 32]. Moreover, we are not using the bmast as a diagnostic tool for depicting problem versus nonproblem drinking, but as it is intended, as suggestive of different degrees of problematic drinking . The measure of economy - related stressors is the life change consequences of the great recession (lccgr) instrument . This construct was developed on the basis of qualitative analyses of transcripts derived from focus groups involving both genders and diverse racial / ethnic groups . The items fall into seven categories: home ownership problems, such as difficulties in mortgage payments, difficulties in paying property taxes, or a drop in credit rating; undesirable living situation, including having to live in a less desired location to save money or having gas and electricity or heat shut off due to an inability to pay bills; problematic employment situation, including a pay - cut, furlough days, and increased feelings of competition with fellow employees; unemployment or underemployment; inadequate health insurance, including lack of medical or dental coverage, decreased quality of coverage, and inability to obtain coverage; social role constraints, such as dissolution of spouse / partner relationship, decreased social life, and increased social isolation due to finances; and inadequate sick time, including inadequate sick days and having to work despite poor health . Consistent with common practice, each score for this measure is a straight count of the number of stressors reported . Three dimensions of nonpolitical modes of coping are assessed: active coping, support coping, and avoidant coping . These measures of coping are derived from subscales of the brief cope instrument and have previously been validated as stand - alone indices in community samples [3436]. Participants in the present study were asked whether they have used these coping strategies in response to the economic recession . Confirmatory factor analysis of the present data supports the inclusion of these items as three separate coping indices, consistent with prior research . Active coping (= 0.84) includes eight items measuring acceptance, positive reframing, and planning and taking action in response to the economic recession . Support coping (= 0.81) includes four items measuring use of emotional and instrumental support (i.e., receiving emotional support and getting advice and help from other people). Avoidant coping (= 0.75) includes 10 items measuring self - distraction, behavioral disengagement, self - denial, blame, and a tendency to vent about or make fun of the situation . All items were rated on a four - point likert - type scale ranging from 0 (i did not do this at all) to 3 (i did this a lot). The measure of politically oriented coping is assessed by a four - item instrument (= 0.79) drawn from the summed responses (i.e., not at all, a little, some, quite a bit, and a lot) to four statements asking how often respondents, in response to the economic recession, have been (1) engaging in political activities such as signing petitions, leading or participating in rallies or marches, or writing to political representatives; (2) organizing with others to challenge politicians currently in office; (3) voting in elections to support politicians who share your political beliefs; and (4) participating in groups trying to influence the policies of the government at the local, state, or national level . The questions used to construct this index were derived from analyses of focus group transcripts (see for details about these focus groups). Confirmatory factor analysis reveals that these items load on a single factor, supporting their inclusion as one index . Education is a categorical variable based on the educational attainment categories of (1) less than high school (n = 45); (2) high school graduate (n = 350); (3) college graduate (n = 110); and (4) postcollege training (n = 150). Race / ethnicity is a dummy variable including non - hispanic whites (n = 436), african americans (n = 80), hispanics (n = 91), asians (n = 29), and individuals who identify as an other race / ethnicity (n = 17). In all analyses, non - hispanic whites serve as the reference category . After examining bivariate correlations in order to assess the basic patterns of association among key study variables, we performed structural equation modeling (sem) using mplus software to examine the predictive significance of economy - related stressors for coping outside of the political realm and politically oriented coping tactics and the two drinking outcomes considered (i.e., past - month drinking and problematic drinking), net of the sociodemographic control variables . We considered the potential for nonpolitical coping and politically oriented coping tactics to mediate the associations between economy - related stressors and each of the outcomes assessed in two models . The first model tested for associations between economic stressors and the drinking - related outcomes . The second model adds nonpolitical and politically oriented coping tactics to test the full mediation model . This latter model assesses all of the direct and indirect paths between economic stressors and the drinking outcomes considered through the nonpolitical and politically oriented coping tactics investigated . We formally tested for mediation using the procedures described by muthen and muthen for mplus software, which apply the tests described by mackinnon et al . . Finally, because the associations between social stress and drinking are found to vary by gender [33, 39], we examined whether any observed mediating effects of the coping strategies investigated vary by gender . For these tests, separate equations include the interaction term for gender by each coping strategy in the path models linking coping with drinking outcomes . It is noteworthy that stressors related to the economy are associated with each of the alcohol - related outcomes and all of the coping resources considered: economy - related stressors are associated with more alcohol consumption and problematic drinking, as well as higher levels of active coping, support coping, avoidant coping, and politically oriented coping . It is also noteworthy that only two of the coping strategies assessed are associated with the drinking outcomes . Avoidant coping and politically oriented coping are associated with both alcohol consumption and problematic drinking, but in opposite directions . That is, greater avoidant coping is associated with greater alcohol consumption and problematic drinking, whereas greater politically oriented coping is associated with less alcohol consumption and problematic drinking . The lack of correlation between active coping and support coping and each of the drinking outcomes, respectively, provides some indication that not all of the coping strategies may be useful in understanding the associations between economic stressors and drinking - related outcomes . Additionally, the possibility that coping resources may vary by gender is not strongly supported by the pattern of correlations reported, with the exception that women reported significantly more emotional support than men . However, and consistent with previous research, women are found to drink less and less problematically . The hypothesized associations between economy - related stressors, coping strategies, and the alcohol - related outcomes are further elaborated upon in the structural equation model . Estimation of the first model (figure 2), including only economic stressors, the drinking - related outcomes, and sociodemographic controls, produces a just identified model and, as such, meaningful fit statistics are not provided . The standardized path coefficients demonstrate that economic stressors and each of the drinking - related outcomes considered are significantly and positively related . Net of the sociodemographic controls, greater economic strain is associated with greater alcohol consumption over the past month (= 0.094, s.e . = 0.004, and p <0.01) and a higher incidence of problematic drinking over the past year (= 0.181, s.e . Sem analysis testing the second model, of the hypothesized associations between economy - related stressors, coping strategies, and the alcohol - related outcomes considered, is presented as figure 3 . In figure 3, solid lines indicate effects that are statistically significant, and dashed lines indicate effects that are not statistically significant . The model fit criteria provided by hu and bentler (cfi> 0.95; rmsea <0.06; srmr <0.08) are used to assess the measurement model . Based on these criteria, there is consistent evidence of good fit for this model (cfi = 0.982; rmsea = 0.046; this model demonstrates that economic stress is associated with higher levels of each of the coping resources considered . That is, greater economic strain appears to predict a greater propensity to use both maladaptive coping tactics (i.e., avoidant coping) and adaptive coping tactics (i.e., active coping, support coping, and politically oriented coping). Avoidant coping is associated with higher levels of past - month drinking and problematic drinking, whereas politically oriented coping is associated with less alcohol consumption and problematic drinking . Formal mediation tests next reveal that the effects of economy - related stressors on the alcohol - related outcomes assessed are partly explained by variation in avoidant coping and politically oriented coping . Significant indirect effects are found for the pathways from economy - related stress to both past - month drinking and problematic drinking . Of the total effect of economy - related stress on past - month drinking (0.071), 0.047 is accounted for by the indirect effect of economy - related stress through avoidant coping and 0.024 is explained by the indirect influence of politically oriented coping . A similar pattern emerges with respect to the relationship between economy - related stressors and problematic drinking . The indirect effects of avoidant coping account for 0.046 of the total effect of economic stressors on problematic drinking (0.098) and politically oriented coping explains 0.032 . Taken together, these findings indicate that both adaptive and maladaptive coping strategies come to bear on drinking patterns associated with economic strain . On the one hand, economic strain appears to be associated with drinking more and more problematically, in the extent to which it is associated with a tendency to engage in avoidant coping strategies . But, then, again, economic strain is also associated with greater politically oriented coping, which is protective against alcohol use and misuse . Moderation tests next determine whether the mediating effects of the coping strategies investigated vary by gender . However, the mediating effect of avoidant coping for the economy - related stressor problematic drinking association differs for men and women in this sample . This effect is displayed in figure 4, which presents the predicted pattern of gender contrasts in the effects of avoidant coping on problematic drinking based on the mean, plus and minus two standard deviation values of avoidant coping (as displayed in table 1). As shown in figure 4, the mediating effects of avoidant coping differ for men and women because the relationship between avoidant coping and problematic drinking is significantly less strong for women compared to men (= 0.319, s.e . Thus, the observation that economic strain is associated with greater problematic drinking in the extent to which it is associated with avoidant coping strategies appears to be more pronounced among men than among women . The findings from this study support a broadened conceptualization of modes of coping in stress paradigm - oriented research to encompass politically oriented coping, in addition to modes of coping outside of the political realm which have predominated in studies of the coping - related moderators or mediators of the associations between social stressors and drinking outcomes . Moreover, given our focus on economic stressors deriving, at least in part, from the macrolevel social forces producing the great recession, we suggest that politically oriented coping is particularly salient as a mode of behavioral adaptation in relation to societally engendered stressors as opposed to stressors that are less affected by macrolevel social forces . While this study specifically addressed deleterious drinking consequences of the recent great recession, social scientists have also delineated broader social - structural and political forces occurring over the last three decades which have led to pervasive job insecurity across all sectors of the us workforce and the erosion in the standard of living for most of the population [4143]. These phenomena include globalization and the outsourcing of work, the downsizing of corporate entities, the shift from secure semiskilled industrial jobs which paid a living wage to low wage service sector jobs, an increase in contingent workers with lower pay, and lack of job security and fringe benefits . Thus, politically oriented coping encompassing the goal of changing governmental policies (e.g., rallying for changes in the tax structure influencing the distribution of wealth throughout society, fighting for government stimulus policies oriented toward job creation, or rallying support for raising the government - mandated minimum wage) may prove to be a more efficacious mode of coping with economic stressors and more protective against deleterious drinking outcomes compared to nonpolitically oriented active coping activities such as looking for a job when unemployed, especially if adequate numbers of jobs relative to demand do not exist and a large proportion of jobs that do exist pay less than a living wage . Consistent with our gender - linked hypothesis, our data showed that males and females did not differ either in the use of politically oriented coping or in the extent to which politically oriented coping was protective in relation to drinking outcomes . However, our data showed that male but not female avoidant coping significantly predicted problem drinking . Thus, with regard to nonpolitically oriented coping with economic stressors, males clearly utilized a coping mode that was maladaptive . This finding might be seen as congruent with early male socialization patterns which have been viewed as fostering men's sense of self - importance rather than connectedness in social relationships insofar as men's avoidance in dealing with economic problems may affect both themselves and others close to them . Alternatively, avoidant coping may predict problem drinking in men but not women to the extent to which males are socialized to drink more heavily than women . Our findings should be viewed within the context of the methodological limitations of this study . The politically oriented coping measure which we developed for this study represents an initial attempt to operationalize this concept . However, it is limited to 4 items in contrast to the much longer nonpolitically oriented coping instrument and does not differentiate politically oriented coping tactics into discrete modes, similar to the measurement of nonpolitically oriented coping . Although factor analysis supported the inclusion of the indicators of politically oriented coping as a single measure, additional work on the concept of politically oriented coping would be useful, with a differentiation between alternative types of politically oriented coping . First, the differentiation between individual modes of political action (e.g., voting, signing petitions, and donating money) and collective political activities (participation and leadership roles in different types of political action groups) would be useful . Secondly, some types of collective coping could be viewed as relatively more adaptive versus maladaptive . For example, the tea party social movement was motivated by both economic and cultural concerns [45, 46]. However, one might differentiate between the tea party articulation of problem - focused social policies such as its belief in the need to diminish the size of government and racially oriented collective venting, such as screams of kill him by audience members in response to sarah palin's critique of barak obama at rallies during the 2008 presidential election . Second, this study utilized cross - sectional data and, thus, likely provides only a snapshot of the complex processes linking economy - related stressors, coping strategies, and drinking outcomes . While our theoretical framework postulated that exposure to economic stressors coupled with particular modes of coping leads to problematic drinking, it is possible that problem drinking coupled with maladaptive coping might make one prone to experiencing economic stressors such as losing one's job . Moreover, we lack data regarding alcohol consumption prior to exposure to the stressors focused on in this study and the extent to which alcohol may have been used as a coping mechanism . Thus, further longitudinal studies are necessary to more clearly delineate the causal directions of the relationships between economic stressors, modes of coping, and drinking outcomes . Third, the study methodology encompassed random - digit - dialing for recruiting the sample, thus only reaching individuals with landline telephone numbers . Consequently, individuals relying on cell phones only, along with households without access to any telephone, were not included in this study . This potential noncoverage error is a source of concern because comparisons of our data with the us population revealed that the sample underrepresented african americans, latinos, and younger (<age 40) and less - educated (high school or less) persons . However, our data were weighted to reflect the demographics of the overall population, and we compared weighted and unweighted estimates of each of our dependent variables to determine if nonresponse and/or noncoverage may have introduced serious bias into one or more of them . In each instance, we found that the weighted values of each measure fell well within 1 sd of the unweighted values, suggesting that the distributions of our key measures were not appreciably influenced by the underrepresentation of particular demographic groups . Despite the noted limitations, this study extends prior research on the moderators and mediators of the social stressor - drinking outcome relationships to broaden notions of coping to include politically oriented coping . Future studies incorporating this mode of coping may more clearly elucidate the political dynamics involved in both the macrolevel production of social stressors and the deleterious alcohol - related consequences of these stressors . This line of research would also have implications for the treatment of alcohol - related problems . In particular, considerations of more adaptive modes of coping might go beyond recommending individual behaviors such as job seeking by unemployed individuals to also suggest politically oriented coping to collectively try to influence the social conditions such as unemployment levels that may give rise to the propensity to self - medicate distress through the use of alcohol.
|
The development of titanium fixtures has brought several benefits for the rehabilitation of edentulous patients . When biological and mechanical principles are respected, this treatment modality may successfully restore the functional and esthetic impairments caused by tooth loss3 . In spite of the significant evolution of a number of implant systems, implant design and features, such as those related to the mechanical behavior of implant - supported prostheses, dental prostheses do fail during function mainly due to abutment and prosthesis screw loosening and/or fracture . In addition, it has been reported that abutment screw loosening is only surpassed by loss of osseointegration as the main cause of failure on implant - supported restorations, as shown in longitudinal follow - up studies5 . When two metal surfaces are in contact, adhesion and friction forces do limit the movement between them . An applied method aimed to reduce this friction and improve adhesion consists of interposing a lubricating film between these surfaces . A metal with low shear strength, such as pure gold, may act as a dry lubricant . When compared to screws without gold coating, it has been found that gold - coated abutment screws subjected to torques of 12, 20, and 32 ncm aiming a 0.0064 mm opening of the implant - abutment interface presented 26, 24, and 24% of preload increase, respectively7 . In another study, it was found that when a torque force is applied to an abutment screw, a significant part of this force is lost due to friction between the contact points of metal surfaces, inhibiting the rotation of the screw . Thus, decreasing of friction between metallic surfaces may increase the screw rotation and, consequently, the preload . The rotation of gold - coated abutment screws placed with torque forces of 12, 20, and 32 ncm increased 73, 76, and 62%, respectively, when compared to titanium abutment screws2 . The purpose of this study was to evaluate by strain gauges the preload and torque removal values on three abutment screws (gold, titanium, and titanium with surface treatment screws) applying an equivalent torque force (30.070.28 ncm). Three machined self - tapping external hex titanium screws with 4 mm in diameter and 15 mm in length were used in this investigation (master screw, conexo sistemas de prtese ltda . Three transmucosal cera one type abutments (2.0 mm height, cera one, conexo sistemas de prtese ltda ., reference 045022, batch #5080915121), designed for cemented single standing implant - supported restorations were also used . The transmucosal abutments were attached to the fixtures using 10 gold screws (conexo, sistemas de prtese ltda ., reference 121022, batch #5073147) (figure 1 a a), 10 titanium screws (conexo sistemas de prtese ltda ., reference 121024, batch #5063223) (figure 1a b), and 10 surface treated titanium screws (ti - tite, conexo sistemas de prtese ltda ., reference 121026, batch #5063035) (figure 1a c). A load cell adapted from a model described in the literature this load cell presented a central void for fixture fixation in its upper portion and a horizontal plate for fixation of four strain gauges on its lower portion (figure 1 b). The abutments were placed on the upper plate of the cell (figure 1 c) in such way that the contact between abutments and fixtures was free of any interference . Therefore, when the abutment was fixed to the fixture by the abutment screw, tensions generated by this fixation pulled the unit against the abutment, producing a deformation in the lower plate connected to the strain gauges . Next, the force (preload) generated on the abutment screws was captured by the strain gauges in volts (v) and later converted to newton (n). The aforementioned sample was arranged into 3 different groups according to the characteristics of each abutment screw: group a was formed by gold screws, group b was formed by titanium screws, and group c was formed by surface - treated titanium screws . To determine fixation and removal torques, a digital torquemeter was used (torqueleader, model tsd150, type i, class e, part #117317), previously calibrated according with iso 6789:2003 (e) standard . A square hand wrench (1.27 mm diameter, conexo,, reference 062300, batch #5091632) was attached to the torquemeter to allow proper connection between torquemeter and screws (figure 1 d). Following the proper assembly of fixture and abutment on group a, the gold screw was then attached to the fixture with an applied torque force of 30.070.28 ncm, being repeated afterwards for groups b and c. then, the initial preload value for the abutment screws was determined (in volts) and all screws were kept in their positions for 5 minutes for preload stabilization, according to the literature9 . During this the preload stabilization period, preload values were obtained after 1, 2, 3, 4, and 5 minutes after fixation, and thereafter a mean value was calculated . After this evaluation, the abutment screw was removed using a digital torquemeter and the maximum value of reverse torque force required for screw removal was recorded in ncm . Next, the same screw was fixed again another 4 times, obtaining the preload and torque removal mean values . Nine other screws from group a as well as 10 other screws from b and c groups were subjected to the same procedure described above . The values of fixation torque forces of the 3 groups were analyzed statistically by to one - way analysis of variance (anova). Comparison of preload values within groups was possible using the mean of 6 measurements (0 to 5 minutes) obtained at the first abutment fixation, using two - way anova . One - way anova was used to compare the mean preload values among the groups . Tukey's test was used for multiple comparisons among the groups . For all statistical tests, all fixations for each screw (n=5) were considered for evaluation of the torque removal to obtain an average value, and the statistical analysis was performed similarly to the preload data . Two - way anova was used to evaluate the mean torque removal among the groups, and one - way anova to evaluate the differences between screws . Tukey's multiple comparison test was used for individual comparisons among the groups . For all statistical tests, the mean fixation torque force when all screws were considered was 30.070.28 ncm (c.i . There were no statistically significant differences (p=0.1244) among the groups regarding the fixation torque . The gold screws presented the highest preload values and the titanium screws the lowest values (figure 2). The mean preload values of the gold screws was 131.728.98 n, and presented statistically significant differences (p<0.01) compared to groups b and c. screw #3 and screw #1 presented the highest (140.48 n) and the lowest (117.73 n) preload values, respectively . The titanium screws presented statistically significant differences (p<0.01) (mean 37.035.69 n). The highest preload value was obtained for screw #7 (49.68 n), while screw #3 presented the lowest value (25.30 n). In the group of surface - treated titanium screws, the mean preload value was 97.784.68 n. statistically significant differences (p<0.01) were also observed in this group, (maximum: 104.09 n for screw #4; minimum: 90.28 n for screw #2). The removal torque presented statistically significant differences among the analyzed materials (p<0.001) (figure 3). The gold screws presented a mean removal torque of 17.641.12 ncm, i.e. They did not shown statistically significant differences (p=0.3713). Titanium screws presented a mean removal torque of 18.751.89 ncm, and showed statistically significant differences (p<0.001). The group of surface - treated titanium screws present statistically significant difference (p=0.004) (mean: 16.431.33 ncm). The results of this study are similar to those of previous investigations4,8, which found statistically higher preload values for gold fixation screws in comparison to other tested materials, in spite of using different methodologies and materials . A maximum preload value of 666.4 n for gold screws and 458.2 n for titanium screws was reported8 . In addition, the finds of the present study suggest that the evaluated surface treatment of titanium screws was effective, since these screws presented higher preload values than conventional titanium screws . Most previously published reports in the dental literature do not specify the removal torque of abutment screws . The effect of different cyclic loads has been evaluated using a 32 ncm torque for fixation of the screws, which was repeated after 10 minutes to avoid contact relaxation6 . Several manufacturers have suggested this clinical approach to decrease screw loosening . In the present study, to allow a direct comparison between results of preload and torque removal for the studied groups, all screws received a similar fixation torque of30.070.28 ncm, despite the manufacturer's recommendations of using 35 ncm torque for the ti - tite screws . This was performed to eliminate a possible bias caused by elastic deformation that might occur in titanium screws during fixation, which might not only quantitatively but qualitatively influence the study outcomes and impair comparison among groups . This approach allowed that, in this investigation, only the screw was left as a study variable . Another relevant issue is that up to 10% of the initial preload may be lost to smooth contact surfaces (embedment relaxation), rather than elongation stresses . However, it has been previously observed that when the same screw is fixed several times, its preload values increased4 . Comparison to different results obtained in other studies might be a difficult task due to variations of tested products and variables that may influence the produced preload value, such as the elastic modulus of the screws, opposing joint surfaces, abutment design, friction coefficient, lubrication, rate of the applied torque and the adaptation between the fixture hexagon and the abutment2 . The findings of the present study suggest a trend for greater preload values verified for gold screws, followed by surface - treated titanium screws and titanium screws, confirming the outcomes of previous investigations4,8 . Finite element analysis has been used to evaluate preloading through elongation of the abutment screw . A study evaluating the preload of two different systems of the same implant manufacturer in function, found that the optimal preload produced should be 75% of the screw yield stress, and also that the preload value increases dramatically as the friction coefficient between implant and screw decreases7 . As loosening of implant / abutment joint causes clinical problems, another question that may be raised is whether the torque values recommended by the manufacturers should be increased in order to obtain greater longevity of screw tightening . The preload produced by gold or titanium fixation screws can be evaluated through the measurement of elongation stresses . It has been found that the stresses were 60% lower than the strengths against the torques applied according to the manufacturer's instructions4 . On the other hand, it has been reported that gold or titanium screws could support higher torques than those indicated by the manufacturers without presenting plastic deformations, although it has been recommended elsewhere that the stresses should not exceed 65% of the screw's fracture strength1 . Although the results of this study showed that gold screws have a clear superiority of the produced preload, application of cyclic loads would be required for a closer simulation of the masticatory function on implanted - supported restorations . It may be concluded: 1 . Gold should be the material of choice for abutment fixation screws, since it produced the highest preload values, followed by surface - treated titanium screws and conventional titanium screws; 2 . Titanium screws presented the highest torque removal values, followed by gold screws, and surface - treated titanium screws.
|
The central nervous system (cns) represents an important target for hiv infection during multiple stages of the disease: early, after invasion of the host, since the virus rapidly enters the cns, which then constantly acts as a viral reservoir; lately, subverting its function and causing peripheral neuropathies and neurocognitive disorders; and lastly, during the final stage of neuroaids, triggering opportunistic cns infections, cancers, and dementia (tardieu and boutet, 2002). Highly active antiretroviral therapy (haart), a combination of drugs that inhibits enzymes essential for hiv replication, can reduce the viremia and the onset of opportunistic infections in most patients, and prolong the survival (see table 1). Although haart has reduced the incidence of clinical signs of neurological disease in hiv - infected individuals, autopsy studies suggest that there has been no corresponding decline in the incidence of inflammatory lesions in the cns . Haart currently in use in the clinical practice . Among the limits of the current treatments the most noticeable is the inability to eradicate hiv - infected cells, both, limiting the time frame in which haart initiated after exposure to hiv can prevent infection, and allowing replication - competent virus that persists in infected cells to emerge rapidly after the cessation of haart . According to those considerations, there is evidence that haart is less effective in lowering virus replication in the cns than in the blood (gisolf et al ., 2000); and haart resistant viruses are more often found in the cerebrospinal fluid (csf) than in biological samples (cinque et al ., the principal challenges in drug development for cns hiv infections are: (1) understanding the pathways for viral entry, replication, reservoirs, and glial activation in order to identify new targets for treatment, (2) developing selective therapeutics agents for those targets, or shaping effective strategies to deliver them within the cns, and finally but not to underestimate (3) collaborating with pharmaceutical companies to test promising drugs in clinical trials, and eventually exploit them in clinical practice . Hiv is known to productively replicate in macrophages and microglia of the cns, but it also infects, via a cd4-independent pathway, macroglial cells such as astrocytes and most - importantly brain microvascular endothelial cells, which represent the major component of the blood brain barrier (bbb; bissel and wiley, 2004). Although it is generally accepted that neurons do not become infected by hiv, recent reports have shown that neuronal progenitor brain cells can be infected by various viral strains (i.e., hiv-1), eventually playing a role as viral reservoirs (lawrence et al ., 2004). Moreover, one of the important features of cns infection is that its viral populations can diverge from those of plasma: indeed, genetic compartmentalization of csf hiv-1 infection has been nicely demonstrated in a series of studies using the heteroduplex tracking essay to compare blood and csf viral populations cross - sectionally and longitudinally (ritola et al ., 2005); therefore even if during acute infection the two population are identical, during chronic infection and especially in cases of hiv encephalitis they genetically and functionally diverge, and may justify the failure of antiretroviral therapy (strain et al ., 2005). Identification of viral and cellular mechanisms in the cns that control virus replication after acute infection, maintain latency during the asymptomatic stage, and mediate resurgence of virus replication and development of hiv - associated encephalitis during late infection, is critical . The dynamic signaling pathways that are activated by virus replication and active / infiltrating macrophages and lymphocytes and the cytokines, chemokines, and neurotoxic products they elaborate may interfere with the homeostatic signaling pathways that maintain normal quiescent brain function . To understand the correlates in terms of neuroprotection, neuroinflammation, and neurodegeneration processes many preclinical models have been developed, such as: hiv transgenic rat (i.e., tg rat from reid et al ., 2001), or mice (i.e., gp 120 tg mice from toggas et al ., 1994), but also those obtained by injection of hiv proteins (i.e., gp 120 from sundar et al ., 1991; or tat and bansal et al ., 2000), or hiv - infected macrophages into the brain of mice (anderson et al ., 2003) the most studied signaling pathways include, among others, the gsk3, cdk5, erk, notch, p38, and jnk cascades . For instance, it is noteworthy that many mitogen - activated protein kinases are pivotal during acute, asymptomatic, and terminal infection: some of them seems to promote cell growth and differentiation in response to initial infection (i.e., erk), whereas others are associated to growth arrest, apoptosis, and oncogenic transformation during aids . Cns infection: in contrast to hiv - infected cd4 + t cells, infection in brain macrophages and microglial cell lines leads to an extended life span and elevated survival against apoptotic stresses (chugh et al ., 2007), and only during terminal infection, when there is resurgent virus replication, the balance favors neuronal death (i.e., via activation of jnk and p38) reflecting a failure to maintain homeostasis in the cns (barber et al ., 2004) with the consequent motor and cognitive impairments . Many strategies are currently under evaluation to improve hiv treatment, but a relatively small number are primarily dedicated to the alleviation of neurological complaints or the control of neuroaids, and unfortunately more than 98% of drug candidates for cns disorders never make it to the clinic (pardridge, 2003). Herein are a couple of examples picturing how researches, initially conducted for neoplastic, neurodegenerative, or epileptic disorders, on specific pathways and delivery systems, might be adapted and applied to the field of cns hiv infection (see figure 1). Neutralization of vif on microvascular endothelial cells (ifn and ifn) and subsequent inhibition of viral entry into the cns; 3 . Inhibition of hiv replication in macrophages and viral spread into the cns (nk-1-agonists); 4 . Inhibition of cytoprotective effect exerted by tat proteins over microglial cells which act as cns viral reservoirs (pi3k and akt inhibitors); 5 . Protection of neural integrity and plasticity along with prevention of neurotoxicity and neuronal death (glutamate receptors-, gsk3-, jnk-, and p38-inhibitors). Discovered in 1898, mitoguazone (mgbm) had been investigated but abandoned as an anti - cancer drug, recently it was found to cause selective loss of cd16 + hiv - infected cells, specifically by blocking osteopontin needed to transform a circulating macrophage into a cns / resident one . Mgbg although ineffective in reducing hiv viremia, does appear to shut down viral evolution by selectively killing recent migrants macrophages rather than resident cells, and to be safe over the long - term treatment in aids patients (jeymohan et al ., 2009). The manipulation of ifn and ifn apobec pathways could prevent hiv invasion of cns because of the potent intrinsic immunity exerted by the expression of apobec3 g gene in microvascular endothelial cells (argyris et al ., 2007). This gene code for proteins possessing cytidine deaminase activity and allow the bbb to actively neutralize the effects of viral infectivity factors (vif), which are essentials for viral entry and spread into the cns (jeong et al ., 2008). Nk-1, also known as substance p, was the first neuropeptide discovered in 1931, it is widely distributed in the central and peripheral nervous system where it functions as a potent mediator of immunoregulation . Agonists to nk-1 receptor potently inhibit both in vitro and in vivo hiv replication in human macrophages, apparently down regulating ccr5 (jeymohan et al ., 2009). Initially recognized, and extensively studied as a promising target for anti - cancer therapies because of its role during tumorigenesis, the pi3k / akt cell survival pathway became a target for anti - hiv treatment after the observation that pi3k inhibitors (such as wortmannin and ly294002) or akt inhibitors (such as miltefosine), both able to cross the bbb, contrast the cytoprotective effect exerted by tat proteins over macrophage / microglial cells, and make them again susceptible to cell death following an apoptotic stimulus (chugh et al . Most interestingly pi3k / akt inhibitors proved to be effective without harming uninfected cells and therefore experimental data as far available support their possible use for hiv - therapy and targeting of long - lived viral reservoirs . Nanoformulated haart essentially manipulates the immune system for therapeutic purposes by using synthetic or biological nanoengineered drug carriers . Those nanoformulated drugs have been proven to be efficient delivery vehicles for a wide range of therapeutic agents, and can be easily injected in the blood circulation or virtually into any site of the brain with minimal invasiveness . Major concerns to this therapeutic approach are the choice of drug administration (systemic or local) and consequently the residence in the systemic blood circulation, or in the brain tissue adjacent to topic injection, the drug loading efficiency, and the burst release effect . Furthermore, many other question marks are still to be answered, or even formulated . Concerning synthetic carriers, hyaluronic acid, a linear polysaccharide composed of alternating d - glucuronic acid and n - acetyl - d - glucosamine units, because of its immunoneutrality, has been proposed as a biocompatible and biodegradable biomaterial for tissue engineering, and in drug delivery systems into the cns: particularly appealing would seem the opportunity to produce drug - incorporated hyaluronic acid nanoparticles (jeong et al ., 2008). As well monocytes, because of their abilities to move drugs inside the cells have advantages as a depot for haart, but also they might improve compliance as drugs can be released from cells for periods up to weeks or longer . Nevertheless, further application of biological nanoengineered drug carriers will require optimization of nanoparticles uptake, deeper knowledge of their kinetics across the bbbs, and more sophisticated imaging systems to track migration of monocyte macrophages to the brain and target the delivery of specific therapeutics (jeymohan et al ., 2009). Beside compounds aimed at control the virus, others try to treat the effects of the underlying neuroinflammation and neurodegeneration mechanisms, and might provide a beneficial supplement to haart . Neurotoxicity is mainly mediated through glutamate production, which is triggered by nmda subtypes of glutamate receptors, and correlated to caspase activation and subsequent neuronal apoptosis (erdmann et al ., 2006); accordingly, pharmacologic inhibition of glutaminase directly correlate to neuronal survival (tian et al ., 2008). Those insights support the hypothesis that inhibition of glutamate production by blocking mitochondrial glutaminase activity may clinically prevent neurotoxicity during hiv-1 infection . Taken together the gsk3, cdk5, jnk, and p38 signaling pathways are important regulators of neurotoxicity, being responsible for synaptic and dendritic damage to pyramidal neurons, loss of immunoreactive neurons, and demyelinization . Gsk3 inhibitors (i.e., lithium, valproic acid) as well as cdk5 inhibitors (i.e., roscovitine) seems to protect neuronal integrity and plasticity (crews et al ., 2009), while jnk- and p38-inhibitors (i.e., minocycline) may prevent neuronal death (lin et al ., 2001; bozyczko - coyne et al ., 2002) each of those target holds promise for the development of treatment strategies to ameliorated the neuropathological effects exerted by hiv proteins (tat, vif, etc . ). Discovered in 1898, mitoguazone (mgbm) had been investigated but abandoned as an anti - cancer drug, recently it was found to cause selective loss of cd16 + hiv - infected cells, specifically by blocking osteopontin needed to transform a circulating macrophage into a cns / resident one . Mgbg although ineffective in reducing hiv viremia, does appear to shut down viral evolution by selectively killing recent migrants macrophages rather than resident cells, and to be safe over the long - term treatment in aids patients (jeymohan et al ., 2009). The manipulation of ifn and ifn apobec pathways could prevent hiv invasion of cns because of the potent intrinsic immunity exerted by the expression of apobec3 g gene in microvascular endothelial cells (argyris et al ., 2007). This gene code for proteins possessing cytidine deaminase activity and allow the bbb to actively neutralize the effects of viral infectivity factors (vif), which are essentials for viral entry and spread into the cns (jeong et al . Nk-1, also known as substance p, was the first neuropeptide discovered in 1931, it is widely distributed in the central and peripheral nervous system where it functions as a potent mediator of immunoregulation . Agonists to nk-1 receptor potently inhibit both in vitro and in vivo hiv replication in human macrophages, apparently down regulating ccr5 (jeymohan et al ., 2009). Initially recognized, and extensively studied as a promising target for anti - cancer therapies because of its role during tumorigenesis, the pi3k / akt cell survival pathway became a target for anti - hiv treatment after the observation that pi3k inhibitors (such as wortmannin and ly294002) or akt inhibitors (such as miltefosine), both able to cross the bbb, contrast the cytoprotective effect exerted by tat proteins over macrophage / microglial cells, and make them again susceptible to cell death following an apoptotic stimulus (chugh et al . Most interestingly pi3k / akt inhibitors proved to be effective without harming uninfected cells and therefore experimental data as far available support their possible use for hiv - therapy and targeting of long - lived viral reservoirs . Nanoformulated haart essentially manipulates the immune system for therapeutic purposes by using synthetic or biological nanoengineered drug carriers . Those nanoformulated drugs have been proven to be efficient delivery vehicles for a wide range of therapeutic agents, and can be easily injected in the blood circulation or virtually into any site of the brain with minimal invasiveness . Major concerns to this therapeutic approach are the choice of drug administration (systemic or local) and consequently the residence in the systemic blood circulation, or in the brain tissue adjacent to topic injection, the drug loading efficiency, and the burst release effect . Furthermore, many other question marks are still to be answered, or even formulated . Concerning synthetic carriers, hyaluronic acid, a linear polysaccharide composed of alternating d - glucuronic acid and n - acetyl - d - glucosamine units, because of its immunoneutrality, has been proposed as a biocompatible and biodegradable biomaterial for tissue engineering, and in drug delivery systems into the cns: particularly appealing would seem the opportunity to produce drug - incorporated hyaluronic acid nanoparticles (jeong et al ., 2008). As well monocytes, because of their abilities to move drugs inside the cells have advantages as a depot for haart, but also they might improve compliance as drugs can be released from cells for periods up to weeks or longer . Nevertheless, further application of biological nanoengineered drug carriers will require optimization of nanoparticles uptake, deeper knowledge of their kinetics across the bbbs, and more sophisticated imaging systems to track migration of monocyte macrophages to the brain and target the delivery of specific therapeutics (jeymohan et al ., 2009). Beside compounds aimed at control the virus, others try to treat the effects of the underlying neuroinflammation and neurodegeneration mechanisms, and might provide a beneficial supplement to haart . Neurotoxicity is mainly mediated through glutamate production, which is triggered by nmda subtypes of glutamate receptors, and correlated to caspase activation and subsequent neuronal apoptosis (erdmann et al ., 2006); accordingly, pharmacologic inhibition of glutaminase directly correlate to neuronal survival (tian et al ., 2008). Those insights support the hypothesis that inhibition of glutamate production by blocking mitochondrial glutaminase activity may clinically prevent neurotoxicity during hiv-1 infection . Taken together the gsk3, cdk5, jnk, and p38 signaling pathways are important regulators of neurotoxicity, being responsible for synaptic and dendritic damage to pyramidal neurons, loss of immunoreactive neurons, and demyelinization . Gsk3 inhibitors (i.e., lithium, valproic acid) as well as cdk5 inhibitors (i.e., roscovitine) seems to protect neuronal integrity and plasticity (crews et al ., 2009), while jnk- and p38-inhibitors (i.e., minocycline) may prevent neuronal death (lin et al ., 2001; bozyczko - coyne et al ., 2002) each of those target holds promise for the development of treatment strategies to ameliorated the neuropathological effects exerted by hiv proteins (tat, vif, etc .) Combinations of drugs work better and longer than seen previously, patients benefit demonstrably from the magnitude and duration of viral suppression, and require more and more symptomatic treatment of neuroaids cognitive impairment . However haart is very demanding for patients, non - adherence can lead to therapeutic failure, and in addition drug resistance is a continuing problem; therefore, the need for improved drug and delivery systems, but also an interest for adaptive treatment strategies and mathematical modeling to manage structured treatment interruptions (rosenberg et al ., 2007), have been outlined by many researchers . To this regard a thigh collaboration with industry is strictly required and introduces a new set of challenges such as: (1) circulation of promising ideas, often just developed with university grants, (2) protection of intellectual property and patent rights, (3) fund - raising opportunities for start - ups during preclinical researches on novel compounds, until (4) identification of potential blockbusters appealing to big pharma companies for introduction in the market and their clinical exploitation . Finally, current criteria for initiation of haart do not consider cns outcomes as a benchmark of efficacy, thus establishing cns - based criteria for initiation of protocols should be the ultimate goal not only for therapeutic but also for neuroprotection strategies; as recently stated by jeymohan et al . (2009) on behalf of the neuroaids research participants these priorities should be seen as a template for future growth of the field and its long - term impact . The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
|
Colorectal adenocarcinoma is the fourth most frequently diagnosed malignancy in korea, accounting for 12% of newly diagnosed cancer cases . According to the ministry of health and welfare, the incidence of colorectal cancer has increased in both males and females during the past 2 decades . Although surgery is potentially curative, approximately one third of all newly diagnosed patients present with inoperable metastatic disease . Palliative chemotherapy is more effective than the best supportive care for improving overall survival (os) as well as quality of life in advanced colorectal cancer . While significant advances have been made in recent years, cure is rarely possible in advanced colorectal cancer (acc), making further improvements in therapy imperative . For more than three decades, the treatment options for acc have been almost exclusively based on 5-fluorouracil (5-fu) and folinic acid (fa). Until the early 1990s, 5-fu, often modulated by fa, was the single effective chemotherapy available, but only led to meaningful responses in a small minority of treated patients . The recent integration of oxaliplatin and irinotecan for the management of acc patients has extended median os in a meaningful way . Both drugs have been shown to have synergistic effects with 5-fu and fa in colorectal cancer cell lines . Since irinotecan and oxaliplatin have been used for acc treatment, the efficacy of palliative chemotherapy for acc has considerably improved . First - line treatment with irinotecan and either bolus or infusional 5-fu / fa, namely irinotecan / bolus fluorouracil / lv or 5-fluorouracil, folinic acid plus irinotecan (folfiri), significantly improved outcomes as compared with 5-fu / fa . Similarly, a combination of oxaliplatin and infusional 5-fu / fa, known as 5-fluorouracil, folinic acid plus oxaliplatin (folfox), significantly increased the response rate and the time to progression compared with 5-fu / fa . These results established 5-fu - based chemotherapy, in combination with either irinotecan or oxaliplatin, as standard first - line chemotherapy regimens for patients with acc . Furthermore, capecitabine has been shown to exhibit antitumor activity against acc both as a single agent and in combination with oxaliplatin [12 - 14], as well as with irinotecan . In korea, capecitabine was approved in january 2006 as a partner with oxaliplatin or irinotecan for the treatment of acc . A decision regarding chemotherapy regimens for factors considered include the extent of disease, potential toxicities, especially for those with impaired oral intake or with decreased performance status, activity of chemotherapy, and the patient preference . We therefore decided to evaluate various combination chemotherapy regimens as first - line chemotherapy for acc . This report describes a single - center, retrospective study . Between january 2006 and december 2007, a total of 537 acc patients were treated with first - line chemotherapy for advanced disease at samsung medical center (seoul, korea). Fifty - nine patients were excluded because they were treated with single - agent chemotherapy . The criteria for case inclusion were as follows; 1) histologically confirmed diagnosis of adenocarcinoma arising from colon or rectum, 2) no prior chemotherapy or radiotherapy except for adjuvant use, 3) advanced (metastatic and/or recurrent) disease, 4) availability of clinical data at the beginning of therapy and follow - up . We attempted to exclude patients who were enrolled in clinical trials to ensure the choice of chemotherapy regimen was solely at the discretion of the treating physician . All the data were prospectively recorded and only the survival data was updated at the time of analysis . Written informed consent was given by all patients prior to receiving chemotherapy, according to institutional guidelines . The patients were required to have a life expectancy of 12 weeks of more; age of at least 18 years or older; eastern cooperative oncology group (ecog) performance status of 2 or lower; adequate hematologic (neutrophil count>1,500/mm and platelet count>100,000/mm), hepatic (serum total bilirubin level<1.5 mg / dl and aspartate aminotransferase / alanine aminotransferase<3upper limit normal) and renal (serum creatinine level<1.5 mg / dl) functions . Our department guidelines define combination chemotherapy regimens as follows: in folfox or folfiri, fa is given at the dose of 200 mg / m followed by bolus 5-fu 400 mg / m on day 1, and a 46-hour continuous infusion of 5-fu 2,400 mg / m on days 1 and 2 . Oxaliplatin 85 mg / m or irinotecan 180 mg / m was administered on day 1 as a 2-hour infusion, concurrent with fa . In capecitabine plus oxaliplatin (xelox) and capecitabine plus irinotecan (xeliri), oxaliplatin 130 mg / m or irinotecan 240 mg / m was given on day 1 in combination with oral capecitabine 1,000 mg / m twice daily on days 1 to 14 . Folfox and folfiri were repeated every 2 weeks, whereas xelox and xeliri were repeated every 3 weeks until disease progression or unacceptable toxicity occurred, or until a patient chose to discontinue treatment . The dosages for subsequent cycles were adjusted according to the toxic effects that developed during the preceding cycle . The prophylactic use of hematopoietic growth factors was not allowed during treatment, except for patients with febrile neutropenia or grade 4 myelosuppression at the treating physician's discretion . After this combination chemotherapy had failed, second - line chemotherapy was recommended to all the patients if their performance status was preserved . According to department policies, all tumor measurements were assessed every 2 or 3 cycles of chemotherapy by using an abdominopelvic computed tomography (ct) scan and other tests that were initially used to stage the tumor . Tumor response and progression were evaluated according to the response evaluation criteria for solid tumors (recist). The primary endpoint of this retrospective study was progression - free survival (pfs). The date of disease progression or death from causes other than acc was used in calculating pfs . Pfs and os were estimated according to the kaplan - meier method and the statistical significance of differences in survival curves between groups was tested with a log - rank test . Multivariate models were used for exploratory purposes to examine the impact of each regimen on the outcomes of chemotherapy . Covariates included were age (below vs.median), gender, previous adjuvant therapy, an ecog performance status (0 - 1 vs.2), number of involved sites (1 vs.2), metastases (liver, peritoneum, and lung), baseline chemistry profiles (serum albumin, alkaline phosphatase, and bilirubin), combination with bevacizumab, and chemotherapy regimens . Laboratory parameters were initially recorded as continuous variables and later dichotomized according to the median value of each variable (below vs.median). Between january 2006 and december 2007, a total of 478 acc patients were treated with combination chemotherapy in a first - line setting: folfox (n=172), folfiri (n=95), xelox (n=155), and xeliri (n=56). In 29 patients, chemotherapy involved bevacizumab . . Sixty percent of patients were male, and 33 patients (7%) had an ecog performance status of 2 or more . More than half of the patients (n=263) had received surgery for curative intent, and 206 patients received adjuvant chemotherapy or chemoradiotherapy . Approximately one - third of the patients had two or more metastatic disease sites, mostly involving liver and abdominal lymph nodes . We noted that more folfiri or xeliri patients had received adjuvant therapy involving oxaliplatin than folfox or xelox patients . After first - line failure, second - line chemotherapy was administered for more than half of the patients (n=290). Median follow - up duration was 40.6 months (95% confidence interval [ci], 39.3 to 41.8 months). At the time of data collection, 449 (89%) median chemotherapy durations for folfox, folfiri, xelox, and xeliri were 4.9, 4.5, 5.7 and 5.4 months, respectively . We found no statistically significant difference among chemotherapy durations for these regimens (log - rank p=0.19). The most common reason for discontinuation of treatment was disease progression . In 172 patients receiving folfox, two - thirds of patients discontinued therapy due to disease progression (n=118), physician's recommendation or patient withdrawal (n=33), or toxicity (n=21). Folfiri patients discontinued therapy due to progression (n=60), physician's recommendation or patient withdrawal (n=13), toxicity (n=20), or unknown causes (n=2). Similarly, disease progression was the most common cause of therapy discontinuation in 101 xelox patients and 34 xeliri patients . We found no relevant difference in the occurrence of overall grade 3 or 4 toxicities among regimens (table 2). In brief, the main difference in grade 3 or 4 toxicities with folfiri or xeliri was diarrhea (21% for folfiri and 27% for xeliri vs. 11% for folfox and 9% for xelox; p=0.02), and with folfox or xelox the difference involved peripheral neuropathy (9% for folfox and 7% for xelox vs. 2% for folfiri and xeliri; p<0.01). Although patients who were treated with irinotecan - containing chemotherapy more frequently experienced grade 3 or 4 leukopenia (13% vs. 10%; p=0.09) than those treated with oxaliplatin - containing regimens, we found no significant difference in the incidence of febrile neutropenia (5% in each arm). In addition, grade 2 or more hand - foot syndrome was more frequently observed in xelox and xeliri (14% and 12%, respectively) than in folfox and folfiri (6% and 8%, respectively). In the current retrospective analysis, one death occurred in the midst of treatment with folfox, with no clinical evidence of progression having been demonstrated . Another patient died of respiratory failure shortly after completion of the second folfox cycle, in which the possibility of disease progression could not be completely excluded . The patient, initially presenting with multiple pulmonary nodules and bilateral pleural effusion, complained about increasing dyspnea and suffered a sudden respiratory arrest . Five other deaths occurred in patients while receiving folfiri or xelox, and were attributed to neutropenic sepsis . Of a total of 478 patients, 61 could not be evaluated for responses because of the absence of any measurable lesions or early discontinuation of therapy . Objective responses to chemotherapy were noted in 200 patients (response rate, 48%; 95% ci, 43 to 53%); 42% for folfox, 49% for folfiri, 55% for xelox, and 51% for xeliri . The difference in the response rates for each regimen was not statistically significant (p=0.09). Patients who had a poor performance status (2 in ecog scale) were significantly less likely to respond to first - line chemotherapy (24% vs. 50%; p<0.01) compared to those with an ecog performance status of 0 or 1 . Response rate was not significantly influenced by age, gender, prior treatments, baseline laboratory parameters, metastatic sites, or chemotherapy regimen . The estimated median pfs for all patients was 6.8 months (95% ci, 6.3 to 7.3 months), and the median os was not yet reached . Pfs was shorter, although statistically insignificant (p=0.12), in patients receiving folfox or folfiri (6.2 months and 6.0 months, respectively) than those receiving xelox (7.9 months) or xeliri (7.1 months). One - year pfs rates for folfox, folfiri, xelox, and xeliri were 24%, 21%, 32%, and 32%, respectively (fig . 1). A multivariate regression model revealed that pfs was significantly affected by performance status (hazard ratio, 0.39; 95% ci, 0.28 to 0.57; p<0.01). We also tested whether the pfs was modified by interaction between the effect of baseline clinical parameters and the chemotherapy regimens; the first - level interaction term between these variables was entered into a separate multivariate model . However, we found no interaction between any first - line chemotherapy regimens for each clinical parameter . Despite recent advances in the treatment of acc, patients treated with first - line chemotherapy have a median os rarely exceeding 24 months . In the current analysis, our observation that pfs was slightly shorter with folfox or folfiri than with xelox or xeliri is possibly related to negative prognostic factors influencing the choice of intravenous chemotherapeutic agents instead of oral agents . Similarly, the choice of a chemotherapeutic agent depends on the ones previously used in the adjuvant setting . Although this study is retrospective in nature, the results provide a piece of evidence that patients with acc may derive an indisputable benefit from fluoropyrimidine - based combination chemotherapy . The decision to use specific chemotherapeutic agent(s) in patients with acc should be determined by their relative merits on a case - by - case basis . The evolution of treatment using irinotecan and oxaliplatin in combination with 5-fu regimens has resulted in a significant prolongation of life in patients with acc . Since both drugs have demonstrated similar activity in first- and second - line settings, the optimal chemotherapy regimen and dosing schedule in patients with acc remains undecided . Randomized trials comparing first - line folfox with folfiri indicated equivalent activity and moderate toxicity differences between these two regimens, suggesting that use of either oxaliplatin or irinotecan is reasonable . In another phase iii study in which patients crossed over to the alternative regimen upon progression while on their first - line regimen, the overall pfs on first - line therapy was 8.1 months for folfox and 8.5 months for folfiri . In a combined analysis of seven phase iii trials in acc, grothey et al . Reported that the strategy of making these three active drugs (fluoropyrimidine, oxaliplatin, and irinotecan) available to patients with acc could maximize os . In addition to efficacy data, patient convenience and satisfaction are assuming increased importance in cancer management . Oral administration has the advantage of permitting convenient, patient - orientated therapy, providing the patient with a degree of independence and improved quality of life, while avoiding complications associated with intravenous drug administration . Chemotherapy regimens involving oral capecitabine showed similar safety and efficacy profiles compared with 5-fu - based regimens . Oral capecitabine was proved to have a similar quality of life profile to that of 5-fu, but seemed to be more convenient in terms of administration . In korea, a capecitabine - containing regimen was approved in january 2006 as the first - line treatment of acc . Data from the current retrospective study suggest that patients are highly compliant with capecitabine, when given in combination with either oxaliplatin or irinotecan . Patients treated with capecitabine experienced a higher incidence of clinically relevant hand - foot syndrome, but this toxic effect was predictable and manageable . An improved understanding of the molecular pathogenesis of cancer has lead to the development of novel agents designed to target critical cellular pathways . One of the most successful novel approaches in the treatment of acc involves therapeutic agents that inhibit the neovascularization process of growing tumors . Bevacizumab is a recombinant humanized anti - vascular endothelial growth factor monoclonal antibody that is being clinically evaluated in many tumor types, including acc . Because bevacizumab was only recently made available in korea as first - line chemotherapy, only 29 patients received bevacizumab . This study confirms that both oxaliplatin- and irinotecan - containing combination chemotherapy are effective for the first - line treatment of acc . Capecitabine clearly represents an effective and well - tolerated oral alternative to 5-fu . While the current study was primarily focused on cytotoxic therapies, the integration of targeted agents, including bevacizumab, is a novel standard option to further improve outcomes for patients with acc.
|
Lymphomatoid granulomatosis (lyg) is a rare angiocentric and angiodestructive lymphoproliferative disease with granulomatous reaction involving the lungs most frequently, however, it may also involve the kidneys, skin and especially the central nervous system4,6,9,11). Lyg is characterized by an infiltration of atypical lymphocytoid and plasmocytoid cells, with granulomatous inflammation in an angiocentric and angiodestructive polymorphic cellular infiltrate6,8). Therefore the purpose of this study is to submit the first report about the case with thoracic spinal lyg after diagnosis with b - precursor childhood acute lymphoblastic leukemia (all). After surgical decompression with biopsy on the spinal lesion, diagnosis of grade ii lyg was made and rituximab was administered . The patient is in good neurological condition without recurrence at the 6-year follow - up . A 4-year - old girl was diagnosed with b - precursor all with the involvement of kidneys and pancreas in november, 2004 . Treatment was initiated according to the pediatric oncology group (pog) protocol 900612). On april 12, 2006, the patient was admitted to pediatric clinic with a complaint of intermittent fever for 3 days . On april 19, 2006, 7 days after the admission, the patient developed a gait disturbance . Neurological examination revealed paraparesis of grade 3 on medical research council (mrc) muscle strength grading scale1) with increased deep tendon reflex in both ankles, knee jerks, and bilateral positive babinski sign, but her senses were intact . Cerebrospinal fluid (csf) findings were as follows: elevation of protein (243.3mg / dl), and decrease of glucose (44mg / dl). The condition was suspected to be an acute inflammatory demyelinating polyneuropathy and was treated with intravenous immunoglobulin (400 mg / kg / day) for 5 days . However, her paraparesis was aggravated to grade 1 on mrc muscle strength grading scale from april 26, 2006, 14 days after the admission, and spinal mri was performed . T2 weighted mri demonstrated heterogeneous high signal intensity infiltration on t4 vertebral body and subligamental spreading soft tissue mass on t3 - 5 epidural space from t4 posterior vertebral body, causing spinal cord compression (fig . 1). On april 27, 2006, laminectomy of t3, 4 with open biopsy were performed . The epidural mass was encircling the spinal cord mainly on ventral surface and was slightly grey to yellow, solid and compact nature . A histopathologic examination showed an angiocentric distribution of polymorphous lymphoid infiltrate, with extensive necrosis . Immunohistoche mical staining for cd3 and cd20 showed the predominance of mature t cells and atypical b cells (fig . Hybridization revealed positivity for epstein - barr virus (ebv) encoded rna in a few lymphocytes, confirming the diagnosis of grade ii lyg . One - week post - operative neurologic examination showed paraparesis grade 3 on mrc scale, and bare independent walking but as she still had gait impairment, she received rehabilitation . After four weeks of the surgery, she restored her normal state and could walk quite well . At that time, there were no pulmonary lesions, so we suspected the spinal lesion as the primary involvement site . Two weeks after, chest and abdomen ct revealed multiple low density nodular mass on the liver and the lower lobe of the left lung . Histopathologically, lesions were not blastic in appearance and in immunophenotype, and the lesions were negative for cd10, tdt, and cd22, so we ruled out the relapse of all . She was treated with rituximab (275mg / m / day, 4 times per week) for 4 weeks and intravenous high dose methylprednisolone (30mg / kg per day for 3 days, 20mg / kg per day for 2 days and 10mg / kg per day for 2 days). Chest and abdomen ct showed marked improvement of the lesions 3 months after the treatment compared with the lesions in the images obtained before the treatment . A follow - up mri study performed 4 months after the operation documented no evidence of residual mass or recurrence (fig . 3). Chest and abdomen ct performed 1 year after the operation showed no demonstrable focal lesion in lung field and mediastinum and unremarkable abdominal organs . Her weakness improved and she was able to walk independently and had no gait impairment . But unfortunately we failed to take additional follow - up of mri for the patient, as she was terrified to take mri and full sedation was not possible . Moreover the parents of the patient did not agree with the idea of taking mri one more time because she was in good state at that time . To date, lyg is a rare lymphoproliferative disease characterized by angiocentric and angiodestructive ebv - positive b - cell proliferation of uncertain malignant potential, which might be associated with exuberant reactive t cell infiltration2,9). Lyg affects men more than women with ratio 2 to 1 and presents mainly in adults between the fourth and sixth decades of life, although patients of all ages can be affected . Its occurrence in children is quite rare4). There were three cases of lymphomatoid granulomatosis with onset after all . Two of these patients died of the disease, only one obtained benefit from acyclovir therapy7). Lyg usually affects lungs primarily, and it may also present several significant extrapulmonary manifestations, affecting skin, kidney, spleen, and the central nervous system . Involvement of the spine has been rarely reported . To my best knowledge, this is the first report of thoracic spinal lyg presenting with unique progressive myelopathy . However, numerous granulomatous lesions in the central nervous system and lungs are highly suggestive of lyg . Lyg with central nervous system involvement, observed in approximately 30% of the affected patients, indicates poor prognosis4,9,11). There was only one case report about lyg with spinal involvement . In that case, lyg involve cervical spinal cord, and the patient submitted four cycles of adjuvant cyclophosphamide, doxorubicin, vincristine and prednisone (chop). But the patient died 5 months after the treatment due to systemic progression of the disease7). A grading system of lyg is based on the number of atypical lymphocytes, ebv - positive b - cells and amount of necrosis5). Pathophysiologically, grade i lesions consist of a polymorphous angiocentric and angiodestructive infiltrate of lymphocytes, plasma cells, and histocytes, with or without eosinophils . Large lymphoid cells or immunoblasts were less than five in high power field (400) or absent . If large lymphoid cells or immunoblasts were present, there would be no cellular atypia and minimal - to - absent necrosis . Grade ii lesions consisted of large lymphoid cells with less than twenty ebv - positive cells in high power field with some cellular atypia in small lymphoid cells, and necrosis was more common . Grade iii lesions, angiocentric lymphomas, consisted of large atypical cells with more than twenty ebv positive cells in high power field with the marked cytologic atypia in both small and large lymphoid cells4,13). To date, no standard treatment has been established for lyg and treatments approach to systemic lyg include drugs acting on the immune system(corticosteroids, interferon alfa-2b, cyclosporine a, anti - cd20 monoclonal antibody - rituximab), mono- or combined chemotherapy, radiotherapy, and autologous stem cell transplantation . Several treatments with rituximab have been reported, with or without chemotherapy or radiotherapy3,9,10,15). Rituximab was approved for the treatment of recurrent, poorly differentiated refractory or follicular cd20 positive b - cell non - hodgkin's lymphoma14). In this case, immunohistochemical staining for cd3 and cd20 showed the predominance of mature t cells and atypical b cells . In situ hybridization revealed positive ebv encoded rna in a few lymphocytes, confirming the diagnosis of grade ii lyg . The patient experienced rapid worsening of neurological symptoms and absence of systemic involvement on pre - operative laboratory findings and radiological imaging, and she therefore was treated with surgical decompression and biopsy on the t3 - 5 epidural lesion and improved neurologic symptoms . Surgical decompression can improve neurological morbidity of the patient . However, appropriate chemotherapy is highly needed as systemic progression of lyg make poor prognosis . The patient responded to rituximab therapy well without adverse effects, and her condition remained stable for 6 years . Therefore it was suggestive that decompression and rituximab is suitable as the initial therapy for symptomatic spinal lyg . This case described an unusual occurrence of thoracic spinal lyg in a 4-year - old girl . Childhood lyg is a rare disease but should be considered in the nodular pulmonary infiltrates and central nervous system manifestations, especially in the past diagnosis of childhood acute lymphoblastic leukemia . Awareness of the features of lyg can lead to earlier diagnosis and prompt appropriate therapy.
|
Kidney transplant recipients not only have numerous comorbidities associated with renal failure, but also often have additional problems due to chronic immunosuppression [13]. The surgical management of colorectal cancer is risky to the patient in terms of the surgical procedure and the interruption of immunosuppression . In general, these patients are more susceptible to perioperative complications . Although open colorectal resection has been practiced for many years in kidney recipient patients, the minimally invasive procedure has been developed and is gaining popularity . Multiple randomized controlled trials have proven that minimally invasive surgery yields better short - term outcomes than open colorectal surgery in terms of reduced intraoperative bleeding, postoperative pain, and hospital stay, as well as a lower incidence of infection and respiratory complications, with equivalent long - term outcomes [4, 5]. However, selected high - risk patients may benefit from minimally invasive colorectal resection due to reduced morbidity . The aim of this study was to prove the safety and feasibility of laparoscopic and robotic colorectal resection in kidney transplant recipients by evaluating the technical protocol and the short- and long - term outcomes . This retrospective review of all kidney transplant recipients diagnosed with colon or rectal cancer who received laparoscopic or robotic resection was conducted between may 2007 and august 2012 at yonsei university college of medicine, south korea . Data were analyzed using the spss statistical program (version 18 for windows; spss inc ., all patients received 4 liters of golytely (peg-3350 and electrolytes for oral solution, braintree laboratories, inc ., antibiotics and a stress dose of steroids of 100 mg were given on induction of anesthesia and continued postoperatively with tapering dose of steroid . A main concern in laparoscopic and robotic colorectal resection is accurate and safe port placement to avoid injury to the transplanted kidney . After periumbilical port insertion using an open or closed technique, the abdomen was insufflated with medical co2 to 1214 mmhg pressure . The kidney was shifted posterolaterally to provide adequate space for the working ports (figure 1). Next, depending on the type of procedure, two right- or left - sided trocars under direct visualization were easily placed . For robotic trocar positioning, we used a hybrid technique by which the colon was mobilized laparoscopically and the robot was docked between the legs of the patients and used mainly for pelvic dissection . Robotic port insertion depended on the location of the kidney: for the right kidney, arms 2 and 3 were on the left and arm 1 was on the right; for the left kidney, arms 1 and 3 were on the right and arm 2 was on the left . The procedure used colonic mobilization and followed total mesorectal excision principles as required for pelvic dissection . We started medial to lateral mobilization of the colon 2 cm distal to the sacral promontory going upward toward the inferior mesenteric artery where most of it is ligated at its origin . Then, lateral dissection followed including splenic flexure mobilization . Finally, we dissect the rectum starting posteriorly going deep to the levator ani muscles carefully to avoid hypogastric nerve injury . Then, we dissect laterally and anteriorly where we should avoid injury to prostrate and neurovascular puddle . Usually, we perform a rectal irrigation before transection . The specimen extracted from the left iliac fossa assistant port and duple stabling technique was used for bowel anastomosis . Regarding the right colectomy cases, medial to lateral approach our preferred method is applying complete mesocolic principles where vessel ligation is performed at its origin . Ten of these recipients were diagnosed with colon or rectal cancer and underwent minimally invasive surgical resection . Five (50%) patients were males; the mean patient age was 56.8 (range, 4772) years, and the mean body mass index was 22.4 (range 20.526.4) kg / m . Nine (90%) patients had hypertension, three (30%) had diabetes mellitus, one patient had a history of hepatitis, and one had a history of chronic pulmonary tuberculosis . The american society of anesthesiologists scores were ii in 60% of patients and i and iii in 20% of patients each . All rectal patients were evaluated by computed tomography (ct) scan and a colonoscopy . In addition, magnetic resonance imaging (mri) was used for further evaluation of the patients with rectal cancer . Preoperative stages were i and ii in 40% of the patients and iii in 10% of the patients . No tumor invasion or extension beyond the mesorectal fat with a maximum stage preoperative chemoradiation therapy was administered to one patient with low - rectal cancer with a preoperative stage iii (t3n1 m0). Four (40%) patients underwent an anterior and a low anterior resection, two (20%) underwent a covering ileostomy and a right hemicolectomy, and one patient (10%) underwent a left hemicolectomy . Most (90%) procedures were performed laparoscopically and 10% were conducted robotically (table 1). Pre- and postoperative laboratory blood findings were evaluated every other day to minimize intra- and postoperative complications (table 2). The mean carcinoembryonic antigen level was 3.66 2.53 (range 0.729.18) ng / ml and the mean white blood cell count was 7, 315 3,842 (range 2,99016,520) mm . Three (30%) patients were anemic, with a mean hematocrit of 34.65 7.72% (range 26.753.4%) and a mean hemoglobin concentration of 11.38 2.54 (range 8.917.4) g / dl . Mean preoperative urea and creatinine levels were 27.7 23.62 (range 11.489.4) mg / dl and 1.43 0.98 (range 0.593.94) mg / dl, respectively . Most of the immunosuppressive medications used pre- and postoperatively were cyclosporine or tacrolimus combined with low dose of steroid ranging between 5 mg to 12 mg . No change in immunosuppressive the mean postoperative hemoglobin concentration was 10.63 2.45 (range 7.616.1) g / dl and no patient required a blood transfusion . The mean postoperative leukocyte count (10,655 2,219 (range 7,53014,220) mm) was slightly but significantly higher than the preoperative value (p = 0.032), and no severe leukocytosis or leukopenia was seen . Mean postoperative urea and creatinine levels were 18.35 17.8 (range 11.460.7) mg / dl and 1.40 0.76 (range 0.723.09) mg / dl, respectively . The mean interval between kidney transplantation and surgery was 11.7 (range 1.322) years . The mean estimated blood loss was 30 53.74 (range 0150) ml . We rarely found adhesions; most observed were minimal and were noted when the peritoneum was opened accidentally during the kidney transplant or another procedure . No significant difference was observed between pre- and postoperative kidney function parameters, and no organ rejection was reported . The mean timing of the first oral intake was 3.8 5.81 (range 27) days postoperatively . Postoperative stages were i in 20% of the patients, ii in 50% of the patients, and iii in 30% of the patients (table 3). One patient underwent adjuvant chemoradiation (xeloda (capecitabine) + radiation) and four patients underwent adjuvant chemotherapy alone (fluorouracil, leucovorin, folic acid, oxaliplatin (folfox) in three cases, and 5-fluorouracil + leucovorin in one case). Over a median follow - up period of 31.4 21.57 (range 263) months, no mortality occurred . One patient showed liver metastasis 1 year postoperatively, which was treated by radiofrequency ablation and no further recurrence till the present date of our study . In six patients who were followed for a mean of 43.5 9.84 (range 3263) months, the 3-year disease - free rate was 83.3% and the 3-year overall survival rate was 100% (table 3). The risk of colorectal neoplasia is high among renal transplant recipients and is associated with the duration of immunosuppression, regardless of age . The reported incidence of colorectal cancer in kidney transplant recipients has ranged from 0 to 0.9% . Kim et al . Found that the rate of right colon cancer was significantly higher in transplant recipients than in the general cancer population (35.2% versus 15.4%), whereas the rate of rectal cancer was significantly lower in transplant recipients (33.5% versus 46.5%; p = 0.031). Also reported that the risk of colorectal cancer was twofold higher in the first posttransplantation year than in the general population, and an additional 2.2-fold higher after the third posttransplantation year . In contrast, saidi et al . Found no increased risk of colorectal cancer among transplant recipients compared with the general population and noted the need for further evaluation of this issue . Parnaby et al . Reported that three population - based studies showed increases of up to twofold in the incidence of colonic but not rectal cancer in renal transplant recipients and that two population - based studies showed threefold and 10-fold increases in the incidence of anal cancer in these patients . Patients on immunosuppressive medications or who have undergone organ transplantation with comorbidities have increased morbidity (stress - related complications) and mortality and a prolonged postoperative recovery period, after major open surgery, including colorectal surgery [1215]. He concluded that the nonspecific immune response appeared to be less affected by laparoscopic surgery compared with open surgery, while specific cell - mediated immunity was equally affected . Laparoscopic colorectal resection is less physically stressful and offers short - term advantages compared with open resection . Technically, selection of the port insertion site is the most important step in a laparoscopic or robotic procedure . After the establishment of pneumoperitoneum, the kidney is moved inferolaterally to allow port placement . Our hospital is one of the leading hospitals in robotic surgery in korea . As we reported in our results, that one case was performed by robotic method . In that case, we used a hybrid technique where the colonic mobilization was completed laparoscopically and the da vinci robot was used only for pelvic dissection . We found that the robotic port position of the 3rd arm should be positioned on the opposite side of the transplanted kidney because of its close proximity with the anterior superior iliac spine where the kidney is located even after pneumoperitoneum . However, any port position even in totally robotic technique could be safe as long as the ports are placed away from transplanted kidney . We found no or minimal adhesion during the procedures, which may have been related to peritoneum opening during retroperitoneal dissection in the kidney transplant procedure . Adhesions from previous surgeries, possibly related to the use of steroids, were not an issue . Only one case series of laparoscopic - assisted colectomy in three kidney transplant recipients has been published . In that series, the average time since transplantation was 8 (range 610) years and no patient experienced organ rejection . All patients had colon cancer, and all allografts were contralateral to colon resection . The mean operative time was 103 (range 100105) min and no complications occurred . The average hospital stay was 5 (range 47) days and the mean follow - up time was 17 (range 340) months . Our series was larger than that described above, and it included patients with colonic and rectal cancer . Moreover, we included patients who underwent laparoscopic and robotic surgery . In our series, the mean interval between kidney transplantation and diagnosis of colorectal cancer (11.7 years) was slightly longer . Our mean operative time was 192.5 53.87 (range 77263) min, due to the longer operative time (263 min) of the robotic procedure; the mean operative time for laparoscopic procedures was 184.6 50.74 min . We observed similarly intact renal function and no rejection during the follow - up period . Two patients in our series had minor complications (wound seroma and chyloperitoneum) that were managed conservatively . The leukocyte count is normally raised after any major surgical procedure, but no severe leukocytosis or leukopenia occurred in our patients indicating infection or rejection . No change in the form or dosage of immunosuppressive medications was required before surgery, and medications were resumed postoperatively under monitoring by the transplant team . In general, these patients are more susceptible to perioperative complications . Immunosuppression can lead to a higher infection rate and surgical stress can increase immunosuppression, a phenomenon that is more pronounced following open (versus laparoscopic) surgical procedures [12, 14, 15]. Our follow - up period (mean 31.4 21.57 months) was longer than that previously reported . In addition, the mean follow - up period was 43.5 9.84 months for the six patients in whom long - term outcomes were assessed . No mortality occurred; the 3-year disease - free rate was 83.3%, and the 3-year overall survival rate was 100% . In conclusion, minimally invasive surgery is feasible in kidney transplant recipients, who can benefit from fewer wound - related problems . Technical proficiency, experience, and the use of a multidisciplinary team approach including an oncologist and transplant team can result in a successful procedure and ensure the safety of the transplanted kidney . Therefore, minimally invasive colorectal procedures could be considered safe alternatives to open colorectal resection in selected kidney transplant patients.
|
Acute occlusion of the superior mesenteric artery (sma) causes extensive intestinal necrosis due to the difficulty of early diagnosis, resulting in poor prognosis, with a high postoperative mortality rate of 65.2% . Recent reports indicate that selective thrombolytic therapy with intraarterial infusion of urokinase is effective for acute sma occlusion diagnosed early after onset . Early thrombolytic therapy cannot always induce complete thrombolysis, and even if intestinal necrosis is avoided by administration of initial thrombolytic therapy, indications for additional thrombolytic therapy or the method for monitoring intestinal viability during subsequent follow - up have not been established . In this report, we present a case of acute sma occlusion diagnosed early after onset that was successfully treated by sequential and intermittent thrombolytic therapy by intraarterial urokinase infusion with angiographic evaluation of blood flow, thereby avoiding intestinal resection . An 82-year - old woman with a past history of atrial fibrillation was admitted to our hospital, complaining of acute epigastric pain and stool with fresh blood . Physical examination was as follows: blood pressure 140/80, heart rate 70/min, o2 saturation 97% (room air), body temperature 37.2c . The abdomen was flat and soft, with no apparent tenderness or sign of peritoneal irritation . Laboratory data on admission revealed an elevated wbc count and mildly elevated hepatic enzyme values (wbc 15,400/mm, crp 0.05 mg / dl, ldh 502 iu / l, ast 57 iu / l, alt 21 iu / l, cpk 113 colonoscopy revealed mildly erosive, edematous mucosa, but no obvious bleeding from the ascending colon to the terminal ileum . Abdominal enhanced ct showed a filling defect in the proximal portion of the sma main trunk, which led to the diagnosis of acute sma occlusion (fig ., selective sma angiography was performed, showing complete occlusion of the sma around the first jejunal artery branch . Subsequently, intraarterial bolus infusion of urokinase (600,000 iu) with thrombus suction was performed . As a result, however, the thrombus remained, and intramural blood flow of the affected intestine was not visualized, suggesting possible necrosis of the affected intestine (fig . A mild ischemic change was observed at the intestinal wall from the jejunum 40 cm distal from the treitz ligament to the ascending colon, but no apparent necrosis . Blood flow in the mesentery was well palpable at the central portion of the sma, while peripheral blood flow was not palpable . The operation was completed without intestinal resection or direct removal of the thrombus from the sma . 24 h after the laparotomy, a second angiography was performed via the catheter that remained in place after first angiography, because clinical signs such as abdominal pain suggested the progression of intestinal ischemia . Peripheral blood flow was well visualized, and no signs of intestinal necrosis were observed . Thereafter, thrombolysis with urokinase infusion (240,000 iu) and suction of the residual thrombus were performed . In addition, 36 h after the laparotomy, a third angiography and thrombolysis (urokinase 240,000 iu) were performed, showing improvement in peripheral blood flow via the gradual development of collateral blood flow . Follow - up carefully monitored the possible onset of shower embolism by the residual thrombus . Intestinal blood flow was well visualized on ct angiography performed 48 h after laparotomy (60 h after the first thrombolytic therapy). The patient began to take food by mouth on the 6th day after laparotomy and was discharged from our hospital 35 days after laparotomy . Early diagnosis and treatment contribute to the improvement of therapeutic results for acute sma occlusion . A delay in diagnosis results in an extremely high mortality rate due to extensive intestinal necrosis; however, successful resection of necrotic intestine causes short bowel syndrome, severely impairing quality of life . Recent reports indicate that enhanced ct is feasible for early diagnosis of acute sma occlusion . When acute sma occlusion is suspected from symptom, clinical history and physical findings, enhanced ct plays a role not only in identifying the causal portion, but also in determining the subsequent treatment plan . Early thrombolytic therapy is effective for acute sma occlusion in avoiding extensive intestinal resection . Since the first report by jamieson et al ., reports that support the usefulness of selective thrombolytic therapy via a catheter for angiography have increased . The golden hour, the time during which the viability of the ischemic intestine can be preserved, varies, dependent on the portion and extent of occlusion . Muneoka et al . Studied 23 cases of acute sma occlusion treated by selective thrombolytic therapy in japan, and concluded that the golden hour is 5 h for occlusion of the sma main trunk and 12 h for the occlusion of the distal sma . The goal of thrombolytic therapy is complete thrombolysis, but administration over 48 h increases the risk of complication . Easy bleeding due to fibrinolysis promoted by urokinase and shower emboli induced by the release of residual thrombi are known to be the major complications associated with thrombolytic therapy with urokinase . Careful monitoring during 24 h after the completion of thrombolytic therapy is essential, and emergency laparotomy is mandatory if intestinal necrosis is suspected . Urokinase has no influence during surgery as its half - life in blood is only 16 min . In the present case, the thrombus was detected in the sma main trunk by angiography performed 5 h from onset . Therefore, judging that we were within the golden hour, we added urokinase infusion and thrombus suction via the angiography catheter . However, the thrombus remained left, and visualization of intramural blood flow was poor, therefore, we selected exploratory laparotomy . On the other hand, when no apparent intestinal necrosis is observed during exploratory laparotomy, a clinical consensus concerning the indication of additional thrombolytic therapy or optimal methods for evaluation of intestinal blood flow or viability in the subsequent follow - up is not yet established . Even if intestinal necrosis can be avoided, intestinal ischemia would cause perforation or stricture of the affected intestine . From 1985 to 2007, 45 cases of thrombolytic therapy for acute sma occlusion were reported in japan . Complete thrombolysis was successful in 28 cases (63.6%), and 17 cases (36.4%) received laparotomy following thrombolytic therapy . Among those 17 patients, intestinal resection was performed in 5 cases (11.1%) due to intestinal necrosis; the remaining 12 cases (26.7%) without intestinal necrosis at laparotomy were thereafter free from intestinal necrosis . Of those 12 patients, 2 received angiographic reevaluation of blood flow and subsequent second - look operation, 3 received embolectomy, and 6 were carefully observed by laboratory examination and physical findings without any invasive treatments . In the present case, we performed thrombolytic therapy with angiographic evaluation of blood flow, sequentially and intermittently, after exploratory laparotomy, which enabled us not only to accurately evaluate intestinal blood flow or viability, but also to avoid a second - look operation . In conclusion, sequential and intermittent thrombolytic therapy with meticulous angiographic evaluation of blood flow is effective in the early stage of acute sma . In particular, it is much less invasive than strategies described in previous reports and enables accurate evaluation of intestinal blood flow or viability over the time course.
|
Advances in imaging technology have continued, and recently there has been increasing interest in the use of standing whole - body stereoradiography (sr) when evaluating spinal deformity . The purported advantages of sr include lack of magnification, lack of parallax distortion, simultaneous two - dimensional (anteroposterior and lateral) high - quality imaging of the entire skeleton with lower radiation exposure, as well as capabilities for three - dimensional image reconstruction.2 however, both arms must be forward flexed at the shoulders during sr imaging to reduce obstruction by arm overlapping the thoracic and lumbar regions, and a previous study has found arm positioning, particularly arms flexed with hands touching the clavicle, may change cervical sagittal alignment during xr imaging . Previous studies have demonstrated that arm positioning is an important factor during xr imaging, changing sagittal alignment parameters of the thoracic and lumbar spine.3 4 5 6 7 8 in fact, park et al found that lateral whole - spine xrs with hands positioned touching the clavicle were associated with a decrease in t1 slope (t1-s), posterior translation of the head, hypolordotic cervical spine, and downward gazing when compared with standing lateral cervical xrs with arms relaxed on either side of the body.9 to our knowledge, no study to date has compared cervical sagittal alignment parameters obtained from standing lateral cervical xrs versus lateral whole - body srs . The purpose of this study is to evaluate the correlation and reliability of cervical sagittal alignment parameters measured from lateral cervical xrs compared with lateral whole - body eos srs (eos imaging, paris, france). We hypothesized that the difference in arm position and in the trajectory of the radiation beam between standard cervical xr and sr would result in a difference for all cervical sagittal alignment parameters . We retrospectively evaluated adult patients with a primary diagnosis of cervical deformity treated by a single surgeon between january 2010 and december 2014 with both lateral cervical xrs and lateral srs obtained within 1 week of each other . At our institution, lateral cervical xrs are routinely obtained with the patient standing, with the arms in a relaxed neutral position, hanging at the side of the body; this image is compared with srs obtained with eos imaging, which are acquired with patients standing and arms forward flexed at the shoulders . Cervical sagittal alignment measurements were performed using a picture archiving and communications system, with each xr measured side by side on the same computer monitor to allow equal magnification / resolution of the cervical region from the lateral whole - body sr compared with the lateral cervical xr (fig . Were measured by two independent spine surgeon reviewers on two separate occasions, using the following cervical sagittal alignment parameters: c2c7 sagittal cobb angle (sca), c2c7 sagittal vertical axis (sva), c1c7 translational distance (c1c7), t1-s, neck tilt (nt), and thoracic inlet angle (tia) (fig . Cobb angle was measured by drawing the angle between a line parallel to the inferior end plate of c2 and a line parallel to the inferior end plate of c7.10 positive values demonstrate kyphotic alignment and negative values, lordotic alignment . The distance between the vertical plumb line from the center of c2 and the vertical line from the posterosuperior corner of c7 was measured for c2c7 sva . Translational distance was defined by the distance from anterior tubercle of c1 to the vertical line from the posteroinferior corner of c7 to evaluate the horizontal translation of the head position.10 t1-s was defined by the angle between the line parallel to the upper end plate of t1 and the horizontal line.11 nt is the angle formed by the line from the mid - t1 upper end plate to the cranial - most aspect of the midsternum and the vertical line from the cranial - most aspect of the midsternum . Tia was then calculated by the formula tia = t1 slope + nt.12 the measuring parameters from cervical xr and sr were analyzed using r package irr . The intrarater reliability was quantified by intraclass correlation coefficient (icc) (3, 1), termed by shrout and fleiss.13 this type of icc is appropriate when study patients are a random sample of the underlying patient population, and a test and retest are only two occasions of interest . Only two variance components are involved: the variance of study subjects and the variance of random errors . This type of icc is appropriate when both study patients and raters are a random sample from their respectively underlying populations . Three variance components are involved: the variance of the study subjects, the variance of the raters, and the variance of random errors . Icc values of more than 0.75 represent excellent reliability, values between 0.4 and 0.75 represent fair to good reliability, and value less than 0.4 represent poor reliability.14 the relationships between the parameters obtained from xrs and those from srs were compared by correlation analysis (pearson correlation coefficient) and paired t test . A total of 35 (12 male, 23 female) patients, with mean age of 59 years old, were included in the study . Intrarater reliability was excellent for all cervical sagittal alignment parameters in both the xr and sr groups, with icc ranging from 0.799 to 0.994 for xr and 0.791 to 0.995 for sr . C1c7 demonstrated the highest intrarater icc in both groups (0.994 xr, 0.995 sr), with nt having the lowest intrarater icc in both groups (0.799 xr, 0.791 sr; table 1). Abbreviations: ci, confidence interval; icc, intraclass correlation coefficient; nt, neck tilt; sva, sagittal vertical axis; t1-s, t1 slope; tia, thoracic inlet angle . Note: 95% ci is the 95% upper and lower boundaries for the confidence interval of icc . Icc (3, 1): two random sample components model, two tails . Interrater reliability was excellent for all cervical sagittal alignment parameters in both the xr and sr groups, except nt and tia parameters, which had fair reliability . Interrater icc was highest for sva (0.990) in the xr group and c1c7 (0.978) in the sr group, with nt having the lowest interrater icc in both groups (0.465 xr, 0.414 sr; table 2). Abbreviations: ci, confidence interval; icc, intraclass correlation coefficient; nt, neck tilt; sva, sagittal vertical axis; t1-s, t1 slope; tia, thoracic inlet angle . Note: 95% ci is 95% upper and lower boundaries for the confidence interval of icc . Icc (2, 1): three random sample components model, two tails . We found excellent correlations between xr and sr measurements for most cervical sagittal alignment parameters, with sca, sva, and c1c7 having r> 0.90 . T1-s and tia were between 0.75 and 0.90, and only nt had an r <0.70 . We found a significant difference between the groups, with sr having lower measurements compared with xr for both sva (0.68 cm lower, p <0.001) and c1c7 (1.02 cm lower, p <0.001). There were no differences between the groups for the other cervical sagittal alignment parameters (sca, t1-s, nt, and tia; tables 3 and 4, fig . Icc values of cervical alignment parameters between lateral cervical radiograph and lateral whole - body stereoradiography . Abbreviations: icc, intraclass correlation coefficient; nt, neck tilt; sca, sagittal cobb angle; sva, sagittal vertical axis; td, translational distance; tia, thoracic inlet angle . Abbreviations: nt, neck tilt; sd, standard deviation; sva, sagittal vertical axis; t1-s, t1 slope; tia, thoracic inlet angle . Abbreviations: nt, neck tilt; sd, standard deviation; sva, sagittal vertical axis; t1-s, t1 slope; tia, thoracic inlet angle . Intrarater reliability was excellent for all cervical sagittal alignment parameters in both the xr and sr groups, with icc ranging from 0.799 to 0.994 for xr and 0.791 to 0.995 for sr . C1c7 demonstrated the highest intrarater icc in both groups (0.994 xr, 0.995 sr), with nt having the lowest intrarater icc in both groups (0.799 xr, 0.791 sr; table 1). Abbreviations: ci, confidence interval; icc, intraclass correlation coefficient; nt, neck tilt; sva, sagittal vertical axis; t1-s, t1 slope; tia, thoracic inlet angle . Note: 95% ci is the 95% upper and lower boundaries for the confidence interval of icc . Icc (3, 1): two random sample components model, two tails . Interrater reliability was excellent for all cervical sagittal alignment parameters in both the xr and sr groups, except nt and tia parameters, which had fair reliability . Interrater icc was highest for sva (0.990) in the xr group and c1c7 (0.978) in the sr group, with nt having the lowest interrater icc in both groups (0.465 xr, 0.414 sr; table 2). Abbreviations: ci, confidence interval; icc, intraclass correlation coefficient; nt, neck tilt; sva, sagittal vertical axis; t1-s, t1 slope; tia, thoracic inlet angle . Note: 95% ci is 95% upper and lower boundaries for the confidence interval of icc . Icc (2, 1): three random sample components model, two tails . We found excellent correlations between xr and sr measurements for most cervical sagittal alignment parameters, with sca, sva, and c1c7 having r> 0.90 . T1-s and tia were between 0.75 and 0.90, and only nt had an r <0.70 . We found a significant difference between the groups, with sr having lower measurements compared with xr for both sva (0.68 cm lower, p <0.001) and c1c7 (1.02 cm lower, p <0.001). There were no differences between the groups for the other cervical sagittal alignment parameters (sca, t1-s, nt, and tia; tables 3 and 4, fig . Icc values of cervical alignment parameters between lateral cervical radiograph and lateral whole - body stereoradiography . Abbreviations: icc, intraclass correlation coefficient; nt, neck tilt; sca, sagittal cobb angle; sva, sagittal vertical axis; td, translational distance; tia, thoracic inlet angle . Abbreviations: nt, neck tilt; sd, standard deviation; sva, sagittal vertical axis; t1-s, t1 slope; tia, thoracic inlet angle . Abbreviations: nt, neck tilt; sd, standard deviation; sva, sagittal vertical axis; t1-s, t1 slope; tia, thoracic inlet angle . Cervical sagittal imbalance remains a complex problem,9 15 and optimal imaging to assess cervical sagittal alignment parameters is important during patient evaluation and particularly preoperative planning . When cervical sagittal imbalance or deformity is identified, additional standing full - length spine xrs are recommended to assess whether other regions of the spine may also have deformity and contribute to global sagittal imbalance . However, obtaining several separate xrs is often time - consuming with repeated radiation exposure . Recent advances in imaging techniques include full - body sr, which allows low - dose, high - quality imaging of the entire spinal column and pelvis, as well as assessing for concomitant length discrepancy / deformity of the lower extremities and joints (hips, knees, ankles).16 despite the purported advantages of sr, the difference in arm positioning compared with the standing lateral cervical xr and the effect on cervical sagittal alignment parameters is not completely understood . Our study found most cervical sagittal alignment parameters (sca, sva, and c1c7) measured from lateral cervical xrs and lateral whole - body eos srs had excellent correlation, with excellent intra- and interrater reliability in both groups . Our results regarding sca are similar to a previous report by vidal et al that also found excellent intra- (icc = 0.847 to 0.955) and interrater (icc = 0.846 to 0.954) reliability for sca measured on sr imaging, both in the upper cervical spine (c1c3) and lower cervical spine (c3c7).14 however, this study was performed in patients with adolescent idiopathic scoliosis, and although global sagittal alignment using the c7 plumb line was also found to have excellent reliability, other cervical sagittal alignment parameters were not evaluated . Intra- and interrater reliability were lowest for nt and tia, which had fair reliability . We postulate the lower reliability for nt and tia was due to poor visualization of the sternum on both imaging techniques, and they may be suboptimal cervical sagittal alignment parameters in the setting of spinal deformity . Similarly, there was only fair correlation between the xr and sr groups for nt, which further emphasizes that nt may not be an ideal cervical sagittal alignment parameter . The most important finding from our study was the significant difference in mean values for both sva and c1c7 between the xr and sr groups . We found the sr group had a mean sva that was 0.68 cm lower and mean c1c7 that was 1.02 cm lower than the xr group, although there was excellent correlation with r> 0.900 for both measurements . The most plausible explanation for our findings is the difference in arm positioning during xr and sr imaging, with forward arm flexion during sr causing the head position to shift posteriorly . Our findings are similar to a previous study by park et al, who evaluated cervical sagittal alignment parameters in 101 asymptomatic adults and found that lateral whole - spine xrs with arms flexed in the hand - touching - clavicle position also resulted in posterior head translation compared with lateral cervical xrs.9 however, the study also found the arm - flexed position in the whole - spine xrs resulted in significantly lower t1-s, cervical hypolordosis, and downward gaze . Our study did not find differences in t1-s or sca; however, this discrepancy may be explained by the smaller sample size of our study, as well as the difference in studied population between symptomatic adults with cervical deformity versus asymptomatic adults . We postulate that patients with symptomatic cervical deformity have degenerative changes with less flexibility of the subaxial spine . Also, the forward flexion arm position for sr is not as exaggerated as the whole - spine lateral xr, which requires additional muscle activation / strain with elbow and wrist flexion to touch the clavicles . Weaknesses of our study include the retrospective design and the potential for selection bias based on nonconsecutive sampling of patients . Also, changes in pain or worsening deformity over time may have resulted in differences in cervical sagittal alignment parameters; however, we attempted to reduce this confounding variable by including only patients with xr and sr images obtained less than 1 week apart . Also, our study may have had insufficient sample size to avoid type ii error for various cervical sagittal alignment parameters . Based on the findings of our study, we believe sr is a reliable method for determining most cervical sagittal alignment parameters and a viable alternative to lateral cervical xr despite differences in arm position during imaging . However, measurements requiring visualization of the sternum such as nt and tia may not be reliable and do not appear to be optimal cervical sagittal alignment parameters . Also, sr results in slight posterior head translation and subsequently lower sva and c17 translational distance compared with lateral cervical xr and may underestimate regional cervical sagittal alignment parameters in patients with cervical deformity or sagittal imbalance . The lower radiation exposure using single sr has to be weighed against its higher cost compared with xr.
|
Nucleotide excision repair (ner) plays a central role in preserving the genome of prokaryotes and eukaryotes . This versatile repair system removes structurally and chemically diverse bulky dna lesions, including those induced by exposure to uv light and environmental chemical carcinogens [1, 2]. The vital importance of this mechanism is demonstrated by several human ner - deficiency syndromes including xeroderma pigmentosum (xp), cockayne syndrome (cs), and trichothiodystrophy (ttd). Xp, for example, is characterized by high photosensitivity, hyperpigmentation, premature skin ageing, and proneness to developing skin cancer . Furthermore, the capacity of the ner pathway is important in cancer chemotherapy: ner diminishes the efficacy of chemotherapeutic agents such as cisplatin, which act via the formation of bulky dna adducts . A better understanding of the mechanisms of recognition of dna lesions by the ner system may lead to the design of improved chemotherapeutic drugs that can modulate the repair response . Recent findings reveal that polymorphisms in human ner repair genes have an impact on the repair of dna lesions and cancer susceptibility [6, 7], as well as on chemotherapeutic efficacy . The eukaryotic ner pathway is a biologically complicated process and consists of two sub - pathways with different substrate specificity: global genome ner (gg - ner) [9, 10] and transcription - coupled repair (tcr) [1114]. Both sub - pathways consist of ordered multistep processes, which differ in the early steps, when the dna lesions are recognized, but converge in the later steps . In gg - ner, the focus of our present interest, the whole genome is scanned for bulky lesions to initiate the repair process . Two independent complexes, one involving the xpc / hr23b / centrin 2 proteins [1517] and the other involving the ddb1/ddb2 heterodimer [1821], have been implicated in the early steps of base - damage recognition during ner . By contrast, the tcr sub - pathway is activated by a stalled rna polymerase during transcription . Once the lesion is detected, the two sub - pathways proceed in an essentially identical manner to excise it: the multisubunit transcription factor . Tfiih, containing helicases xpb, and xpd, is recruited to the lesion site, followed by xpa, the single - strand dna binding protein rpa, and the two nucleases xpg and xpf - ercc1 . Once assembled, a 2432 oligonucleotide stretch containing the lesion is excised from the damaged strand . Finally, gap resynthesis by dna polymerases,, and and ligation by dna ligase i complete the ner process . One remarkable characteristic of the ner pathway is its ability to excise an astounding variety of chemically and structurally diverse lesions, and the rates of repair can vary over several orders of magnitude . However, the differences in the structural and thermodynamic properties of the lesions that control the diverse ner efficiencies have remained elusive . It has been suggested that the ner factors do not recognize the lesion itself, but rather the local distortions and destabilizations in the dna that are associated with it [2430]. A number of different properties of damaged dna that elicit the ner response have been proposed . These include disruption of watson - crick hydrogen bonding [24, 31], kinks in the damaged dna, thermodynamic destabilization [24, 29, 33], diminished base stacking [34, 35], local conformational flexibility, and flipped - out bases in the unmodified complementary strand [3740]. A crystal structure of yeast rad4/rad23, the homolog of the human ner recognition factor xpc / hr23b, bound to dna containing a cyclobutane pyrimidine dimer, shows that rad4/rad23 inserts a -hairpin through the dna duplex and expels two mismatched thymines in the undamaged strand out of the duplex to bind with the enzyme (pdb i d: 2qsg). This structure suggests that lesions which thermodynamically destabilize the dna duplex and facilitate the flipping of base pairs and the intrusion of the beta - hairpin are good substrates to the ner machinery: the more locally destabilized the lesion, the better it is repaired . The modulation of ner susceptibility for the same lesion by neighboring base sequence context, is however, a relatively unexplored area . If a lesion is better repaired in one sequence context than the other, a lesion - induced mutational hotspot could result . In order to elucidate the relationship between ner efficiency and base sequence - governed dna distortion and destabilization induced by a bulky dna adduct, we have employed as a model system the major lesion derived from the cancer - causing compound benzo[a]pyrene (b[a]p). B[a]p is the most well - studied member in a family of ubiquitous environmental pollutants known as polycyclic aromatic hydrocarbons . The tumorigenic metabolite of b[a]p is the diol epoxide r7, t8-dihydroxy - t9,10-epoxy-7,8,9,10-tetrahydrobenzo[a]pyrene (b[a]pde). This intermediate reacts with dna and rna; the most abundantly stable adduct produced in mammalian cells [4446] is the 10s (+) -trans - anti - b[a]p - n - dg adduct ([g *]) (figure 1(a)), the focus of our work . This adduct, unless removed by dna repair mechanisms, is highly mutagenic [48, 49]. We have investigated the identical 10s (+) -trans - anti - b[a]p - n - dg adduct in the six sequence contexts shown in figure 1(b), utilizing an array of approaches: ner in human hela cell extracts, ligation and polyacrylamide gel electrophoresis techniques to assess bending properties of the modified duplexes, and structural studies utilizing high resolution nmr methods as well as unrestrained molecular dynamics (md) simulations . The position of the b[a]p ring system in the b - dna minor groove, directed 5 along the modified strand, was first determined by nmr in the 5- c[g*]c - i sequence in 1992, but sequence - governed structural details as well as dynamic properties remained to be elucidated . One important motivation for our work was to explore the role of nearby guanine amino groups on the structural properties and ner susceptibilities of these duplexes . The key difference in these duplexes is the presence and positioning of guanines flanking the [g *], either immediately adjacent to the lesion or beyond: the b[a]p rings compete for space with the bulky amino group of guanine on the minor groove side of b - dna, which we anticipated would differentially impact the structures of the damaged duplexes in a sequence context - dependent manner . A further motivation was to explore the role of differing sequence contexts beyond the lesion that vary in intrinsic flexibility . We hypothesized that subtle but critical structural effects governed by sequence context would manifest themselves by impacting ner efficiencies . Our results determined that sequence context could cause an up to four - fold difference in relative ner susceptibility, with even distant neighbors influencing ner . Locally disturbed watson - crick hydrogen bonding and flexible bending are two key sequence - governed structural distortions caused by this lesion that the ner machinery appears to recognize with different efficiencies . More generally, different lesions in varied sequence contexts will cause different kinds of distortions; thus, the extent of the local thermodynamic destabilization will also vary; we hypothesize that it is the extent and type of destabilization that determines the relative ner efficiency . The 5- c[g *], 5- g[g *] c, and 5- i[g *] sequences . High resolution nmr solution studies have shown that the bulky aromatic b[a]p residue is positioned in the minor groove on the 5-side of [g *] in the 5- c[g*]g and 5- g[g*]c duplexes (figure 2). However, there are sequence - governed differences in some of the structural features . Duplex, nmr studies revealed that the c: g base pair on the 5-side of [g *] is severely disturbed . In the case of the sequence - isomer 5- g[g*]c duplex, this perturbance is not observed . On the other hand, analyses of md simulations [51, 52] based on the nmr data revealed significant unwinding near the lesion site combined with an anomalously enlarged roll (figure 3), not observed in the 5- c[g*]g duplex . Duplex, which is a manifestation of a kink that is highly flexible . This flexible bend is caused on a molecular level by the severe untwisting and enlarged roll determined by md from the nmr data: dna bending is largely caused by increased roll, which is correlated with untwisting [5557]. The underlying structural reasons for the disturbed watson - crick hydrogen bond in the 5-, the bulky amino group on g20 (figure 3), which is partner to the c on the 5 side of [g *], is sterically crowded by the b[a]p ring system since both are on the minor groove side, and hence this c5: g20 base pair is episodically denatured (figure 3(a)); for the 5- g[g*]c case, the b[a]p rings crowd the g6 amino group, and in this case the crowding is relieved by the severe untwisting accompanied by the increased roll, which produces the flexible bend observed by gel electrophoresis . Investigations with the 5- i[g*]c sequence context substantiated the critical role of the guanine amino group since i (figure 1(b)) lacks this group: the gel electrophoretic manifestation of a flexible bend was abolished . The nmr data showed conformational heterogeneity in minor groove conformations, and the md simulations showed episodic denaturation of one of the two hydrogen bonds at the i: c base pair, explaining the heterogeneity . The repair efficiency relative to 5- c[g*]c - i, the standard sequence utilized in many nmr and ner studies [53, 58], is 4.1 0.2, 1.7 0.2 and 1.3 0.2 for the 5- c[g*]g, 5- g[g*]c and 5- i[g*]c duplexes, respectively (figure 4). Duplex, dynamic episodic denaturation of watson crick base pairing flanking the lesion on the 5-side correlates with the greatest ner susceptibility while the flexible bend in 5- g[g*]c is a less pronounced ner recognition signal, and the disturbance to one hydrogen bond in the 5- i[g*]c case provides a still lesser signal [52, 53] in this series . The 5- c[g *] c - i and 5- t[g *] t - ii sequence contexts . The 5- c[g*]c - ii and 5- t[g*]t - ii while a single, well - defined minor groove adduct conformation is observed in 5- c[g*]c duplexes, in the 5- t[g*]t - ii sequence context, the minor groove - aligned adduct conformation is heterogeneous . Furthermore, polyacrylamide gel electrophoresis studies showed that the adduct induces a rigid bend in the 5-c[g*]c - ii sequence context, the lesion induces a highly flexible bend [59, 60]. Also, the 5- t[g*]t - ii 11-mer duplex has a lower thermal melting point than the 11-mer 5- duplex (the exact difference depends on sequence length) as expected from the thermodynamic properties of t: a and c: g watson - crick base pairs [62, 63]. Molecular insights on these experimental observations were provided by md simulations for the 5- t[g*]t - ii and 5- c[g*]c - ii duplexes . Consistent with the conformational heterogeneity observed in the nmr studies, it was found that the 5- t[g*]t - ii duplex is much more dynamic than the 5- c[g*]c - ii duplex: the highly dynamic base pair on the 5-side of the lesion exhibits episodic denaturation of one of the two watson - crick hydrogen bonds, in agreement with the partial rupturing of this base pair observed by the nmr methods; also, the 5- t[g*]t - ii duplex shows somewhat increased and more dynamic roll and untwisting compared to the 5- c[g*]c - ii duplex, consistent with the flexible bend observed only for the 5- t[g*]t - ii case; in addition, the b[a]p ring system exhibits greater mobility and the duplex groove dimensions are more variable . The differences are accounted for by a coupled series of properties: the intrinsically weaker stacking of t - g compared to c - g steps allows for greater flexibility in the 5- t[g*]t - ii duplex; the weaker t: a pair, with only two hydrogen bonds, compared to the c: g pair, with three bonds, provides enhanced flexibility; moreover, the absence of guanine amino groups adjacent to the [g *] in the 5- t[g*]t - ii case allows for greater mobility for the b[a]p ring system . Overall, the greater flexibility of the 5- t[g*]t - ii sequence is attributable to the absence of the guanine amino group . The rates of incision in the human hela cell assay relative to 5- c[g*]c - i is 2.4 0.2 and 1.6 0.2 for the 5- t[g*]t - ii and the 5- c[g*]c - ii duplexes, respectively, corresponding to a 1.5 0.2-fold higher - repair efficiency for the 5- t[g*]t - ii case is consistent with the overall enhanced dynamics manifested in various structural properties, notably watson - crick hydrogen bonding and bending . The 5- c[g*]c - i and 5- c[g*]c - ii sequences (figure 1(b)) differ in the sequences beyond the nearest neighbors to [g *]. Since different sequence steps are known to be differentially flexible [57, 65], we hypothesized that the same minor groove lesion [50, 64] with different distant neighbors would be differentially repaired . Polyacrylamide gel electrophoresis and self - ligation circularization experiments revealed that the 5- c[g*]c - ii duplex is more bent and suggested that it has more torsional flexibility than the 5- c[g*]c - i duplex . The key role is played by the unique -c3-a4-c5- segment in the 5- c[g*]c - ii duplex . Duplex originates from the guanine amino group at the c3: g20 pair (figure 5). This amino group acts as a wedge to open the minor groove; facilitated by the highly deformable local -c3-a4- base step, the amino group allows the b[a]p ring system to better bury its hydrophobic surface within the groove walls . This produces a yet more enlarged minor groove which is coupled with more local untwisting and more enlarged and flexible roll, causing the greater bend in 5- c[g*]c - ii (figure 5). The ner efficiencies are 1.6 0.2 times greater in the 5- c[g*]c - ii than in the 5- c[g*]c - i sequence context showing that distant neighbors to [g *] modulate the ner susceptibility . The greater ner susceptibility for the 5- c[g*]c - ii duplex is explained by its greater bending with enhanced flexibility: the intrinsic minor groove enlargement caused by both the guanine amino groups [55, 68] and the great flexibility of pyrimidine - purine steps, including the c - a step [57, 6972] allow the b[a]p moiety (figure 5) to more favorably position itself, but at the expense of the greater bend that makes it more repair - susceptible . We have carried out a series of studies with the same 10s (+) -trans - anti - b[a]p - n - dg lesion in a number of sequence contexts that differ in how the lesion is positioned in relation to nearby guanine amino groups . Additionally, we have considered differences in intrinsic flexibility of sequences flanking the lesion . These are model systems for gaining understanding of ner lesion recognition factors . We have obtained molecular structural data by nmr and md simulations, bending properties from gel electrophoresis studies, and ner data from human hela cell extracts for all of our investigated sequence contexts (figure 1(b)). Figure 4 summarizes our key findings and enables us to infer a hierarchy of ner recognition signals for the series of sequences and the single lesion we explored . We point out here that a variety of structural disturbances are found in each case, which are correlated . Examples include impaired watson - crick pairing that is accompanied by diminished base stacking, and dna bending towards the major groove, that is induced by a minor groove lesion and is accompanied by minor groove enlargement . Our present model system suggests that disturbed watson - crick base pairing is a better recognition signal than a flexible bend, and that these can act in concert to provide an enhanced signal: for example, for 5- t[g*]t - ii one episodically ruptured watson - crick hydrogen bond combined with the flexible bend results in better repair than just one disturbed hydrogen bond as in 5- i[g*]c, or the flexible bend alone in 5- g[g*]c (figure 4). For our system, steric hindrance between the minor groove - aligned lesion and nearby guanine amino groups, if present, determines the exact nature of the disturbances, depending on exactly where the guanine amino groups are situated . The intrinsic flexibility of the specific base steps also plays an important role in causing the differential disturbances . Both the nearest neighbor and the more distant neighbor sequence contexts have an impact . More globally, different lesions may cause different types of distortions depending on the specific nature of the lesion and its sequence context . However, regardless of exactly what these distortions are, we hypothesize that they must provide a local thermodynamic destabilization signal for repair to ensue, and the greater the extent of destabilization, the better the repair . The destabilization would facilitate the strand separation, base - flipping, and -hairpin insertion by the xpc / hr23b recognition factor [41, 73] needed to initiate ner . In this way, the ner machinery would excise a large variety of lesions with different efficiencies, by recognizing the thermodynamic impact of the lesions rather than the lesions themselves [24, 29, 41, 73]. Lesions that resist ner present a great hazard, as they survive to the replication step and produce a mutagenic outcome; such ner - resistant lesions provide an important opportunity for gaining further understanding of the mechanism utilized by the ner apparatus to recognize different lesions.
|
Differences in life span between males and females are commonly observed across many species . For example, where the heterogametic sex (xy sex chromosomes) is male, as in humans and drosophila, females tend to live longer than males . Similarly, in caenorhabditis elegans, where the hermaphrodite has two x chromosomes (xx) and the male has one (xo), the hermaphrodite tends to live longer . In contrast, in most bird species, where the heterogametic sex is female (zw sex chromosomes), males tend to live longer than females . Genetic and environmental interventions that affect life span tend to have a greater effect in one sex than the other . For example, reduced insulin / insulin - like growth factor 1 (igf-1) signaling and dietary restriction tend to increase life span more in females than males in drosophila and mammals, whereas mild stress tends to increase life span more in males than in females, at least in drosophila . Quantitative genetic analyses have revealed a different genetic architecture of life span in males versus females . For example, quantitative trait loci (qtls) that affect life span are often sex - specific or sex - biased in drosophila, mice and humans, and studies over the past few years show strikingly different effects of inbreeding in male versus female insects . Two recent studies in bmc evolutionary biology on the effects of inbreeding in a seed beetle (bilde et al .) And in drosophila (vermeulen et al . ), respectively, provide additional insight into the genetic factors involved . Taken together, all these data suggest that the genetic differences between males and females have a significant effect upon aging and life span . Several possible and potentially overlapping genetic mechanisms have been suggested to explain differences in life span between genders, including asymmetric inheritance of sex chromosomes, differences in physiology, maternal effects, and sex - specific selective pressures . For example, the asymmetric inheritance of the sex chromosomes, such that males inherit a single x chromosome in flies, c. elegans and humans, means that in males any x chromosome recessive mutant phenotype will be expressed (the' unprotected x' model), whereas in females the presence of the second x chromosome means that there is likely to be a wild - type copy of the gene present, and the recessive phenotype will not be expressed . These deleterious recessive mutations could lead to decreased life span, affecting males more than females . Consistent with this idea, inbreeding (which will tend to make recessive mutations homozygous) has been found to cause decreased life span in drosophila, mice and several other species (called inbreeding depression of life span). However, several other studies, including that of vermeulen et al . (and see references therein) have failed to detect inbreeding depression of adult life span, or found effects that varied depending upon the particular strain, sex, or environmental conditions . For example, vermeulen et al . Mapped a recessive qtl on the second chromosome of drosophila that causes a temperature sensitive reduction in life span in inbred males but not females . Asymmetric inheritance of mitochondrial genomes and other cytoplasmic genomes is another possible contributor to sex - specific differences in life span . Given that the mitochondrial genome is inherited maternally in drosophila and humans, natural selection cannot act to optimize mitochondrial function or nuclear - mitochondrial genetic interactions in the male genetic background . This might result in suboptimal mitochondrial function in males and reduced life span in males relative to females . The maternal effect may also contribute to differences in life span between males and female . In many species, the mother makes a large contribution of gene products to the egg or embryo, and this has been shown to affect life span in a gender - specific way in certain species . Because the mother contributes these materials equally to eggs that will develop as either male or female, the genetic differences between male and female zygotes must underlie aspects of the sex - specific effects of maternal products on life span . One possibility is that because maternal - effect gene products are being produced by a female genome, they may be more optimized for female offspring, thereby contributing to the reduced life span often observed in males . Consistent with this idea, maternal effects on life span are greater in males than females for certain species such as the seed beetle . Finding mechanisms that explain the difference in life span between males and females is hindered by our lack of understanding of the basic mechanisms of aging and underlying causes of mortality . Life span appears to be limited by the accumulation of irreversible damage, probably including oxidative damage to macromolecules, mutations, and loss of epigenetic regulation, as well as more acute and dynamic modifiers of mortality rates, perhaps including the efficiency of detoxification and excretion . Mechanistic explanations often involve the concept of tradeoffs, that is, the allocation of energy or other' resources' to functions such as reproduction and behavior, at the expense of somatic maintenance pathways required for optimal longevity . In several recent studies, however, it was shown that life span can be increased by dietary restriction or altered insulin / igf-1 signaling without a detectable decrease in reproduction or overall metabolism, and conversely, reproduction can be increased in old female flies with no detectable cost for life span . Seed beetles (figure 1) could be a particularly powerful model in which to look for trade - offs between somatic maintenance required for optimal life span and other traits such as fecundity . The adult is' facultatively aphagous' and does not require food or drink, but can rely on nutrient stores accumulated during development . Have examined the effects of inbreeding on male and female life span in the species callosobruchus maculatus . They found that inbreeding reduced fitness of both males and females, as indicated by reduced total reproductive output . As expected, female life span was decreased by extreme inbreeding, but surprisingly, male life span was increased . Previous studies of seed beetles by fox et al . Had found a large maternal effect on life span of males but not females . However, the bilde et al . Study included an elegant control for maternal effects, in that animals with varying amounts of inbreeding had mothers of the same genotype, thus separating the effects of cytoplasmic factors such as mitochondria and maternally contributed gene products from the effects of inbreeding . Of course, this result does not rule out an important role for maternal products in modulating life span, but it does show that they are not the direct targets of the observed inbreeding effects . One possible explanation for the decrease in female life span is that inbreeding led to homozygosity of recessive alleles that are deleterious for female lifespan, providing support for the unprotected x hypothesis . However, this hypothesis cannot account for the increase in life span observed in males . Suggest that the increase in male life span might be due to changes in energy - intensive behaviors, such as a reduction in courtship or aggression, thereby leading to longer life span . (a) male and (b) female . The sex specific coloration of the posterior abdominal plate (pygidium) is shown . The squares are 1 mm . From beanbeetles.org . Photographs by lawrence blumer, reproduced with permission . Sex - specific differences in genetic architecture could contribute to the observed differences in life span and the effects of inbreeding . For example, a recent study examined how evolution shapes variation in transcript abundance in male and female drosophila, and sex - specific differences in the mode of transcriptome inheritance were identified . In males, variation in gene expression was found to be due mostly to additive interactions of alleles, whereas in females, gene expression variation was found to be due mostly to non - additive (epistatic) interactions between alleles; a substantial x - chromosome effect was shown to underlie these differences . Similarly, in the seed beetle, loci affecting life span exhibited more non - additive interactions (dominance) in females than in males . Given that additive variation responds to selection more quickly, because additive variation does not involve interactions of multiple loci, sex - specific differences in selection could underlie aspects of sexual dimorphism in life span observed in many species . Sex - specific selective pressures that result in higher male reproductive fitness may contribute to sexual dimorphism of life span . For example, costly male - biased metabolism or behaviors, such as aggression or specific courtship behaviors, might be positively selected for, but could result in decreased life - span in males relative to females . Future studies may be directed toward further study of the underlying differences in genetic architecture between males and females, in particular, testing the idea that deleterious alleles affecting life span may be more exposed to selection in males than in females due to reduced non - additive effects in males, thereby reducing inbreeding load for male - specific deleterious alleles in the population . It will be particularly interesting to ask if the increased life span observed in highly inbred male seed beetles by bilde et al . Can be found to correlate with a reduction in specific costly aspects of metabolism, or behaviors such as locomotion and aggression . We thank sergey nuzhdin for helpful discussions . This work was supported by grants from the department of health and human services to jt (1r01ag011833) and to ma (1r01gm073039).
|
Sepsis can be difficult to distinguish from non - infectious conditions in critically ill or comatose patients in the early stages; and diagnosis, treatment and outcomes greatly differ between patients with and without sepsis . Positive bacteriological cultures, including blood cultures, may not be available before 24 to 48 hours; interpretation of local colonization may be ambiguous; and traditional markers of infection, such as body temperature and white blood cell (wbc) count, may not be specific . Furthermore, there are concerns about possible blood culture negative clinical sepsis, particularly in the setting of increased prophylactic and empirical antibiotic use . Conversely, differentiating true infection from contamination after growth of common skin commensals in blood cultures, poses a diagnostic problem . Since early identification of infections and sepsis is crucial for patient management, an effective marker specific for bacterial infection is very useful in the critical care settings . There are several markers of sepsis, like c - reactive protein, serum procalcitonin (pct), il-6, il-8, lactate, etc ., of pct has been proposed as an indicator of the presence of infection and as a useful marker of the severity of sepsis . The present study was an attempt to assess the usefulness of serum pct as a marker of sepsis in critically ill patients, using the semi - quantitative, rapid immunochromatographic kit, in apollo hospitals, bangalore . This study was carried out from july 2007 to june 2008 in the department of microbiology, apollo hospitals, bangalore . The study included patients from the intensive care unit (icu) with suspected sepsis . Sepsis was confirmed clinically and by positive blood culture (bact / alert system). (sepsis, severe sepsis, septic shock) or no sepsis based on the accp (american college of chest physicians) recommendations . Serum pct was assayed semi - quantitatively by rapid immunochromatographic technique using a commercially available test kit (pct - q, b.r.a.h.m.s . The result was independently read by two microbiologists to minimize reading bias and interpreted as per the manufacturer's recommendations: i)pct> 10 ng / ml: severe bacterial sepsis or septic shockii)pct 2 to 10 ng / ml: severe systemic inflammatory response, most likely due to sepsis unless other causes are knowniii)pct 0.5 to 2 ng / ml: a systemic infection cannot be excludediv)pct <0.5 ng / ml: local bacterial infection possible; sepsis unlikely pct> 10 ng / ml: severe bacterial sepsis or septic shock pct 2 to 10 ng / ml: severe systemic inflammatory response, most likely due to sepsis unless other causes are known pct 0.5 to 2 ng / ml: a systemic infection cannot be excluded pct <0.5 ng / ml: local bacterial infection possible; sepsis unlikely the clinical condition, signs and symptoms of sepsis, antibiotics used, blood culture and final outcome of patients were recorded for all patients . Sensitivity and specificity of the pct assay were analyzed using two different cut - off values for pct (0.5 ng / ml and 2 ng / ml); sensitivity being pct positives / total no . Of sepsis cases 100 and specificity being pct positives / total no . Of cases without sepsis statistical analysis was carried out using chi - square test to evaluate the correlation between pct levels and sepsis . Sensitivity and specificity of the pct assay were analyzed using two different cut - off values for pct (0.5 ng / ml and 2 ng / ml); sensitivity being pct positives / total no . Of sepsis cases statistical analysis was carried out using chi - square test to evaluate the correlation between pct levels and sepsis . Patient ages ranged from 18 to 84 years [male - female ratio, 28:12]. Among these patients, pct above 10 ng / ml was seen in 12 patients; 2 - 10 ng / ml, in 7 patients; 0.5 - 2 ng / ml, in 3 patients; and <0.5 ng / ml, in 18 patients [table 1]. Serum procalcitonin values in the 40 patients with suspected sepsis among the 12 patients with pct> 10 ng / ml, 1 patient in shock did not have any signs of sepsis or infection and recovered with inotropic support only (no antibiotics were required; cardiogenic shock). Of the 11 patients with clinically diagnosed sepsis, 8 yielded positive blood cultures subsequently (2 patients with septic shock had staphylococcus aureus bacteremia); 1 patient had rickettsial disease with a typical clinical presentation (fever, skin rashes, altered sensorium), which was confirmed by a positive weil felix reaction which showed elevated titres and a rise in titre within a week, and responded well to doxycycline and supportive therapy; and 2 patients with negative blood cultures were on empiric antimicrobial therapy . Four patients in this group expired due to complications of sepsis (mortality, 33.3%). One of the patients with renal transplant and with features of sepsis had a serum pct> 10 ng / ml (day 1). He responded to parenteral meropenem and teicoplanin, and his subsequent serum pct levels reduced to <0.5 ng / ml on day 3 and day 5 . All 7 patients with pct of 2 - 10 ng / ml had some form of sepsis (sepsis, 4 patients; severe sepsis, 2; and septic shock, 1 patient). Four of them yielded positive blood cultures; 1 patient had parasitemia; and 2 malignancy patients with febrile neutropenia who were on empiric antimicrobial therapy had negative blood cultures . Of the 3 patients with pct of 0.5 - 2 ng / ml, 1 patient had clinical evidence of sepsis secondary to culture - proven pseudomonas bronchopneumonia, though his blood culture did not yield any organism . He responded well to a combination therapy of cefoperazone - sulbactam and amikacin and was stable at discharge . The other 2 patients had no evidence of infection (congestive cardiac failure and unstable angina), and 1 of them expired due to cardiac complications . Of the 18 patients with pct <0.5 ng / ml, only 2 patients with bronchopneumonia had evidence of sepsis . Among 3 other patients with infections, 1 patient had lobar pneumonia but without sepsis; 1, pyrexia of unknown origin (possibly a viral infection); and 1, probable viral encephalitis but no signs of sepsis . Two patients (post - myomectomy hypertrophic obstructive cardiomyopathy and acute myocardial infarction) with positive blood cultures (s. epidermidis and s. haemolyticus) were concluded to have cardiogenic shock and not septic shock, as they responded well to inotropic support . In 1 of them, antibiotics were given additionally, considering his postoperative status (single - vessel stenting done 3 days prior to pct testing). In this cohort, in a patient with a differential diagnosis of food botulism, a low pct assisted in excluding an infective aetiology, and the patient was subsequently diagnosed as having acute oculobulbar syndrome . In 8 out of the 9 fatal cases, serum pct cut - offs of 0.5 ng / ml and 2 ng / ml were analyzed separately for their sensitivity and specificity as biomarkers for sepsis among the 21 patients with sepsis and 19 patients without sepsis . There was a statistically significant correlation with the presence of sepsis determined using either pct 0.5 ng / ml or 2 ng / ml (p<0.0001 in both cases). Using 0.5 ng / ml or more as cut - off, 19 of the 21 patients with sepsis could be detected, but 3 out of the 19 patients without sepsis showed pct above 0.5 ng / ml (sensitivity, 90%, i.e., 19/19 + 2; and specificity, 84%, i.e., 16/16 + 3). Using pct cut - off of 2 ng / ml or more as a marker of sepsis, 18 of the 21 patients with sepsis could be detected by pct, and only 1 out of the 19 patients without sepsis showed pct above 2 ng / ml (sensitivity, 85.7%, i.e., 18/18 + 3; and specificity, 94.7%, i.e., 18/18 + 1) [table 2]. Relation of serum pct levels with sepsis, number of patients (blood cultures; mortality) the aim of this study was to assess the usefulness of serum pct as a marker of sepsis in critically ill patients in our hospital . Early identification of infection and sepsis in critically ill patients is a challenge for clinicians . Serum pct has been found to be a very good indicator of sepsis syndrome . To the best of our knowledge these include studies on its use in determining bacterial sepsis in children with febrile neutropenia, its use as a marker of renal parenchymal infection and its use as a marker of the severity of acute pancreatitis. [68] most studies using pct for interpretation of bacterial infection and sepsis have used the quantitative pct assay (immunoluminometric method). Several studies have achieved high sensitivity and modest specificity with a cut - off of 1 to 1.2 ng / ml . Others have used 2 ng / ml as the diagnostic threshold for infection and sepsis . Various studies have found the pct values in sepsis ranging from 0.5 to 3.5 ng / ml; in severe sepsis, 6.2 - 9.1 ng / ml; and in septic shock, 12.8 to 38.5 ng / ml . On the other hand, semi - quantitative pct assay is a rapid immunochromatographic assay and is easy to perform . The method shows good sensitivity and specificity in diagnosing bacterial sepsis at pct levels of 2 ng / ml. [1315] using pct levels above 2 ng / ml as the cut - off to indicate sepsis syndrome, the present study showed sensitivity of 86% and specificity of 95% . Using a cut - off of above 0.5 ng / ml revealed higher sensitivity but with a reduction in the specificity to 84% . Hence serum pct of 2 ng / ml or more using the rapid immunochromatographic method is an effective marker of sepsis and may help in aggressive management of such patients along the lines of sepsis . Despite improved methods, blood cultures are not always positive in clinically confirmed sepsis . Presumed bacterial cause of fever cannot be detected in 60% to 80% of patients with suspected primary and secondary bloodstream infections . In this study, excluding the 2 cases of malaria and rickettsial fever, the sensitivity of blood culture was 63% (12 of 19); and in all these patients, serum pct was above 2 ng / ml . Differentiating true infection from contamination or probable skin commensals in blood cultures poses a diagnostic problem . The 2 blood cultures yielding coagulase - negative staphylococci were probable skin commensals, as both patients did not have any infective foci and both responded well with inotropes alone . In both these patients, the serum pct was less than 2 ng / ml . Falsely high pct is known to occur in cardiogenic shock, major surgery, accidental trauma, pancreatitis and burn patients . Of patients with cardiogenic shock, 1 patient had pct above 10 ng / ml, 2 had pct less than 0.5 ng / ml and 1 patient with coexisting sepsis had pct of 2 - 10 ng / ml . Pct levels are significantly higher in patients with septic shock than in those with cardiogenic shock, and hence a cut - off of above 10 ng / ml is recommended to discriminate between septic and cardiogenic shocks . Serum pct increases early after trauma and peaks within 48 to 72 hours post - trauma and declines thereafter in the absence of infection or sepsis . In the present study, out of 13 patients with major surgery or trauma, 4 patients had surgery or trauma with in 72 hours of suspected sepsis and pct testing; 3 of them with pct levels below 0.5 ng / ml did not have sepsis, and 1 patient had septic shock (pct> 10 ng / ml). In contrast, initial falsely low pct levels, typically seen during the early course or localized state of infection, often show a gradual increase during follow - up measurements after 6 - 24 hours . Reduction in concentration of pct has been described in response to antibiotic administration and may be used to detect antibiotic responsiveness . In the present study, serial serum pct levels were not estimated for most patients . However, one of the patients (post - renal transplant status) from this cohort for whom 3 serum pct levels were performed showed a marked decrease in the pct levels in response to the antibiotics administered . This is in concordance with the several clinical - management protocols, like the pct - guided antimicrobial stewardship, that have been used to either withhold or continue antibiotics based on the pct levels . A limitation of the present study is that serial measurements of pct were not done for most patients . More indian studies evaluating pct on a larger number of patients with suspected sepsis are needed to conclusively corroborate the findings of this study, and such studies will be useful in an age of overuse of antibiotics and emerging antibiotic resistance . Another limitation of the study was that c - reactive protein (crp) levels were not estimated for most patients . However, most studies have found superiority of pct in comparison to crp as a marker of infection and sepsis . The pct assay was found to be a promising biomarker of sepsis in this small exploratory study and provided valuable and early information before the culture results were available . The semi - quantitative, rapid assay revealed moderate sensitivity (86%) and high specificity (95%) at a cut - off above 2 ng / ml . Pct assay might assist in avoiding unwarranted antibiotic usage in critically ill patients who present with symptoms similar to those in infective conditions . However, the assay result must be interpreted in association with the clinical findings and other laboratory parameters.
|
We used monthly reports of slide - confirmed malaria and annual census based population data from 434 counties (municpios) in the brazilian amazon region for 19961999, during which no coordinated national malaria interventions occurred (12). To study the relationship of reported malaria cases to climate, we used monthly precipitation and temperature from the cru ts 2.1 gridded climate data set for selected states (13) (figure 1). To consider how the precipitation malaria relationship depends on surface water conditions, including the extent of open water and wetlands, we used 100 m 100 m maps from the jers-1 synthetic aperture radar satellite and calculated the percentage of maximum inundatable open water and wetland coverage for each county (figure 2, panel a) (14). In this region, monthly temperatures were between 24.6c and 29.4c (well within the range for optimal malaria transmission) for 95% of the observations (18,416 of 19,364) included in the analysis (temperature relationships not shown). Malaria incidence per 1,000 population (black lines) and mean monthly precipitation (blue lines) during la nia (orange bars) and el nio (red bars) events for the states of a) amazonas, b) mato grosso, and c) roraima . A) percentage of wetlands in amazon basin counties (shades of blue), counties without wetlands data (yellow), and counties with <80 total malaria cases (gray). Wetland colors correspond to percentage wetland values in panel d. b) risk ratios for malaria incidence for 1 sd (14 cm) change in monthly precipitation (january 1996december 1999), plotted at each county seat of government; c) spatially smoothed risk ratios for 14-cm changes in monthly precipitation . In both panels, red shaded squares show reduced risk for 14-cm increase in monthly precipitation; blue shaded squares show increased risk for malaria with increased precipitation . D) boxplot of risk ratios for malaria incidence for 14-cm changes in monthly precipitation, by percentage wetland cover . If the lag and the rainfall coefficient vary across regions, meaningful geographic comparisons would be difficult to achieve because neither the lag nor coefficient have consistent meanings across models . To interpret results, either the coefficient must be fixed and the lags varied (difficult to do) or the lags must be fixed and the coefficients varied (relatively easy to do). The aim is to describe the variable patterns of malaria incidence and precipitation, not create a highly predictive model . We chose to fix the lag and vary the coefficients . To assess the association between malaria incidence and precipitation data, we estimated the rate ratio of malaria incidence associated with 1 sd - increase in monthly precipitation (14 cm) for each county by using the following poisson regression model, which includes a flexible temporal trend represented as a natural cubic spline with 6 degrees of freedom (figure 2, panel b): malariait poisson(it) log it = log popit + i + iprecipit + fi(t) i normal(g(lati, loni),) the (estimated) regression coefficients from the county - specific models were then modeled as a spatially smooth surface, a thin - plate spline . Degrees of freedom for the thin - plate spline were selected using generalized cross - validation (figure 2, panel c). The relationships between precipitation and malaria incidence in the amazon basin are spatially varied and change signs, depending on the region . Positive correlations between monthly precipitation and malaria incidence (rate ratios> 1) occur in the upland regions of the southwest and central amazon basin, whereas negative correlations between precipitation and incidence (rate ratios <1) occur in the north, largely along the main waterways of the amazon river and the major wetland regions of the basin (figure 2). For a 14-cm increase in monthly rainfall, the malaria rate can double in the upland area, yet decrease by up to 80% along the main amazon channel . The p values of the precipitation coefficient are 0.00020.0009 along the main waterways and 0.0040.10 in uplands areas . We hypothesize that this reversal of the malaria precipitation relationship from positive to negative is related to the extent of open water and wetlands in the basin . Mosquito habitats in wetlands or along large rivers may wash out or become too deep during months with high precipitation, but in areas with fewer wetlands, mosquito habitats are limited by precipitation . To test this hypothesis, we compared the malaria precipitation association for 338 counties that reported> 80 cases of malaria over the 48 months against the estimated percentage of open water and wetland cover for each county (figure 2, panel d). As expected, the precipitation - linked risk for malaria fell as the percentage of wetland in each county increased, but the risk for malaria varied in counties with low percentages of wetlands . The central - east region had the lowest level of malaria incidence, which may explain why this region also lacked a malaria - precipitation relationship . Studies have proposed that flooding created new pools of water suitable for mosquito larvae as the water levels slowly receded from alluvial forests along the rio branco river in roraima and the maroni river on the frontiers of suriname and french guiana (6,15). Our results suggest that monthly precipitation along the amazon basin can have both strong positive and negative associations with malaria incidence . Further research is needed to address the limitations of our study, including its short time frame and the crude countywide approximation of percentage wetlands as an exposure . The quality and reliability of the health data were concerns, but we verified that the distribution of null reporting was unbiased temporally and spatially . Also, our study did not quantify increasing malaria incidence in response to increasing or decreasing precipitation or the impact of lag factors . Instead, we focused on the seasonality of these patterns until longer data series of malaria incidence and climate data are available . Our evidence suggests that precipitation drives malaria risk in the amazon basin, but the relationship varies in the uplands (more precipitation, more / less malaria) and is negative in areas dominated by wetlands and large rivers (more precipitation, less malaria). Our findings show the need to account for local landscape characteristics, especially the extent of wetlands and open water, in regional to global projections of the effects of climate change on malaria . Better understanding the impact of climate and landscape on malaria will improve our ability to assess health risks.
|
The clavicle is a rare site for bone tumours . According to the world health organisation, the giant cell tumor is an aggressive potentially malignant lesion which means that its evolution based on histological features is unpredictable . Sites commonly affected by giant cell tumour are proximal tibia, distal femur and distal radius . The oncologic patterns of clavicle resemble that of flat bones and not other long bones . Among tumors of clavicle, a 60 year old man presented to our department with pain and swelling over lateral end of left clavicle (fig . 1, fig . The pain was insidious in onset, non radiating and had no diurnal variations and was aggravated on shoulder movements and relieved on taking medications . We got a plain radiograph which revealed which an expansile radiolucent lesion arising from lateral end of left clavicle (fig . 3). The swelling demonstrated geographic type destruction without any soft tissue component or periosteal reaction . 4). To aid in the diagnosis fine needle aspiration cytology was done which revealed a predominantly cellular lesion having sheets of plump, oval mononuclear cells with mild pleomorphism . The cells had moderate cytoplasm, oval to elongated nucleus with moderate anisokaryocytosis with irregular nuclear membrane . Amongst these cells, many multinucleated giant cells were also which were distributed evenly . The differential diagnosis which were kept in mind are aneurysmal bone cyst, non ossifying fibroma, eosinophilic granuloma and tuberculous osteomyelitis . Since the clavicle does not necessary require reconstruction and the patient was a retired school teacher, not engaged in any physical work so surgical resection of the tumor was planned . After proper investigations and pre anaesthetic clearance, a wide excision of the mass along with 3 cm of the healthy tissue was done (fig . The excised mass was sent for histopathological examination which also confirmed it to be a giant cell tumor . The range of motion of the left shoulder was normal and post operatively there was no neurovascular deficict . The patient was happy with the surgical outcome and at 1 year follow up there was no evidence of recurrence or metastasis . . Primary bone tumors of the clavicle are more likely to be malignant than benign, and amongst these tumors which occur in clavicle, giant cell tumor is a rare entity . The differential diagnosis of giant cell tumor of clavicle which pose a diagnostic challenge both for the surgeon and the histopathologist are primary aneurysmal bone cyst, non ossifying fibroma.eosiniphilic granuloma and tuberculous osteomyelitis . Giant cell tumor is basically a cellular lesion made up of sheets of plump mononuclear cells with mild pleomorphism . The cells have moderate amount of cytoplasm, oval to elongated nuceuswith moderate anisokaryosis with irregular nuclear membrane and 01 nucleolus . Amongst these cells are multinucleated giant cells distributed in a regular fashion.no collagen formation, no new bone formation or no necrosis is usually seen . Giant cells in abc are smaller as compared to giant cell tumor and their arrangement is loose with collagen formation . Histologically it has histiocytes loaded with lipid and hemosiderin and spindle cells arranged in storiform or whorled pattern and there is presence of collagen fibres . Eosinophilic granuloma has diagnostic langerhans cells and also it has large number of leucocytes, fibroblasts, plasma cells and lymphocytes . Curettage remains the main stay of treatment for giant cell tumors but for giant cell tumors occurring in expendable bones like distal ulna, iliac wing or proximal fibula, en bloc resection is performed without any reconstruction . After extensive search of literature it was found that there are very few case reports describing giant cell tumors of clavicle,, . Due to the paucity of the available literature no definite treatment guidelines are available on the management of giant cell tumor of clavicle . Some authors reported not so favourable outcomes after total claviculectomy due to pain, loss of muscle strength and dropping of shoulder . While some authors established that total or subtotal excision of clavicle was rarely associated with loss of function . Based on their reports we also performed partial claviculectomy and at one year follow up, patient was well satisfied with the clavicle is a rare site for bone tumors and shares its oncological behavior with that of flat bones rather than long bones . We have reported this case to emphasize the fact any expansile lytic lesion occurring in the lateral end of clavicle should be taken seriously and the diagnosis can be easily missed both clinically and radiographically if the clinician is not aware of the wide array of differential diagnosis which range from an infectious etiology like tuberulous osteomyelitis to a neoplastic etiology like giant cell tumour . There seems to be a difference in opinion regarding functional outcome after claviculectomy for tumour like lesions of clavicle and our case report further highlights the fact the claviculectomy without any reconstruction seems to be a good option with no disability noted in long term . Since it is a single case report involving a single subject and we are not reporting the first case of this type in the literature, hence no approval was taken from the relevant ethics committee but written informed consent was taken from the patient to publish his details and clinical photographs . Written informed consent was obtained from the patient for publication of this case report and accompanying images . A copy of the written consent is available for review by the editor - in - chief of this journal on request . Ak, kk and js contributed to the development of protocol and edited the manuscript.
|
Pathological gambling is defined in the current classification system of the world health organization (1992) (icd10) as an impulse control disorder (icd) which causes excessive, uncontrollable gambling despite financial losses and social problems, while the latest version of the diagnostic and statistical manual (dsm5) of the american psychiatric association (2013) grouped pathological gambling together with substancerelated and addictive disorders and renamed it to gambling disorder . Despite this aetiological debate, in parkinson's patients it has been observed that pathological gambling occurs more frequently (3.46.1%) than in the general population (0.252%), alongside with icds, such as binge eating, so called hypersexuality and compulsive shopping (cox et al ., 2005; avanzi et al ., 2006; grosset et al ., 2006; voon et al ., 2006; bondolfi et al ., 2008; weintraub et al ., 2010; santangelo et al ., the aetiology of the development of pathological gambling in parkinson's disease is still unclear, however, research suggests an association with dopamine replacement therapy, specifically with dopamine agonists (voon et al ., 2006; weintraub et al ., 2006; gallagher et al ., 2007). This review summarizes evidence in this field of research attempting to reveal the relationship between parkinson therapy and pathological gambling, discusses the reasons why some patients react on them differently than others, what the relevant risk factors are and considers how impulsivity may contribute to the development of gambling symptoms . (2007) found that these patients are younger, earned a higher score in tests investigating noveltyseeking and impulsive behaviour, and were more likely to have a personal or family history of alcohol abuse . Being male and smoking in the past also seem to be risk factors (gallagher et al ., 2007; valena et al ., 2013). In this respect, pathological gambling with and without parkinson's disease is rather similar: young age, male sex, impulsivity, noveltyseeking, smoking and alcoholism are also considered risk factors for pathological gambling in the general population (johansson et al ., 2009). Observing the progress of their disease, in comparison to other parkinson's patients, those who later develop pathological gambling tend to have an earlier onset of the illness and also suffer more frequently from manic or hypomanic episodes during the onperiod of dopaminergic medication (voon et al ., 2007). Even in the first case reports about parkinson's patients developing pathological gambling, a clear correlation has been observed with the initiation or dose escalation of dopaminergic medication (molina et al ., 2000; seedat et al ., 2000). In further studies comparing the effect of different parkinson's therapies, dopamine agonists emerged as the medication with the strongest association with the development of pathological gambling (voon et al ., 2006; weintraub et al ., 2006, 2010; some studies claim that pramipexole could have the largest effect (dodd et al ., 2005). Other studies systematically comparing different dopamine agonists have found no significant difference between each of them (weintraub et al ., 2006; recent research also shows a strong effect of aripiprazole, prescribed for the treatment of mood disorders and schizophrenia, with stronger gamblingrelated cognition in comparison to other dopamine agonists (grallbronnec et al ., 2016). Levodopa seems to play a less important role as only a few patients developed pathological gambling under levodopa monotherapy (dodd et al ., 2005; voon et al ., 2006; gallagher et al ., 2007), however, studies suggest that additionally prescribed levodopa raises the risk of the development of pathological gambling and icds (dodd et al ., particularly high doses and longterm use of levodopa and shortacting dopamine agonists are also associated with dopamine dysregulation syndrome and punding, that is, stereotypic behaviour (gallagher et al ., 2007). Further, subthalamic nucleus deep brain stimulation (stn dbs) has a controversial role in the development of pathological gambling in parkinson's disease . It has been observed that after the initiation of stn dbs therapy, gambling symptoms resolved (ardouin et al ., 2006; bandini et al . These results could be explained by the significant reduction in the dosage of dopamine agonist medications . However, in some individual cases, pathological gambling and/or impulsive behaviour only developed after stn dbs surgery (funkiewiez et al ., 2003; contarino et al ., 2007; smeding et al ., 2007; 2011); although in these cases the symptoms resolved spontaneously or after the change in stimulation parameters and further reduction in dopaminergic therapy . This could be associated with the stimulation of the limbic subregion of the stn which has been shown to affect neurotransmission in the limbic basal gangliathalamocortical circuitry (winter et al ., 2008). Evidence also shows that patients are more impulsive after activating stn dbs (frank et al . 2009). As impulsivity is considered as a risk factor for developing pathological gambling in parkinson patients (voon et al ., 2007), the contentious effects of stn dbs raise questions about the role of impulsivity in the development of gambling behaviour in general (table 1). Main results of studies on the association of pathological gambling with parkinson's disease therapy bis, barratt impulsivity scale; da, dopamine agonists; icd, impulse control disorder; igt, iowa gambling task; ledd, ldopa equivalent daily dose; pd, parkinson's disease; pg, pathological gambling; stn dbs, subthalamic nucleus deep brain stimulation . The fact that not all parkinson's patients develop medicationassociated impulse control disorders or pathological gambling and that most of the patients solely developed pathological gambling under dopaminergic medication suggests an underlying genetic vulnerability mechanism (voon et al ., 2006). To analyse the genetic susceptibility of parkinson's patients with pathological gambling, several genes have been examined that are relevant for the function of the mesolimbic reward system . The most obvious genes to investigate are the dopamine receptor genes, which could be affected by dopaminergic medications . Some studies suggest that a certain mutation of the drd2 gene (taq1a) is more frequent in pathological gamblers than in the general population (lobo et al ., 2010). This variation in the gene may be connected to a lower density of d2receptors in the striatum (thompson et al ., 1997) and to impulsivity (eisenberg et al ., 2007), while the literature is inconclusive regarding its potential role in alcohol addiction (heinz et al ., 1996; heinz & goldman, 2000; munaf et al ., 2007 however, no significant difference was found between the frequency of this mutation between parkinson's patients with and without pathological gambling (lee et al ., 2009). Interestingly, recent case reports suggest that not only dopamine agonists but also dopamine antagonists acting on the d2 receptors can trigger pathological gambling (grtsch et al ., 2015), which underlines the role of this receptor . On the other hand, the homozygote genotype of a single nucleotide mutation (p.s9 g) of the drd3 gene has been shown to have a higher frequency in pathological gamblers with parkinson's disease (lee et al ., 2009). This mutation is not associated with increased risk for pathological gambling in the general population (lobo et al ., 2010). However, the heterozygote genotype of this mutation has been reported to be linked to impulsivity (retz et al ., 2003; limosin et al ., this mutation was also associated with decreased response rate to pramipexole in parkinson's patients (liu et al ., 2009), which could result in higher prescribed dosage . According to our current knowledge, there has not been any study performed yet to assess the relationship between drd4 mutations and pathological gambling in parkinson's patients . However, the number of tandem repeats of a 48bp region in the drd4 gene is associated with pathological gambling, substance abuse and impulsivity, with discordant results of what number of repeats is relevant (de castro et al ., 1997; comings et al ., 1999 healthy subjects with this genotype also presented an increased gambling behaviour after receiving ldopa (eisenegger et al ., 2010). Another neurotransmitter system that has been shown to be affected in patients with pathological gambling is the serotoninergic system . (1999) have observed a significantly higher frequency of the short (s) allele of the promoter region of the serotonin transporter gene, 5httlpr, in male pathological gamblers compared to the general population . The s allele of 5httlpr has also been associated with increased risk of developing depression under stress (karg et al ., 2011), some aspects of impulsivity (sakado et al ., 2003), impulsive aggression and increased activity in the amygdala after negative affective visual stimuli (heinz et al ., 2011). An association between this mutation and pathological gambling has indeed been observed in patients with parkinson's disease (lee et al ., 2009). Another mutation that may be associated with pathological gambling in parkinson's patients is the mutation of grin2b (lee et al ., 2009). Grin2b is a gene from the 2b subunit of the nmda receptor, which is mainly expressed in the hippocampus, the striatum and also the cortex (loftis & janowsky, 2003). The variation found to be more frequent in parkinson's patients with pathological gambling is a single nucleotide polymorphism . Its specific role in the development of pathological gambling in parkinson's disease is unclear, as this variation does not cause an amino acid change (c.366c> g). Furthermore, it was also found to be associated with schizophrenia (li & he, 2007), as a different polymorphism of grin2b has been associated with obsessive compulsive disorder (arnold et al ., 2004). (2011) found a different single nucleotide polymorphism of the grin2b gene to be related with risky decisionmaking, which might be considered as impulsive behaviour and therefore explain a link to pg in parkinson's disease . These research findings suggest that an underlying genetic susceptibility might facilitate the development of pathological gambling in parkinson's patients . However, some studies are inconsistent and there are some differences between pathological gamblers with and without parkinson's disease . Altogether, these results and the observed connection to dopaminergic medication described above suggest that the vulnerability of parkinson patients towards pathological gambling may be triggered by dopamine agonists . Several studies have compared neuronal activation patterns of parkinson's patients with and without pathological gambling . Summarizing the results, differences have been found in the activity of regions associated with the mesolimbic reward system, mainly in the orbitofrontal cortex (ofc) and the ventral striatum (cilia et al ., 2008; (2008) compared the blood perfusion of different brain regions in parkinson's patients with pathological gambling with patients who only have parkinson's disease and a control group in a spect imaging study in a resting condition . They have observed a generally increased blood flow in the ofc, hippocampus, parahippocampal gyrus, amygdala, ventral striatum and cuneus on the right hemisphere and in the insulae on both sides in parkinson's patients with pathological gambling compared to both other groups . (2013) studied the function of the subthalamic nucleus by capturing local field potentials (lfp) in parkinson's patients with and without pathological gambling on medication during an economic task . The lfps were recorded with the aid of stn dbs electrodes that were implanted 4 days prior to the experiment . The economic task included nonconflict and conflict decisions with stimuli pairs with the same probability vs. stimuli pairs with different probabilities of winning money . In conflict situations, risky choices could result in a higher reward, however, the task was overall designed to reward more nonrisky choices . The results showed that during the economic decisionmaking task, lowfrequency oscillations synchronize in the subthalamic nucleus . This synchronization was stronger during highconflict situations in comparison to lowconflict situations in patients with pathological gambling . Patients without pathological gambling showed no differences in the synchronization of lowfrequency oscillations during conflict or nonconflict situations . The results of this experiment underline the role of the subthalamic nucleus in decisionmaking and might also explain why symptoms of pathological gambling resolve in some parkinson patients after stn dbs surgery . However, the results do not explain why patients usually only improve after months of stn dbs therapy . Some studies focused more on the dopaminergic system and several differences were found between pathological gamblers with parkinson's disease and parkinson's patients without gambling . The turnover of monoamines, including dopamine, in the ofc was found to be higher (joutsa et al ., 2012), further the dopamine release during gambling tasks was found to be significantly increased in pathological gamblers (steeves et al ., 2009). These results suggest that the vulnerability to gambling problems is partly mediated by increased dopaminergic neurotransmisson the ofc and the ventral striatum . Pathological gambling in these patients may be caused by dopamine agonists in the mesolimbic dopaminergic system, particularly in the ventral striatum, which is less affected by the disease than the dorsal striatum . As dopamine agonist therapy seems to have a very strong association with the development of pathological gambling (voon et al . 2010), imaging studies have been conducted to further understand the effect of this medication . Dopamine agonists have been shown to effect reward processing; patients on this medication have a diminished reaction in the ofc after negative prediction errors compared to patients on levodopa therapy or off medication (van eimeren et al ., 2009), suggesting a decreased learning effect after punishment . Parkinson's patients with and without pathological gambling or compulsive shopping were compared in a prediction learning task on or off dopamine agonists . Patients with pathological gambling were faster and better at learning and had a higher activity in the ventral striatum and the ofc during rewardrelated learning while on medication . On the contrary, while learning through loss, the activity of these areas was lower in this group of patients than in the group with parkinson's disease only under the same circumstances . (2012) suggest that these patients have an impaired activation of d2 and d3autoreceptors caused by tonic stimulation through dopamine agonists . Through the absence of negative feedback, these findings could be used to propose that dopamine agonists cause a higher vulnerability to pathological gambling due to impaired learning processes . As a consequence of the impaired negative feedback, the dopamine concentration would not decrease to the previous level after a rewardrelated dopamine release . The high level of dopamine could also blunt the drop of dopamine concentration after punishment . Imaging studies with nonparkinson patients with pathological gambling also showed differences in the activation of the mesolimbic rewards system, however, the results are not consistent . Some studies showed a reduced activation of the prefrontal cortex and ventral striatum during loss and gain anticipation as well (balodis et al . 2012), others showed higher activity in the striatum during gain anticipation (romanczukseiferth et al ., 2015). The activity of the prefrontal cortex and the ventral striatum also seems to be diminished after successful loss avoidance compared to healthy control subjects (romanczukseiferth et al . Neuronal activity during loss and gain anticipation and loss avoidance have not been researched yet in parkinson's patients with pathological gambling . As described above, impulsive behaviour is considered to be a general risk factor for developing pathological gambling in patients with parkinson's disease (voon et al ., 2007; johansson et al ., 2009). However, there are studies that indicate a more specific connection: frank et al . (2007) compared two groups of patients with parkinson's disease with a control group, assessing their learning ability in a probabilistic prediction task and their performance in a conflictbased decision task . One of the groups of parkinson's patients was treated with dopaminergic medication, the other group with stn dbs and lowdose dopaminergic therapy . The first group's performance was compared on and off medication, the second group's performance on and off stn dbs without changing the dosage of their medication . The results in the prediction task in the group taking dopaminergic medication only were similar to the findings of voon et al . (2010) described above, that is, the learning ability of patients from negative outcome was impaired on medication . The activation of deep brain stimulation showed no effect on the learning ability of the patients, neither after reward nor after punishment . On the other hand, in the conflictbased decision task, patients with activated stn dbs responded faster in high rather than in lowconflict conditions, while off deep brain stimulation, their response was slower during highconflict situations . Dopaminergic medication did not affect the difference in decisionmaking speed in high vs. lowconflict conditions . This result is supported by other experiments assessing patients with stn dbs clinically with the barratt impulsiveness scale (hlbig et al ., 2009) and the simon task (wylie et al ., 2010). If high impulsivity can promote pathological gambling, as suggested by the results of frank et al . (2007), there should be a higher risk for parkinson's patients treated with stn dbs . However, there are only individual cases of patients developing pathological gambling after initiation of deep brain stimulation (smeding et al ., 2007), with no clear way of interpretation, because dopaminergic medication had also been changed postoperatively . (2009) found a higher frequency of impulse control disorders (icds) in parkinson's patients treated with stn dbs . However, the difference in prevalence of icds to the patient group only receiving drug therapy was not significant and it was not described when these patients developed icds and how long they had already received dbs therapy . This information is relevant, as the recovery from icds after the initiation of dbs therapy can take up to 4 years and in some cases the symptoms initially worsen after the therapy (ardouin et al ., 2006). The effects on impulsive and compulsive behaviour of stn dbs can also depend on the localization of the electrodes . The stimulation of the limbic subregion of the stn or the stimulation of adjacent structures can change the neurotransmission in limbic brain regions (winter et al ., 2008). These findings question the causal relationship between high impulsivity and pathological gambling in parkinson's patients . Altogether, more research is needed for clarification of the effects of stn dbs . On the other hand, the results of those studies comparing the effect of stn dbs and dopamine agonist medication support the theory that parkinson's patients with pathological gambling show impaired learning mechanisms modulated by dopamine agonists . Therefore, alterations of reward and punishment processing seem to play a prominent role in the development of pathological gambling in parkinson's patients . Several genetic and neurofunctional findings suggest that individual differences in dopaminergic neurotransmission in the ventral striatum and associated brain areas contribute to pathological gambling in parkinson's disease, and indicate complex interactions between such risk factors . Taken together, altered learning processes in parkinson's patients with pathological gambling appear to include increased baseline blood perfusion of mesolimbic brain areas, increased activation by reward and reduced activation by punishment in those brain areas, which are implicated in reinforcement learning (schultz, 2002), impulsivity (horn et al ., 2003), addiction (kalivas & volkow, 2005) and pathological gambling (romanczukseiferth et al ., 2015). However, most of the studies performed in parkinson's patients with pathological gambling are retrospective or crosssectional research, which makes the analysis of potentially causal factors more difficult . For example, in crosssectional studies, impulsivity seems to be an important risk factor (voon et al ., 2007); however, these findings are not fully consistent with the results of experimental studies on the effects of dbs of the stn . Prospective or longitudinal studies could broaden the perspective on the role of potential risk factors, that is, impulsivity or impaired learning . Despite the obstacles in conducting such studies, the results of this research can play a crucial role in understanding the development of pathological gambling and icds not only in parkinson's patients but also in the general population.
|
Suicide is one of the leading causes of death throughout the world; it ranks among the top 10 causes of death for individuals of all ages and is the leading cause of death in males under 35 years old.1,2 a decrease in the concentrations of serotonin metabolites (in particular the serotonin 5-hydroxyindoleacetic) in patients with suicide behavior (suicide attempt and suicide) suggests that the serotonergic system is associated with suicide behavior.3,4 studies have consistently proposed that genes of the serotonergic system could play an important role in suicide.5,6 for example, in sh - sy5y cells, the administration of human interferon - alpha modifies the htr2c mrna editing, and this could be a mechanism of drug - induced depression or suicidal side effects in humans.7,8 it has also been proposed that the serotonin receptor 2c (htr2c) gene9,10 contributes to suicide behavior.11 the htr2c belongs to the family of 5-ht2 receptors, which has three members: 5-ht2a, 5-ht2b, and 5-ht2c.1 the gene that encodes the htr2c is located on the long arm of the x chromosome at position 24; and it contains six exons and five introns, spanning at least 230 kb.12 one of the most common variants of the htr2c is the cys23ser (rs6318), which is a functional polymorphism (c / g at position 68) that results in the substitution of cysteine for serine at position 23 of the n - terminal extracellular domain.2,13,14 in the last few years, several authors have reported an association between the htr2c polymorphism and suicidal behavior.15 furthermore, in analyses performed by gender, a negative association has been observed between the htr2c polymorphism and suicidal behavior.14,16 other polymorphisms of htr2c that also have been studied in suicide behavior are rs547536, rs2192372, rs2428707, and rs4272555;14 however, no association has been established in several populations . Therefore, the association between the htr2c gene remains controversial, given that the available case control studies have obtained both positive and negative findings.1315,1620 in addition, to date, the relationship between the htr2c gene and suicide behavior in the mexican population has not yet been studied . As the htr2c gene is located on chromosome x, the objective of this work was to analyze the association by gender between five genetic variants of htr2c gene, rs547536, rs2192372, rs6318, rs2428707, and rs4272555, and suicide attempt in a mexican population . A total of 187 unrelated patients, of whom 110 (58.8%) were females and 77 (41.2%) were males who had attempted suicide, were included in this study . We defined suicide attempt as a self - harm behavior with at least some intent to end one s life . The subjects were recruited from the outpatient service of the general hospital of comalcalco in the state of tabasco, mexico . We also included 223 healthy subjects as controls (146 females [65.5%], 77 males [34.5%]) who were recruited from the blood donor center at the same hospital . We want to emphasize that all the individuals in this study were exclusively from comalcalco and had parents and grandparents of mexican origin so as to reduce ethnic variation and stratification effects . We considered as exclusion criteria patients who had an organic disorder or self - injury behavior, patients who had concomitant diagnoses of mental retardation or drug dependence, and patients with somatic or neurological illnesses that impaired psychiatric evaluation . All the individuals (suicide patients and healthy subjects) were evaluated by trained psychiatrists or clinical psychologists with a master s degree as the minimum education level . For all of them, the lifetime diagnoses were determined using the diagnostic and statistical manual of mental disorders fourth edition (dsm - iv) criteria following appropriate interviews (structured clinical interview for dsm - iv [scid] i and ii).21 the suicide patients were classified in one of the following psychiatric diagnoses: schizophrenia spectrum disorders n=32 (17.1%), mood disorders n=59 (31.5%), stress - related disorders n=73 (39.0%), and substance - related disorders 23 (12.4%). Written informed consent was obtained from all subjects after the procedures had been fully explained to them . The study was approved by the local ethics and research committee of divisin acadmica multidisciplinaria de comalcalco (damc)-universidad jurez autnoma de tabasco (ujat) (ujat - damc-2012 - 02). The study was performed in compliance with the ethical standards of the 1964 declaration of helsinki . Genomic dna was isolated from whole blood samples using standard procedures that have been previously reported.9,22 genotyping of the htr2c variants rs547536, rs2192372, rs4272555, rs6318, and rs2428707 was performed using the taqman (applied biosystems inc, foster city, ca, usa) snp genotyping assay obtained from applied biosystems . We selected five single - nucleotide polymorphisms (snps) of the htr2c gene found in the promotor and introns of the gene (table 1). First, the hardy weinberg equilibrium for the htr2c variants was determined using pearson s goodness of fit test . For female controls, the genotype frequencies of rs6318, rs2428707, and rs4272555 did not deviate from hardy weinberg equilibrium (p>0.05); however, the genotype frequencies of rs547536 and rs2192372 did deviate from hardy weinberg equilibrium (p<0.05). Random blind duplicates of up 30% of the samples were used as a quality control measure, and we obtained consistent results . Then, and fisher s exact tests were used to compare the genotype and allele frequencies between cases and controls . Finally, the haploview 4.2 (broad institute, cambridge, ma, usa)23 was employed to calculate the linkage disequilibrium (ld) of the markers . All the individuals (suicide patients and healthy subjects) were evaluated by trained psychiatrists or clinical psychologists with a master s degree as the minimum education level . For all of them, the lifetime diagnoses were determined using the diagnostic and statistical manual of mental disorders fourth edition (dsm - iv) criteria following appropriate interviews (structured clinical interview for dsm - iv [scid] i and ii).21 the suicide patients were classified in one of the following psychiatric diagnoses: schizophrenia spectrum disorders n=32 (17.1%), mood disorders n=59 (31.5%), stress - related disorders n=73 (39.0%), and substance - related disorders 23 (12.4%). Written informed consent was obtained from all subjects after the procedures had been fully explained to them . The study was approved by the local ethics and research committee of divisin acadmica multidisciplinaria de comalcalco (damc)-universidad jurez autnoma de tabasco (ujat) (ujat - damc-2012 - 02). The study was performed in compliance with the ethical standards of the 1964 declaration of helsinki . Genomic dna was isolated from whole blood samples using standard procedures that have been previously reported.9,22 genotyping of the htr2c variants rs547536, rs2192372, rs4272555, rs6318, and rs2428707 was performed using the taqman (applied biosystems inc, foster city, ca, usa) snp genotyping assay obtained from applied biosystems . We selected five single - nucleotide polymorphisms (snps) of the htr2c gene found in the promotor and introns of the gene (table 1). First, the hardy weinberg equilibrium for the htr2c variants was determined using pearson s goodness of fit test . For female controls, the genotype frequencies of rs6318, rs2428707, and rs4272555 did not deviate from hardy weinberg equilibrium (p>0.05); however, the genotype frequencies of rs547536 and rs2192372 did deviate from hardy weinberg equilibrium (p<0.05). Random blind duplicates of up 30% of the samples were used as a quality control measure, and we obtained consistent results . Then, and fisher s exact tests were used to compare the genotype and allele frequencies between cases and controls . Finally, the haploview 4.2 (broad institute, cambridge, ma, usa)23 was employed to calculate the linkage disequilibrium (ld) of the markers . The demographic characteristics of the cases (mean age: 25.96 years, standard deviation [sd]: 9.26 range: 1456 years) and comparison group (mean age: 31.95 years, sd: 13.03 range: 1461 years) in this mexican population are presented in table 2 . Table 3 shows the genotype and allele frequencies of the htr2c variants rs547536, rs21923372, rs6318, rs2428707, and rs4272555 in the suicide attempters and control groups . The htr2c variants rs4272555 and rs2428707 were significantly associated with suicide attempt in this mexican population . In the female group, the g allele of the snp rs2428707 was associated with an increased risk of suicide attempt (p=0.01, odd ratio [or] = 3.68, 95% confidence inrterval [ci]: 1.2410.90), while the c allele of the snp rs4272555 was associated with a decreased risk of suicide attempt (p=0.01, or = 0.26, 95% ci: 0.090.79). The distributions of the htr2c variants rs547536, rs21923372, and rs6318 were not significantly different between the subjects with suicidal behavior and the control group (table 3). Subsequently, for the snps that showed a significant association, we summarized the evidence and performed a meta - analysis . The results of the meta - analysis (supplementary materials) showed a nonsignificant association for the rs2428707 (fixed effects: or: 1.21, 95% ci: 0.801.82, p(q)=0.03) and for the rs4272555 (fixed effects: or: 0.56, 95% ci: 0.161.94, p(q)=0.03) (figures s1s4 and tables s1 and s2). The ld (linkage disequilibrium) in this mexican population was measured for all markers examined in this case control study (rs547536, rs2192372, rs6318, rs4272555, and rs2428707). We conducted a haplotype analysis of the same five markers and did not find a significant association between suicide attempt and any of the examined haplotypes (p>0.01, table 4). The demographic characteristics of the cases (mean age: 25.96 years, standard deviation [sd]: 9.26 range: 1456 years) and comparison group (mean age: 31.95 years, sd: 13.03 range: 1461 years) in this mexican population are presented in table 2 . Table 3 shows the genotype and allele frequencies of the htr2c variants rs547536, rs21923372, rs6318, rs2428707, and rs4272555 in the suicide attempters and control groups . The htr2c variants rs4272555 and rs2428707 were significantly associated with suicide attempt in this mexican population . In the female group, the g allele of the snp rs2428707 was associated with an increased risk of suicide attempt (p=0.01, odd ratio [or] = 3.68, 95% confidence inrterval [ci]: 1.2410.90), while the c allele of the snp rs4272555 was associated with a decreased risk of suicide attempt (p=0.01, or = 0.26, 95% ci: 0.090.79). The distributions of the htr2c variants rs547536, rs21923372, and rs6318 were not significantly different between the subjects with suicidal behavior and the control group (table 3). Subsequently, for the snps that showed a significant association, we summarized the evidence and performed a meta - analysis . The results of the meta - analysis (supplementary materials) showed a nonsignificant association for the rs2428707 (fixed effects: or: 1.21, 95% ci: 0.801.82, p(q)=0.03) and for the rs4272555 (fixed effects: or: 0.56, 95% ci: 0.161.94, p(q)=0.03) (figures s1s4 and tables s1 and s2). The ld (linkage disequilibrium) in this mexican population was measured for all markers examined in this case control study (rs547536, rs2192372, rs6318, rs4272555, and rs2428707). We conducted a haplotype analysis of the same five markers and did not find a significant association between suicide attempt and any of the examined haplotypes (p>0.01, table 4). The aim of the present study was to assess the association between the htr2c variants rs547536, rs2192372, rs6318, rs2428707, and rs4272555 and suicide attempt in a mexican population . To our knowledge, this is the first association analysis between htr2c polymorphisms and suicidal behavior performed in a latin american population . We found that the g allele of rs2428707 was associated with an increased risk of suicidal behavior in females; however, this is not similar to the results of previous studies.14,20 this discrepancy could be due to differences of the sample sizes used . The number of control subjects used in those previous studies and our study were similar; however, the number of cases in our study were fewer than what the german and italian populations used in previous studies.14,20 another possible explanation for this discrepancy is the heterogeneity between the studies . In our study, the absence of the a allele of rs2428707 and the t allele of rs4272555 in the female group, could be ethnic - dependent because the allelic and genotypic distributions we observed were different from those reported in the literature.14,20 third, the positive results of this study are modest because we did not exclude the presence of false positives, even when the results were corrected by bonferroni s . For major evidence, we performed a meta - analysis that included studies that have been reported up to date and observed a no - association . However, we considered that the low number of studies, the low number of samples, and the presence of heterogeneity in the analysis reduced the statistical power to detect a possible association between the htr2c polymorphisms and suicidal behavior . In consequence, more studies that analyze this association are needed . Our analysis also showed an opposite effect for the rs4272555 and suicide; we observed that in females, the c allele of the rs4272555 is a protective allele against suicidal behavior . It is fundamental to consider these findings with caution for the following reasons: first, the ld analysis indicated stronger linkage disequilibrium for rs2428707 and rs4272555 than for the other htr2c variants . Second, the small sample size of our study may have resulted in a weaker statistical association than other studies with a larger study population . Therefore, it is necessary to analyze other populations and increase the sample size, without the presence of the heterogeneity, in order to have conclusive results . The htr2c cys23ser (rs6318) polymorphism is perhaps the most extensively studied for a possible association with suicidal behavior11,13,14,1720 and self - injury.24 the present study did not find an association between the htr2c cys23ser (rs6318) and suicidal behavior . However, this finding is in accordance with previous studies14,20 performed in caucasian and chinese populations.18,19 in contrast, in a recent study by karanovic et al,11 an association between the c allele of htr2c rs6318 and suicide attempt was observed . Karanovi et al11 included 165 suicide attempters and 188 controls, which is similar to what we used in the present study; however, their controls were subjects with psychiatric diseases other than suicidal behavior and our controls were subjects without any psychiatric disorders . Hence, these findings need to be replicated before any strong conclusions can be drawn . Second, although we perform a bonferroni correction and performed a meta - analysis, the small sample size and the small number of the studies (respectively) do not ensure the absence of false positives . Finally, we did not analyze the clinical features of suicide attempters that may predispose them to this behavior . Our results suggest an association between the rs2428707 and rs4272555 polymorphisms of htr2c in mexican females with suicidal ideation . Future research must examine the potential mediating effects of the htr2c gene variants to highlight the importance of the serotonin system in suicidal behavior, with special focus on the receptor gene htr2c . Or and forest plot for the meta - analysis of rs2428707 . Note: g allele vs a allele with heterogeneity . Note: g allele vs a allele with heterogeneity . Or and forest plot for the meta - analysis of rs4272555 . Funnel plot indicating publication bias for studies included in the meta - analysis of rs4272555 . Descriptive characteristics of two studies analyzing the role of the htr2c gene variant rs2428707 in suicide attempt descriptive characteristics of two studies in the meta - analysis of the htr2c gene variant rs4272555 in suicide attempt
|
In the right amounts, boron is an essential nutrient for animals, plants, and fungi [13]. However, at high concentrations boric acid (ba) becomes an effective poison that is widely used for the killing of diverse organisms ranging from bacteria to rodents . In medicine while the molecular details of ba action on yeast remain unclear, it was recently shown that ba interferes with morphogenesis, to the effect that it inhibits the transition from the yeast to the hyphal form of the pathogenic yeast c. albicans . Because the ability to switch to hyphal growth is an important virulence factor in c. albicans, suppression of such elongated growth by ba may in part explain its therapeutic effect . The present study was undertaken to assess the effect of ba on morphogenesis and cell wall synthesis in yeast, using the well - established model organism saccharomyces cerevisiae as a study subject . In s. cerevisiae, morphogenesis and cell wall synthesis depend on the correct assembly of cytoskeletal proteins . To guide cell wall synthesis during cytokinesis, a ring of septin filaments forms during the g1 phase of the cell cycle and is subsequently completed into a contractile actomyosin ring (car) by the addition of myosin and actin, among other proteins [8, 9]. To complete abscission, the last phase of cytokinesis, the cells first separate mother and daughter cells with a chitin primary septum . The deposition of glucan and mannoprotein - rich cell wall material on the mother and daughter side of the primary septum later completes the trilaminar septum that can be observed under normal culture conditions . A disturbance in the assembly of the septation apparatus the cohesive functional unit that constructs the primary septum leads to the formation of highly aberrant septa [10, 11]. The septa formed under these conditions do not allow for the separation of cells after cytokinesis, leading to the formation of chains and clumps of misshaped cells . Based on the observation that ba causes such clumping and chain formation in s. cerevisiae, the present study was initiated to assess the influence of ba on the function of the septation apparatus . Strain yms415 (chs3::ha - his3) was constructed by the short flanking homology method . The chs3::3ha - his3 fragment was amplified by pcr from plasmid pfa6a-3ha - his3mx6 with primers 5-tattctcaatcggaaggaggaaagtgactccttcgttgcaggtggaggtggaggtggaggtggacggatccccgggttaattaa-3 and 5-tcaacttgtaagtatcacagtaaaaatattttcatactgtgaattcgagctcgtttaaac-3. Integration of the fragment was verified by pcr and western blotting . Transformants showed a wild - type like distribution of chitin in calcofluor white stained preparations, demonstrating full functionality of the chs3p - ha fusion protein . A visual representation of ba sensitivity was obtained by serially diluting an overnight culture of yeast grown in ypd and spotting 5 l of cell dilutions on ypd plates with the indicated concentrations of ba . Viability staining of yeast cultures was performed by incubating cells in 0.2 mg / ml methylene blue in 50 mm kh2po4 for 5 minutes at rt . In order to visualize the distribution of chitin and glucan in the cell wall, cells were washed and incubated for 5 minutes in 0.01% calcofluor white or 0.5% aniline blue, respectively . Fluorescence was observed with a standard diamidino-2-phenylindol (dapi) filter set (zeiss). Fifty ml yeast cultures at a titer of 1510 cells / ml in ypd were fixed by the addition of formaldehyde to a final concentration of 4% and incubated for 10 minutes at room temperature . Cells were pelleted and incubated for 1 hour in phosphate buffered saline (pbs; 137 mm nacl, 2.7 mm kcl, 10 mm na2hpo4, 1.76 mm kh2po4, ph 7.4) with 4% formaldehyde . After 2 washes in pbs, cells were suspended in 100 l pbs with 10 l of an alexa 568-phalloidin solution (6.6 m in methanol; invitrogen) and 1 l of 1 mg / ml calcofluor white . Cells were incubated for 1 hour in the dark and washed twice with pbs . Cells were then pelleted and taken up in 50 l prolong antifade reagent (invitrogen) before mounting on slides . Gfp - tagged cdc3p and myo1p were observed with the gfp - filter set (zeiss) in cells transformed with prs316cdc3gfp and pms55 . Analysis of slt2p phosphorylation and total slt2p by western blotting followed established protocols [19, 20]. As a loading control, an antibody directed against tub4p (goat -tubulin yk18, santa cruz biotechnology) was used at 1/1,000 dilution . For the determination of chs3p - ha, cell membranes were isolated according to orlean . One volume of mercaptoethanol - free 2x sample buffer with 2% sds (bio - rad) was added to the protein extracts and samples were loaded on 6% sds polyacrylamide gels without boiling . Antibodies used were a 1/5,000 dilution of anti - ha/1/5,000 dilution of goat antimouse hrp (santa cruz biotechnology). Membranes were stained in 0.02% coomassie blue r250 in 40% methanol, 5% acetic acid to serve as loading controls . For the determination of enzyme activities, a 40 l glucan synthase assay contained 20 l of membrane suspension at a protein concentration of 1 mg ml, 5 mm c - udp - glucose (activity 1 10 cpm mmol), 75 mm tris - cl ph 7.5, 25 mm kf, and when indicated with 20 m gtp--s for the determination of maximal gs activity . The reaction was incubated for 1 hour at 30c and then stopped by adding 1 ml 10% trichloroacetic acid (tca). Reaction mixtures were filtered through a type a / e glass fiber filter (pall). Filters were washed twice with 1 ml 10% tca and four times with 70% ethanol . Filters were dried and taken up in 10 ml cytoscint es scintillation fluid (icn), and activity was recorded in a scintillation counter . Chitin synthesis was determined as described by choi and cabib . To measure chitin synthase 2 and 3 activities, experiments were performed in the chs1 deletion strain ecy46 - 1 - 8d . The chs1 deletion was found to have no influence on ba sensitivity (figure 1(a)). The chitin synthase assay mixture contained 20 l of membrane suspension at 1 mg protein ml, 5 l of 0.5 m tris / cl ph 7.8, 5 l of 20 mm cobalt acetate, 5 l of 10 mm c - udp - glcnac (5000 c.p.m . L), and 2 l of trypsin solutions (sigma) at concentrations from 0.25 to 2.0 mg ml in a total volume of 46 l . For determination of chitin synthase 3 activity, 5 l of water were substituted with 5 l of 50 mm nickel acetate . Proteolysis was stopped after incubating for 15 minutes at 30c by adding 2 l of a soybean trypsin inhibitor solution at 1.5x the concentration of the trypsin solution . Chitin synthesis was initiated by adding 2 l of 0.8 m glcnac . After incubating for 60 minutes at 30c, chitin synthesis reaction mixtures were filtered, washed, and assayed in cytoscint fluid as described above . Assays containing cobalt only show activities of chitin synthases 2 and 3 while cobalt / nickel assays show the activity of chitin synthase 3 . Vital staining of strains yph499 and ecy46 - 1 - 8d with 0.05% methylene blue showed that ba concentrations between 0.1 and 0.4% do not severely reduce cell viability (figure 1(a)). In the examined range around the minimal inhibitory concentration of 0.31%, ba thus functions as a fungistatic agent that slows down proliferation but does not kill cells . Note that the decline in viability in chs1 deletion strain ecy46 - 1 - 8d parallels the decline in wildtype viability . Due to the previously reported lysis of daughter cells in chs1 mutants, strain ecy46 - 1 - 8d shows a higher fraction of dead cells in all of the examined samples . Clumping and chain formation of cells occurs at ba concentrations above 0.2%, with the most striking effect observed at 0.4% (figure 1(b)). This clumping is the hallmark of a cytokinesis defect that causes daughter cells to remain attached to mother cells . A spot test of by4742 cells on ypd plates showed that no growth occurs at ba concentrations above 0.5%although viable cells can be retrieved even after 10 days of incubation under these conditions (data not shown). Staining of chitin and glucan in walls of cells grown with 0.4% ba revealed a buildup of cell wall material at bud necks, particularly in cell chains (figure 2). In order to characterize the cytokinesis defect in ba - treated cells, the localization of key morphogenetic proteins at the bud neck was examined by fluorescence microscopy . It was found that ba influences the localization of the septin cdc3, the cytokinetic myosin myo1p, and the ring of filamentous actin that form sequentially in preparation for cytokinesis . Increasing concentrations of ba leads to the formation of cdc3gfp rings that are disorganized, uneven, and not centered at the bud neck . Moreover, ba causes the formation of cdc3gfp patches at sites other than the buck neck (figure 3). Imaging of myo1gfp and actin shows that the formation of the car is impaired in a manner similar to the disturbance in septin ring organization . Increasing ba concentrations lowers the fraction of cells with myo1gfp rings at the bud neck from 49 5% at 0% to 25 11% at 0.2% to 11 11% at 0.4% . In addition, myo1gfp rings formed under the influence of ba are often irregular in shape and at high concentrations (0.4%) ectopic localization of myo1gfp patches at sites other than the bud neck is common (figure 4(a)). Ba also impairs the assembly of the actin ring at the bud neck, which is the last component to be incorporated into the car before contraction starts (figure 4(b)). Actin rings formed under the influence of ba become blurry, faint, and irregular in thickness . Under these conditions, it can be observed that some actin rings fail to localize to the narrowest point of the bud neck . In some cases, ba - treated cells due to the low abundance of cells with actin rings in culture (<2% in controls), quantification of rings yielded no statistically significant data . Cultures of cells grown with 0.3% and 0.4% ba were examined by electron microscopy using a protocol that allowed for the visualization of chitin (figure 5). The analysis of ba - treated cells showed massive abnormalities in the cell wall, particularly in the area of the septum, worse at 0.4% than at 0.3% . At these concentrations, ba prevented the construction of a single, straight chitin septum to separate mother and daughter cells . Instead, the cells synthesized protuberances extending far into the cytosol and large irregular septa, often at ectopic locations at the cell periphery . In order to assess ba - induced cell wall integrity signaling, the amounts and the phosphorylation status of the signaling kinase slt2p were determined by western blotting (figure 6(a)). Phosphorylation of slt2p increases with escalating concentrations of ba, suggesting that ba induces a cell wall integrity stress response . The dramatic increase in phosphorylation of slt2p is accompanied by a weak increase in protein expression . Furthermore, it was determined that a slt2 deletion mutant is sensitive to ba (figure 6(b)), suggesting that slt2p - signaling improves ba resistance by causing a transcriptional response to ba stress . Western blotting showed a nonlinear correlation between ba concentration and abundance of chs3p - ha (figure 7(a)). While at ba concentrations of 0.1 and 0.2% the amount of chs3p - ha decreases, there is an increase of chs3p - ha at 0.4% ba . The increase of chs3p - ha parallels the increase of chitin - rich septa visible in calcofluor white - stained cultures . The multiple posttranslational and protein targeting processes involved in chs3p and chs2p activation necessitate enzymatic determination of chitin synthase activities in addition to detection of protein amounts . Figure 7(b) shows that ba - induced changes in chitin synthase activities mirror the changes in chs3p - ha amount (figure 7(a)) and bud neck thickness (figure 2). While at 0.1% and 0.2% ba decreases chitin synthase activities, presence of 0.3% and 0.4% ba increases chitin synthesis . At 0.4% ba, a measurement of glucan synthase activity in the membranes of strain yph499 showed a constant decline with increasing ba concentrations (figure 7(b)). Neither maximal nor physiological (without addition of gtp-s) glucan synthase activity showed an increase at high concentrations of ba . Living organisms are constantly exposed to boron, a mineral that is abundant in soil and water . Boron is a weak acid and, at physiological ph, is present mostly as boric acid (h3bo3; ba). For each organism, there is an optimal ba concentration . Too little ba causes symptoms of deficiency while too much ba has a poorly defined cytotoxic effect . Particularly the toxic effects of boron overload have led to a variety of applications for ba and related compounds, ranging from pest control to the treatment of vaginal yeast infections . . The biological function of ba might be due to its reactivity with cis - hydroxyl groups on carbohydrate molecules . Examples for boron - dependent reactions include plant hormone - sensitive nadh oxidase activity, the crosslinking of plant cell wall carbohydrates, and the mineralization of bone . The molecular effects of boron lead to developmental defects in animals, particularly in the formation of the skeleton [30, 31]. These teratogenic effects of boron might be caused by direct or indirect inhibition of histone deacetylase activity and a shift in hox gene expression . However, none of the above observations about ba toxicity serve to explain its effect on yeast an organism that does not undergo genomic imprinting or hox - dependent development . The only published data about the ba effect on yeast come from a recent study of the yeast c. albicans that suggested that ba impairs oxidative metabolism . While this observation in itself is interesting and deserves further study, the authors also show that ba directly or indirectly influences the morphology of c. albicans . The present study expands on this observation by showing that ba disturbs morphogenesis in the model yeast saccharomyces cerevisiae, particularly during cytokinesis . The data presented here show that ba impairs the formation of the primary septum in s. cerevisiae a defect that can be explained by incorrect assembly of the cytoskeleton at the bud neck . The molecular machinery that constructs the chitin cell wall between mother and daughter cells, the septation apparatus, consists of chitin synthase 2, and a contractile actomyosin ring (car). The septation apparatus is assembled sequentially from myosin, chitin synthase 2 and actin on a scaffold of septins at the bud neck [8, 9]. Should the assembly of a functional septation apparatus fail, the cell is unable to construct an orderly primary septum by chitin synthase 2 and is forced to divide by depositing large amounts of chitin - rich cell wall material at the bud neck . The chitin in these so - called default septa is provided by chitin synthase 3 [10, 33, 34]. Since these irregular septum structures are resistant to degradation by chitinase, cells remain connected after cytokinesis and form cell chains and clumps . In s. cerevisiae . A septin assembly that erroneously localizes to a site other than the bud neck will direct the formation of a septum - like structure at the respective location . Our data show that in s. cerevisiae increasing concentrations of ba leads to an irregular assembly of the septin scaffold, an inability to position the myo1 ring, and a failure to correctly assemble an actin ring at the bud neck . The aberrant localization and irregular appearance of the septin cdc3gfp in ba - treated cells is an important key to understanding the septation defect . We propose that ba causes problems with the assembly of the septin scaffold which later impair the localization and function of the car, resulting in the formation of highly irregular cell wall structures . Like other threats to the integrity of the cell wall, septation defects trigger cell wall integrity signaling through the protein kinase c (pkc) pathway . Under these conditions, cell wall integrity signaling leads to hyperphosphorylation of the pkc downstream effector slt2p [3638], accompanied with a much weaker increase in slt2p amount . This will ultimately lead to the activation of cell wall repair enzymes, most notably chitin synthase 3 [36, 40]. The present study shows that ba activates yeast cell wall integrity signaling pathways as evidenced by ba concentration - dependent phosphorylation of slt2p . Presumably in response to cell wall integrity signaling, cells increase the activity of the cell wall repair enzyme chitin synthase 3 in a ba concentration - dependent manner . A decline at low concentrations followed by an increase at higher doses should be interpreted based on the impact boric acid on growth . We propose that at concentrations below the mic where the impact on growth is measurable but weak, boric acid stress reduces cell wall synthesis activity along with other metabolic activities . Once boric acid stress exceeds a tolerable limit at concentrations above the mic the cell responds forcefully by induction of stress survival mechanisms such as chitin synthase 3-mediated cell wall reinforcement . It is worth noting that the activity of the chitin septum - forming chitin synthase 2 also increases during ba exposure . It is evident that the increase in chitin synthase 2 activity correlates well with the increased number and size of chitin septa in ba - treated cells . However, since the regulation of chitin synthase 2 activity is not well understood, we dare not hazard an explanation for this phenomenon . The data presented in this study show that in s. cerevisiae ba disturbs the localization of the contractile actomyosin ring secondary to causing irregularities in the septin scaffold at the bud neck . In agreement with the reviewed literature we propose that the aberrant localization of the septins ultimately impedes the formation of the primary septum, which leads to the synthesis of thick, chitin - rich default septa . In addition, the localization of septins at sites other than the bud neck explains the synthesis of cell wall protuberances that should be interpreted as incomplete ectopic septa . Furthermore, our data show that a ba - induced septation defect, just like other septation defects, triggers cell wall integrity signaling through the pkc1-slt2 pathway and results in increased chitin synthase 3 activity.
|
The pylorus, duodenal c - loop, and ileocecal valve are the three physiological narrowings in the gastrointestinal tract, and most of the swallowed indigestible foreign bodies pass through it without complications . However, foreign bodies such as a toothbrush cannot pass out of the stomach, and the gastrointestinal tract should get rid of these objects as soon as possible to avoid pressure necrosis and gastrointestinal perforation . Although these objects are extracted either by endoscopy or laparoscopic gastrostomy, we devised an innovative technique by using pneumatic gastric insufflation and extracted the toothbrush by a tiny gastrotomy under local anesthesia . A 35-year - old male presented in our hospital at m.m . Institute of medical sciences and research (mmimsr), mullana, ambala, haryana, india in may 2013; he had accidentally swallowed a toothbrush two months back and there was a history of epigastric discomfort especially after meals . However, the vital signs were within normal limits and the abdomen was soft and nontender . X - ray of the abdomen suggested the presence of a foreign body and a computed tomography (ct) scan was done which confirmed a toothbrush lying in the stomach [figures 1, 2]. An upper gastrointestinal endoscopy was done which revealed the toothbrush in the stomach with its head toward the gastroduodenal junction . Biopsy forceps were used to deliver the toothbrush by holding its bristles [figure 3]. The endoscope was kept inside to insufflate and distend the stomach and a minilaparotomy with gastrotomy of 1.5 - 2 cm was performed through the midline under local anesthesia and the toothbrush was successfully removed . X - ray of the abdomen suggesting the presence of the toothbrush in the abdomen computed tomography (ct) scan of the abdomen showing the presence of the toothbrush in the tomach endoscopic picture of toothbrush with biopsy forceps in situ to retrieve it from the stomach in the stomach, 80 - 90% of foreign bodies pass uneventfully through the gastrointestinal tract without complications . However, objects longer than 10 cm like a toothbrush cannot negotiate the duodenal c - loop due to its fixed position in the retroperitoneum, and these must be removed as soon as possible to avoid pressure necrosis and gastric perforation . More than 40 cases of toothbrush ingestion have been reported in the literature till date . However, extreme caution and experience of the endoscopist is required for such procedures . In failed cases of endoscopic removal, however, we devised a simple technique of minilaparotomy and gastrotomy under local anesthesia for removing such foreign bodies . In this technique, the stomach is distended with the help of air insufflation through the endoscope and a small incision is made in the midepigasrium under local anesthesia and the foreign object can be removed directly under the vision of the endoscope . A swallowed toothbrush is a rare occurrence and it never passes through the gastrointestinal tract spontaneously . Early removal of the toothbrush is critical for reducing morbidity and mortality . In cases where endoscopic removal fails, endoscopy still remains an aid in performing surgical gastrotomy for delivering such complex foreign bodies under local anesthesia.
|
In a contemporary health - care environment characterized by rapidly changing developments and relentlessly increasing knowledge, professional nurses need to develop critical thinking (ct) skills that will provide them with expertise in flexible, individualized, situation - specific problem - solving . Ct has been defined as a nonlinear and cycled process that allows people to make decisions on what to believe and what to do within a given context . According to kostovich et al ., the ability to think critically is an essential attribute for today's nurses, and the development of this skill in nursing students requires multiple approaches and techniques . Use of the nursing process is an essential element to cultivate ct and judgment skills in nursing students . The nursing process is a nonlinear, dynamic activity, which focuses on the multifaceted aspects of a patient, their family, and the environment . Nurses and nursing students must develop and write nursing care plans to provide and organize nursing interventions based upon identified patients needs . However, some researchers have reported that the current linear nursing care plan format does not meet the educational needs of students to develop ct skills and visualize the interconnectedness of patient clinical data . In addition, nurse educators feel that the nursing care plans developed by students are not case sensitive and need in - depth comprehension of each client's physical, psychological, social, and spiritual health . In the authors program, the traditional linear format nursing care plan used in the first five semesters was found not to meet the needs of sixth - semester nursing students . These students need to be able to quickly conceptualize the plan of care in a functional format as they graduate and enter the practice arena, where they will be expected to care for multiple patients simultaneously and to rapidly use the nursing process to develop a nursing plan of care based upon priority needs of these patients . Concept map development is an alternative to using care plans as a method to document a plan of care based on evidenced - based practices ., learners assimilate new concepts into their existing cognitive structure . When new concepts are integrated by identifying relationships with concepts already possessed, learning becomes meaningful . Hence, concept maps provide a format to visualize physiological, pathological, and psychological relationships and interactions in a concrete fashion . Visualization of patient care priorities through a holistic view of the patient can be achieved through concept mapping . In addition, the minimal use of text or words makes it easy to scan for a word, phrase, or the general idea that is being explored . Some studies have explored the short - term effects of concept map teaching on students ct and found positive effects in clinical or classroom teaching . Concept mapping has also been described in an online course on distance education to adults in nursing to assess thinking processes of the students where it was found that they helped the students to self - assess their own thinking processes, thus facilitating reflective practice . It has also identified by gerdeman et al . To improve clinical judgment skills in nursing students . However, contrary to previous positive results, some other studies reported contradictory results, for example in a quasi - experimental study, wheeler and collins found that the experimental group scored significantly higher on the overall analysis and evaluation scores in the pre and posttest comparisons, but no significant differences between the groups were found . Yeh and chen also found no significant differences of ct scores between their experimental and control groups, and one longitudinal study on concept mapping, conducted in a united states medical school with 1 year medical students, found no significant differences between ct scores in the pre- and post - tests . Possible explanations for the findings of these studies may stem from several factors, such as measurement error, instrumentation, the curriculum and various definition of ct adopted by the studies . On the other hand, some studies indicate that ct skill of nursing students in different countries had been different . In iran, it can be stated that although ct is important in clinical judgments and decisions but during the training period, have had no significant development therefore the traditional education system needs evolution and revision in order to realize training purposes in line with fostering creative and efficient students . With regard to the need for finding best way to promote nursing students ct and the limited evidence of comparing concept mapping with traditional nursing care plan in clinical setting, this study was performed to compare the effect of concept mapping with traditional nursing care plan on nursing students ct in clinical pediatric course . A before - after experimental design with the control group was used to compare the effect of concept mapping and traditional linear nursing care planning on baccalaureate nursing student's ct skills at shahrekord university of medical sciences in shahrekord, iran . All 60 students from the nursing faculty of the shahrekord university of medical sciences, shahrekord, iran, who had enrolled in pediatric nursing clinical course, and in sixth - semester of their study in the year 2011, were invited to participate in this study . Students were randomly divided into six equal groups of 10 students; three groups as the control group and the other three groups as an experimental group . To prevent contact between the control and experimental groups, they take the pediatric clinical course in sequential time order . During the course, students cared for patients from an assigned pediatric setting . Because students were not able to have prior contact with their patients, they began developing their nursing care plans on the 1 day of their clinical experience . They were asked to create a nursing care plan for a child they were caring for, which required gathering information on complete patient histories, relevant medications, treatments and medical diagnoses . On the 2 day of clinical experience, clinical instructor who has the experience of concept mapping development taught the students in the experimental group how to create concept maps . The students were informed in advance that a concept map should display each nursing diagnosis and more importantly, its relationship to the patient's data, pathophysiology of the disease and interventions in a holistic view . Students were required to analyze assessment data and identify nursing diagnoses, relevant pathophysiology and interventions related to those diagnoses . They used diagrams, color, and shapes to code the parts of the nursing process . They also had 5 days after the clinical experience to reflect on and evaluate the effectiveness of their nursing care before the concept maps were due . Each student in the experimental group created nine concept maps during the course . During clinical group discussions this activity provided all students with the opportunity to think out aloud about the accuracy and completeness of the nursing diagnoses, goals, nursing interventions and relationship depicted on their concept maps . A sample concept map demonstrated by student students in the control group received traditional clinical teaching to create linear nursing care plans on a blank sheet . The students were asked to read and analyze the patient profile data, formulate initial problems, prioritize nursing diagnoses and identify the relationship between nursing diagnoses, then develop and implement interventions to solve the problems, and to evaluate the effectiveness of their nursing care . Linear care plans were in text format without using any shapes, propositions or arrow to illustrate the interconnectedness between the data, nursing diagnosis and interventions . They also had the opportunity to discuss their care plans in group discussion with guidance provided by the teacher . Nobody in the control group asked about concept mapping showing that control groups did not contaminate with the intervention by experimental groups . A well - known, validated and reliable tool was selected for this study . Ct skills were measured using the california critical thinking skill test (cctst) with subscales of analysis (9 items), evaluation (14 items), inference (11 items), and two types of reasoning (deductive reasoning and inductive reasoning included 16 and 14 items respectively). We selected this scale because it was tested for reliability and validity in iranian nursing students . Khalili and hossein zadeh reported that this scale in comparison with the other measuring tools of ct is more comprehensive . The reliability coefficient of subscales after factor analysis in their study was in the range of 62 - 67% . (l4 items) note that a kr-20 range of 0.650.75 for this type of instrument is acceptable . This instrument contains 34 items in multiple - choice format, 19 four - option multiple - choice items and 15 five - option multiple - choice items . The range of possible total scores was 034, with each subscale having a possible score range of 012 . An overall score of <11 indicated a lack of ct skills, a score of 1125 indicated average ct skills, and a score above 25 indicated strong ct skills . For a given ct skill, a subscale score of 4 or less indicated weakness, whereas a subscale score of 7 or above indicated strength . Data were collected before and after the program in a clinical setting at the beginning and end of clinical education . Agreement to use and evaluate concept mapping as a teaching strategy in clinical courses was obtained from the nursing department of shahrekord university of medical sciences, shahrekord, iran . Information about the study was given to every participant to assure the protection of human rights by the clinical teacher . Participants in the experimental group were informed that they would be free to change to the traditional teaching strategy at any time without effects on their course evaluation . To ensure students in the control group were not disadvantaged, after completing the study, they were taught concept mapping during a 1-day workshop . Chicago, il, usa) software . In all analyses, p - 0.05 was considered as statistically significant . We used independent and paired t - tests to compare mean scores between the experimental and control groups at pre- and post - tests . A before - after experimental design with the control group was used to compare the effect of concept mapping and traditional linear nursing care planning on baccalaureate nursing student's ct skills at shahrekord university of medical sciences in shahrekord, iran . All 60 students from the nursing faculty of the shahrekord university of medical sciences, shahrekord, iran, who had enrolled in pediatric nursing clinical course, and in sixth - semester of their study in the year 2011, were invited to participate in this study . Students were randomly divided into six equal groups of 10 students; three groups as the control group and the other three groups as an experimental group . To prevent contact between the control and experimental groups, they take the pediatric clinical course in sequential time order . During the course, students cared for patients from an assigned pediatric setting . Because students were not able to have prior contact with their patients, they began developing their nursing care plans on the 1 day of their clinical experience . They were asked to create a nursing care plan for a child they were caring for, which required gathering information on complete patient histories, relevant medications, treatments and medical diagnoses . On the 2 day of clinical experience, clinical instructor who has the experience of concept mapping development taught the students in the experimental group how to create concept maps . The students were informed in advance that a concept map should display each nursing diagnosis and more importantly, its relationship to the patient's data, pathophysiology of the disease and interventions in a holistic view . Students were required to analyze assessment data and identify nursing diagnoses, relevant pathophysiology and interventions related to those diagnoses . They used diagrams, color, and shapes to code the parts of the nursing process . They also had 5 days after the clinical experience to reflect on and evaluate the effectiveness of their nursing care before the concept maps were due . Each student in the experimental group created nine concept maps during the course . During clinical group discussions this activity provided all students with the opportunity to think out aloud about the accuracy and completeness of the nursing diagnoses, goals, nursing interventions and relationship depicted on their concept maps . A sample concept map demonstrated by student students in the control group received traditional clinical teaching to create linear nursing care plans on a blank sheet . The students were asked to read and analyze the patient profile data, formulate initial problems, prioritize nursing diagnoses and identify the relationship between nursing diagnoses, then develop and implement interventions to solve the problems, and to evaluate the effectiveness of their nursing care . Linear care plans were in text format without using any shapes, propositions or arrow to illustrate the interconnectedness between the data, nursing diagnosis and interventions . They also had the opportunity to discuss their care plans in group discussion with guidance provided by the teacher . Nobody in the control group asked about concept mapping showing that control groups did not contaminate with the intervention by experimental groups . Ct skills were measured using the california critical thinking skill test (cctst) with subscales of analysis (9 items), evaluation (14 items), inference (11 items), and two types of reasoning (deductive reasoning and inductive reasoning included 16 and 14 items respectively). We selected this scale because it was tested for reliability and validity in iranian nursing students . Khalili and hossein zadeh reported that this scale in comparison with the other measuring tools of ct is more comprehensive . The reliability coefficient of subscales after factor analysis in their study was in the range of 62 - 67% . (l4 items) note that a kr-20 range of 0.650.75 for this type of instrument is acceptable . This instrument contains 34 items in multiple - choice format, 19 four - option multiple - choice items and 15 five - option multiple - choice items . The range of possible total scores was 034, with each subscale having a possible score range of 012 . An overall score of <11 indicated a lack of ct skills, a score of 1125 indicated average ct skills, and a score above 25 indicated strong ct skills . For a given ct skill, a subscale score of 4 or less indicated weakness, whereas a subscale score of 7 or above indicated strength . Data were collected before and after the program in a clinical setting at the beginning and end of clinical education . Agreement to use and evaluate concept mapping as a teaching strategy in clinical courses was obtained from the nursing department of shahrekord university of medical sciences, shahrekord, iran . Information about the study was given to every participant to assure the protection of human rights by the clinical teacher . Participants in the experimental group were informed that they would be free to change to the traditional teaching strategy at any time without effects on their course evaluation . To ensure students in the control group were not disadvantaged, after completing the study, they were taught concept mapping during a 1-day workshop . Data analysis was performed using statistical package for the social sciences (spssinc ., chicago, il, usa) software . In all analyses, p - 0.05 we used independent and paired t - tests to compare mean scores between the experimental and control groups at pre- and post - tests . Almost all students were 21 years old except one who was 22 years old (range: 2122). The statistical analysis showed that two groups did not appreciably differ in age or sex . There was no significant difference between the groups overall, and in all subscales before the program [table 1]. Paired t - test showed significant improvement in overall and all subscales of cctst from pretest to posttest in both groups (p <0.001) [tables 2 and 3] but t - test demonstrates that improvement in students ct skills in the experimental group was significantly greater than that in the control group after the program (p <0.001) [table 4]. Student's ct skills on the pretest comparison of overall and subscales of cctst - a in the experimental group comparison of overall and subscales of cctst - a in the control group student s ct skills on the posttest this study was developed to examine whether concept mapping helped students develop better ct skills than the traditional method in an undergraduate pediatric clinical course . In the current study, it was found that either concept map or traditional linear nursing care plan could promote ct skills in nursing students from lacking to an average ct standard . However, similar to findings of other prior studies which observed improvements to nurses ct abilities following a concept mapping teaching strategy, the present study provided evidence to indicate that the effects of concept mapping were greater than those of traditional linear nursing care plans, with greater improvements to students overall and all subscales of ct skills as indicated by cctst scores . Considering that the test of ct is based on the problem - solving process and the nursing process in the defined problem - solving stages, the use of which could improve ct skills . The ct skills overall describe overall strength in using reasoning to form reflective judgments about what to believe or what to do and includes core reasoning skills such as analysis, inference, evaluation, induction, and deduction . Analytical reasoning skills enable people to identify the elements of a situation and determine how these parts interact . In the nursing process, students identify bio - psycho - social aspects of patients health and determine how these parts interact . In our study, students tried to understand the relationship between patient data, nursing process, interactions and connections between sign and symptoms, diagnostic data and medications as they developed traditional care plans or concept maps . Although both care plans and concept maps could reinforce the students analytical reasoning skills, concept mapping had a greater effect . According to cook et al ., the linear format of the nursing care plan is based upon the nursing process that does not always allow for a holistic picture of patient needs and does not allow for visualization of the interrelatedness of patient data . In contrast, concept maps provide a format to visualize physiological, pathophysiological and psychological relationships and interactions in a concrete fashion, which is more effective to support quality analysis . Schuster also suggested that visualization of patient care priorities through a holistic view of the patient can be achieved through concept mapping . Nirmala and shakuntala also supported that the cross - links in concept maps are useful for correlating patients diagnoses, symptoms, treatment and interventions and then to thinking critically in clinical decision - making . According to facione et al . Inductive reasoning helps in isolating the cause of an ailment or arriving at a theory to explain the relationship between symptoms . Evaluative reasoning skills enable students to assess the credibility of resources of information and the claims they make . In our study, after the 5 weeks program, the concept mapping participants demonstrated greater ct abilities to assess the credibility of, and relationships between statements and to provide reasoning according to evidence and using deduction, comprehend, express and clarify meaning and to perform inductive reasoning tasks . Similar to some previous studies (yeh and chen), our study found that the experimental group had significantly higher scores of inference and deduction than those of the control group in the posttest . When constructing concept maps, students need to draw logical conclusions from factual knowledge or promises known through a process of inference such as identifying the major concepts, determining the relationship between concepts and making propositions using cross - links before coming to conclusions . In summary, converting to a concept map format allow for visualization of all aspects of patient clinical data, physical assessment, disease process and the relationship between this information, facilitating ct in nursing students in a clinical area . Previous researches on the ct of nursing students in iranian faculties showed that learning in the educational system takes place at the initial cognitive levels, and higher levels such as analysis or synthesis and evaluation are less addressed . In fact, less attention is paid to the growth of the ct power according to kermansaravi et al . There are main and serious obstacles in the development of ct, one of which is the predominant use of traditional teaching methods in the current education system which is preventing from the development of decision making and troubleshooting (or problem - solving) skills in the learners and as a result limits the opportunities for students ct . Considering that the test of ct is based on the problem - solving process and the nursing process is the defined problem - solving stages, the use of which is one - way emphasized in nursing education programs to the growth of ct . Our study suggested that preparing nursing care using the concept map is more effective in promoting ct in nursing students than traditional linear nursing care plans . As with all studies with small samples, generalization of findings must be made cautiously . However, this study adds to the growing body of knowledge that suggests concept mapping improves students abilities to see patterns and relationships . Although this study identified some short - term effects of the concept mapping program, its long - term effects remain unknown . The sample set came from only one university in iran limiting the feasibility of generalization of results to other universities and countries . Future investigations should include multisite evaluations in a range of geographic locales with larger sample sizes . As with all studies with small samples, generalization of findings must be made cautiously . However, this study adds to the growing body of knowledge that suggests concept mapping improves students abilities to see patterns and relationships . Although this study identified some short - term effects of the concept mapping program, its long - term effects remain unknown . The sample set came from only one university in iran limiting the feasibility of generalization of results to other universities and countries . Future investigations should include multisite evaluations in a range of geographic locales with larger sample sizes . When presented with complex health - care situations and the need to process vast amounts of information, clinical nurses must be in ownership of ct skills in order to make appropriate professional judgments and clinical decision making . Results from the present study support the application of concept mapping as a clinical teaching strategy to promote the development of ct skills . Concept mapping, in comparison with the traditional linear nursing care plan, resulted in greater improvements in all ct skills . However, the 5 weeks program demonstrated only short - term effects, therefore, further longitudinal studies are suggested.
|
These include the intrinsic flexor pollicis brevis, flexor pollicis longus, lumbricalis, flexor brevis, and flexor longus muscles1 . Toe - gripping strength is measured in the sitting position with the trunk vertical, the hip and knee joints at 90, and the ankle joint in the neutral position1,2,3 . Low toe - gripping strength is a risk factor of falls for the elderly, and several studies have reported that toe - gripping strength is lower in subjects with a history of falls than in those with no history of falls1,2,3,4 . Furthermore, toe - gripping strength can be increased by training5, which can decrease the risk of falls1 . Souma et al.6 studied the% iemg of several crural muscles (the soleus muscle, medial head of the gastrocnemius muscle, and tibialis anterior) during toe - gripping in 3 different ankle joint positions10 of plantar flexion and 0 and 10 of dorsiflexion and reported that the crural muscles help the ankle joint by co - contracting during toe - gripping . In another study, nakae et al.7 calculated the% iemg of the same muscles during toe - gripping with subjects seated on the edge of a seat or standing, and reported that the% iemg of the medial gastrocnemius muscle was significantly lower when subjects were seated than when they were standing . However, as both studies focused on the activity of the crural muscles, the activity of the femoral muscles during toe - gripping remains unclear . We believe it is important to elucidate the contribution of femoral muscles to toe - gripping strength . In the present study, we investigated femoral muscle activity during toe - gripping to examine the role of the femoral muscles in toe - gripping strength . Their average (mean sd) age, height, and body weight were 20.6 1.0 years, 159.4 6.3 cm, and 51.8 5.8 kg, respectively . This study was approved by the ethics committee for human research of tohoku fukushi university, and written informed consent was received from all of the subjects after the purpose of the study had been explained to them . Toe - gripping strength of the dominant toe and emg activity of the ipsilateral thigh were synchronously recorded to assess the activity of the rectus femoris and biceps femoris muscles . Toe - gripping strength was measured using a toe - gripping dynamometer (t.k.k.3360; takei co, ltd, niigata, japan). As described by uritani8, the subjects were instructed to sit with their trunk in the vertical position, hip and knee joints at 90, and ankle joints in the neutral position . After a sufficient number of training trials and adequate rest, toe - gripping strength was measured twice and the maximal force was used in the analysis . For all subjects, the right toe was dominant (defined as the toe used to kick a ball). To measure the maximum voluntary contraction (mvc) activity of the rectus femoris muscles, as described by kai9, each subject was instructed to sit on a chair with the hip and knee joints at 90, and to exert maximal isometric force of knee extension while resisting an opposing force applied by the examiner . The emg was recorded for 3 seconds while each subject exerted maximal force of knee extension . To measure the mvc of the biceps femoris muscle, each subject was instructed to generate maximal isometric force of knee flexion while resisting an opposing force applied by the examiner . The emg was recorded for 3 seconds while each subject exerted maximal force of knee flexion . After confirmation of adequate skin preparation (skin resistance of less than 5 k), three bipolar lead electrodes (de-2.1, delsys, inc ., boston, usa) were attached to the skin over the rectus femoris and the long head of the biceps femoris, as described by peroto10 . For measurement of the rectus femoris muscle, the electrode was attached at the midpoint between the superior edge of the patella and the anterior superior iliac spine . For measurement of the long head of the biceps femoris, the electrode was attached at the midpoint between the head of the fibula and ischial tuberosity . The emg signal was collected using ml846 power lab 4/26 (sample: 1,000 hz; ad instruments co., ltd .) And transferred to a personal computer . The bandwidth was 20500 hz . The emg signal segment selected and integrated (integrated electromyogram: iemg) for analysis was the middle 1 s of the entire 3-s duration of continuous maximal toe - gripping strength . The iemg was analyzed using lab chart pro v7.3.5 (ad instruments co., ltd .) And normalized to the iemg of each muscle s mvc . Repeated mann - whitney u tests were used to compare the% iemg of the rectus and biceps femoris muscles . Relationships between the% iemg of the rectus and biceps femoris muscles were statistically analyzed using spearman s correlation coefficient . The average (mean sd) toe - gripping strength was 20.9 3.6 kg . The average (mean sd)% iemg values of the rectus and biceps femoris muscles were 7.0% 6.2% and 25.6% 15.9%, respectively . The% iemg of the biceps femoris was significantly higher than that of the rectus femoris (p <0.01, table 1table 1.comparison of the% iemg values of the rectus femoris and biceps femoris muscles during toe - gripping actionrectus femorisbiceps femorismedian (range: min max)median (range: min max)%iemg4.8 * (1.521.1)27.2 (3.068.1)mann - whitney u test *: p <0.05). Mann - whitney u test *: p <0.05 using spearman s correlation coefficient analysis, a significant positive correlation was found between the% iemg of the rectus femoris and that of the biceps femoris (r = 0.548, p in the present study, we found that the% iemg of the biceps femoris was significantly higher than that of the rectus femoris . Moreover, a significant positive correlation was found between the% iemg of these two muscles . These results suggest that femoral muscles co - contract during toe - gripping action, and thus possibly contribute to knee joint stability . We found that toe - gripping action stimulates femoral muscle activity and that the% iemg of the biceps femoris was significantly higher than that of the rectus femoris . Sato et al.11 reported that during toe - gripping, the tibialis anterior and soleus muscles are activated first, followed by the gradual activation of the medial head of the gastrocnemius muscle . The biceps femoris initiates knee flexion, and the medial head of the gastrocnemius is a synergist for knee flexion . Additionally, active tension of the biceps femoris decreases during toe - gripping in knee flexion . This may be because the length of the biceps femoris is shorter during active tension than during resting tension . We think that the activation of the biceps femoris during toe - gripping was caused by increasing motor unit recruitment and synchronization of the impulse to compensate for decreasing activity of the biceps femoris . In the present study, we found a significant positive correlation between the% iemg of the rectus femoris and that of the biceps femoris . This suggests that the% iemg of the rectus femoris increases with increases in the% iemg of the biceps femoris . Toe - gripping strength was measured using a closed kinetic chain movement, and therefore, the likelihood of movement in the directions of flexion or extension of the knee joint is less . However, because the gastrocnemius also acts on knee joint flexion during exertion of toe - gripping strength, the knee joint is readily displaced in the direction of flexion . To prevent this, it is thought that the knee joint is immobilized by contraction of the rectus femoris, that is, we think the rectus femoris during exertion of toe - gripping strength acts in order to control the action of knee joint flexion by the gastrocnemius . First, we were unable to avoid the common problems that negatively affect surface emg recording, such as skin resistance, artifacts, and the effects of proximal muscles . Second, as only healthy young women participated in this study, it is difficult to extend our findings to the general population . In future studies, we need to consider this aspect, and involve healthy young men and individuals of different age groups.
|
The majority of our likes and dislikes we acquire throughout the lifespan are the product of learning . One of the most important ways through which stimuli acquire affective meaning is the change of valence that results from pairing one stimulus (cs) with a positive or negative affective stimulus (ucs). As a result this effect is called (associative) evaluative conditioning and has been demonstrated in humans with a large variety of procedures and stimuli (e.g., [24]; for a meta - analysis see). In dementia severely impaired explicit memory nonetheless, patients with dementia might still be able to implicitly learn affective reactions through the process of evaluative conditioning . However, to the best of our knowledge, no study applied this approach in dementia patients . Another classical paradigm that has already been used to investigate conditioning of affective reactions in this population is fear conditioning . Indeed, two studies indicate that fear conditioning is impaired in dementia patients [6, 7]. Even though fear conditioning is impaired, evaluative conditioning might still be possible in dementia patients . Some researchers have argued that while on a procedural level evaluative conditioning is similar to fear conditioning, the underlying processes might be different . It was hypothesized that fear conditioning is an instance of signal learning; it is learned that the ucs is going to appear after the presentation of the cs . Evaluative conditioning, on the other hand, only involves a reference to the ucs without expectation of its occurrence . Thus, explicit knowledge about the cs - ucs relation seems crucial in fear conditioning while evaluative conditioning can be demonstrated in the absence of contingency awareness [1012]. Since there could be variables that play a different role in these forms of learning; dementia patients might show intact evaluative conditioning despite impaired fear conditioning . Indeed, some studies indicate that dementia patients might retain the capacity to acquire affective reactions [13, 14]. Blessing et al . Demonstrated that dementia patients' affective reactions can be influenced by pairing faces with fictional biographical content that characterized the depicted persons in terms of either positive or negative traits . Pictures were rated before and at two different time points after the presentation of fictional biographical content with respect to valence and arousal . Patients changed their ratings of pictures according to the biographical information presented, but did not recognize pictures above chance level or recall biographical information . These findings were replicated and extended in a subsequent study . The paradigm used by blessing et al . [however, there are two main differences: (1) in standard evaluative conditioning paradigms the subjects are not explicitly informed about the interrelation between stimuli in the learning phase . In the paradigm used by blessing et al . [13, 14] the paring of the cs and ucs is made explicit and thus, the procedure cannot be described as a simple cooccurrence of stimuli; (2) in contrast to the approach of blessing et al . [13, 14] the ucs and cs in evaluative conditioning paradigms belong to the same type of stimuli (e.g., faces). Hence, in the present study we addressed the question if affective evaluations of dementia patients can be manipulated using a standard evaluative conditioning paradigm . Participants . Demographical data and clinical characteristics of both groups are listed in table 1 . The study included 15 dementia patients (diagnosed as alzheimer's disease (n = 10) or mixed dementia (n = 5)). Patients were outpatients in the memory clinic of the psychiatric clinic of muensterlingen at the time of testing . All patients were diagnosed by a multidisciplinary team of the hospital ward using icd 10 criteria . All patients had received medical attendance including magnetic resonance imaging and specific screening blood tests, in order to exclude syphilis, diabetes, thyroid disorders, and vitamin b12 and folic acid deficiency . They reported that they had no known cns diseases, contact with toxic substances, or substance abuse . Test stimuli were 10 pictures of neutral (i.e., displaying no facial expression of emotion) unfamiliar faces (6 female: 3 young, 3 old; 4 male: 2 young, 2 old) and one picture of a happy young, female adult as well as one picture of a happy old, male adult selected from the productive aging laboratory face database . However, based on affective valence ratings of these pictures in other studies (dann hier referenz), some of the included faces were also rated as positive or negative . The happy faces were added to increase the variance in subjective liking between pictures . Emotional ratings . The sam was designed to assess subjective ratings of participants' emotional responses and minimize the influence of language and culture on ratings . The sam valence rating scale has been successfully used in previous studies with dementia patients [13, 14]. Using the paper - pencil version of this instrument, participants rated the stimuli as to their emotional valence (range: 19). Similar to other studies investigating evaluative conditioning we used a cover story in order to minimize demand effects . Participants were told that the aim of the experiment was to examine the relationship between mood and subjective affective evaluation . In line with this cover story participants rated their mood on a five - point likert scale (very good / good / normal / bad / very bad). Subsequently, the pictures were presented to participants one after the other and rated with respect to valence using the sam rating scale . Pictures were presented in four different pseudorandom sequences . After the valence rating an individual, unequivocal preference order of all stimuli was established . The pictures that received identical valence ratings were again presented to participants who then had to decide which of the pictures they preferred and the respective picture was put aside . Again, the participants had to choose which of the remaining pictures with identical valence ratings they preferred and so on . The most preferred stimulus out of the 12 faces was used as the liked (l) stimulus and the stimulus with the lowest ranking was used as the disliked (d) stimulus . The four stimuli ranked 5th, 6th, 7th, and 8th were used as neutral (n) stimuli . The experimenter entered these six individual l, d, and n stimuli in a computer program (presentations 11.3) that automatically formed three stimuli pairs (i.e., neutral - liked, neutral - disliked, and neutral - neutral) by randomly assigning the neutral stimuli . Participants were then seated about 50 cm from the computer screen and instructed to look at the pictures that would appear on the screen . Each picture from the different pairs (i.e., (n - l), (n - d) or (n - n)) was presented 10 times in the center of the computer screen . The duration of each stimulus presentation was 1 second and the interstimulus interval (isi; i.e., onset of the first stimulus of a pair to onset of the second stimulus of a pair) was 4 seconds . The inter - trial interval (iti; i.e., onset of the first stimulus of the previous trial to onset of the first stimulus of the next trial) was 13 seconds . After the presentation of stimuli on the computer screen, participants were again asked to rate the n, d, and l stimuli on the sam valence rating scale . The three relevant n stimuli (i.e., the first stimulus of each pair) were placed one after the other in front of participants together with the three stimuli second in the pairs (l, d, n). Participants were asked to indicate which of these three stimuli followed the currently presented n stimulus . The experimenter registered the answer on a response sheet . A repeated measures analyses of variance (anovas) was conducted for the valence ratings of the relevant n stimuli (i.e., the first stimulus of each pair). A separate analysis was performed for ratings of stimuli paired with l and d pictures . Type of stimulus pair and measurement point (i.e., valence rating pre and post presentation) were used as within - participant factors and group was included as between subject factor . In the case of significant group differences a separate analysis was performed for both groups . The repeated measures anova revealed no main effect of type of stimulus pair (f(2,26) = 2.42; p>.109) but an interaction between type of stimulus pair and time (f(2,26) = 7.354; p>.003; see table 2). This interaction was due to the fact that there was no influence of the type of stimulus pair at baseline (f(2,27) = 0.296; p>.746), but a significant effect after conditioning in the direction of the experimental manipulation (f(2,27) = 5.460; p <.010). No interaction between type of stimulus pair and group (f(2,26) = 3.023; p>.066) or stimulus pair, time, and group (f(2,26) = 2.798; p>.079) appeared . Anova indicated no main effect of time (f(1,27) = 0.78; p>.385). As expected, we found a grater rating change over time for stimuli paired with l and d pictures than stimuli paired with n pictures (see table 2). We conducted a separate analysis using only pictures paired with l and d pictures to further investigate the influence of the experimental manipulation . The repeated measures anova revealed a main effect of type of stimulus pair (f(1,27) = 4962; p>.034) along with an interaction between type of stimulus pair and time (f(1,26) = 15.237; p>.001; see table 2). We found no significant interaction between type of stimulus pair and group (f(2,26) = 2.894; p>.10) but a significant interactions between stimulus pair, time, and group (f(1,26) = 5.784; p <.023). Anova indicated no main effect of time (f(1,27) = 0.296; p>.591). Because of the significant interaction between stimulus pair, time, and group, indicating group differences, we performed a separate analysis for each group . The repeated measures anova for valence ratings of pictures paired with l and d stimuli of dementia patients revealed a significant main effect of type of stimulus pair (f(1,14) = 16.000; p>.001) along with an interaction between type of stimulus pair and time (f(1,14) = 29.007; p>.001). We found no main effect of time (f(1,14) = 0.121; p>.733). The repeated measures anova for ratings of controls indicated no main effect of type of stimulus pair (f(1,13) = .087; p>.773) and no interaction between type of stimulus pair and time (f(1,13) = .832; p>.378). Again, anova indicated no main effect of time (f(1,13) = 0.188; p>.671). In the group of dementia patients, 24.4% of the relevant n stimuli were assigned to the correct stimulus second in the pairs in the forced choice test, which did not differ from chance level (i.e., 33.3%; p>.14). In the control group, 31% relevant n stimuli were assigned to the correct stimulus second in the pairs in the forced choice test, which did not differ from chance level (i.e., 33.3%; p>.37). The main aim of the present study was to investigate if affective evaluations of dementia patients can specifically be influenced through a standard evaluative conditioning paradigm . As hypothesized, dementia patients changed their valence ratings of unfamiliar and previously neutral faces according to its pairing with either a liked or disliked face stimulus . Generally, the neutral pictures that were paired with a liked stimulus were rated higher and the neutral picture that was paired with the disliked stimulus was rated lower on the valence dimension after our evaluative conditioning intervention by dementia patients . Thus, results indicate that ratings of initially neutral stimuli can be influenced in the according direction through simple time - near presentation (i.e., pairing) with both a liked as well as a disliked stimuli . It does not seem surprising that our forced choice recognition test indicated no contingency awareness as this is based on the functionality of explicit memory that is severely impaired in dementia patients . However, dementia patients significantly differed from controls in the effect of the experimental manipulation . The negative finding in the control group could indicate that our paradigm did not produce evaluative conditioning effects . Consequently, the detected influence in the ad group could be accounted for by demand effects or other nonevaluative conditioning effects . Another explanation could be that there was only a small effect in the control group that could not be detected due to small sample size . However, the sample size was only slightly smaller than that of the ad group . We looked at the data on the level of individual subjects and found that 11 of 14 subjects in the control group changed their ratings in the expected direction or showed no rating change . The negative result in the control group was due to two participants who showed a strong rating change in the opposite direction . Post hoc analysis indicated a significant influence of the experimental manipulation in the control group after exclusion of these two outliers (p <.028). Thus, it seems possible that evaluative conditioning effects in the control group were masked by the influence of outliers in our small sample . The rating changes of outliers could have been motivated by reactance, as observed in other studies investigating evaluative conditioning . Our result could also indicate that evaluative conditioning effects are stronger in dementia patients than in healthy elderly controls . A possible reason for stronger effects could be lower attentional resources in dementia patients due to disease - related cognitive impairments . Some studies indicate that attentional resources have a negative impact on affective learning through evaluative conditioning (e.g. [19, 20]) and accordingly it seems possible that dementia patients show stronger effects . However, there are conflicting findings concerning the influence of attentional resources on evaluative conditioning (e.g.,). The observed positive change of the valence rating in the neutral stimulus that was paired with another neutral stimulus could be a result of the mere exposure effect . This effect describes the preference for stimuli that have been previously presented over novel stimuli . Preference changes due to the mere exposure effect have also been demonstrated in dementia patients [2325]. In line with this explanation are findings from other studies investigating evaluative conditioning that report a similar trend of positive changes in evaluations of neutral pictures paired with other neutral pictures over time . The results suggest that dementia patients changed their ratings according to the experimental manipulation without contingency awareness, since pairings were not identified above chance level in the forced choice recognition test . In fact, participants of the control group performed better than dementia patients in the recognition test, yet their results did not differ from chance level as well . The results of dementia patients are in line with findings demonstrating evaluative conditioning in healthy participants using subliminally presented stimuli [2729]. Could show that the individual amount of the evaluative conditioning effect is not related to the number of pairings (i.e., neutral stimulus - affective stimulus) participants were aware of . On the other hand, findings of a recent meta analysis suggest that contingency awareness is an important moderator in evaluative conditioning . However, a critical limitation of the present study is our assessment of contingency awareness using a forced choice recognition test . Following the recent discussion of gawronski and walther, it seems possible that we measured contingency memory rather than contingency awareness . Subjects may have realised the respective pairings during conditioning but may not have been able to remember these pairings explicitly when the recognition test was applied . This may have been the case especially in dementia patients because of severe memory deficits . Subjects may have remembered statistical probabilities that could not be assessed using a forced choice test . Thus, it is also possible that contingency awareness differed between dementia patients and controls in our study and that contingency awareness influenced the results . To prohibit contingency awareness, very long time intervals on short isi could facilitate the detection of contingencies in the combinations of pictures and would enhance contingency awareness . However, this result has to be considered preliminary, since it is unclear what prevented rating changes in the expected direction in the control group in our paradigm . Nevertheless, the results seem to be in contrast to previously reported impaired fear conditioning . As discussed above it is still unresolved whether evaluative conditioning is a form of pavlovian conditioning or if there are variables that are unique to evaluative conditioning . Thus, the results of our study support the notion that different processes are involved in evaluative conditioning and fear conditioning . A relevant difference could be the dependence of pavlovian conditioning on contingency awareness in contrast to evaluative conditioning as discussed above . Another reason for conflicting findings in fear conditioning versus evaluative conditioning studies could be the use of different dependent measures . Fear conditioning studies primarily use skin conductance as a dependent measure, whereas evaluative conditioning studies rely on behavioural measures . This explanation is supported by recent findings from our lab revealing that changes of affective evaluations were not related to skin conductance responses but to heart rate response in dementia patients in a face - emotion association paradigm . Accordingly, there might be a specific impairment in dementia patients with respect to skin conductance response . On a neurophysiological level, the underpinnings of evaluative conditioning are not well understood . Some studies indicate that temporal regions and specifically the amygdala are involved in both fear conditioning [3235] and evaluative conditioning . However, there is also evidence suggesting that the functionality of the amygdaloid nuclear complex may not be crucial for the occurrence of evaluative conditioning . Hence, preserved evaluative conditioning in dementia patients would be in line with findings demonstrating that despite of impaired fear conditioning evaluative conditioning is preserved in persons with unilateral damage to the amygdaloid nuclear complex . Similarly, tranel and damasio report the case of a patient with bilateral damage to the entire medial lobe who could learn connections between unfamiliar persons and affective valence they displayed, despite severely impaired explicit memory . In summary, results of our study suggest that dementia patient' affective evaluations of neutral stimuli can be changed through pairing with liked or disliked stimuli . However, caution is warranted since it is not unambiguous what caused these rating changes in our study . Future research should focus on preserved learning processes in dementia patients since they are of great importance for nonpharmacological therapeutic interventions.
|
Para - aortic and pelvic lymphadenectomy is often performed in the treatment of ovarian or testicular cancer . Internal herniation of a small bowel behind the external iliac artery after lymphadenectomy is a very rare complication to this procedure and to our knowledge only reported twice in the literature . In the first paper published in 1978 the author described how they managed their patient with laparotomy and resection of a perforated small bowel . The hernia orifice was closed by using a free peritoneal graft harvested from the under surface of the anterior abdominal wall . This patient had to undergo several surgical procedures to re - establish blood flow to the extremity because of trombosis of the iliac artery . As there are few similar cases reported worldwide, there is no consensus or guidelines available . We did not close the orifice . Because of the skeletonized vessel we were afraid of compromising the vessel if we tried to close the defect . At follow - up after 10 months a 56-year - old woman underwent in 2008 prophylactic bilateral laparoscopic salpingoophrectomy because of a mutation in brca1 gene . The histological result revealed a serous papillary adenocarcinoma in the right ovary and on its surface . Therefore a restaging operation was performed . She underwent laparotomy with total abdominal hysterectomy, omentectomy, appendectomy, with a radical retroperitoneal lymphadenectomy which involved en bloc dissection and removal of the para - aortic and iliac lymphe nodes . There was no metastasis in the biopsies taken from the rectum wall and the laparoscopy trocar ports as well as the 46 harvested lymphe nodes . The patient did not receive any radiation therapy . In 2012, 4 years later, she was admitted to hospital with a 2 days history of severe abdominal pain, vomiting and the inability to pass gas or stools for the last few days . The abdomen was distended, diffused tender and tympanitic, without guarding or rebound tenderness . Her groin examination was normal without any sign of herniation through the femoral or inguinal canals . Blood pressure 140/90 mmhg, pulse 71 beats / minute and a temperature of 37.9 c . Our patient received 90 ml of iomeprol 350 mgl / ml i.v . And this was sufficient to see the vessels . The ct scan demonstrated transition zone both where the loop entered behind the external iliac vessel and where the intestine passed out behind the vessel as a closed loop . The small bowel was dilated both proximal to, as well as inside the closed loop (figs . 2 and 3). The patient received a prophylactic antibiotics composed of metronidazole 1.5 g and doxycycline 400 mg i.v . We established pneumoperitoneum with a pressure of 12 mmhg and inserted two other working ports of 12 mm and one of 5 mm . We examined the non dilated bowel from the ileocoecal junction, approximately 200 cm from the ilecoecal junction the small bowel made a closed loop underneath the left external iliac artery (picture 1). The small bowel was strangulated by the external iliac vessel . By gentle manipulation we reduced the herniated small bowel (picture 2) that soon recovered . The blue color and venous congestion were fading out and we noticed peristaltic movement of the previously herniated bowel we therefore did not perform any bowel resection . The defect underneath the artery was about 23 cm (picture 3) in diameter . We found it risky to try to close the orifice and decided to leave it unrepaired . We noticed pulsation on the iliac vessel after the small bowel reduction and we evaluated the pulsation of the dorsalis pedis artery and the posterior tibial artery during the operation . The abdomen was exsufflated and the fascia defects in the 12 mm ports were sutured and the skin closed with stapler . The patient was observed in the intensive care unit until the next morning, with focus on her leg pulse and color . Dalteparin 5000 ie was given subcutaneously 6 h after surgery and continued for the first 24 h after surgery . The postoperative course was uneventful and she was discharged from hospital the day following operation . Due to limited peritoneum in the area of the hernia defect and the skeletonized external iliac artery, we did not do any direct suture of the orifice as this might have compromised the artery and/or the vein . Due to previous omentectomy, an alternative might have been to harvest a free peritoneum graft to cover the defect as described in the two other cases . Another option was to use a mesh covered with an oxidized regenerated cellulose or expanded polytetrafluoroethylene (eptfe) that minimize bowel adhesions . A longer follow - up of the patient is needed to clearly conclude if this simple procedure has been sufficient . If the patient later experience any sign of recurrence and need another operation we will have to close the defect . A challenge would have been if the bowel could not be reduced due to long standing obstruction . In such a case a bowel resection and/or a vascular surgical procedure might have been necessary . The small bowel in ileus might be fragile, gangrenous or necrotic and there is probably a higher risk of bowel perforation performing a laparoscopic approach . We do not routinely use verres needle in laparoscopy, we prefer to use visiport as an optical trocar or an open hasson approach that is another safe alternative to minimize the chance of bowel perforation on entrance into the abdominal cavity . Strangulated internal hernia behind the iliac vessel is a rare entity only reported twice in the literature . This is the first case in the literature where laparoscopically reduction of the internal herniated bowel underneath the iliac vessel is performed . A quick recovery with no complications, short hospital stay and minimal discomfort postoperatively made our approach an acceptable surgical option for this patient . Written informed consent was obtained from the patient for publication of this case report and accompanying images . A copy of the written consent is available for review by the editor - in - chief of this journal on request.
|
Tumor - associated cell cycle defects, manifesting in unscheduled proliferation, and the associated genomic and chromosomal instabilities are mediated by misregulation of cyclin - dependent kinases (cdks). Because of the main role in the division cycle, cdks have been recognized as targets for anticancer therapy . Many small - molecule organic compounds, which have been identified as cdk modulators, are currently in preclinical or clinical development . However, no cdk inhibitors have gained marketing approval, despite 20 years of scientific investigation . Several studies have shown synergism when cdk inhibitors were combined with organic (e.g., doxorubicin, paclitaxel) and inorganic (e.g., cisplatin, carboplatin) cytotoxic drugs . The first publications have appeared recently and include fe, cu, and pt complexes with cdk inhibitors derived from 6-benzylaminopurine, metal - based indolo-[3,2-d]benzazepines (paullones; ga, cu, ru, and os), and indolo-[3,2-c]quinolines (ru, os). Another class of compounds potentially suitable for targeted metal - based chemotherapy is that of 3-(1h - benzimidazol-2-yl)-1h - pyrazolo[3,4-b]pyridines . These have been documented recently as potent cdk1 inhibitors with antiproliferative activity in hela (cervical carcinoma), hct116 (colon carcinoma), and a375 (melanoma) human cancer cell lines . Comparison of cdk1 inhibitory activity with the inhibiting activity in four other protein kinases (vegf - r2, her2, aurora - a, and ret) revealed selectivity for cdk1 . Structural modifications consisting of a replacement of both bicyclic rings in 3-(1h - benzimidazol-2-yl)-1h - pyrazolo[3,4-b]pyridines by monocycles while retaining the imidazolyl pyrazole core have been proposed in order to obtain inhibitors with improved pharmacokinetic and solubility properties . The most promising were suggested to be 3-(1h - benzimidazol-2-yl)-1h - pyrazolo[3,4-b]pyridines (see chart 1). The inspection of substitution patterns on the benzimidazole moiety and structure activity relationships revealed that a methoxymethyl group in position 7b (4b) is favorable for cdk1 inhibiting potency . The role of the pyrazole nh group is also of note, since its methylation led to a significant reduction of cdk1 activity . The effect of various heteroaryl groups in position 5a was also remarkable for the development of more - effective cdk inhibitors and antiproliferative agents . Our previous experience with metal - based indolo-[3,2-d]benzazepines prompted the use of the half - sandwich metal - arene moiety as a suitable scaffold to which 3-(1h - benzimidazol-2-yl)-1h - pyrazolo[3,4-b]pyridines may be attached . Organometallic compounds [m(-arene)(yz)x] (where m = ru, os) exhibit promising anticancer activity and are the focus of attention for several groups . These compounds have shown activity toward classic (dna) and nonclassic (e.g., cdks) targets in anticancer chemotherapy . Herein, we report (i) the modified synthetic approach to 3-(1h - benzimidazol-2-yl)-1h - pyrazolo[3,4-b]pyridines (recall chart 1: l1, x = h, y = h; l2, x = br; y = h; l3, x = br; y = ch2och3); (ii) the synthesis and characterization of a new family of organoruthenium(ii) (11a, 12a, 13a) and osmium(ii) (11b, 12b, 13b) complexes of the general formula [mcl(-p - cymene)l]cl, where l = 3-(1h - benzimidazol-2-yl)-1h - pyrazolo[3,4-b]pyridines (l1l3) (chart 1); (iii) stabilization of the 7b tautomer of methoxymethyl - substituted l3 by metal coordination as well as (iv) nmr spectroscopic characterization of two tautomers 7b - l3 and 4b-l3 in a metal - free state; and (v) cell cycle effects, as well as the antiproliferative and cdk inhibitory activities of both metal - free ligands and organometallic complexes . 1h - pyrazolo[3,4-b]pyridine-3-carboxylic acid (1) was obtained via the oxidation of 3-methyl-1h - pyrazolo[3,4-b]pyridine by kmno4 in the presence of a base, followed by acidification with 37% hcl . Solvents [toluene, ethanol (etoh), tetrahydrofuran (thf), diethyl ether (et2o)] were dried using standard procedures . 3-methyl-1h - pyrazolo[3,4-b]pyridine (10.9 g, 0.08 mol) and anhydrous sodium acetate (10.21 g, 0.13 mol) were suspended in glacial acetic acid (42 ml). Bromine (20.42 g, 0.13 mol) was added, and the resulting mixture was stirred at room temperature for 22.5 h and then at 110115 c for 2.53 h. afterward, water (300350 ml) was added and the mixture was stirred at room temperature . The formed light yellow precipitate was filtered off and dried in vacuo at 4050 c . Yield: 17 g. the raw product was used without further purification in the next step . Purification by column chromatography afforded a white powder (sio2, etoac, rf = 0.79; 12.5 g, 72.6% yield). Esi - ms in meoh (positive): m / z 213 [m+h], 235 [m+na], 253 [m+k]; (negative): m / z 211 [m h]. H nmr (500.32 mhz, meoh - d4): 8.55 (d, 1h, j = 2.16 hz, ch), 8.43 (d, 1h, j = 2.15 hz, ch), 2.56 (s, 3h, ch3) ppm . H nmr (500.32 mhz, dmso - d6): 13.42 (brs, 1h, nh), 8.54 (d, 1h, j = 2.19 hz, ch), 8.53 (d, 1h, j = 2.18 hz, ch), 2.49 (s, 3h, ch3) ppm . Colorless crystals of 20.5h2o suitable for x - ray diffraction (xrd) study were grown in etoac (see figure s1 in the supporting information). To sodium hydroxide (9.54 g, 0.24 mol) in water (150 ml) was added the raw product 2 (7.1 g, 0.03 mol). After a dropwise addition of kmno4 (16.98 g, 0.11 mol) in water (300 ml) at 100 c over 2 h, the reaction mixture was further heated for 1 h. mno2 was filtered off from the hot reaction mixture and washed with hot water . 400 ml, and the yellow solution was acidified to ph 2, using concentrated hcl . Yield: 2.28 g. the crude hydrochloride of 3 was used without further purification in the next step . Esi - ms in meoh (positive): m / z 243 [m+h], 265 [m+na], 287 [m+2na h]; (negative): m / z 241 [m h]. H nmr (500.32 mhz, meoh - d4): 8.69 (d, 1h, j = 2.22 hz, ch), 8.68 (d, 1h, j = 2.22 hz, ch) ppm . H nmr (500.32 mhz, dmso - d6): 14.65 (s, 1h, nh), 13.45 (brs, 1h, nh), 8.72 (d, 1h, j = 2.23 hz, ch), 8.58 (d, 1h, j = 2.25 hz, ch) ppm . Nah (1.75 g, 0.07 mol) was suspended in dry thf (200 ml). A solution of 2-amino-3-nitrobenzyl alcohol (5.23 g, 0.03 mol) in dry thf (100 ml) was added dropwise at 0 c and the mixture was stirred at the same temperature for 15 min . After a dropwise addition of mei (11.5 g, 0.08 mol), stirring was continued at room temperature for 3 h. a saturated aqueous solution of nahco3 (300 ml) and meoh (300 ml) then were added . The organic phase was dried over na2so4, filtered, and evaporated to yield a red oil (4.85 g). The raw product was purified by column chromatography (sio2, etoac, or etoac / hexane 1/1, first fraction, a red - orange oil crystallized to form a red solid at 4 c; yield: 3.68 g, 65%). H nmr (500.32 mhz, dmso - d6): 8.00 (d, 1h, j = 8.71 hz, c6h3), 7.09 (br, 2h, nh2), 6.67 (t, 1h, j = 8.45 hz, c6h3), 4.48 (s, 2h, ch2), 3.31 (s, 3h, ch3) ppm . A mixture of 4 (1.4 g, 0.008 mol) and 10% pd / c (0.18 g) in dry etoh (55 ml) was stirred under hydrogen atmosphere at room temperature for 1824 h. the catalyst was removed by filtration through gf-3-filter under argon and washed with dry etoh (5070 ml). The filtrate was evaporated in vacuo to give a light - orange solid (1.17 g, 100% yield), which was used immediately in the next step . H nmr (500.32 mhz, dmso - d6): 6.52 (dd, 1h, j = 1.87 hz, j = 7.25, c6h3), 6.426.36 (m, 2h, c6h3), 4.48 (br, 2h, nh2), 4.31 (br, 4h, nh2+ch2), 3.24 (s, 3h, ch3) ppm . N, n-carbonyldiimidazole (cdi, 4.16 g, 0.026 mol) was added in small portions to 1 (2.34 g) in dry dmf (12 ml). The mixture was stirred at room temperature for 2024 h. water (5 ml) then was added and the suspension was stirred until all co2 was ceased . The white precipitate was filtered off, washed with water (35 ml), and dried in a sublimator in vacuo at 60 c, to remove the imidazole as a contaminant . Esi - ms in methanol (positive): m / z 214 [m+h], 237 [m+na]; (negative): m / z 212 [m h]. H nmr (500.32 mhz, dmso - d6): 14.95 (brs, 1h, nh), 8.91 (s, 1h, chim), 8.74 (dd, 1h, j = 1.61 hz, j = 4.51 hz, chpy), 8.63 (dd, 1h, j = 1.59 hz, j = 8.12 hz, chpy), 8.14 (t, 1h, j = 1.23 hz, chim), 7.51 (dd, 1h, j = 4.46 hz, j = 8.06 hz, chpy), 7.20 (s, 1h, chim) ppm . N, n-carbonyldiimidazole (cdi, 16.2 g, 0.1 mol) was added in small portions to crude 3 (11.58 g) in dry dmf (70 ml). The mixture was stirred at room temperature for 2024 h. water (10 ml) then was added and the suspension was stirred until all co2 was ceased . The white precipitate was filtered off, washed with water (1015 ml), and dried in a sublimator in vacuo at 60 c, to remove the imidazole as a contaminant . Esi - ms in methanol (positive): m / z 315 [m+na]; (negative): m / z 291 [m h]. H nmr (500.32 mhz, dmso - d6): 14.95 (brs, 1h, nh), 8.89 (s, 1h, chim), 8.83 (d, 1h, j = 2.12 hz, chpy), 8.75 (d, 1h, j = 2.07 hz, chpy), 8.13 (s, 1h, chim), 7.20 (s, 1h, chim) ppm . The solution of 1,2-diaminobenzene (0.5 g, 4.67 mmol) in dry dmf (2 ml) was added to the suspension of 6 (0.94 g, 4.41 mmol) in dry dmf (13 ml), and this reaction mixture was heated under argon at 85 c for 5 h. dmf then was evaporated in vacuo at 50 c and water (1012 ml) was added . The light - yellow precipitate was filtered off and dried in vacuo at 50 c . Yield: 0.86 g. the raw product was used without purification in the next step . Esi - ms in methanol (positive): m / z 255 [m+h], 277 [m+na]; (negative): m / z 253 [m h]. H nmr (500.32 mhz, dmso - d6): 14.30 (brs, 1h, nhpz), 9.73 (brs, 1h, conh), 8.64 (dd, 1h, j = 1.59 hz, j = 4.44 hz, chpy), 8.56 (dd, 1h, j = 1.53 hz, j = 8.02 hz, chpy), 7.397.36 (m, 2h, chpy+chbz), 6.97 (td, 1h, j = 1.31 hz, j = 7.73 hz, chbz), 6.82 (dd, 1h, j = 1.2 hz, j = 7.89 hz, chbz), 6.64 (td, 1h, j = 1.2 hz, j = 7.67 hz, chbz), 4.93 (s, 2h, nh2) ppm . (10 ml) was added to the suspension of 7 (2.28 g, 7.8 mmol) in dry dmf (10 ml), and this mixture was heated under argon at 85 c for 7 h. dmf then was evaporated in vacuo at 50 c and water (20 ml) was added . Yield: 2.2 g. the raw product was used without purification in the next step . Esi - ms in methanol (positive): m / z 333 [m+h], 355 [m+na]; (negative): m / z 331 [m h]. H nmr (500.32 mhz, dmso - d6): 14.54 (brs, 1h, nhpz), 9.80 (brs, 1h, conh), 8.73 (d, 1h, j = 2.26 hz, chpy), 8.69 (d, 1h, j = 2.22 hz, chpy), 7.34 (dd, 1h, j = 0.98 hz, j = 7.88 hz, chbz), 6.99 (td, 1h, j = 1.43 hz, j = 8.03 hz, chbz), 6.82 (dd, 1h, j = 1.22 hz, j = 7.96 hz, chbz), 6.64 (td, 1h, j = 1.19 hz, j = 7.73 hz, chbz), 4.94 (s, 2h, nh2) ppm . A mixture of 5 (1.17 g, 7.69 mmol) and 7 (2.1 g, 7.2 mmol) in dry dmf (45 ml) was heated under argon at 85 c for 20 h. dmf then was evaporated in vacuo at 50 c and water (20 ml) was added . Yield: 2.3 g. the product was used without further purification in the next step . Esi - ms in methanol (positive): m / z 399 [m+na]; (negative): m / z 375 [m h]. H nmr (500.32 mhz, dmso - d6): 14.54 (brs, 1h, nhpz), 9.85 (brs, 1h, conh), 8.73 (d, 1h, j = 2.13 hz, chpy), 8.68 (d, 1h, j = 2.05 hz, chpy), 7.29 (d, 1h, j = 7.56 hz, chbz), 7.03 (d, 1h, j = 7.29 hz, chbz), 6.65 (t, 1h, j = 7.79 hz, chbz), 4.78 (brs, 2h, nh2), 4.42 (s, 2h, ch2), 3.29 (s, 3h, ch3) ppm . The raw product 8 (0.86 g) was heated in a glacial acetic acid (10 ml) at 125 c for 2.5 h. the solvent was evaporated under reduced pressure and the residue was dried in vacuo at 50 c, then resuspended in ch2cl2/meoh (4/1, 25 ml), filtered off, and dried in vacuo to give l1 as a white powder (0.4 g). The filtrate was evaporated and the residue was purified by column chromatography (sio2, etoac, rf = 0.58) to give an additional amount of l1 (0.22 g). Calcd for 110.15h2o0.1etoac (mr = 246.76 g / mol): c, 65.22; h, 4.13; n, 28.38 . Found: c, 65.56; h, 3.90; n, 28.39 . Esi - ms in methanol (positive): m / z 237 [m+h], 259 [m+na]; (negative): m / z 235 [m h]. Vis (methanol), max, nm (, m cm): 232 (25618), 275 (15198), 324 (22333). H nmr (500.32 mhz, dmso - d6): 14.19 (brs, 1h, h1a), 13.11 (brs, 1h, h1b), 8.85 (dd, 1h, j = 1.5 hz, j = 8.1 hz, h4a), 8.66 (dd, 1h, j = 1.5 hz, j = 4.5 hz, h6a), 7.75 (d, 1h, j = 7.3 hz, h4b or h7b), 7.54 (d, 1h, j = 7.7 hz, h4b or h7b), 7.39 (dd, 1h, j = 4.5 hz, j = 8.0 hz, h5a), 7.24 (m, 2h, h5b+h6b) ppm . C nmr (125.81 mhz, dmso - d6): 153.13 (c8a), 150.22 (c6a), 146.99 (c2b), 144.34 (c8b or c9b), 136.06 (c3a), 134.68 (c8b or c9b), 131.82 (c4a), 123.35 (c5b or c6b), 122.11 (c5b or c6b), 119.44 (c4b or c7b), 118.65 (c5a), 113.33 (c9a), 112.01 (c4b or c7b) ppm . N nmr (50.70 mhz, dmso - d6): 166.2 (n1a), 121.3 (n1b) ppm . The raw product 9 (2.2 g) was heated in a glacial acetic acid (30 ml) at 125 c for 2 h. the solvent was evaporated under reduced pressure, and the residue was dried in vacuo at 50 c, then resuspended in ch2cl2/meoh (7/1, 50 ml), filtered off and dried in vacuo to give l2 as a white powder (1.15 g). The filtrate was evaporated and the residue was purified by column chromatography (sio2, etoac / hexane 2/1, rf = 0.6) to give an additional amount of the product (0.27 g). Yield: 1.42 g, 58% based on 7 . Calcd for 120.25h2o0.04etoac (mr = 322.17 g / mol): c, 49.06; h, 2.76; n, 21.74 . Esi - ms in methanol (positive): m / z 315 [m+h], 337 [m+na]; (negative): m / z 313 [m h]. Vis (methanol), max, nm (, m cm): 234 (28154), 282 (17628), 335 (17198). H nmr (500.32 mhz, dmso - d6): 14.43 (brs, 1h, h1a), 13.19 (brs, 1h, h1b), 8.99 (d, 1h, j = 2.2 hz, h4a), 8.75 (d, 1h, j = 2.3 hz, h6a), 7.77 (d, 1h, j = 7.9 hz, h4b or h7b), 7.54 (d, 1h, j = 7.9 hz, h4b or h7b), 7.26 (m, 2h, h5b+h6b) ppm . C nmr (125.81 mhz, dmso - d6): 151.49 (c8a), 150.66 (c6a), 146.42 (c2b), 144.24 (c8b or c9b), 135.61 (c3a), 134.67 (c8b or c9b), 133.35 (c4a), 123.54 (c5b or c6b), 122.27 (c5b or c6b), 119.55 (c4b or c7b), 114.87 (c5a or c9a), 113.49 (c5a or c9a), 112.09 (c4b or c7b) ppm . N nmr (50.70 mhz, dmso - d6): 167.5 (n1a), 121.3 (n1b) ppm . The raw product 10 (2.3 g) was heated in a glacial acetic acid (40 ml) at 125 c for 2 h. the solvent was evaporated under reduced pressure, and the residue dried in vacuo at 50 c . After washing with ch2cl2 (30 ml), ch2cl2/meoh (2/1, 57 ml) the gray product was purified by column chromatography (sio2, etoac, rf = 0.68) to give a white powder (0.9 g). The filtrates were evaporated and the remaining solid was purified by column chromatography to give an additional amount of the product (0.3 g). Calcd for 13: c, 50.29; h, 3.38; n, 19.55 . Found: c, 50.03; h, 3.19; n, 19.19 . Esi - ms in methanol (positive): m / z 381 [m+na]; (negative): m / z 357 [m h]. Vis (methanol), max, nm (, m cm): 235 (29776), 282 (17544), 337 (16958). Nmr characterization of 7b - l3 and 4b-l3 tautomers (1/1.3) in dmso - d6: h nmr (500.32 mhz, dmso - d6), 7b - l3: 14.47 (brs, 1h, h1a), 13.25 (brs, 1h, h1b), 8.99 or 8.98 (d+d, (1 + 1.3)h, j = 2.3 hz, h4a+h4a), 8.75 (d, (1 + 1.3)h, j = 2.3 hz, h6a+h6a), 7.72 (dd, 1h, j = 1.8 hz, j = 6.8 hz, h4b), 7.287.21 (m, (2 + 2.6)h, h5a, h6a+h5a, h6a), 4.80 (s, 2h, h10b), 3.37 (s, 3h, h11b) ppm . H nmr (500.32 mhz, dmso - d6), 4b-l3: 14.43 (brs, 1.3h, h1a), 13.22 (brs, 1.3h, h1b), 8.99 or 8.98 (d+d, (1 + 1.3)h, j = 2.3 hz, h4a+h4a), 8.75 (d, (1 + 1.3)h, j = 2.3 hz, h6a+h6a), 7.47 (dd, 1.3h, j = 1.2 hz, j = 7.7 hz, h7b), 7.287.21 (m, (2 + 2.6)h, h5a, h6a+h5a, h6a), 4.96 (s, 2.6h, h10b), 3.44 (s, 3.9h, h11b) ppm . C nmr (125.81 mhz, dmso - d6), 7b - l3: 151.51 (c8a+c8a), 150.69 (c6a or c6a), 150.65 (c6a or c6a), 146.70 (c2b), 144.46 (c9b), 135.62 (c3a+c3a), 133.45 (c4a or c4a), 133.42 (c4a or c4a), 133.29 (c8b), 123.38 (c6b; c5b or c6b), 123.36 (c6b; c5b or c6b), 122.95 (c7b), 122.16 (c5b or c6b), 118.97 (c4b), 115.04 (c5a or c9a or c5a or c9a), 114.92 (c5a or c9a or c5a or c9a), 113.49 (c5a or c9a or c5a or c9a), 70.49 (c10b), 57.95 (c11b) ppm . C nmr (125.81 mhz, dmso - d6), 4b-l3: 151.51 (c8a+c8a), 150.69 (c6a or c6a), 150.65 (c6a or c6a), 146.13 (c2b), 142.50 (c9b), 135.62 (c3a+c3a), 134.42 (c8b), 133.45 (c4a or c4a), 133.42 (c4a or c4a), 129.38 (c4b), 123.38 (c6b; c5b or c6b), 123.36 (c6b; c5b or c6b), 122.16 (c5b or c6b), 120.81 (c5b), 115.04 (c5a or c9a or c5a or c9a), 114.92 (c5a or c9a or c5a or c9a), 113.49 (c5a or c9a or c5a or c9a), 111.17 (c7b), 69.90 (c10b), 58.35 (c11b) ppm . N nmr (50.70 mhz, dmso - d6): 167.6 (n1a+n1a), 121.4 (n1b+n1b) ppm . A mixture of l1 (54.7 mg, 0.23 mmol) and [rucl2(-p - cymene)]2 (70 mg, 0.11 mmol) in dry ethanol (25 ml) was stirred at room temperature for 1 h. ethanol then was evaporated up to ca . Calcd for 11ah2o (mr = 559.45 g / mol): c, 49.38; h, 4.50; n, 12.52; cl, 12.67 . Found: c, 49.68; h, 4.25; n, 12.11; cl, 12.26 . Esi - ms in methanol (positive): m / z 470 [m hcl cl], 507 [m cl], 528 [m hcl+na]; (negative): m / z 468 [m2hcl h], 505 [m hcl h]. Vis (methanol), max, nm (, m cm): 251 (16335), 299 (26663), sh 347 (16012). Vis (h2o), max, nm (, m cm): sh 245 (10728), 294 (18597), 360 (9666). H nmr (500.32 mhz, dmso - d6): 14.91 (brs, 1h, h1b), 9.17 (d, 1h, j = 7.7 hz, h4a), 8.82 (d, 1h, j = 3.8 hz, h6a), 8.11 (d, 1h, j = 7.1 hz, h4b), 7.84 (d, 1h, j = 8.5 hz, h7b), 7.58 (m, 3h, h5a+h5b+h6b), 6.43 (m, 2h, h2c+h6c), 6.31 (d, 1h, j = 5.3 hz, h3c or h5c), 6.12 (d, 1h, j = 5.5 hz, h3c or h5c), 2.54 (sep, 1h, h7c, under dmso - d6 peak), 2.21 (s, 3h, h10c), 0.94 (d, 3h, j = 6.6 hz, h8c or h9c), 0.91 (d, 3h, j = 6.6 hz, h8c or h9c) ppm . C nmr (125.81 mhz, dmso - d6): 153.97 (c8a), 150.45 (c6a), 146.52 (c2b), 141.37 (c9b), 134.70 (c8b), 134.64 (c3a), 131.48 (c4a), 125.39 (c5b or c6b), 124.92 (c5b or c6b), 119.56 (c5a), 117.85 (c4b), 113.96 (c7b), 111.54 (c9a), 103.96 (c4c), 103.74 (c1c), 84.44 (c2c or c6c), 83.73 (c2c or c6c), 82.15 (c3c or c5c), 80.84 (c3c or c5c), 31.12 (c7c), 22.19 (c8c+c9c), 19.17 (c10c) ppm . N nmr (50.70 mhz, dmso - d6): 128.7 (n1b) ppm . A mixture of l1 (42.5 mg, 0.18 mmol) and [oscl2(-p - cymene)]2 (70 mg, 0.09 mmol) in dry ethanol (25 ml) was stirred at room temperature for 2 h. ethanol then was removed under reduced pressure up to ca . Calcd for 11bh2o (mr = 648.61 g / mol): c, 42.59; h, 3.88; n, 10.79 . Found: c, 42.56; h, 3.57; n, 10.97 . Esi - ms in methanol (positive): m / z [m hcl cl], 596 [m cl], 618 [m hcl+na]; (negative): m / z 595 [m hcl h]. Vis (methanol), max, nm (, m cm): sh 252 (17048), 299 (20228), 343 (19879). H nmr (500.32 mhz, meoh - d4): 8.99 (dd, 1h, j = 1.3 hz, j = 8.1 hz, h4a), 8.77 (dd, 1h, j = 1.4 hz, j = 4.8 hz, h6a), 7.96 (dd, 1h, j = 2.0 hz, j = 6.4 hz, h4b), 7.80 (dd, 1h, j = 1.9 hz, j = 6.1 hz, h7b), 7.647.59 (m, 3h, h5a+h5b+h6b), 6.66 (d, 1h, j = 5.6 hz, h2c or h6c), 6.59 (d, 1h, j = 5.7 hz, h2c or h6c), 6.43 (d, 1h, j = 5.6 hz, h3c or h5c), 6.21 (d, 1h, j = 5.7 hz, h3c or h5c), 2.43 (sep, 1h, j = 6.9 hz, h7c), 2.38 (s, 3h, h10c), 0.96 (d, 3h, j = 6.9 hz, h8c or h9c), 0.92 (d, 3h, j = 6.9 hz, h8c or h9c) ppm . C nmr (125.81 mhz, meoh - d4): 153.25 (c8a), 148.91 (c2b), 147.42 (c6a), 140.49 (c9b), 135.15 (c3a), 134.25 (c8b), 132.07 (c4a), 125.47 (c5b or c6b), 124.81 (c5b or c6b), 118.48 (c5a), 116.89 (c4b), 112.98 (c7b), 112.92 (c9a), 97.71 (c4c), 94.88 (c1c), 76.44 (c2c or c6c), 74.99 (c2c or c6c), 71.93 (c3c or c5c), 70.44 (c2c or c6c), 31.37 (c7c), 21.35 (c8c or c9c), 21.09 (c8c or c9c), 17.84 (c10c) ppm . Crystals of 11b4h2o suitable for xrd study have been obtained from a solution of 11b in ethanol . A mixture of l2 (73.2 mg, 0.23 mmol) and [rucl2(-p - cymene)]2 (70 mg, 0.11 mmol) in dry ethanol (25 ml) was stirred at room temperature for 1 h. ethanol then was removed under reduced pressure up to ca . Calcd for 12ah2o (mr = 638.35 g / mol): c, 43.28; h, 3.79; n, 10.97 . Esi - ms in methanol (positive): m / z 548 [m hcl cl], 608 [m hcl+na]; (negative): m / z 549 [m2hcl h], 582 [m hcl h]. Vis (methanol), max, nm (, m cm): sh 254 (17778), 303 (29953), 351 (17387). H nmr (500.32 mhz, dmso - d6): 14.34 (brs, 1h, h1b), 9.21 (s, 1h, h4a), 8.73 (s, 1h, h6a), 8.06 (d, 1h, j = 7.6 hz, h4b), 7.79 (d, 1h, j = 8.5 hz, h7b), 7.52 (m, 2h, h5b+h6b), 6.32 (d, 2h, j = 5.8 hz, h2c+h6c), 6.22 (d, 1h, j = 6.2 hz, h3c or h5c), 6.03 (d, 1h, j = 6.1 hz, h3c or h5c), 2.52 (sep, 1h, h7c, under dmso - d6 peak), 2.18 (s, 3h, h10c), 0.94 (d, 3h, j = 6.8 hz, h8c or h9c), 0.89 (d, 3h, j = 6.9 hz, h8c or h9c) ppm . C nmr (125.81 mhz, dmso - d6): 154.04 (c8a), 151.24 (c6a), 146.57 (c2b), 141.37 (c9b), 134.63 (c8b), 133.43 (c3a), 131.82 (c4a), 125.33 (c5b or c6b), 124.88 (c5b or c6b), 117.78 (c4b), 114.72 (c5a or c9a), 113.85 (c7b), 112.48 (c5a or c9a), 103.96 (c4c), 103.74 (c1c), 84.44 (c2c or c6c), 83.69 (c2c or c6c), 82.16 (c3c or c5c), 80.76 (c3c or c5c), 31.09 (c7c), 22.20 (c8c or c9c), 22.17 (c8c or c9c), 19.16 (c10c) ppm . N nmr (50.70 mhz, dmso - d6): 127.3 (n1b) ppm . A mixture of l2 (56.4 mg, 0.18 mmol) and [oscl2(-p - cymene)]2 (70 mg, 0.09 mmol) in dry ethanol (25 ml) was stirred at room temperature for 2 h. ethanol then was removed under reduced pressure up to ca . Calcd for 12bh2o (mr = 727.51 g / mol): c, 37.97; h, 3.33; n, 9.63 . Found: c, 37.82; h, 3.02; n, 9.33 . Esi - ms in methanol (positive): m / z 638 [m hcl cl], 696 [m hcl+na]; (negative): m / z 672 [m hcl h]. Vis (methanol), max, nm (, m cm): sh 253 (21638), 302 (30505), 357 (21813). H nmr (500.32 mhz, meoh - d4): 9.08 (d, 1h, j = 2.1 hz, h4a), 8.84 (d, 1h, j = 2.1 hz, h6a), 7.96 (dd, 1h, j = 2.1 hz, j = 6 hz, h4b), 7.80 (dd, 1h, j = 2.1 hz, j = 6.1 hz, h7b), 7.63 (m, 2h, h5b+h6b), 6.69 (d, 1h, j = 5.7 hz, h2c or h6c), 6.63 (d, 1h, j = 5.6 hz, h2c or h6c), 6.48 (d, 1h, j = 5.6 hz, h3c or h5c), 6.22 (d, 1h, j = 5.7 hz, h3c or h5c), 2.42 (sep, 1h, j = 6.9 hz, h7c), 2.39 (s, 3h, h10c), 0.95 (d, 3h, j = 6.9 hz, h8c or h9c), 0.91 (d, 3h, j = 6.9 hz, h8c or h9c) ppm . C nmr (125.81 mhz, meoh - d4): 153.04 (c8a), 152.49 (c6a), 148.15 (c2b), 140.47 (c9b), 134.58 (c3a), 134.19 (c8b), 131.13 (c4a), 125.79 (c5b or c6b), 125.05 (c5b or c6b), 116.99 (c4b), 115.39 (c5a or c9a), 113.09 (c7b), 112.11 (c5a or c9a), 98.54 (c4c), 95.52 (c1c), 75.73 (c2c or c6c), 75.25 (c2c or c6c), 71.87 (c3c or c5c), 69.99 (c3c or c5c), 31.41 (c7c), 21.34 (c8c or c9c), 21.16 (c8c or c9c), 17.84 (c10c) ppm . Crystals of 12b and 12b2ch3oh2h2o suitable for xrd study have been obtained from a solution of 12b in methanol . A mixture of l3 (64 mg, 0.18 mmol) and [rucl2(-p - cymene)]2 (50 mg, 0.08 mmol) in dry ethanol (25 ml) was stirred at room temperature for 1 h. ethanol then was removed under reduced pressure up to ca . Calcd for 13a1.5h2o (mr = 691.41 g / mol): c, 43.43; h, 4.23; n, 10.13; cl, 10.26 . Found: c, 43.81; h, 4.24; n, 10.11; cl, 10.57 . Esi - ms in methanol (positive): m / z 592 [m hcl cl], 650 [m hcl+na]; (negative): m / z 591 [m2hcl h], 628 [m hcl h]. Vis (methanol), max, nm (, mcm): sh 252 (18744), 306 (28529), 354 (16889). H nmr (500.32 mhz, dmso - d6): 13.88 (brs, 1h, h1b), 9.41 (s, 1h, h4a), 8.68 (s, 1h, h6a), 7.99 (d, 1h, j = 7.7 hz, h4b), 7.49 (m, 2h, h5b+h6b), 6.29 (m, 2h, h2c+h6c), 6.20 (d, 1h, j = 5.5 hz, h3c or h5c), 6.00 (d, 1h, j = 5.9 hz, h3c or h5c), 4.88 (s, 2h, h10b), 3.39 (s, 3h, h11b), 2.48 (sep, 1h, h7c, under dmso - d6 peak), 2.17 (s, 3h, h10c), 0.93 (d, 3h, j = 6.9 hz, h8c or h9c), 0.87 (d, 3h, j = 6.8 hz, h8c or h9c) ppm . C nmr (125.81 mhz, dmso - d6): 155.35 (c8a), 150.27 (c6a), 147.43 (c2b), 141.64 (c9b), 133.07 (c8b), 132.68 (c3a), 131.68 (c4a), 124.87 (c5b or c6b), 124.59 (c5b or c6b), 124.53 (c7b), 117.18 (c4b), 114.23 (c5a or c9a), 112.78 (c5a or c9a), 103.74 (c4c), 103.09 (c1c), 85.38 (c2c or c6c), 83.68 (c2c or c6c), 82.13 (c3c or c5c), 81.05 (c3c or c5c), 70.19 (c10b), 58.03 (c11b), 31.04 (c7c), 22.22 (c8c or c9c), 22.09 (c8c or c9c), 19.13 (c10c) ppm . N nmr (50.70 mhz, dmso - d6): 122.9 (n1b) ppm . The red xrd - quality crystals of [rucl(-p - cymene)(l3h)] (13c) were obtained from etoh / et2o and an etoh solution of 13a (long crystallization). The yellow crystals of [rucl(-p - cymene)(l3)]cl[rucl(-p - cymene)(l3h)]ch3oh (13dch3oh) suitable for xrd study have been obtained from methanolic solution of 13a (short crystallization). H nmr (13c, 500.32 mhz, dmso - d6): 13.43 (s, 1h), 9.18 (d, 1h, j = 2.1 hz), 8.48 (d, 1h, j = 2.2 hz), 7.94 (d, 1h, j = 8.2 hz), 7.45 (t, 1h, j = 7.8 hz), 7.39 (d, 1h, j = 7.2 hz), 6.16 (d, 1h, j = 6.0 hz), 6.13 (d, 1h, j = 6.1 hz), 6.07 (d, 1h, j = 5.9 hz), 5.89 (d, 1h, j = 6.4 hz), 4.85 (s, 2h), 4.04 (s, 3h), 2.14 (s, 3h), 0.93 (d, 3h, j = 6.8 hz), 0.86 (d, 3h, j = 6.9 a mixture of l3 (59 mg, 0.17 mmol) and [oscl2(-p - cymene)]2 (60 mg, 0.08 mmol) in dry ethanol (25 ml) was stirred at room temperature for 3 h. ethanol was evaporated up to ca . Calcd for 13b: c, 39.85; h, 3.48; n, 9.29 . Found: c, 39.60; h, 3.32; n, 9.20 . Esi - ms in methanol (positive): m / z 682 [m hcl cl], 704 [m2hcl+na]; (negative): m / z 680 [m2hcl h], 716 [m hcl h]. Vis (methanol), max, nm (, m cm): sh 256 (19825), 303 (24634), 357 (18850). H nmr (500.32 mhz, meoh - d4): 9.33 (d, 1h, j = 2.1 hz, h4a), 8.84 (d, 1h, j = 2.2 hz, h6a), 7.91 (dd, 1h, j = 1.2 hz, j = 7.8 hz, h4b), 7.647.58 (m, 2h, h5b+h6b), 6.69 (d, 1h, j = 5.6 hz, h2c or h6c), 6.62 (d, 1h, j = 5.7 hz, h2c or h6c), 6.47 (d, 1h, j = 5.5 hz, h3c or h5c), 6.21 (d, 1h, j = 5.6 hz, h3c or h5c), 4.94 (q, 2h, j = 12.4 hz, h10b), 3.49 (s, 3h, h11b), 2.41 (sep, 1h, j = 6.9 hz, h7c), 2.39 (s, 3h, h10c), 0.94 (d, 3h, j = 6.9 hz, h8c or h9c), 0.89 (d, 3h, j = 6.9 hz, h8c or h9c) ppm . C nmr (125.81 mhz, meoh - d4): 153.18 (c8a), 152.16 (c6a), 148.36 (c2b), 140.82 (c9b), 134.35 (c3a), 132.68 (c8b), 131.68 (c4a), 125.63 (c5b or c6b), 124.85 (c5b or c6b), 124.51 (c7b), 116.72 (c4b), 115.24 (c5a or c9a), 112.26 (c5a or c9a), 98.75 (c4c), 95.50 (c1c), 75.98 (c2c or c6c), 75.34 (c2c or c6c), 71.82 (c3c or c5c), 70.29 (c10b), 70.04 (c3c or c5c), 57.17 (c11b), 31.39 (c7c), 21.34 (c8c or c9c), 21.16 (c8c or c9c), 17.85 (c10c) ppm . The yellow crystals of [oscl(-p - cymene)(l3)]cl[oscl(-p - cymene)(l3h)]0.75 ch3oh0.25h2o (13e0.75ch3oh0.25h2o) suitable for xrd study have been obtained from a methanolic solution of 13b . Elemental analyses (c, h, n, cl) were performed by the microanalytical service of the institute of physical chemistry, university of vienna . Electrospray ionization mass spectrometry (esi - ms) was carried out with an esquire 3000 instrument (bruker daltonics, bremen, germany), using solutions of compounds in methanol . Vis spectra were recorded on a lambda 20 uv vis spectrophotometer (perkin elmer), using samples dissolved in methanol (l1l3, 11a, 12a, 13a, 11b, 12b, 13b) and water (11a) over 24 or 48 h, correspondingly . The one - dimensional (h, c, n) and two - dimensional spectra (n, h hsqc, c, h hsqc, c, h hmbc, h, h cosy, h, h tocsy, h, h noesy (l3, 12a), h, h roesy (l3, 11a, 12a, 13a, 13b)) were recorded with a bruker model dpx500 (ultrashield magnet) system in dmso - d6 (l1l3, 11a, 12a, 13a), meoh - d4 (11b, 12b, 13b), d2o (h nmr, 11a), and d2o / dmso - d6 (h nmr, 12a), using standard pulse programs at 500.32 (h), 125.81 (c) and 50.70 (n) mhz . H signals are referenced relative to the solvent signals (dmso - d6 at 2.51, meoh - d4 at 3.33 ppm). Single crystals were positioned at distances of 35, 40, 40, 40, 40, 40, and 35 mm from the detector, and 1556, 1131, 518, 1911, 1176, 1978, and 1039 frames were measured, each for 30, 60, 30, 20, 70, 60, and 30 s over 1 scan width for 20.5h2o, 11b4h2o, 12b, 12b2ch3oh2h2o, 13c, 13dch3oh, and 13e0.75ch3oh0.25h2o, correspondingly . Crystal data, data collection parameters, and structure refinement details are given in table 1 . The structures were solved by direct methods and refined by full - matrix least - squares techniques . Refinement of the structure of 12b revealed that the chloride counteranion occupies two statistically disordered positions with site occupation factor (sof) values of 0.57:0.43, whereas, in 13c, the methoxymethylene group was found to be disordered over two positions with sof values of 0.80:0.20 . Similarly, the methoxymethylene group of one crystallographically independent complex in 13dch3oh or in both crystallographically independent complexes in 13e0.75ch3oh0.25h2o is disordered with sof values of 0.35:0.65 and 0.60:0.40, 0.80:0.20, correspondingly . The disorder was resolved with constrained anisotropic displacement parameters and restrained bond distances using eadp and sadi instructions of shelx97, respectively . Structure solution was achieved with shelxs-97 and refinement with shelxl-97, and graphics were produced with ortep-3 . Wr2 = {[w(fo fc)]/[w(fo)]}. Gof = {[w(fo fc)]/(n p)}, where n is the number of reflections and p is the total number of parameters refined . A549 (non - small cell lung carcinoma, human) and sw480 (colon carcinoma, human) cells were kindly provided by brigitte marian (institute of cancer research, department of medicine i, medical university of vienna, austria). Ch1 cells (ovarian cancer, human) were a gift from lloyd r. kelland (crc centre for cancer therapeutics, institute of cancer research, sutton, u.k . ). Cells were grown in 75-cm culture flasks (iwaki) in a complete medium (i.e., minimum essential medium supplemented with 10% heat - inactivated fetal bovine serum, 1 mm sodium pyruvate, 4 mm l - glutamine, and 1% nonessential amino acids from 100 stock) as adherent monolayer cultures . Cultures were grown at 37 c under a humidified atmosphere containing 5% co2 and 95% air . Antiproliferative activity in vitro was determined by the colorimetric mtt assay (mtt = 3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2h - tetrazolium bromide, fluka). For this purpose, cells were harvested from culture flasks by the use of trypsin and seeded in complete medium (100 l / well) into 96-well plates (iwaki) in densities of 4 10 (a549), 1.5 10 (ch1), and 2.5 10 (sw480) viable cells per well . Test compounds were dissolved in dmso first, appropriately diluted in complete medium, and instantly added to the plates (100 l / well), where the dmso content did not exceed 0.4% and 1% for the ligands and complexes, respectively . After exposure for 96 h, the medium was replaced with 100 l / well rpmi 1640 medium (supplemented with 10% heat - inactivated fetal bovine serum and 4 mm l - glutamine) plus 20 l / well mtt solution in phosphate - buffered saline (5 mg / ml), followed by incubation for 4 h. subsequently, the medium / mtt mixture was removed, and the formazan product formed by viable cells was dissolved in dmso (150 l / well). Optical densities were measured with a microplate reader (tecan spectra classic) at 550 nm (and a reference wavelength of 690 nm) to yield relative quantities of viable cells as percentages of untreated controls, and 50% inhibitory concentrations (ic50) were interpolated from concentration effect curves . Calculations are based on at least three independent experiments with triplicates for each concentration level . To study the effects on the cell cycle of exponentially growing ch1 cells by flow cytometric analysis of their relative dna content, cells were harvested from culture flasks, seeded in complete medium into 90-mm petri dishes (1 10 cells / dish) and, after recovery for 24 h, exposed to various concentrations of the test compounds for 24 h. for this purpose, test compounds were diluted from dmso stocks with complete medium (see above) such that the effective dmso content did not exceed 0.5% . After exposure, treated and control cells were collected by scratching, washed with pbs, and stained with 5 g / ml propidium iodide overnight . Their fluorescence was measured with a facs calibur instrument (becton dickinson), and the obtained histograms were analyzed with cell quest pro software (becton dickinson). At least two independent experiments were performed for each setting, and 2.5 or 3.0 10 cells were measured per sample . The cdk - inhibitory capacities of test compounds were studied by a radiochemical assay using recombinant cdk1/cyclin b and cdk2/cyclin e isolated from sf21 insect cells and histone h1 as the substrate for phosphorylation, as described by marko et al . Briefly, mops - buffered assay mixtures containing the test compound (with a maximum of 1% dmso), the respective kinase / cyclin complex, histone h1, and 0.4 ci (-p)atp per sample were incubated for 10 min at 30 c . Aliquots of the solution were spotted onto phosphocellulose squares, which had been washed three times with 0.75% phosphoric acid, followed by acetone . The dried squares were measured in scintillation vials by -counting (perkin elmer tri - carb 2800tr; quanta smart software). Results were obtained in duplicate in at least two independent experiments, and ic50 values were calculated by interpolation . Several routes to 3-(1h - benzimidazol-2-yl)-1h - pyrazolo[3,4-b]pyridines have been proposed by johnson & johnson pharmaceutical research & development l.l.c . The first one was developed for 3-(1h - benzimidazol-2-yl)-1h - pyrazolo[3,4-b]pyridines with an unsubstituted benzimidazole moiety and involved sulfur - induced benzimidazole ring formation via the treatment of 5-bromo-1h - pyrazolo[3,4-b]pyridine-3-carboxaldehyde with 1,2-diaminobenzene . The poor reproducibility of this synthesis prompted the exploration of an alternative way, via 5-bromo-1h - pyrazolo[3,4-b]pyridine-3-carboxylic acid, which was used for the preparation of 3-(1h - benzimidazol-2-yl)-1h - pyrazolo[3,4-b]pyridines with a substituted benzimidazole moiety . The patented route to 5-bromo-1h - pyrazolo[3,4-b]pyridine-3-carboxylic acid (3) consists of four steps (see scheme 1, steps i iv): oxidation of 3-methyl-1h - pyrazolo[3,4-b]pyridine by kmno4 in the presence of a base with subsequent acidification with h2so4, esterification of 1h - pyrazolo[3,4-b]pyridine-3-carboxylic acid (1) in the presence of h2so4 in methanol, bromination of 1h - pyrazolo[3,4-b]pyridine-3-carboxylic acid methyl ester in an acoh / acona mixture, and hydrolysis of 5-bromo-1h - pyrazolo[3,4-b]pyridine-3-carboxylic acid methyl ester in the presence of naoh, followed by acidification with hcl . Reagents and conditions: (i) kmno4, naoh, 3 h, 100 c, h2so4; (ii) methanol, h2so4, reflux, 68 h, nahco3, 42% (i + ii); (iii) br2, acoh, acona, 115 c, overnight, chromatographic purification, 43%; (iv) naoh, meoh, reflux, 4 h, hcl, 100%; (v) br2, acoh, acona, 115 c, 2.53 h; and (vi) kmno4, naoh, 3 h, 100 c, hcl, 2435% (v + vi). We performed the synthesis of 3 in two steps (see scheme 1, steps v and vi): bromination of 3-methyl-1h - pyrazolo[3,4-b]pyridine in acoh / acona mixture and oxidation of crude 5-bromo-3-methyl-1h - pyrazolo[3,4-b]pyridine (2) by kmno4 in a basic medium, followed by acidification with 37% hcl, with an overall yield of 2435% . 5-bromo-3-methyl-1h - pyrazolo[3,4-b]pyridine (2) is a known compound, the synthesis of which is well - documented . For the benzimidazole ring formation, 1,2-diaminobenzene and 1-methoxymethyl-2,3-diaminobenzene the reported synthesis of 1-methoxymethyl-2,3-diaminobenzene (5) from 2,3-diaminobenzyl alcohol afforded the desired product in 34% yield (see scheme 2, step i). However, the instability and low yield of diamines, as well as the necessity to purify the desired ether using column chromatography, stimulated the search for a more - convenient procedure that was subsequently proposed: etherification of 2-amino-3-nitrobenzyl alcohol, followed by the reduction of 1-methoxymethyl-2-amino-3-nitrobenzene (4) with 10% pd / c in ethanol under a hydrogen atmosphere afforded 5 in 6575% yield (see scheme 2, steps ii and iii). Reagents and conditions: (i) nah, mei, dry thf, 0 c, 30 min, room temperature, overnight, chromatographic purification, 34% yield; (ii) nah, mei, dry thf, 0 c, 15 min, room temperature, 3 h, chromatographic purification, 6575% yield; (iii) 10% pd / c, ethanol, h2, room temperature, 1824 h, 100% yield . Patented benzimidazole ring formation by cyclization of the 3-carboxyl group of 5-bromo-1h - pyrazolo[3,4-b]pyridine-3-carboxylic acid (3) with substituted 1,2-diaminobenzenes was realized via amide formation using coupling reagents, followed by treatment with glacial acetic acid . Hatu (n, n, n,n-tetramethyl - o-(7-azabenzotriazol-1-yl)uronium hexafluorophosphate) was used as a coupling reagent . Three 3-(1h - benzimidazol-2-yl)-1h - pyrazolo[3,4-b]pyridines (l1l3) (where x = h, br; and y = h, ch2och3) have been synthesized in this work (see chart 1): 3-(1h - benzimidazol-2-yl)-1h - pyrazolo[3,4-b]pyridine (l1) is a new compound that we have prepared as a model ligand for coordination to metals; 3-(1h - benzimidazol-2-yl)-5-bromo-1h - pyrazolo[3,4-b]pyridine (l2) was previously known as boc - protected compound prepared via 5-bromo-1h - pyrazolo[3,4-b]pyridine-3-carboxaldehyde;5-bromo-3-(4-methoxymethyl-1h - benzimidazol-2-yl)-1h - pyrazolo[3,4-b]pyridine (l3) was synthesized via 5-bromo-1h - pyrazolo[3,4-b]pyridine-3-carboxylic acid (3) and patented as a potential cdk inhibitor and antiproliferative agent . For the synthesis of l1l3, we used n, n-carbonyldiimidazole (cdi) as an amide - coupling reagent, because it is relatively inexpensive and the side products, carbon dioxide and imidazole, could be easily removed from the reaction mixture . Cdi - mediated amidation of acids 1 and 3 was performed as shown in scheme 3 (steps i and ii). In the first step, the acyl - imidazolides 6 and 7 were obtained in dry dmf at room temperature and isolated as white solids . The yields based on 3-methyl-1h - pyrazolo[3,4-b]pyridine are: 2529% (6) and 1316% (7). In the second step, monoacylation of phenylenediamines (1,2-diaminobenzene and 1-methoxymethyl-2,3-diaminobenzene (5)) using acyl - imidazolides was performed in dmf at 8085 c . Reagents and conditions: (i) cdi, dry dmf, room temperature, 2024 h; (ii) 1,2-diaminobenzene or 5, dry dmf, 8085 c; 520 h; and (iii) glacial acoh, 120125 c, 2.54.5 h, chromatographic purification . Amides 810 were used without further purification in ring closure reactions in a glacial acetic acid at 120125 c and afforded the desired 3-(1h - benzimidazol-2-yl)-1h - pyrazolo[3,4-b]pyridines: l1 (5560%), l2 (5861%), and l3 (4451%), based on 6 and 7 (see scheme 3, step iii). The reported synthesis of l3 is a one - pot approach for amide formation using hatu with 57% yield, followed by cyclization under acidic conditions (acetic acid) with 87% yield . Thus, the ligands l1, l2, and l3 have been prepared in 7, 8, and 11 steps, correspondingly . Finally, the ligands l1l3 were reacted with [mcl2(-p - cymene)]2 (where m = ru, os) in a 2:1 molar ratio in dry ethanol at room temperature to give [mcl(-arene)(l)]cl complexes (11a, 11b, 12a, 12b, 13a, 13b) in quantitative yields . Crystallization of [rucl(-p - cymene)(l3)]cl (13a) in etoh or etoh / et2o resulted in xrd - quality crystals of [rucl(-p - cymene)(l3h)] (13c), while the crystallization of 13a in methanol afforded crystals of composition [rucl(-p - cymene)(l3)]cl[rucl(-p - cymene)(l3h)]ch3oh (13dch3oh). The osmium(ii) analogue 13e0.75ch3oh0.25h2o was obtained via the crystallization of 13b in methanol . The full assignment of proton, carbon, and nitrogen resonances for l1l3, 11a, 11b, 12a, 12b, 13a, and 13b is quoted in tables s1s3 in the supporting information . 3-(1h - benzimidazol-2-yl)-1h - pyrazolo[3,4-b]pyridines with an unsubstituted benzimidazole moiety (l1, l2) display one set of signals . L1 is characterized by three doublets of doublets for h4a, h5a, h6a (8.85, 7.39, 8.66 ppm, correspondingly) of pyrazolopyridine moiety, two doublets for h4b, h7b (7.54 and 7.75 ppm), the overlapped h5b, h6b proton signals in one multiplet (7.24 ppm) for a benzimidazole moiety and two singlet resonances for h1a and h1b (for atom numbering, see chart 1). The substitution of h5a by bromine (l2) results in reduced multiplicity for the h4a and h6a signals (two doublets at 8.99 and 8.75 ppm), whereas the benzimidazole moiety spectrum remains almost unchanged . Two singlets were attributed to nh protons and related to pyrazolopyridine (h1a, at 14.19 (l1), 14.43 (l2) ppm) and benzimidazole (h1b, at 13.11 (l1), 13.19 (l2) ppm) moieties . Nmr spectra for 11a, 11b, 12a, and 12b, where l1 and l2 coordinate as bidentate ligands via n2a and n3b with the formation of a stable five - membered chelate cycle, show one set of signals . There was no evidence for monodentate or tridentate coordination of ligands with the formation of dinuclear or polynuclear complexes . Coordination of l1 and l2 to ruthenium(ii) made it possible to assign the two doublets to proton resonances of h4b and h7b of the benzimidazole moiety . In the h, h roesy plots, one of them has cross - peaks with a ch cymene ring and the nearest to them is h4b (e.g., at 8.11 (11a), 8.06 (12a) ppm). A singlet at 14.91 (11a), 14.34 (12a) ppm was assigned to nh proton and showed no couplings with other atoms . The nitrogen resonance shift at 128.7 (11a), 127.3 (12a) ppm is closer to the benzimidazole nh chemical shift in metal - free ligands (121.3 (l1, l2) ppm) and, therefore, was assigned as n1b (see table s3 in the supporting information). The h1b resonance shows a significant shift by 1.8 and 1.15 ppm for 11a and 12a, respectively, upon ligand coordination (l1 and l2) to the metal(ii)-arene moiety . The nearest to the metal binding site pyrazolopyridine proton h1a was not detected for 11a, 11b, 12a, and 12b, and the proton resonance of h1b was also not seen for 11b or 12b . L3 displays two sets of signals originated from 7b - l3 and 4b-l3 tautomers (see chart 1). The signals of pyrazolopyridine moieties are partially overlapped (e.g., h1a (h1a) at 14.47 and 14.43 ppm, h4a (h4a) at 8.99 and 8.98 ppm, h6a (h6a) at 8.75 ppm), whereas the signals of the benzimidazole moieties are better resolved (see table s1 in the supporting information). According to the h, h roesy plot, one of the ch2 groups at 4.80 ppm couples with the nh proton at 13.25 ppm, indicating their attribution to the 7b - l3 tautomer, whereas another nh proton at 13.22 ppm gives a cross - peak with h7b at 7.47 ppm and belongs to 4b-l3 tautomer (figure 1). Tautomers 7b - l3 and 4b-l3 are present in solution in 1:1.3 molar ratio and give, for the substituted benzimidazole moiety, two singlets (h1b at 13.22 ppm, h1b at 13.25 ppm), two doublets of doublets (h7b at 7.47 ppm, h4b at 7.72 ppm), one multiplet (h5b, h6b, h5b, h6b at 7.287.21 ppm), two ch2 (4.80 (h10b), 4.96 (h10b) ppm) and two ch3 singlets at 3.37 (h11b) and 3.44 (h11b) ppm . The absence of cross - peaks between h7b and h4b in the h, h cosy plot supports their relation to the two different molecules . The binding site in 4b-l3 tautomer is sterically shielded by a methoxymethyl group . Consistent with this nmr spectra display, only one set of signals is shown for 13a and 13b with the coordination of the 7b - l3 tautomer to ruthenium(ii) and osmium(ii) via n2a and n3b (see scheme 4). The preference for coordination of the 7b - l3 tautomer is also confirmed by h, h roesy plots: h4b (7.99 (13a), 7.91 (13b) ppm) has couplings with ch protons of cymene ring . The cross - peak between h10b at 4.88 ppm (13a) and nh at 13.88 ppm (13a) enabled the assignment of this singlet to a benzimidazole moiety (h1b). In addition, the chemical shifts for the c atoms of the benzimidazole moiety (c4b, c7b, c5b, c6b) of the coordinated ligand and metal - free 7b - l3 tautomer are very similar (see table s2 in the supporting information). The nitrogen resonance at 122.9 ppm (13a) compares well to the benzimidazole nh chemical shift in metal - free l3 at 121.4 ppm . As for 11a, 11b, 12a, and 12b, the nearest to the coordination place pyrazolopyridine proton h1a resonance was not detected . According to the h, h roesy plots of 11a, 12a, 13a, and 13b only ch cymene ring protons have couplings with the nearest h4b benzene ring proton, suggesting that the isopropyl or methyl groups are further away from the h4b proton . The results of the xrd studies of [oscl(-p - cymene)(l1)]cl4h2o (11b4h2o), [oscl(-p - cymene)(l2)]cl (12b), [oscl(-p - cymene)(l2)]cl2ch3oh2h2o (12b2ch3oh2h2o), [rucl(-p - cymene)(l3h)] (13c), [rucl(-p - cymene)(l3)]cl[rucl(-p - cymene)(l3h)]ch3oh (13dch3oh) and [oscl(-p - cymene)(l3)]cl[oscl(-p - cymene)(l3h)]0.75ch3oh0.25h2o (13e0.75ch3oh0.25h2o) are shown in figures 2, figure s2 in the supporting information, and figures 36, respectively . All complexes have a typical three - legged piano - stool geometry of ruthenium(ii) and osmium(ii) arene complexes, with an -bound p - cymene ring forming the seat and three other donor atoms (two nitrogens n1 and n5 of the corresponding 3-(1h - benzimidazol-2-yl)-1h - pyrazolo[3,4-b]pyridine and one chlorido ligand) as the legs of the stool . Selected bond distances and angles are quoted in the figure captions . All complexes crystallize as racemates, because of the presence of the stereogenic metal center . Fragment of the crystal structure of 11b4h2o showing nitrogen atoms n3 and n4, which act as proton donors in intermolecular hydrogen bonding interactions n3hcl2 [n3cl2 3.067(7), n3hcl2 177.3] and n4ho3 [n4o3 2.671(9), n4ho3 170.9]; thermal ellipsoids have been drawn at 50% probability level . Selected bond lengths and angles: os cl1, 2.421(2); os c(arene)av, 2.198(32); c1n2, 1.349(11); n2n1, 1.366(10); n1c6, 1.357(11); c6c7, 1.428(12); c7n5, 1.345(11); n5c13, 1.391(11); n1os n5, 75.6(3); n1os cl1, 85.5(2); n5os cl1, 83.4(2). The bidentate 3-(1h - benzimidazol-2-yl)-1h - pyrazolo[3,4-b]pyridines, which can have different substituents in positions 5a and 7b, reveal different acid base properties . It can act as a neutral organic ligand, with nitrogen atoms n2 and n4 as proton donors involved in intermolecular hydrogen bonding interactions n4ho1(x + 1, y + 1, z + 2) [n4o1, 2.730(4); n4ho1, 176.1] and n2ho3(x + 2, y + 1, z + 1 [n2o3, 2.697(4); n4ho1, 172.3] with one methanol and one water molecule, respectively, as is the case for 12b2ch3oh2h2o (figure 3) or n2hcl2(cl2x) and n4hcl1(x, y, z + 2) [n4cl1, 3.213(9); n4ho1, 162.91] in 12b (see figure s2 in the supporting information), correspondingly . The ligand can be protonated at n3 (n3hcl2) and deprotonated at n2 [n2h o4 (x + 1, y + 1, z + 1) with n2o4 2.923(9), n2h o4 138.7] (overall charge zero) with atom n4 as a proton donor to one of the four co - crystallized water molecules n4ho3, as occurs in 11b4h2o (see figure 2). Ortep plot of the structure of the cation [oscl(-p - cymene)(l2)] in 12b2ch3oh2h2o . Thermal ellipsoids have been drawn at the 50% probability level . Selected bond lengths and angles: os cl1, 2.4043(1); os c(arene)av, 2.197(26); c1n2, 1.361(5); n2n1, 1.344(4); n1c6, 1.336(5); c6c7, 1.447(6); c7n5, 1.335(5); n5c13, 1.380(5); n1os n5, 74.73(13), n1os cl1, 84.29(10); and n5os cl1, 83.25(10). In 13c, the ligand was found to be deprotonated at n2, acting as a proton acceptor in the intermolecular hydrogen bonding interaction n2h n4 (i denotes symmetry transformations x, y + 1.5, z + 0.5) used to generate equivalent atoms) [n2n4, 2.896(7); n2h n4, 155.6] (see figure 4). Ortep plot of the complex [rucl(-p - cymene)(l3h)] (13c). Thermal ellipsoids have been drawn at 30% probability level . Selected bond lengths and angles: ru cl, 2.399(2); ru n1, c(arene)av, 2.186(31); c1n2, 1.366(8); n2n1, 1.353(7); n1c6, 1.362(7); c6c7, 1.426(9); c7n5, 1.335(8); n5c13, 1.398(8); n1ru n5, 75.9(2); n1ru cl, 87.35(17); and n5ru cl, 85.73(17). Complexes 13dch3oh and 13e0.75ch3oh0.25h2o crystallized both in the centrosymmetric triclinic space group p1. The asymmetric unit in both consists of a neutral complex [mcl(-p - cymene)(l3h)] and a complex cation [mcl(-p - cymene)(l3)] (m = ru or os), a chloride counteranion and co - crystallized solvent (methanol or methanol / water). Deprotonation of the organic ligand in [mcl(-p - cymene)(l3h)] is corroborated by the presence of hydrogen bonding of the type n2ah n2b (x + 1, y + 1, z + 1) in the crystal structure of the ruthenium complex 13dch3oh (figure 5) and a similar interaction n2bh n2a (x, y + 1, z) [n2bn2a, 2.810(9); n2bh n2a, 170.1] in the crystal of the osmium analogue 13e0.75ch3oh0.25h2o . In figure 6 the structure of [oscl(-p - cymene)(l3h)] is shown . In both structures, the atoms n4a and n4b act as proton donors in strong hydrogen bonding interactions to the chloride counteranion, namely, n4ah cl2 (x + 1, y + 2, z + 1) [n4cl2, 3.275(6); n4ah cl2, 176.9], n4bh cl2 [n4bcl2, 3.211(5); n4bh cl2, 176.0] (13dch3oh) and n4ah cl2 (x + 1, y + 1, z + 1) [n4acl2, 3.273(8); n4ah cl2, 177.0], n4bh cl2 [n4bcl2, 3.204(7); n4bh cl2, 177.0] (13e0.75ch3oh0.25h2o). Fragment of the crystal structure of [rucl(-p - cymene)(l3)]cl[rucl(-p - cymene)(l3h)]ch3oh (13dch3oh) showing the intermolecular hydrogen bonding n2a hn2b [n2an2b (x + 1, y + 1, z + 1), 2.814(7); n2a hn2b, 163.3]. Selected bond lengths and angles: ru1a cl1a, 2.3952(17); ru1a c(arene)av, 2.194(33); c1a n2a, 1.358(8); n2a n1a, 1.354(7); n1a c6a, 1.350(8); c6a c7a, 1.441(9); c7a n5a, 1.335(8); n5a c13a, 1.381(8); n1a ru1a n5a, 75.6(2); n1a ru1a cl1a, 84.45(15); and n5a ru1a cl1a, 85.05(15). Ortep plot of [oscl(-p - cymene)(l3h)] in [oscl(-p - cymene)(l3)]cl[oscl(-p - cymene)(l3h)]0.75ch3oh0.25h2o (13e0.75ch3oh0.25h2o). Selected bond lengths and angles: os1a cl1a, 2.402(2); os1a n1a, 2.068(7); os1a n5a, 2.086(7); os1a c(arene)av, 2.192(25); c1a n2a, 1.349(10); n2a n1a 1.369(9); n1a c6a, 1.361(10); c6a c7a, 1.431(11); c7a n5a, 1.339(10); n5a c13a, 1.398(11); n1a os1a n5a, 75.1(3); n1a os1a cl1a, 83.56(18); and n5a os1a cl1a, 84.2(2). Ligands l1l3, as well as the corresponding ruthenium(ii) (11a13a) and osmium(ii) (11b13b) arene complexes, were studied with regard to their capacity of inhibiting cell growth in vitro in the human cancer cell lines ch1 (ovarian carcinoma), sw480 (colon carcinoma), and a549 (non - small cell lung cancer), yielding the ic50 values listed in table 2 . All compounds show the strongest effect in the generally chemosensitive ch1 cells, whereas the more chemoresistant a549 cells are also less affected by the compounds investigated here .> l2> l1, indicating that bromination (l2, l3) and, even more so, the double substitution (bromination and an additional replacement of h by a methoxymethyl group (l3)) are advantageous, with regard to activity . These structure activity relationships are also reflected in the rank orders of the corresponding ruthenium and osmium complexes for the ruthenium complexes, 13a> 12a> 11a, and for the osmium complexes, 13b> 12b> 11b . However, the ic50 values are shifted to higher concentrations (see figure 7). The differences between the ruthenium and osmium analogues are mostly small (ic50 values differ only up to a factor of 2.4), with the osmium complexes being at least as active as their ruthenium counterparts . Ch1 denotes ovarian cancer, human; sw480 denotes colon carcinoma, human; and a549 denotes non - small - cell lung carcinoma, human . 50% inhibitory concentrations (mean value standard deviation from at least three independent experiments) obtained by the mtt assay (96-h exposure). Concentration effect curves of each ligand, compared to the corresponding ruthenium and osmium complexes, in ch1 ovarian cancer cells (mtt assay, 96 h exposure): (a) l1, 11a, 11b; (b) l2, 12a, 12b; and (c) l3, 13a, 13b . Both the presence of substituents in the ligands and complexation result in a marked shift of antiproliferative activity . Since 3-(1h - benzimidazol-2-yl)-1h - pyrazolo[3,4-b]pyridines have been reported to be potent cdk inhibitors, we expected the investigated ligands and complexes to induce cell cycle perturbations . To confirm this assumption in a sensitive cell line, exponentially growing ch1 cells were treated with the compounds for 24 h, stained with propidium iodide, and analyzed for their dna content by fluorescence - activated cell sorting (facs). Surprisingly, the metal - free ligands l1l3 turned out to exert only modest effects on cell cycle distribution, with a slight increase of the g2/m fraction from 32% in the untreated control to 53% by 20 m l2 as the strongest effect observed in this setting (higher concentrations of this compound led to disintegration of cells already after 24 h). However, the less cytotoxic ruthenium complexes 12a and 13a, both bearing substituted ligands (l2 and l3 correspondingly), cause a more pronounced g2/m phase arrest, as reflected by an increase of this cell fraction to 65% at 80 m and 59% at 40 m, respectively, and a concomitant decrease of the g0/g1 fraction to 21% and 24% (compared to 42% in controls), whereas ruthenium complex 11a bearing an unsubstituted ligand l1 is devoid of activity on the cell cycle . On the other hand, the osmium complexes do not generally show stronger effects on the cell cycle than the metal - free ligands, perhaps with the exception of 13b, which induces an increase of the g2/m fraction up to 53% at 80 m, accompanied by a decline of the g0/g1 fraction to 31% (see figure 8). Concentration - dependent effects of metal - free ligands (top), and the corresponding ruthenium (middle) and osmium complexes (bottom), on the cell cycle distribution of ch1 cells (() g0/g1, () s, and () g2/m phase). Although the lack of generally pronounced cell cycle effects does not argue for a strong role of cdk inhibition in the mechanism of action of the investigated compounds, inhibitory potencies were studied in cell - free experiments with two recombinant cdk / cyclin complexes, by means of the histone h1 kinase assay . Results reveal that all compounds are capable of inhibiting kinase activities in a concentration - dependent manner, being more effective on cdk2/cyclin e than on cdk1/cyclin b (see figure 9). In contrast to the observed cell cycle effects, but in accordance with antiproliferative activities, cdk - inhibitory potency of the metal - free ligands is consistently higher than that of the metal complexes . In particular, only l1l3 effectively inhibit cdk2/cyclin e in low concentrations (1 m or 10 m), whereas all complexes require higher concentrations to exert> 50% inhibitory effects . As in the mtt assay, differences between the effects of corresponding ruthenium and osmium complexes are minor, compared to the differences from those of the metal - free ligands . Concentration - dependent effects of metal - free ligands (l1l3) as well as corresponding ruthenium (11a13a) and osmium complexes (11b13b), on kinase activities of recombinant cdk1/cyclin b (top) and cdk2/cyclin e (bottom). The known multistep synthesis of 3-(1h - benzimidazol-2-yl)-1h - pyrazolo[3,4-b]pyridines, which we have modified, essentially afforded three organic compounds (l1l3) that possess cdk - inhibiting properties . These were used as bidentate ligands, and six novel organometallic complexes of the general formula [mcl(-p - cymene)(l)]cl, where m = ru (11a, 12a, 13a) or os (11b, 12b, 13b) and l = l1l3, have been synthesized and comprehensively characterized using spectroscopic and x - ray diffraction methods . Complexation of l1l3 with ruthenium or osmium yielded compounds with increased solubility in the biological medium, yet lowered antiproliferative activity in human cancer cell lines . Modulation of biological activities by substitution at the ligands can be accomplished in the metal - free molecules and their metal complexes in a similar way . The known cdk - inhibitory activity of the ligands could be confirmed in cell - free experiments, in particular in cdk2/cyclin e, and their stronger effects on cdk activity parallel their higher capacity of inhibiting cancer cell growth in vitro, compared to their metal complexes . Nevertheless, the lack of pronounced effects on the cell cycle of chemosensitive ovarian cancer cells argues against a major role for inhibition of cell growth, at least in this setting.
|
Fibro - osseous lesions of the jaws represent a diverse group of entities which include developmental (hamartomatous) lesions, reactive or dysplastic processes and neoplasms . Benign fibro - osseous lesions of the head and neck region are uncommon and represent a wide range of tumors sharing some histopathological features; which comprise fibrous dysplasia, ossifying fibroma (of), and cement - osseous dysplasia . Of can be further divided into conventional and juvenile forms (juvenile ossifying fibroma (jof)). Jof has to be distinguished from a larger group of ofs on the basis of the age of the patient, site of involvement and clinical behaviour . According to the world health organization (who) classification of odontogenic tumors 2005, jof is further subdivided into psammomatoid jof (psjof) and trabecular jof (trjof). Benjamins in 1938 first reported psjof as an osteoid fibroma with atypical ossification of the frontal sinus, golgi in 1949 called it as psammomatoid ossifying fibroma, and johnson in 1952 coined the term juvenile active ossifying fibroma . According to who classification of odontogenic tumors 2005, it was named as the term juvenile psammomatoid ossifying fibroma is now used to designate the neoplasm of the craniofacial skeleton of young age with well - defined clinicopathological features . The pathogenesis of these jaw lesions are related to the abnormal development of basal generative mechanism that is essential for root formation . This paper highlights a rare entity of psjof involving the maxillary sinus and nasal cavity on the left side . A 20-year - old female patient reported with a painless progressive swelling in the left cheek region and difficulty in breathing since 1 year . Past medical history revealed that the patient underwent surgery in a private dental clinic 5 years back for the impacted tooth 23 which was associated with pathology . The swelling was 6 4 cm in size approximately extending anteroposteriorly from ala of the nose to 5 cm from tragus of the ear on the left side . Nasal polyp was seen in the left nostril with obliteration of left ala of the nose [figure 1]. Nasal polyp seen in left nostril with obliteration of left ala of nose intraoral examination presented a swelling extending anteroposteriorly from the distal aspect of 21 to mesial aspect of 26; medially till the mid palatine raphe and laterally the buccal vestibule was obliterated and the swelling extended from 21 to 26 . Paranasal sinus (pns) x - ray revealed haziness in the left maxillary sinus . Computed tomography (ct) scan confirmed well - defined mixed radiolucent and radiopaque areas with calcifications extending superoinferiorly from infraorbital rim to alveolus and anteroposteriorly from the nasal septum to post zygomatic buttress on left side [figure 2]. Axial computed tomography revealing well - defined radiolucent and radiopaque areas with calcifications histopathological examination of incisional biopsy revealed connective tissue stroma with numerous spherical / irregular ossifications interspersed with cellular fibrous tissue [figure 3]. The ossifications showed peripheral brush border surrounded by an eosinophilic rimming [figure 4]. Haemorrhagic areas were also seen . The constellation of clinical, radiological, and histopathological features of this lesion supported an interpretation of psammomatoid variant of jof . Photomicrograph of hematoxylin and eosin (h&e) stained section (100) showing numerous spherical and irregular calcifications interspersed with fibrous tissue photomicrograph of h&e stained section (400) showing peripheral brush border surrounded by eosinophilic rimming under general anesthesia, a weber - ferguson incision was given to expose the complete lesion . Subtotal maxillectomy was performed and the tumor mass along with nasal and ethmoidal polyps were removed with the help of a chisel and mallet . After complete removal of the mass, borders were carefully osteotomized to avoid the chances of recurrence [figure 5]. The excised specimen was sent for histopathological examination [figure 6] and the diagnosis of psjof was confirmed . Jof are benign, potentially aggressive fibro - osseous lesions of the craniofacial bones . The word psjof is a unique variant of jof that has a predilection for orbit and pnss accounting for about 72% followed by calvarium 11%, maxilla 10%, and mandible 7% . The ethmoidal sinuses are most commonly involved, followed by the frontal sinuses, the maxillary sinuses, and the sphenoid sinus . Both the variants of jof show a predilection for males . The swelling in this case is associated with maxilla involving maxillary sinus and nasal cavity in a 20-year - old female patient . Table 1 summarizes the clinical presentation of case series of psjof reviewed in the literature . The patients may develop exopthalmoses, bulbar displacement, and nasal obstruction . In the present case because of the extension of the tumor into the nasal cavity, nasal obstruction was present on the left side . Radiographically, psjof can be radiolucent, radiopaque, or mixed depending upon cystic changes and the degree of calcification . Sclerotic changes are evident in the lesion which may show a ground - glass appearance . Histologically, psjof shows highly cellular fibrous stroma often with whorled pattern containing closely packed spherical ossicles resembling psammoma bodies . These ossicles are round to oval in shape which have a basophilic center and peripheral pink rim showing some radiating fibers which corroborates with the microscopic features provided in the present case . Psjof should be differentiated from extracranial meningioma with psammoma bodies, which demonstrates epithelial membrane antigen (ema) positivity and even the psammomatoid ossicles in psjof are clearly different from spherical true psammoma bodies . Other differential diagnosis include fibrous dysplasia, osteoma, cementoblastoma, well - differentiated osteosarcoma, psammomatous extracranial meningioma [table 2]. Differential diagnosis the clinical management of smaller lesions is simple excision with surrounding marginal bone, whereas larger lesions warrant more aggressive surgical management . Prognosis is good with a recurrence rate of about 30 - 58% . No malignant transformation has been documented . Even though these lesions tend to locally invade, there were no cases of metastasis being reported . Therefore, it is very important to correlate the clinical, radiographical, and histopathological findings for proper treatment . Early detection and complete surgical excision of the lesion followed by long - term follow - up is necessary for proper clinical management.
|
Endoscopic methods are among the most important and frequently employed means of treating pancreatic pseudocysts . When possible an endoscopic approach should generally be attempted in all patients with pseudocysts, and for pancreatic fluid collections endoscopic transmural drainage is the treatment of choice . If the cyst contains more than 2/3 solid material a self - expandable stent should be selected to ensure effective drainage . An additional advantage of the self - expandable metal stent is that the necrotic tissue contained within the cyst can be actively removed using an endoscope . This article discusses the unusual case of a stent that became dislodged and migrated into the omental bursa . Following this migration some time was allowed to elapse, and the gastrotomy closed completely . Since a simple endoscopic retrieval was no longer possible, a combined laparoscopic - endoscopic technique (rendezvous technique) was used instead, and the stent was successfully retrieved . In 2013, a 49-year - old male smoker with a history of diabetes mellitus and arterial hypertension developed severe necrotizing pancreatitis . Imaging revealed paralytic ileus along with an expanding cystic formation near the liver hilus and pancreatic head with compression of the duodenum . A pseudocyst near the left abdominal wall with enormous but stable proportions was also found to be compressing the left colon transversum (14 cm). Due to the extreme thinness of the wall areas of necrosis in the corpus area developed, necessitating transgastral cystotomy and placement of a wall stent (niti - s nagi stent - taewoong - medical co, seoul, south korea, 14 mm wide, 22 mm long). Twenty - four hours later, however, the stent became dislodged and migrated into the omental bursa . An attempt at endoscopic removal the following day was unsuccessful, making the insertion of a second stent (nagi fully covered taewoong,16 mm wide, 22 mm long) necessary . Endoscopic retrograde cholangiopancreatography (ercp) was then performed, along with papilotomy and insertion of an 8.5 fr . Two weeks later, after significant clinical improvement and drainage of necrotic tissue, the second transgastric stent was removed with no complications . For technical reasons, retrieval of the migrated stent was not possible . At follow - up gastroscopy 4 weeks later the gastric wall had completely closed and hence that endoscopic localization of the stent was no longer possible . In november 2013 the pseudocysts had regressed significantly, and a computed tomography of the abdomen showed the migrated stent in the omental bursa with no direct contact to the gastric wall . In february 2014, we decided to attempt a laparoscopic - endoscopic retrieval of the displaced wall stent . In the first step, intraoperative endoscopy demonstrated normal gastric mucosa so that a purely macroscopic localization of the stent was not possible [figure 1]. After localization of the stent via image converter we made a targeted 3 cm incision into the posterior gastric antrum using an endo knife (erbe, germany). Due to the location of the stent deep within the omental bursa neither optical nor palpatory contact could be made, and consequently, endoscopic retrieval was not an option . In the next step, first, electrocoagulation was used to make three incisions in the anterior wall of the greater gastric curvature (two in antrum, one in fundus). Then, 3 (applied medical kii, usa) 5 mm trocars were inserted [figure 1]. Dissection within the omental bursa was performed using two dissectors, inserted through an incision that had been made endoscopically . After localization of the stent and some blunt dissection it was possible to carefully dislodge the stent into the gastric lumen [figure 2]. After further inspection, the transgastral trocars were removed, and the gastric wall incisions were closed with lahodny stitches (ethicon, usa). The postoperative clinical course was without complications, and the patient was discharged on the 6 postoperative day . At follow - up 4 weeks later, no complications were found . The gastric wall has closed, and the stent cannot be localized (a). Three applied kii 5 mm trocars in the stomach (b) blunt dissection near the omental bursa after incision and retrieval of the stent (a). Currently, endoscopic ultrasound - guided drainage is a safe and effective means of treating pancreatic fluid collections . Compared with surgical or percutaneous drainage it is less invasive and results in lower mortality, costs, and hospitalization times . Drainage - related complications either may be related directly to the procedure or can occur in relation to the stents themselves . The stent should not, however, be removed before complete involution of the pseudocyst or before the passage of at least 2 months . On average, 15% of stents will become accidentally dislocated, but efforts to develop technically superior stents continue . Tllez - vila et al ., for example, report on fully covered self - expandable metal stents with an innovative anti - migration system . Describe a stent - in - stent combination which employs the mechanical advantages of both plastic stents and fully covered self - expandable metal stents . Although these new solutions will help reduce the rate of migration, they will not eliminate it completely . In most cases of stent migration endoscopic retrieval can be performed without difficulty . In cases of extraluminal loss, however, a surgical approach is often necessary, and a minimally invasive exploration of the abdominal cavity is the approach of choice . Retrieval from the retroperitoneal space may pose a more significant challenge due to the proximity of the large vessels . When endoscopic retrieval fails a combined laparoscopic - endoscopic approach offers an alternative to open surgery . The choice of technique is likely best predicated by individual patient presentation and local expertise . With this endoscopy - laparoscopy combination (rendezvous technique)
|
Adenomyoepithelioma has been described as a rare benign neoplasm that occurs almost exclusively in the breast . In the breast it is defined as a neoplasm composed of two structures, namely, tubules limited by an inner epithelial layer of duct - like cells and an outer layer with mostly clear myoepithelial cells . Apart from the breast, adenomyoepitheliomas have been described in the salivary glands and in the lung . In the skin, these neoplasms seem to be exceedingly rare, with only few reports of adenomyoepitheliomas published to date [47]. We present the case of a 53-year - old woman with a clinically benign nodular cutaneous lesion that revealed histopathologic and immunohistochemical features of adenomyoepithelioma . A 53-year - old woman presented to her dermatologist with a 3 cm asymptomatic nodule on the left forearm . The biopsy specimen consisted of a 2.5 1.9 1.5 cm tan ellipse of skin and contained a hard yellow nodule measuring 1.5 cm in greatest dimension . Examination of the sections at scanning magnification revealed beneath an intact epidermis a zone of fibrosis within the upper part of the dermis (figure 1 a, b). Beneath the scar, there was a large, lobulated neoplasm, which for the most part was surrounded by a compressed fibrous pseudocapsule . Each of the aggregates of neoplastic cells varied in sizes and shapes and some were large and nodular (figure 1a c). At higher magnification, most of the cells that constituted the lesion displayed myoepithelial differentiation with polygonal and plasmacytoid features (figure 2). The cells presented sometimes as solid sheets, but also as cords and solitary units . In places glandular and ductal structures were evident; in some areas apocrine - type secretion within glandular structures was found (figure 2 a c). F). In some areas cells were present within a myxoid stroma (figure 2 g foci of cells with pleomorphic nuclei and mitotic figures were identified (figure 2 k the myoepithelial cellular component of the neoplasm stained for s100 protein and was negative for cytokeratin and carcinoembryonic antigen (cea) expression . We describe a cutaneous neoplasm composed of myoepithelial cells and a focal epithelial and glandular component . The s100 positivity indicates myoepithelial cells, while epithelial - glandular cells are negative for s100 protein expression . Based on findings by conventional microscopy and immunohistochemistry, this neoplasm shows myoepithelial differentiation and focal epithelial lined tubules with features of apocrine secretion, findings that are consistent with the diagnosis of primary adenomyoepithelioma of the skin . While various adnexal neoplasms with a myoepithelial cellular component have been described in the skin, adenomyoepithelioma of the skin seems to be extremely rare . What are the criteria that distinguish adenomyoepithelioma from other benign cutaneous neoplasms with myoepithelial differentiation? While myoepithelioma is defined as a benign neoplasm consisting exclusively of myoepithelial cells embedded in a myxoid stroma, adenomyoepithelioma shows in addition to myoepithelial cells a second component displaying various degrees of epithelial - ductal differentiation . Chondroid syringoma, at the other end of the spectrum is a benign adnexal neoplasm that, in addition to apocrine epithelium, manifests various degrees of follicular and/or sebaceous differentiation . Clinically, myoepitheliomas occur usually in children and young adults and are located on the extremities, while mixed apocrine tumors affect older individuals and are usually found on the face . The few cases of cutaneous adenomyoepitheliomas that have been described to date, including the present case, were described in older patients and were located on the extremities and on the trunk . Pleomorphic adenoma in the breast is regarded as the analogue to mixed apocrine tumor in the skin, while adenomyoepithelioma of the breast is defined as a neoplasm with nodular aggregations of clear myoepithelial cells that surround epithelial lined tubules . Occasionally, the myoepithelial component predominates and loses the close association with epithelial structures . In the skin, the predominance of myoepithelial cells in relation to ductal epithelial structures lacking features of follicular and/or sebaceous differentiation separates this neoplasm from mixed apocrine tumor . Therefore, myoepithelioma, adenomyoepithelioma and mixed apocrine tumor lie in the spectrum of neoplasms with pure myoepithelial differentiation at one end and apocrine - sebaceous - follicular differentiation at the other . The most important question for the patient is the biologic potential of such a lesion . While the chronic course in our patient and the majority of the histopathologic features suggest a benign neoplasm, foci of cells having pleomorphic nuclei and mitotic figures were present . Both findings could indicate the potential for locally aggressive behavior and/or metastasis, as has been rarely described in adenomyoepitheliomas of the breast . Therefore, adenomyoepitheliomas of the skin should be completely excised, as has been recommended in the reported case.
|
Although the human genome sequence was released a decade ago, the role of functional noncoding rnas (ncrnas) is much less understood compared with their coding counterparts . Several previous studies have demonstrated that the human genome is pervasively transcribed (14), but thoroughly cataloging all the rna species (especially ncrna) is challenging . Undiscovered ncrnas might be rare, transient or beyond the detection limits of conventional approaches . Furthermore, ncrnas also tend to be idiosyncratic to species and tissues (5,6). Nevertheless, advances in rna - seq have provided a new method of surveying the whole transcriptome to an unprecedented degree . Recent genome - wide studies revealed tens of thousands of novel transcripts, the majority of which were long noncoding rnas (lncrnas,> 200 nt) (49). Although a few dozen lncrnas have been characterized to some extent and are reported to have critical roles in diverse cellular and disease development processes (6,1014), the biogenesis and function of most lncrnas remain unclear . Accurate and quantitative assessment of coding potential is the first step toward comprehensive annotation of newly discovered transcripts . Until now, prediction of coding potential heavily relied on sequence alignment, either pairwise homology search for protein evidence such as that used in the coding - potential calculator (cpc) and portrait methods (15,16) or multiple alignments to calculate the phylogenetic conservation score such as that used in the phylogenetic codon substitution frequencies (phylocsf) and rnacode methods (17,18). Alignment - based approaches are particularly useful for highly conserved protein - coding genes and, to a lesser extent, short genes encoding housekeeping or regulatory rnas (e.g. Snrnas, snorna, transfer rna). However, these approaches cannot immediately apply to all the novel transcripts because of several intrinsic limitations . First, most newly discovered transcripts are lncrnas, which tend to be lineage specific and less conserved (5,6). For example, only 29 of 550 lncrnas identified from zebrafish had detectable sequence similarity with putative mammalian orthologs (6), and only 993 of 8195 human lncrnas have orthologous transcripts in other species (5). Second, considerable fractions of lncrnas are overlapped with either the sense or antisense strand of protein - coding genes . These lncrnas cannot be correctly classified by homology searching because they would have significant matches to protein - coding genes (3,8,19). Third, the reliability of alignment - based approaches largely depends on the quality of alignments (20). This is problematic because most widely used multiple - sequence alignment tools use heuristics and do not guarantee optimal alignments . For instance, cpc and phylocsf took 2 days to evaluate the coding potential of 14 353 lncrnas identified by cabili et al . This problem is getting more attention as massive - scale rna sequencing is increasingly being performed . Consequently, a more accurate, robust and faster method that does not rely on sequence alignment is needed to distinguish ncrnas, especially lncrnas, from protein - coding genes . Here, we present coding - potential assessment tool (cpat), an alignment - free program, which uses logistic regression to distinguish between coding and noncoding transcripts on the basis of four sequence features . Cpat is highly accurate (0.967) and extremely efficient (10 000 times faster than cpc and phylocsf, and 50 times faster than portrait). Cpat needs only the sequence or coordinate file as input, and it is straightforward to use . We expanded the availability of cpat to a larger scientific audience via a web interface, which allows users to submit sequences and receive the prediction results back almost instantaneously (http://lilab.research.bcm.edu/cpat/index.php). Coding - potential prediction is essentially a binary decision problem, which makes logistic regression a suitable approach . As an alignment - free method, all selected features (predictor variables) the first feature was the maximum length of the open reading frame (orf). Orf length is one of the most fundamental features used to distinguish ncrna from messenger rna because a long putative orf is unlikely to be observed by random chance in noncoding sequences . Despite the simplicity, orf length has high concordance with more sophisticated discrimination methods and remains the primary criterion in almost all coding - potential prediction methods (21). The second feature was orf coverage defined as the ratio of orf to transcript lengths . This feature also has good classification power, and it is highly complementary to, and independent of, the orf length (supplementary figures s1 and s3). Some large bona fide ncrnas may contain putative long orfs by random chance (5), and thus cannot be classified correctly by orf length alone . Fortunately, those large ncrnas usually have much lower orf coverage than protein - coding rnas (figure 1b). Figure 1.score distribution between coding (red) and noncoding (blue) transcripts for the four linguistic features selected to build the logistic regression model; training data set containing 10 000 coding and 10 000 noncoding transcripts were used . Score distribution between coding (red) and noncoding (blue) transcripts for the four linguistic features selected to build the logistic regression model; training data set containing 10 000 coding and 10 000 noncoding transcripts were used . The third feature we used was the fickett testcode score (termed fickett score hereafter), which is a simple linguistic feature that distinguishes protein - coding rna and ncrna according to the combinational effect of nucleotide composition and codon usage bias (22). Briefly, the fickett score is obtained by computing four position values and four composition values (nucleotide content) from the dna sequence . The position value reflects the degree to which each base is favored in one codon position versus another . For example, position value of a (apos) is calculated as follows: cpos, gpos and tpos are determined in the same way . These eight values are then converted into probabilities (p) of coding using a lookup table provided in the original article . Each probability is multiplied by a weight (w) for the respective base, where the value of w reflects the percentage of time each parameter alone successfully predicts coding or noncoding function for the sequences of known function . Finally, the fickett score is calculated as follows: the fickett score is independent of the orf, and when the test region is 200 nt in length (which includes most lncrna), this feature alone can achieve 94% sensitivity and 97% specificity, with the fourth feature we used was hexamer usage bias (termed hexamer score hereafter). This may be the most discriminating feature because of the dependence between adjacent amino acids in proteins (23). The hexamer score can be computed in numerous ways; here, we used a log - likelihood ratio to measure differential hexamer usage between coding and noncoding sequences . For a given dna sequence, we calculated the probability of the sequence under the model of coding dna and under the model of noncoding dna, and then we took the logarithm of the ratio of these probabilities as the score of coding potential . We used f (hi) (i = 0, 1,, 4095) and f (hi) (i = 0, 1,, 4095) to represent in - frame hexamer frequency, calculated from coding and noncoding training data sets (described below), respectively . For a given hexamer sequence s = h1, h2,, hm, hexamer score determines the relative degree of hexamer usage bias in a particular sequence . Positive values indicate a coding sequence, whereas negative values indicate a noncoding sequence . We build a logistic regression model using these four linguistic features as predictor variables . A test was used to evaluate whether our logit model with predictors fits the training data significantly better than the null model, which had only an intercept . We built a high - confidence training data set to measure the prediction performance of our logit model . This data set contained 10 000 protein - coding transcripts selected from the refseq database; all transcripts had high - quality protein sequences annotated by the consensus coding sequence project . We evaluate the model with a 10-fold cross - validation and measured its sensitivity, specificity, accuracy, precision and area under the curve (auc) characteristics . The receiver operating characteristic (roc) curve and precision recall (pr) curve were generated using rocr package (24). We also built a nonparametric two - graph roc curve for selecting the optimal cpat score threshold that maximizes the sensitivity and specificity of cpat while minimizing misclassifications . We built an independent test data set to compare the performance of cpat with that of cpc, phylocsf and portrait . This test set composed of 4000 high - quality protein - coding genes (refseq annotated) and 4000 lncrnas from a human lncrna catalog (5). Assuming that all 4000 lncrnas are truly noncoding sequences, we could compute the sensitivity, specificity, accuracy and precision of the algorithms to measure their performance . Those 528 genes were equally assigned to the true - negative and false - positive categories . The abbreviations in the equations below are as follows: fn, false negative; fp, false positive; tn, true negative; tp, true positive all four selected features were concordantly higher in coding transcripts and lower in noncoding transcripts (figure 1). We plotted three major features (orf size, fickett score and hexamer score) in a three - dimensional space to evaluate their combinatorial effect (figure 2). Coding and noncoding transcripts in our training data set were grouped into two distinct clusters, indicating good concordance between features . The test p value was <.001 (= 23 548.44; degrees of freedom = 4), indicating that the logit model as a whole fits significantly better than the null model . Ten - fold cross - validation showed that cpat could achieve very high accuracy, with an auc of 0.9927 (figure 3a). We also provide the pr curve because the roc curve can be misleading when the test data are largely skewed (figure 3b). We use nonparametric two - graph roc curves to determine an optimal cpat score threshold that maximizes the discriminatory power (figure 3c and d). According to figure 3d, a score threshold of 0.364 gave the highest sensitivity and specificity (0.966 for both) for human data . Figure 2.three-dimensional plot shows combinatorial effects of fickett score, hexamer score and orf size on 10 000 coding genes (red dots) and 10 000 noncoding genes (blue dots). Dashed curves represent the 10-fold cross - validation; solid curves represent the averaged curve from 10 validation runs . (d) two - graph roc curve is used to determine the optimum cutoff value . Three - dimensional plot shows combinatorial effects of fickett score, hexamer score and orf size on 10 000 coding genes (red dots) and 10 000 noncoding genes (blue dots). Dashed curves represent the 10-fold cross - validation; solid curves represent the averaged curve from 10 validation runs . (d) two - graph roc curve is used to determine the optimum cutoff value . We compared the performance of cpat with that of cpc, phylocsf and portrait (protein - independent support vector machine model) using an independent test data set composed of 4000 coding genes and 4000 noncoding genes . A multiple alignment of 45 vertebrate genomes, including that of human, was downloaded from the ucsc (university of california, santa cruz) genome browser and was used as the input alignment for phylocsf . In general, cpat (sensitivity: 0.96, specificity: 0.97) had greater classification power compared with all other programs (figure 4; supplementary tables s1 and s2). Although cpc had the highest sensitivity (0.99), it suffered from poor specificity (0.74). One possible explanation is that a significant proportion of ncrnas has a certain degree of sequence similarity to protein - coding genes . Phylocsf had the least sensitivity (0.90) and the lowest specificity (0.63). Part of the reason for these outcomes is that nonconserved transcripts cannot be processed by phylocsf . If we consider those 528 nonconserved transcripts as noncoding, the specificity increased from 0.63 to 0.69, and the sensitivity remained unchanged . Cpat achieved highest overall accuracy (0.97) when compared with cpc (0.87), phylocsf (0.76) and portrait (0.92). Cpat s excellent discriminatory power was further demonstrated by the greatest separation between the score distributions of coding and noncoding sequences (figure 5). Unlike cpc, phylocsf and portrait, choosing a smaller cpat score threshold to increase the sensitivity will not sacrifice too much specificity . Figure 4.performance comparison between cpat, cpc, phylocsf and portrait using roc curves . Figure 5.cumulative curves of coding - potential assessment score for (a) cpat, (b) portrait, (c) cpc and (d) phylocsf . Cumulative curves of coding - potential assessment score for (a) cpat, (b) portrait, (c) cpc and (d) phylocsf . One could argue that phylocsf underperformed in this study because we used whole transcripts for testing rather than consecutive protein - coding exons and intergenic regions as used in its original article (17). To address this issue, we compiled another single - exon test data set consisting of 184 protein - coding and 278 noncoding transcripts . The test results with this data set indicated that cpat (sensitivity: 0.962, specificity: 0.842) still outperformed phylocsf (sensitivity: 0.832, specificity: 0.588, supplementary figure s2). (25), phylocsf (sensitivity 0.91, specificity 0.99) has better performance than cpat (sensitivity 0.50, specificity 0.98). This is reasonable because lncrnas in our test data set are poorly conserved, whereas lncrnas in lin et al . Test data set are highly conserved because they are taken from multiple - sequence alignments of three closely related drosophila species . Hence, we argue that phylocsf works better if the transcripts are highly conserved, which are rare to find in lncrnas (5,6). This also highlights the achilles heel of the alignment - based methods for detecting lncrnas . In contrast, the dramatic decrease in cpat s sensitivity is due to the lack of orf information in lin et al . Test data set, which is largely composed of individual exons, and not exon - length complete transcripts . This, however, will not limit the application scope of cpat because most full - length transcripts can be constructed at the current sequencing depth (8). We measured the computational speed of cpat, cpc and phylocsf on a sample of 200 sequences randomly selected from the test data set . Cpat took 0.67 s to process the data, and it was four orders of magnitudes faster than both cpc [11 945 s (3.3 h)] and phylocsf [11 737 s (3.3 h)]. Furthermore, computational time for the phylocsf did not include the time spent preparing multiple - alignment files for analysis . Portrait was significantly faster than cpc and phylocsf, and therefore all 8000 test genes were used to evaluate its speed: cpat took 23.83 s to process the test set, and it was 48 times faster than portrait [1146.30 s (19 min)]. A number of linguistic features characterizing coding rna sequences have been developed over the past 30 years . These include maximum orf size, dinucleotide usage, codon usage bias, hexamer usage bias, nucleotide composition bias between codon positions and imperfect periodicity in base occurrences (23,26). Among these features, we selected orf features (size and coverage) because of their discriminatory power and ease of calculation (21). In - frame hexamer score was selected because it has the highest prediction accuracy (average of sensitivity and specificity) as evaluated by fickett and tung in 1992 (23). Fickett score was selected because it simultaneously captures the compositional bias and position asymmetry, which are orthogonal to the orf features . Supplementary figure s3 shows the performance of these individual features as well as the combined feature set . The combined feature set has very high sensitivity and specificity (> 0.966), leaving very little room for further improvement . Annotation of genomes has always been a challenging task for biologists, and these efforts have been accelerated by deep transcriptome sequencing . Distinguishing between protein - coding and noncoding sequences is the first and arguably the most crucial step in genome annotation . Detecting the coding - potential of these transcripts via alignment - based software is intractable . We developed cpat, a highly accurate alignment - free method, which uses a logistic regression model to discriminate between coding and noncoding transcripts using pure linguistic features . Compared with other tools, cpat is more robust, markedly faster and more convenient to use . Taken together, cpat is able to accurately assess the coding potential of tens of thousands of transcripts in real - time, and will be a valuable tool for the rapidly growing rna - seq community . Source code was implemented in c and python and is freely available at: http://code.google.com / p / cpat/. The web server was implemented in php, mysql and apache, with support for all major browsers: http://lilab.research.bcm.edu/cpat/index.php . Supplementary data are available at nar online: supplementary tables 1 and 2 and supplementary figures 13 . Department of defense prostate cancer program [pc094421 to w.l . ]; the cancer prevention and research institute of texas [rp110471-c3 to w.l . ]; the center for individualized medicine (cim) at mayo clinic (to j.p.k . ). Funding for open access charge: cancer prevention and research institute of texas [rp110471-c3 to w.l . ].
|
Beyond its role of cellular energy currency and phosphate donor, atp plays a potent signaling role through its extracellular release and activation of cell surface purinergic receptors . Fast responses to atp are mediated through activation of p2x receptors, a family (p2x1p2x7) of atp - activated ligand - gated ion channels and metabotropic effects through the activation of p2y receptors (p2y12, p2y4, p2y6, p2y1114) which couple to heterotrimeric g proteins . Human leukocytes including monocytes, mast cells, neutrophils and central microglia express a diverse repertoire of p2y receptors though p2x1, p2x4 and p2x7 are the dominant p2x subtypes present . Activation of purinergic receptors in leukocytes is coupled to the production and secretion of cytokines and other pro - inflammatory molecules including prostaglandin e2 . Purinergic receptors are associated with inflammation, with some receptors inhibited either directly (p2y12) or indirectly through the activity of anti - thrombotic, in the case of platelet p2y12, or anti - inflammatory agents, in the case of the action of statins on monocyte p2x4 . Atp can act as a non - peptide damage - associated molecular pattern (damp) release from injured cells and tissues . In this fashion the release of cellular atp is unregulated and released due to cell lysis or puncture . Cell surface purinergic receptors are activated by this atp damp signal which serves to initiate an inflammatory response and promote wound healing . However, atp can be released from cells physiologically and act as a critical signal for painful, inflammatory processes . Do release other nucleotides including utp and udp - sugars but our focus here is atp release . Mechanisms of atp release during physiological processes remain diverse and controversial . Investigation into how cellular stress stimulates atp release in non - leukocytes suggests roles for connexin and pannexin hemichannels, maxi- and volume - regulated anion channels and efflux through the p2x7 receptor, though release routes and signal transduction mechanism underlying atp release in leukocytes remain poorly defined . In neutrophils atp is released in response to activation of fmlp receptor by bacterially derived n - formylmethionine . The precise release mechanism is unclear but occurs at the leading edge of migrating neutrophils . Released atp and its subsequent metabolism to adenosine at the cell surface activate p2y2 and a3 receptors serving to direct cell orientation and promote migration in response to chemotactic signals . Bacterially derived lipopolysaccharide can stimulate central microglia to secrete atp which in - turn activates neighboring astrocytes and modulates excitatory neurotransmission . This raises the possibility that atp can act in a feed forward loop possibly amplifying responses to itself or other external cues which couple to atp secretion . Furthermore, such constitutive secretion leads to activation of cell surface gq - coupled p2y receptors which elevate intracellular calcium levels through release of calcium . This mode of constitutive secretion generates a constant pericellular atp cloud or halo which appears to be important in regulating intracellular calcium homeostasis following p2y receptor activation . In cells of hematopoietic lineage such as monocyte / macrophage, nk killer and mast cells, secretory lysosomes have evolved as bifunctional organelles which combine classical degradative properties with secretion . The mechanism of lysosomal atp transport remains undefined though a nucleotide transporter (v - nut) has been characterized for other atp containing vesicles . The signal transduction coupling external cues such as cytokines, chemokines and bacterially derived molecules to atp release is poorly defined . What are the release machines in leukocytes and do they differ from other cell types? It is expected that therapeutic intervention in agonist stimulated atp release is a potentially novel route to pharmacological modulation of innate immune responses but also in chronic inflammatory disease where normal inflammatory responses are heighten and act deleteriously.
|
Paraoxonases were originally discovered as enzymes hydrolyzing exogenous toxic organophosphate compounds such as insecticide paraoxon . There are three members of paraoxonases family currently known: paraoxonase 1 (pon1), paraoxonase 2 (pon2), and paraoxonase 3 (pon3), which are encoded by three separate genes on the same chromosome 7 (human) or chromosome 6 (mouse). All three human members of the family are 70% identical at nucleotide level and 60% identical at the amino acid level . Studies on enzymatic activity of paraoxonases revealed esterase and lactonase / lactonizing activities in addition to organophosphatase activity . Despite of the large number of compounds that can be hydrolyzed by paraoxonase, in many cases arylesterase activity is measured to access pon1 level in biological samples . Based on kinetic parameters of paraoxonases toward different substrates hydrolysis of homocysteine thiolactone by pon1 is considered to be protective against coronary artery disease (cad). After the introduction of the oxidative stress hypothesis of atherosclerosis and the discovery of antioxidant effect of high - density lipoprotein (hdl), pon1 attracted significant interest as a protein that is responsible for the most of antioxidant properties of hdl . Purified pon1 protects hdl and low - density lipoprotein (ldl) from oxidation catalyzed by copper ions . Pon1 inhibits copper - induced hdl oxidation by prolonging oxidation lag phase, and reduces peroxide and aldehyde content in oxidized hdl . Remarkably, pon1 inhibitors pd-11612, pd-65950, pd-92770, and pd-113487 lessen this antioxidative effect of pon1 . Pon1 is especially effective in decomposition of linoleate hydroperoxides . Also, mass - spectrometry analysis of biologically active fraction of oxidized2-arachidonoyl - sn - glycero-3-phosphorylcholine (ox - papc) underwent pon1 treatment showed degradation of these oxidized phospholipids by pon1 . The exact antioxidant mechanism of pon1 is not known yet, although it is known that protection is not caused by chelating of copper ions or because of potential lipid transfer from ldl to hdl . Existence of an enzymatic mechanism is supported by the observation that heat inactivation of purified pon1 abolishes its antioxidant effect . Some in vitro data suggest that antioxidant activity might be related to other components of purified pon1 preparations . However, experiments with pon1 deficient mouse provide strong evidences that pon1 is required to enable hdl antioxidant properties . Hdl from pon1 knockout animals were more prone to oxidation and were less efficient in the protection of ldl from oxidation in co - cultured cell model of the artery wall compared with hdl from control mice . Also, transfection of pon1-deficient peritoneal macrophages (isolated from pon1 knockout mice) with human pon1 decreased level of peroxides, lowered release of superoxide, and increased intracellular level of reduced glutathione, key observations are summarized in table 1 . Summary of key facts on pon1 expression, activity, and effects in in vitro and in vivo studies the first pon1 messenger ribonucleic acid (mrna)ionanalysis in different rabbit tissues was performed by northern blot, and revealed pon1 mrna expression predominately in liver . Polymerase chain reaction (pcr) amplification using a panel of first - strand complementary deoxyribonucleic acid (cdnas) from 24 tissues detected pon1 expression in kidney and colon beside liver and fetal liver expression . Biopsies showed pon1 mrna and protein expression in human but not in mouse gastrointestinal tract . Deletion analysis in cultured cells revealed that cell type specific expression in liver and kidney is determined within first 200 bp of promoter area . There are several transcription factors and pathways that regulate pon1 expression [figure 1]. All processes occur in liver, and bile acid -stimulated synthesis of fibroblast growth factor 19 (fgf-19; or fgf-15 in mouse) might be additionally occur in ileum . Signals from pma (phorbol 12-myristate 13-acetate) and high glucose activate transcription factor sp1 through protein kinases c (pkc) and p44/ p42 mitogen - activated protein kinases (mapk) a ubiquitous mammalian transcription factor specificity protein 1(sp1) plays an essential role in regulation of pon1 expression . High glucose level activates protein kinase c (pkc), which activates sp1, and stimulate pon1 transcription in human hepatoma cell lines hepg2 and huh7 . A potent pkc activator phorbol 12-myristate 13-acetate (pma) also stimulates pon1 transcription in hepg2 through activation of sp1 . Two members of pkc family are involved, pkc (zeta) and pkc- (alpha) activation . Statins (pitavastatin, simvastatin, or atorvastatin) stimulate pon1 transcription through sp1 activation as well, however, they activate another kinase, p44/p42 mitogen - activated protein (map) kinase, as was observed for pitavastatin in huh7 cells . Also, pivostatin - stimulated p44/p42 mitogen - activated protein kinase (mapk) activates sterol regulatory element binding protein 2 (srebp-2), which contributes to transcriptional activation of pon1 . Dietary polyphenols, such as resveratrol, aspirin and its hydrolysis product salicylate, and artificial ligands of aryl hydrocarbon receptor (ahr), such as 3-methylcholanthrene, activate ahr and stimulate pon1 transcription activation in mouse liver and hepg2 cell line. [2426] c - jun is another transcription factors that is involved in pon1 expression . The activity of c - jun is regulated by c - jun n - terminal kinase (jnk). Phosphorylated c - jun in a complex with c - fos or some other transcription factors forms an active ap-1 complex that usually promotes transcription of target genes . Thus, berberine (benzyl tetrahydroxyquinoline), a cholesterol lowering alkaloid, activates jnk, c - jun and stimulates pon1 transcription in human hepatoma cell lines . However, stimulation of jnk / c - jun pathway by bile acids leads to opposite effect . Bile acids such as taurocholate, cholic acid, or chenodeoxycholic acid inhibit pon1 expression in liver of c57bl/6j mice, and in hepg2 and huh7 . The inhibition of pon1 expression starts with activation of farnesoid x receptor (fxr) by bile acids that promote expression of fibroblast growth factor 19 in human (fgf-19) or fgf-15 in mouse . The growth factor activates fibroblast growth factor receptor 4 (fgfr4) followed by activation of jnk, and phosphorylation of c - jun . Opposite to activation of c - jun by berberine, fxr / fgf-19/fgfr4/jnk / c - jun pathway results in suppression of pon1 transcription . It is likely that pon1 stays associated with endoplasmic reticulum through its hydrophobic n - terminus until it is released from the hepatocytes . The mechanism of pon1 secretion is not well investigated . A study on cultured hepatocytes and transfected chinese hamster ovary (cho) cells, which do not naturally express pon1 and apoa proteins, when pon1 protein is synthesized, it accumulates on plasma membrane and slowly dissociate into extracellular medium . Dissociation is promoted by hdl, very - low - density lipoprotein (vldl), and in much lesser extent by protein - free phospholipids particles or apoa - i protein . Pon1 binds to hdl through interaction of hydrophobic n - terminus to phospholipids, and through pon1-apoa interaction . Two major principal hdl proteins, that is, apoa - i and/or apoa - ii which differ in their properties are linked to atherosclerosis modulation . Thus, transgenic mice with hdl consisting of both human apoa - i and apoa - ii developed 15-fold greater lesions compared with mice with hdl containing solely human apoa - i . In vitro study of reconstituted hdl demonstrated that apoa - i containing hdl stabilizes pon1 binding as compared with protein - free hdl particles, and apoa - ii in opposite destabilizes the hdl the paraoxonase and arylesterase activities of pon1 do not depend on the apolipoprotein content of hdl . However, apoa - i containing hdl significantly increases lactonase activity of pon1, promotes inhibition of ldl oxidation, and stimulates macrophage cholesterol efflux compared with apoa - ii containing hdl . A study of human hdl isolated from apoa - i deficient patients revealed that pon1 is still associated with hdl in the absence of apoa-1, however, the pon1hdl complex is less stable, and pon1 loses activity faster than in normal controls . A higher content of human apoa - ii protein in mouse hdl suppresses pon1 binding to hdl compared with hdl with lower human apoa - ii content . Hdl high in human apoa - ii binds less pon1 protein, possesses less pon1 activity, and is impaired in protection of ldl from oxidation . Transgenic mouse with higher human apoa - ii content in hdl are more susceptible to atherosclerosis compared with transgenic animals with lower apoa - ii level in hdl and control animal . Hdl - associated pon1 can be successfully transferred to cultured cells in vitro and deliver protection from oxidative stress and bacterial substrate of pon1 n-3-oxo - dodecanoyl - l - homoserine lactone . Beside hdl while liver is the major tissue of pon1 gene expression, lipoprotein - assisted circulation of pon1 in plasma delivers the enzyme to multiple tissues that do not express pon1 themselves . Immunohistochemical staining of rat tissues revealed pon1 presence in liver, kidney, in endothelial lining of lung and brain . More recent study with mouse tissue detected pon1 protein in hepatocytes, adipocytes, chondrocytes, skeletal and cardiac muscle, kidney, spermatozoa, and epithelial cells of skin, stomach, intestine, trachea, bronchiole, and eye lens . Studies did not find co - localization of pon1 with apoa - i protein that might mean local pon1 expression or different sources of apoa - i, an integral component of hdl . Immunostaining of healthy human aorta shows a low level and granular distribution of pon1 in smooth muscle cells . Western blot confirmed presence of intact and degraded pon1 in media of healthy aorta . With the development of atherosclerosis, pon1 increasing accumulation of pon1 with the progression of the atherosclerosis can be seen in the intimal part of aorta as well . Aorta with advanced atherosclerosis lesions shows massive pon1 accumulation . A more recent study attributed an increased pon1 immunostaining in human atherosclerotic arteries to macrophages accumulated in lesions . High fat, high - cholesterol (atherogenic) diet leads to fast development of atherosclerosis in c57bl/6j mouse strain with concomitant decrease in liver pon1 expression . At the same time pon1 expression and its protective effects macrophages from this mouse did not protect ldl from oxidation by other cells in vitro, and pon1 knockout mice developed atherosclerosis faster than control mice on high fat, high cholesterol diet . To study the effect of pon1 knockout further, . Plasma lipid profile of these double knockout mice was similar to apoe-/- control animals with slightly decreased level of intermediate density lipoprotein (idl) and ldl, and increased level of lysophosphatidylcholine and oxidized phospholipids in idl and ldl . The rates of ldl oxidation and clearance were higher in pon1-/-, apoe-/- mice than in control mice as was determined by injection of human ldl . Expression of genes responding to increase of oxldl, such as heme oxygenase-1, peroxisome proliferator - activated receptor gamma, scavenger receptor type a, cd36, and macrosialin, was upregulated in liver of pon1-/-, apoe-/- mice compared with apoe-/- mice . Involvement of pon in inflammation and oxidative stress were detected in vascular wall of pon-/- animals . Expression of mrna of essential cell adhesion molecules p - selectin and icam1 was upregulated in aortic wall . If a deficiency of pon1 leads to inflammation and oxidative stress, then increases in pon1 function could be beneficial . A transgenic mouse mpon1 was developed in 2001, with 5-fold higher level of mouse pon1 protein and corresponding increase in arylesterase activity . Pon1 was associated with hdl, and protected hdl from oxidation by copper ions as it was assessed by lipid hydroperoxide formation assay, and by retaining oxidation - sensitive activity of lecithin: cholesterol acyltransferase (lcat). A decrease in atherosclerotic lesion size and improved oxidation status of aorta and peritoneal macrophages in pon1 overexpressing transgenic mouse on apoe-/- background have been compared with apoe-/- control have been reported . In another transgenic mouse model, pon1-tg, which overexpresses human pon1 gene of 55l/192q genotype, plasma level of arylesterase activity was twice higher in pon1-tg mouse compared with control mouse when animals were fed normal chow . The excess of pon1 level resulted in better retaining of its activity after feeding animals with atherogenic diet . Pon1 activity decreased to about three - fourth (3/4) of original level after 15 weeks of atherogenic diet feeding to pon1-tg mice, and to less than one - half (1/2) of original level in control animals . Thus, arylesterase activity mediated by pon1 was almost 4-fold higher in pon1-tg mice compared with control mice after feeding atherogenic diet . Aortic lesion areas in pon1-tg animals were about half of the size of areas of the control mice after feeding atherogenic diet . Apoe-/-, pon1-tg genotype mice fed normal chow similarly developed lesions slower, compared with apoe-/- controls; however, the difference in lesion area was just 22% . Plasma arylesterase activity of apoe-/-, pon1-tg mice was 2.5-fold higher than that of apoe-/- animals, however, there is no difference between their lipid profile . A decreased inflammatory status of aortas in apoe-/-, pon1-tg mice compared with apoe-/- mice was detected by examination of the expression level of mcp-1 cytokine gene . Hdl isolated from pon1-tg mouse plasma or apoe-/-, pon1-tg mouse plasma provided better protection against ldl oxidation, than hdl isolated from control animals . Beside pon1 studies on transgenic mouse, a transient overexpression of pon1 gene in mouse adenovirus - mediated delivery of human pon1 gene (55 m, 192q genotype) in double knockout leptin-/- (ob / ob), ldlr-/- mouse resulted in more than 4-fold increase of pon1 activity on day 7 with gradual decrease to the control level by day 21 . Mice were injected with adenovirus at the age of 18 weeks when the progression of atherosclerosis occurs in a fast rate . Six weeks later, cross - sections of the aortic root were analyzed by immunohistochemistry . Plaque size, volume of macrophages, concentration of oxldl was significantly lower in pon1 expressing animals . The titer of anti - oxldl antibodies was lower in plasma of pon1 overexpressing mice as well . While an early pon1 intervention proved to have significant athero - protective effect, another study was performed to assess whether transient pon1 overexpression can improve vascular function in advanced atherosclerosis . Similar to the previous study, 55m/192q variant of human pon1 gene was delivered in 18 month old apoe-/- mouse fed normal chow using adenovirus vector . Serum pon1 activity was increased 10-fold by day 7 and 2.5-fold on the day 21 in pon1 overexpressing animals compared with controls . After 3 weeks, lesions were measured and no changes in their size were found . However, vasomotor function was improved by transient overexpression of pon1 . Thus, phenylephrine - constricted segments of the aortas relaxed significantly better in response to endothelium dependent agonists ach, adenosine-5-triphosphate (atp), and uridine-5-triphosphate (utp) observations on pon1 role in animal models is summarized in table 2 . Meta - analysis of 47 studies with 9853 cad and 11,408 control subjects published in 2012 confirmed association of lower plasma pon1 activity with increased cad risk (19% lower pon1 activity, p <0.00001). Another meta - analysis published in 2012 included 43 studies with total 20,629 subjects showed similar association of pon1 activity and cad with standardized mean difference (smd) of -0.78 (p <0.001) for cad subjects compared with controls . Slightly weaker association was between arylesterase activity of pon1 and cad with smd of -0.50 (p <0.001). Both meta - analyses observed increased risk of cad in subjects with lower pon1 regardless of age and ethnicity; tables 3 and 4 summarizes the role of pon1 in human studies . Summary of allele differences of pon1 in vitro, and conclusions from pon1 human studies recent human studies on the role of pon1 in cvd some alleles of polymorphous genes can be causative factors in development of diseases and reliable predictors . There are at least five known polymorphisms in promoter region of pon1: -909/-907 (c or g), -832/-824 (a or g), -162/-160 (a or g), -126 (c or g), and -108/-107 (c or t). Also, there are two polymorphisms in the pon1 coding region, q192r (aka rs662 or 575a> g) and l55 m (aka rs854560 or 163 t> a), and several polymorphisms in 3 untranslated region of the gene . Pon1 protein level in human serum varies more than 13-fold, and variations in the sequence of promoter region of pon1 gene might cause difference in its expression . Two - fold differences in expression level between alleles were observed in cell culture reporter gene assay for three polymorphisms: -909/-907 (c or g), -162/-160 (a or g), and -108/-107 (c or t). Polymorphisms -162/-160 (a or g) is a putative binding site for transcription factor nf - i, and -108/-107 (c or t) is a putative binding site for sp1 . No effect on expression level in the reporter gene assay was observed for -832/-824 (a or g), -162/-160 (a or g) polymorphisms . Gene expression and enzyme activity studies on pon1 polymorphisms in protein coding region q192r and l55 m resulted in several observations . First, messenger rna of allele 55 m appeared to be more stable than 55l as determined by pcr amplification and restriction analysis of cdna synthesized from heterozygous liver samples . L55 m heterozygous liver had roughly twice more mrna of 55 m allele compared with 55l . That might results in difference in protein expression levels between alleles and ultimately in pon1 activity and protection, although it was not assessed in the study . Q192r and l55 m alleles differ in their enzymatic activities . In a study of serum of 279 healthy human subjects activity of 55 m homozygotes were always lower than 55l / m heterozygotes or 55l homozygotes . Qq, qr, and rr phenotypes can be reliably determined by assaying pon1 catalytic activities toward two substrates: diazoxon and paraoxon . Pon1 of qq genotype exhibits relatively high activity toward diazoxon and relatively low activity toward paraoxon . Rr genotype, opposite to qq, exhibits low activity toward diazoxon and high activity toward paraoxon . 192r pon1 hydrolyzes homocysteine thiolactone faster than 192q pon1 . Q192r and l55 m pon1 enzymes differ in their protection to ldl from oxidation in vitro using ldl oxidation assay with copper in the presence of hdl . Protection by pon1 decreases in the order of genotypes qq> qr> rr with almost no antioxidant activity in rr genotype, and about a half of qq activity in qr phenotype . The antioxidant activity of pon1 decreased in the series mm> lm> ll, with the activity of ll genotype about a half of activity of mm genotype . Multiple clinical studies were performed to expose whether pon1 polymorphism may contribute to cad and other diseases . Currently, analyses of association of pon1 polymorphism with atherosclerosis - related diseases determined just one reliable association, an association of q192r polymorphism with ischemic stroke . Meta - analysis of 22 studies have been published earlier up to mid of 2009, totaling 7384 ischemic stroke subjects and 11,074 controls revealed odds ratio of 1.10 for g (192r) allele (95% ci: 1.041.17). Another meta - analysis study that was published in 2010 and summarized results of 11 studies confirmed that 192r allele confers significant risk of ischemic stroke (odds ratio = 1.25, 95% ci: 1.07,1.46, p = 0.006). Surprisingly, this risk is confined to caucasian subjects, but there is no significant association of 192r allele of pon1 and ischemic stroke in east asian population . Association of pon1 polymorphism q192r with cad was examined in extensive meta - analysis of studies published before 2011 . Per - allele odds ratio for cad for 192r was 1.11 (95% ci: 1.05, 1.17) based on all studies regardless of their size . However, analysis suggested that small studies were less reliable, perhaps because of small studies bias . No significant association of 192r allele with cad was observed when 10 larger studies with more than 500 cases each were analyzed . Similar conclusions regarding small study bias and the absence of reliable association of q192r polymorphism with cad were concluded in two other independent massive meta - analysis studies published in 2004; also, no association was found between cad and l55 m or -108/-107 (c or t) polymorphisms of pon1 gene . Meta - analysis for l55 m and -108/-107 (c or t) pon1 polymorphisms determined per - allele odds ratios for cad as 0.94 (95% ci: 0.88,1.00) for 55 m and 1.02 (95% ci: 0.911.15) for -108/-107 c, respectively . No significant association of l55 m or -108/-107 (c or t) pon1 polymorphisms with cad were observed in an earlier meta - analysis study . No association between l55 m (rs854560) polymorphism and ischemic stroke was found in meta - analysis of 16 studies published before mid-2009 totaling 5518 ischemic stroke subjects and 8951 controls . Similarly, a meta - analysis published in 2010 for 10 studies did not find significant association 55l allele with stroke regardless on the stroke type, age of patients, and ethnicity . Resent human studies generally support the conclusions of meta - analyses [table 4]. A novel pon1 polymorphism associated with atherosclerosis was recently revealed, snp rs854563(a / g). In conclusion, pon1 antioxidant and anti - inflammatory effect is extensively examined in vitro, in cell culture and animal models . Human studies confirm protective role of pon1 in cad and another atherosclerosis - related disease, ischemic stroke . Although the current knowledge of pon1 provides valuable insights on the function and role of pon1, yet mechanism of pon1 action is still not well investigated . Transient overexpression of pon1 in mouse demonstrated beneficial effects of pon1 beyond its antiatherogenic properties . Further research of pon1 could potentially lead to new clinical strategies in prevention and treatment of cardiovascular diseases.
|
Uterine adenomyosis is a common gynecologic disorder characterized by the presence and growth of heterotopic endometrial or endometrium - like structures in the myometrium, with adjacent smooth muscle hyperplasia and can lead to dysmenorrhea and infertility . The ectopic endometrial tissue induces hypertrophy and hyperplasia of the surrounding myometrium, resulting in diffuse globular enlargement of the uterus analogous to the concentric enlargement of the pregnant uterus . The presenting symptoms include a soft and diffusely enlarged uterus with menorrhagia (40%50%), dysmenorrhea (10%30%), metrorrhagia (10%12%), dyspareunia and dyschezia . The advised treatment for severe adenomyosis is total hysterectomy, but for patients wishing to preserve their uterus, a minimally invasive alternative procedure, uterine artery embolization (uae), can be performed . Uae is a nonsurgical alternative for patients with menorrhagia, symptomatic adenomyosis, or symptomatic uterine fibroids . Although uterine infarction is a relatively common occurrence after uae for the treatment of fibroids or adenomyosis, uterine infarction after ivf - et in a patient with adenomyosis is very rare . To our knowledge, this is the first report of uterine infarction after ivf - et in a patient with uterine adenomyosis in korea . She had suffered severe dysmenorrhea, menorrhagia, and pelvic pain due to severe adenomyosis which was diagnosed following a pelvic magnetic resonance imaging (mri) and clinical examination three years earlier . The patient had undergone three unsuccessful cycles of frozen - thawed embryo transfer at an external infertility clinic, due to primary infertility, during the period from 4 - 7 months before hospital admission . The patient was admitted to hospital for treatment of ovarian hyperstimulation syndrome (ohss) arising after controlled ovarian hyperstimulation about four months before the initiation of embryo transfer . A thyroid function test on january 2013 indicated a euthyroid state: triiodothyronine 166 ng / dl (range, 80 - 200 ng / dl), thyroid stimulating hormone 0.17 iu / ml (range, 0.4 - 4.1 iu / ml), free thyroxine 1.21 ng / dl (range, 0.80 - 1.90 mg / dl). The patient underwent another cycle of ivf at a local clinic in february 2013, during which she received follitropin- 150 iu from menstrual cycle day 3 to day 12 and chorionic gonadotropin 250 g at menstrual cycle day 13 . Ovum pick - up was performed about four weeks before she present to the emergency department and embryo transfer three days later . The patient received intramural progesterone 50 mg and was prescribed a vaginal progesterone gel (crinone) for daily use for 11 days after the embryo transfer . The patient presented to hospital with vaginal bleeding, fever and abdominal pain on eleven days after embryo transfer, and received antibiotic treatment followed by supportive care at a local clinic for three days . She visited our outpatient clinic due to vaginal bleeding and lower abdominal pain on sixteen days after embryo transfer and was admitted to hospital . C - reactive protein (crp) was elevated to 7.52 mg / dl and intravenous antibiotic treatment was given . Biochemical abortion was diagnosed on nineteen days following embryo transfer after serum -hcg decreased from 161 to 63 mlu / ml in two days . The patient was discharged after symptom improvement, but presented with vaginal bleeding and lower abdominal pain, at a local clinic two days later, where she received hydration . The last day of that month, she presented to the emergency department with high fever (39) and, lower abdominal pain . Peripheral blood cell analysis indicated a: white blood cell count of 17.510/l, an elevated crp of 24.3 mg / dl, a hemoglobin level of 7.6 g / dl and a hematocrit level of 24.5% . Computed tomography at the emergency department revealed a wedge - shaped low attenuation area in the anterior uterine corpus . Focal uterine infarction was suspected, and the pelvic mri revealed a wedge - shaped, irregularly marginated, non - enhancing area in the anterior uterine wall and the presence of preserved myometrium between the endometrial cavity and the inner margin of the necrotic myometrium (figure 1). Blood markers investigated to establish the cause of infarction, including antiphospholipid immunoglobulin g (igg) and igm, protein c activation, protein s, and plasminogen, were all within normal ranges . Five days after hospital admission, pelvic pain improved and crp decreased to 6.08 mg / dl, and the patient was discharged . Two months later, pelvic mri showed interval regression of the previously noted possible focal uterine infarction site with a remarkably improved blood flow (figure 2). Adenomyosis uteri is a pathological entity characterized by the presence of endometrial glands and stroma embedded within the myometrium, but without apparent contact with the endo - myometrial junction . Uterine adenomyosis is relatively frequent, affecting 1% of females; its diagnosis is more often made in multiparous patients, in their fourth and fifth decade of life, and for this reason, infertility is not frequently concurrent with adenomyosis . However, given the trend for first pregnancies to be delayed until women are in their thirties or forties, adenomyosis uteri becoming a more frequently considered diagnosis . Pregnancy resulting from assisted reproductive technology (art) is possible in patients with ademoyosis; however, spontaneous abortion, including biochemical abortion, still occurs in these patients . Uterine infarction after ivf - et in a patient with adenomyosis has not previously been reported . The objective of uae is to initiate tumor infarction resulting in substantial reduction of the uterine and tumor volumes . First, when undergoing ivf - et, the risk of thrombosis is increased, as in the cases of pregnancy and hyperthyroidism, with which the patient also presented . The precise mechanisms by which the ohss and exogenous hormonal stimulation used in art induce thromboembolic events are still uncertain . However, vascular endothelial growth factor secreted during ohss, high estradiol concentrations, and blood hyperviscosity play a prominent part in inducing a prothrombotic state . Reported that the overall venous thrombosis incidence rate during ivf pregnancies was three times higher than in reference pregnancies . An elevated crp can activate the coagulation system, following which microthrombosis formation, in the uterine myometrium, could cause necrosis of the myometrium and lead to focal uterine infarction . Second, the disruption of the endometrial - myometrial interface also disrupts the organization of myometrial muscle fibers and may also disrupt normal contractility of the subendometrium . Uterine adenomyosis with abnormal contractility and the subsequent abortion caused massive vaginal bleeding which may have led to uterine ischemia, and the resulting uterine infarction . Clinical hyperthyroidism is generally accompanied by a hypercoagulable state, which may lead to microthrombosis of the uterine myometrium . Last, fever and the elevated crp suggested that infection could have complicated the ischemic necrosis after uterine infarction . However, there were no clinical features such as rapid tumor growth, extrauterine extension or metastases, leading to the conclusion that the possibility of uterine sarcoma was very small . A follow - up mri three months later showed only traces of uterine infarction lesion and adenomyosis . In conclusion, we experienced a rare case of uterine adenomyosis that developed into uterine infarction after ivf - et and biochemical pregnancy . This case demonstrates that uterine infarction should be considered in the differential diagnosis of acute abdominal pain, vaginal bleeding and infectious signs in women with biochemical abortion after ivf - et, with a history of adenomyosis and hyperthyroidism . The insertion of a hormonal intrauterine device could be considered another option for treating the symptoms of adenomyosis in cases presenting with focal uterine infarction dysmenorrhea and menorrhagia . In addition, the surgical management of focal uterine infarction, may be considered in the management of uterine infarction after ivf - et in patients with uterine adenomyosis if future fertility is not desired . Finally, it is important to note that the previous infarction site might be a potential risk site for uterine rupture in a future pregnancy.
|
To optimize the benefits of minimally invasive procedures, surgeons have attempted to reduce the overall abdominal wall trauma by decreasing either the size of the ports or the number of trocars . In these efforts, transumbilical single - port surgery uses an umbilical single incision technique to access the peritoneal cavity and target organs . Owing to the nature of umbilicus, single - port laparoscopy through the umbilicus offers an exciting opportunity to perform laparoscopic surgery with no visible scar . However, transumbilical single - port laparoscopy is not a new concept in gynecologic surgery [15]. In 1969, wheeless and thompson first published the technique and the results of a large series of laparoscopic tubal ligations using single - trocar laparoscopy . Later, wheeless reported a large series of one - incision tubal ligation . Additionally, in 1991, the first laparoscopic total abdominal hysterectomy with bilateral salpingooophorectomy (bso) using only a single incision was reported by pelosi and pelosi iii . One year later, four supracervical hysterectomies with bso for benign uterine disease were reported by the same authors [15]. Although single - port surgery enhances cosmetic benefits and reduces postoperative pain and morbidity, use of this technique was not widespread due to technical difficulties . However, with advances in instrumental and surgical skills, the technical difficulties associated with this surgical procedure have been overcome considerably [615]. Particularly, single - port surgery is ideal for laparoscopic - assisted vaginal hysterectomy (lavh) because the vagina of woman can be considered as an additional route for surgery; thus, uterine manipulators can be applied through the vagina [1117]. Unlike uterine repair following myomectomy or bowel reanastomosis after bowel resection this is because the vaginal stump can be repaired not by laparoscopy, but through the vagina . In this study, we report our initial 100 cases observations of spa - lavh (with or without bilateral salpingooophrectomy (bso)) using a homemade, single - port, three - channel system . A retrospective medical records review was performed for the initial 100 patients who underwent spa - lavh at eun hospital . Between march 2010 and september 2011, 100 patients had undergone spa - lavh for nonmalignant gynecological diseases, including uterine leiomyoma (25 cases), adenomyosis (19 cases), adenomyosis coexisting leiomyoma (41 cases), preinvasive lesion of cervix coexisting adenomyosis or leiomyoma (7 cases), ovarian huge cyst (5 cases), endometrial hyperplasia (2 cases), and tuboovarian abscess (1 case). Past abdominopelvic surgery, body mass index (bmi), and the size of the uterus were not considered as exclusion criteria . The following parameters were determined in the present observational study: age, parity, bmi, surgical history, indication for surgery, operative time (from incision to final umbilical closure), largest dimension of the uterus, weight of the extirpated uterus (as pathology report), hemoglobin change (from before surgery to postoperative day 1), and perioperative and postoperative complications . We used homemade, single - port, three - channel system using the alexis wound retractor (applied medical, rancho santa margarita, ca, usa), surgical glove, two 10 mm trocars, and one 5 mm trocar [7, 16, 17]. After partial eversion of the umbilicus, a curved semilunar skin incision was performed at the hidden lateral aspect of the umbilical crater . The incision was c - shaped and followed the natural curve of the inferior lateral aspect of the umbilical crater near the base . After skin incision, a rectus fasciotomy and peritoneal incision were performed by direct cut - down technique . An approximately 1.5 2 cm - sized skin incision was sufficient to install the three - channel, single - port system, because of the elasticity of the skin and the tissue beneath it, which can be dissected as long as required [16, 17]. As shown in figure 1(a), the fascial edges were tagged with suture for traction prior to port system installation; this was useful for fascial closure at the end of the procedure . The alexis wound retractor consists of a proximal ring, distal ring, and connecting retractable sleeve . As shown in figure 1(a), the distal ring was loaded within the intraperitoneal space and tightly turned inside out of the proximal ring (rolled up manner), creating an effective seal and a wider opening of the single - port incision by connecting retractable sleeve between the distal and proximal rings . Once fixed in the opening site, it laterally retracted the sides of the wound opening . Subsequently, as shown in figure 1, a sterile surgical glove was placed over the proximal ring and fixed tightly to prevent leakage of carbon dioxide gas . Three trocars were inserted through the surgical glove with cut edges of the distal fingertips and tied with an elastic string . The elastic nature of the glove enabled to achieve an airtight seal, which maintained the pneumoperitoneum . The multiple truncated fingers of the glove functioned as a multiport for surgical instruments [16, 17]. A limited range of motion was closely related to the bulkiest portion of the trocar head and instrumental grip (external handle) extracorporeally overlapping . As shown in figure 1(b), the length of the instruments was the same, but the lengths of the truncated glove digits varied . However, varying the height of the trocar head may minimize clashing of the bulkiest portion of the trocar head and instrumental grip (the external handle) extracorporeally overlapping . All the surgical procedures were performed as a standard lavh (with or without bso) technique using conventional nonarticulated rigid laparoscopic instruments and the ligasure system (valleylab, boulder, co, usa). As has been established earlier, exploration of pelvis, coagulation and cut of ligaments and vessel above the uterine vessel, and bladder mobilization were undertaken in laparoscopic phase . Ligation of uterine vessel, cardinal and uterosacral ligament, extirpation of uterus, and vaginal stump closure were undertaken in the vaginal phase . All procedures were successfully completed through the single - port system and vagina without the need for extraumbilical puncture or conversion to laparotomy . As shown in table 1, the mean standard deviation (sd) of patient age, parity, and bmi was 48.2 6.5 years, 2.3 1.0, 25.4 3.3 kg / m, respectively . Thirty - three patients had a past history of abdominopelvic surgery, such as a caesarean section, laparoscopic tubal ligation, appendectomy, ovarian cystectomy, or salpingooophrectomy . Among these patients, six had a history of caesarean sections, five had a history of repeat caesarean sections, and five had a history of three caesarean sections . Seven patients needed 2 - 3 units of packed red blood cell transfusion due to chronic anemia or intraoperative hemorrhage . The mean sd of time to installation of the transumbilical single - port system was 7.3 1.5 min . The mean sd of total operative time, largest dimension of the uterus, and weight of the uterus were 73.1 24.6 min, 10.5 2.1 cm, and 300.8 192.5 gram, respectively . The operative time between laparoscopic phase and vaginal phase was similar but depended on pelvic pathology . The median decline in the hemoglobin level from before surgery to postoperative day 1 was 1.8 0.9 g / dl . Bladder injury occurred in one patient who had a history of three caesarean sections but was repaired through intraoperative laparoscopic suture . The postoperative course was uneventful in most patients, but three had a transient paralytic ileus, and five had pelvic hematoma, all of whom recovered following conservative managements . No port - related complications were noted, and the cosmetic results and patient satisfaction were excellent . Spa - lavh is a technically safe and feasible procedure, and the homemade single - port system offers reliable and cost - effective access for single - port surgery . As mentioned earlier, lavh is most ideal for single - port surgery because the vagina of woman can be considered as an additional route for surgery; thus, uterine manipulators can be applied through the vagina . Unlike uterine repair after myomectomy this is because the vaginal stump can be repaired not by laparoscopy, but through the vagina . Thus, spa - lavh is safe, and the procedure can be learned by skillful surgeons over a short period of time, because a considerable portion of the procedure can be performed through the vagina . The homemade three - channel, single - port system using a surgical glove and an alexis wound retractor offers reliable, flexible, and cost - effective access for single - port procedures, and the system can be applicable in nonarticulated, rigid, conventional laparoscopic instruments [16, 17]. Limitations of single - port surgery include the loss of instrumental triangulation, reduced operative working space, reduced laparoscopic visualization, and instrumental crowding and clashing . These limitations act as hurdles for some reconstructive procedures, such as repair after myomectomy . However, the reconstructive procedure can be performed with instrumental advancement, such as the use of articulated instruments [615]. Our observations show that a history of abdominopelvic surgery is not a contraindication for single - port surgery; however, central obesity is problematic to secure a route for the single - port system through a small intraumbilical incision . Procedural difficulties resulting from previous abdominopelvic surgery are not because of the single - port surgery itself, but owing to abdominopelvic conditions [10, 1517]. A linear correlation existed between the operation time and an extirpated uterine weight of> 400 g, because more time was needed for uterine fragmentation for extirpation through the vagina; however, no linear correlation existed between the operation time and a uterus weight of <400 g. for pelvic adhesion, such as in previous pelvic surgery or endometriosis, additional operation time is required for adhesiolysis . It is not a case - control study, and pain score, hospital stay, cost effectiveness, and return to work were not considered because of the retrospective nature of the study . Additional clinical data and long - term followup may be needed to address port - related complications.
|
Drug eruptions are common, affecting 23% of all hospitalized patients, and complications associated with medications make up the largest proportion of adverse events seen in hospitals . Drug eruptions can be difficult to diagnose, particularly causality, as even biopsies are nonspecific and patients are often on more than one potentially offending medication . We present 3 cases that highlight these difficulties and the broad spectrum of drug eruptions in the setting of lymphoma patients receiving multidrug regimens including bendamustine . A 60-year - old caucasian female presented with a 6-month history of constitutional symptoms, dyspnea on exertion, lymphadenopathy and pleural effusions and was diagnosed with stage iv marginal zone lymphoma with bone marrow involvement . Four to six weeks prior to admission, she had developed a progressive generalized erythematous rash and edema involving her trunk and extremities . These findings were characterized as consistent with drug eruption, although no new drugs were identified in her history . The decision was made to treat with bendamustine and rituxan as an inpatient due to nonresolving malignant pleural effusion . Her initial rash on presentation was thought to be due to possible lymphomatous involvement and lymphedema as it improved over the 23 days following chemotherapy . On day 7 she developed a bullous rash involving 6070% of her skin as well as mucosa (fig . A new biopsy revealed vacuolar interface dermatitis with necrosis of keratinocytes in the epidermis, with the underlying dermis displaying a superficial perivascular lymphocytic inflammatory infiltrate with eosinophils (fig . 2; fig . 3). She began to deteriorate rapidly with a clinical course further complicated by the development of severe hepatic and renal failure . A diagnosis of dress syndrome was made . Despite a high dose of steroids, the rash spread, eventually involving 100% of her body surface area, including her eyelids, conjunctiva, oral and vaginal mucus membranes . Despite the use of filgrastim and broad spectrum antibiotics the second case was a 66-year - old male diagnosed in 2009 with chronic lymphocytic leukemia associated with the deletion of chromosome 13 . In 2012, his lymphocyte count reached 253,000, and he developed autoimmune hemolytic anemia . He initially received one cycle of intravenous immunoglobulin, cyclophosphamide, vincristine and prednisone (without rituxan). The initial cycle was again given without rituxan due to the high burden of the disease . He received antibiotic therapy with cefepime, fluconazole, azithromycin and levofloxacin during two separate hospitalizations . Two days following the second admission (day 7 following bendamustine), he developed a generalized erythematous rash with desquamation that did not resolve with the discontinuation of cefepime or the administration of rituxan . His rash slowly resolved . A second episode of nonneutropenic fever, hypotension and acute renal failure occurred with the second cycle of bendamustine and rituxan 2 months later . This resolved as well . Given the timing of the reaction, it was questioned that the offending drug was bendamustine in both events . The third patient was a 59-year - old female diagnosed with stage ivb splenic marginal zone lymphoma after presenting with constitutional symptoms and urticaria . She was treated with splenectomy and systemic chemotherapy consisting of bendamustine and rituxan . Prior to the third cycle, the eruption worsened 2 weeks later as the lesions became intensely pruritic, erythematous and ulcerative . Despite the treatment with antibiotics and corticosteroids, she progressed over the course of 1 week to a tense bullous rash covering the extremities . A 60-year - old caucasian female presented with a 6-month history of constitutional symptoms, dyspnea on exertion, lymphadenopathy and pleural effusions and was diagnosed with stage iv marginal zone lymphoma with bone marrow involvement . Four to six weeks prior to admission, she had developed a progressive generalized erythematous rash and edema involving her trunk and extremities . These findings were characterized as consistent with drug eruption, although no new drugs were identified in her history . The decision was made to treat with bendamustine and rituxan as an inpatient due to nonresolving malignant pleural effusion . Her initial rash on presentation was thought to be due to possible lymphomatous involvement and lymphedema as it improved over the 23 days following chemotherapy . On day 7 she developed a bullous rash involving 6070% of her skin as well as mucosa (fig . A new biopsy revealed vacuolar interface dermatitis with necrosis of keratinocytes in the epidermis, with the underlying dermis displaying a superficial perivascular lymphocytic inflammatory infiltrate with eosinophils (fig . 2; fig . 3). She began to deteriorate rapidly with a clinical course further complicated by the development of severe hepatic and renal failure . A diagnosis of dress syndrome was made . Despite a high dose of steroids, the rash spread, eventually involving 100% of her body surface area, including her eyelids, conjunctiva, oral and vaginal mucus membranes . Despite the use of filgrastim and broad spectrum antibiotics the second case was a 66-year - old male diagnosed in 2009 with chronic lymphocytic leukemia associated with the deletion of chromosome 13 . In 2012, his lymphocyte count reached 253,000, and he developed autoimmune hemolytic anemia . He initially received one cycle of intravenous immunoglobulin, cyclophosphamide, vincristine and prednisone (without rituxan). The initial cycle was again given without rituxan due to the high burden of the disease . He received antibiotic therapy with cefepime, fluconazole, azithromycin and levofloxacin during two separate hospitalizations . Two days following the second admission (day 7 following bendamustine), he developed a generalized erythematous rash with desquamation that did not resolve with the discontinuation of cefepime or the administration of rituxan . His rash slowly resolved . A second episode of nonneutropenic fever, hypotension and acute renal failure occurred with the second cycle of bendamustine and rituxan 2 months later . This resolved as well . Given the timing of the reaction, it was questioned that the offending drug was bendamustine in both events . The third patient was a 59-year - old female diagnosed with stage ivb splenic marginal zone lymphoma after presenting with constitutional symptoms and urticaria . Prior to the third cycle, the patient developed a mild pruritic eruption with raised plaques . The eruption worsened 2 weeks later as the lesions became intensely pruritic, erythematous and ulcerative . Despite the treatment with antibiotics and corticosteroids, she progressed over the course of 1 week to a tense bullous rash covering the extremities . Severe drug eruptions associated with high morbidity and mortality include stevens - johnson syndrome and toxic epidermal necrolysis . These syndromes are often confused and may represent a continuum of each other, with toxic epidermal necrolysis having> 30% of epidermal detachment and stevens - johnson syndrome having only 10% or less morbidity and mortality from these conditions stem from their complications including massive fluid losses, electrolyte imbalances, infections and diffuse interstitial pneumonitis, leading to acute respiratory distress syndrome . Dress syndrome represents another severe drug eruption with a 10% mortality rate, typically in the setting of hepatic failure . The term dress syndrome was later coined in 1996 as a syndrome specifically describing a drug eruption with internal organ involvement and hematologic abnormalities, particularly eosinophilia or atypical lymphocytosis . Dress syndrome can be difficult to diagnose, as onset is typically 26 weeks after the drug was administered but is more probable when associated with hypereosinophilia, liver involvement, fever and lymphadenopathy . Etiology, as with other severe drug eruptions, is unclear but postulated to be associated with human herpes virus reactivation . Many drugs have been implicated in dress syndrome; however, the ones most often reported are allopurinol, penicillins, sulfonamides and antipsychotics . Severity and likelihood of the diagnosis of dress as well as other severe cutaneous drug reactions are scored using the regiscar in europe . The mainstay of treatment remains the removal of the offending drug and supportive care with the use of steroids remaining controversial in their effectiveness [2, 5]. Bendamustine was first synthesized in 1963 as a chemotherapeutic agent with both antimetabolite and alkylating properties . Since that time, bendamustine has demonstrated significant efficacy in many lymphoma subtypes, particularly indolent lymphomas resistant to other alkylators . In 2008, it was approved by the fda for the treatment of rituximab - refractory chronic lymphocytic leukemia and indolent b - cell non - hodgkin lymphomas . Its side effect profile has been shown to be well tolerated, with the most common side effects being cytopenias and fatigue . The fda prescribing guidelines state that skin reactions have been reported with bendamustine, most often in combination with another agent (rituximab or allopurinol), so that true causality cannot be determined . However, these reactions have been reported to be severe and progressive with several deaths mentioned . Most described rashes develop following the first administration of bendamustine and generally worsen in severity over the following days . One patient with b - cell prolymphocytic leukemia developed rash with palpable purpura and hemorrhagic plaques while thrombocytopenic . This rash was preceded by a severe generalized maculopapular rash with most bendamustine skin reactions . A biopsy revealed a diffuse eosinophilic infiltrate . In a case series of 16 patients with chronic lymphocytic leukemia or follicular lymphoma, over 50% of the patients developed an erythematous maculopapular rash . Another case report described a severe desquamating rash involving> 75% of the skin as well as oral mucosa . A biopsy revealed interface dermatitis with a lymphohistiocytic infiltrate . In our case of dress syndrome, this led to the question of the offending agent; however, the patient did not have a reasonable alternate medication exposure . We also postulate that both the patient's lymphoma and bendamustine itself may have induced a quicker response based on already reduced immunoglobulin levels and a rapid reduction in b - cell lymphocytes . This initiating factor in the mechanism of dress was proposed by criado et al . And has been cited as the reason for the long latency in cases . Case 2 represents the typical scenario of a drug exanthem where the causative agent is in question . Rash developed following bendamustine, but the patient was also exposed to antibiotics that are known to cause dermatologic complications . However, unlike most reported cases, rituximab was not a questionable cause, as it was not administered with the bendamustine initially . Case 3 also represents a more atypical presentation than initially reported, with a reaction after the second cycle rather than after initial exposure to the drug . However, no other causative agent was found.
|
Although indomethacin is usually well tolerated, some patients developed gastrointestinal side effects, specially those patients who require long term therapy . Therefore, the use of cyclo - oxygenase-2 specific inhibitors could reduce secondary effects and they are essentially equipotent to indomethacin in vitro and in vivo . Indeed, some reports in the literature indicate the usefulness of the cox-2 inhibitors in the treatment of indomethacin - responsive headaches [38]. We report four cases of hemicrania continua and a patient suffering chronic paroxysmal hemicrania completely responsive to cox-2 inhibitors . A 42 years - old woman had sudden onset of short - lived pains on the left side of her head . She suffers for a month an intense headache with short attacks (about 510 min) but high frequency (1018 attacks per day). We put her on indomethacin 25 mg 3 times a day, and in 24 h her hemicranial pain completely disappears . Because of legs oedema we discontinued indomethacin and 1 week later the pain returned . A 56 years - old man present with an 8 month history of a continuous left - sided headache strictly unilateral . The pain was moderate in intensity but fluctuating (between 2 and 7/10 vas). The pain exacerbations were associated with lacrimation but not phono, photofobia, nausea or vomiting . An mri was normal and indomethacin 25 mg 3 times a day was started with completely recovery . Two - month later he started to have gastric symptoms, indomethacin was discontinued and the hemicrania return . A 78 years - old woman with 1 year history of continuous and strictly left - sided headache, fluctuating in intensity (39 in vas) and accompanied by conjuntival injection and nasal congestion during exacerbation time . With indomethacin 50 mg 3 times a day the hemicrania disappear, however, she developed disabling subjective tinnitus 1 month later . We discontinued indomethacin and introduced celecoxib 200 mg twice a day with completely recovery that persists 18 month later . A 64 years - old woman with 3 years history of right - sided headache, fluctuating in intensity (28 in vas). With indomethacin 25 mg 3 times a day the hemicrania disappear, however, the patient suffer gastrointestinal disturbances . We discontinued indomethacin and introduced celecoxib 200 mg twice a day with completely recovery that persists 10 month later . A 76 years - old man with 6 month history of continuous left - sided headache and facial pain . After 2 weeks on indometacina he complaint about pyrosis, that persists after omeprazol 40 mg per day . We decided to discontinue indomethacin and introduced celecoxib 200 mg twice a day with completely recovery that persists 6 month later . A 42 years - old woman had sudden onset of short - lived pains on the left side of her head . She suffers for a month an intense headache with short attacks (about 510 min) but high frequency (1018 attacks per day). We put her on indomethacin 25 mg 3 times a day, and in 24 h her hemicranial pain completely disappears . Because of legs oedema we discontinued indomethacin and 1 week later the pain returned . A 56 years - old man present with an 8 month history of a continuous left - sided headache strictly unilateral . The pain was moderate in intensity but fluctuating (between 2 and 7/10 vas). The pain exacerbations were associated with lacrimation but not phono, photofobia, nausea or vomiting . An mri was normal and indomethacin 25 mg 3 times a day was started with completely recovery . Two - month later he started to have gastric symptoms, indomethacin was discontinued and the hemicrania return . With celecoxib 200 mg twice a day the hemicrania disappears . After 10 month a 78 years - old woman with 1 year history of continuous and strictly left - sided headache, fluctuating in intensity (39 in vas) and accompanied by conjuntival injection and nasal congestion during exacerbation time . With indomethacin 50 mg 3 times a day the hemicrania disappear, however, she developed disabling subjective tinnitus 1 month later . We discontinued indomethacin and introduced celecoxib 200 mg twice a day with completely recovery that persists 18 month later . A 64 years - old woman with 3 years history of right - sided headache, fluctuating in intensity (28 in vas). With indomethacin 25 mg 3 times a day the hemicrania disappear, however, the patient suffer gastrointestinal disturbances . We discontinued indomethacin and introduced celecoxib 200 mg twice a day with completely recovery that persists 10 month later . A 76 years - old man with 6 month history of continuous left - sided headache and facial pain . After 2 weeks on indometacina he complaint about pyrosis, that persists after omeprazol 40 mg per day . We decided to discontinue indomethacin and introduced celecoxib 200 mg twice a day with completely recovery that persists 6 month later . We present five patients suffering indomethacin - responsive headache case 1 suffering from paroxysmal hemicranias and cases from 2 to 5 from hemicranias continua (table 1). All of them have absolutely response to indomethacin, but the presence of adverse reactions or intolerability let us discontinued and introduce celecoxib with completely recovery of the symptoms.table 1clinical characteristics of the patientscaseagegenderheadache typesidedoses (mg)time in month142fhpleft20012256mhcleft40010378fhcleft40018464fhcright40010576mhcleft4006all doses correspond to celecoxibf female, m male, hc hemicrania continua, hp hemicrania paroxistica clinical characteristics of the patients all doses correspond to celecoxib f female, m male, hc hemicrania continua, hp hemicrania paroxistica indomethacin is consider the first - choice drug for the treatment of indomethacin - responsive headaches, and the headache resolution is consider as a diagnosis criteria in some of theses headaches . Although other drugs have been reported as useful treatment, most of them are anecdotic or single cases [915]. Other anti - inflammatory drugs that have been demonstrated as alternative drugs, in particular piroxicam, however, their efficacy is lower when compared with indomethacin . The pathophysiology of theses indomethacin - response headache are still unknown, but the cyclo - oxygenase (cox)-2 should be implicated in the pathogenesis . Celecoxib have been previously reported to be effective in the treatment of other indomethacin - responsive headache [311], however, there was no absolutely response in all patients . Anyhow, in our experience celecoxib is a good option treatment for patients suffering from hemicrania continua or chronic paroxysmal hemicranea that presents indomethacin adverse effects.
|
According to early treatment of diabetic retinopathy study (etdrs), protocol panretinal photocoagulation (prp) can prevent severe visual loss in proliferative diabetic retinopathy (pdr). Several studies have shown histopathologic changes in choroid of diabetic patients [24]. Meanwhile, using panretinal photocoagulation (prp), as was suggested beneficially by diabetic retinopathy study for proliferative diabetic retinopathy, has gotten general acceptance . With the advent of enhanced depth imaging optical coherence tomography (edi - oct), it is now possible to visualize and measure choroidal changes easily . To the best of our knowledge, no other study has compared these two laser modalities in changing choroidal or central retinal thickness . In this study, we have evaluated the subfoveal choroidal, central retinal, and peripapillary retinal nerve fiber layer (rnfl) thickness changes before and after prp using edi - oct and we compare the green and red laser in this regard . This clinical trial was approved by the institutional review board / ethics committee . Written informed consents were obtained from all participants . Exclusion criteria were advanced proliferative diabetic retinopathy, a history of any laser treatment (panretinal or focal laser photocoagulation), any history of intravitreal drug injection, ocular surgery, significant media opacity, myopia, or hyperopia with refractive error of more than 3 diopters . Primary objective was to determine subfoveal choroidal and retinal thickness and peripapillary nerve fiber layer thickness changes 6 weeks after red versus prp laser . A complete ophthalmic examination including best corrected visual acuity (bcva) using snellen chart, goldmann applanation tonometry, and dilated indirect ophthalmoscopy was conducted . Enhanced depth imaging optical coherence tomography (edi - oct) mapping was performed using sd - oct (spectralis, heidelberg engineering, heidelberg, germany). A total number of 1600 to 2000 spots per eye were applied to ablate retina using ellex integre pro scan laser photocoagulator (82 gilbert street, adelaide, sa 5000, australia). The order of treated areas was as follows: nasal, inferior, superior, and then temporal retina . Power setting was chosen to have a mild gray - white burn (grade 2) according to etdrs guidelines . Laser setting parameters did not differ significantly between two groups (mean power 303 mwatts in red and 290 mwatts in green laser group, p value: 0.14; mean laser spots 1789 spots in red and 1869 spots in green laser group, p value: 0.13). One eye of all patients was randomly assigned to red laser and the other eye to green laser . Spectral domain optical coherence tomography images were obtained using spectralis oct (heidelberg engineering, heidelberg, germany) to measure central retinal thickness and enhanced depth imaging (edi) mode to measure subfoveal choroidal thickness . Bcva measurement and an oct scan were performed at baseline and 6 weeks after completion of prp . Subfoveal choroidal thickness was measured using apparatus measurement tool at baseline and 6 weeks after prp . Choroidal segmentation was done manually, moving the reference lines from the retinal borders to the choroidal borders . The internal limiting membrane line was moved to the base of the retinal pigment epithelium . Also retinal nerve fiber layer (rnfl) thickness analysis was done at baseline and 6 weeks after treatment . Data were analyzed using spss software (version 16, spss, inc . ). A paired sample t - test was used to compare macula and choroid thickness before and after treatment . Independent sample t - test was performed to compare macula and choroid thickness changes from baseline between two groups . The mean visual acuity of patients was 0.32 0.28 logmar and 0.27 0.23 logmar in red laser group and green laser group, respectively . The mean subfoveal ct increased significantly in each group at 6 weeks follow - up (in red laser group, 202.14 24.5 micron at baseline and 211.7 26.6 micron at 6 weeks, p value <0.00, showing 4.86% ct increase compared to baseline) (in green group, 201.9 21.13 micron at baseline and 208.9 25.0 at 6 weeks, p value <there was not a significant difference between red and green laser in terms of choroidal thickness changes from baseline (p value 0.184). In red laser group, the mean central retinal thickness was 271.6 30.33 micron at baseline and 298.5 62.14 micron at week 6 of follow - up (p value 0.03). In green laser group, the mean central retinal thickness was 267.0 36.9 micron at baseline and 306.4 73.3 micron at week 6 of follow - up, (p value 0.000 for both groups). There was no significant difference between macular thickness increase between two groups (p value: 0.404) (table 2). There was no significant association between choroidal thickness change and retinal thickness change in each group (p values: 0.051 and 0.52, resp . ). The mean peripapillary rnfl thickness was 100.5 20.1 micron in red laser group at baseline which increased to 108.2 23.1 micron at 6 weeks (p value 0.000) (7.8% as compared to baseline). In green laser group, it was 103.5 19.8 micron at baseline which increased to 112.7 22.9 in week 6 of follow - up (p value 0.000) (9.2% as compared to baseline). Rnfl change between two groups was not significant (p value: 0.762) (table 2). In this study, in eyes with proliferative diabetic retinopathy and without significant macular edema, the mean subfoveal choroidal, central retinal, and peripapillary rnfl thickness increased significantly after both red and green argon laser treatments . This is in accordance with some of previously published studies that confirm this finding [69]. Takahashi et al . Measured changes in choroidal blood flow in the foveal area one month after prp in patients with severe diabetic retinopathy and no macular edema using a laser - doppler flowmetry . They reported that prp increases both the choroidal blood flow and the choroidal blood volume . Changes in subfoveal choroidal thickness did not correlate with changes in macular thickness in their study . First, it has been attributed to redistribution of choroidal blood flow [1014]. This leads to redistribution of blood in other untreated areas, especially the macula . Following blood flow increase, this transient inflammation probably causes release of cytokines and leads to increase of blood flow and choroidal thickness [18, 19]. Mean ct increase in both groups in this study is similar to what have been reported before in other trials [710]. It is noteworthy that, in some other trials, the measured subfoveal ct showed decreased thickness after prp in short term follow - up . They have hypothesized that the reason may be due to the destruction of choroidal vasculature after thermal damage of prp [20, 21]. Also, we found that central macular thickness and rnfl thickness increased significantly in both groups; this is also similar to what has been found in other studies [2024]. This finding is similar to what has been reported before about the increase of retinal thickness after prp and it was attributed to the release of proinflammatory cytokines or hypoxia - induced macular edema [2024]. Also, we did not find any correlation between changes of choroidal thickness and central retinal thickness . One of the novel analyses done in this study is the comparison between red and green laser in changing retinal, choroidal, and rnfl thickness . Although all three measured variables showed significant increase after treatment in each eye, intereye comparisons were not statistically significant considering central retinal, subfoveal choroidal, and rnfl thickness changes (p values: 0.404, 0.184, and 0.762, resp .) That may indicate no considerable difference between red and green laser in this regard . To the best of our knowledge, there is only one report by ghassemi et al . That compared the difference between red and green laser in pdr patients . They reported significant increase of rnfl thickness after prp without any difference between red and green laser . One of the advantages of this study is selection of both eyes of one patient which can exclude the effect of systemic factors on retinal, choroidal, and rnfl thickness . This study has some limitations including low sample size and short follow - up time . Nonetheless, this study showed significant increase of subfoveal choroidal, foveal retinal, and peripapillary rnfl thickness after red and green laser prp and no significant difference between these two lasers in aforementioned measurements.
|
The prognosis for patients with non - small cell lung cancer (nsclc) deteriorates with advancing disease stage, and only about 1% of patients with metastatic nsclc are alive after 5 years.1 the most appropriate treatment for these patients is palliative, systemic, platinum - based chemotherapy in first line.25 however, platinum - based, first - line treatment is limited to 46 cycles due to cumulative toxicity and a plateau in effectiveness . Following discontinuation of chemotherapy, most patients will experience disease progression within 23 months.6,7 previous guidelines have recommended withholding second - line treatment until disease progression.2,3 however, cappuzzo et al suggested that 30%50% of patients were not receiving second - line treatment due to rapid disease progression and decreasing performance status.8 hence, there is a need for therapies that prolong the clinical benefits of first - line treatment . Bevacizumab has been approved for use in patients with metastatic non - squamous nsclc in combination with platinum - based chemotherapy until disease progression.9 however, there remains an unmet need for further treatment options that extend survival in patients with advanced or metastatic nsclc . An alternative treatment strategy that can be used to prolong duration of first - line treatment and extend survival in metastatic nsclc is first - line maintenance therapy . Maintenance therapy is defined as the prolongation of treatment duration or administration of additional treatment at the end of a defined number of initial chemotherapy cycles, after maximum tumor response has been achieved (this may be complete response, partial response, or stable disease). Erlotinib (tarceva, f hoffmann - la roche ltd, basel, switzerland) is one of only two treatments approved for use as first - line maintenance therapy by the european medicines agency,10 the other being pemetrexed.11 the randomized, multicenter, phase iii saturn (sequential tarceva in unresectable nsclc) study compared first - line maintenance therapy with either erlotinib or placebo (n = 487) following four cycles of platinum - based chemotherapy in patients with metastatic nsclc.8 patients who had not experienced disease progression after initial chemotherapy were randomized 1:1 to receive erlotinib 150 mg / day orally + best supportive care or placebo + best supportive care until disease progression, unacceptable toxicity, or death.8 erlotinib therapy significantly improved progression - free survival (hazard ratio [hr]: 0.71; 95% confidence interval [ci]: 0.620.82; p <0.0001) and overall survival (hr: 0.81, 95% ci: 0.700.95; p = 0.0088) in the intent - to - treat population (n = 438)8 and in a subpopulation of patients (n = 252) with stable disease following initial first - line chemotherapy (progression - free survival hr: 0.68, 95% ci: 0.560.83; p <0.0001; overall survival hr: 0.72, 95% ci: 0.590.89; p = 0.00198). The survival benefits observed following erlotinib maintenance therapy in patients with mutated epidermal growth factor receptor and patients with wild - type epidermal growth factor receptor were also achieved without significantly compromising tolerability or health - related quality of life . The objective of this analysis was to estimate the cost - effectiveness of erlotinib versus best supportive care when used as first - line maintenance therapy for patients with locally advanced or metastatic nsclc and stable disease following first - line therapy in three european countries, ie, france, germany, and italy . To estimate the incremental cost - effectiveness of erlotinib, an economic decision model was developed using patient data on progression - free survival and overall survival for erlotinib and best supportive care as first - line maintenance therapy from the saturn trial.8 an area under the curve (or partitioned survival) model was developed consisting of three health states, ie, progression - free survival, progression, and death (figure 1). Survival data from the trial were used to follow patients from the progression - free survival to the progression and death states, and allowed for extrapolation of the data beyond the trial period . The model uses the stable disease population, as indicated in the european union label,12 to calculate efficacy and the same dose as was used in the trial, ie, erlotinib 150 mg / day orally + best supportive care or placebo + best supportive care . The area under the curve model works by assuming that, at any discrete time point, the difference between the proportion of patients in overall survival and the proportion of patients in progression - free survival determines the proportion of patients who have experienced disease progression . At the start of the analysis, it was assumed that all patients were in the progression - free survival health state . A half - cycle correction is used to account for events that occur during each monthly cycle . The time horizon of 5 years can be considered to be a lifetime perspective in this patient population (after 5 years, virtually all patients will have died). The model was developed from the perspective of the national health care payer in three european countries, ie, france, germany, and italy; therefore, indirect costs, including travel costs, and costs to other public agencies were not included . Probabilistic sensitivity analyses were performed to investigate the impact of changes in the key input parameters and assumptions on the results of the base - case analysis . Distributions around the following parameters were used to reflect uncertainty in the model (ie, the probability of erlotinib being cost - effective): estimates for the parametric progression - free survival and overall survival functions, and cost and frequency of adverse events . Adverse events were selected for inclusion in the model by grade of severity and frequency of occurrence by event and treatment arm, according to the following rules: all treatment - related adverse events grade 34, and adverse events that occurred from the start of the study and 28 days after the last cycle of first - line treatment inclusively . The frequency of each event was further categorized into the number of patients experiencing at least one adverse event . These values were used for calculating the average number of each adverse event per patient (eg, probability of a specified adverse event per patient average number of episodes of adverse event per patient). The model does not include post - progression - free survival treatments (following disease progression) once maintenance therapy is stopped, because it was not designed to incorporate this information . Therefore, second - line and further - line treatment costs, capturing the various treatment strategies used following progression, were not accounted for within the model . This was due to the variation in second - line treatment observed in the saturn study; uncontrolled patients received multiple therapies after disease progression, which included taxanes (eg, docetaxel), antimetabolites (eg, pemetrexed), anti - neoplastic agents, epidermal growth factor receptor tyrosine kinase inhibitors (eg, erlotinib), and platinum compounds . In addition, insufficient data were reported in the saturn study on second - line treatment dosing and duration . Survival curves were fitted parametrically to the kaplan meier progression - free survival and overall survival curves to facilitate extrapolation beyond the clinical trial period . The gamma function13,14 provided the best fit for overall survival, whereas for progression - free survival the gompertz distribution14 was shown to be the best fit for the stable disease population . Therefore, these functions were used in all analyses to estimate and extrapolate progression - free survival and overall survival beyond the clinical trial period . The cost of erlotinib was incorporated into the model using the country - specific list price of a pack of 30 150 mg tablets (2130.00, 2928.24, and 1864.57 for france, germany, and italy, respectively) and was applied in the base - case analysis for the average treatment duration during the clinical trial (table 1). As per the study protocol, patients received a single daily dose of erlotinib 150 mg orally . In order to calculate the monthly cost of erlotinib, the cost per 150 mg tablet (71.00, 83.63, and 49.10, respectively) was multiplied by the average number of days per month (30.4 days, table 1). To estimate the resource use associated with administration of erlotinib, the appropriate reference costs associated with administration of oral medication in the pharmacy were used (table 1). Administration costs were obtained from france,15 germany,16 and italy.17 country - specific estimates of the most likely minimum and maximum costs of treatment - related adverse events were employed to propagate the gamma distribution to express uncertainty in the cost of treating the event.18 the cost values were then applied to the frequency of adverse events.1921 an area under the curve (or partitioned survival) model was developed consisting of three health states, ie, progression - free survival, progression, and death (figure 1). Survival data from the trial were used to follow patients from the progression - free survival to the progression and death states, and allowed for extrapolation of the data beyond the trial period . The model uses the stable disease population, as indicated in the european union label,12 to calculate efficacy and the same dose as was used in the trial, ie, erlotinib 150 mg / day orally + best supportive care or placebo + best supportive care . The area under the curve model works by assuming that, at any discrete time point, the difference between the proportion of patients in overall survival and the proportion of patients in progression - free survival determines the proportion of patients who have experienced disease progression . At the start of the analysis, it was assumed that all patients were in the progression - free survival health state . A half - cycle correction is used to account for events that occur during each monthly cycle . The time horizon of 5 years can be considered to be a lifetime perspective in this patient population (after 5 years, virtually all patients will have died). The model was developed from the perspective of the national health care payer in three european countries, ie, france, germany, and italy; therefore, indirect costs, including travel costs, and costs to other public agencies were not included . Probabilistic sensitivity analyses were performed to investigate the impact of changes in the key input parameters and assumptions on the results of the base - case analysis . Distributions around the following parameters were used to reflect uncertainty in the model (ie, the probability of erlotinib being cost - effective): estimates for the parametric progression - free survival and overall survival functions, and cost and frequency of adverse events . Adverse events were selected for inclusion in the model by grade of severity and frequency of occurrence by event and treatment arm, according to the following rules: all treatment - related adverse events grade 34, and adverse events that occurred from the start of the study and 28 days after the last cycle of first - line treatment inclusively . The frequency of each event was further categorized into the number of patients experiencing at least one adverse event . These values were used for calculating the average number of each adverse event per patient (eg, probability of a specified adverse event per patient average number of episodes of adverse event per patient). The model does not include post - progression - free survival treatments (following disease progression) once maintenance therapy is stopped, because it was not designed to incorporate this information . Therefore, second - line and further - line treatment costs, capturing the various treatment strategies used following progression, were not accounted for within the model . This was due to the variation in second - line treatment observed in the saturn study; uncontrolled patients received multiple therapies after disease progression, which included taxanes (eg, docetaxel), antimetabolites (eg, pemetrexed), anti - neoplastic agents, epidermal growth factor receptor tyrosine kinase inhibitors (eg, erlotinib), and platinum compounds . In addition, insufficient data were reported in the saturn study on second - line treatment dosing and duration . Survival curves were fitted parametrically to the kaplan meier progression - free survival and overall survival curves to facilitate extrapolation beyond the clinical trial period . The gamma function13,14 provided the best fit for overall survival, whereas for progression - free survival the gompertz distribution14 was shown to be the best fit for the stable disease population . Therefore, these functions were used in all analyses to estimate and extrapolate progression - free survival and overall survival beyond the clinical trial period . The cost of erlotinib was incorporated into the model using the country - specific list price of a pack of 30 150 mg tablets (2130.00, 2928.24, and 1864.57 for france, germany, and italy, respectively) and was applied in the base - case analysis for the average treatment duration during the clinical trial (table 1). As per the study protocol, patients received a single daily dose of erlotinib 150 mg orally . In order to calculate the monthly cost of erlotinib, the cost per 150 mg tablet (71.00, 83.63, and 49.10, respectively) was multiplied by the average number of days per month (30.4 days, table 1). To estimate the resource use associated with administration of erlotinib, the appropriate reference costs associated with administration of oral medication in the pharmacy were used (table 1). Administration costs were obtained from france,15 germany,16 and italy.17 country - specific estimates of the most likely minimum and maximum costs of treatment - related adverse events were employed to propagate the gamma distribution to express uncertainty in the cost of treating the event.18 the cost values were then applied to the frequency of adverse events.1921 comparison of the total average costs of alternative therapies for first - line maintenance shows that erlotinib was more costly than best supportive care in all three countries . Treatment with erlotinib in first - line maintenance resulted in a mean life expectancy of 1.39 years (16.7 months) in all countries, compared with a mean 1.11 years (13.3 months) with best supportive care, which represents 0.28 life - years (3.4 life - months) gained with erlotinib versus best supportive care . Results of the base - case and probabilistic analyses, presented as mean values and corresponding 95% ci for the latter are shown in table 2 . In the base - case analysis, the cost per life - year gained was 39,783, 46,931, and 27,885 in france, germany, and italy, respectively . In the probabilistic analysis, the cost per life - year gained was 39,214, 46,816, and 27,864, respectively . The variation in cost per life - year gained between countries was due to the difference in the total monthly cost of erlotinib, which comprises administration costs, acquisition costs, and costs of adverse events (table 3).2225 a cost - effectiveness acceptability curve for each country, generated from the probabilistic analysis, is presented in figure 2 . These curves show that there is a 50% chance that erlotinib would be cost - effective in first - line maintenance with a willingness to pay approximately 50,000 in france and germany and 40,000 in italy . Treatment of advanced or metastatic nsclc is often considered costly; however, the value of a new treatment should incorporate the clinical benefit it provides compared with current treatment options, and the incremental cost of funding the new therapy versus the unmet need . In view of the current poor survival outcomes in metastatic nsclc, it is of interest to consider the cost per life - year gained with a new therapy . An increase in health care expenditure in cancer care makes cost - effectiveness analysis an important tool for national health care payers.26 this is the first analysis of its kind to present a cross - market analysis of cost per life - year gained for first - line maintenance therapy in patients with locally advanced or metastatic nsclc . In each country, erlotinib resulted in a survival gain when compared with best supportive care . The difference between highest and lowest cost per life - year gained across the three countries was 19,000 for both base - case and probabilistic results . Figure 2 demonstrates that the chance of erlotinib being cost - effective versus best supportive care in first - line maintenance is relatively stable across the three countries, although slightly higher in italy given the same willingness to pay . A strength of the model is its transparency, given that the discrete health states closely match the end points measured in the clinical trial . The methods of extrapolation are also similar to those commonly suggested by the health economic community,18 as well as the modeling methods widely reported in peer - reviewed publications . Despite the strengths of the model, it is important to recognize any associated limitations . The model was developed to estimate the cost - effectiveness of treatment in the first - line maintenance setting only . This was due to a variety of second - line and further - line treatments reported in the saturn trial and insufficient data reported on treatment dosing and duration . Pemetrexed, a multitargeted antifolate chemotherapeutic agent, is the only other therapy approved by the european medicines agency for use in first - line maintenance for metastatic nsclc (in patients with non - squamous disease).11 in the jmen trial,27 pemetrexed was associated with similar efficacy benefits versus best supportive care (progression - free survival hr: 0.50, 95% ci: 0.420.61; p <0.0001)27 as erlotinib versus best supportive care in the saturn trial . In a population - matched, indirect comparison analysis comparing erlotinib and pemetrexed as first - line maintenance therapy in metastatic nsclc, both treatments were found to be similarly efficacious (table 3).23 an economic analysis of pemetrexed versus best supportive care in the us market showed that the cost per life - year gained using pemetrexed first - line maintenance therapy versus best supportive care in patients with advanced, non - squamous nsclc was us$122,371 (86,869).22 the analysis suggests that pemetrexed is not cost - effective compared with best supportive care, given the cost - effectiveness ratios for medication typically reimbursed in the us, while our analysis shows that erlotinib is cost - effective when compared with best supportive care (table 3). However, it is difficult to compare the cost - effectiveness of erlotinib and pemetrexed using the results of these three analyses . Pemetrexed was only efficacious in a non - squamous population and erlotinib was efficacious in both the intent - to - treat and stable disease populations . Patient distributions of key characteristics between the saturn and jmen studies were not balanced . The adenocarcinoma population varied by 3%, the number of patients with stage iiib and iv disease varied by 8% between the two trials for both disease stages, and eastern cooperative oncology group performance status varied by 9% for both 0 and 1 . Patients in the jmen trial had a better prognosis at baseline.8,27 furthermore, drug costs in the us and europe are different . If a cost - effectiveness analysis of erlotinib versus pemetrexed were to be performed, the comparable efficacy of erlotinib and pemetrexed derived from the indirect comparison analysis23 would make drug costs the key driver . Monthly costs of erlotinib and pemetrexed comprising administration, acquisition, and adverse event costs (table 3) derived from a manuscript in press28 (published in part at a recent scientific conference24,25) show erlotinib has lower monthly per - patient treatment costs . Based on these costs, a cost - effectiveness analysis of erlotinib versus pemetrexed might be expected to show that erlotinib is as efficacious as pemetrexed but less costly . However, the results would need to be interpreted with caution, given the imbalance in the key characteristics of patient populations between the saturn and jmen trials.8,27 given that erlotinib is cost - effective versus best supportive care based on this economic analysis, and has efficacy similar to that of pemetrexed at a lower cost, it could become the new standard of care in first - line maintenance therapy in locally advanced and metastatic nsclc . In addition to the clinical similarity and economic advantages of erlotinib over pemetrexed, erlotinib may also have other advantages due to a lower incidence of adverse events and an oral, as opposed to intravenous, formulation.8 oral treatment is often considered more convenient and is not usually associated with any administration costs . Erlotinib is a cost - effective treatment option versus best supportive care when used as first - line maintenance therapy for locally advanced or metastatic nsclc in patients with stable disease . This study suggests that, in conjunction with toxicity and efficacy data, economic analyses are useful in defining the best maintenance strategy for patients with locally advanced or metastatic nsclc.
|
Spinal anaesthesia has been widely used for caesarean section (cs) deliveries because of greater maternal safety, foetal benefits, higher parental satisfaction, and consumer demand . However, to address the problem of limited duration of action and to improve the quality of analgesia, various adjuvants are added intrathecally with local anaesthetics (la). The adjuvants gained widespread popularity as they reduce the amount of la and thus the incidence of side - effects . Clonidine, a selective partial agonist for alpha-2 adrenoreceptors, is an attractive alternative to commonly used opioids, and is known to increase both sensory and motor block of la . Several studies have shown that clonidine also has antihyperalgesic effect and thus reduces the post - operative analgesic requirement . Commonly, adjuvants are mixed with la in a single syringe before injecting the drugs intrathecally . Mixing of these drugs changes the density of both drugs, thus affecting their spread in the cerebrospinal fluid (csf). Density is known to influence the spread of la, but the effect of adjuvant solution density on its movement in the csf has not been studied extensively . Therefore, we hypothesised that if we administer la and the adjuvants separately, it may minimise the effect of the changes in densities and also hence their actions . Thus, in this study we aimed to compare block characteristics, intra - operative haemodynamics and post - operative pain relief in parturients undergoing cs under subarachnoid block (sab), after administering hyperbaric bupivacaine (hb) and clonidine as a mixture in single syringe and sequentially in two syringes . After approval by the institutional ethical committee and written informed consent, sixty parturients with singleton pregnancy, american society of anaesthesiologist (asa) i and ii physical status, scheduled for elective cs under sab, were enrolled in this single - blind prospective randomised controlled trial . Patients having multiple pregnancy, intrauterine deaths or known foetal anomaly, severe pregnancy induced hypertension, contraindication to sab, patients on cardiovascular medications and those having history of hypersensitivity to clonidine and la were excluded from the study . Using a sealed envelope technique, (n = 30) received hyperbaric bupivacaine (0.5%) 10 mg (2 ml) and clonidine 75 mcg (0.5 ml) as a mixture . Group b (n = 30) received clonidine 75 mcg (0.5 ml) followed by hyperbaric bupivacaine (0.5%) 10 mg (2 ml) in different syringes . For our study, the two drugs used were sourced from same company to avoid manufacturer's difference . Hyperbaric bupivacaine used was heavy anawint and clonidine used was cloneont manufactured by neon laboratories limited, mumbai . Patients were kept fasting overnight and antacid prophylaxis with oral ranitidine 150 mg at night and on the morning prior to surgery were given . The patients were familiarised with the concept of visual analogue scale (vas) for pain assessment with 0 = no pain and 10 = worst possible pain . In the operating room, monitor for heart rate (hr), non - invasive blood pressure, electrocardiography and oxygen saturation (spo2) was connected and baseline parameters were recorded . After establishing 18 gauge venous cannula, patients were pre - loaded with 15 ml / kg of lactated ringer's solution 15 - 20 min before spinal block . Under all aseptic precautions sab was administered with 23 g quincke spinal needle through mid - line approach in sitting position . Intrathecal (it) drug was injected in l3-l4 interspace over 30 s (including the time for change of syringe in sequential administration). After the block was performed, the patients were made supine with 15-20 left displacement of uterus until birth of baby by keeping a wedge under the right buttock . Fluid therapy was maintained with lactated ringer's solution 10 ml / kg / h . An experienced anaesthesiologist who was unaware of the drug given evaluated the spinal block and other physiological parameters . Haemodynamic parameters such as hr, systolic arterial pressure (sap), diastolic arterial pressure (dap) were monitored at every 2 min (min) for the first 20 min and then every 5 min subsequently until 75 min or until completion of surgery . Any episode of hypotension and bradycardia in 24 h was noted . Hypotension (decrease in sap below 90 mmhg or a fall in blood pressure by> 20% of baseline values) was treated with a rapid infusion of crystalloids (200 ml) and a bolus of ephedrine 5 mg intravenous (i.v) was administered if hypotension persisted . Bradycardia (hr <50 beats / min) was treated with injection atropine 10 mcg / kg i.v . The onset of sensory block was assessed by loss of pin prick sensation along the mid clavicular line bilaterally . Dermatomal level was tested every 2 min after sab until level was stabilised for four consecutive readings . The time from it injection to highest sensory level (maximum block height) was noted . Furthermore, level was tested every 30 min until regression from highest level to t10 dermatome was noted . Degree of motor block was assessed by modified bromage scale as follows; i free movement of legs and feet; ii just able to flex knees with free movement of feet; iii unable to flex knees but with free movement of feet; iv unable to move legs and feet . Time to achieve complete motor block (modified bromage iv) and its regression to modified bromage i was noted . Respiration was monitored and respiratory depression was defined as respiratory rate <10 breaths / min or spo2 <92%; oxygen was then supplemented through nasal prongs at 4 l / min . Sedation score was assessed at the same interval as sensory block until 2 h post - operatively by ramsay sedation score (rss) as: level 1 awake, anxious, agitated, restlessness; level 2 awake, tranquil, co - operative; level 3 responds to commands; level 4 asleep, brisk response to stimuli; level 5 n asleep, sluggish response to stimuli; level 6 asleep, no response to stimuli . Intra - operative pain was checked and expressed as vas, whenever the parturients complained of any discomfort or pain . Duration of effective analgesia was defined as time from it injection till vas was 3, when rescue analgesia in the form of injection i.v diclofinac sodium 75 mg was administered . Patients complaining of nausea or having any episode of vomiting were given injection ondansetron 0.15 mg / kg i.v ., new - born's apgar scores were determined by a paediatrician not otherwise involved in the study at 1, 5, and 10 min . Post - operatively any incidence of bradycardia, hypotension, nausea / vomiting, prolonged sedation reported by the recruited post - operative care unit staff was taken into account and managed accordingly . The parturients were also interviewed for post - dural puncture headache (pdph), backache, and examined for any neurological deficit . Power analysis suggested that a sample size of 30 patients / group was required to achieve a power of 80% and a level significance of 0.05 to be able to detect a difference between the groups, based on the assumption that an increase in the mean duration of analgesia by 60 min in sequential group . Interpretation of the data was carried out and analysed using software microsoft excel and spss version 19 . Data is represented as mean standard deviation for continuous data and frequency (percentage%) or median (range) for non - parametric (categorical) data . The proportion of adverse effects was compared using chi - square test and level of sedation was compared with the help of wilcoxon test . The p <0.05 was considered significant and p <0.01 was considered highly significant . Demographic data in terms of age, height, weight, asa physical status and duration of surgery were comparable in both groups [table 1]. The onset time of sensory and motor block and also the highest level of block achieved (t4) were comparable in both groups [table 2]. Mean time to reach maximal cephalad sensory block height was significantly less in group b (3.21 0.13 min) than in group m (4.43 0.26 min) and the total duration of analgesia lasted significantly longer in group b (474.3 20.79 min) as compared to group m (337 18.22 min) (p = 0.000). Complete motor blockade was achieved earlier in group b (4.75 0.40) than in group m (5.84 0.36) (p = 0.000). The resolution time of motor block back to modified bromage i was significantly prolonged in group b (292.23 15.24 min) than in group m (189.50 16.31 min) [table 2]. Characteristics of sensory and motor block haemodynamic parameters showed that the lowest values of the hr were after 45 min of the administration of sab, but none of the patients had bradycardia [figure 1]. There was a significant fall in sap at 2 min and 4 min after administration of sab in both groups [figure 2]. A significant fall in dap was seen at 2, 4, 6, and 8 min of administration of sab . There was an overall trend of fall in sap and dap in both groups, except during the time intervals of 20 and 25 min (during delivery of baby) where there was rise in both sap and dap [figures 2 and 3]. The falling trend of arterial blood pressures was more in the group b than in group m. heart rates at different time intervals systolic blood pressure at different time intervals diastolic blood pressure at different time intervals there was no noticeable fall in spo2 in both groups . It was observed that only one patient in group m and 3 in group b had sedation score of 4 according to rss . Intra - operative incidence of hypotension, bradycardia, respiratory depression, nausea / vomiting, dry mouth and additional analgesic requirement are comparable in both groups [figure 4]. Newborn's well - being, assessed by the apgar scoring system was observed in both groups . The median value was 8 at 1 min, 9 at 5 min and 10 at 10 min in both groups . Activation of post - synaptic alpha-2 receptors in the substantia gelatinosa of the spinal cord is the presumed mechanism by which clonidine produces analgesia . These receptors are located on primary afferent terminals (both at peripheral and spinal endings), on neurons in the superficial lamina of the spinal cord, and within several brainstem nuclei implicated in analgesia, supporting the possibility of analgesic action at peripheral, spinal, and brainstem sites . Various authors have used different doses of it clonidine ranging from 15 mcg to 300 mcg along with local anaesthetics . Kaabachi et al ., in their study used 2 mcg / kg of it clonidine and reported extended duration of post - operative analgesia, but with moderate side - effects . Sethi et al ., used 70 mcg of clonidine and found a significant decrease in mean arterial pressure and hr in clonidine group, but no therapeutic intervention was required for either . Since marked decrease in blood pressure is observed only with intermediate doses of spinal clonidine (150 mcg) and relative haemodynamic stability is maintained after larger doses (300 - 400 mcg), we were interested to test a dose of lower range of efficacy . Hence, we selected a 75 mcg of preservative free clonidine as an adjuvant for spinal anaesthesia in cs . Patients scheduled for cs were chosen for the study because it is a well - known fact that visceral discomfort and pain is common occurence in cs under sab . The observations and results obtained in the study are based on the assumption that the original densities of hyperbaric bupivacaine and clonidine are lost when they are premixed in a syringe thus, they exert suboptimal actions when compared to their it administration in a sequential manner . The above assumption is supported by the work of desai et al . Who studied the same effect by adding opioids to la solution intrathecally . The densities of the drugs that we used (hb and clonidine) were 1.0260 and 0.9930, respectively . The density of the mixture of 2 ml (10 mg) of hyperbaric bupivacaine and 0.5 ml (75 mcg) clonidine was also estimated and it was found to be 1.0189 . In our study, we observed that the mean onset time of sensory and motor block was similar in both groups . However, onset of sensory block does not get any better after a particular dose as supported by a study done by heo et al . Who did not report any difference in onset time even after using 150 mcg clonidine . The time to reach maximum sensory block height and maximum motor block was significantly less in group b (sequential drugs) than in group m (mixed drugs) in this study . This difference might have existed because of the preferential cephalad spread of clonidine when we administered it through a separate syringe, owing to its hypobaric nature which is lost when the drugs are premixed . Desai et al . Also observed that the time to reach highest level of block was less when morphine and fentanyl were administered sequentially with hb than when given as a mixture . In our study, we found that the mean time taken for sensory block to regress to t10 level was significantly longer in group b (240.67 18.47 min) than in group m (153.83 13.11 min). Similarly, the mean duration of analgesia lasted significantly longer in group b (474.33 20.79 min) than in group m (337 18.22 min), depicting significant prolongation of analgesic effect in the group receiving drugs in a sequential fashion . This difference might be due to the fact that injecting clonidine and bupivacaine as a mixture dilutes clonidine and receptor occupancy might decrease leading to less pronounced effect . However, if clonidine is administered separately, we expect a greater spread and therefore formation of stronger bonds with the receptor leading to a denser and prolonged block . According to desai et al ., dextrose in a hb solution slow the movement of morphine molecules in the csf, reducing the exposure of supraspinal centres to morphine . Clonidine also being hypobaric drug, acting on both spinal and supraspinal receptors, might exhibit similar properties . Gray et al . Observed that duration of analgesia is increased when it morphine is administered with normal saline (hypobaric) than with dextrose saline (hyperbaric). Clonidine decreases hr by a presynaptic mediated inhibition of nor epinephrine release and by a direct depression of atrioventricular nodal conduction after systemic absorption . The maximum fall in the hr when compared to the baseline was 28% in group b, whereas it was only 13% in group m which was statistically significant (p <0.001). This fall in hr was more pronounced after about 40 - 60 min of administration of sab and toward end of the surgery . However, in our study none of the patients had bradycardia . A significant fall in arterial blood pressure after sab the fall from baseline sap and dap in group m was 15% and 18% and in group b was 19% and 20%, respectively . Haemodynamic effects of clonidine after neuraxial or systemic administration begin within 30 min, reach maximum within 1 - 2 h, and last approximately 6 - 8 h after a single injection . We observed hypotension in 13% patients in group m and 16% patient in group b. hypotention was managed by i.v fluids and vasopressors were needed for only 1% and 3% parturients in groups m and b, respectively which was comparable in both groups, suggesting that the clonidine groups did not have a higher predisposition for the development of hypotension if administered sequentially . In our study, the level of sedation provided by it clonidine (rss 2 and 3) was not only acceptable, but also beneficial owing to its anxiolytic role . None of the patients needed any additional analgesics during the intra - operative period . In line with our observations, benhamou et al . Found that when it clonidine was administered with hb, none of patients required additional analgesics to obtain an adequate sensory block . None of the patients complained of dry mouth . In the post - operative period one patient each in group m and b developed pdph, which was managed conservatively . There was no incidence of hypotension, bradycardia and nausea / vomiting, neurological deficit, prolonged sedation in the post - operative period . Neves et al . Also concluded that addition of it clonidine did not adversely affect the neonatal outcome in terms of apgar scores . The limitation of our study was that we measured the densities of solutions in vitro; but, we could not measure the densities when injected into the csf . Sequential administration of clonidine reduces the time to achieve complete sensory and motor block and significantly prolongs the total duration of analgesia . Addition of clonidine to hyperbaric bupivacaine provided a dense surgical anaesthesia irrespective of the technique of administration . However, we noticed that sequential technique did not increase the level of sedation and incidence of hypotension or bradycardia as compared to the administration of drugs as mixture.
|
In 2014, there will be 63,920 new cases of kidney and renal pelvis cancer diagnoses resulting in approximately 13,860 deaths . Renal cell carcinoma (rcc) is one of the most lethal genitourinary cancers and comprises 85% of these new diagnoses . The incidence of rcc has steadily increased over the past few decades due to incidentally discovered small renal masses (srm) on radiographic imaging resulting in stage migration to clinical t1a disease from more advanced disease . Numerous treatment options exist for clinical t1a disease, including total nephrectomy, partial nephrectomy, radiofrequency ablation, cryoablation, and high - intensity focused ultrasound (hifu). In 2009, the american urologic association (aua) published the guideline for the clinical stage 1 renal mass which concluded that partial nephrectomy is the standard of care for clinical t1a disease suggesting that the open approach is preferred over minimally invasive techniques . In experienced hands, laparoscopic partial nephrectomy (lpn) is associated with similar oncologic outcomes to open partial nephrectomy (opn) with the added benefit of decreased narcotic use, decreased hospital stay, and earlier convalescence [57]. Robotic partial nephrectomy (rpn) and lpn have also been compared with similar outcomes, if not superior rpn outcomes, in the hands of an experienced minimally invasive surgeon . Most studies report the outcomes of either (a) single surgeon and single and/or dual approach or (b) multicenter, multisurgeon, and dual approach . To our knowledge, there have been no reports of a single surgeon's experience with each of the three modalities . Our hypothesis is that when performed by a single surgeon, open, laparoscopic, and robotic partial nephrectomy could differ in postoperative complication rates and overall kidney function . Thus, we report the perioperative outcomes of 106 consecutive patients treated with partial nephrectomy by a single surgeon using all three surgical approaches opn, lpn, and rpn . After obtaining institutional review board approval, a retrospective chart review of a prospectively collected kidney cancer database was performed . From august 2006 to february 2012, a single surgeon (rm) with minimally invasive and urologic oncology fellowship training performed 106 consecutive partial nephrectomies using any of the three available surgical modalities opn, lpn, or rpn . The decision for the approach was multifactorial and was based on patient and tumor characteristics . Initially in the practice, lpn was offered to patients with tumors of favorable size and location . Opn was reserved for patients who were uninephric, had compromised kidney function, or had large tumors in an unfavorable location . In early 2008, rpn gradually replaced lpn as the preferred minimally invasive approach . Preoperative variables and demographics analyzed included age, gender, body mass index (bmi), american society of anesthesiologist (asa) score, glomerular filtration rate (gfr), hematocrit (within 30 days of surgery), tumor laterality, and tumor size . Operative variables analyzed included operative time, estimated blood loss (ebl), complications, pathology (benign, malignant), and margin status . Postoperative variables included length of stay, discharge hematocrit, transfusion, gfr, 3-month gfr, and 30-day complications . The indication for partial nephrectomy was an enhancing renal mass found on cross - sectional abdominal imaging . Pathology was reviewed by a dedicated genitourinary pathologist for margin status and tumor type . Briefly, patients were positioned in a modified 45-degree flank and an incision was made for access to the retroperitoneum . The kidney was dissected free of attachments in the retroperitoneal space and the hilum was identified . Intravenous mannitol (12.5 g) administration and renal hypothermia (cold ischemia) were utilized prior to hilar clamping in all cases . The hilum was clamped using the satinsky vascular clamp and the resection of the renal lesion was performed with sharp dissection . The collecting system was closed primarily, and individual vessels were identified and controlled using nonabsorbable monofilament suture . Argon beam coagulation achieved hemostasis prior to reapproximation of the renal parenchyma with surgicel (ethicon inc, somerville, nj) bolsters . In all cases, the patient was positioned in a modified flank configuration with a total of four ports . Once the hilum and mass were identified, mannitol (12.5 g) was administered and the hilum was controlled using a laparoscopic vascular clamp (warm ischemia). Surgicel (ethicon inc, somerville, nj) and floseal (biosurgery, deerfield, il) were used for hemostasis and the tumor bed was repaired in a running fashion based on the depth of the lesion . The parenchyma was reapproximated with 2.0 v lock suture, surgicel (ethicon inc, somerville, nj) bolsters, and secured with hem - o - lok clips . In superficial tumors penetrating less than 1 cm into kidney parenchyma, clamping and/or repair of the base of resection was not performed . All patients underwent warm ischemia, which was achieved using either laparoscopic bulldog clamps or a vascular clamp . Similar to the lpn technique, the resection bed was closed in a running fashion using an absorbable suture and the defect was approximated using a surgicel (ethicon inc, somerville, nj) bolster in most cases . The statistical package for the social sciences v.19 (spss inc . All p values were one - sided, and p <0.05 was considered statistically significant . Categorical variables were compared using a chi - square test and continuous variables were compared using one - way anova . Among the 106 patients in the study, 23 patients (22%) underwent opn, 48 patients (45%) underwent lpn, and 35 patients (33%) underwent rpn . There was no difference in age, gender, bmi, asa score tumor laterality, or tumor size between the three groups (table 1). There was a statistical trend towards lower preoperative hematocrit for opn patients compared to the minimally invasive patients (opn40 4%, lpn43 4%, rpn42 4%, p = 0.09). Preoperative gfr was 71 28 ml / min for opn patients, 76 25 ml / min for lpn patients, and 96 37 ml / min for rpn patients (p = 0.004). There was no difference in intraoperative complication rate, tumor pathology, or margin status between the opn, ldn, and rpn patients (table 2). Operative time was the shortest in the opn group (opn163 35 min, lpn227 53 min, rpn244 53 min, p <0.0001). Ebl (opn367 286 ml, lpn163 179 ml, rpn191 173 ml, p <all patients who had opn had the kidney cooled for an average time of 8 minutes before excision of the tumor . There were no differences in length of stay, blood transfusion, discharge gfr, or 3-month gfr for the three cohorts of patients (table 3). Discharge hematocrit was significantly lower for opn patients (30 3%) compared to lpn (36 4%) and rpn (35 4%) patients (p <0.0001). Upon follow - up, the opn group had the highest incidence of 30-day complications (30%), while the rpn group had the lowest (14%, p = 0.008). The opn complications included clavien i (n = 2), clavien ii (n = 1), clavien iii (n = 3), and clavien iv (n = 1). The lpn complications included clavien i (n = 4), clavien ii (n the rpn complications included clavien i (n = 1), clavien ii (n = 1), and clavien iii (n = 3). Radical nephrectomy (rn) has been the mainstay of treatment for clinical stage i tumors resulting in excellent cancer specific survival, local tumor control, and progression free survival; however, reports have highlighted a negative impact on renal function and chronic kidney disease (ckd) associated with rn . This effect was acknowledged in the 2009 aua guideline for the management of small renal masses which concluded that opn should be considered standard of care and that minimally invasive options, such as lpn and rpn, be considered as second line treatment modalities . Furthermore, recent studies have established that partial nephrectomy (pn) provides similar oncological outcomes when compared to rn [1214]. The current study is the first, to our knowledge, which compares all three modalities of pn (opn, lpn, and rpn) by a single surgeon . Multi - institutional studies may represent dissimilar patient cohorts that introduce selection bias and may invoke concerns regarding surgeon variability ., there was no randomization or objective criteria for the pn approach; rather, the trend was for more minimally invasive surgery as the surgeon developed a comfort level with the lpn and rpn approach . This is evident by the fact that tumor characteristics for each group are comparable (laterality, size, pathology, and margin status). Previous single surgeon studies have analyzed rpn versus lpn [11, 1519] with the consensus being that rpn offers a shorter learning curve to minimally invasive pn and comparable warm ischemia time, ebl, and length of stay . Two common criticisms associated with rpn include (i) the cost of the robot and (ii) increased surgical time . Although it is difficult to mitigate the cost associated with rpn compared to lpn and opn, the oft - held conception that procedures take significantly longer may be a misconception after achieving the learning curve associated with rpn . Concluded that rpn achieved similar operative times to lpn after only 5 procedures and the current study corroborates similar operative times between the two approaches (244 53 versus 227 53 min). In the opn cohort, there was a 30-day complication rate of 30%, which was statistically significant compared to the lpn (17%) and rpn (14%) groups, and higher than that reported by other authors . Gill et al . Reported a 16% and 13% postoperative complication rate in their initial comparison of lpn and opn, respectively . Bhayani and waxman and winfield reported postoperative complication rates of 16% and 18.2%, respectively, in each of their single - surgeon experiences with lpn [21, 22]. A recent report, which pooled data from 4 institutions considered centers - of - excellence, reported a postoperative complication rate of 14.4% in patients who underwent rpn . Most complications were clavien grade i / ii and were managed conservatively and affirm the safety of rpn in experienced hands . The complication rate was lowest in the rpn group at 14% and is similar to other reports, with ranges of 1020% [8, 15, 24]. The primary limitation of the study is the inherent selection bias and patient confounders associated with a retrospective study . Surgical confounders were minimized as only operations performed by a single surgeon were analyzed . Secondly, renorrhaphy differed between the opn and minimally invasive cohorts along with the use of renal cooling in the opn group compared to warm ischemia time for the minimally invasive approaches . Nephron sparing surgery has emerged as the optimal surgical approach for t1a and in experienced hands t1b kidney masses . By removing surgeon as a confounding variable, although not currently the gold standard for partial nephrectomy, robotic surgery continues to emerge as the future for renal surgery secondary . Rpn offers less blood loss and fewer postoperative complications than opn and overcomes the technical difficulties of lpn.
|
Job syndrome is one of the hyper immunoglobulin e (ige) syndrome (hies) conditions characterized by signal transducer and activator of transcription 3 (stat3) signaling mutations . Patients with job syndrome have characteristic clinical features in association with mutations in stat3 signaling . These include marked elevation in serum ige and susceptibility to staphylococcal infections of the pulmonary tract and skin.1 one of the hallmark features of the disease includes the formation of abscesses . On the basis of the elevation of serum ige levels, it was hypothesized that there would be a lower incidence of clinical anaphylaxis among pediatric job syndrome patients . An electronic medical record database, including both inpatient and outpatient records, was utilized . The database from a large urban children s medical center was searched from january 1, 2009 to december 31, 2014, using the international classification of diseases, ninth revision (icd-9) codes assigned to each diagnosis, job syndrome, hies, and anaphylaxis . The icd-9 codes used corresponding to each diagnosis were as follows: asthma, 493.00493.99; job syndrome, 288.1; and anaphylactic shock, 995.61 (peanut) and 995.67 (milk). The anonymous data generated for anaphylactic shock, asthma with anaphylactic shock, and job syndrome / hies were used to identify patients . The total number of patients was identified with 1) job syndrome / hies; 2) asthma with anaphylactic shock; 3) anaphylactic shock with and without peanut allergy, and with and without milk allergy; and 4) job syndrome / hies with anaphylactic shock . The database search was conducted with the medical center health information support and did not involve personal health information analysis . The study was exempt from irb review because there was no use of personal health information, as discussed with the university of california irb office . The total number of patients with job syndrome / hies identified in the database was 18 . Among the 22,890 patients evaluated with asthma of the 614 total anaphylactic patient cases identified, 286 (46.5%) had anaphylaxis with no determined specific cause . There were 250 cases (40.7%) of peanut allergen - induced anaphylaxis and 78 cases (12.7%) were because of milk products . Some patients may have been coded for one or more causes of shock . Despite the elevation of ige associated with hies / job syndrome a one- and two - tailed t - test showed that there was no statistically significant difference when comparing asthma and anaphylaxis and hies with anaphylaxis . A one- and two - tailed t - test showed that there was no statistically significant difference when comparing asthma and anaphylaxis and hies with anaphylaxis . This study shows that there were no identified cases of anaphy - laxis among the job syndrome / hies population studied . This low incidence is in contrast to established higher rates of ana - phylaxis among atopic conditions associated with high levels of serum ige . The incidence of anaphylaxis among children and adolescents has been reported as between 0.05% and 2%.2 this study identified> 600 cases of anaphylaxis, during the same time period at the same medical center, among the non - hies pediatric population . The association between allergic disease and autosomal - dominant (ad) hies was studied in a murine model . These mutations result in a very elevated serum ige level, usually without any evidence of atopic disease . The authors found that in a murine model of mast cell degranulation, mast cell - induced anaphylaxis was blunted in the mutant mice . The animals treated with a c188 - 9 stat3 inhibitor demonstrated altered physiologic responses . The responses measured included body temperature and survival . Those treated with the inhibitor had longer survival and less change in body temperature.3 in a cellular model described in the same citation, human umbilical vein cells from ad hies patients or control cells treated with a stat3 inhibitor demonstrated aberrant responses to mast cell mediators, such as histamine or platelet - activating factor . The cells from two newborns with hies were less permeable than wild - type cells when exposed to mast cell mediators.3 these findings suggest that stat3 mutations confer resistance to mast cell degranulation . A clinical study of food allergies and adult hies conducted a clinical evaluation of food allergies in a cohort of 71 patients with ad hies compared with healthy control subjects (n=41) and atopic subjects (n=65). The results indicated that fewer patients with ad hies developed food allergies and anaphy - laxis than atopic patients with marked serum ige elevation, eczema, and no stat3 mutations . The study reported that fewer patients with ad hies had anaphylaxis to a food allergen than atopic controls (8.5% vs. 33.3%). The ad hies patients did demonstrate that they had specific ige to food allergens . When comparing peanut anaphylaxis between the groups, there were no cases of peanut - induced anaphylaxis found in the patients with hies.4 the authors concluded that stat3 mutations may play a role in protecting the individual from food allergies as a trigger for anaphylaxis . In studying the activation of a key regulatory cell, basophils from hies patients were less sensitive to ige cross - linking than basophils from non - allergic subjects.4 this study demonstrates that among the pediatric cases identified, there have been no cases of anaphylaxis among the hies patients . This is in contrast to a large number of children without hies who did have anaphylaxis due to peanut or milk allergens . This study finds support for a potential protective effect of stat3 mutations in preventing anaphylaxis and demonstrates this finding in a pediatric population . Further studies are warranted to identify the molecular and cellular pathways involved in reducing vascular permeability during mast cell degranulation among children with hies.
|
Leishmania parasites are heteroxenous kinetoplastid protozoan organisms, which undergo complete differentiation upon a cycle of proliferation / differentiation in the midgut of phlebotomine sand flies followed by the transmission of infective metacyclic promastigotes [1, 2] to mammalian hosts during the insect blood meal . Once infecting mammalian hosts, these organisms, from free - living protozoa, become obligate intracellular parasites, residing and proliferating inside phagolysosomes of mononuclear phagocytic cells as amastigote forms . In humans, leishmania parasites can cause a broad spectrum of clinical manifestations from mild, self - resolving skin diseases to potentially fatal, disseminated visceral diseases . The outcome of the infection is dependent on multiple, interdependent factors, such as vector species, parasite species and strain, genetic background, and immunological status of the host . There are two main groups of parasites, stratified upon the clinical outcome of the infection: the ones capable of causing tegumentar and the ones capable of causing visceral diseases . In both cases, disease is initiated by the bite of an infected sand fly, followed by the generation of a skin lesion, mainly caused by the inflammatory response induced on that site . In some cases the disease is confined to the skin or mucosal tissues, and is termed cutaneous (cl) or muco - cutaneous (mcl) leishmaniasis, respectively . In addition, diffuse cutaneous leishmaniasis (dcl) occurs when the parasite disseminates causing the appearance of multiple skin lesions, in distal sites relative to the transmission site . In a similar way, in visceral leishmaniasis, there is parasite dissemination through blood and lymphatic vessels from the initial lesion site . However, these parasites establish in organs that comprise important populations of mononuclear phagocytes, such as bone marrow, spleen, and liver . Among the clinical manifestations observed in humans with the tegumentary disease, diffuse and mucocutaneous leishmaniasis most patients were found in the south and central america, associated with l. amazonensis infection for dcl and l. braziliensis infection for mcl . Diffuse cutaneous leishmaniasis (dcl) is a rare clinical manifestation and is characterized by the appearance of several nonulcerated nodular skin lesions, uncontrolled parasite proliferation, an inefficient cellular immune response against parasite antigens, and resistance to most therapeutic strategies [5, 6]. The intense parasitism in the dcl lesions reflects the functional state of macrophages, which are considered permissive . The deficient macrophage activation in dcl hinders the elimination of leishmania resulting in a disorganized inflammatory process, unable to control the infection . The determinants of dcl are multifactorial and may be associated with both immunologic and genetic events of the patient and the pathogenic factors related to the parasite and vector . The participation of factors associated with the parasite has been shown by some authors although it is a point that still remains to be further explored . In this context, the exhibition of markers of apoptosis by the parasite could be a contributing factor during host - parasite interactions as a possible immunosuppressive mechanism of dcl . Experimental infection models with leishmania parasites have been extensively used as a tool to study immune responses, especially regarding t - cell differentiation [8, 9]. This is due to the fact that inbred mice strains demonstrate specific patterns of susceptibility and resistance to the disease [9, 10] which correlate with the immune response built by these animals . The classical experimental model that generated this knowledge was infection with l. major parasites . C57bl/6 mice infected with this parasite develop a th1 cd4 t - cell response, which is highly effective to activate leishmanicidal and inflammatory mechanisms in macrophages, leading to intracellular parasite destruction . In this case, nevertheless, latent parasites remain in the infected tissue, providing antigens to maintain a protective immune response that prevent reinfections . On the other hand, balb / c mice infected with the same parasite species and strain developed a th2 cd4 t - cell response, which is not efficient to promote macrophage classical activation, leading to progressive disease . At the cellular level, this difference is mainly due to the activation of a population of cells that express a highly restricted t - cell receptor, v4 v8, which recognizes the lack (leishmania homologue of receptors for activated kinase) antigen and rapidly produces il-4, necessary to deviate the immune response towards th2 . Currently, it is clear that the proposed model of susceptibility and resistance to leishmania infection is quite reproducible when working with some specific strains of l. major though, for other strains and/or species, the picture is relatively more complex . Indeed, effective macrophage activation is the key to control the infection; however, the phenotype displayed by t cells in different situations is not as polarized as observed in the classical model . Actually, there are several papers that suggest that most correlations between cd4 t - cell response and disease development are not straightforward . Balb / c il-4 receptor knock - out (ko) mice remained susceptible to l. major infection when infected with lv39 strain, which seems to be due to an increased production of il-10 by t cells . C57bl/6 mice infected with a l. major strain, isolated from a patient with nonhealing lesions, still developed a th1 response but displayed a progressive disease . In addition, when infected with the ir173 strain of l. major, cd4 t cells from both balb / c and the resistant mice strain b10.d2 produce il-4 very rapidly . Other factors such as infection route, number of parasites inoculated, and type of infection (needle versus sand fly inoculation) are crucial to determine the type of response elicited (reviewed in). The complexity of the interactions that determines the clinical and immunological outcome of the disease is much less known, and apparently much more multifactorial in other infection systems, such as the ones that involve l. amazonensis infection . Experimental infection with l. amazonensis parasites leads to progressive disease and uncontrolled lesion development in all inbred mouse strains, including those ones that are highly resistant to l. major infection . However, there is a gradient of disease severity, ranging from balb / c mice, which develop a very fast lesion, that ulcerate, generating extensive areas of necrotic tissue, to c3h.hen mice that still develop nonhealing lesions, however, displaying slow progression rates [16, 17]. Nonetheless, the phenotype displayed by different mouse strains does not correlate with dichotomic th1/th2 responses . Actually, in the analyzed mouse strains such as balb / c, c57bl/6, and c3h.hen, it was possible to observe cd4 t cells capable of producing different types of cytokines such as th2 cytokines (il-4, il-5, and il-13), th1 cytokines (ifn, and tnf), and regulatory cytokines (tgf and il-10), which characterizes an unpolarized cellular response [1820]. Targeted deletion of the il4 or il10 gene [21, 22] causes minimal effects on lesion development and parasite tissue loads as well as treatment of infected mice with ifn or il-12 . Interestingly, l. amazonensis promastigotes and, especially amastigotes, are able to get through the innate immune response almost unnoticeable . As mentioned before, the main host cell for leishmania proliferation in the mammalian host is the macrophage, which is, together with dendritic cells (dcs), the main antigen presenting cells of the innate immune response . When compared to l. braziliensis parasites, for example, l. amazonensis parasites are much less capable of triggering the expression of cd40 and cd80, both costimulatory molecules for t - cell activation, and the production of il-12p40 . Actually, amastigote infection is able to downregulate the expression of mhc class ii molecules, which, during macrophage infection, is depending on sequestering these molecules inside the parasitophorous vacuole for degradation [26, 27]. During the first week of infection in c57bl/6 mice, chemokines such as ccl5, ccl3, ccl2, ccl4, and ccl11 as well as their receptors, are not upregulated when compared to l. major infection, both at the lesion site and draining lymph node . Additionally, amastigote infection downregulates several intracellular pathways that lead to dc activation such as stat 1, stat 3 and erk 1/2 phosphorylation and the expression of the interferon - responsive elements irf8 and 1, suggesting a global inhibition of inflammatory responses of these cells . The most well - characterized ligand for amastigote recognition and internalization in macrophages is the opsonizing antibodies produced throughout infection . Triggering of fc receptors on the host cells lead to il-10 production and has a pathogenic role . These events are necessary to evade the early immune response culminating with the ineffective t - cell response observed in most cases . In parallel to l. major infection in balb / c mice, where the oligoclonal v4 v8 cd4 t - cell population is necessary to the development of susceptibility in the host and is considered as pathogenic t cells, in l. amazonensis infection, t cells, in a general way, seem to be highly pathogenic . First of all, there is no clonal or oligoclonal t - cell population involved, since there is no predominance of a single or a group of v chains expressed on t cells that respond to l. amazonensis infection . However, the disruption of cd4 t cell effector functions, as observed in recombinase - activating gene ko mice (rag ko), mhc class ii transactivator ko mice (ciita ko) and nude mice leads to transient resistance to l. amazonensis infection, measured by lesion development . In addition, the adoptive transfer of regulatory t cells also restrains pathogenic effector t cells, diminishing lesion size and parasite tissue loads . The mechanisms underlying pathogenic role of t cells for the disease need to be determined . Phosphatidylserine (ps) is a structural phospholipid present in virtually all membranes and cell types . In normal cells these molecules face the cytoplasmic leaflet of the plasma membrane, whereas during apoptotic cell death these molecules translocate to the outer surface . Once outside the cell, ps becomes one of the ligands recognized by surrounding phagocytes to clear dying cells . Ps is the most characterized tickling ligand of apoptotic cells, which means that ps provides the signals for the phagocyte to activate immunosuppressive and anti - inflammatory mechanisms . Ps recognition is mandatory to prevent the establishment of a response to the self - antigens engulfed by these cells during apoptotic cell clearance and to avoid triggering inflammatory responses, especially during the embryogenesis, when massive amounts of apoptotic cells are generated and therefore, cleared [3537], but also in adults to prevent inflammatory immunopathologies . The intracellular events, receptors, and soluble factors involved in this mechanism are still being deciphered and are not the focus of this discussion . However, the effects of ps recognition in macrophages and dcs have a direct impact in immune responses . Apoptotic cells actively induce the production of the anti - inflammatory cytokines tgf, pge2, and paf and actively inhibit the production of tnf and il-1, even upon lps challenge [35, 38]. Recognition of apoptotic cells also decreases the expression of several activation markers and costimulatory molecules by both human and murine dcs [39, 40] and regulates the expression of cytokines involved with t - cell differentiation at the transcriptional level [41, 42]. At the single cell level, dcs that ingested an apoptotic cell and bacteria at the same time are able to discern between them and only present bacterial antigens this is possible because the generation of peptide - mhc class ii complexes is controlled by toll - like receptors (tlrs) in a strictly phagosome autonomous manner . Since apoptotic cells do not trigger tlr activation, the generation of stable complexes is inhibited or abrogated . All these effects are fundamental to maintain homeostasis and comprehend the last step of the efferocytosis or apoptotic cell clearance . However, it seems that intracellular parasites elegantly make use of these mechanisms to establish in the host [4547]. Furthermore, some parasites mimic the features of apoptotic cells to avoid host immune response, as discussed in the next section . One of the most common pcd phenotypes is phosphatidylserine (ps) exposure, which can be observed upon chemotherapy, starvation, and heat shock conditions in several unicellular organisms [4851] or is actively displayed in normal conditions . Our group observed that lesion - derived amastigotes of l. amazonensis actively expose high levels of ps, and by blocking this molecule there is a drastic decrease in the ability of these parasites to infect and establish in the macrophages . These parasites are viable and capable of differentiating into promastigote forms in vitro (unpublished data) and inside the sand fly vector and to infect macrophages and mice [52, 54] and did not display other markers of pcd . Ps exposure on amastigotes of l. amazonensis occurs in virtually 100% of the parasites; however, the amount of ps molecules depends on the infected host . Parasites obtained from balb / c mice expose higher amounts of ps than the ones obtained from c57bl/6 mice . This observation demonstrates that the amount of ps at the surface of the amastigotes has a positive correlation with the severity of the disease and suggests that the host is able to modulate this phenotype of the parasite . Following our description several other groups demonstrated the role of ps exposure and recognition in different infection models . Blood and cell - derived trypomastigotes of trypanosoma cruzi are able to expose ps, in contrast with epimastigotes, which are not . In addition, infection with ps - exposing trypomastigote forms induces smad nuclear translocation and inducible nitric oxide synthase inhibition (inos), suggesting an autocrine modulation of the host cell dependent on tgf . It is interesting to note that, among all t. cruzi parasite stages, only the ones that are infective for mammalian cells evolve the ability to expose ps, suggesting the presence of an evolutionary link between ps exposure and the ability to infect host cells . Similarly, toxoplasma gondii peritoneal tachyzoites expose ps at their surface, and the recognition of this molecule seems to be necessary to downmodulate inos expression and activity upon macrophage infection . More recently, several papers have demonstrated the role of exposed ps molecules for the infection by enveloped viral particles . For human immunodeficiency virus-1 (hiv-1), ps at the viral envelope is a cofactor for monocyte infection; in vaccinia virus infection, ps recognition modulates the activity of proteins involved in cytoskeleton reorganization such as p21-activated kinase (pak) and the small rho gtpase rac, leading to increased macropinocytic activity and uptake of viral particles . In addition, ps exposure by tumor cell, microvesicles shed by transformed cells, or endothelial cells in the intratumor environment seems to be involved in different events in tumor development, maintenance, and metastasis [59, 60]. This knowledge stimulated some researchers to evaluate the efficacy of anti - ps antibodies to treat viral and tumoral diseases . Actually the results so far are promising . In murine models of lassa fever (pichinde virus) or murine cytomegaloviruses the treatment efficacy was very high, reaching complete cure (total absence of detectable viral loads) in combination with available antiaviral drugs . For experimental tumoral disease, lung cancer, pancreatic tumors, and glioblastomas were efficiently treated, decreasing tumor growth and metastasis in some cases or potentiating the effect of chemo- and radio - therapies [6264]. Our group has been committed to study the role of ps exposure on the surface of different isolates of l. amazonensis . We worked with the hypothesis that l. amazonensis isolates from dcl patients would have higher ps exposure compared with localized cutaneous leishmaniasis (lcl), and this would contribute to macrophage deactivation, favoring parasite replication . For this, we compared ps exposure in l. amazonensis isolates from dcl clinical cases in the active phase of the disease, reported in maranho state in brazil, to those isolated from lcl patients of clinical cases from bahia . The results indicate that the isolates obtained from dcl patients indeed displayed more ps than isolates from lcl patients at early times postinfection . In addition, isolates from dcl patients were more infective than the ones obtained from lcl patients (frana - costa et al . The other hand, independent of parasite strain analyzed, the parameters of infectivity correlated positively with the exposure of ps in the parasites . These data suggest that in human infections the pattern observed in mice when comparing balb / c versus c57bl/6 mice is maintained . However, it is necessary to investigate the mechanisms by which the recognition of ps on the surface of the isolates of l. amazonensis deactivate the macrophage response . Particularly, it would be necessary to evaluate whether freshly isolated parasites display this phenotype to validate our analysis made on amastigotes derived from macrophages infected in vitro with cultured promastigote parasites isolated from human lesions . We believe that understanding the dynamics of ps expression, along with identification of the mechanisms involved in the immunosuppression of dcl patients, can result in therapeutic targets for intervention in the immunopathogenesis of this chronic and severe form of leishmaniasis . In a similar way we are interested in the immunomodulatory mechanisms underlying ps exposure in different inbred mice strains . For that we are currently evaluating these mechanisms during balb / c infection, which induces high levels of ps exposure on intracellular amastigotes . We observed that ps exposure is intrinsic to the intracellular parasite and however, these levels are dramatically increased when infected macrophages are in the presence of previously primed t cells or their soluble products . We confirmed these results by infecting balb / c nude mice where we observed that the amastigotes obtained from these mice display minimal levels of ps, which are completely restored if we adoptively transfer primed cd4 t cells to nude mice (wanderley et al . Interestingly, these data indicate that one possible role for the previously reported pathogenic t cells would be to induce ps exposure on intracellular amastigotes and, therefore, contributing to the generation of highly infective parasites . The t - cell - dependent ps exposure on amastigotes seems to be dependent on the induction of inos expression on host macrophages, and parasite survival is dependent on the concomitant induction of arginase 1 expression (wanderley et al . We propose that high levels of ps exposure are induced by parasite stress delivered by inos activity . In this case, it is still unknown whether ps exposure on amastigotes is indeed a phenotype triggered by pcd or a specific process involving modulation of ps translocation . Under ps - inducting conditions, unpublished results), that is the enzyme necessary to produce ornithine, the precursor of polyamines . In this situation, polyamines could protect the parasite from the inos - dependent stress, stimulating parasite growth [66, 67] and increasing dna stabilization [68, 69]. We understand that the unique characteristics of the t - cell response to l. amazonensis infection contribute to the generation of a perfect environment to stimulate and maintain increased levels of ps on the surface of intracellular parasites . Probably the balance observed in infected balb / c mice, when disrupted, leads to the differences observed among different mouse strains . In figure 1 we summarized our hypothesis regarding the t - cell - dependent modulation of ps exposure on intracellular amastigotes of l. amazonensis . The observation of ps exposure as a strategy to evade the immune system and persist in the mammalian host, made initially in the experimental model of l. amazonensis infection, was a breakthrough since it stimulated different groups around the world to look for the possibilities for basic and applied research on the field . Our group is still studying the immunological, cellular, and molecular mechanisms underlying control of ps exposure in parasites and the effects of its recognition by parasitized cells and organisms . We believe that this could be a major strategy in different systems where avoidance from immune surveillance is necessary to establish a disease.
|
Despite of presentation of medical ethics as a new science in academic teaching, the ethical concepts have been alongside the medicine, and its antiquity back to the medicine history . For instance, literatures such as hippocratic oath letter, liturgy of ibn maymun, and shirazi ethics ordinance are the old literatures in which the principles such as the necessity of patient preference defender on the physician and observing the principle of confidentiality have been emphasized . However, in the past literature using physician s commitment and pledge human being is a creature with physical, mental and spiritual dimensions which has rights during the health and illness . Patient rights are the very expectations he has from the health care services and must encompass his physical, mental, spiritual and social needs which are manifested as criteria, standards, rules and laws (4, 5). Emphasis on patient rights in the health care services particularly maintains patient dignity as a rank of a human, and is considered important especially when patient s vulnerability easily expose him to the violations and weaknesses of the health care system (6). Considering that health is the most important existence aspect of every person and according to the article 29 of the constitution, providing health is the most important commitment of the government of islamic republic of iran; because of this, in 2002, for the first time the patients right charter was developed in iran and was notified by department of health, treatment and medical education (7). The patients right charter of iran was approved by health policy council with a new and comprehensive viewpoint aimed to clarify the rights of the health services recipients and observance of moral standards in the treatment and medical fields in november 26th, and in december 1st it was communicated to the relevant centers (1, 8, 9). In this charter patient satisfaction is considered as one of the characteristics of hospital effectiveness (9). Today, the issues related to the quality of health care services, attention to the patients as customers and accomplishing their satisfaction are the main priorities and are of high importance . One of the important factors in patient satisfaction is regarding their demands and observing their rights and providing care along with respect (6). Awareness of the patients rights and observing them accomplishes more satisfaction of the patient, physician and other medical team and hospital staff and will lead to the spread of good morals among patients and medical team; so eventually the moral status of all the individuals such as patients and medical team will be upgraded, but otherwise provided not observing these rights, it would lead to distrust to health care team . If there is no trust between medical staff and patients, it would lead to damages and losses for the patient and the medical team . Furthermore, it would lead to terrible and unpleasant occurrences which are difficult to compensate and would be followed by the legal prosecution (5, 10). Protecting the patient rights by the nurses only will be possible when they have gained necessary knowledge about it and suitable conditions be provided for respecting these rights (11). Appropriate care and observing patient rights require nurses knowledge which would be possible through different ways such as side studies, retraining courses, and academic courses during education (5). In the studied researches about the nurses level of knowledge from patient rights, several aspects were mentioned . Nasiriani et al (5) and houshmand et al (11) reported good nurses level of knowledge in yazd hospitals and teaching public wards of tehran hospitals respectively . Observed moderate and parsinia et al obtained weak nurses knowledge in tehran and karaj hospitals respectively (10). The clinical researchers in different wards of teaching hospitals have reported that the patients rights have been ignored or have not been considered seriously due to shortage of nursing staff, high number of patients in the hospitals, psychological pressures and etc . Taken together, we decided to evaluate the nurses knowledge about patients rights in one of the teaching hospitals of tehran city . This was a descriptive cross - sectional study in which the nurses knowledge about patient rights was determined . The study samples consisted of 156 nurses who have been selected randomly from one of the teaching hospitals of tehran . The data collection instrument was a two - part questionnaire; the first part included the demographic information (age, gender, marital status, work experience, educational level, etc . ); the second part consisted of 10 questions according to the 10 section of patients rights charter of iran (11). This part determined the following areas about patient rights: right to receive essential information about health care providers, rate of tariff, target insurance coverage if sent to the other medical centers . Right to receive respectful and quick treatment and care regardless of cultural and racial factors . Right to know about the probable complications, treatment options and participate in the ultimate treatment choosing . Right to make a decision about the presence of those who are not directly involved in the treatment process . Right to announce personal satisfaction from ending the treatment and referring to other centers, and right to preserve privacy and being ensured about confidentiality of all of the medical information . The answers of the study subjects to the questions were quantified by measuring a three - score scale; good (3 scores), moderate (2 scores) and weak (1 scores). The maximum score in the questionnaire was 30 scores which were considered 2130 as high knowledge, 1020 as moderate knowledge and less than 10 as weak knowledge . The validity was done using content validity i.e. The questionnaire was given to 10 faculty members of universities of tehran and after collecting the comments, the relevant comments were applied . The validated questionnaire was given to 10 eligible study subjects for reliability and in both stages the questionnaire was completed with a 10-day interval and the required correlation of the first and second answers and confidence was obtained r = 0.90 and finally these people were excluded from the study population . The questionnaires were completed during two weeks by direct referring of the researcher to the wards . In order to observe ethics, confidentiality and integrity, the mentioned questionnaires were anonymous and in all stages of the study the information were collected confidential and were kept by the researcher . The review of the demographic variables indicated that the majority of the nurses were females (76.28%) with mean age of 34.31 7.3 . Most of them (91.2%) had bachelor degree and were married (62.82%). In terms of employment and work experience, almost half of nurses (47.43%) were contractual, 46.79% had 610 years of work experiences, 30.99% never passed any course about patient rights and 30.99% of them had the simultaneous experience in public and private sectors . No association between the variables of gender, age, degree and marital status and nurses knowledge about patient rights was found . There was no significant difference between them in terms of work section, work experience and simultaneous work in the public and private sectors, however there was a significant difference between their level of knowledge about patient rights and simultaneous work in the public and private hospitals and work experience (table 1). The findings of the study about the nurses level of knowledge in different areas indicated that the highest level of knowledge (95.51%) was in the area of right to preserve privacy and being ensured about confidentiality of all medical information and the lowest level was right to receive essential information about health care providers, rate of tariff, target insurance coverage if sent to the other medical centers . Observing patients rights is the most important ethical issue in a hospital which should absolutely be considered . Regarding patients rights and respecting them are two main factors for patients care . Observing patients rights means the accountability of all health care staff to the patients at the time of treatment and care giving (12,13). Promoting patients rights is a multidimensional issue and in order to achieve it, comprehensive efforts should be done . World health organization has offered some strategies such as active participation of health care recipients and providers policy making and extending educational programs for health care providers and entire community (11). The findings of the study showed that nurses level of knowledge about patients rights in terms of the variables such as type of the hospital, work experience, degree, age and gender was good, moderate and weak in 58.33%, 39.10%, and 2.56% of them respectively . In the studies conducted in karaj hospitals (10) and the public wards of teaching hospitals of tehran (11) also the nurses level of knowledge reported as weak . Today patients are more aware of their rights and physicians responsibilities and commitments and also hospitals managements regarding their rights (14) and they are more insisting on their principle rights (2). Therefore it is highly needed that nurses with low level of knowledge, and the other health care providers be aware of patients right charter and increase their knowledge . Determined the reasons of the nurses low level of knowledge as lack of institutionalization and regulation of the rights (12); lack of adequate time for studying and researching due to various obstacles such as poor economic conditions; lack of positive vision in selecting nursing profession; tough job conditions in the hospitals such as large number of the patients versus staff shortages, and lack of necessary facilities such as adequate and suitable libraries (5). The results indicated that there was a significant and direct association between level of knowledge and simultaneous jobs in the public and private hospitals (p=0.01) i.e. The nurses who provided services simultaneously in the public and private hospitals had higher level of knowledge . The reason might be due to regulations and rules which are performed more in the private hospitals compared to the public hospitals i.e. No implementation of patients right charter which may be followed by punishment . The findings of the present study indicated that in the area of right to preserve privacy and being ensured about confidentiality of all the medical information, the nurses had the highest level of knowledge . In the patients right charter codified in 2009 it says observance of the principle of confidentiality is necessary about all the information related to the patient except for the cases the law excluded (1). In a comparative study about the patients right charter in the selected countries with iran in 2007, it was indicated that regulations of iran for the right of the confidentiality of the patient information and medical records is similar to the other countries such as hungary, hong kong, new zealand, united states, south africa, european union and lithuania (14). Unlike the above results, in canada it was indicated that 84% of the medical staff did not have enough knowledge about commitments and obligations of the law about confidentiality of the information and privacy of the patients information (15). Our findings indicated that there was a direct and significant association between level of knowledge and work experience (p= 0.008) and the level of knowledge of the study subjects from patients rights charter was increased by increasing work experience which was in accordance with the studies of nasiriani et al . And in addition, the study indicated that there was no association between level of knowledge and degree and increasing degree had no effect on the level of knowledge . In a study in karaj it was mentioned that the level of knowledge of the technicians was higher in comparison with supervisors and matrons and the most important reasons were sense of job security, professional status and disregardness of matrons and supervisors to the important tasks (10). The findings indicated that nurses in the area of right to receive essential information about health care providers, rate of tariff, target insurance coverage if sent to the other medical centers had the lowest level of knowledge . The patients right charter codified in 2009 states that information must be given to the patient at the right time and appropriate condition by considering individual characteristics such as language, degree and perception; however the patient has the right to access all the information recorded in his / her clinical records (16, 17). In the patients right charter of some countries such as canada and united states unlike the other countries such as iran, hong kong, new zealand, africa, european union, lithuania, right to ask for explanation about the costs has been discussed (14). The results indicated that 66% of the nurses was aware of the right to access to the health care providers during hospitalization, instead of 90% of turkish nurses (17). Nowadays ethical and legal concepts such as patient rights are included in the educational curriculum of greek and turkey (18, 19). According to the considerable gap between development and realization of the patient rights (20) and the increased knowledge, claims and demands of the patients and also the results of this study, in order to observe patients right the following solutions are suggested: - encouraging the nurses to consider patients right charter seriously . - establishing and empowering the sanction of patients right charter - more emphasizing on concepts of professional ethics and patient rights in teaching nursing students - attending expertise meetings with presence of beneficiaries for evaluating barriers and presenting strategies in order to implement the patients right charter as soon as possible - providing periodic educational programs for health care providers and patients about patient rights generally, since 41.6% of the nurses of the study had not a proper level of knowledge about patient rights and considering the fact that awareness and knowledge can be the base of nurses performance and also patients increasingly are getting informed about their rights, the implementation of patients right charter is highly recommended . Holding educational programs, seminars, workshops and academic panels for nurses, and nursing students help overcome difficulties.
|
All subjects were consecutively recruited from the greater philadelphia area from 20062009 at the children's hospital of philadelphia . Our study cohort consisted of 5,465 singleton children of european ancestry with recorded birth weight information . All of these participants had their blood drawn in an 8-ml ethylenediamine tetraacetic acid blood collection tube and subsequently dna extracted for genotyping . This study was approved by the institutional review board of the children's hospital of philadelphia . Parental informed consent was given for each study participant for both the blood collection and subsequent genotyping . We performed high - throughput genome - wide single nucleotide polymorphism (snp) genotyping using the illumina infinium ii humanhap550 or human 610 beadchip technology (illumina, san diego, ca) at the children's hospital of philadelphia's center for applied genomics, as described previously (23). The snps analyzed survived the filtering of the genome - wide dataset for snps with call rates <95%, minor allele frequency <1%, missing rate per person> 2%, and hardy - weinberg equilibrium p <10 . Most loci described from gwa studies published to date have been found using either the affymetrix or illumina platform . In the event a locus was reported using both the illumina and affymetrix arrays, we used the snps present on the illumina array . In the event of a signal only being described on the affymetrix array, we either already had that snp on our illumina array or identified and used the best surrogate snp available based on the ceu hapmap (supplementary table 1, available in the online appendix at http://diabetes.diabetesjournals.org/cgi/content/full/db09-0506/dc1). We used two snps at the cdkal1 (rs4712523 and rs7756992; r = 0.677), hhex - ide (rs1111875 and rs7923837; r = 0.698), and pparg (rs17793693 and rs6802898; r = 0.011) loci as the association with type 2 diabetes, taken from various gwa studies that reported various snps that were in imperfect linkage disequilibrium with each other . In addition, rs4712523 is a proxy (r = 1) for rs10946398, which was previously associated with birth weight . From our database, we eliminated outliers with birth weight <1 or> 8 kg, i.e., those individuals not within the credible range for birth weight at term, to avoid the potential consequences of error or mendelian causes of extreme birth weight . Each birth weight value was adjusted for each sex separately then expressed as a z score . All statistical analyses were carried out using the software package plink v. 1.05 (24). Ethnicity for our cohort was derived using the multidimensional scaling feature within plink . By treating birth weight as a quantitative trait (treated as a z score after correcting for sex), association analysis for each snp was carried out using linear regression analysis with the snp included as an independent variable (coded as 0, 1, and 2). With 5,465 subjects, the powers to detect 0.2, 0.3, 0.4, 0.5, 0.6, 0.8, and 1% variation at the p = 0.002 level (i.e., the corrected p value for the number of tests) were 47.4, 74.6, 90.0, 96.6, 98.9, 100, and 100%, respectively . All subjects were consecutively recruited from the greater philadelphia area from 20062009 at the children's hospital of philadelphia . Our study cohort consisted of 5,465 singleton children of european ancestry with recorded birth weight information . All of these participants had their blood drawn in an 8-ml ethylenediamine tetraacetic acid blood collection tube and subsequently dna extracted for genotyping . This study was approved by the institutional review board of the children's hospital of philadelphia . Parental informed consent was given for each study participant for both the blood collection and subsequent genotyping . All subjects were consecutively recruited from the greater philadelphia area from 20062009 at the children's hospital of philadelphia . Our study cohort consisted of 5,465 singleton children of european ancestry with recorded birth weight information . All of these participants had their blood drawn in an 8-ml ethylenediamine tetraacetic acid blood collection tube and subsequently dna extracted for genotyping . This study was approved by the institutional review board of the children's hospital of philadelphia . Parental informed consent was given for each study participant for both the blood collection and subsequent genotyping . We performed high - throughput genome - wide single nucleotide polymorphism (snp) genotyping using the illumina infinium ii humanhap550 or human 610 beadchip technology (illumina, san diego, ca) at the children's hospital of philadelphia's center for applied genomics, as described previously (23). The snps analyzed survived the filtering of the genome - wide dataset for snps with call rates <95%, minor allele frequency <1%, missing rate per person> 2%, and hardy - weinberg equilibrium p <10 . Most loci described from gwa studies published to date have been found using either the affymetrix or illumina platform . In the event a locus was reported using both the illumina and affymetrix arrays, we used the snps present on the illumina array . In the event of a signal only being described on the affymetrix array, we either already had that snp on our illumina array or identified and used the best surrogate snp available based on the ceu hapmap (supplementary table 1, available in the online appendix at http://diabetes.diabetesjournals.org/cgi/content/full/db09-0506/dc1). We used two snps at the cdkal1 (rs4712523 and rs7756992; r = 0.677), hhex - ide (rs1111875 and rs7923837; r = 0.698), and pparg (rs17793693 and rs6802898; r = 0.011) loci as the association with type 2 diabetes, taken from various gwa studies that reported various snps that were in imperfect linkage disequilibrium with each other . In addition, rs4712523 is a proxy (r = 1) for rs10946398, which was previously associated with birth weight . We performed high - throughput genome - wide single nucleotide polymorphism (snp) genotyping using the illumina infinium ii humanhap550 or human 610 beadchip technology (illumina, san diego, ca) at the children's hospital of philadelphia's center for applied genomics, as described previously (23). The snps analyzed survived the filtering of the genome - wide dataset for snps with call rates <95%, minor allele frequency <1%, missing rate per person> 2%, and hardy - weinberg equilibrium p <10 . Most loci described from gwa studies published to date have been found using either the affymetrix or illumina platform . In the event a locus was reported using both the illumina and affymetrix arrays, we used the snps present on the illumina array . In the event of a signal only being described on the affymetrix array, we either already had that snp on our illumina array or identified and used the best surrogate snp available based on the ceu hapmap (supplementary table 1, available in the online appendix at http://diabetes.diabetesjournals.org/cgi/content/full/db09-0506/dc1). We used two snps at the cdkal1 (rs4712523 and rs7756992; r = 0.677), hhex - ide (rs1111875 and rs7923837; r = 0.698), and pparg (rs17793693 and rs6802898; r = 0.011) loci as the association with type 2 diabetes, taken from various gwa studies that reported various snps that were in imperfect linkage disequilibrium with each other . In addition, rs4712523 is a proxy (r = 1) for rs10946398, which was previously associated with birth weight . From our database, we eliminated outliers with birth weight <1 or> 8 kg, i.e., those individuals not within the credible range for birth weight at term, to avoid the potential consequences of error or mendelian causes of extreme birth weight . Each birth weight value was adjusted for each sex separately then expressed as a z score . From our database, we eliminated outliers with birth weight <1 or> 8 kg, i.e., those individuals not within the credible range for birth weight at term, to avoid the potential consequences of error or mendelian causes of extreme birth weight . Each birth weight value was adjusted for each sex separately then expressed as a z score . All statistical analyses were carried out using the software package plink v. 1.05 (24). Ethnicity for our cohort was derived using the multidimensional scaling feature within plink . By treating birth weight as a quantitative trait (treated as a z score after correcting for sex), association analysis for each snp was carried out using linear regression analysis with the snp included as an independent variable (coded as 0, 1, and 2). With 5,465 subjects, the powers to detect 0.2, 0.3, 0.4, 0.5, 0.6, 0.8, and 1% variation at the p = 0.002 level (i.e., the corrected p value for the number of tests) were 47.4, 74.6, 90.0, 96.6, 98.9, 100, and 100%, respectively . In our initial analysis, 12 snps corresponding to the 9 type 2 diabetes loci previously studied in the context of birth weight were investigated in our cohort, namely, tcf7l2, hhex - ide, pparg, kcnj11, slc30a8, igf2bp2, cdkal1, cdkn2a/2b, and jazf1 (4,6) (table 1). Quantitative association results for previously studied type 2 diabetes risk alleles with birth weight in the european american cohort (n = 5,465), sorted by chromosomal location the direction of effect is shown for the minor allele in each case . * major allele previously reported to be associated with type 2 diabetes; * * p 0.002 ., regression coefficient for the test snp; bp, base pair position; maf, minor allele frequency; n, number of subjects tested; p, two - sided trend test p value; r, value in linear regression; t, test statistic . As a result, we observed strong association with rs7756992 (p = 8 10) at the cdkal1 locus with low birth weight; this snp yielded strongest association to type 2 diabetes in an icelandic gwa study carried out on the illumina humanhap500 platform (21). Snps rs10946398 or rs7754840 at the same locus have been reported to be most strongly associated with type 2 diabetes from gwa studies on the affymetrix platform or the illumina humanhap300 beadchip (16,18,19); however, using a perfect surrogate, rs4712523 (r = 1), we only observed nominally significant association (p = 0.01). It should be noted that rs10946398 and rs7756992 are far from being in perfect linkage disequilibrium (r = 0.677), thus the inclusion of both in this current study . Unlike previous reports, we did not observe association between rs1111875 at the hhex - ide locus and this trait (6). In line with previous reports, we also did not observe association between birth weight and tcf7l2, pparg, kcnj11, slc30a8, igf2bp2, cdkn2a/2b, or jazf1 (4,6,10). Furthermore, we did not observe any significant association with risk alleles at other type 2 diabetes loci after correction for multiple testing for all 23 snps (threshold p 0.002) (supplementary table 2). We detected nominal association with rs1387153 (p = 0.02) at the mtnr1b locus; however, the corresponding type 2 diabetes risk allele was tracking with higher birth weight . We also analyzed male and female subjects separately, but the effect of each locus on birth weight did not vary by sex (supplementary tables 3 and 4). From this interim analysis of our ongoing gwa study of birth weight in a european american cohort, it is clear that the cdkal1 locus, which was uncovered in gwa analyses of type 2 diabetes, is strongly associated with birth weight in our study population . This result clearly supports a previous report that came to a similar conclusion (6). However, the study by freathy et al . Used a different snp, namely, rs10946398, which was not present on our illumina beadchip; we used a perfect surrogate, i.e., rs4712523 (r = 1), that only yielded nominal significance (p = 0.01). Although they did not report for rs7756992, we found that it gave us the strongest association (p = 8 10) and was selected for this study because it yielded the strongest association to type 2 diabetes in an icelandic gwa study (21). Secondly, we did not observe association between hhex - ide and birth weight, which is in contrast with what had been described previously (6). We acknowledge that our cohort is smaller than the original report (5,465 vs. 19,200 individuals); indeed, this association was not observed (p <0.05) in the similarly sized 1958 birth cohort (6). The lack of available covariate data, such as gestational age, was also a limitation of this study . Therefore, it is possible that with a larger cohort with additional covariate data we may observe the association of this locus with birth weight; however, it could also indicate that hhex - ide has a less pronounced impact on birth weight than cdkal1 . Consistent with the existing literature, we did not find any evidence of association between birth weight and tcf7l2, pparg, kcnj11, slc30a8, igf2bp2, cdkn2a/2b, or jazf1 (4,6,10). Given the monogenic precedent for opposing effects of maternal and fetal genotype (25), it is possible that effects of common type 2 diabetes alleles could be masked by this phenomenon . It has been shown that cdkal1 is expressed in the rat pancreatic -cell line ins-1 (21). Homozygous carriers of the risk allele have been shown to have a 22% lower corrected insulin response than individuals who are wild - type carriers . It has been suggested that cdkal1 might influence the secretion of insulin by interacting with cdk5 (21). Our data contributes another piece of evidence supporting the hypothesis, namely, that the same genotype conferring lower birth weight can also confer higher type 2 diabetes risk later in life . Cdkal1 was first described in the context of type 2 diabetes in both european caucasians and in han chinese (21); as such, it would be interesting to examine whether the association of cdkal1 with lower birth weight also stands in this and other ethnicities, such as african americans and hispanics . In conclusion, we strongly confirm that the established type 2 diabetes locus cdkal1 also influences birth weight . However, we do not observe such association with tcf7l2, hhex - ide, cdkn2a/2b, or jazf1 . In addition, of all the other established type 2 diabetes loci to date, we do not observe a convincing role for them in the determination of birth weight.
|
The most often reported reasons have been dehydration of dentin, removal of tooth structure during root canal treatment, prolonged use of high concentrations of irrigation solutions, and excessive pressure during obturation . In the literature there are several studies in which the fracture resistance of endodontically treated teeth were evaluated or the techniques for reinforcing of these teeth were described . It is important to examine systems in an in vitro model prior to in vivo use in order to identify treatment or materials that might improve clinical performances . Extracted human teeth are also widely used for in vitro studies in fracture resistance tests . However standardization among the extracted teeth should be performed in order not to affect the study's results . Standardization of the roots is one of the important steps in the study in which fracture resistance is evaluated . If roots were not distributed among the groups equally, these variables could have affected the results of the studies . In many studies, the mesiodistal (md) and buccolingual (bl) dimensions and the lengths of the roots researchers also attempt to choose the same type of teeth in order to standardize the specimens . In spite of these standardization attempts, it has been discussed that the standard deviations within the groups were rather high, rendering the results meaningless, and prompting studies using a larger number of specimens . The aim of this study was to determine how physical (weight, volume, and density) and morphological (md and bl dimensions) properties affect the fracture resistance of roots, and which criteria are important for standardization in fracture resistance evaluated studies . The null hypothesis was that different physical properties of roots would not affect the fracture resistance of endodontically treated roots . Seventy - five human canine teeth extracted for periodontal reasons with completed apices and similar lengths were used in this study . Mesiodistal (md) and buccolingual (bl) radiographs were taken of the specimens to evaluate the anatomical structures of the teeth . The teeth with internal or external resorption, those which had two or more root canals, and those with calcification were discarded . The teeth were examined under a stereomicroscope to discard specimens with cracks and craze lines . Soft tissues and calculus were removed mechanically from the root surfaces using a periodontal scaler . Specimens were decoronated with a diamond disc under a water coolant to obtain a standardized root length of 16 mm . Was carried out, weight, volume [figure 1], and density [figure 1] were calculated with precisa xb 220a precision balance (precisa, gravimetrics ag, dietikon, switzerland) which had a capacity of 220 g, and a readability of 0.0001 g. weight change in distilled water is equal to root volume, because density of distilled water is 1 g / cm . Md and bl dimensions at 16 mm (the coronal end of the root) from the apex of the each root were recorded with root number . A size 10 k - file (dentsply, maillefer, ballaigues, switzerland) was inserted into the canal until it was visible at the apical foramen, and the working length was determined to be 1 mm short of this position . Root canal shaping procedures were performed with protaper universal rotary files (dentsply maillefer, ballaigues, switzerland), and apical region was prepared to size #30 (f3) in all specimens . The canal was irrigated with 2 ml freshly prepared 5% naocl solution with a 27-gauge needle after each file . A final rinse with 5 ml 17% edta for 1 min, followed by rinsing with 5 ml 5% naocl for 1 min was applied for smear layer removal . The specimens were dried with paper points and filled with gutta - percha and ah plus sealer (dentsply detrey, kontanz, germany) using cold lateral compaction . Calculation of root volume and density using a precise balance proper wax stencils were molded and the roots were mounted into acyclic resin at an angle of 45 degrees to its long axis, leaving 6 mm of each root exposed [figure 2]. A universal testing machine (instron corp . Vertical force was loaded with a speed of 1 mm / min until fracture occurred . The results indicated that volume (r = 0.427, p <0.001) and weight (r = 0.394, p <0.001) of the roots had a more significant effect than bl (r = 0.197, p = 0.085), md (r = 0.239, p = 0.037) dimension which implying that volume or weight had greater importance regarding the prediction of fracture strength [table 1]. Physical and morphological properties of the samples along with pearson correlation coefficients and p values . When extracted human teeth are used for evaluating the fracture resistance of roots, there is a potential for large uncontrollable variations to affect strength . For that reason, all controllable factors should be standardized as much as possible . Many researchers who have carried out this type of study - performed standardization, according to root length, md and bl dimensions . However, many of these studies admitted very high standard deviations as normal . Thus, this study aimed to control factors such as weight, volume, and density, which can affect the fracture resistance of teeth in order to contribute to the standardization process . In the current study, the volumes or weights of root specimens have more statistically significant value than density, md, and bl dimension . In previous studies, however, these variations did not take into account when the standardization of groups was performed . Future studies should be standardized to inhibit high standard deviations . During the study design, standardization is generally achieved based on the lengths, and md and bl dimensions of roots with referrals to other studies in the literature . However, this study has shown that the physical properties of teeth can affect the resistance of roots . Thus, it is important to determine the alternative properties of roots which could be useful for the standardization process in future investigations . This is the first study in the literature to conclude that the volume or weight of root as the most important determining factors in root fracture. Within the limitations of this study, it can be concluded that when forming groups to evaluate fracture resistance, after the root length is standardized, the roots should be equally distributed according to their volumes or weights, rather than their md and bl dimensions, as these dimensions cannot closely simulate the entire strength of the root as much as the volume or weight.
|
Intensive insulin therapy using basal - bolus insulin regimen is the standard therapy for patients with type 1 diabetes mellitus . By mimicking the endogenous insulin secretion profile in healthy subjects, it has been shown to improve glycemic control and reduce the risk of long - term complications compared with conventional insulin therapy [1, 2]. Unfortunately, many patients with type 1 diabetes cannot achieve the target glycemic control, and insulin therapy leaves room for improvement . Thus, the efficacy of basal insulin is especially important in this group of patients . Importantly, in some type 1 diabetes patients with severe loss of endogenous insulin secretion capacity, once - daily injection of basal insulin does not always cover the basal effect of insulin over the 24-hour period [35]. In addition, the intraday and day - to - day variability in insulin agents could sometimes be an obstacle for optimized titration of insulin and a cause of increased frequency of hypoglycemia . Given that increased frequency of injection and large fluctuations in blood glucose could be a burden in such patients, any improvement in the efficacy of basal insulin agents should be appreciated . Insulin degludec is a new ultra - long - acting basal insulin that forms soluble multihexamers at the subcutaneous injection site from which insulin monomers are slowly and continuously absorbed into the circulation, leading to a peakless action profile over 42 hours . Consistent with this pharmacological action, begin basal - bolus type 1 trial showed that the rate of nocturnal - confirmed hypoglycemia was 25% lower with insulin degludec than with insulin glargine . In addition, it was reported that the day - to - day variability in plasma glucose in type 1 diabetes patients treated with insulin degludec was lower compared to insulin glargine . Taking these unique actions of insulin degludec into consideration, switching from twice - daily injections of basal insulin to once - daily injection of insulin degludec could provide great benefit to patients with type 1 diabetes . In this study, to evaluate the efficacy of insulin degludec as a basal insulin for basal - bolus regimen for japanese patients with type 1 diabetes mellitus who are treated with twice - daily basal insulin injection therapy, we investigated glycemic control, daily, and day - to - day variability in plasma glucose using continuous glucose monitoring before and after switching to once - daily insulin degludec injection in 22 patients with type 1 diabetes . We recruited 24 eligible japanese patients (8 males and 16 females) with type 1 diabetes who visited the outpatient clinic of juntendo university hospital between july 2013 and january 2014 . Patients who satisfied the following conditions were included: (1) treated with basal - bolus insulin regimen with twice - daily injections by insulin glargine or detemir and (2) aged more than 20 and less than 80 years . Also, patients were excluded if they (1) had serious liver disease (ast and/or alt> 100 iu / l), (2) had serious kidney disease (serum creatinine> 2.0 mg / dl), (3) had untreated severe diabetic retinopathy, (4) had adrenal or pituitary insufficiency, (5) had other conditions considered by the attending physician to be contraindicated to inclusion in the study, or (6) were pregnant or breastfeeding women . This trial was conducted in accordance with the declaration of helsinki, and the protocol was approved by the human ethics committee of juntendo university . All patients provided a written informed consent prior to trial initiation . In this prospective, single - center, single - arm, open - label, 12-week study, we compared the effects of switching from twice - daily basal insulin to once - daily insulin degludec on glycemic control, daily, and day - to - day variability in plasma glucose . Figure 1 shows the patient enrolment process . At baseline before switching, the following laboratory tests were performed in each patient: fasting plasma glucose (fpg), plasma c - peptide, hba1c, and glycosylated albumin . Plasma c - peptide assay was performed using ultrasensitive c - peptide elisa kit (mercodia, uppsala, sweden) for precise determination of intrinsic basal insulin level . Then, cgm and 7-point self - measured blood glucose (smbg) profiles (before and 2 hours after meals and bedtime) were obtained . After that, the patient was switched from twice - daily basal insulin to once - daily insulin degludec, which involved 10% reduction in insulin dosage without any change in the rapid acting insulin therapy . Insulin degludec was administered once - daily at bedtime . At 4 weeks after switching, the same fasting laboratory tests, cgm and 7-point smbg, were repeated . After 4 weeks, the basal insulin dose was adjusted for each individual patient based on self - measured fbg levels taken before breakfast . The dose of insulin degludec was decreased by 1 unit if fbg was 80 mg / dl over three consecutive days just before the hospital visit . Then, the increase of the dose of basal insulin or titration of rapid acting insulin was performed by the judgement of each physician in charge . At the end of the study (12 weeks), the same laboratory tests (fpg, hba1c, and glycosylated albumin) were repeated again . Cgm data were obtained by using the ipro2 (medtronic; northridge, ca). Patients were required to use cgm for six consecutive days . Over each cgm occasion, at least 288/day cgm glucose values were to be recorded . As an index of day - to - day variability, the mean of daily difference (modd) was calculated from the absolute difference between paired cgm values during two successive days (days 2 to 3 and days 4 to 5), and the data were presented as the average of the two values . The patient was asked to record 7-point smbg profiles for one day during cgm for before and 2 hr after meals and at bedtime . The primary outcome of the study was change in hba1c before and 12 weeks after switching . The secondary outcomes based on cgm values were (1) changes in standard deviation (sd) and modd . Safety variables included the frequencies of severe hypoglycemia, which was defined as low blood glucose level requiring assistance from another person to treat, nocturnal hypoglycemia, and adverse events . Confirmed hypoglycemia was defined as a glucose value of less than 70 mg / dl by cgm and was reported in percentage (= times <70 mg / dl / total time of measurement). Hypoglycemic episodes occurring between 0:00 and 5:59 hours were classified as nighttime while daytime episodes occurred between 6:00 and 23:59 . Data were expressed as mean sd . The mann - whitney u test was used for analysis of cgm data before and 4 weeks after switching and, for analysis of fpg, hba1c and glycosylated albumin before and 12 weeks after switching were used . All statistical analyses were conducted using statview statistical software package, version 5.0 (sas institute inc ., cary, nc). Two patients withdrew from the study after the first treatment period; one decided to withdraw during the conduct of the study and the other did not visit the outpatient clinic . The mean age and duration of type 1 diabetes mellitus were 54.8 14.5 and 14.6 9.0 years, respectively . Fasting plasma c - peptide was below the detection limit of the ultrasensitive c - peptide elisa kit in 18 patients (81%), indicating severely low insulin secretion in most subjects . As shown in table 2, hba1c levels at baseline and 4 and 8 weeks after switching to insulin degludec were 8.5 1.4%, 8.6 1.6%, and 8.7 1.6%, respectively . Glycosylated albumin levels before and 4 and 8 weeks after switching were 24.9 5.0%, 25.3 5.2%, and 24.7 3.6%, respectively . Furthermore, fasting blood glucose levels were 203.2 81.2 mg / dl, 165.5 82.1 mg / dl, and 206.5 122.4 mg / dl, respectively . Based on these data, it is clear that switching to insulin degludec did not improve glycemic control throughout the study . The mean basal insulin and total daily doses at 12 weeks after switching to insulin degludec were significantly reduced compared to the baseline (15.2 7.6 versus 11.6 6.9 u, p <0.01, and 40.0 17.3 versus 37.9 16.7 u, p <0.01, resp .) Whereas the bolus insulin dose did not significantly change after switching . Table 3 summarizes fluctuations in glucose level and the frequency of hypoglycemia recorded by cgm over 4 days before and after switching . The averages of blood glucose and standard deviation (sd) through the daytime (0:0023:59) were 184.1 45.8 versus 189.6 52.7 mg / dl and 68.4 14.5 versus 66.5 17.1 mg / dl, respectively . Furthermore, the modd was 72.1 16.0 versus 74.0 23.0 mg / dl and the frequency of hypoglycemia below 70 mg / dl was 6.1 8.0 versus 6.5 9.7%, respectively . Table 3 also shows fluctuations in glucose level and the frequency of hypoglycemic episodes recorded by cgm during the nighttime (0:005:59). The averages of blood glucose before and after switching were 156.5 63.7 versus 174.6 58.5 mg / dl during the nighttime . The sd during nighttime did not change significantly (before: 22.6 10.9, after: 24.8 10.7 mg / dl). Modd tended to increase during the nighttime both at baseline and after switching, however; these changes were not significantly different . The frequency of hypoglycemic glucose (below 70 mg / dl) was 14.4 17.0 versus 11.1 15.0% during the nighttime, before and after switching . Thus, the frequency of nocturnal hypoglycemia did not change significantly after switching, similar to other parameters, and no severe hypoglycemia was recorded during the study period . Blood glucose level at 2 hours after lunch was significantly low before and after switching (207.6 87.7 versus 158.2 90.3 mg / dl, p <0.01). The present study investigated the efficacy and safety of switching from twice - daily basal insulin injections to once - daily insulin degludec injection in japanese patients with type 1 diabetes . However, some patients with extremely low insulin secretion capacity often need to use twice - daily basal insulin because the duration of action of insulin detemir is about 16 hours and that of insulin glargine does not last up to 24 hours [4, 12]. A few studies from japan have already investigated the outcome of switching from once - daily or twice - daily basal insulin to once - daily insulin degludec in patients with type 1 diabetes [1315]. Specifically, these studies investigated the effects of switching to insulin degludec in type 1 diabetes patients who were being treated with a combination of once- or twice - daily injections of insulin glargine or detemir, though there are no studies that focused on type 1 diabetes patients treated only with twice - daily basal insulin . The basal insulin levels were very low in our patients and the level could not be detected in most patients even by using high - sensitivity c - peptide kits with detection limit of <0.015 ng / ml . Therefore, the selection of twice - daily basal insulin injections in our study seems reasonable to achieve better glycemic control . Insulin degludec, an ultra - long - acting basal insulin, became available in japan in 2013, ahead of other countries, and is known to have longer duration of action (over 42 hours) compared with insulin glargine and detemir . Therefore, it is clinically worthy to investigate the efficacy and safety of switching from twice - daily insulin glargine or detemir to once - daily insulin degludec in type 1 diabetes patients with severely reduced insulin secretion . The results showed no significant changes in various parameters of glycemic control, such as fasting plasma glucose, hba1c, and glycosylated albumin, after switching to insulin degludec despite about 20% reduction in basal insulin dose at 12 weeks, indicating that insulin degludec has longer duration of action and a more potent glucose - lowering effect than insulin glargine or insulin detemir . The frequency of hypoglycemic episodes recorded by cgm did not increase at 4 weeks after switching to insulin degludec . In our study protocol, the bolus insulin dose was not changed before and after cgm recording because the effect of bolus insulin on glycemic control needed to be minimized . According to a previous report by the begin basal - bolus type 1 trial investigators, the mean doses of basal and premeal bolus insulin were significantly decreased by 14% and 10% in the insulin degludec group compared with the insulin glargine group at the end of the trial, leading to similar rate of overall hypoglycemia between insulin glargine and degludec groups . Therefore, in daily clinical practice, adjustment of the premeal bolus insulin dose also needs be considered when switching to insulin degludec . The smbg data in our study showed that postlunch blood glucose level was significantly lower after switching to insulin degludec injected at bedtime, suggesting that the peak action of insulin degludec occurs 14 - 15 hours after injection . Consistent with this finding, another study showed that the trough blood glucose was recorded at daytime when insulin degludec was injected at bedtime . In addition, one review showed that the peak of the glucose - lowering effect of insulin degludec appeared about 12 hours after injection . In addition to the longer duration of action of basal insulin, its effects on daily and day - to - day variability of plasma glucose should be noted . Reported that the use of insulin degludec resulted in lower day - to - day variability in blood glucose compared to insulin glargine in type 1 diabetes patients . However, different from this study, our results showed that switching to insulin degludec did not reduce modd, an index of plasma glucose day - to - day variation, which was consistent with a previous study in japan [13, 14]. Heise et al . Examined the glucose fluctuation by the glucose clamp method after very long fasting, which was not different from our method by cgm . Therefore, the inconsistency might be due to differences between experimental and real - world study . Our study extended over a short period of time and included a limited sample size . In addition, the carry - over effect of hba1c could not be completely excluded because our study was not a randomized controlled trial . Therefore, a crossover trial or randomized controlled trial of a larger sample size is needed in the future . In conclusion, our study demonstrated that glycemic control 12 weeks after switching to once - daily insulin degludec injection with 20% dose reduction was comparable to that in patients treated with twice - daily injection of basal insulin injections and that such switching did not change the frequency of nocturnal hypoglycemia recorded by cgm.
|
A 33 year old healthy male of afro - caribbean origin presented to the emergency department with acute generalised abdominal pain of three hours duration . He had not noticed any recent change in bowel habit, bleeding per rectum or any systemic symptoms . It was of note that there was no family history of inflammatory bowel disease or gastrointestinal malignancy . He was a non - smoker and did not consume alcohol . On examination he had a heart rate of 110 beats per minute, temperature of 37.2c, stable blood pressure but he was cold and clammy . Bowel sounds were absent and rectal exam revealed an empty rectum and no palpable masses . Blood tests revealed a neutrophilia of 25,000 but urea and electrolytes were within normal range . He was resuscitated with intravenous fluids and an emergency laparotomy was performed . During the laparotomy, a 0.5 cm perforation was noted in the ileum 25 cm proximal to the ileocaecal valve on the mesenteric border . An inflammatory mass measuring 5 3 cm was noted directly adjacent to the perforation in the mesentry . 30 cm of small bowel was resected with a right hemicolectomy, hence removing the mass and the perforation . No obvious cause of sepsis was identified and it was thought that he may have a subphrenic collection . Therefore a computed tomography (ct) scan was arranged . However, he had a severe reaction to the intravenous contrast medium which resulted in hypotension . The patient underwent a second laparotomy to drain the subphrenic abscess and no masses were seen during this procedure . Histological examination of the resected specimen from the first laporotomy revealed mesenteric fibromatosis (desmoid tumour) incompletely excised . The resected right hemi - colon did not show evidence of dysplasia, malignancy or polyposis . The estrogen receptor status was not reported . Due to continuing abdominal discomfort on the ward after the second laparotomy, an ultrasound scan was arranged that revealed the following: a rather ill - defined, fairly ovoid, inhomogeneously - hypoechoic mass lesion is identified in the lower abdomen (infra- umbilical) para - sagittal plane . It measures about 5 3 4.5 cm in maximum dimensions surrounded by excess peritoneal fat and some bowel loops representing a residual of a previously resected abdominal desmoid . The pain eventually resolved and after making a good recovery, he was commenced on oral tamoxifen, 20 mg once a day . Although estrogen receptor status was not reported, the patient was commenced on this therapy as it was assumed that most desmoid tumours have estrogen receptors . He was subsequently referred to a specialist in a distant tertiary unit for further evaluation of the residual tumour and for the prospect of further elective surgery . A 33 year old healthy male of afro - caribbean origin presented to the emergency department with acute generalised abdominal pain of three hours duration . He had not noticed any recent change in bowel habit, bleeding per rectum or any systemic symptoms . It was of note that there was no family history of inflammatory bowel disease or gastrointestinal malignancy . He was a non - smoker and did not consume alcohol . On examination he had a heart rate of 110 beats per minute, temperature of 37.2c, stable blood pressure but he was cold and clammy . Bowel sounds were absent and rectal exam revealed an empty rectum and no palpable masses . Blood tests revealed a neutrophilia of 25,000 but urea and electrolytes were within normal range . He was resuscitated with intravenous fluids and an emergency laparotomy was performed . During the laparotomy, a 0.5 cm perforation was noted in the ileum 25 cm proximal to the ileocaecal valve on the mesenteric border . An inflammatory mass measuring 5 3 cm was noted directly adjacent to the perforation in the mesentry . 30 cm of small bowel was resected with a right hemicolectomy, hence removing the mass and the perforation . No obvious cause of sepsis was identified and it was thought that he may have a subphrenic collection . Therefore a computed tomography (ct) scan was arranged . However, he had a severe reaction to the intravenous contrast medium which resulted in hypotension . The patient underwent a second laparotomy to drain the subphrenic abscess and no masses were seen during this procedure . Histological examination of the resected specimen from the first laporotomy revealed mesenteric fibromatosis (desmoid tumour) incompletely excised . The resected right hemi - colon did not show evidence of dysplasia, malignancy or polyposis . Due to continuing abdominal discomfort on the ward after the second laparotomy, an ultrasound scan was arranged that revealed the following: a rather ill - defined, fairly ovoid, inhomogeneously - hypoechoic mass lesion is identified in the lower abdomen (infra- umbilical) para - sagittal plane . It measures about 5 3 4.5 cm in maximum dimensions surrounded by excess peritoneal fat and some bowel loops representing a residual of a previously resected abdominal desmoid . The pain eventually resolved and after making a good recovery, he was commenced on oral tamoxifen, 20 mg once a day . Although estrogen receptor status was not reported, the patient was commenced on this therapy as it was assumed that most desmoid tumours have estrogen receptors . He was subsequently referred to a specialist in a distant tertiary unit for further evaluation of the residual tumour and for the prospect of further elective surgery . Desmoid tumours (fibromatosis) are benign fibrous neoplasms originating from the musculo - aponeurotic structures throughout the body . Desmoid tumours can arise from any skeletal muscle but commonly affect the rectus abdominus in post - partum females and in old surgical scars of the abdomen . Peripheral tumours are smooth, firm and mobile . They are adherent to the surrounding structures gardner s syndrome and familial adenomatous polyposis coli (fap) should be suspected in patients with such soft tissue growths (3). An intra - abdominal desmoid, also known as mesenteric fibromatosis, is the most common solid primary neoplasm of the mesentry . Approximately 80% of intra - abdominal desmoids involve small bowel mesentry, as was the case with our patient . Involvement of the transverse mesocolon, retroperitoneum, omentum and the ligamentum teres have also been reported (1, 4). Intra - abdominal desmoids are usually asymptomatic until their growth and infiltration causes compression of the viscera . This can lead to intestinal obstruction, ischemic bowel secondary to vascular compression and hydronephrosis due to ureteric compression . Bowel perforation is extremely rare and my research has yielded one previous case report (1). Other rare manifestations reported in the literature include deep vein thrombosis, pyrexia of unknown origin, gastrointestinal bleeding and intra - abdominal abscess formation (5, 6). The subphrenic abscess that our patient developed is very likely to have been a complication of the initial laparotomy . Histologically, these tumours are composed of collagen that surrounds spindle cells which are poorly circumscribed (figure 12). Exact etiology is uncertain but hormonal factors are implicated as there are estrogen eceptors present in some desmoid tumours . The adenomatous polyposis coli (apc) gene located on chromosome 5 is responsible for familial adenomatous polypsois coli (fap). Biallelic mutations of the apc gene induces desmoid tumour formation, hence the association between these two disorders (8). In our patient, there was no polyposis in the resected right hemi - colon . Trauma has also been suggested as another causative factor but there was no such history in our patient (1). Both ct and magnetic resonance imaging (mri) are useful in diagnosing and monitoring recurrence . They allow accurate staging and also enable one to delineate accurate anatomy prior to embarking upon major resection . Mri has the advantage of defining the extent of involvement and monitoring post operative recurrence, which can be as high as 70% (6). These patients should also undergo colonoscopy and examination of the eye to exclude gardner s syndrome . Colonoscopy may reveal multiple colonic polyps and fundoscopy may demonstrate multiple pigmented lesions affecting the fundus of the eye (2, 3). Complete surgical excision may be the only effective way of providing a cure but complete excision is often impossible and therefore adjuvant treatments have been employed with various degrees of success (1, 2). Other treatment modalities include radiotherapy, if there is recurrence or as primary treatment to avoid radical surgery (9). Anti - estrogens (e.g. Tamoxifen), prostaglandin inhibitors and non - steroidal anti - inflammatory drugs (nsaids) have also been used . Cytotoxic chemotherapy may be useful in those with disease recurrence or where surgery is contraindicated (10). Desmoid tumours originate from the musculo - aponeurotic structures of the body and can be peripheral or intra - abdominal . Patients should be screened for gardner s syndrome and familial adenomatous polyposis coli since these can often present with dermatoid, epidermoid or other benign tumours . Emergency presentations are not common, but are usually secondary to mass effect on the viscera . Ct and mri are the imaging modalities of choice, particularly if surgery is contemplated and also in postoperative follow up to detect recurrence . Surgery is usually the mainstay of treatment but recurrence is common and adjuvant therapy is used . Some tumours possess estrogen receptors, hence they regress in response to anti - estrogens, such as tamoxifen.
|
Between april 1999 and march 2001, 32 (26 men and 6 women; age range, 7 - 62 years; mean age, 43 years) of 195 patients who had undergone ldlt underwent 42 sessions of conventional arteriography in search of bleeding foci of arterial origin within 6 months of the operation . Arterial bleeding was suspected clinically if the symptoms or signs were as follows: abnormally increased drainage of fresh blood through the jackson - pratt (jp) tube in 26 sessions, hematochezia or melena in 8 sessions, hemothorax or hemoptysis in 5 sessions, hemobilia in 2 sessions, or an acute decrease in the hemoglobin level in one session . Six patients underwent two or three sessions of arteriography or tae, because of recurrent arterial bleeding . However, the bleeding foci were different in each of the sessions conducted for the same patient . In all patients, the arterial bleeding occurred within two months (mean, 14 days; range, 1 - 56 days) after ldlt . Arteriography was performed within three days (mean, 1 day) after the detection of arterial bleeding, depending on the patient's condition . The underlying causes of hepatic failure and ldlt in these 32 patients were hepatitis b - related liver cirrhosis with or without hepatocellular carcinoma (n=29), secondary biliary cirrhosis due to intrahepatic stones (n=1), fatal fulminant hepatitis due to wilson's disease (n=1), and biliary atresia (n=1). The grafts involved in the ldlt included the right lobe (n=21), left lobe (n=8), dual left lobe (n=2), and left lateral segment (n=1). In all patients, informed consent was obtained from the patient or the patient's family prior to arteriography . Once the right or left femoral artery was punctured, a 5-f end - hole catheter was introduced over a 0.035-inch guide wire (terumo; radiofocus, tokyo, japan). Following the superior mesenteric and common hepatic arteriographies, which were performed to evaluate the patency of the portal and hepatic arterial anastomoses and potential bleeding foci, the suspected arteries destined for selective arteriography were selected . A provisional identification of the bleeding arteries was made based on the patient's symptoms or signs, radiological findings, including dynamic ct and rbc scans, and the surgical information obtained during ldlt . In the patients with abnormally increased drainage of fresh blood through the jp tube, selective arteriographies were performed of several specific arteries, for which the arterial bleeding might be stagnant in the jp tube placed area . In those patients with hematochezia or melena, inferior mesenteric or left gastric arteriography was performed following superior mesenteric and common hepatic arteriographies, according to the available clinical information . In those patients with hemothorax or hemoptysis, selective arteriographies of the inferior phrenic artery, intercostal arteries adjacent to the pleural drain tubes, subclavian artery and/or bronchial artery were performed according to the available clinical information . Aortography for the purpose of gaining an understanding of the arterial anatomy prior to selective arteriography was not routinely performed . However, aortography was performed to rule out the possible of there being any missed bleeding foci, if the selective arteriographies of the presumptive arteries did not demonstrate any active bleeding foci . If the bleeding foci were present on the arteriograms, then either tae or surgery was undertaken to control the bleeding, subject to the mutual agreement of the surgeons and interventional radiologists . Tae was intended to be the primary treatment, however, surgical management was considered as the primary treatment if the bleeding foci were technically too difficult or dangerous to be embolized, such as in the case of a hepatic arterial anastomotic site or hepatic resection margin . For tae, the bleeding arteries were superselected using a 3f - microcatheter (microferret; cook, bjaerverskov, denmark) and embolized with 0.018-inch - hilal microcoils (cook, bloomington, u.s.a .) Or 0.018-inch - tornado microcoils (cook, bloomington, u.s.a . ). Gelatin sponge particles (gelfoam; upjohn, kalamazoo, mi) were also used in the case of several specific arteries (intercostal, inferior phrenic and epigastric arteries) prior to embolization using microcoils, to minimize any rebleeding from collateral vessels . If the bleeding foci were absent on the selective arteriograms and aortogram, explorative laparotomy or clinical observation was chosen by the surgeons, depending on the patient's condition . In all patients, a complete retrospective review of the medical and surgical records and radiological imaging were performed . The following items were documented retrospectively: the presumptive causes and locations of arterial bleeding, the technical and clinical success rates of tae, and the complications . A bleeding focus was defined as an extravasation of the contrast media or a pseudoaneurysm that was a likely cause of bleeding . The arterial bleeding was divided into four categories according to the possible related causes: surgical bleeding was defined as an arterial bleeding related to the ldlt itself and included bleeding from the hepatic resection margin, hepatic arterial anastomotic site, incision wounds, and the hepaticojejunostomy site . Iatrogenic bleeding was defined as bleeding associated with percutaneous invasive procedures, such as transhepatic biliary drainage, central venous access and chest tube insertion . Spontaneous bleeding was defined as bleeding that developed spontaneously, such as gastrointestinal bleeding remote from the hepaticojejunostomy site . Non - classifiable bleeding was defined as bleeding that was not able to be classified properly . The technical success of tae was defined as the complete disappearance of arterial bleeding following tae . Technically impossible or incomplete clinical success was defined as an amelioration of the presenting signs or symptoms of arterial bleeding following tae . Major complications were defined as those necessitating an increased level of care, surgery, prolonged hospital stay, permanent adverse sequelae or death . Between april 1999 and march 2001, 32 (26 men and 6 women; age range, 7 - 62 years; mean age, 43 years) of 195 patients who had undergone ldlt underwent 42 sessions of conventional arteriography in search of bleeding foci of arterial origin within 6 months of the operation . Arterial bleeding was suspected clinically if the symptoms or signs were as follows: abnormally increased drainage of fresh blood through the jackson - pratt (jp) tube in 26 sessions, hematochezia or melena in 8 sessions, hemothorax or hemoptysis in 5 sessions, hemobilia in 2 sessions, or an acute decrease in the hemoglobin level in one session . Six patients underwent two or three sessions of arteriography or tae, because of recurrent arterial bleeding . However, the bleeding foci were different in each of the sessions conducted for the same patient . In all patients, the arterial bleeding occurred within two months (mean, 14 days; range, 1 - 56 days) after ldlt . Arteriography was performed within three days (mean, 1 day) after the detection of arterial bleeding, depending on the patient's condition . The underlying causes of hepatic failure and ldlt in these 32 patients were hepatitis b - related liver cirrhosis with or without hepatocellular carcinoma (n=29), secondary biliary cirrhosis due to intrahepatic stones (n=1), fatal fulminant hepatitis due to wilson's disease (n=1), and biliary atresia (n=1). The grafts involved in the ldlt included the right lobe (n=21), left lobe (n=8), dual left lobe (n=2), and left lateral segment (n=1). In all patients, informed consent was obtained from the patient or the patient's family prior to arteriography . Once the right or left femoral artery was punctured, a 5-f end - hole catheter was introduced over a 0.035-inch guide wire (terumo; radiofocus, tokyo, japan). Following the superior mesenteric and common hepatic arteriographies, which were performed to evaluate the patency of the portal and hepatic arterial anastomoses and potential bleeding foci, the suspected arteries destined for selective arteriography were selected . A provisional identification of the bleeding arteries was made based on the patient's symptoms or signs, radiological findings, including dynamic ct and rbc scans, and the surgical information obtained during ldlt . In the patients with abnormally increased drainage of fresh blood through the jp tube, selective arteriographies were performed of several specific arteries, for which the arterial bleeding might be stagnant in the jp tube placed area . In those patients with hematochezia or melena, inferior mesenteric or left gastric arteriography was performed following superior mesenteric and common hepatic arteriographies, according to the available clinical information . In those patients with hemothorax or hemoptysis, selective arteriographies of the inferior phrenic artery, intercostal arteries adjacent to the pleural drain tubes, subclavian artery and/or bronchial artery were performed according to the available clinical information . Aortography for the purpose of gaining an understanding of the arterial anatomy prior to selective arteriography was not routinely performed . However, aortography was performed to rule out the possible of there being any missed bleeding foci, if the selective arteriographies of the presumptive arteries did not demonstrate any active bleeding foci . If the bleeding foci were present on the arteriograms, then either tae or surgery was undertaken to control the bleeding, subject to the mutual agreement of the surgeons and interventional radiologists . Tae was intended to be the primary treatment, however, surgical management was considered as the primary treatment if the bleeding foci were technically too difficult or dangerous to be embolized, such as in the case of a hepatic arterial anastomotic site or hepatic resection margin . For tae, the bleeding arteries were superselected using a 3f - microcatheter (microferret; cook, bjaerverskov, denmark) and embolized with 0.018-inch - hilal microcoils (cook, bloomington, u.s.a .) Or 0.018-inch - tornado microcoils (cook, bloomington, u.s.a . ). Gelatin sponge particles (gelfoam; upjohn, kalamazoo, mi) were also used in the case of several specific arteries (intercostal, inferior phrenic and epigastric arteries) prior to embolization using microcoils, to minimize any rebleeding from collateral vessels . If the bleeding foci were absent on the selective arteriograms and aortogram, explorative laparotomy or clinical observation was chosen by the surgeons, depending on the patient's condition . In all patients, a complete retrospective review of the medical and surgical records and radiological imaging were performed . The following items were documented retrospectively: the presumptive causes and locations of arterial bleeding, the technical and clinical success rates of tae, and the complications . A bleeding focus was defined as an extravasation of the contrast media or a pseudoaneurysm that was a likely cause of bleeding . The arterial bleeding was divided into four categories according to the possible related causes: surgical bleeding was defined as an arterial bleeding related to the ldlt itself and included bleeding from the hepatic resection margin, hepatic arterial anastomotic site, incision wounds, and the hepaticojejunostomy site . Iatrogenic bleeding was defined as bleeding associated with percutaneous invasive procedures, such as transhepatic biliary drainage, central venous access and chest tube insertion . Spontaneous bleeding was defined as bleeding that developed spontaneously, such as gastrointestinal bleeding remote from the hepaticojejunostomy site . Non - classifiable bleeding was defined as bleeding that was not able to be classified properly . The technical success of tae was defined as the complete disappearance of arterial bleeding following tae . Technically impossible or incomplete clinical success was defined as an amelioration of the presenting signs or symptoms of arterial bleeding following tae . Major complications were defined as those necessitating an increased level of care, surgery, prolonged hospital stay, permanent adverse sequelae or death . Conventional arteriography demonstrated 42 bleeding foci of arterial origin in 30 sessions (23 patients). The number of bleeding foci detected were one in 22 sessions (15 patients), two in six sessions (6 patients), and more than three in two sessions (2 patients). The bleeding foci originated most frequently from the hepatic artery (14/42, 33%) and intercostal artery (11/42, 26%). Based on a complete review of the clinical, interventional and surgical data, the bleeding foci were classified into 4 categories corresponding to the most likely causes of arterial bleeding (table 2). In this way, it was demonstrated that, in addition to surgical bleeding (36%), iatrogenic bleeding (40%) was also a major cause of arterial bleeding after ldlt . Tae was technically successful in 33 of the 42 foci of active arterial bleeding (table 1) (figs . 1, 2) however, tae failed in the remaining 9 foci of active arterial bleeding, due to technically difficult superselection of the corresponding bleeding artery or the potential high risk associated with tae (fig . 3). These bleeding foci consisted of hepatic artery anastomotic sites (n=2), hepatic resection margins (n=4) and hepaticojejunostomies (n=3), and they were treated by surgery . However, in three sessions, additional immediate surgery had to be conducted following successful tae for the evacuation of hematoma . However, there was no evidence of active arterial bleeding in the operation field in any of these cases . In 20 of the 21 sessions, the patients showed a clinical improvement in the active arterial bleeding after successful tae . One patient did not show any clinical improvement, because of recurrent arterial bleeding of the same focus . This patient had been treated by anti - coagulation therapy due to cerebral infarction, resulting in a severe iatrogenic bleeding tendency, and died of multifocal hemorrhage including cerebral hemorrhage several days after tae . The overall technical and clinical success rates for the 30 sessions of tae were 21 (70%) and 20 (67%), respectively . These relatively low success rates can be ascribed to the three bleeding foci (hepatic resection margins, hepatic artery anastomotic sites and hepaticojejunostomy sites), in which embolization was either incomplete or impossible . In the case of the three bleeding foci, if these bleeding foci were excluded, the overall technical and clinical success rates were 19 (100%) and 18 (95%) out of 19 sessions . Six (19%) patients underwent two or three sessions of arteriography, because of recurrent arterial bleeding . However, different bleeding foci were treated in each session of arteriography conducted for the same patient . Recurrent bleeding at the same foci was present in only one patient, as described above . On the other hand these cases were managed either by surgery (6 patients) or close clinical observation (5 patients) with transfusion, depending on the patient's condition . In three of the former six patients, surgery allowed the discovery of active arterial bleeding at the hepatic artery anastomotic site (n=1), hepatic resection margin (n=1), and venous oozing (n=1) at the anastomosis of the hepatic vein and vena cava . However, a retrospective review of the selective angiographic images of these patients did not demonstrate the presence of any bleeding focus . In the remaining three patients, surgery did not lead to the discovery of any bleeding focus, and they only underwent hematoma evacuation . After either conservative or surgical management, the signs of active bleeding ameliorated in all 11 patients . During the 6 month follow - up period after ldlt, there were no major tae - related complications . Conventional arteriography demonstrated 42 bleeding foci of arterial origin in 30 sessions (23 patients). The number of bleeding foci detected were one in 22 sessions (15 patients), two in six sessions (6 patients), and more than three in two sessions (2 patients). The bleeding foci originated most frequently from the hepatic artery (14/42, 33%) and intercostal artery (11/42, 26%). Based on a complete review of the clinical, interventional and surgical data, the bleeding foci were classified into 4 categories corresponding to the most likely causes of arterial bleeding (table 2). In this way, it was demonstrated that, in addition to surgical bleeding (36%), iatrogenic bleeding (40%) was also a major cause of arterial bleeding after ldlt . Tae was technically successful in 33 of the 42 foci of active arterial bleeding (table 1) (figs . 1, 2). However, tae failed in the remaining 9 foci of active arterial bleeding, due to technically difficult superselection of the corresponding bleeding artery or the potential high risk associated with tae (fig . 3). These bleeding foci consisted of hepatic artery anastomotic sites (n=2), hepatic resection margins (n=4) and hepaticojejunostomies (n=3), and they were treated by surgery . However, in three sessions, additional immediate surgery had to be conducted following successful tae for the evacuation of hematoma . However, there was no evidence of active arterial bleeding in the operation field in any of these cases . In 20 of the 21 sessions, the patients showed a clinical improvement in the active arterial bleeding after successful tae . One patient did not show any clinical improvement, because of recurrent arterial bleeding of the same focus . This patient had been treated by anti - coagulation therapy due to cerebral infarction, resulting in a severe iatrogenic bleeding tendency, and died of multifocal hemorrhage including cerebral hemorrhage several days after tae . The overall technical and clinical success rates for the 30 sessions of tae were 21 (70%) and 20 (67%), respectively . These relatively low success rates can be ascribed to the three bleeding foci (hepatic resection margins, hepatic artery anastomotic sites and hepaticojejunostomy sites), in which embolization was either incomplete or impossible . In the case of the three bleeding foci, the technical success rate was only 2 (18%) out of 11 sessions . If these bleeding foci were excluded, the overall technical and clinical success rates were 19 (100%) and 18 (95%) out of 19 sessions . Six (19%) patients underwent two or three sessions of arteriography, because of recurrent arterial bleeding . However, different bleeding foci were treated in each session of arteriography conducted for the same patient . Recurrent bleeding at the same foci was present in only one patient, as described above . On the other hand, arteriography showed no active bleeding focus in 12 sessions (11 patients). These cases were managed either by surgery (6 patients) or close clinical observation (5 patients) with transfusion, depending on the patient's condition . In three of the former six patients, surgery allowed the discovery of active arterial bleeding at the hepatic artery anastomotic site (n=1), hepatic resection margin (n=1), and venous oozing (n=1) at the anastomosis of the hepatic vein and vena cava . However, a retrospective review of the selective angiographic images of these patients did not demonstrate the presence of any bleeding focus . In the remaining three patients, surgery did not lead to the discovery of any bleeding focus, and they only underwent hematoma evacuation . After either conservative or surgical management, the signs of active bleeding ameliorated in all 11 patients . During the 6 month follow - up period after ldlt, there were no major tae - related complications . According to our results, arterial bleeding after ldlt was not confined to surgical causes . Surgical bleeding was one of the most common causes of bleeding after ldlt, however, iatrogenic bleeding was even more common than surgical bleeding in our retrospective study . Coagulopathy after ldlt is inevitable for a certain period of time in most liver transplant recipients, until the graft's function is normalized . The risk of iatrogenic bleeding is also high in the early post - ldlt period . Thus, clinicians should make a particular effort to prevent iatrogenic bleeding during percutaneous procedures after ldlt . Some amount of surgical bleeding from the hepatic artery at the hepatic arterial anastomotic site, hepatic resection margin or hepaticojejunostomy site is inevitable, because ldlt generates a liver graft with variable - sized cut surfaces and multiple anastomotic sites . In fact, bleeding from the hepatic artery was the most common cause of bleeding in our study . However, performing tae in the case of bleeding from the hepatic artery following ldlt was virtually impossible, because of the difficulty involved in the superselection of the bleeding arteries, due to the existence of fine arterial feeders, hepatic arterial anastomotic stenosis, a tortuous arterial course or multifocal occurrences . Furthermore, performing tae of the hepatic artery runs the risk of hepatic infarction or failure following inadvertent diffuse proximal embolization (16). (17) reported that three of nine patients with extrahepatic pseudoaneurysm following liver transplantation underwent effective coil embolization, however all patients subsequently underwent retransplantation due to graft ischemia . Accordingly, we achieved technical success in only four of the 14 foci involving bleeding from the hepatic arterial branches . Although tae can be performed in some patients with massive bleeding from the hepatic artery, we consider that surgical management is the treatment of choice for the management of surgically induced bleeding from the hepatic artery anastomotic site, hepatic resection margin or hepaticojejunostomy site . The cause of bleeding from the intercostal artery was iatrogenic bleeding in most cases, resulting from either placement of a drain tube or central venous catheterization . The cause of bleeding from the inferior phrenic artery was uncertain, however it might have been related to various causes, such as intraoperative retractor injury, chest tube insertion or spontaneous bleeding, and it must be routinely evaluated to rule out active bleeding . Knowledge of the clinical symptoms or signs of arterial bleeding provided by the clinicians is very helpful prior to the performance of arteriography . A jp drain was the most common clinical clue to the presence of arterial bleeding after ldlt . Bleeding can occur from the hepatic, intercostal, inferior phrenic or pancreaticoduodenal arteries or from the jejunal branches of the superior mesenteric artery . Unusually, bleeding from the deep circumflex iliac and inferior epigastric arteries was manifested as jp bleeding in one case . Therefore, in our opinion, arteriograms of the inferior phrenic and intercostals arteries, as well as of the superior mesenteric and common hepatic arteries, should be surveyed in cases of jp drain bleeding . In addition, those arteries supplying the lower thoracic and abdominal walls should also be considered as possible sources of arterial bleeding . As in the case of general surgical patients, ldlt recipients are also subject to bleeding from stress ulceration, peptic ulcer and angiodysplasia of the colon (4, 6, 18). Not uncommonly, this bleeding tends to be resolved only by proper medical treatment (4). Clinical observation may be sufficient whenever the patient's condition tolerates it . In our study, four patients with hematochezia or melena showed negative outcomes on arteriography, but improved clinically without surgery or tae . In fact, tae was very effective in cases of positive arteriography, and all four patients with arteriographically proven gastrointestinal bleeding improved after only one session of tae . In the conventional arteriogram, a negative outcome does not always guarantee the absence of actual bleeding . In our study, surgery demonstrated active bleeding foci in three of six patients without active bleeding on selective arteriography . This discrepancy seems to have been caused by minor or intermittent arterial bleeding or venous oozing . In contrast, surgery did not lead to the detection of any bleeding focus in the three remaining patients . In conclusion, technical limitations were encountered when using tae for the management of hepatic arterial bleeding . However, in the other locations, tae seems to be effective and safe for the control of arterial bleeding after ldlt.
|
Fibrodysplasia ossificans progressiva (fop) is a rare genetic disoder characterized by bone formation within muscles tendons and ligaments . We hereby report a case of fop in a four year male child from a tribal family in orissa . 4 yr old male child presented with gradual development of stiffness of neck and hard nodules on his body for which his parents had sought all sort of indegenous treatment and manipulations by traditional bone setters . Patient returned to our hospital at the age of four years with widespread ossification and stiffness of neck, shoulders and back . He also had upper tibial osteochondromas and scalp nodules and valgus deformity of bilateral great toes . Though rare, diagnosis of myositis ossificans progressiva should be considered in a child with heterotopic bone formation and valgus deformities of great toes . Being a rare condition, treatment guidelines are not clear and this condition need further research . Fibrodysplasia ossificans progressiva (fop) is also known as myositis ossificans progressiva, stone man disease, munchmeyer s disease . Fop is an extremely rare and most crippling form of heterotopic ossification in humans with an incidence of 1 in 2 millions . Kitterman et al reported that it takes atleast six physician evaluations to reach the diagnosis and 90% of these individuals will have received some wrong or hazardous treatment before appropriate diagnosis . We hereby report a case of fop in a 4 year old boy coming from tribal family in orissa . The diagnosis of this patient was delayed due as the parents tried all sorts of indigenous medications and even manipulations by traditional bonesetters whose influence has been deep rooted in minds of the tribal population in this part of the country . Our patients was a four year old boy who presented with chief complains of stiffness of neck, decreased movements in bilateral shoulders and had bony hard swellings in his back ., his parents noticed that he had stiffness of neck and had developed nodules at his scalp, which gradually subsided without any treatment . Coming from a tribal background, parents consulted many indigenous medicine practitioners and child was subjected to repeated manipulations of the neck by traditional bone setters . These swellings hardened over a period of few days and the child developed stiffness of spine . He was subjected to further manipulations and gradually developed stiffness of bilateral shoulders and left elbow . On examination, the patient had bony hard swellings in cervico - thoraco - lumbar spine, bilateral axillae and left elbow and left 3rd costochondral junction along with hypoplasia and valgus deformity of great toes (fig . A frontal view of the patient showing ankylosis of bilateral shoulders and left elbow with bony swelling at left 3rd costo chondral junction . Radiographs revealed hallux valgus and hypoplasia of proximal phalanges of great toes with short widened first metacarpals bilaterally (fig . 2b, c) extensive ossification overlying both side of the neck and in the para vertebral tissues in dorsolumbar area (fig . Diagnosis of fop was made in basis of all these radiological and clinical findings radiological findings . A- bilateral hallux valgus and hypoplastic proximal phalynx of great toe with short and widened first metatarsal . Our case once again highlights the deleterious effects of trauma in the form of manipulations and massage that can aggravate the ossification process in case of fop . Trauma as trivial as intramuscular injections, mandibular block during dental procedures, muscle fatigue, muscle trauma due to bumps, falls and influenza like illness can aggravate the process of heterotopic ossification in these patients . A sporadic mutation in the gene encoding bone morphogenetic protein (bmp) activin receptor type ia / activin - like kinase 2 (acvr1/alk2) located on chromosome 2q23 - 24 region has been identified as the main genetic abnormality in fop . Recently, additional mutations have been identified in the gs - domain and kinase domain of acvr1 in individuals with a typical forms of fop . Inheritance is in autosomal dominant manner but less than 10 cases of familial transmission have been reported . In vitro experiments with use of cells derived from patients with fibrodysplasia ossificans progressiva show a markedly attenuated response of noggin (bmp-4 antagonist) expression to bmp4 stimulation . An inadequate bmp - antagonist response following soft - tissue trauma would permit the rapid expansion of a bmp4 morphogenetic gradient in a patient with fibrodysplasia ossificans progressiva and could explain the explosive bone induction seen during flare - ups . A new research by quen et al interpreted that in addition to the above, the mutation also induces chondrogenesis by signaling in a bmp independent and bmp responsive manner . This mutation may also sensitize mesenchymal cells to bmp - induced osteoblast differentiation, and stimulates new bone formation . Individuals with fop are normal at birth except for having valgus deformity of great toes . Heterotopic ossification is heralded by the rapid appearance of large painful swellings of highly vascular fibro - proliferative tissue involving tendons, ligaments, fascia, and skeletal muscle . These preosseous swellings progress along a pathway of endochondral ossification to form mature heterotopic bone . Typically, the dorsal, axial, cranial, and proximal regions of the body are involved early, and the ventral, appendicular, caudal, and distal regions are involved later . Several skeletal muscles including the diaphragm, tongue, and extra - ocular muscles are spared from fop . Cardiac muscle and smooth muscle histological examination of early fop lesions reveals an intense perivascular lymphocytic infiltrate followed by lymphocyte - associated death of skeletal muscle and robust development of fibro proliferative tissue with extensive neovascularity and mast cell infiltration . Tissues from fop lesions at later stages of maturation exhibit characteristic features of endochondral ossification that support ectopic hematopoiesis . Definitive genetic testing for fop is now available however is not essential for diagnosis which is purely clinical . This condition needs to be differentiated from progressive osseous hyperplasia (poh), which presents with heterotopic ossification . Poh is distinguished from fop by the absence of congenital skeletal malformations, the absence of predictable regional patterns of heterotopic ossification, the pre- dominance of intramembranous rather than endochondral ossification, and the presence of heterotopic ossification in skin and subcutaneous fat piram et al noted 40% incidence of scalp nodules in patients of fop in their retrospective study on 43 patients . Deirmengian et al reported 90% incidence of upper tibial osteochondromas in a study on 96 patients . Our case had this particular finding and cases with combined heterotrophic ossifications with osteochondromas should be considered for this diagnosis . Based on these typical and commonly found characteristics, mutlu et the great toe malformations along with rapidly developing and waxing / waning soft tissue lesions over head, neck and upper back are characteristics for fop . Kaplan et al commented that failure to make such association is the commonest cause of misdiagnosis of fop . Misdiagnosis may lead to inadvertent managements like manipulations, biopsies and surgery . As in our case, these strategies just help the disease to flare and make the life of patient much difficult . Kitterman et al reported incidence of misdiagnosis to be> 90%, with 68% receiving inappropriate treatment which lead to permanent disability in about 50% of cases . Early diagnosis and high index of suspicion will not only prevent the itrogenic harm but may also slow the disease progress and avoid rapid and early deterioration in patients quality of life . In our case, this lead to rapid progression of disease in our case with early development of deformities . Short course of steroids are used in during acute flare - ups in large joints and submandibular area . Other drugs tried are nsaids and cox-2 inhibitors, bisphonates like etidronate and pamindronate, rosiglitazones, mast cell inhibitors, retinoic receptor agonists etc [15, 16]. However a statement made by julius rosenstirn in 1918 still holds true: the disease was attacked with all sorts of remedies and alternatives for faulty metabolism; every one of them with more or less marked success observed solely by its original author but pronounced a complete failure by every other follower . In many cases, the symptoms of the disease disappear often spontaneously, so the therapeutic effect (of any treatment) should not be unreservedly endorsed . The rare incidence of this disease and unpredictable nature of flare - ups makes it difficult to formulate an ideal treatment for it . Kaplan et al reported that bone marrow transplant for replacement of hematopoietic cells was not sufficient to prevent ectopic skeletogenesis in the patient with fibrodysplasia ossificans progressiva but pharmacologic suppression of the apparently normal donor immune system following transplantation in the new host modulated the activity of the fibrodysplasia ossificans progressiva and diminished the expression of skeletal ectopia . Glaser et al reported bmp4-induced heterotopic ossification can be prevented in vivo either by local delivery of wild - type noggin or after somatic cell gene transfer of a noggin mutein in murine model of fop . Recently, dorsomorphin has been identified as a powerful orally - available signal transduction inhibitor of bmp signaling and preliminary data suggest that this category of stis may play a powerful role in inhibiting heterotopic ossification in animal models but its safety and efficacy in animal models of fop is still to be determined . Although the rate of disease progression is variable, most patients are confined to a wheel- chair by their early twenties and require lifelong assistance with activities of daily living . Patients with fop usually succumb later in adulthood at mean age of 40 years to cardiopulmonary complications secondary to thoracic insufficiency syndrome and severe restrictive pulmonary disease due to ossification and ankylosis of the joints of thoracic cage . Thus in conclusion clinical suspicion, early diagnosis and expectant treatment are the main management strategy in cases with fop . Fop demands further research to treat individuals suffering from this dreaded form of heterotopic ossification . Valgus deformity of great toes and neck stiffness are important pointers towards diagnosis of fop and this condition needs further research to find an effective treatment modality for it
|
Delivery of exogenous nucleic acids such as dna into cells (transfection) holds great promise for disease prevention and therapy (aka: gene therapy). (1) genetic material delivered into the cell modifies the function of such cells generally by altering the production of proteins . The selection of appropriate dna carriers is a common problem for gene therapy, and better gene delivery agents are still being sought . Viral vectors (such as retroviral, lentiviral, adenoviral) and nonviral vectors (such as liposomal and polymeric) have both been used as gene delivery agents in the past . Although viral vectors are efficient carriers due to their natural ability to penetrate cells, they have also often been shown to provoke undesirable immune responses, thus limiting their usefulness. (2) nonviral vectors often prove less immunogenic, but improvement is needed to increase their overall transfection efficiency . To increase such efficiency, effort should be directed at increasing the vector s ability to promote efficient dna condensation, intracellular transport, and sustained gene expression . Additionally, the cytocompatibility of nonviral vectors must be well understood before they can be further optimized and become a viable option for gene therapy . Fullerene (c60) derivatives have been extensively studied for a variety of medical applications(8) including their use as neuroprotective agents,(9) hiv-1 protease inhibitors,(10) bone - disorder therapy agents,(11) x - ray contrast agents,(12) and slow - release agents for drug delivery. (13) recently, c60-based reagents have also been examined as dna transfection vectors and tested for the ability to mediate gene transfer . These first generation c60-based transfection vectors have shown promise, but a few have also exhibited high cytotoxicity. (16) as many of the c60 derivatives previously described in the literature have only been slightly soluble in aqueous solutions, it has also been suggested that one possible reason for such observed cytotoxicity was due to the use of organic solvents that were necessary to dissolve those first generation c60-based transfection agents . Thus, the search for new materials and enhanced protocols are key objectives in the continuing development of c60-based transfection vectors, including the design, construction, and testing of new reagents that are water soluble and able to effect enhanced gene delivery without promoting significant cytotoxicity . Herein we report transfection efficiencies, cytotoxicity profiles, and biophysical structure / activity studies for a new class of water - soluble c60 vectors prepared using the hirschbingel reaction which is one of the simplest, highest - yielding, and most versatile c60 functionalization methods known . As shown in figure 1, the structurally derivatized c60 vectors reported herein were synthesized to yield either positively charged, negatively charged, or neutral chemical structures when solvated under physiological conditions . These vectors, which have been analyzed for their ability to promote dna transfection, offer the opportunity to elucidate the roles that hydrophobicity (due to the fullerene core), hydrophilicity (due to the water soluble substituents), and overall charge state displayed by the c60 derivatives have on dna transfection, gene expression, and cytotoxicity . Depiction of the structures of the derivatized c60 vectors; the positively charged amino - c60 compounds (iiv), the neutral serinolamide - c60 compound (v), and the negatively charged c3-c60 compound (vi) (chemical structures depicted at neutral ph in aqueous solution; counterions in solution not shown). Materials for culturing cells, including dulbecco s modified eagle s medium (dmem), trypsin, and phosphate buffer saline (pbs), were obtained from gibco (gibco life, grand island, ny). Complete osteogenic medium containing minimum essential medium (mem), 10 mm -glycerophosphate, 50 g / ml ascorbic acid, and 10 vol% fetal bovine serum was obtained from gemini bio - products (calabasas, ca). A plasmid dna (7.2 kbp) containing the gene for a red - shifted wavelength variant of the enhanced green fluorescent protein (egfp) under the transcriptional control of the cytomegalovirus (cmv) immediate - early gene promoter was used as the dna construct from which reporter gene expression was measured in the transfection assays . Plasmid dna was prepared in bulk from transformed bacterial sources and purified to homogeneity using commercial kits (qiagen; germantown, md) employing anion - exchange chromatography . The amino - c60 adducts (iiv), the seri - c60 adduct (v), and the c3-c60 adduct (vi) were synthesized and characterized according to previously published procedures . Stock solutions of individual compounds ivi were prepared by weight and filtered for sterilization using a cellulose acetate membrane filter (0.2 m pore diameter) prior to use in forming transfection mixtures . Standard solutions were prepared at a concentration 10 g/l for each of these compounds in both tris edta (te) solution (10 mm tris, 1 mm edta, ph = 7.4), and in serum - free dmem in separate reaction vials . Nih 3t3 mouse fibroblast cells (atcc #crl-1658) and hek 293 cells (human embryonic kidney; atcc #crl-1573) were cultured in dmem containing 10% fbs in a 5% co2 atmosphere at 37 c prior to collection and plating in individual assay wells used for transfection studies . For subculture of cells, routinely on reaching 80% confluence, the cells were washed with pbs, detached using trypsin - edta, harvested by centrifugation, resuspended in culture medium and counted in a coulter counter prior to plating in multiwell dishes for subsequent transfection assays . Marrow stromal cells (mscs) were harvested from wistar rats as previously described. (24) mscs were cultured for 6 days in the presence of 10 m dexamethasone in complete osteogenic media before use in transfection studies and cultured under identical environmental conditions to 3t3 and hek 293 cells . Mixtures of individual derivatized c60 vector material and plasmid dna were allowed to form a complex in serum - free dmem, as described below, prior to adding to cells in the transfection assays . Each c60-vector solution was added dropwise to a solution of plasmid dna to obtain a final volume of 200 l . Each resulting solution was then vortexed briefly and allowed to stand for 30 min at room temperature to allow complete assembly of the vector / dna complex, which was then used immediately in the transfection experiment . The final dna mass of each solution remained constant at 10 g while the concentration of the c60 derivative was varied to obtain a range of c60-reagent - to - dna - base - pair (bp) ratios (defined here as the value of dna mass was fixed at 10 g per well since it showed the most optimum transfection among different dna masses used (112 g) for transfection at r = 16.8 . Transfections of nih 3t3 cells were carried out with c60/dna complexes in a range of r values (0.4242). For hek 293 cells and mscs, transfections were performed only at r = 4.2 and r = 16.8 . Cells were plated at 40,000 cells / cm in 96 well tissue culture plates and incubated overnight to permit cell attachment to the well surface . The culture medium was then replaced by the serum - free transfection mixture for various time periods (2 h, 8 h, 24 or 48 h) (transfection time). After exposing the cells for the respective periods of time to the serum - free transfection mixture, the cells were washed with pbs and the medium was replaced with complete medium (containing fbs). The cells were then further incubated for 8 h, 24 or 48 h (incubation time) before gfp fluorescence was measured using a flow cytometer . For comparative purposes, control cell populations were also transfected with plasmid dna alone (no c60 vector), or with plasmid dna complexed with an optimal level of one of two commercially available transfection reagents; such that the dna was complexed with either 25 kda polyethylenimine (pei), or with cytopure transfection reagent, which is reported by the manufacturer to exhibit very low levels of cytotoxicity . The dna / pei complexes were assembled using a well - established protocol(25) and the cytopure / dna complexes were assembled as per the manufacturer s instructions and optimized to obtain an optimal level of dna transfection / gfp expression within the nih 3t3 cell type . Below is a brief description of the conditions which gave the optimal level of transfected nih 3t3 cells using 25 kda pei and cytopure . For pei, dna / polymer complexes were prepared in serum - free dmem to achieve a ratio of polymer to dna of 4 . The complexes (100 l) were then incubated at 25 c for 1015 min and then added to cell wells that contained 100 l of serum - free dmem . For cytopure, 1.1 l of cytopure stock was diluted to 50 l with serum - free dmem . The cytopure mixture was then added slowly to 1 g of dna diluted to 50 l with serum - free dmem . The transfection mixture was vortexed, left standing for 15 min at room temperature and added to cell wells that contained 100 l of serum - free dmem . After 24 h of transfection, the cells were washed and the medium was replaced with the serum - containing medium . For purposes of this study, transfection as described herein also relates to cell viability for sufficient time to ensure gfp gene expression, which was determined by cell fluorescence levels above a defined background threshold level (determined using nontransfected cells to set lower detection limit parameter) with flow cytometry . Cells were prepared for flow cytometry by trypsinization after being washed with sterile pbs to remove cell debris and any residual gene - delivery agents . Cells that were transfected successfully expressed gfp protein and were detected at 470/515 nm (excitation / emission) by the flow cytometer . Transfection efficiency has been determined as the percent of cells that express gfp per study sample relative to the total number of cells passing through the flow cytometer per study sample (10,000 events counted for each transfection sample). (25) the c60/dna complex solutions were prepared as described above . C60 vector solutions without dna (010 g/l) were prepared by diluting the c60 stock solution with serum - free dmem . The concentration of cultured cells was determined prior to cell plating using a coulter counter and the cells were plated on 96 well clear - bottom plates at a density of 40,000 cells / cm . After incubating overnight to allow cell attachment, the medium in each well was replaced either with 200 l of the c60 vector alone or with c60 vector / dna solutions prepared as described above . The cells were exposed to the solutions for either 2, 8 or 24 h before the cytotoxicity was determined . Control cell samples were plated and grown under identical conditions as those described for treated cell samples, with the exception that neither c60 compounds nor transfection mixtures were added to the control cells . The live / dead viability / cytotoxicity assay (molecular probes, eugene, or) was used to determine cytotoxicity levels in cells treated with either c60-vector or c60-vector / dna solutions . This assay makes use of 2 different fluorescent dyes, calcein am and ethidium homodimer (ethd-1), to measure the number of live and dead cells respectively . The lipid permeable dye, calcein am, when taken up by living cells with intact plasma membranes, emits green fluorescence (excitation / emission: 495/515 nm) upon being cleaved by esterase enzymes in the cells . Conversely, the ethd-1 dye emits red fluorescence (excitation / emission: 528/617 nm) on binding to nucleic acids released from dead cells, and is excluded by the intact cell membranes of viable cells . This assay was preferred over the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (mtt) assay for evaluation of cell viability because c60-vectors compounds i and ii interacted and attached to the mtt - formazan making the formazan crystals insoluble for the next colorimetric assay . Similar effects have been reported for single - walled carbon nanotubes. (26) the reagents were prepared and added to the wells according to the manufacturer s guidelines . At the time points indicated, the media from the wells was aspirated and replaced with the live / dead reagent, after washing the cells with pbs . The plates were then incubated in the dark at room temperature for additional 30 min before being measured for fluorescence . Fluorescence of each sample well was measured by using a fluorescent microplate reader (tecan safire). Fluorescence of each sample well was normalized to percent of both live (no c60 compounds or transfection mixtures treatment condition) and dead (70% methanol treated) control cell groups . These normalized fractions are defined as the fraction of live and dead cells, respectively, in each of the c60-treated samples . Since gfp fluorescence has excitation / emission wavelengths of 470/515 nm, close to that of calcein am, there was a possibility that gfp fluorescence could interfere with the calcein am (live) measurement leading to potential errors for those wells containing c60 vector / dna mixtures . Thus, a baseline fluorescence intensity of each sample well at 495/515 nm was obtained before the addition of the live cell / dead cell dyes . This intensity was then subtracted from the final calcein am detection intensity . For the dynamic light scattering (dls) experiments, a standard solution with concentration 10 g/l of each of the c60 vectors was prepared in each of these solvents: hplc grade water, 10 mm tris / edta solution, and serum - free dmem . These solvents were filtered through a 0.22 m syringe filter (millpore, millex- gp) prior to use . The size of standard 100 nm polystyrene beads in tris / edta solution and in serum - free dmem was measured to confirm that no discrepancies were detected with the data acquisition system . Dls measurements were conducted using a wyatt technologies dawn eos instrument equipped with a quasi - elastic light scattering interface module (wyatt qels unit). The scattering angle used for detection was 90 at a constant temperature of 25 c . Data analysis and size distribution computations were performed using the vendor supplied software (astra v) and a multi- digital recorder (wyatt qels). Statistical analysis was performed between groups for the live / dead assay and for flow cytometry studies . Groups were analyzed by anova with significance defined by a p - value <0.05, and pairwise comparison was performed using the tukey test . The cytotoxicity studies had four samples per group, and the transfection studies had three samples per group . Initial screening was performed on each of the six different derivatized c60 samples, compounds ivi (figure 1). The different c60-vector / dna complexes were assembled at various r values (0.4242) and each analyzed for its ability to affect transfection in nih 3t3 cells under serum - free conditions . Serum - free conditions were used in these studies to ensure that derivatized nanomaterial / dna complexes were not compromised by serum lipids and/or proteins, and that the dna complexes were imported into the cells based on the individual physical properties of the complexes themselves, without the potential aid of serum proteins acting as carrier . The best transfection efficiencies were routinely observed after allowing transfection mixtures to remain on cells for 24 h (transfection time), then removing the transfection mixtures and incubating cells for an additional 24 h (incubation time) in the presence of serum for maximal gene expression to be detected . Unless otherwise noted, all transfection efficiency data presented below were for cells transfected for 24 h under serum - free conditions and incubated for an additional 24 h in the presence of serum . All c60-conjugated transfection mixtures showed the ability to transfect cells with exogenous dna with statistically significant differences relative to unconjugated dna alone (naked dna) (table 1). Transfection efficiency as reported in table 1 is defined as the ratio of gfp - positive cells as determined by fluorescence under flow cytometry per total number of cells counted in the flow cytometer . No statistical difference was observed between the transfection efficiencies of the different groups at r = 0.42 and r = 4.2 . For r values above 4.2, compounds iii and iv exhibited a statistical difference in transfection efficiencies compared to the other compounds . Both of these compounds exhibited an increased transfection efficiency relative to the other c60 compounds studied, with a maximum transfection efficiency of 31% at r = 16.8 . At larger values of r the efficiency dropped off . At r = 16.8, their transfection efficiencies were comparable to that of 25 kda pei containing and cytopure transfection reagent containing complexes . 25 kda pei is a widely used and well - studied nonviral vector, while cytopure is a biodegradable polymeric transfection reagent that exhibits very low cytotoxicity and is reported to work on a broad spectrum of cell types, including hard - to - transfect primary cell isolates . C60 vectors are listed in order of their measured efficiency at promoting transfection in nih 3t3 cells under serum - free conditions . To assess the transfection ability of c60 vectors in different cell types, studies were also performed on two other cell types: hek 293 cells and mscs . Hek 293 cells were chosen since they are another standard cell line used routinely for transfection assays, while mscs were chosen due to their eminence as primary cells for tissue engineering . Based on the initial screening results of each of the various derivatized c60 compounds for transfection - promoting ability in nih 3t3 cells as reported in tables 1 and 2, transfection studies were also performed on hek 293 cells and mscs using compounds iii and iv at ratios of r = 4.2 and r = 16.8 . However, hek 293 cells' transfection efficiencies were lower than those observed for nih 3t3 cell at similar r values . Mscs exhibited low transfection efficiencies overall, and no increase in transfection efficiency was observed with increase in r values . Transfected cells were visualized by fluorescence microscopy for morphological analysis after transfection (micrographs not shown). Positive transfection of cells with the plasmid coding for green fluorescent protein could be easily discerned by this technique . However, variations in transfection efficiency among the different cell types tested here is not surprising, as cell type is a major factor in determining the level of transfection and gene expression from nonviral vectors as noted previously. (27) differences in cell characteristics, such as cell mitosis rates, can play an important role in transgene expression, and may explain the differences in the level of gene expression among the various cell lines studied here . Transfection efficiency values are presented as a quotient of gfp (+) cells relative to the total viable cells present in the transfected sample well as measured by flow cytometry . Figures 2 a, b and c display the fraction of viable nih 3t3 cells as a function of the c60 vector (no dna present) concentration after 2, 8, or 24 h post - treatment incubation times, respectively . Incubation with c60 compounds for 2 h resulted in a viable cell fraction greater than 50% for all c60 vector solutions . Lowest overall cell viability was observed with compound i (0.55 0.08) at 10 g/l, and no statistically significant increase in cell viability was observed with decreasing compound i concentration . For all other c60 compounds tested, there was a general trend of increased cell viability with decreased c60 compound concentration . Fraction of live nih 3t3 cells after incubation with the different c60 vectors as a function of derivatized fullerene concentration after (a) 2 h, (b) 8 h, or (c) 24 h c60-incubation times respectively, under serum - free conditions . Error bars represent mean standard deviation for n = 4 . At the 8 h c60 incubation time, the fraction of live cells was higher than 50% for all c60 solutions tested except those exposed to compound i. for compound i, the cell viability was the lowest (0.51 0.04) at 10 g/l, but no statistically significant increase in cell viability was observed with decreasing compound i concentration . For all other c60 vectors, there was a general trend of increased cell viability with decreased compound concentration, but at each compound concentration tested, the cell viability was lower in the 8 h time point than in the corresponding sample concentration at the 2 h time point . At the 24 h c60 incubation time point, only cells treated with compounds iii and iv exhibited greater than 50% cell viability at all concentrations tested, with an increase in cell viability with decreased c60 compound (iii and iv) concentration . All other compounds showed a general trend of increased viability with a decrease in compound concentration, with cell viability values lower than 50% at 10 g/l . Figures 3 a, b and c display the cell viability of nih 3t3 cells cultured in the presence of the various c60-vector / dna mixtures as a function of both c60 compound concentration and r values after 2, 8 or 24 h post - transfection time, respectively . Cell viability at the two hour post - transfection time point for compound i / dna and compound ii / dna mixtures increased from 0.19 0.0 at 10 g/l (r = 42) to 0.70 0.15 at 0.1 g/l (r = 0.42). The fraction of live cells was greater than 50% for all other c60 derivative / dna solutions at the 2 h post - transfection time point . Fraction of live nih 3t3 cells after incubation with the different c60/dna transfection mixtures as a function of c60 compound concentration and varying r value after (a) 2 h, (b) 8 h, or (c) 24 h post - transfection incubation time, under serum - free conditions respectively . Error bars represent the mean standard deviation for n = 4 . At the 8 h post - transfection time point, the fraction of live cells for compound i / dna and compound ii / dna was less than 50% at all concentrations and r values tested . For all other samples, the trend was similar to that of the 2 h post - transfection time point, with cell viability greater than 50% and an increase in viability observed with a decrease in transfection mixture concentration . At the 24 h time point, cells treated with the compound v / dna mixture exhibited greater than 50% cell viability at all concentrations tested, while compound i / dna, compound ii / dna exhibited less than 50% cell viability . Cells treated with compounds iii / dna, iv / dna and vi / dna mixtures resulted in cell viabilities less than 50% at 4 g/l (r = 16.8) and 10 g/l (r = 42), but greater than 50% viability when added at lower concentrations . Dls and optical microscopy studies were performed to help elucidate the biophysical structure / activity relationships that might exist between the various c60 complexes . These studies were carried out to help generate correlations between the different c60 vectors, and the various c60 vector / dna structural attributes resulting in the different transfection efficiencies and cytotoxicity results observed under serum - free conditions . Table 3 presents the dls measurements on the various c60 vector compounds ivi when dissolved alone in either water (4 g/l), in a 10 mm tris / edta solution (4 g/l), in serum - free dmem (4 g/l), or when dissolved in complex with dna in 10 mm tris / edta (4 g/l, r = 16.8) or as a complex with dna in serum - free dmem (4 g/l, r = 16.8). The concentration of 4 g/l was chosen for dls experiments since compounds iii and iv exhibited maximum transfection efficiency at this concentration of c60 . The rh values in table 3 provide qualitative information about the transfection mixture aggregate behavior which can readily be seen in figures 4 and 5 . The rh parameter obtained from the dls measurements, and shown in table 3, corresponds to the radius of a monodisperse hypothetical sphere having the same diffusion constant as that of the c60 compound aggregates or the c60/dna mixture aggregates under study . Pdi values between 0 and 0.05 indicate more monodisperse particles, and values above 0.05 indicate broadened size distributions. (30) clearly, the rh values shown in table 3 for the various c60 compounds and c60/dna complexes are average values for quite polydisperse populations of aggregates . Previous work by our group and others using atomic force microscopy (afm) and cryo transmission electron microscopy (cryo - tem) have shown that derivatized c60 compounds form aggregates that are irregularly shaped in solution . The rh values observed for these c60 compounds and the c60/dna mixtures suggests that these reagents also form such irregularly shaped aggregates when in aqueous solutions, including when dissolved in solutions of physiological ionic strength such as dmem . Such qualitative information about the aggregate behavior provides valuable information for understanding the transfection and toxicity results, as discussed below . Representative morphologies of nih 3t3 cells and the c60/dna complexes at r = 0.42 ten minutes after transfection . The optical images represent complexes formed with compound (a) i, (b) ii, (c) iii, (d) iv, (e) v, and (f) vi . All images are shown at the same magnification . Representative optical microscopy images of nih 3t3 cells incubated with c60/dna complexes formed using compounds (a) iii and (b) vi at r = 0.42 twenty four hours post - transfection . All c60 compounds display a broadly distributed aggregate size in each solvent tested (water, 10 mm tris / edta solution, and serum - free dmem). The compounds had aggregate sizes between 47 and 650 nm (pdi = 0.330.51) and between 33 and 446 nm (pdi = 0.290.46) in plain water and 10 mm tris / edta solution, respectively . In the presence of dna, there is an increase in rh for all formulations . In general, the rh values decrease in the order v, vi> i> ii> iii, iv in the presence of dna . Presumably, this trend is the result of the influence of the various structures of the c60 derivatives on the condensation behavior of the dna in the transfection mixture . In the case of cationic polymers, the condensation process with dna has been thought to rely predominantly on electrostatic interactions with minor contributions from other interactions such as hydrophobic interactions, hydrogen bonding, and van der waals forces. (5) in case of the positively charged c60 derivatives, the hydrophobicity of the c60 core, and electrostatic interactions between the water - soluble functional groups and the dna are the main contributors to the condensation process . Compound i, with two adducts on the fullerene core, has less positive charge than the hexa - amino c60 adduct of compound ii and the octa - amino adduct of compound iii . Fewer electrostatic interactions between functionalized c60 vectors and the dna sugarphosphate backbone can lead to a decrease in condensation capacity, resulting in larger c60-vector / dna complexes . Compound v, although polar, has no net charge at neutral ph; while compound vi will possess a negative charge, the same as that of dna . Thus, for compounds v and vi, hydrophobicity is presumably the only interaction contributing to the formation of the dna condensates, and this interaction appears insufficient to fully condense the dna, leading to large c60 vector / dna complex aggregates . The relatively large sizes for the c60 vector / dna complexes, and in particularly for those formed from compounds i, ii, v and vi, may be a reason for the poor transfection efficiencies observed with these compounds . This may also be a reason for the low transfection efficiency reported for a similar positively charged amino - c60 compound with a monoadduct on the fullerene core. (17) however, increased positive charge - state alone is insufficient to solely predict increased transfection capability of amino - derivatized fullerenes . Variation in transfection protocol and/or cell types can also dramatically affect transfection efficiencies, as positively charged amino - derivatized c60 similar to compound iv have previously been shown to be inefficient at effecting transfection. (17) in general, the condensation behavior of nonviral vector / dna complexes is governed by several factors including the molecular weight of the dna condensing agent, the density of the charges on the condensing agent, and the ratio of composition (r values) between the condensing vector and the dna. (5) in addition, it is now well - documented that the size of the transfection vector / dna complex is one of the most important parameters for efficient dna delivery into cells, with the most efficient uptake observed for complex with sizes <150200 nm in diameter. (5) the rh values shown in table 3 suggest that only dna complexes formed with compounds iii and iv satisfy these criteria . On addition of the c60-vector / dna complexes to cells, the complexes formed with compounds i and ii immediately aggregated further to form large clusters, even at the lowest r value tested of 0.42 . Figure 4af shows the optical microscopy images of all c60-vector / dna complexes at r = 0.42 ten min after their addition to nih 3t3 cells . Large, irregularly shaped aggregates (shown as brown) can clearly be seen for complexes formed with compound i (figure 4a) and for complexes formed with compound ii (figure 4b). The aggregate concentration is greater and more densely distributed for compound i than for compound ii . No such increased aggregation propensity was seen for the other c60 vector / dna complexes (figure 4cf). However, time - dependence of aggregation could be observed for compound iii and compound vi . Figure 5a, b shows the optical microscopy images of compound iii / dna, and compound vi / dna complexes at r = 0.42 at 24 h post - transfection time . The images show the presence of large sized aggregates, more densly distributed for compound vi than for compound iii . Interestingly, addition of compound iii / dna mixtures caused cell morphological changes when added to cultured cells, causing the attached cells to round up from the substratum surface in contrast to the usual planar, extended / elongated shapes the cells assumed in the normal growth state . This shape change may be attributed to the depolymerization / disruption of either the actin or tubulin networks of the cytoskeleton by the complexes, and/or to the disruption / inhibition of focal adhesion plaques formed on the cell surface . However, this observation at r = 0.42 does not have any noticeable effects on cell proliferation, as flow cytometry measurements indicate no statistically significant difference in the number of cells for those treated with compound iii / dna complexes relative to the controls cells (no c60/dna complexes added). Our results indicate that compounds iii and iv, when complexed with dna, bring about the highest levels of transfection when compared to the other derivatized c60 compounds under evaluation in this study . At the optimal ratio of compound iii or iv to dna (r = 16.8), however, at 24 h post - transfection, there is only approximately 30% viability in cells treated with these two tranfection mixtures . This result is in contrast to cell viability of greater than 50% in cells treated with the compounds iii or iv alone at equivalent c60 concentrations (4g/l) as that when in complex with dna at r = 16.8 . The temporal increase in aggregate sizes for these c60/dna complexes (not seen in the free c60 compounds alone) leads to precipitation onto the cell surface when these mixtures are left in the culture medium for 24 h (e.g., see figure 5). This effect may explain the higher levels of cell death in the transfection mixture - treated cells . The overall trend observed in these studies was that increased cell death was observed with an increase in either c60 concentration alone or for increased r values in c60/dna mixtures, irrespective of the chemical nature of the c60 compound, with compounds iii and iv exhibiting the least toxicity when free in solution, but not necessarily when complexed with dna (under these conditions, compound v seems to exhibit the least cell toxicity). Also, higher levels of cytotoxicity seem to correlate more with complex aggregate formation induced by the presence of dna in the mixtures, leading to the formation of visible precipitates . Such deposition of aggregates onto the cell surface will impair normal functioning of the plasma membrane and thereby contribute to cell death. (31) there may also be other slow processes contributing to cell death for the positively charged c60 vectors in the c60/dna solutions at the longer (8 and 24 h) transfection times . Following cellular entry, the presence of positively charged amino - c60 compounds (iiv) (individuals or as aggregates) inside the cell or nucleus may lead to disruptions to other cellular functions, such as interfering with histonedna interactions and/or other cellular processes. (7) the favorable transfection efficiencies of compounds iii and iv suggest that these compounds have some characteristics in common with other positively charged amino - c60 derivatives previously cited in the literature which are reported to effect transfection in cells . These similarities include having a flexible linker situated between the fullerene core and the positively charged amino groups . Although the results presented here suggest that the structures of compounds iii and iv will result in higher levels of transfection than those previously reported by others, direct comparison of our results with the results from others using different structurally derivatized positively charged amino c60 vectors is not possible, since the structure of the c60 vectors, the cell lines tested, and the methodologies used are not consistent . Another distinct feature of all the c60 vectors reported here is their water solubility which obviates the need to use organic solvents such as dimethylformamide (dmf) in the preparation of the transfection mixture; the high cytotoxicity observed for some other c60-based transfection agents has been attributed to the toxicity of dmf . The comparable transfection efficiencies of compounds iii and iv on nih 3t3 cells to those of commercially available nonviral vectors 25 kda pei and cytopure is encouraging . 25 kda pei is a widely used nonviral vector and is quite often used as a standard for comparing new nonviral vectors . This high cytotoxicity has been attributed more to free pei than to the pei / dna complex . However, in case of compound iii or iv, at the optimal r = 16.8, their complexes with dna show higher toxicity (30% viability) compared to the free compounds iii or iv alone (greater than 50% cell viability). Since the cytotoxicity seems to correlate more with complex aggregate formation induced by the presence of dna in the mixtures, future refinement of the c60/dna complex preparation protocol, such as disaggregating these complexes with phosphate buffer and/or nacl, should potentially lead to lower cytotoxicity while maintaining the same level of transfection efficiency, or potentially even increase these transfection efficiency levels . Furthermore, although not addressed in this study (for reasons of maintaining uniformity in c60/dna complex formation and cellular entry), the presence of serum proteins on enhanced c60/dna complex uptake, and on subsequent cell viability during extended transfection times, would also be worth examining, and could be expected to lower the observed cellular cytotoxicity levels seen in this study . The small, but statistically significant, expression of the reporter protein from c60/dna conjugates formed from compounds v and vi was surprising and interesting since these samples do not possess a net positive charge under the physiological conditions used to form the complexes, although there have been limited reports of other nonpositive charged nanoparticles translocating into cells(35) and, indeed, also demonstrating gene transfection. (36) thus, at least for some derivatized c60 molecules, the hydrophobic nature of the c60 carbon nanostructures may be the common important property in their binding to dna and their subsequent translocation into the interior of the cell . There is now a growing body of work that suggests that carbon nanomaterials such as fullerenes, metallofullerenes and carbon nanotubes, due the hydrophobicity of their carbon sheaths, have the ability to efficiently translocate into the interior of cells irrespective of the charge of their water - solubilizing moieties . In addition, carbon nanomaterials such as gd@c60, gd@c82, gd@c80 and gd@ultrashort single - walled carbon nanotubes (gd@us - tubes) have shown potential as high - performance magnetic resonance imaging (mri) contrast agents suitable for advanced applications such as tracking and/or delivery of magnetically labeled cells by mri in vivo . These reports, along with the favorable c60-based gene transfection results reported here and by others, offer opportunities for development of analogous gd@c60-based vectors to monitor noninvasively the biodistribution and pharmacokinetics of gene therapy vectors in vivo. (49) a new class of water - soluble c60 transfecting agents with positively charged, negatively charged, or neutral chemical functionalities under physiological conditions was prepared using hirschbingel chemistry . Transfection, cytotoxicity and biophysical structure / activity studies were performed in an effort to elucidate the relationship between the hydrophobicity of the fullerene core, the hydrophilicity of the water - solubilizing groups, and the overall charge state of the c60 vectors in gene delivery / expression . However, only two positively charged c60 derivatives, namely, an octa - amino derivatized c60 and a dodeca - amino derivatized c60 vector, showed efficient in vitro transfection . Increased levels of cellular toxicity were observed for positively charged c60 vectors relative to the negatively charged and neutral vectors . Structural analyses using dynamic light scattering and optical microscopy confirmed that higher positive charge on c60 compounds is a dominant physical attribute necessary for optimal c60/dna structural features leading to increased transfection efficiency, and that aggregation is the major factor that negatively affected the cytotoxicity profiles of the c60 vector / dna complexes . Aggregation is presumably also the dominant reason for increased cytotoxicity of certain specific derivatized c60 compounds (most notable for compound i) even in the absence of dna, at least when analyzed under the serum - free conditions utilized in this study . Future studies should be able to capitalize on this information and enable the design of additional c60 derivatives that address these issues specifically and help lower the propensity of these reagents to aggregate in the presence of dna . Such reagents would be expected to enhance transfection of cells and tissues while simultaneously lowering toxicity levels . Future studies using these reagents will also more precisely indicate the cellular uptake and endosomal release mechanisms that these compounds inherently possess, thereby lending further insight into potential enhanced chemical design of future generations of these carbon - based nanomaterials specifically for dna delivery into the cell nucleus . The successful demonstration of intracellular dna uptake, intracellular transport, and gene expression from dna using c60 vectors suggests the possibility of developing analogous gd@c60-based vectors to serve simultaneously as both therapeutic and diagnostic agents.
|
Previously we reported that deletion of neutral endopeptidase (nep) provides protection from obesity- and diabetes - induced neural complications . We have also shown that treating obese and streptozotocin - diabetic mice with the vasopeptidase inhibitor ilepatril prevented neural complications including slowing of nerve conduction velocity, thermal hypoalgesia, and decreased intraepidermal nerve fiber density . Vasopeptidase inhibitors are drugs that simultaneously inhibit nep and angiotensin - converting enzyme (ace) activity . Recent studies have shown increased expression of angiotensin - ii - forming enzymes in adipose tissue and increased activity of the renin - angiotensin system being implicated in the development of insulin resistance and type 2 diabetes . Nep is found in many tissues including vascular and renal tissue and its activity is increased by fatty acids and glucose in human microvascular cells [59]. In the peripheral nervous system nep is located in schwann cell membranes surrounding dorsal root ganglion cells and nerve fibers [10, 11]. Nep degrades many vaso- and neuroactive peptides including natriuretic peptides, adrenomedullin, bradykinin, and calcitonin - gene - related peptide [12, 13]. Therefore, inhibition of ace and nep activity would be expected to improve vascular and neural function . In this regard we have demonstrated that treating type 1 and type 2 diabetic rats as well as a genetic rat model of obesity with ilepatril improves vascular and neural dysfunction [1416]. However, little information is available about the effect of vasopeptidase inhibitors in animal models of diet - induced obesity . In order to further elucidate the effects of vasopeptidase inhibitors in peripheral nerve dysfunction associated with obesity we examined the effect of diet - induced obesity on nerve conduction velocity and thermal response latency in the hindpaw of c57bl/6j mice and mice deficient in nep treated with ilepatril, enalapril, ace inhibitor, or candoxatril, nep inhibitor [1, 2]. Unless stated otherwise all chemicals used in these studies were obtained from sigma chemical co. (st . Louis, mo). C57bl/6jj breeding pairs of neutral endopeptidase - deficient (nep) mice were provided by drs . These mice have been bred and a colony created at the veterans affairs medical center, iowa city, ia . Deficiency of nep activity was confirmed in nep mice by measuring the specific activity of nep in kidney homogenates using the method described by ayoub and melzig with modification . Activity of nep in kidney from c57bl/6j and nep mice was 0.35 0.02 and 0.02 0.02 mm 7-amido-3-methylcoumarin (amc)/min / mg protein, respectively (p <0.001 versus c57bl/6j by unpaired t - test). This test was performed on all mice used in these studies in order to confirm that nep was functionally knocked out in the nep mice . Mice were housed in a certified animal care facility and food (harlan teklad, no . Adequate measures were taken to minimize pain or discomfort and all of the experiments were conducted in accordance with international standards on animal welfare and were compliant with all institutional and national institutes of health guidelines for use of animals (acurf protocol 1101009). For the prevention protocol c57bl/6j and nep mice at 12 weeks of age were divided into five groups . A second group was fed a high - fat diet containing 24 gm% fat, 24 gm% protein, and 41 gm% carbohydrate (d12451; research diets, new brunswick, nj). The primary source of the increased fat content in the diet was soybean oil and lard . The control and high - fat diet contained 0.4 and 0.3% sodium chloride, respectively . The average fat content of the control diet was 4.25 gm% (harlan teklad, no . The third through fifth groups were fed the high - fat diet containing ilepatril (500 mg / kg in the diet), candoxatril (30 mg / kg in the diet), or enalapril (500 mg / kg in the diet). We have found that these doses provide maximal inhibition of nep and/or ace activity in vivo [2, 19]. For the intervention study the same five groups of c57bl/6j and nep mice at 12 weeks of age were fed the control diet (group 1) or high - fat diet (groups 25) for 12 weeks . Afterwards, the four groups of high - fat - fed mice were fed a high - fat diet with no additions (group 2) or high - fat diet containing ilepatril, candoxatril, or enalapril (groups 35) for 12 weeks . After an overnight fast mice were injected with a saline solution containing 2 g / kg glucose, i.p . Immediately prior to the glucose injection and for 120 minutes afterwards blood samples were taken to measure circulating glucose levels with the use of glucose - dehydrogenase - based reagent strips (aviva accu - chek, roche, mannheim, germany). Blood samples (0.6 l) were taken from a tail vein that was lanced once . Thermal nociceptive response in the hindpaw was measured using the hargreaves method with instrumentation provided by iitc life science, woodland hills, ca (model 390 g) as previously described . The test was performed in a blind manner . Thermal nociceptive responses were measured by placing the mouse in the observation chamber on top of the thermal testing apparatus and allowing it to acclimate to the warmed glass surface (33c) and surroundings for a period of 15 min . The mobile heat source was maneuvered so that it was under the heal of the hindpaw and then activated, a process that starts a timer and locally warms the glass surface, when the mouse withdrew its paw, the timer, and the heat source was turned off . Following an initial recording, which was discarded, two measurements were made for each hindpaw, with a rest period of 5 min between each set of measurements . The mean of the measurements, reported in seconds, was used as a measure of the thermal nociceptive response latency ., abbott laboratories, north chicago, il) and sensory nerve conduction velocities were determined as previously described [1, 2]. Briefly, sensory nerve conduction velocity was recorded in the digital nerve to the second toe by stimulating with a square - wave pulse of 0.05 ms duration using the smallest intensity current that resulted in a maximal amplitude response (grass s44 stimulator; grass medical instruments, quincy, ma). The maximal sensory nerve conduction velocity was calculated by measuring the latency to the onset / peak of the initial negative deflection and the distance between stimulating and recording electrodes (measured in millimeters using a vernier caliper). Biopsies of skin of the right hindpaw were fixed, dehydrated, and embedded in paraffin . Sections (7 m) were collected and immunostained with anti - pgp9.5 antibody (rabbit anti - human no . 7863 - 0504 (this antibody cross - reacts with rat, mouse guinea pig, and other species), abd serotic, morpho sys us inc ., raleigh, nc) overnight followed by treatment with secondary antibody alexa fluor 546 goat anti - rabbit (invitrogen, eugene, or). Profiles were imaged using a zeiss 710 confocal microscope with a 40x objective and were counted by two individual investigators that were blinded to the sample identity . Length of the epidermis was determined by drawing a polyline along the contour of the epidermis and recording its length in mm . Comparisons between the groups for body weight, blood glucose, sensory nerve conduction velocity, thermal nociception, and intraepidermal nerve fiber profiles were conducted using a one - way anova and bonferroni's test for multiple comparisons (prism software; graphpad, san diego, ca). Presented in table 1 are weight and blood glucose changes for c57/bl6j and nep mice used in the prevention study . At 12 weeks of age when fed a high - fat diet c57bl/6j and nep mice both gained a similar amount of weight . Treating the high - fat diet with ilepatril or enalapril but not candoxatril completely prevented the gain in weight . The mass of the epididymal fat pad was significantly increased in high - fat - fed mice and mice fed the high - fat diet treated with candoxatril compared to control mice or mice fed the high - fat diet containing ilepatril or enalapril . When calculating the epididymal fat pad mass as a percent of total body weight epididymal fat pad mass was significantly increased in high - fat - fed c57bl/6j mice and mice fed a high - fat diet containing candoxatril compared to control . Treating the high - fat diet with ilepatril and to a greater extent enalapril prevented the increase in epididymal fat pad mass when presented as percent of final body weight . Nonfasting blood glucose levels were not significantly different between c57bl/6j and nep mice fed the control or high - fat diets and not affected by ilepatril, candoxatril, or enalapril treatment . In the intervention study all mice fed the high - fat diet for the initial 12 weeks of the experimental design gained a significant amount of weight (table 2). When transferred to a high - fat diet containing ilepatril or enalapril for an additional 12 weeks c57bl/6j and nep mice lost weight . Mice remaining on the high diet or high - fat diet containing candoxatril continued to gain weight . The epididymal fat mass decreased after c57bl/6j or nep mice, fed a diet containing high fat for 12 weeks, were given a high - fat diet containing enalapril . The epididymal fat mass also was decreased after nep mice but not c57bl/6j mice were fed a high - fat diet treated with ilepatril . Treating high - fat - fed c57bl/6j or nep mice with candoxatril did not reduce epididymal fat mass . A similar trend was observed when the epididymal fat mass data was presented as percentage of final body weight . Nonfasting blood glucose levels were not changed in c57bl/6j or nep mice fed control or high - fat diets with or without ilepatril, candoxatril, or enalapril . In the prevention study c57bl/6j (figure 1) and nep (figure 2) mice fed the high - fat diet or high - fat diet containing candoxatril had an impaired glucose clearance curve compared to control mice . In contrast, the glucose clearance curve was near normal in c57bl/6j and nep mice fed a high - fat diet containing ilepatril or enalapril . In the intervention study feeding c57bl/6j (figure 3) or nep (figure 4) mice for 24 weeks a high - fat diet caused an impaired glucose clearance curve . Treating high - fat - fed c57bl/6j or nep mice with enalapril for the last 12 weeks of the 24-week period partially corrected glucose utilization . Treating nep mice with ilepatril treating c57bl/6j mice with ilepatril did not improve glucose utilization nor did treating c57bl/6j or nep with candoxatril . Data in figure 5 (left) demonstrate that sensory nerve conduction velocity was significantly decreased in high - fat - fed c57bl/6j mice compared to control mice and that this was prevented by treating high - fat - fed mice with ilepatril or candoxatril using a prevention protocol . Data in figure 5 (center) demonstrate that thermal nociception was significantly decreased in c57bl/6j mice after 12 weeks of a high - fat diet compared to control mice as indicated by an increase in paw withdrawal latency . Treatment with ilepatril or candoxatril and to a lesser extent enalapril for the 12-week period prevented thermal hypoalgesia in high - fat - fed c57bl/6j mice . Data in figure 5 (right) demonstrate that the number of intraepidermal nerve fiber profiles was significantly decreased in high - fat - fed c57bl/6j mice and that treatment of these mice with ilepatril or candoxatril but not enalapril for 12 weeks prevented the significant decrease . Sensory nerve conduction velocity, thermal nociception, and intraepidermal nerve fiber density were not impaired in nep mice fed a high - fat diet (figure 6, left, center, and right, resp . ). We also determined the effect of treating high - fat - fed c57bl/6j and nep mice using an intervention protocol (figures 7 and 8, resp . ). In this study design high - fat - fed mice were untreated for 12 weeks followed by 12 weeks of a high - fat diet with or without treatment . Feeding c57bl/6j mice a high - fat diet for 24 weeks caused a significant decrease in sensory nerve conduction velocity (figure 7, left). Treating these mice for the last 12 weeks of the 24-week period with ilepatril, candoxatril, or enalapril the decrease in thermal nociception in high - fat - fed c57bl/6j mice was reversed by treating mice with ilepatril or candoxatril but not enalapril (figure 7, center). Treating high - fat - fed c57bl/6j mice with ilepatril, candoxatril, or enalapril reversed the decrease in intraepidermal nerve fiber profiles (figure 7, right). Feeding nep mice a high - fat diet for 24 weeks with or without treatment had no effect on sensory nerve conduction velocity, thermal nociception, or intraepidermal nerve fiber density (figure 8, left, center, and right, resp . ). The main findings from these studies were that diet - induced obesity caused significant weight gain and impaired glucose utilization in c57bl/6j and nep mice that was improved when the mice were treated with ilepatril or enalapril using a prevention protocol . Using the intervention protocol enalapril but not ilepatril treatment was effective improving glucose utilization by c57bl/6j mice . Treating c57bl/6j or nep mice with candoxatril did not improve weight gain or glucose utilization . These data suggest that inhibition of ace and not nep activity was responsible for improving weight gain and glucose utilization in high - fat - fed mice . Diet - induced obesity also caused slowing of sensory nerve conduction velocity, thermal hypoalgesia, and decrease in epidermal nerve fiber density in the paw of the hindlimb in c57bl/6j mice but not nep mice . The impairment in sensory nerve function endpoints in c57bl/6j mice fed a high - fat diet was prevented / improved when the mice were treated with ilepatril or candoxatril and to a much lesser extent enalapril using either the prevention or intervention protocol . These data suggest that increased nep activity / expression but not ace activity contributes to diet - induced obesity - related deficits in sensory nerve function . Previous studies have shown that diet - induced obesity in rodent models can be prevented by ace inhibitors and angiotensin ii receptor blockers [2124]. In addition, diet - induced weight gain and fat mass are reduced, energy expenditure increased, and glucose tolerance improved in mice lacking ace or the angiotensin ii type 1a receptor [25, 26]. The mechanisms proposed for the improvement in obesity and glucose tolerance with treatment of rodent models with ace inhibitors are increased energy expenditure, liver and adipose tissue metabolic modulation, lower concentration of leptin, improved insulin signaling, and increased glucose and fatty acid utilization by muscle [2130]. In a study comparing the effects of ramipril, an ace inhibitor, to ilepatril in jcr: la - cp rats, an obese, insulin - resistant, hyperinsulinemic, normoglycemic model, it was found that both compounds reduced the surge of plasma insulin in a meal tolerance test by about 50% but ilepatril was more beneficial in improving vascular reactivity . In our study we found that enalapril trended to be more effective than ilepatril preventing / reducing fat pad mass . This could be because enalapril at the dosage used was a more effective ace inhibitor than ilepatril in target tissues . In another study using obese zucker rats it was found that dual inhibition of ace and nep improved insulin - mediated glucose disposal more effectively than monotherapy and this effect was linked to increased activation of the kinin - nitric oxide pathway . In a similar independent study it was found that omapatrilat, a vasopeptidase inhibitor, induced insulin sensitization and increased myocardial glucose uptake in obese zucker rats and that the effect of omapatrilat was greater than ramipril in part due to stimulation of the b2 receptor . Later this group reported that treatment of obese zucker rats with a vasopeptidase inhibitor increased muscle glucose uptake independent of insulin signaling . In two of these studies protection of bradykinin from degradation by nep interestingly, it has been shown that natriuretic peptides promote muscle mitochondrial biogenesis and fat oxidation as to prevent obesity and glucose intolerance . The natriuretic peptides are also degraded by nep . Because nep is expressed in skeletal muscle in relatively large amounts and being located on the cell surface, nep is able to hydrolyze peptides in the vicinity of their receptors thereby neutralizing their bioactivity [34, 36]. However, inhibition of ace may also lead to protection of bradykinin levels by inhibiting kininase - ii - mediated degradation of this nonapeptide . Reported that ace inhibition by captopril improved glucose transport in insulin - resistant muscle of the obese zucker rat . They attributed the improvement to modulation of insulin action by bradykinin mediated through b2 receptors and by an increase in nitric oxide production . Since bradykinin and natriuretic peptides may have a role in enhancing insulin action and regulating glucose and fatty acid metabolism by muscle protecting their bioactive function by preventing degradation through inhibition of ace and/or nep may be a therapeutic approach for treatment of obesity and insulin resistance [34, 36, 38]. We have previously shown that treating diabetic rats with enalapril improved vascular and nerve endpoints but enalapril was less effective in rats fed a high - fat diet [19, 36, 39, 40]. In contrast, we found that treating obese or diabetic rats with ilepatril was more effective than enalapril in improving peripheral nerve dysfunction [19, 36, 40]. We have shown that treating diabetic or diet - induced obese rodents with ilepatril improves vasodilation of blood vessels that provide circulation to the sciatic nerve by reducing oxidative stress and preventing degradation of vasoactive peptides by nep including calcitonin gene - related peptide and c - type natriuretic peptide thereby maintaining endoneurial blood flow and preventing ischemia . Since nep degrades both calcitonin gene - related peptide and substance p, peptides important in pain signaling pathways, it is likely that blocking nep activity or mice deficient in nep would maintain higher levels of both of these neuroactive peptides and perhaps be more sensitive to painful stimuli . Data from clinical trials clearly suggest that activation of the renin - angiotensin - aldosterone system plays an important role in the pathophysiology of the metabolic syndrome through interaction of a wide range of physiological and molecular mechanisms . More recently in humans activity of nep has been shown to correlate with body mass index and measures of insulin resistance with increasing activity found in subjects with multiple cardiovascular risk factors . In these studies we found that feeding mice a high - fat diet causes weight gain, impaired glucose tolerance, and sensory nerve dysfunction . Inhibition of ace was effective in reducing weight gain and improving glucose utilization but generally noneffective in improving sensory nerve dysfunction . In contrast, inhibition of nep improved sensory nerve dysfunction and had no effect in improving weight gain or glucose utilization . Treating high - fat - fed mice with a vasopeptidase inhibitor improved weight gain, glucose utilization, and sensory nerve function . Thus, we conclude that increased activity of nep is associated with sensory nerve dysfunction in an animal model of diet - induced obesity and that dual inhibition of ace and nep may be more effective than monotherapy in reducing insulin resistance and the sensory nerve complications associated with metabolic syndrome.
|
Tetracyclines bind to the a - site on the bacterial ribosome, resulting in steric blocking of the aminoacyl - trna binding site, which prevents protein synthesis . They are effective against both gram - positive and gram - negative bacteria and, due to the relative lack of major side effects and cheap cost, have been used extensively in the treatment of infections as well as growth promoters in animal husbandry . Bacterial resistance to tetracycline is often mediated through the acquisition of dna encoding proteins that confer resistance by one of three main mechanisms: atp - dependent efflux, enzymatic inactivation of tetracycline, or ribosomal protection . To date, a total of 60 different classes of tetracycline resistance gene, including oxytetracycline resistance genes, have been reported . These include 33 predicted or proven to encode active efflux pumps, 12 encoding ribosomal protection proteins (rpps), 13 encoding inactivating enzymes and 1 reported to confer resistance via an as yet undetermined mechanism, designated tet(u) (a full list is periodically updated by roberts). Although it has yet to be assigned a mechanistic class, tet(u) has been identified in enterococcus and staphylococcus isolates . However, a study by caryl et al . Reported that when tet(u) was cloned and expressed in escherichia coli, the transformants were not resistant to tetracycline . To be considered a new class of tetracycline resistance gene determinants representing new classes were originally assigned a letter from the english alphabet . However, as all letters are used, they are now assigned an arabic numeral, with new determinants referred to the levy group (bonnie.marshall@tufts.edu) in order to obtain a designation prior to publication to avoid duplication and ensure taxonomic consistency . Rpps are a related group of proteins that, when bound to the ribosome, result in the release of tetracycline from the ribosome, enabling protein synthesis to proceed (reviewed by thaker et al . ). Of the 12 classes of rpp gene currently reported [tet(m), (o), (q), (s), (t), (w), (32), (36), (44), b(p), otr(a) and tet], tet(m) is considered the most prevalent due to its association with the broad host range tn916/tn1545 family of conjugative transposons . However, a subgroup of rpp genes has been identified that consist of regions of different, already characterized rpp genes that appear to have undergone recombination forming a mosaic gene . It must be stressed here that the progenitors of mosaic genes are assumed based purely on the order in which they were discovered and we cannot be sure of the directionality of mosaic gene formation . In 2003, stanton and humphery reported two rpp genes in megasphaera elsdenii that encoded predicted proteins showing 89.1% and 91.9% identity to tet(w) (accession number aj222769) from butyrivibrio fibrisolvens . As this was above the <80% cut - off, they did not qualify as a new resistance class under the nomenclature system . However, further analysis of the amino acid sequence revealed variability in the percentage identity to tet(w) across its length . The large central section in both sequences showed 98.1% identity to tet(w), while small sections at the n- and c - terminal ends were found to have a lower amino acid sequence identity to tet(w) [between 66.6% and 75.3%]. However, these same n- and c - terminal sections were shown to have between 99.3% and 100% amino acid identity to tet(o) (accession number m18896), despite the central section showing identity to tet(w). Given the evidence, this suggested recombination had occurred, creating a mosaic determinant with a central tet(w) region flanked by two tet(o) regions . Although never before observed between two different rpp classes, recombination resulting in functional genes has previously been reported between different phylotypes of tet(m) as well as in other antibiotic resistance genes, such as pena and pbp2x, which confer resistance to penicillin . Furthermore, in vitro experiments have successfully recombined tet(a) and tet(c) to create mosaics that confer resistance to tetracycline at levels comparable to the non - mosaic tet(c). The guideline for determining a new resistance gene class was established prior to the discovery of these mosaic rpp genes and none of the mosaic genes qualified as a new class when analysed as one single continuous sequence . It was clear, however, that these mosaic genes were different from their non - mosaic counterparts and that the current classification did not adequately reflect the true evolutionary background of these genes . Therefore, an expansion of the nomenclature system was suggested whereby the mosaic gene would receive a designation that reflected the structural order and class of the genes they comprised, better reflecting their variable nature . For example, the two resistance genes reported in m. elsdenii, which comprised a central tet(w) region flanked by two tet(o) regions, were designated tet(o / w / o). Although stanton and humphrey were the first to report mosaic rpp genes, melville et al . Had unknowingly reported a mosaic gene 2 years previously . This resistance gene, found in clostridium saccharolyticum k10, encoded a predicted protein that showed 76% amino acid identity to tet(o) (accession number y07780). As per the original nomenclature guidelines, it was given the new designation tet(32). However, subsequent re - examination of the sequence found that only the central section showed <80% identity to known proteins, while the n- and c - terminal regions flanking the central section shared 100% and 97.7% identity, respectively, to tet(o) (accession number m18896). The central region was still thought to represent a section of a new tet(32) class and therefore the determinant was reclassified tet(o/32/o). Subsequently, the proposed full, non - mosaic sequences of tet(32) have been reported in several isolates identified from the human oral cavity, with the tet(o/32/o) mosaic determinant now showing 89% amino acid identity to these . Similarly, the previously reported tet(s) allele (accession number ay534326) on the conjugative transposon tn916s has subsequently been reclassified as a result of in silico analysis . The amino acid sequence shows identity to tet(s) across 595 amino acids (1595 inclusive), with the final 61 amino acids at the c - terminus end identical to tet(m) (accession number u09422), resulting in it being reclassified as tet(s / m). To date, a total of 30 mosaic genes have been reported in the literature, of which 26 currently have sequences deposited in genbank (table 1). Some studies have reported multiple occurrences of known genes; however, many of these have been characterized by pcr amplification only . Structurally, these chimeric genes currently comprise either two [e.g. Tet(o / w)], three [e.g. Tet(o / w / o)], four [e.g. Tet(o / w/32/o)] or six [e.g. Tet(o / w/32/o / w / o)] different regions (figure 1), with tet(o), tet(w) and tet(32) being the predominant rpp genes reported to form mosaic genes, comprising all but two of the reported variants, and tet(m) and tet(s) forming the remaining two . Given the prevalence of tet(m) in certain samples, and the previous reports of self - recombination, it is surprising that there are so few reports of mosaic genes containing tet(m). Furthermore, alignment of 12 representative rpp gene sequences shows tet(m) sharing 75% and 70% identity, respectively, to tet(o) and tet(44), which is higher than the percentage identity observed between the more commonly reported rpp mosaic genes comprising tet(o), (w) and (32) (table 2). However, mosaic genes comprising tet(m) and any other gene, with the exception of tet(s), have yet to be reported . It is entirely possible that this may be due to a lack of investigation rather than an absence of recombination followed by fixation of the recombinant allele in the bacterial population . Alternatively, it is possible that there is little selective pressure for tet(m)-based mosaic genes if the resultant protein is no more efficient than tet(m) itself and/or there is no indirect selective pressure for mosaicism . Reported that the protein encoded by the tet(o / w / o) mosaic genes in m. elsdenii conferred a higher level of resistance to tetracycline than their non - mosaic counterparts, but similar investigations are still to be reported for other rpp genes . Therefore, the prevalence of certain mosaic gene variants could suggest that they are in some way more beneficial to the host than the non - mosaic genes they comprise . Table 1.a summary of the mosaic tetracycline genes reported to dategeneorganismsource(s)accession numberreference(s)tet(o / w)bifidobacterium thermophilum b0219environmental (pig slaughterhouse) sampleam88911832tet(o / w)b . Faecesam88912232tet(o / w)-2megasphaera elsdenii 25 - 51swine faecesay48512218,27tet(o / w)-1 [n = 15]m . Elsdenii 27 - 51swine faecesay48512627,33tet(o / w / o)-4uncultured bacterial clonepig faecesno accession number21tet(o / w / o)-3 [n = 9]uncultured bacterial clonepig elsdenii 14 - 14swine caecumay19692013,18,27,33tet(o / w / o)-1 [n = 2]m . Elsdenii 7 - 11swine caecumay19692113,18,27tet(o / w/32/o) [n = 32]uncultured bacterial clonepig faecesef06552321tet(o / w/32/o) [n = 7]streptococcus suis ss1303pig (brain, lung and spleen) and human (csf) suisdiseased pig (blood, brain, heart, joint and lung) samplesjq74005328tet(o / w/32/o / w / o)lactobacillus johnsonii g41human faecesdq52502332tet(o / w/32/o / w / o)uncultured bacterial clonepig faecesdq67992621tet(o/32/o)s . Suisdiseased pig (blood, brain, heart, joint and lung) samplesjq74005228tet(o/32/o)clostridium saccharolyticum k10human colonaj29523818tet(o/32/o)-2 [n = 3]uncultured bacterial clonehuman and animal faecal samplesno accession number21tet(o/32/o)-3uncultured bacterial clonehuman and animal faecal samplesno accession number21tet(o/32/o)-4uncultured bacterial clonehuman and animal faecal samplesno accession number21tet(o/32/o)-5uncultured bacterial clonehuman and animal faecal samplesno accession number21tet(o/32/o)dorea longicatena agr2136rumen microbiomenz_aujs01000017 (41 62643 545 bp)direct submission, analysed in this studytet(o/32/o)campylobacter coli 202/04human faecesainh01000038 (23614280 bp)direct submission, analysed in this studytet(o/32/o)c . Coli 317/04human faecesnz_ainj01000054 (20944013 bp)direct submission, analysed in this studytet(o/32/o)campylobacter jejuni subspecies jejuni 2008 - 894humanaioq01000025 (14 51516 434 bp)direct submission, analysed in this studytet(o/32/o)roseburia intestinalis xb6b4human intestinal tractfp929050 (2 873 8142 875 733 bp)direct submission, analysed in this studytet(s / m)streptococcus equinus 1357foodhm36771125tet(s / m)streptococcus intermediushuman isolateay53432623,24tet(w/32/o)b . Thermophilum b0256pig faecesam71060532the number given in square brackets indicates the instances of that mosaic gene variant reported, if more than one.fourteen of the 15 tet(o / w)-1 variants were only determined by pcr analysis and so could be either tet(o / w)-2.eleven of the 28 tet(o / w / o)-2 variants were only determined by pcr analysis and so could be either tet(o / w / o)-2 or tet(o / w / o)-1.all s. suis isolates, but not the same strain . Table 2.sequence identity matrix showing the percentage nucleotide identity between representatives of all 12 rpp gene classes, in descending order, compared with tet(m)rpp genetet(m)tet(s)tet(o)tet(44)tet(32)tet(w)tet(t)tet(36)tet(q)tetb(p)otr(a)tettet(m)1007875706964574946231111tet(s)10070696762565648111110tet(o)100696965564948151211tet(44)1007164505846151110tet(32)10067554947111210tet(w)10012451551412tet(t)10057561882tet(36)1006491111tet(q)100131212tetb(p)10011otr(a)10063tet100accession numbers of representative genes included in the matrix: tet(m), u09422; tet(o), y07780; tetb(p), ae001437; tet(q), x58717; tet(s), x92946; tet(t), l42544; tet(w), aj222769; tet(32), dq647324; tet(36), aj514254; tet(44), fn594949; otr(a), x53401; tet, al939106.shaded boxes represent those genes currently reported to comprise mosaic genes . The coded bars indicate sequences of high identity to specific rpp genes: vertical line bars for tet(m), white bars for tet(o), grey bars for tet(s), black bars for tet(w) and checked bars for tet(32). Indicates those sequences that are incomplete or absent in genbank, with the crossover points taken from the publication . Indicates sequences that have been analysed in this study due to no specific crossover point(s) reported . A summary of the mosaic tetracycline genes reported to date the number given in square brackets indicates the instances of that mosaic gene variant reported, if more than one . Fourteen of the 15 tet(o / w)-1 variants were only determined by pcr analysis and so could be either tet(o eleven of the 28 tet(o / w / o)-2 variants were only determined by pcr analysis and so could be either tet(o / w / o)-2 or tet(o / w / o)-1 . Sequence identity matrix showing the percentage nucleotide identity between representatives of all 12 rpp gene classes, in descending order, compared with tet(m) accession numbers of representative genes included in the matrix: tet(m), u09422; tet(o), y07780; tetb(p), ae001437; tet(q), x58717; tet(s), x92946; tet(t), l42544; tet(w), aj222769; tet(32), dq647324; tet(36), aj514254; tet(44), fn594949; otr(a), x53401; tet, al939106 . The coded bars indicate sequences of high identity to specific rpp genes: vertical line bars for tet(m), white bars for tet(o), grey bars for tet(s), black bars for tet(w) and checked bars for tet(32). Indicates those sequences that are incomplete or absent in genbank, with the crossover points taken from the publication . Indicates sequences that have been analysed in this study due to no specific crossover point(s) reported . Stanton and humphrey describe an assay that distinguished between the non - mosaic genes tet(o) and tet(w) and the mosaic tet(o / w / o) from megasphaera strains, enabling them to detect tet(o / w / o) variants in six additional m. elsdenii strains . Patterson et al . Investigated the presence of mosaic genes using various specific oligonucleotide sets that either bound within the resistance genes or flanked them . Amplicons specific to tet(o / w), tet(o/32) and tet(w/32) were detected in faecal samples, with tet(o/32) being the most common of these mosaic amplicons; it was amplified in all 12 pig faecal samples and 6 of 7 human faecal samples tested . In contrast, the faecal samples from cows and sheep, as well as human saliva samples, failed to produce any amplicons for these mosaic genes, suggesting they were not present at detectable levels . Chen et al . Also used an oligonucleotide primer set that annealed outside tet(o) to determine the presence of tetracycline resistance genes in two streptococcus suis isolates . Although no amplicon was produced using internal, tet(o)-specific primers, the primers binding to flanking dna yielded an amplicon, indicating the presence of mosaic genes [identified as tet(o/32/o) and tet(o / w/32/o)]. This full - length oligonucleotide primer set does aid the identification of mosaic genes; however, it is only specific for those with regions homologous to tet(o) flanking sequences . Since pcr strategies aimed at identifying resistance genes require knowledge of the sequence of the target, mosaic rpp genes are likely to be largely undetected and under - reported by pcr - based studies ., almost all the mosaic genes reported to date have originated from faecal samples, with the majority identified from a porcine origin and less commonly from humans (table 1). The gut houses a complex and diverse bacterial community with potential for widespread horizontal gene transfer, and the mosaic genes found in faecal samples are likely to reflect the pool of non - mosaic genes present within the gut microbiota . Genes such as tet(w) and tet(o) are commonly reported from these types of samples, but the prevalence of tet(32)-containing mosaic genes suggests that tet(32) may be more common than initially thought . In fact, tet(o/32/o) was found to be the most common mosaic gene in both the human and pig faecal samples tested and was present in almost as many samples tested as the non - mosaic tet(o) and tet(w) genes . In contrast, mosaic genes have not yet been reported in faecal samples from bovine and ovine origin or in human saliva . Why they are predominantly found in pigs while as yet unreported in other animals is not immediately clear, though the extensive use of tetracyclines in the swine industry may have contributed to their selection . The advent of high - throughput genomic sequencing has led to an increase in the number of genomes being deposited in sequence databases . Many contain tetracycline resistance genes that are generically labelled simply as tetracycline resistance protein or as tet(m)-like, the designation of which may be a result of automated annotation pipelines . A preliminary search of the ncbi nucleotide database, using tet(o) (accession number y07780) as the query, found that some of these generically labelled tetracycline resistance genes gave a partial match to tet(o). Further examination indicates that some are as yet uncharacterized and unreported mosaic genes, which have been further defined for this review using the nucleotide sequence to determine the crossover points . For example, the tet(m)-like gene (accession number nz_aujs01000017, location 41 62643 545 bp) in the draft genome of dorea longicatena agr2136 from a human faecal sample appears to be a previously unreported variant of tet(o/32/o) (figure 1). Furthermore, the tetracycline resistance genes present in campylobacter jejuni subspecies jejuni 2008 - 894, campylobacter coli 202/04, c. coli 317/04 (accession numbers aioq01000025, ainh01000038 and nz_ainj01000054, respectively) and roseburia intestinalis xb6b4 (accession number fp929050) are also structurally novel variants of tet(o/32/o) (figure 1). The three mosaic genes present in the campylobacter spp . Taking into account these newly defined genes, the total number of mosaic genes reported increases from 30 to 35 (not including those identified via pcr amplification only; table 1) and suggests that other generically labelled tetracycline resistance genes present in the database [e.g. Those labelled as tet(m)-like] could be further classified, helping to understand mosaic gene proliferation and diversity . Our knowledge of the mosaic rpp gene group is steadily increasing since their discovery in 2003, with the majority derived from tet(o), tet(w) and tet(32) and others deriving from tet(m) and tet(s). It is clear that these genes are being under - reported both in terms of experimental detection and also within genomic data . Further work and increased attention on mosaic rpp genes is important if we are to understand the evolutionary selective pressures driving their fixation in bacterial populations and the subsequent effects on resistance and mobile genetic element evolution within their host.
|
Follicular thyroid cancer (ftc) metastasizes most commonly to the lungs and non - cranial bones . Skull and skin are uncommon sites and usually manifest well after the diagnosis of primary malignancy . Metastasis to skull and skin as the presenting feature of ftc is infrequently reported in the literature . A 65-year - old caucasian woman with a history of thyroid nodule presented with the complaint of rapidly growing skull nodules which had been present for 3 years but were stable previously . She denied any history of smoking or head and neck irradiation . On physical examination, she had two non - tender gray cystic lesions one on her left temporal region and the other on the right parietal region . Magnetic resonance imaging of the brain demonstrated 7.13.8 cm and 3.74.5 cm fairly homogeneous, enhancing, relatively well - defined masses centered in the posterior and left anterior lateral calvarium with intracranial and extracranial extensions but without any vasogenic edema or mass effect on the brain . Histopathological studies of the thyroid gland revealed a well - differentiated ftc in the left lobe . She did not have any recurrence of the ftc or metastases during the follow - up period and will be receiving radioactive iodine treatment . Bone and lung are the common sites of metastasis from ftc, but involvement of skull or skin is unusual, particularly as the presenting feature . Metastases from ftc should be in the differential of patients with new osteolytic hypervascular skull lesions or cutaneous lesions in head and neck area . A 65-year - old caucasian woman with a history of thyroid nodule presented to dermatology clinic with the complaint of rapidly growing skull nodules . She reported that the nodules had been present for 3 years but had been stable, so she had not sought medical attention . She denied any fevers, chills, pain, or redness over the nodules, fatigue, weight loss, recent infections, or history of trauma . She admitted to drinking alcohol on social occasions but denied any history of smoking or head and neck irradiation . Her family history was positive for leukemia in her father and melanoma in her mother . She indicated a remote history of thyroid nodule which she reported was benign on biopsy . On physical examination, she had two non - tender gray cystic lesions one on her left temporal region measuring about 5 cm in diameter and the other on the right parietal region measuring about 7 cm in diameter . Laboratory tests revealed a normal tsh of 0.52 iu / ml (reference range 0.35.0 iu / ml) and t4 of 0.68 ng / dl (reference range 0.581.64 ng / dl). A complete metabolic panel including serum creatinine, bun, and hepatic panel was normal . Biopsy was attempted under local anesthesia which revealed possible extension to the bone with vascular origin and hence the patient was referred to surgery for debulking . During surgery, total excision of the nodules could not be performed as there appeared to be skull erosion underneath . An immunohistochemical panel showed positive staining for ck7, thyroglobulin, and hbme-1 while it was weakly positive for pankeratin, suggesting a thyroid origin of these lesions, that is, metastatic ftc (fig . Two large extra - axial enhancing masses with both intra- and extracranial components were seen (figs . 2, 3). Magnetic resonance imaging (mri) of the brain demonstrated 7.13.8 cm and 3.74.5 cm fairly homogeneous, enhancing, relatively well - defined masses centered in the posterior and left anterior lateral calvarium with intracranial and extracranial extensions but without any vasogenic edema or mass effect on the brain (fig . 4). Positron emission tomography (pet) or ct of the skull demonstrated the two skull lesions to be lytic . Two foci of hypermetabolic activity were also seen in the thyroid gland in the left lobe and thyroid isthmus . Thyroid ultrasound showed numerous nodules in both lobes, the largest measuring up to 2.5 cm in greatest dimension . Ct head with and without contrast showing a large, round, relatively smoothly marginated enhancing extra - axial left frontal mass (4.4 cm in anteroposterior diameter and 4.1 cm in transverse diameter) that has eroded and partially destroyed the calvarium and extends into the subcutaneous scalp . Ct head with and without contrast demonstrating a large, round, relatively smoothly marginated enhancing extra - axial mass (measuring 6.8 cm in transverse diameter, 5.9 cm in ap diameter) involving the right and left parietal region, straddling the posterior falx cerebri and superior sagittal sinus . Mri brain revealing a large 7.13.8 cm fairly homogeneous enhancing relatively well - defined mass centered in the posterior calvarium with intracranial extension into the extra - axial space as well as extracranial extension . There is a similar appearing 3.74.5 cm fairly homogeneous relatively well - defined enhancing mass centered in the left anterior lateral calvarium also extending into the extra - axial space as well as extracranially . Histopathological studies of the thyroid gland revealed a well - differentiated ftc in the left lobe, pathological stage pt2nxm1, a 1-cm focus of classic papillary thyroid cancer in the right lobe of thyroid, with a background of multinodular goiter (fig . She underwent intravascular embolization of the feeding blood vessels of her metastatic skull lesions from the external carotid system . Then she underwent resection of the tumor in multiple stages with resection of the posterior and left frontal tumor, and calvaria, followed by cranioplasty . Although she had other unrelated postoperative complications, she did not have any recurrence of the ftc or metastases during the follow - up period, had a normal thyroglobulin of 4.9 ng / ml (reference range 2.840.9 ng / ml), and will be receiving radioactive iodine treatment . It typically presents as a thyroid nodule, either noted by the patient or the physician on routine physical examination or incidentally on routine imaging (1). Vascular invasion is characteristic for follicular carcinoma accounting for more common distant metastasis (5). These metastases occur in 1015% of patients with ftc, with lung and bone being the commonest sites of involvement . Bone metastases from ftc tend to be multiple and often involve sternum, ribs, and vertebrae (3). Skull metastases are uncommon with recent decline in incidence because of early detection and treatment of thyroid cancer; among thyroid carcinomas, these metastases tend to occur more commonly in ftc and have a female preponderance (68). There were only 12 reported cases of skull metastases out of 473 patients of thyroid cancer in one study, accounting for 2.5% of cases (8). Likewise cutaneous metastases from dtc are uncommon with less than 30 reported cases of cutaneous metastases in the english literature until 2010 (9). These cutaneous metastases are more common in head and neck region and can manifest in a variety of histological appearances (1012). However, in most of these cases metastases occurred long after the diagnosis and institution of treatment for ftc and it is extremely unusual to encounter skull and cutaneous metastases as the presenting feature of ftc (3). Skull metastases from ftc most commonly present as a slow - growing soft, painless usually hemispheric and singular lump in the occipital region (6, 7, 12). Unusual presentations include headaches, hemiparesis, exophthalmos, cranial nerve dysfunction, and altered consciousness (13). These skull lesions are osteolytic on skull x - ray, and ct scans generally show homogeneous lesions with density slightly greater than the brain and a highly vascular appearance on angiographic assessment with blood supply most commonly from external carotid system (7, 14). In patients with scalp lesions, pet / ct can be used to determine the biopsy site (5). In patients with established diagnosis of ftc with no documented metastases, evaluation of possible metastatic lesions can be done with (131)i single photon emission ct / ct [(131)i - spect / ct] (15). (99m)tc - mibi scan has been reported to be a highly sensitive technique for the detection of dtc metastases that have lost the capability to uptake (131)i; the combined (99m)tc - mibi scintigraphy and serum thyroglobulin (tg) estimation appear to be an alternative method of radioiodine imaging in cases with dtc and elevated tg (16). Bone metastases uncommonly respond to radioactive iodine therapy and are associated with poor prognosis (7). Surgical approach should be considered as one of the treatments of choice for bone metastasis, if possible, and curative resection of solitary bone metastasis is associated with improved survival (7). Bone defects often require extensive bone resection, bleeding is often profuse during surgical resection, and deaths have been reported from extreme hemorrhage (1, 4, 13, 14). Because of the life - threatening nature of such hemorrhages, preoperative angiographic assessment of these lesions with prophylactic ligation or embolization of feeding vessels is recommended (14). When surgical excision is not possible, internal radiation with i-131 is recommended; external radiation is generally reserved for cases where uptake of i-131 by metastatic foci is poor (8). Thyroid hormone should be administered after complete excision of thyroid gland to suppress endogenous tsh from promoting tumor growth (17). Frequent follow - up examination is recommended and monitoring thyroglobulin measurement can be useful during follow - up (13). Ftc is thought to have the most optimistic prognosis even with metastases to the lymph nodes and lung . However, when combined with distant, especially widespread, metastases, the quality of life is compromised and the overall survival rate significantly decreases (2). In one case series, the mean time from the diagnosis of thyroid tumor until discovery of skull metastasis was 23.3 years (8). Prognosis in case of metastasis is generally poor and the 10-year survival with bone metastases from dtc is reported to be 27% (7). However, mean survival time of 4.5 years was reported with skull metastases in one case series, suggesting even worse prognosis and warranting an aggressive and multidisciplinary approach in this subset of patients (5). A regular follow - up is crucial in these patients for early detection and management of any residual or recurrent metastatic ftc (6). Bone and lung are the common sites of metastasis from ftc but involvement of skull is unusual, especially as the presenting feature . Metastases from ftc should be included in the differential of patients with new oteolytic hypervascular skull lesions or cutaneous lesions in head and neck area (7, 14). The authors have not received any funding or benefits from industry or elsewhere to conduct this study.
|
Although water - bath polymerization is extensively used to process polymethylmethacrylate (pmma), new resins and processing methods are often proposed to obtain better physical and esthetic properties and simplify the technique1,6,8,11,14 . One of the advantages of microwave and visible light polymerization methods is the shorter processing time they offer in comparison to water bath . In addition, light - polymerized resins can be processed directly in the mouth using a portable light - curing device, which simplifies the clinical procedures9 . While denture base acrylic resins polymerized by microwave irradiation and conventional water bath curing systems are composed of pmma6,8, visible light - polymerized resins are similar to composites, having an organic instead of an inorganic filler content . The material is composed of a urethane dimethacrylate matrix plus small amounts of microfine silica . The filler consists of acrylic resin beads (pmma) of varying sizes that become part of an interpenetrating polymer network . Light polymerization occurs by exposure to quartz halogen lamps in the shorter blue 400 to 500 nm wavelength spectrum of visible light . Visible light - polymerized resins were initially proposed for clinical repairs and/or additions in sub - extended removable dentures7, but due to their easy manipulation and fast polymerization, their are now indicated for many clinical situations, such as transitional and interim dentures, complete and removable partial dentures, provisional splints, denture repairs and additions, orthodontic appliances and record bases5,7,9 . Although light - polymerized resins have been used in removable partial dentures, it is not clear whether the presence of a metal framework could interfere with their polymerization, by possibly reflecting the light and affecting important physical properties, such as surface roughness and hardness . These properties are largely investigated because they indicate polymerization characteristics4,7,11,14 and might influence plaque accumulation later on 2,3,10 . Thus, the aims of this study were to investigate whether metal interferes with the surface hardness and roughness of a visible light - polymerized acrylic resin and to compare these values to those of water - bath- and microwave - polymerized resins . The resins used in this study are listed in table 1 . Twelve disc - shaped specimens, 30 mm in diameter and 4 mm thick, were fabricated for each resin according to the manufacturers' directions . All specimens were made using a silicone (optosil, heraeus kulzer, hanau, germany) matrix (30 0.05 mm in diameter and 4 0.05 mm thick). The matrix was flasked in type iii dental stone (herodent soli - rock; vigodent, rio de janeiro, rj, brazil) using standard metal dental flasks (uraby; dlc, so paulo, sr brazil) or plastic flasks (onda cryl; artigo odontolgicos clssico ltd, so paulo, sp, brazil) for water bath and microwave polymerization, respectively . After the gypsum had completely set, the flasks were opened and the matrixes were removed . A separating medium (al - cote, dentsply ltd, rio de janeiro brazil) was applied to the exposed areas of the mold . Before packing the resin, a rectangular (28 mm 8 mm 0.5 mm) insert of co - cr alloy bar (degussa, hanau, germany) was centered at the bottom of each mold . As the size of the metal bars was almost the same as that of the mold cavities, once positioned at the bottom of each mold microwave acrylic resin specimens were polymerized in a microwave oven (continental aw-42, with 2,450 hz frequency and 900w maximum potency; bosch, manaus, am, brazil), according to the manufacturer's directions (3 min at 360 w; 4 min resting and 3 min at 810 w). Specimens polymerized by hot water bath were processed in an automatic polymerization unit (termotron p-100; termotron piracicaba, sp, brazil) at 74c for 9 h. once processed, all flasks were allowed to bench cooling for 2h . The resin samples were ground with water - cooled 320-, 400-, 600- and 1200-grit silicon carbide papers (carbimet; buehler, lake bluff, il, usa) in a polishing machine (arotec apl-4; so paulo, sp, brazil) followed by polishing with cloths and 1-m diamond suspension (metadi diamond suspension; buehler). Next, they were ultra - sound cleaned (thornton - inpec eletrnica ltda, vinhedo, sp, brazil) for 2 min and then immersed in distilled water at 37c for 12 h to release residual monomers6,12,14 . Light - polymerized resin specimens were prepared using a transparent matrix, consisting of an acrylic resin plate containing a circular hole measuring 30 0.05 mm in diameter and 4 0.05 mm thick . First, a co - cr framework was placed at the bottom of the matrix and then the light - polymerized resin was inserted in the matrix . This assembly was put into a light box (edg lux; edg equipamentos e controles, so paulo, sp, brazil) containing four 75 w halogen lamps . The resin was polymerized for 6 min, according to manufacturer's instructions . After processing, the same finishing, polishing and cleaning procedures used for heat and microwave polymerized acrylic resins surface roughness was determined using a mechanical profilometer with a 2-m radius tip under a measuring force of 0.7 mn and accurate to 0.01 m (surfcorder se 1700, kosaka, tokyo, japan) calibrated at sample length of 0.25 mm, spread of 2.0 mm and speed of 0.5 mms . Six readings were performed on each specimen and an average (ra) was determined . These profilometric traces were taken from the edge of specimen, in the middle and at its bottom.12 knoop hardness was assessed using a microhardness tester (shimadzu hmv-2000, shimadzu corporation, kyoto, japan). Knoop penetrations were made on the acrylic surface of each sample at distances of 50, 100, 200, 400 and 800 m from the co - cr metal bar (figure 2). Knoop hardness means were analyzed by two - way anova with 2 factors: acrylic resins and distances . The acrylic resin groups were compared using tukey test and distances were compared by kruskal - wallis test . Means and standard deviations for acrylic resin surface roughness m) are presented in table 2 . The visible light - polymerized resin (triad) showed the highest means (p<0.05), but the metal alloy did not interfere with surface roughness . . Means and standard deviations for knoop hardness (kg / mm) of acrylic resins at several distances from the metal are described in table 3 . Comparisons between acrylic resins showed that the visible light - polymerized resin (triad) exhibited significantly higher means (p<0.05). However, no differences in hardness values at several distances from the metal alloy were found . Mean followed by different letters are statistically different (p<0.05) lowercase letters indicate differences between acrylic resins and uppercase letters indicate differences between distances from metal . This technique is considered to be time - saving as it does not require cast inclusion, is non - toxic and biocompatible . It is therefore indicated for using in many clinical situations, such as complete and removable partial dentures9 . However, little is known about the influence of metal alloys on the polymerization process and on important physical properties, such as hardness and roughness . In this study, a visible light - polymerized resin was compared to microwave- and heat - polymerized acrylic resins, which have similar composition and surface characteristics6,8 . Smooth surfaces do not readily retain food debris, epithelial cells and bacteria, thus facilitating oral hygiene, reducing the risk of plaque formation and preventing negative effects on periodontal tissues3 . Therefore, the roughness of intraoral surfaces helps determining their colonization by different microorganisms because retention preferably occurs on rough surfaces, as they provide protection against shear forces2 . Acrylic resin roughness is dependent on the polishing method used2 . In this study, polishing was done with 360-, 400-, 600- and 1000-grit abrasive papers, resulting in roughness values below 0.2 m, which is considered clinically acceptable for preventing plaque accumulation2 . Although the same polishing procedure was carried out for all resins, higher roughness means were found in the light - polymerized resin group (0.11 0.02 m). This result may be explained by the large amounts of inorganic compounds in this resin, which were probably exposed during polishing procedures, causing irregularities on the resin surface . The surface roughness means of microwave- (onda - cryl) and water - bath - polymerized (clssico) resins did not differ statistically (p>0.05), probably because of the similarity of their composition . 12 (2004), who investigated the influence of denture cleansers on the surface roughness of heat- and microwave - polymerized resins . However, the findings of the present are in contrast with those of ulusoy et al.15, who reported higher roughness means (0.31 m). It is likely that these differences can be due to the polishing method used in each study because ulusoy et al.15 polished the specimens on a bench lathe using a roller brush with pumice / water paste, followed by a wet polishing wheel and a chalk . In contrast, in the present study, the specimens were polished with materials of decreasing granulation,(up to 1-m diamond particles). The other two resins (onda cryl and clssico), which do not have inorganic compounds, had lower roughness . Hardness is a property used to predict the wear resistance of a material and its ability to abrade opposing dental structures1 . Therefore, surface scratching can be determined by its knoop hardness because its weakness explains why the surface is at risk of roughening during professional cleaning or even during habitual oral hygiene procedures10 . This test can also be used to verify the efficacy of polymerization . In this study, it was used to assess resin polymerization around a metal alloy . The visible light - polymerized resin presented the highest knoop hardness, which is in accordance with khan et al . 7 (1987), who compared triad (dentsply inc .) Hardness with that of a water - bath - polymerized resin . This could be explained by the inorganic content of the light - polymerized resin (silica)9, which increased the resistance of this resin to the microhardness indenter1 . Water - bath - and microwave - polymerized resins had similar knoop hardness means, which are in agreement with many authors4,11,12,14 . No differences between 50, 100, 200, 400 and 800 m distances from the metal were found in any of the acrylic resins evaluated (p>0.05). The absence of significant differences suggests that light emission and polymerization processes were not affected by the presence of metal . These results are in consistent with those of braun et al . 4 (1998), who compared water bath- and microwave - polymerized resins with respect to the hardness means at pre - determined distances from a metal alloy . In this study, roughness and knoop hardness results indicated that triad has clinically acceptable properties and its polymerization was not affected by the presence of metal . However, further studies about the clinical behavior of visible light - polymerized acrylic resins should be conducted . Within the limitations of this in vitro study, it may be concluded that the presence of a metal framework did not interfere with the roughness and knoop hardness of the tested visible light - polymerized (triad), microwave - polymerized (onda cryl) and water - bath - polymerized (clssico) acrylic resins, indicating that all materials can be used in removable partial dentures.
|
There is limited data upon skin cancer screening program in western asia region and especially iran . The two most common variants are basal cell carcinoma (bcc) and squamous cell carcinoma (scc); regardless of their low mortality rates, these tumors can provoke severe consequence as a result of their treatment . The third most frequent skin cancer type, malignant melanoma (mm), has a more destructive behavior and accordingly a poor prognosis; malignant melanoma accounts for approximately 75% of all deaths from skin cancer . Skin cancer screening includes the complete cutaneous examination and 2 - 3 minute visual inspection of the skin . There is strong data that whole - body clinical skin examination reduces the incidence of thick melanoma and, as a result, screening would reduce melanoma mortality . In us and however, some studies debate on the effective and beneficial method of skin cancer screening as mass screening or high risk group screening and the real impact of skin cancer screening result on the society health . In iran, there are limited studies about prevalence and incidence of skin cancers . Therefore, this study was planned as a pilot one - week skin cancer screening campaign in tehran, iran to evaluate its profit and failure and design further large - scale screening program more definitely . This study was planned as a skin cancer screening campaign in the public health centers of shahid beheshti medical university in a one - week period in tehran, iran . We applied for the collaboration of the public health centers in tehran as the location of this screening program . The usual services provided in these centers include prenatal and pediatric care, women health, vaccination, health education, environmental or occupational health, etc ., due to distribution of these centers in different areas of tehran, we discussed with the health deputy of the university for the collaboration of these health centers in this screening campaign and finally, thirty one public health centers were selected in different areas of tehran . Physicians and health staffs of these health centers were volunteered to cooperate in this study . Due to cultural and religious belief in our country, some female participants might be reluctant to be examined by male physicians . In this regard, we select a male physician and female health staff or vice versa in each center to avoid any limitation in examination of the female participants . Practical information upon skin cancer risk factors and its early symptoms or signs along with any needed guideline of this screening project provided to them in a two - day course by an expert board certified dermatologist . An illustrated educational pamphlet in the case of the risk factors especially sun exposure, ways of prevention and early detection of skin cancer published and distributed in the health centers for general patient education . We invited all people over 40 years old to the mentioned health centers for complete skin examination in a one - week period on october 2008 . We emphasized in these pamphlets and brochures that any bizarre or asymmetric skin lesion especially with change in shape, color and size might be important for screening . Moreover, it has been advocated that any skin erosion or ulcer remained unimproved after one month should be examined by physicians . The participants would have undergone the whole - body skin examination by the trained physicians or health staffs . Any lesion with bizarre or asymmetric shape, uneven color, increasing size, resistant ulcers or erosions considered as suspicious . Patients with any suspected lesions were referred to the specialized dermatology clinics of shahid beheshti university of medical sciences for further evaluation of their lesions . All the participants were instructed about the study, and they signed the informed consent forms . A board certified dermatologist performed the whole - body skin examination for the referred patients and further evaluation particularly skin biopsy was done whenever needed . The skin examination was done by visual inspection and use of hand lens in the setting of proper lighting . The alarming signs including bizarre or asymmetric shape, uneven color, increasing size, resistant ulcers or erosions were considered for decision to perform skin biopsy . We could not use dermatoscope because of some limitation in the facilities . In the case of confirmed malignancies, the suitable treatment would be provided for the patients in the dermatology ward or referred to the proper department . All the data registered and the related questionnaires were completed . After gathering the data, statistical analysis was performed using the statistical software spss 16.0.0 . In a one - week period of screening, 1314 patients, 194 males (14.8%) and 1120 females (85.2%), with mean age of 51.81 10.28 years were attended the allied health centers and underwent the whole - body skin examination . Regarding the considerable attendance of female volunteers, most of them had indoor occupation especially being housewives . We had the data of the number of melanocytic nevi in 92.9% of the participants . 25% of them had less than 3 melanocytic lesions and 25% had more than 10 lesions . Less than one percent of the participant had the positive personal history of skin cancer . We have found the personal history of non - skin cancers in 14 (1.1%) of participants . These were ovarian, prostate, breast and gastrointestinal carcinoma . Physicians found suspected lesions in 182 (13.85%) of participants [142 (78%) females and 40 (22%) males] with possible diagnosis of bcc, scc or malignant melanoma which were located mostly on the head, neck and trunk [table 1]. These participants with suspected lesions were referred to the allied dermatology clinics of the university . All these patients underwent the whole - body skin examination by a board certified dermatologist and skin biopsy performed in 115 patients for the histopathological examination . Table 2 shows the final diagnosis of suspected malignant skin lesions referred from the health centers . Clinical diagnosis of suspected lesions by primary physician final diagnosis of the suspected lesions the diagnosis of skin cancer was finally confirmed by histopathology evaluation in 15 (1.14%) patients out of 1314 volunteers who participated in this skin cancer screening program [figures 1 and 2]. These malignancies include 10 (0.76%) cases of bcc, 2 (0.15%) cases of scc and 3 (0.23%) cases of malignant melanoma . Two patients with bcc had positive personal history of breast and gastrointestinal cancers but no family history of skin and non - skin cancer found in these patients . Thirty six (2.74%) cases of dysplastic nevus were also diagnosed in this study . In the case of confirmed malignancies, the proper treatment provided for the patients in the dermatology ward or surgery department . A morphoeic basal cell carcinoma found on the eyebrow of a middle - age man squamous cell carcinoma on the ear in an elderly man we found no significant difference in the number of common moles, multiple freckling, family history of skin and non - skin cancers between skin - cancer diagnosed patients and other participants . Outdoor occupations and personal history of non - skin cancers was significantly higher in skin cancer diagnosed patients (p <0.05, chi - square test). Early diagnosis of skin cancer is very crucial to improve the prognosis, for best treatment results, and increase the quality of life of the patient . In this regard, there are many studies upon skin cancer screening with valuable results upon the importance of early detection of skin malignancies . However, there is no strong evidence to establish whether there is a decrease in mortality due to regular physical examination of the skin . In this study, we find 15 cases (10 bbc, 2 scc and 2 malignant melanoma) of skin cancer . Most of the participants in this campaign were housewives women and this could be due to the working hours of the public health centers that caused less attendance of male participants or those with outdoor jobs . If we could extend the active daily hours of screening to the evening, we could probably detect more skin cancers . Regarding the high population of tehran, it would better screen more people or extend the campaign period to avoid this selection or estimating bias . However, this campaign was planned as pilot skin cancer screening program in tehran and its results and limitation could help us to design the large - scale screening program more definitely . There are different methods of skin cancer screening including population - based or targeted screening . Planning of a population - based or mass skin cancer screening program needed considerable cooperation of different sectors including dermatology or health departments and it need substantial facilities for the project setting, announcement, training of the volunteered health staff, their remunerations and further diagnostic or treatment measure for the participants . Well - trained physicians should be employed in order to reduce the false positive diagnosis and it may have great financial impact on the health care system . Moreover, the current evidence seems to be insufficient to assess the balance of benefits and harms of mass screening for skin cancer . Therefore, it might be more practical to perform the targeted screening programs for the high - risk groups such as patients with organ transplantation or those with the history of skin cancer or outdoor occupations . The media campaign increased the population awareness of skin cancers, promoted effective sun protection and make known the dangers of excessive uv - exposures . More educational activities for both patients and physicians regarding the skin cancer risk factors and their early signs and symptoms might be more beneficial and cost - effective to decrease the skin cancer mortality and morbidity . To the best of our knowledge, there was no similar study in iran to perform skin cancer screening and this study provides us useful information upon the profit and failure of a screening program . Another limitation of this study was lack of comparison between different methods of skin cancer screening such as targeted or mass screening to provide more exact data upon the efficacy and cost - benefit of different methods of skin cancer screening . Therefore, further controlled study could be beneficial to elucidate the more practical and cost - effective method of skin cancer screening in our country . This study gives us many practical clues to plan and perform large - scale skin cancer screening better.
|
Early failure of fistulas due to thrombosis or inadequate maturation is a barrier to increasing the prevalence of fistulas . Despite the benefits of avfs as a form of vascular access in end stage renal disease (esrd) patients, considerable time is required for the fistula to mature and suitably develop into a functional format maturation rate after autogenous avf depends on various factors such as age, body mass index (bmi), venous and arterial diameter, venous distensibility, and arterial elasticity . The main cause of avf failure is outflow stenosis as a result of vascular intimal hyperplasia and thrombosis . This formation of neointimal hyperplasia and thrombosis may be initiated by activated platelet function, endothelial cell injury and vascular smooth muscle cell proliferation, which may occur due to unphysiologic vascular anastomosis . In view of these postulated mechanisms of avf failure, furthermore, only a few studies have addressed the safety of aspirin use after avf creation . Van der linden et al . Demonstrated that venous potential distensibility was significantly correlated with functional maturation, especially in the group of patients with vein diameter 2 mm . As a result of this study, they concluded that venous line distensibility was a better predictive factor than vein size . There is no report about the effects of combination therapy after avf creation using clopidogrel in combination with prostacycline analog as a potent vasodilator agent after autogenous avf creation . On the basis of these considerations, we performed a study to test the hypothesis that clopidogrel as an irreversible antiplatelet and oral prostacycline analog as an arterial vasodilator and additional antiaggregant drug may increase venous distensibility and arterial elasticity and would prevent primary avf failure in hemodialysis patients with diabetes mellitus . We excluded 289 patients [table 1], and 96 patients met the study criteria for enrollment . Major exclusion criteria of the patients to detect the quality of the brachial artery (ba) and a venous line, doppler usg was used . Preoperative venous and arterial spectral usg showed that there were no differences when we compared arterial and venous quality and diameter . The randomization was stratified according to the medical center with a permuted block scheme, with a block size of four and an equal allocation . Eligible participants were called to the coordinating center to obtain a randomization protocol, which corresponded to a specific medication . Neither the details of the randomization sequence nor the identity of the medication assigned was known to the participant or any personnel at the participating sites . The treatment was initiated 710 days prior to the scheduled access surgery and continued postoperatively . After randomization, the two groups of subjects are followed in exactly the same way, and the only difference between the care with which they receive drugs, outpatient visits and follow - up calls should be those intrinsic to the treatments being compared . In the first group of patients, 710 days prior to the surgery, we started clopidogrel (75 mg daily) and an oral prostacycline analog (200 mg orally daily). Patients in the control and study group were operated by two surgeons using the same technique and same suture materials (6/0 polypropylene suture). To provide the purse or narrowing effect of suture, we noticed that the two surgeons operated on the same number of patients in both the groups . Clopidogrel and prostacycline were administered orally prior to surgery, and continued during the year . Data collection was performed at baseline, 4 weeks after fistula creation, and monthly thereafter until ascertainment of fistula suitability . Study medication was discontinued when there was a sign of fistula thrombosis confirmed by vascular surgeons . In a normally developed fistula, there is a continuous thrill from the anastomosis all the way centrally along the outflow vein . The thrill gradually decreases in intensity from the anastomosis centrally . In the absence of a stenosis we defined the maturation of avf when the mean blood flow from avf was more than 300 ml / min . And a minimum arterial end diastolic velocity was 70 cm / s by sonographic examination for both groups . Venous and arterial line diameters were calculated using sonography . If there was no sign of restriction of blood flow when the patients underwent hemodialysis, we described the hemodialysis access to be good . Primary patency was defined as the interval from avf creation to abandonment due to thrombosis or low flow, inadequate for sufficient hemodialysis . Early patency or failure was defined according to a thrill and/or bruit 4 weeks after the surgery . The antero - posterior diameter of ba was measured in the transverse dimension on gray scale sonography . Peak systolic velocity and end - diastolic velocity of the ba were measured in a representative waveform in each patient [figure 1]. The resistive index was a measure of the downstream flow resistance and was calculated as the difference between the respective measurements obtained after fist release (post) and during fist clenching (pre). The primary outcome measure was final avf failure, which required the creation of a new avf . First, we investigated the need of re - intervention after avf due to thrombosis or occlusion during the follow - up period . Suitability was defined as use of the fistula at a dialysis machine blood pump rate of 300 ml / min . Or more during 8 of 12 dialysis sessions . Doppler ultrasonography (in a gray scale) shows the brachial artery and its diameter in a patient with insulin - dependent diabetes mellitus and peak velocity the statistical program, spss version 13 (spss, chicago, il) was used to analyze the data . Data are presented as mean standard error for continuous variables and as percentages for categorical variables . The t - test was used when the means of two groups were compared . On the basis of intention - to - treat principles, all other participants were monitored according to the research protocol for whom study medications were continued . All hypothesis tests were conducted by using a significance level of 0.05 (two - sided). For evaluation of the relationships between the avf maturation and independent variables, differences between matured and failed groups were tested with the wilcoxon rank - sum test for continuous variables . Multivariate cox proportional hazards models were used to determine factors associated with reduced avf patency . Test results were presented as hazard ratios with 95% confidence intervals (cis), and two - sided p <0.05 was considered statistically significant . The statistical program, spss version 13 (spss, chicago, il) was used to analyze the data . Data are presented as mean standard error for continuous variables and as percentages for categorical variables . The t - test was used when the means of two groups were compared . On the basis of intention - to - treat principles, all other participants were monitored according to the research protocol for whom study medications were continued . All hypothesis tests were conducted by using a significance level of 0.05 (two - sided). For evaluation of the relationships between the avf maturation and independent variables, differences between matured and failed groups were tested with the wilcoxon rank - sum test for continuous variables . Multivariate cox proportional hazards models were used to determine factors associated with reduced avf patency . Test results were presented as hazard ratios with 95% confidence intervals (cis), and two - sided p <0.05 was considered statistically significant . The mean ages were 54.23 2.6 and 55.8 2.8 years in group 1 and 2 respectively (p> 0.05). There were no significant differences in covariables between groups when we compared patient characteristics, blood pressure, blood ldl, calcium, and phosphate levels [table 2]. We did not detect any complication during the treatment period such as bleeding in group 1 patients . Three patients complained from a temporary headache on the 1 day of oral prostacycline analog administration . All patients were taking study medication prior to surgery and did not have to be discontinued prematurely . Four weeks after the surgery, avf maturation failure developed in 14 patients (30.4%) in placebo group and in 4 patients (8%) in clopidogrel and oral prostacycline analog group (p = 0.001). Fistula maturation and survival has been confirmed using physical examinations and by a doppler usg every month for each patient . The kaplanmeier survival curve showed avf maturation and survival results in figure 2 [table 3]. The mean maturation time of avf was 38 6.5 day and 53 12.8 day in clopidogrel plus oral prostacycline analog and placebo groups, respectively (p = 0.023). Patients treated with clopidogrel and oral prostacycline analog had a increased avf survival (p = 0.001). In the placebo group, early avf failure was detected in two patients due to venous line thrombosis . Characteristics of patients in the two groups demonstrates the survival rate of arteriovenous fistulas (avfs) during the study period in group 1 and group 2 . Meier estimates of the cumulative incidence of loss of primary avfs patency in both groups . The median duration of patency was 5.8 months (95% confidence interval (ci): 4.37.1) in the group 1 (study group) and 4.3 months (95% ci: 3.65.4) in the group 2 (placebo group) clinical outcomes at the end of the study the preoperative mean diameter of ba was 4.3 1.5 mm in clopidogrel plus oral prostacycline analog group and 4.04 1.3 mm in placebo group (p = 0.94). After surgery, usg showed that the mean diameter of ba was 6.3 1.4 mm and 4.74 0.9 mm in the study and placebo group respectively (p = 0.002). The preoperative mean diameter of the vein in the study and placebo groups were 3.1 0.8 and 3.04 0.7 mm (p = 0.96). In the postoperative period, the corresponding values were 5.4 0.9 and 4.01 0.3 mm respectively (p = 0.024). Blood flow from avf was 352 94 ml / min . In placebo group and 604 125 ml / min . Doppler usg examination of avf showed that a minimum arterial end - diastolic velocity has been detected at 116 14 cm / s in group 1, 3 months after the surgery . However, this value was 72 21 cm / s in the placebo group (p = 0.036). Overall, the hazard ratio for primary avf failure was 0.82 (95% ci: 0.310.94). During the follow - up period, from 4 weeks to 6 months, tenderness of the extremity, edema, and hematoma occurred in nine patients in study group, and in six in placebo group . Hemodialysis was successfully performed in 36 patients (72%) in the study group and 22 patients (47.8%) in the placebo group at the end of study (p = 0.001). The hemodialysis period in group 1 was significantly longer and more successful than in the placebo group (p = 0.001). Multivariate logistic regression analysis revealed that avf maturation and survival rate was more than in study group (odds ratio 2.27; 95% ci: 1.078.50; p = 0.001). The survival and maturation time of avf in study group and placebo group has been summarized in figure 3(p = 0.001). The flow diagram demonstrates the number of patients who were screened and selected for research [figure 4]. During follow - up this graphic demonstrates the cumulative incidence for the percent of primary end points attributable to flow monitoring compared to total end points in each treatment group . End points due to flow monitoring in the group 1 (study group) and group 2 (placebo - treated control group) are compared to total end points demonstrates the comparison of the mean avfs' flow diagram (left columns) and the differences of arterial end - diastolic velocity (right columns) between the groups . In the early period, we detected high blood flows and lower arterial velocity in study group when we compared groups no bleeding episode such as intracranial hemorrhage in gastrointestinal tract was recorded during the active treatment period . There were no differences between baseline and follow - up hematocrit values or changes in recombinant human erythropoietin doses during the study period for either group . In this prospective double - blind research, we presented our experiences of a new combination therapy and its efficacies on avf access after surgery in our esrd population . According to the study, clopidogrel in combination with oral prostacycline analog as an arterial vasodilator can be used to provide early avf maturation in esrdp with diabetes . According to previous reports, the size and quality of the arterial and venous access and distensibility after avf creation play important roles . Therefore, we decided to use our combination therapy to provide more dilated and elastic arterial and venous access after avf creation . Thus, blood flow from the fistula increased significantly in patients who were given a combination therapy than in patients who were given placebo . Our study findings support the importance of distensibility and quality of vessel access . As we know that after avf creation, anastomotic or juxta - anastomotic stenosis is the most common cause of a fistula failing to mature . The stenosis most likely occurs because of operative trauma . In case of transposed vein fistulas, the loss of vasa vasorum in the mobilized portion of the vein may also contribute to causation of stenosis . Second, there is the element of neo - intimal hyperplasia . Because of a large pressure gradient between arterial and venous circulation, blood accelerates while passing from the artery to the vein causing turbulent flow that is considered responsible for endothelial damage as a result of micro - trauma . In addition, unfortunately, some patients have a small arterial and/or venous access diameter . Therefore, effective hemodialysis can be impossible due to occlusion and/or stenosis of the venous or arterial line . It is shown that venous distensibility is a major problem after avf creation . In van der's study, it was demonstrated that venous distensibility was significantly correlated with avf maturation, especially in patients with vein diameter 2 mm . Thus, if there is no suitable venous distensibility, avf maturation and survival will be a problem . According to this hypothesis, we believe that the effective vasodilatation can be required in these particular groups for early avf maturation and longer survival . There have been a few small trials evaluating pharmacological agents aimed at reducing the early thrombosis rate .. these trials utilized the antiplatelet agents, aspirin, sulphinpyrazone, and clopidogrel and varied in size from as few as 5 patients up to 250 patients . Andrassy et al . Compared patients given aspirin for 4 weeks with placebo; the thrombosis rate in the aspirin group was 4% compared with the control group of 24% . In another study, kooistra et al . Demonstrated that a low - dose aspirin could not prevent thrombovascular accidents in hemodialysis patients during treatment with recombinant human erythropoietin . 's study, it was demonstrated that there was a statistical significance when compared to fistula thrombosis rates in clopidogrel groups versus placebo groups (12% vs. 19%). Studies using sulphinpyrazone showed variable results, but were underpowered with the largest study enrolling only a small number of patients . Thus, although there is some data to suggest that antiplatelet agents may increase the primary patency of avf, the limited evidence base and the uncertainty regarding the choice of agent have not supported the widespread use of antiplatelet agents in the prevention of avf thrombosis . However, for the first time, our study showed the effects of clopidogrel in combination with oral prostacycline agent on autogenous avf creation . We know that autogenous avf is the preferred hemodialysis access and is associated with lower morbidity and mortality than avgs . However, 2060% of fistulas fail to mature sufficiently to support dialysis . Thus, the high rate of maturation failure is a major unsolved problem, yet . The costs and morbidity problems due to avf maturation failure among hemodialysis patients are still reported worldwide . Vascular access surgeons are faced with the same challenge all over the world choosing the best vascular access type for chronic hemodialysis . Size and quality of the vessels seem to be the important factors known . Despite the experiences of avf in esrdp, considerable amount of time is required for the fistula to mature and suitably develop into a functional format . A number of authors and dember et al . Have maintained that outflow venous stenosis and vascular intimal hyperplasia were the main causes of avf failure . Avf thrombosis resulting from neointimal hyperplasia can be initiated by activated platelet function, endothelial cell injury, vascular smooth muscle cell proliferation, and unphysiologic vascular anastomosis . In view of these postulated mechanisms of avf failure, possible clinical benefit of antiplatelet therapy has been proposed for prevention of avf failure . In particular, aspirin, the most widespread antiplatelet drug, has been evaluated as prophylaxis for avf failure in several studies, mainly among the use of avg . In a study, the authors examined the efficacy of combination therapy of aspirin and clopidogrel for prevention of arteriovenous graft failure, but this study was stopped before completion because the prevalence of hemorrhagic complication was significantly higher in the intervention group . In the study group, only 28% of patients required re - intervention during the 1-year follow - up period . However, 52% of placebo group needed re - intervention due to avf failure . During the aspirin therapy, the most important problem is hemorrhage in hemodialysis patients than in the general population because hemodialysis patients are more likely to have platelet dysfunction and they receive intermittent anticoagulant therapy during hemodialysis sessions . However, clopidogrel is tolerated by the patient and is not a cause of gastrointestinal bleeding . Thrombosis or severe occlusion of autogenous avf can be seen within the first several weeks following surgical creation, or inadequate maturation of the vein . Some of the previous studies have indicated that the frequency of avf failure can be reduced with antiplatelet agents; but in other studies the authors maintained antiplatelet therapy did not affect avf maturation and survival . They also concluded that vessel dilation was not needed for adequate blood flow except at the smaller diameters . The successful results of our analysis suggest that to inhibit avf failure, daily administration of 75 mg oral clopidogrel and arterial prostacycline analog administration may be initiated 710 days prior to avf creation . In's trial suggested that the use of antiplatelet was not associated with significant risk reduction in access failure . Kaufman demonstrated no change in the risk of graft thrombosis with aspirin plus clopidogrel therapy . The author reported that in chronic hemodialysis patients there was a trend toward increased or did not change thrombosis rate of avf using aspirin therapy . In fiskerstrand et al . 's study, 2 out of 6 patients in the ticlopidine group compared with 5 out of 9 in the placebo group, developed fistulae thromboses in 1 month . In the previously published study by grntoft et al ., there were only 2 out of 19 patients who received treatment developed for fistulae thromboses compared to 8 out of 17 on placebo . The results of adequacy for avfs developed sufficiently to be used for dialysis in 46.5% of patients . Allon and robbin have suggested that the higher adequacy rate could be provided in upper arm location and multidisciplinary team approach to vascular access by the surgeons, nurses, and radiologists . The arterial diameter, elasticity, and the venous line distensibility are the main factors of fistula maturation . In publications from dac consortium, followed the patients for a long time (approximately 4 years) but we could follow the cases for a year only . Our therapy model may be provided more distensible and large size venous line, and more elastic arterial access . Our study differences may be related to surgical experiences, patients' age, smoking history, bmi, patients' arterial and venous diameters, and distensibility . Multiple individuals are involved in the management of vascular access, including nephrologists, access surgeons, radiologists, dialysis nurses, and the patient . Achieving optimal vascular access outcomes requires agreement on a common set of goals by all these individuals, close collaboration, and good communication . However, primary avf failure remains a major problem for hemodialysis patients worldwide . According to our study, it is observed that prophylaxis of vascular access thrombosis needs to start earlier in the hemodialysis patients . Clopidogrel and oral prostacycline analog, which begins 710 days prior to avf creation and continuing during follow - up period seems to be effective and safe, and inhibit primary avf failure with acceptable side effects in hemodialysis patients.
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.