text
stringlengths 0
868k
|
|---|
Tension - free vaginal tape (tvt) is now the treatment of choice for female stress urinary incontinence because of its ease of use, minimal invasiveness, and high success rate . Mesh in the bladder or urethra following midurethral sling has been reported to occur in somewhere between less than 1% to 6% of patients and can result from intraoperative needle penetration or tape erosion [2 - 4]. Even though the trans - obturator tape (tot) procedure has less risk of lower urinary tract injury, surgeons should handle with care to prevent this complication . Bladder injury that is recognized during the operation is not usually related to long - term sequelae . However, when bladder injury is missed or the mesh erodes into the bladder or urethra, patients might suffer from painful urination, recurrent urinary tract infection, irritative or obstructive symptoms, and hematuria . Since the first case of urethral mesh erosion was reported in 2001, several case series have provided various techniques to manage this difficult complication [7,8 - 10]. Intravesical or intraurethral mesh can be removed by open surgery (cystorrhapy or urethrolysis and urethroplasty) or endoscopic surgery . The objective of this study was to determine the efficacy and complication associated with transurethral removal (tur) of the intravesical or intraurethral mesh following midurethral sling procedures . A retrospective chart review was performed for women who had undergone transurethral surgery for bladder or urethral mesh between january 2002 and december 2010 . A total of 23 consecutive women were identified, and their demographics, midurethral sling procedures, and removal procedures were reviewed . The surgical outcomes and complications were evaluated . To remove the mesh, transurethral resection with an electrode loop (tur - e) was used until march 2010, when a holmium laser became available in the study center . Thereafter, transurethral resection with a holmium laser (tur - h) was performed . The usual surgical techniques of tur - e and tur - h are described below . Tur - e was performed for 15 women with intravesical mesh and 1 woman with intraurethral mesh . With the patient under spinal anesthesia in the lithotomy position, a urethro - cystoscopic exam was performed with a 25 fr resectoscope and a 0, 30, and 70 degree telescope . When the stone was attached to the mesh, lithotripsy was performed with a lithoclast . The mesh was then resected with an electrode loop until it was not visible or the perivesical fat was reached . The resected mesh was removed by foreign body forceps . After confirming that no mesh remained in the bladder or urethra a 16 fr foley catheter was inserted and left in place for a median of 6 days (range, 3 to 29 days). The median operation time was 57 minutes (40 to 135 minutes), and the median hospital stay was 8 days (4 to 36 days). Seven patients were treated with the tur - h procedure with a rigid scope: 5 cases of intravesical mesh and 2 cases of intraurethral mesh . The surgery was similar to that for tur - e except a holmium laser was used . When the laser could not cut deeply enough and strings or a portion of the mesh remained, the remnant was evaporated by the laser . The median energy used was 4.3 kj (range, 0.7 to 14.9 kj). After confirming that no mesh remained in the bladder or urethra, a 16 fr foley catheter was inserted and left in place for a median of 1 day (range, 1 to 2 days). The median operation time was 125 minutes (range, 30 to 180 minutes) and the median hospital stay was 4.5 days (range, 3 to 10 days). Three women required concomitant transvaginal surgery for remnant mesh after tur - h: 2 with intravesical mesh and 1 with intraurethral mesh . A midline vaginal incision was made and submucosal dissection was performed with mezenbaum scissors . After identifying the mesh, it was grasped with kelly forceps and further dissection proceeded toward the exposed side while carefully maintaining traction on the mesh . After exposing the cut edge of the mesh through the vaginal incision, the whole exposed portion of the mesh was resected and removed . The wound was closed layer - by - layer with 3 - 0 vicryl sutures . A foley catheter was left in place for a median of 14 days (range, 6 to 21 days). The median operation time was 215 minutes (range, 180 to 220 minutes) and the median hospital stay was 8 days (range, 6 to 22 days). Tur - e was performed for 15 women with intravesical mesh and 1 woman with intraurethral mesh . With the patient under spinal anesthesia in the lithotomy position, a urethro - cystoscopic exam was performed with a 25 fr resectoscope and a 0, 30, and 70 degree telescope . When the stone was attached to the mesh, lithotripsy was performed with a lithoclast . The mesh was then resected with an electrode loop until it was not visible or the perivesical fat was reached . The resected mesh was removed by foreign body forceps . After confirming that no mesh remained in the bladder or urethra a 16 fr foley catheter was inserted and left in place for a median of 6 days (range, 3 to 29 days). The median operation time was 57 minutes (40 to 135 minutes), and the median hospital stay was 8 days (4 to 36 days). 1 . Seven patients were treated with the tur - h procedure with a rigid scope: 5 cases of intravesical mesh and 2 cases of intraurethral mesh . The surgery was similar to that for tur - e except a holmium laser was used . When the laser could not cut deeply enough and strings or a portion of the mesh remained, the remnant was evaporated by the laser . The median energy used was 4.3 kj (range, 0.7 to 14.9 kj). After confirming that no mesh remained in the bladder or urethra, a 16 fr foley catheter was inserted and left in place for a median of 1 day (range, 1 to 2 days). The median operation time was 125 minutes (range, 30 to 180 minutes) and the median hospital stay was 4.5 days (range, 3 to 10 days). Three women required concomitant transvaginal surgery for remnant mesh after tur - h: 2 with intravesical mesh and 1 with intraurethral mesh . A midline vaginal incision was made and submucosal dissection was performed with mezenbaum scissors . After identifying the mesh, it was grasped with kelly forceps and further dissection proceeded toward the exposed side while carefully maintaining traction on the mesh . After exposing the cut edge of the mesh through the vaginal incision, the whole exposed portion of the mesh was resected and removed . The wound was closed layer - by - layer with 3 - 0 vicryl sutures . A foley catheter was left in place for a median of 14 days (range, 6 to 21 days). The median operation time was 215 minutes (range, 180 to 220 minutes) and the median hospital stay was 8 days (range, 6 to 22 days). Patient demographics and the clinical characteristics of a total of 23 women are described in table 1 according to the removal technique . Sixteen women had the tur - e procedure and 7 women had the tur - h procedure . At the time of surgery, the median age was 51 years (range, 40 to 67 years). The median period between the midurethral sling and mesh removal was 31.3 months (range, 2.2 to 247.6 months), and the median follow - up period was 2.1 months (range, 0.3 to 35.9 months) after mesh removal . The previous midurethral sling procedures were 11 transobturator slings, 8 retropubic slings, 1 single incision sling, and 3 which were not identified . Most women presented with multiple symptoms, including dysuria, hematuria, and irritative or obstructive urinary symptoms . Table 2 summarizes the preoperative findings, surgical outcomes, and complications for all 23 cases . Overall, 6 women (26%) had a mesh remnant after transurethral surgery: 1 woman (6.2%) after tur - e and 5 women (71.4%) after tur - h . The woman who had a mesh remnant after tur - e underwent repeat tur - e for the remnant, and no mesh remained on the follow - up cystoscopic exam . Of the 5 women who had remnant mesh after tur - h, 3 underwent concomitant transvaginal removal . On the postoperative cystoscopic exam, 2 women had remnant mesh after tur - h . One woman had transvaginal removal with no mesh visible on the follow - up cystoscopic exam . In the other woman she wanted to delay additional treatment for the remaining mesh because she had none of the preoperative symptoms . Two cases of vesico - vaginal fistulas occurred in women treated with tur - e . One case was found during the tur - e, and the fistula tract was immediately repaired transvaginally . A foley catheter was placed for 29 days and no sequelae were observed during 9.5 months of follow - up . The woman experienced continuous urine leakage 7 days after the foley catheter was removed . On the vaginal exam, one case of stress incontinence (stamey grade i) recurred in a woman who had remaining intraurethral mesh after tur - h . In this retrospective study, 26% of women (6/23) had a mesh remnant after transurethral removal of intravesical or intraurethral mesh . Mesh exposure in the bladder or urethra is an uncommon but troublesome complication of midurethral slings . Several authors have described their approaches to this difficult problem, with no consensus on the best approach [11 - 16]. Frenkl et al proposed a treatment algorithm after reviewing 22 cases of iatrogenic foreign bodies in the bladder and urethra following pelvic floor surgery . They commented on the technical difficulties of endoscopic resection of the mesh due to the encrusted stone material and the difficulty in applying tension to the mesh during resection . Standard transurethral resection had success rates of 90% to 100% in several case series with a small number of patients [7,17 - 19]. With the electrode loop our series also showed a high success rate (93.7% [15/16]) after the tur - e procedure . On the contrary, the holmium laser completely removed the mesh in only 28% of women (2/7). Doumouchtsis et al reported that 4 of 6 women had recurrent erosion after transurethral resection using a holmium laser . The holmium laser allows sharp incision of the mesh at the entrance and exit points . However, complete excision is difficult with a rigid cystoscope when the mesh is located in the bladder neck or urethra . Of the 3 successful cases of holmium laser excision reported by giri et al, none were in the bladder neck or urethra, and a flexible instrument was used . In the present study, the mesh was in the bladder neck or urethra in all 5 cases with mesh remaining after tur - h, and we used a rigid scope . Therefore, we suggest that complete removal of the mesh using tur - h depends on the location of the mesh and the range of motion of the instrument . Another reason for the low success rate after tur - h might be less experience with the technique using holmium laser . Two cases of vesico - vaginal fistulas were found during or after the tur - e procedure . As mentioned above, one advantage of the electrode loop is that it can resect the mesh down to the submucosal portion . Because damaged urethral or bladder mucosa is atrophic, the risk of perforation may be increased . A laparoscopic trocar was inserted suprapubically into the bladder under cystoscopic control . Under traction and fixation by suprapubically a disadvantage of this technique is that it requires an additional bladder tract, which can increase the hospital stay and morbidity . To avoid bladder or urethral perforation, nevertheless, transurethral resection using an electrode loop for intraurethral mesh might have a higher possibility of urethral perforation or incomplete resection . Also, with a holmium laser and rigid scope the median duration from the manifestation of symptoms to diagnosis was more than 7 months . The possibility of unrecognized tape perforation or erosion and cystosopic exam should be considered in patients with lower urinary tract symptoms after a midurethral sling procedure . Stress urinary incontinence recurred in 1 woman who had a mesh remnant after tur - h . She wanted to delay further treatment because the grade was minimal and her preoperative symptom was resolved . Given these results, transurethral resection wolud have a good functional outcome and low risk recurrence of stress incontinence . However, there are only limited data on the effectiveness of transurethral management for bladder or urethral mesh . Our results can provide information on the outcomes and complications of different transurethral removal techniques and can help physicians to choose the best treatment modality . Transurethral surgery is associated with low morbidity and is familiar to urologists . To remove intravesical or intraurethral mesh after midurethral sling procedures, tur - e has a high success rate, although it has a high risk of bladder perforation . In contrast, tur - h has less risk of tissue damage, but complete resection seems to depend on the location of the mesh and the range of motion of the instrument . The evidence for tur - h is not sufficient to conclude that this is an ineffective method for mesh removal; however, it should be performed in selected patients . Transurethral resection has good functional outcomes and a low risk of recurrence of stress incontinence.
|
Generalized anxiety disorder (gad) is a chronic disorder mainly characterized by pathological worry . Gad also presents with a variety of somatic and psychological symptoms such as restlessness, muscle tension, sleep disturbance, irritability, difficulty concentrating, and fatigue . Gad is one of the most prevalent anxiety disorders, with its lifetime prevalence estimated to be of 5.7% in the united states and 2.8% in europe [2, 3]. Patients with gad have a higher likelihood of developing other mood disorders in their lifetime; one of the most common is major depressive disorder, present in 62% of gad patients . Since gad affects normal functioning, these patients are usually frequent users of healthcare resources; in fact, studies aimed to explore gad clinical prevalence have estimated it to be 7.3% in primary care and up to 13% in the psychiatric outpatient setting [5, 6]. Gad is difficult to diagnose by primary care physicians and psychiatrists . In people who suffer gad, commonly occurring comorbid conditions (e.g., depression, alcoholism, other anxiety disorders) often mask the underlying anxiety and result in a missed diagnosis of gad [7, 8]. Other factors complicating the diagnosis of gad are patients tendency to complain about the somatic symptoms, such as sleeplessness and fatigue, rather than the psychic symptoms (e.g., nervousness, apprehension, chronic worry), and physicians lack of education in the diagnosis of gad . Diagnostic criteria have been modified in each edition of the diagnostic and statistical manual of mental disorders (dsm) [1, 11, 12]. Duration of excessive worry criterion and the number of associated symptoms are still questioned today . The duration criterion was increased to 6 month in the dsm - iii - r to distinguish gad from adjustment disorders or situational stress reactions . However, recent studies have suggested that this duration excludes significantly impaired patients from diagnosis . Dsm - v, which is expected to get released in may 2013, will revise the wording and organization of gad diagnostic criteria in order to simplify them . Meanwhile, several groups are conducting studies aiming to assess the need for 6 months duration of excessive anxiety and worry criterion [13, 15 - 17]. Using data from the us national comorbidity survey replication, ruscio et al . Have demonstrated that broadening the gad diagnosis criteria, more than doubles its prevalence . This broadening of the criteria consists on a shortening of anxiety duration from at least 6 months to at least 1 month (but less than 6 months), relaxing excessiveness to include excessive and non - excessive worry, and reducing the associated symptoms from a minimum of 3 to a minimum of 2 . Most of the increase in prevalence comes from reducing the minimum duration to 1 month and, to a lesser extent, from eliminating the excessive worry requirement . Prevalence is minimally affected by requiring 2 rather than 3 associated symptoms . In a recent study conducted both in developed and developing countries, the 6-month duration criterion was not found to influence symptom severity, age of onset, persistence, impairment or comorbidity when compared to shorter criterion durations (1 - 2 months and 3 - 5 months). To our knowledge, there is no study aimed to evaluate prospectively the evolution of anxiety symptoms in patients diagnosed with broad dsm - iv criteria under medical practice . Before considering changing dsm - iv criteria, full consequences of these changes should be explored . Broadening of gad criteria could lead to earlier diagnosis of gad patients and to diagnosis of otherwise under diagnosed patients . Earlier diagnosis could translate into a sooner start of treatment and this could lead to an improvement in the course of the illness and the quality of life . In fact, gad patients have reported lower perceived quality of life than non - anxious controls and a lower degree of social functioning than patients with arthritis or diabetes . In a recent study by lee et al ., those patients with more than 12 months duration of symptoms were more severely impaired and had a lower rate of recovery than the groups with shorter duration of symptoms, suggesting that an earlier diagnosis could also benefit patient response and recovery . In an attempt to elucidate the consequences of broadening dsm - iv criteria for generalized anxiety disorder, the current study examined prospectively the evolution of gad symptoms in two groups of diagnosed patients in public and private mental healthcare settings; one group according to the existing dsm - iv criteria and the other according to broader criteria (at least 1 month but less than 6 months of excessive or non - excessive worry and 2 associated symptoms listed on dsm - iv for gad diagnosis). By using the total ham - a scores, changes in evolution of anxiety symptoms were studied in both criteria groups under the basis of routine medical care in a 6 month period . Finally, self - reported quality of life, disability and other patient - reported - outcomes were studied as a measure of the overall well - being of gad patients . This was a multicentre, prospective and observational study carried out in outpatient psychiatric clinics between october 2007 and january 2009 . The study was approved by the local ethics committee of the hospital clnico de san carlos (madrid) and was conducted according to the helsinki declaration for research in the human being . Functional and clinical outcome measures were completed in all three visits and included the following instruments: hamilton anxiety rating scale, montgomery - asberg depression rating scale (baseline and 6 month visit only), clinical global impression - severity of illness scale, sleep scale from medical outcomes study (mos - sleep), world health organization disability assessment schedule ii (baseline and 6 month visit only), and the quality of life questionnaire, eq-5d (all described in detail below). At baseline, socio - demographic data, current therapy and psychiatric and medical illnesses information were collected . For the 3 and 6 months visits, psychiatrists participating in the study made a confirmatory diagnosis of gad in 6 consecutive patients, 3 according to dsm - iv criteria and 3 according to broad criteria . Although patients could have symptoms and receive treatment before entering the study, they had nt been diagnosed before by the psychiatrist . Eligible patients were men and women over 18 years of age that were diagnosed with gad by a trained psychiatrist at the baseline visit . Exclusion criteria included previous gad diagnosis, inability or difficulty to understand patient - reported - outcomes questionnaires written in spanish . Diagnosis was carried out by a trained psychiatrist, familiar with the study procedures, and who worked in an outpatient setting . Sampling frame included all public and private healthcare settings within the 17 regions of spain . First stage consisted on a selection of the outpatient psychiatry clinics (mental health centres) in each healthcare region . The number of clinics selected in each region was proportional to the region s population, being the probability of choosing each clinic relative to the population in the area covered by the clinic . In the second stage, one psychiatrist per clinic was chosen randomly within those with previous experience in clinical and epidemiological research in psychiatry, and with at least 5 year experience in mental health diseases diagnosis . If a selected psychiatrist refused to participate, he or she was replaced by another from the same clinic (also selected randomly). Participant psychiatrists were asked to invite in a consecutive manner those patients from the daily list of appointments that fulfilled the inclusion criteria . Psychiatrists were encouraged to maintain the above mentioned proportion of 3 subjects diagnosed following dms - iv criteria and 3 subjects diagnosed following the broad criteria . Sample size was calculated taking into account study s main variable: evolution of anxiety symptoms according to the total ham - a scores for each patient group . A sample of 3400 evaluable patients was estimated assuming a 2-tailed 95% confidence interval for the total ham - a scores lower than 0.25 points from the observed mean . Based on the results of a previous study, a standard deviation lower than 8 was assumed . Gad was diagnosed following the dsm - iv criteria (dsm - iv criteria group) in one group . The other group (broad criteria group) was diagnosed according to broader criteria consisting on shortening of anxiety duration from at least 6 months to at least 1 month (but less than 6 months), including excessive or non - excessive worry and reducing the associated symptoms from a minimum of 3 to a minimum of 2 . Hamilton anxiety rating scale (ham - a): the validated spanish version of the ham - a scale was used to evaluate the evolution of anxiety symptoms during all 3 visits of the study . The ham - a scales includes 14 items, each of them rates from 0 (absence) to 4 (severe). The total score comes from the addition of all 14 items with a maximum of 56 . Scores higher than 24 were considered as severe anxiety; between 16 and 24, moderate; between 10 and 15, mild; and below 9, no anxiety . A psychic anxiety sub domain (addition of items 1 - 6 and 14) and a somatic anxiety sub domain (addition of items 7 - 13) montgomery - asberg depression rating scale (madrs): the validated spanish version of the madrs scale was used to measure the intensity of depression symptoms . This observer - rated depression scale consists on 10 items regarding different depressive symptoms, each item being scored from 0 to 6 depending on the severity of symptoms; the total score results from adding the score of each item, obtaining a minimum of 0 (no symptoms) and a maximum of 60 (very severe). Clinical global impression - severity of illness scale (cgi - s): participant psychiatrists evaluated patient s global severity with the cgi - s scale, which rates illness severity from 0 to 7, where 0 was considered as not evaluated, 1 as no disease, 2 borderline ill, 3 mildly ill, 4 moderately ill, 5 markedly ill, 6 severely ill, and 7 extremely ill . Sleep scale from medical outcomes study (mos - sleep): mos - sleep scale evaluates the impact or interference with sleep of any disease or treatment . The 7 subscales are sleep disturbance (4 items), snoring (1 item), awaken short of breath or with headache (1 item), quantity of sleep (1 item), optimal sleep (1 item), sleep adequacy (2 items), and somnolence (3 items). This scale also has a sleep problems index, rated from 0 (no interference) to 100 (maximum interference), and a sleep problems subscale . Each item is rated independently with more interference scoring higher, except for the sleep adequacy and quantity and optimal sleep subscales [21, 22]. World health organization disability assessment schedule ii (who - das ii): the who - das ii is a psychometric instrument that measures day to day functioning and disability in the following six activity domains: understanding and communicating, moving and getting around, self care, getting along with people, work activities, and participation in society . The 12-item who - das ii scale is rated from 1 (none or nothing) to 5 (extreme or inability to perform a given task). The total calculated score ranges from 0 to 100, with higher scores indicating higher degrees of disability, for the total scale as well as for each subscale . Eq-5d: this is a standard self - reported quality of life questionnaire developed in several european countries and validated for spain . This questionnaire consists of two parts, the first one aims to evaluate patient s health profile in five dimensions (mobility, self - care, daily living activities, pain, and anxiety / depression). The patient rates his / her current status as no problems, some / moderate problems, and severe / extreme problems for each dimension . Results are then converted into 1 of the 243 different eq-5d health state descriptions which are used to calculate a unique index or tariff, between 1 (as healthy as possible) and 0 (usually equivalent to death). This index is used to calculate the time - trade off tariff which allows calculating quality - adjusted - life - year (qaly) gain (further explanation below). The second part consists on a visual analogue scale (vas or thermometer) in which the patient has to rate his health status between 0 (equivalent to death) and 100 (the best possible healthy status). For statistical analysis, last observation carried forward approach was used for those patients for whom data from the 6 months visit were missing . If the only missing data was that from the 3 months visit, this was estimated proportionally to the change observed at the 6 months visit, given that the missing data at 3 month visit were completely at random . Patients were considered to respond to treatment when a higher than 50% reduction was observed for the total ham - a scale score at the study final visit when compared to that of the baseline visit . Descriptive statistics were prepared for the continuous variables in the study, including the assessment of central position and dispersion (two - tailed 95% confidence interval). The kolmogorov - smirnov test was applied to check adjustment of data to a gaussian distribution . Student t tests and chi - square test were used for continuous and categorical variables, respectively, to test homogeneity of baseline data between groups . Analysis of covariance (ancova) or binary logistic regression models were fitted comparing dsm - iv criteria versus broad criteria groups in most variables adjusting by baseline scoring, sex, age, body mass index, educational level, marital status and percentage of patients with comorbid major depression or depressive disorder . Analysis of variance (anova) was applied for quantitative measures and chi square (mcnemar s test) for qualitative measures in case of paired comparisons . The clinical relevance of observed differences in baseline characteristics was ascertained by means of the effect size that was calculated using the difference of means for each group, divided by the combined standard deviation of the variables . Qalys gain after the 6-months follow - up was calculated from patients responses to the eq-5d as described previously using tariff calculated with this instrument . Gained qalys were estimated by using the trapezoidal approach, with baseline and 6- month visit values used as reference values . All statistical tests were two - tailed, and error of <0.05 was accepted as statistically significant . This was a multicentre, prospective and observational study carried out in outpatient psychiatric clinics between october 2007 and january 2009 . The study was approved by the local ethics committee of the hospital clnico de san carlos (madrid) and was conducted according to the helsinki declaration for research in the human being . Functional and clinical outcome measures were completed in all three visits and included the following instruments: hamilton anxiety rating scale, montgomery - asberg depression rating scale (baseline and 6 month visit only), clinical global impression - severity of illness scale, sleep scale from medical outcomes study (mos - sleep), world health organization disability assessment schedule ii (baseline and 6 month visit only), and the quality of life questionnaire, eq-5d (all described in detail below). At baseline, socio - demographic data, current therapy and psychiatric and medical illnesses information were collected . For the 3 and 6 months visits, psychiatrists participating in the study made a confirmatory diagnosis of gad in 6 consecutive patients, 3 according to dsm - iv criteria and 3 according to broad criteria . Although patients could have symptoms and receive treatment before entering the study, they had nt been diagnosed before by the psychiatrist . Eligible patients were men and women over 18 years of age that were diagnosed with gad by a trained psychiatrist at the baseline visit . Exclusion criteria included previous gad diagnosis, inability or difficulty to understand patient - reported - outcomes questionnaires written in spanish . Diagnosis was carried out by a trained psychiatrist, familiar with the study procedures, and who worked in an outpatient setting . Sampling frame included all public and private healthcare settings within the 17 regions of spain . First stage consisted on a selection of the outpatient psychiatry clinics (mental health centres) in each healthcare region . The number of clinics selected in each region was proportional to the region s population, being the probability of choosing each clinic relative to the population in the area covered by the clinic . In the second stage, one psychiatrist per clinic was chosen randomly within those with previous experience in clinical and epidemiological research in psychiatry, and with at least 5 year experience in mental health diseases diagnosis . If a selected psychiatrist refused to participate, he or she was replaced by another from the same clinic (also selected randomly). Participant psychiatrists were asked to invite in a consecutive manner those patients from the daily list of appointments that fulfilled the inclusion criteria . Psychiatrists were encouraged to maintain the above mentioned proportion of 3 subjects diagnosed following dms - iv criteria and 3 subjects diagnosed following the broad criteria . Sample size was calculated taking into account study s main variable: evolution of anxiety symptoms according to the total ham - a scores for each patient group . A sample of 3400 evaluable patients was estimated assuming a 2-tailed 95% confidence interval for the total ham - a scores lower than 0.25 points from the observed mean . Based on the results of a previous study, a standard deviation lower than 8 was assumed . Gad was diagnosed following the dsm - iv criteria (dsm - iv criteria group) in one group . The other group (broad criteria group) was diagnosed according to broader criteria consisting on shortening of anxiety duration from at least 6 months to at least 1 month (but less than 6 months), including excessive or non - excessive worry and reducing the associated symptoms from a minimum of 3 to a minimum of 2 . Hamilton anxiety rating scale (ham - a): the validated spanish version of the ham - a scale was used to evaluate the evolution of anxiety symptoms during all 3 visits of the study . The ham - a scales includes 14 items, each of them rates from 0 (absence) to 4 (severe). The total score comes from the addition of all 14 items with a maximum of 56 . Scores higher than 24 were considered as severe anxiety; between 16 and 24, moderate; between 10 and 15, mild; and below 9, no anxiety . A psychic anxiety sub domain (addition of items 1 - 6 and 14) and a somatic anxiety sub domain (addition of items 7 - 13) montgomery - asberg depression rating scale (madrs): the validated spanish version of the madrs scale was used to measure the intensity of depression symptoms . This observer - rated depression scale consists on 10 items regarding different depressive symptoms, each item being scored from 0 to 6 depending on the severity of symptoms; the total score results from adding the score of each item, obtaining a minimum of 0 (no symptoms) and a maximum of 60 (very severe). Clinical global impression - severity of illness scale (cgi - s): participant psychiatrists evaluated patient s global severity with the cgi - s scale, which rates illness severity from 0 to 7, where 0 was considered as not evaluated, 1 as no disease, 2 borderline ill, 3 mildly ill, 4 moderately ill, 5 markedly ill, 6 severely ill, and 7 extremely ill . Sleep scale from medical outcomes study (mos - sleep): mos - sleep scale evaluates the impact or interference with sleep of any disease or treatment . The 7 subscales are sleep disturbance (4 items), snoring (1 item), awaken short of breath or with headache (1 item), quantity of sleep (1 item), optimal sleep (1 item), sleep adequacy (2 items), and somnolence (3 items). This scale also has a sleep problems index, rated from 0 (no interference) to 100 (maximum interference), and a sleep problems subscale . Each item is rated independently with more interference scoring higher, except for the sleep adequacy and quantity and optimal sleep subscales [21, 22]. World health organization disability assessment schedule ii (who - das ii): the who - das ii is a psychometric instrument that measures day to day functioning and disability in the following six activity domains: understanding and communicating, moving and getting around, self care, getting along with people, work activities, and participation in society . The 12-item who - das ii scale is rated from 1 (none or nothing) to 5 (extreme or inability to perform a given task). The total calculated score ranges from 0 to 100, with higher scores indicating higher degrees of disability, for the total scale as well as for each subscale . Eq-5d: this is a standard self - reported quality of life questionnaire developed in several european countries and validated for spain . This questionnaire consists of two parts, the first one aims to evaluate patient s health profile in five dimensions (mobility, self - care, daily living activities, pain, and anxiety / depression). The patient rates his / her current status as no problems, some / moderate problems, and severe / extreme problems for each dimension . Results are then converted into 1 of the 243 different eq-5d health state descriptions which are used to calculate a unique index or tariff, between 1 (as healthy as possible) and 0 (usually equivalent to death). This index is used to calculate the time - trade off tariff which allows calculating quality - adjusted - life - year (qaly) gain (further explanation below). The second part consists on a visual analogue scale (vas or thermometer) in which the patient has to rate his health status between 0 (equivalent to death) and 100 (the best possible healthy status). For statistical analysis, last observation carried forward approach was used for those patients for whom data from the 6 months visit were missing . If the only missing data was that from the 3 months visit, this was estimated proportionally to the change observed at the 6 months visit, given that the missing data at 3 month visit were completely at random . Patients were considered to respond to treatment when a higher than 50% reduction was observed for the total ham - a scale score at the study final visit when compared to that of the baseline visit . Descriptive statistics were prepared for the continuous variables in the study, including the assessment of central position and dispersion (two - tailed 95% confidence interval). The kolmogorov - smirnov test was applied to check adjustment of data to a gaussian distribution . For categorical variables student t tests and chi - square test were used for continuous and categorical variables, respectively, to test homogeneity of baseline data between groups . Analysis of covariance (ancova) or binary logistic regression models were fitted comparing dsm - iv criteria versus broad criteria groups in most variables adjusting by baseline scoring, sex, age, body mass index, educational level, marital status and percentage of patients with comorbid major depression or depressive disorder . Analysis of variance (anova) was applied for quantitative measures and chi square (mcnemar s test) for qualitative measures in case of paired comparisons . The clinical relevance of observed differences in baseline characteristics was ascertained by means of the effect size that was calculated using the difference of means for each group, divided by the combined standard deviation of the variables . Qalys gain after the 6-months follow - up was calculated from patients responses to the eq-5d as described previously using tariff calculated with this instrument . Gained qalys were estimated by using the trapezoidal approach, with baseline and 6- month visit values used as reference values . All statistical tests were two - tailed, and error of <0.05 was accepted as statistically significant . A total of 3,549 patients were finally recruited by 618 psychiatrists in spanish psychiatric clinics for this observational study . Four hundred and fifty three patients (12.8%) were excluded because they did not meet all inclusion criteria . Remaining patients were diagnosed of gad according to dsm - iv criteria (1,815 patients) or to broad criteria (1,281 patients) as described on the methods section . A total of 529 (17.0%) patients drop - out from study, with no significant differences between study groups (dsm - iv criteria: 313 patients, broad criteria: 216 patients; p=0.899) (fig . However, main reasons for drop - outs were a somewhat different between groups with 52.7% lost to follow - up in dsm - iv group, compared with 67.1% in broad criteria group (p=0.033), and unknown reasons in 22.0% of withdrawals in dsm - iv group compared with 13.6% in broad criteria group (p=0.023). The mean age was 45.5 years for the dsm - iv group and slightly lower for the broad criteria group (42.9 years, p<0.001 vs. dsm - iv group). Regarding gad, all features studied were slightly, but significantly higher in the standard dsm - iv criteria group . Thus, the mean number of anxiety symptoms was 4.7 for the dsm - iv group compared with 4.3 for the broad criteria group (p<0.001). Significant differences were also observed in the percentage of patients presenting with each individual gad symptom . All ham - a scores indicated severe anxiety on both patient groups, being the scores in the dsm - iv group significantly higher (table 1). Likewise, statistical differences were observed at baseline in the cgi and madrs scales between the two groups . However, the magnitude of the effect was low for all quantitative variables at baseline (effect size <0,50) so the statistically significant differences observed were of small or negligible clinical relevance . Most patients in both groups (87.9% for dsm - iv; 82.0% for broad criteria) were following a pharmacological treatment in the six months previous to the baseline visit . (2), benzodiazepines were the most commonly used drugs followed by antidepressants and antiepileptics . At the end of the study, there was an increase in the number of patients under pharmacological treatment (97% in both groups, p<0.001 versus baseline in all cases). The use of antiepileptic drugs increased by 3.2 and 3.8 fold in the dsm - iv and broad criteria groups, respectively, by the end - of - trial (p<0.001 in all cases). The percentage of antiepileptic drugs users in dsm - iv group at baseline and at 6 months was significantly higher, albeit only slightly (p=0.002 in both cases, fig . Both groups showed a significant reduction in the percentage of benzodiazepines users after 6 months of follow - up (p<0.001), being this reduction even higher in the broad criteria group (p=0.011). Also a slight but statistically significant increase was observed in the percentage of anti - depressive users in both groups (p<0.001, see fig . The percentage of subjects in dsm - iv and broad criteria groups that had at least one psychiatric comorbidity was 51.4% and 43.7%, respectively, (p<0.001). Table 2 describes the most frequent psychiatric comorbidities and medical disorders in both study groups . However, neither the mean number of comorbid psychiatric disorders nor the medical illnesses were different between both criteria groups, except for comorbid major depression and other depressive disorders which were slightly more frequent, but statistically significant in dsm - iv group (p<0.01 and p=0.05, respectively, table 2). Regarding psychiatric disorders, most of them were present around 5 months before the diagnosis of gad, without significant differences between groups in disease evolution . Major depression and panic disorders were the most frequent comorbid psychiatric disorders in both study groups . For medical illnesses, chronic pain was present in more than half of patients in both groups, although a higher percentage was seen in dsm - iv group; 64.3% versus 52.0%, p<0.001 (table 2). Anxiety severity was assessed with ham - a and cgi - s scales at 3 and 6 month visits . (3) shows the evolution of ham - a total and sub - scores over study time in the dsm - iv and broad criteria groups . All ham - a scores improved after 3 and 6 months in both criteria groups . Moreover, the percentage of patients without symptoms of anxiety, showing ham - a<9, increased up to 22.3% and 31.4% at the 3 month visit for the dsm - iv and broad criteria groups (p<0.001 vs. basal visit in both groups, and p=0.006 between groups), and up to 49% and 58% at the 6 month visit (p<0.001 vs. basal visit in both groups, and p=0.261 between groups), indicating similar results for both groups at the end of the study . Also, patients responding to anxiety treatment increased when considering the responder criteria (> 50% reduction of baseline scores); 30.7% and 38.2% for the dms - iv and broad criteria, respectively, at the 3 months visit (p= 0.004); increasing up to 59.7% in the dms - iv and 67.7% at the 6 month visit (p=0.103). 4), differences between criteria groups were statistically significant at the study time points . Regarding each gad symptom, fig . (5) shows the reduction in the percentage of patients presenting with each anxiety symptom . However, higher significant reductions were observed in dsm - iv group for the following symptoms: fatigue, irritability and sleep disturbance (p<0.05 in all cases, fig . 5). In this study, depression symptoms were evaluated using the madrs . When compared to scores at baseline visit (table 1), patients in both criteria groups improved their madrs scores with a mean reduction of 12.1 and 12.5 points for the dms - iv and broad criteria groups, respectively (p=0.264 dsm - iv vs. broad criteria). Mos - sleep scale scores revealed an overall improvement in sleep patterns over study time in both criteria group . As described in table 3, all sleep domains in the mos - sleep scale changed significantly after 6 months when compared to basal visit scores . Differences between the dsm - iv and broad criteria groups were observed for the total score (p= 0.018), sleep disturbance domain (p=0.012), sleep quantity (p=0.016), sleep adequacy (p=0.031), and sleep problems (p=0.019) scores, always favouring the broad criteria group . Health - related quality of life was measured by the eq-5d questionnaire . As seen in table 3, both the health status (visual analogue scale) and the frequency of severe problems in each domain had significantly improved at the 6 month visit in both study groups (p<0.001 in all cases). Also, comparisons between both criteria groups in quality - of - life gain by domain were significant in favour of the broad criteria group in health status, daily living activities and mood status . Mean qalys gain at the 3 month and 6 month visits were 0.034 and 0.103 years, respectively, for the dsm - iv criteria group and 0.034 (3 month) and 0.101 (6 month) for the broad criteria patients, without statistical significance between groups (table 3). At the 6 month visit, the percentage of patients reporting an improvement in their health status as compared with that of one year earlier increased by 13.8% for the dsm - iv criteria group, and 16.6% for the broad criteria group (differences not significant). For measuring the disability degree in both groups of patients,, there was a significant improvement in all 7 domains of the who - das ii scale after the 6 month follow - up in both criteria groups . The improvements were not significantly different in the dsm - iv group when compared to the new criteria group except for household activity domain, in which the improvement in the dsm - iv group was significantly better when compared to the broad criteria group . Nevertheless, a trend toward statistical significance was observed in the total scoring of the disability scale favouring broad criteria group . A total of 3,549 patients were finally recruited by 618 psychiatrists in spanish psychiatric clinics for this observational study . Four hundred and fifty three patients (12.8%) were excluded because they did not meet all inclusion criteria . Remaining patients were diagnosed of gad according to dsm - iv criteria (1,815 patients) or to broad criteria (1,281 patients) as described on the methods section . A total of 529 (17.0%) patients drop - out from study, with no significant differences between study groups (dsm - iv criteria: 313 patients, broad criteria: 216 patients; p=0.899) (fig . However, main reasons for drop - outs were a somewhat different between groups with 52.7% lost to follow - up in dsm - iv group, compared with 67.1% in broad criteria group (p=0.033), and unknown reasons in 22.0% of withdrawals in dsm - iv group compared with 13.6% in broad criteria group (p=0.023). The mean age was 45.5 years for the dsm - iv group and slightly lower for the broad criteria group (42.9 years, p<0.001 vs. dsm - iv group). Regarding gad, all features studied were slightly, but significantly higher in the standard dsm - iv criteria group . Thus, the mean number of anxiety symptoms was 4.7 for the dsm - iv group compared with 4.3 for the broad criteria group (p<0.001). Significant differences were also observed in the percentage of patients presenting with each individual gad symptom . All ham - a scores indicated severe anxiety on both patient groups, being the scores in the dsm - iv group significantly higher (table 1). Likewise, statistical differences were observed at baseline in the cgi and madrs scales between the two groups . However, the magnitude of the effect was low for all quantitative variables at baseline (effect size <0,50) so the statistically significant differences observed were of small or negligible clinical relevance . Most patients in both groups (87.9% for dsm - iv; 82.0% for broad criteria) were following a pharmacological treatment in the six months previous to the baseline visit . (2), benzodiazepines were the most commonly used drugs followed by antidepressants and antiepileptics . At the end of the study, there was an increase in the number of patients under pharmacological treatment (97% in both groups, p<0.001 versus baseline in all cases). The use of antiepileptic drugs increased by 3.2 and 3.8 fold in the dsm - iv and broad criteria groups, respectively, by the end - of - trial (p<0.001 in all cases). The percentage of antiepileptic drugs users in dsm - iv group at baseline and at 6 months was significantly higher, albeit only slightly (p=0.002 in both cases, fig . Both groups showed a significant reduction in the percentage of benzodiazepines users after 6 months of follow - up (p<0.001), being this reduction even higher in the broad criteria group (p=0.011). Also a slight but statistically significant increase was observed in the percentage of anti - depressive users in both groups (p<0.001, see fig . At the study entry, the percentage of subjects in dsm - iv and broad criteria groups that had at least one psychiatric comorbidity was 51.4% and 43.7%, respectively, (p<0.001). Table 2 describes the most frequent psychiatric comorbidities and medical disorders in both study groups . However, neither the mean number of comorbid psychiatric disorders nor the medical illnesses were different between both criteria groups, except for comorbid major depression and other depressive disorders which were slightly more frequent, but statistically significant in dsm - iv group (p<0.01 and p=0.05, respectively, table 2). Regarding psychiatric disorders, most of them were present around 5 months before the diagnosis of gad, without significant differences between groups in disease evolution . Major depression and panic disorders were the most frequent comorbid psychiatric disorders in both study groups . For medical illnesses, chronic pain was present in more than half of patients in both groups, although a higher percentage was seen in dsm - iv group; 64.3% versus 52.0%, p<0.001 (table 2). Anxiety severity was assessed with ham - a and cgi - s scales at 3 and 6 month visits . Fig . (3) shows the evolution of ham - a total and sub - scores over study time in the dsm - iv and broad criteria groups . All ham - a scores improved after 3 and 6 months in both criteria groups . Moreover, the percentage of patients without symptoms of anxiety, showing ham - a<9, increased up to 22.3% and 31.4% at the 3 month visit for the dsm - iv and broad criteria groups (p<0.001 vs. basal visit in both groups, and p=0.006 between groups), and up to 49% and 58% at the 6 month visit (p<0.001 vs. basal visit in both groups, and p=0.261 between groups), indicating similar results for both groups at the end of the study . Also, patients responding to anxiety treatment increased when considering the responder criteria (> 50% reduction of baseline scores); 30.7% and 38.2% for the dms - iv and broad criteria, respectively, at the 3 months visit (p= 0.004); increasing up to 59.7% in the dms - iv and 67.7% at the 6 month visit (p=0.103). 4), differences between criteria groups were statistically significant at the study time points . Regarding each gad symptom, fig . (5) shows the reduction in the percentage of patients presenting with each anxiety symptom . However, higher significant reductions were observed in dsm - iv group for the following symptoms: fatigue, irritability and sleep disturbance (p<0.05 in all cases, fig . 5). In this study, depression symptoms were evaluated using the madrs . When compared to scores at baseline visit (table 1), patients in both criteria groups improved their madrs scores with a mean reduction of 12.1 and 12.5 points for the dms - iv and broad criteria groups, respectively (p=0.264 dsm - iv vs. broad criteria). Mos - sleep scale scores revealed an overall improvement in sleep patterns over study time in both criteria group . As described in table 3, all sleep domains in the mos - sleep scale changed significantly after 6 months when compared to basal visit scores . Differences between the dsm - iv and broad criteria groups were observed for the total score (p= 0.018), sleep disturbance domain (p=0.012), sleep quantity (p=0.016), sleep adequacy (p=0.031), and sleep problems (p=0.019) scores, always favouring the broad criteria group . Health - related quality of life was measured by the eq-5d questionnaire . As seen in table 3, both the health status (visual analogue scale) and the frequency of severe problems in each domain had significantly improved at the 6 month visit in both study groups (p<0.001 in all cases). Also, comparisons between both criteria groups in quality - of - life gain by domain were significant in favour of the broad criteria group in health status, daily living activities and mood status . Mean qalys gain at the 3 month and 6 month visits were 0.034 and 0.103 years, respectively, for the dsm - iv criteria group and 0.034 (3 month) and 0.101 (6 month) for the broad criteria patients, without statistical significance between groups (table 3). At the 6 month visit, the percentage of patients reporting an improvement in their health status as compared with that of one year earlier increased by 13.8% for the dsm - iv criteria group, and 16.6% for the broad criteria group (differences not significant). For measuring the disability degree in both groups of patients, the who - das scale was used . As shown in table 4, there was a significant improvement in all 7 domains of the who - das ii scale after the 6 month follow - up in both criteria groups . The improvements were not significantly different in the dsm - iv group when compared to the new criteria group except for household activity domain, in which the improvement in the dsm - iv group was significantly better when compared to the broad criteria group . Nevertheless, a trend toward statistical significance was observed in the total scoring of the disability scale favouring broad criteria group . This real world prospective study in usual medical practice has shown that broadening of gad dsm - iv diagnostic criteria, by reducing the duration of excessive or non - excessive worry to one month and associated symptoms to two, does not significantly affect patient s responsiveness to psychiatrist - prescribed therapy . The patient sample of this study seems to be similar to other gad populations presented in previous studies, with a higher prevalence among women and among those aged above 25 years [4, 18]. The most frequent comorbid psychiatric disorder was major depression; however, its presence was somewhat smaller than the observed in other studies, if we take into account major depression only . The main goal when treating a gad patient is to improve the symptoms, hopefully leading in the long - term to their complete remission and to recovery of patient s functionality . Several guidelines recommend antidepressants, such as the selective serotonin reuptake inhibitors and the serotonin noradrenalin reuptake inhibitors, and antiepileptics as first line treatments, and benzodiazepines as second - line treatment [28, 29]. Although patients in this study received a confirmatory diagnosis of gad, a high percentage of them were already following a therapy recommended for gad at baseline . These results suggest that, in our sanitary context, general practitioners and/or family physicians start treatment to control anxiety symptoms, mostly with benzodiazepines, at patients first complaint . The general practitioner / family physician usually refers those patients with lower treatment response than expected to the psychiatrist . It should be taken into account that refractory patients may be difficult to manage at the primary care level in the spanish health system . One of the reasons is the brief period of time devoted by physicians to each patient visit in the spanish primary health care level, as described by duran et al . . Other studies have explored the consequences of broadening dsm - iv diagnostic criteria for gad [3, 13, 15 - 16, 31]. Most of them have considered a reduction in the duration criteria [3, 16], the excessiveness of worry, and the number of associated symptoms . A possible learning from all of them is that the socio - demographic characteristics between the populations diagnosed with broad or strict dsm - iv criteria are not substantially different . As expected, the broadening of dsm - iv gad criteria results in an increase in the point - prevalence to more than double [15 - 16]. Concluded that the increase was mainly due to the reduction of minimum duration to one month . In regards to gad s severity, ruscio et al . Observed a tendency to reduced severity for the broad criteria group, however we have observed a similar tendency suggesting that patients diagnosed with broader gad criteria present a slightly less severe form of the disease . Every study that has investigated the possibility of broadening the dsm - iv criteria has done it retrospectively [13, 15, 16, 27, 31, 32]. The present study is the first one to compare two groups of gad patients with dsm - iv and broader criteria following a prospective design . According to our results, broadening of gad diagnostic criteria does not affect the response to the prescribed therapy, since ham - a scores, total and domains, improved similarly in both groups, and so did the presence of gad symptoms (fig . A significant improvement was perceived by physicians (cgi - s scores) at the end of the study . The influence of broader gad diagnostic criteria in patient s disability has been studied previously by lee et al . Lee et al . Observed an increase in the sheehan disability scale score when increasing time for the duration criteria although it was not statistically significant . The same observation was made by kessler et al . With data from the ncs . Parallel to their clinical improvement, patients in our study experienced an improvement in the studied quality of life variables . Health status improvements in our study were similar to those observed in primary care patients receiving treatment over six months for their gad . The biggest improvements were observed in the daily living activities and mood domains of the eq-5d . Qalys gain observed corresponded to more than one month of perfect health for both groups; which were similar in magnitude to that observed in other health conditions such as trigeminal neuralgia, successfully treated with pregabalin . All other dimensions of functionality included in the who das - ii scale, and sleep scale were substantially ameliorated in both study groups by the end - of - trial; however, the differences in the magnitude of these improvements for both groups were hardly meaningful from a clinical point of view . Results from this study should be interpreted bearing in mind its observational design with its inherent limitations . Since this study is based on out - patient psychiatric clinics, patients included in this study might not be representative of the whole gad population, since psychiatrists could deal with more severe and refractory cases . Also, due to the high degree of expertise required for participant psychiatrists, diagnosis in our study may have been more accurate than in other settings, such as primary care . A consequence of broadening gad criteria in other healthcare settings could be the difficulty in distinguishing gad from adjustment disorders or situational stress reactions by other less trained physicians . In this study there was a high proportion of patients treated with antiepileptics; that could be explained by the fact that most subjects included in the study were non responders to recommended first line drug treatment according to the european guidelines on the treatment and management of gad patients . Finally, as this was a real world prospective study we did not have a control group so further clinical research with randomized controlled studies and newly diagnosed patients needs to be carried out to confirm the consequences of broadening the criteria . Broadening criteria for gad diagnosis, by reducing excessive and non - excessive anxiety and worry duration to one month and the number of associated symptoms to two, captures a similar population of patients compared to the one identified by applying standard dsm - iv criteria . Broadening diagnostic criteria is able to identify the core symptoms of gad according to the dsm - iv criteria and could lead to an earlier diagnosis . Funding for this study was provided by pfizer spain; pfizer spain participated in the idea and design of the study . Enrique lvarez, jose l. carrasco and jos m. olivares declare not to have any conflict of interests as a consequence of participating in this study . Inma vilardaga was employed of the european biometric institute, a consulting agency which was responsible for logistic of study and analysis of data . Mara perez and vanessa lpez - gmez are employed by pfizer spain, the body funding the study.
|
Renal clear cell carcinomas represent about 3% of all visceral cancers and account for 85% of renal cancers in adults . The tumours occur most often in older individuals, usually in the sixth and seventh decades of life, and are often diagnosed at incurable stages . In western countries the frequency of renal cancer remains relatively high, there being approximately 30,000 new cases and 12,000 deaths per year from the disease . The causes of kidney cancer are believed to be environmental (such as cigarette smoking, asbestos, petroleum products, heavy metals, unopposed oestrogen therapy, hypertension and obesity), genetic or a mixture of both . To date there are 19 hereditary syndromes described in which renal cell cancer may occur (table 1). Genetic syndromes characterised by an increased risk of renal cancer (familial cancer database - facd, http://facd.uicc.org) the identification of genetic predispositions to renal cell cancer remains a priority since knowledge about the underlying molecular genetic basis of the disease will allow for a better understanding of the mechanisms giving rise to the disease and, perhaps more importantly, allow for the identification of individuals who are at risk of disease development . There are two aspects of these criteria that can be problematic in the clinical setting with respect to the identification of familial renal cell cancer patients . The first is the difficulty in fulfilling criteria in countries where large families and extensive pedigrees are impossible to identify, for whatever reason, even though the incidence of hereditary renal cell cancer may be quite high . Second, the criteria do not take into consideration the existence of family cancer syndromes where renal cell cancer may occur in association with an extra - gastric malignancy . From a clinical perspective, there is a necessity to be able to identify hereditary renal cell cancer families with a minimum set of criteria that will provide a high likelihood of ascertainment . The aim of this study was to determine whether a minimum set of criteria could be established to identify suspected hereditary renal cell cancer patients when there is restricted information about the familial occurrence of disease . A total of 146 clear cell renal carcinoma (ccrc) patients comprising 3 groups were enrolled in the study . Group a (familial renal cancer): comprising 46 patients affected by ccrc from 22 randomly selected families with at least two renal cancers among first or second degree relatives, independent of age at diagnosis of tumours . Group a1 (nuclear pedigree): comprising 25 patients affected by ccrc from group a. none of the parents of these patients have been diagnosed as affected with renal cell cancer . Group b: a total of 100 individuals diagnosed with ccrc between the years 1993 and 1997 irrespective of family history were collected from the city of szczecin (total population 400,000). The following inclusion features (if) for the identification of suspected hereditary forms of clear cell renal cancer were used and compared against one another for their sensitivity and specificity: if 1: at least one of the parents of the patient with ccrc was affected by lung cancer if 2: at least one of the parents of the patient with ccrc was affected by gastric cancer if 3: ccrc diagnosed at the age of 45 years or younger if 4: ccrc diagnosed at the age of 50 years or younger if 5: ccrc diagnosed at the age of 55 years or younger univariate statistical analysis (chi - squared, odds ratio (or), and sensitivity and specificity of selection were performed using the sas and logit programs . Univariate statistical analysis (chi - squared, odds ratio (or), and sensitivity and specificity of selection were performed using the sas and logit programs . The comparison of the five ifs was undertaken to identify the most consistent criteria that can be employed in a clinical setting for the identification of suspected hereditary renal cell cancer, based on nuclear pedigree data . The first comparison was between group a (associated with a genetic predisposition to disease) compared to unselected cases from group b (table 2). The results indicate that all inclusion features are more frequent in group a (or 1.62 - 4.88). The second comparison was performed between group a1 and group b (table 3). The results indicate that there is a very strong correlation between hereditary (familial) predisposition to ccrc and occurrence of at least one of the following ifs: if1, if2 or if5 - or 13.4; p <0.00001 . The recognition of features that can be used for the identification of familial predispositions to ccrc in situations where extensive pedigree analysis is unknown or impossible to ascertain but the prevalence of the disease is relatively high in the population will aid in the identification of individuals at increased risk of developing ccrc . By using the criteria described herein and the consequent recognition of significant odds ratios for some of the inclusion features to identify ccrc families, we believe that the identification of additional genes associated with this malignancy will be expedited . Of particular interest are the odds ratio values for the inclusion features if5 between groups a1 and b and if 1 between groups a1 and b, which were relatively high (6.21 and 6.09, respectively). Since these inclusion features are significant we have a relatively high degree of confidence that the reported observations are not biased and are an accurate reflection of the validity of our approach for the identification of hereditary ccrc families . Indeed, these criteria have been tested in our outpatient clinics to successfully identify hereditary ccrc . Therefore if we have families matching if1 or if2 or if5, we are confident that a diagnosis of familial ccrc can be made . At present it seems reasonable to offer the option of ultrasonography examination to all individuals identified by the use of our inclusion features beginning at the age of 5 to 10 years before the youngest ccrc identified within the patient's family . Such surveillance should only be an option and not a recommendation because the efficiency of such management procedures has not been rigorously determined to reduce morbidity and/or mortality . With respect to surveillance the real value of this will have to be established by studies on large cohorts of individuals from families matching pedigree and clinical criteria of suspected hereditary ccrc with identified constitutional dna variants associated with genetic predispositions . So far, the list of genetic changes associated with ccrc is somewhat limited but should be extended in the near future as more knowledge is gained about the genetic factors associated with altered ccrc predisposition . In summary, we advocate the use of our criteria for suspected hereditary clear cell renal cancer identified in this report in order to: a. offer an ultrasound examination option, b. create repositories of nuclear clear cell renal cancer families for future studies on the efficiency of surveillance for individuals with genetic predispositions to renal cancer, c. perform further studies to aid in the identification of genetic factors associated with ccrc.
|
Intracranial hypotension syndrome (ihs) is characterized by a postural headache that is aggravated in the erect or sitting position and relieved in the supine position . It is often associated with one or more of the following symptoms: nausea, vomiting, dizziness, diplopia, photophobia, hearing impairment, neck stiffness, and blurred vision6). Acquired or secondary intracranial hypotension is less common but has been reported after spinal procedures such as lumbar discectomy and dural puncture for myelogram, spinal anesthesia . We report a case of a 54-year - old man who was successfully treated with epidural blood patches for intracranial hypotension due to csf leakage into the lumbosacral area after l4 - 5 discectomy . A 54-year - old male admitted to the er complaining of headache from 13 days ago . It did not occur when lying down but became intensely squeezing around the occipital area within 10 seconds after being seated or standing . Past medical history was insignificant other than undergoing l4 - 5 laminectomy and discectomy at a local hospital 15 days ago . Physical examination did not display any neurologic findings such as neck stiffness and laboratory results as well as brain mri findings were not remarkable . Under the strong impression of intracranial hypotension, he admitted to neurology department and underwent conservative therapy including absolute bed rest (abr) and hydration . A mr myelogram was performed, showing a pseudomeningocele accompanied by large csf leakage in the lumbosacral area (fig . Because resolution of symptoms was unsatisfactory, an epidural blood patch was placed on the sixth admission day . After placing the patient in a prone position, a 22 gage touhy needle was inserted through the l5-s1 epidural space through a paraspinal method . After confirming the epidural space by the loss - of - resistance technique, a dye was injected to confirm the epidural space with the c - arm . After three days of abr following the procedure, the patient practiced changing positions by sitting . Five days after the procedure, the patient did not complain of any symptoms (vas 0). 2). We decided to perform one more procedure of epidural patch placement because of the residual csf leakage 6 days after the first intervention . A total of 10 ml autologous blood was injected, and the patient was discharged the next day . Follow up for six months confirmed no recurrence of symptoms (fig . Intracranial hypotension syndrome can occur spontaneously . Acquired or secondary intracranial hypotension is less common but has been reported after spinal procedures . Reported that the incidence of incidental durotomy during spine surgery was 3.84% in patients who underwent spinal surgery at a single spine unit5). In one study looking into medicolegal aspects of spine surgery, 146 malpractice cases were reviewed and incidental durotomy was second most frequent complication in such cases4). The study has shown that potentially serious problems such as pseudomeningocele, csf fistula formation, meningitis and arachnoiditis with subsequent chronic pain are all related to dural tears and csf leakage after spinal surgery . Good long - term clinical results were noted in all patients with durotomy repaired at identification and are comparable to long - term results of patients undergoing similar surgical procedures but without durotomy . However, cammisa et al.1) reported the incidence of clinically significant durotomy occurred during surgery but not indentified at the time was 0.28%, and patients had subsequent surgical repair of dural defects because of failure of conservative therapy . In one study which investigated incidental durotomy during spine surgery and its treatment, in addition to primary repair, drain, bed rest, hydration, antibiotics had been used for treatment by spine surgeon7). However to our knowledge, there have been no previous studies which compared the effects of epidural blood patch for the treatment of incidental durotomy with other treatments . Epidural blood patch has been employed over the last five decades in the treatment of postdural puncture headache (pdph) and has proven to be beneficial . The mechanism by which an epidural blood patch (ebp) relieves pdph is not known . The " plug " theory for symptom resolution proposes that the blood injected during ebp forms a gelatinous plug, sealing the dural hole and preventing further csf leak into the epidural space . In the absence of continued loss, regeneration of csf restores csf pressure and alleviates the headache3). The " pressure patch " hypothesis emphasizes the impact of injected blood or other fluid (crystalloid or colloid) on the pressure dynamics of the cns . The injected fluid increases epidural pressure which, in turn, elevates subarachnoid csf pressure by compressing the dura8). The optimal volume of blood that must be injected is controversial but recommended volumes have increased over time . Crawford's initial experience using 6 - 15 ml produced a 30% failure rate while later experience with 20 ml produced a 96% success rate, so 20 ml became the recommended volume and has since become commonly cited as a " target volume " to enhance patch efficacy2). However, the effects of ebp in intracranial hypotension are mostly focused on post - dural puncture during csf tapping or spontaneous intracranial hypotension . Even patients with rather large amount of csf leakage and patients with severe complications such as intracranial hematomas have been effectively treated with ebp, so we considered epb for postoperative incidental durotomy due to such evidence . The effects of ebp in postoperative intracranial hypotension cannot be discussed after one successful clinical trial, but additional trials and studies can provide the basis of epb treatment in such cases . When incidental durotomy was recognized postoperatively, conservative therapy or surgical correction has been the therapeutic choice . However, because there has been no report on indication for ebp according to the degree of dural injury or the size of peudomeningocele, additional research is needed . In our case, the patient underwent l4 - 5 spine surgery at a local orthopedic, but dural injury was not recognized at that time . After admitting to our hospital, there was no significant resolution of symptoms after conservative therapy including the five days of bed rest and hydration . Epidural blood patch can be used as an effective treatment modality for csf leakage after lumbar spine surgery.
|
Pituitary insufficiency in childhood is often secondary to pituitary or hypothalamic space - occupying lesions . The differential diagnosis in etiologies of a mass in the sella is broad in spectrum, including rathke s cyst, tumor, autoimmune diseases, primary or metastatic neoplasms, and granulomatous inflammation . Among them, xanthomatous pituitary diseases are rare in childhood . These conditions include xanthomatous hypophysitis, xanthogranulomatous hypophysitis and xanthogranuloma of the sellar region (1,2,3,4,5). Xanthogranuloma of the sellar region is characterized by a granulomatous lesion containing cholesterol clefts, macrophages, chronic inflammatory infiltrates, and hemosiderin deposit (6). This condition has been traditionally regarded as a hallmark of the adamantinomatous craniopharyngioma even in the absence of epithelium (6). However, paulus et al . (7) suggested that xanthogranuloma is likely to constitute a different entity from the classical adamantinomatous craniopharyngioma clinically and pathologically . After their original report, several patients with xanthogranuloma of the sellar region have been described (8, 9). However, to our knowledge, there is no detailed clinical report of xanthogranuloma of the sellar region in cases of pediatric age . Here, we report the cases of two children with xanthogranuloma of the sellar region, presenting central diabetes insipidus (di). A 9-yr - old japanese boy was referred to our clinic because of a 6-mo history of polyuria and polydipsia . His height was 135.3 cm (+ 0.7 sd) and body weight 29.9 kg . The growth hormone (gh) releasing hormone (ghrh) and the thyroid stimulating hormone releasing hormone (trh) tolerance tests showed subnormal responses of gh and tsh, respectively (table 1table 1 endocrinological findings of cases 1 and 2). The corticotropin releasing hormone (crh) tolerance test showed normal responses of acth and serum cortisol (table 1). Magnetic resonance imaging (mri) the mass was hyperintense on the t1-weighted (a) and in the t2-weighted images (b). The pituitary stalk deviated to the frontal direction and the anterior pituitary gland was compressed by the tumor . There was no calcification of the mass detected by computed tomgraphic (ct) scan . Cyst was suspected preoperatively by the mri findings, however a definite diagnosis could not be made . The capsule of the tumor had tightly adhered to the dura of the sellar floor . Histological examination of the tumor showed fibrous tissue with cholesterol clefts, macrophages, multinucleated giant cells, and lymphocyte infiltration (fig . (b) macrophages (white arrowheads) and multinucleated giant cells (black arrowheads) were observed . Postoperatively, di remains and has been treated with desmopessin acetate (ddavp). Two months after surgery, gh and tsh responses after stimulation tests recovered (table 1). After one - year follow - up, the patient continues to have di, but his basal levels of igf-1, ft3, ft4 and tsh are within normal ranges . Radiological appearance on magnetic resonance imaging (mri). The mass was hyperintense on the t1-weighted (a) and in the t2-weighted images (b). (b) macrophages (white arrowheads) and multinucleated giant cells (black arrowheads) were observed . A 6-yr - old japanese boy was admitted to our hospital for evaluation of polyuria and polydipsia of 6-mo duration . His height was 113.2 cm (0.8 sd) and body weight was 18.8 kg . Brain mri showed an intrasellar mass, which was high on the t1-weighted (fig . Gadolinium administration caused no enhancement of the mass .) And hypointense on the t2-weighted images (fig . Ghrh, trh, and crh tolerance tests showed normal responses one month after surgery (table 1). The patient is currently well only on ddavp medication, 12 mo after surgery . A 9-yr - old japanese boy was referred to our clinic because of a 6-mo history of polyuria and polydipsia . His height was 135.3 cm (+ 0.7 sd) and body weight 29.9 kg . The growth hormone (gh) releasing hormone (ghrh) and the thyroid stimulating hormone releasing hormone (trh) tolerance tests showed subnormal responses of gh and tsh, respectively (table 1table 1 endocrinological findings of cases 1 and 2). The corticotropin releasing hormone (crh) tolerance test showed normal responses of acth and serum cortisol (table 1). Magnetic resonance imaging (mri) the mass was hyperintense on the t1-weighted (a) and in the t2-weighted images (b). The pituitary stalk deviated to the frontal direction and the anterior pituitary gland was compressed by the tumor . There was no calcification of the mass detected by computed tomgraphic (ct) scan . Cyst was suspected preoperatively by the mri findings, however a definite diagnosis could not be made . The capsule of the tumor had tightly adhered to the dura of the sellar floor . Histological examination of the tumor showed fibrous tissue with cholesterol clefts, macrophages, multinucleated giant cells, and lymphocyte infiltration (fig . (b) macrophages (white arrowheads) and multinucleated giant cells (black arrowheads) were observed . Postoperatively, di remains and has been treated with desmopessin acetate (ddavp). Two months after surgery, gh and tsh responses after stimulation tests recovered (table 1). After one - year follow - up, the patient continues to have di, but his basal levels of igf-1, ft3, ft4 and tsh are within normal ranges . Radiological appearance on magnetic resonance imaging (mri). The mass was hyperintense on the t1-weighted (a) and in the t2-weighted images (b). (b) macrophages (white arrowheads) and multinucleated giant cells (black arrowheads) were observed . A 6-yr - old japanese boy was admitted to our hospital for evaluation of polyuria and polydipsia of 6-mo duration . His height was 113.2 cm (0.8 sd) and body weight was 18.8 kg . Brain mri showed an intrasellar mass, which was high on the t1-weighted (fig . . The mass had a high appearance on the t1-weighted images (a). Gadolinium administration caused no enhancement of the mass .) And hypointense on the t2-weighted images (fig . Ghrh, trh, and crh tolerance tests showed normal responses one month after surgery (table 1). The patient is currently well only on ddavp medication, 12 mo after surgery . We report the cases of two children with xanthogranuloma in the pituitary region with di . Xanthogranuloma in the sellar region has been traditionally considered to be a variant of adamantinomatous craniopharyngioma despite the lack of epithelium (6). However, paulus et al . (7) reviewed histological sections of 110 patients diagnosed with craniopharyngioma and found sections from 37 patients were exclusively or predominantly composed of xanthogranulomatous tissue . According to their study, pathological findings were characterized by cholesterol clefts (100%), macrophages infiltrates, lympho - plasmacelluar infiltrates (100%), marked hemosiderin deposits (97%), fibrosis (87%), and foreign - body giant cells around cholesterol clefts (86%). Only sections from 3 of these patients had small adamantinomatous components (corresponding to calcifying odontogenic cyst), which are histological features of adamantinomatous craniopharyngioma . Based on these findings, paulus et al . Suggested that xanthogranuloma of the sellar region is pathologically distinct from adamantinomatous craniopharyngioma . In our two patients, histological findings of cholesterol clefts, macrophages including cholesterol droplets, multinucleated giant cells, lymphocytes, and the absence of adamantinomatous components are consistent with those previously reported by paulus et al . Clinically, xanthogranuloma in the sellar region has been reported to cause severe endocrinological deficits (7). (9) also described one adult japanese patient with xanthogranuloma in the pituitary showing panhypopituitarism . By contrast, our patients did not have severe defects of anterior pituitary hormones and showed only central di . In the first report, xanthogranuloma of the pituitary in children was reported, but the frequency in children, and the clinical and endocrinological findings were not mentioned (7). To answer whether clinical manifestations of xanthogranuloma in children are different from those of adults, more patients with xanthogranuloma of pediatric age must be studied . If xanthogranuloma is different form adamantinomatous craniopharyingioma, what is the origin of xanthogranuloma in the sellar region? Xanthogranulomatous inflammation (also known as cholesterol granuloma) has been reported in various tissues such as the middle ear, mastoid, and choroid plexus . Also the obstruction of the gall flow has been considered to cause inflammation, eventually developing to xanthogranulomatous cholecystitis (11). In addition, it is suggested that rathke s cyst and neuroepithelial cyst may undergo xanthogranulomatous changes (12, 13). Taken together, xanthogranuloma of the sellar region is likely to represent a non - specific tissue reaction to hemorrhage or degenerative changes originating from heterogeneous etiologies . It may be plausible that xanthogranulomas of our patients were responses to ruptured cysts, however, no confirmation of pre - existing cysts has been identified . Xanthogranuloma is difficult to differentiate from craniopharyngioma and rathke s cyst by mri findings . Cystic and solid lesions may have any pattern of signal intensity on the t1 and t2-weighted images, although most often they are hypointense to isointense on the t1-weighted images and hyperintense on the t2-weighted images . On ct, craniopharyngiomas typically appear as moderate - to - large, partially calcified mass . Rathke s cysts are present as intrasellar masses . As with craniopharyngiomas, the signal characteristics are variable on the t1 and t2-weighted images due to the variable quality of the cyst fluid . In our two patients, previously, two reports have also described xanthogranuloma as hyperintense on t1-weighted images (8, 9). In addition, there was no calcification of masses in our patients, as well as in previous reports (8, 9). These points may be helpful in considering xanthogranuloma of the pituitary region . However, there is no reliable way to distinguish xanthogranuloma from craniopharyngioma and rathke s cyst without histological examination . In conclusion, currently, whether this condition is a truly distinct entity or merely a different manifestation of adamantinomatous craniopharyingioma is unclear . To clarify the natural history, pathogenesis and prognosis in childhood, further accumulation of well - characterized pediatric cases with xanthogranuloma
|
A 52-year - old female patient visited the hospital complaining of pain in both breasts . The pain started immediately after breast reduction surgery she underwent 3 years previously at a private plastic surgery hospital, and it had continued despite a subsequent surgery . The pattern of the pain included burning, shooting and itching sensations at the operation site as well as unbearable burning sensations when the patient was in the places where the temperature was higher than normal . The pain as measured by the visual analogue scale (vas) was approximately 70/100 mm . In particular, the degree of pain was dependent on the season, and it was unbearable under hot weather, with the patient complaining of pain at vas 80 - 90/100 mm . Before coming to the hospital, the patient had taken aceclofenac (airtal, daewoong pharmaceutical) 200 mg, pregabalin (lyrica, pfizer) 300 mg, acetaminophen 1,300 mg and tramadol hcl 150 mg (ultracet, janssen korea) per day, but the pain was not relieved . Thus, the patient tried pregabalin 600 mg, acetaminophen 1,300 mg and tramadol hcl 150 mg per day, but there was no effect . Complaining of dizziness due to ultracet, the patient started to take 20 mg of oxycodone hcl (oxycontin, mundipharma korea) each day, but she eventually stopped taking it because of dizziness, nausea, and vomiting . Subsequently, the patient underwent drug treatment with pregabalin 300 mg a day, but she visited the hospital because the pain did not subside . There was no specific finding in a simple plane chest x - ray spectrograph, while digital infrared thermographic imaging (diti) showed a slight temperature drop in both breasts . Because the previous treatments were not effective in improving the symptoms and because the patient wanted another method of treatment due to the continued pain, it was decided that a thoracic epidural block would be performed, and informed consent was obtained from the patient . The patient was laid on her side and the epidural space was checked using the loss - of - resistance method with a 22-gauge epidural needle (hakko, japan) in between the t4 and t5, applying an aseptic technique in the interlaminar approach . 0.5% mepivacaine hcl (emcaine 2% inj. Reyon pharm) 6 ml was then injected . The pain was relieved into the vas range of 40 - 50/100 mm after the procedure, and the patient was discharged . The vas was decreased to 40 - 50/100 mm after an additional procedure a week later, but the patient complained of continued pain . A decision was made to carry out prf to the spinal nerve and its root and . To measure the level and determine the effect, informed consent was received from the patient after she was provided with an explanation of the procedure and the side effects that may occur after the procedure . For the diagnosis, selective nerve root block (snb) was performed at t3, t4 and t5, one level each time in order with an interval of 2 days, by injecting 1% lidocaine 0.5 ml with a 25-gauge quincke needle (spinocan, bbraun). Prf was carried out at the fourth thoracic spinal nerve and its root after giving an explanation to the patient about the procedure and the side effects that may occur after the procedure and receiving informed consent once again . After supporting the patient's lower abdomen with a pillow and placing her in a prone position, the site of the procedure was disinfected by a common sterilizing method and a standard monitor was attached . The area between t4 and t5 was identified in the anteroposterior view using a c - arm device and the 4 cm point right lateral from the t4 spinous process was chosen as the needle implantation point . Local anesthesia was carried out with 1% lidocaine, and a 20-gauge 10 cm long rf cannula (owl sharp curved rf insulated cannula, diros technology inc ., usa) with a 10 mm - active tip was then introduced into the anesthetized part . By continuously monitoring the position of the cannula with the c - arm, it continued to the inferior of end plate of fourth thoracic vertebral body (fig . 1), and the tip of the cannula was located at the posterior border of the vertebral space in the lateral view (fig . 3), and an rf generator (rfg-3c plus, radionics, usa) was then connected and an electric stimulus of 50 hz at 0.1 volt was applied . Electric stimulus of 2 hz at 0.1 volt was applied, and it was verified that the muscle did not contract up to 0.8 volt . One minute after injecting 1% mepivacaine 1 ml, prf was performed two times for 120 seconds at 42. the same procedure was performed on the opposite side after one week . During the procedure, the vital signs of the patient were normal and no side effect took place . After the procedure, the pain was reduced to vas 20 - 30/100 mm . The patient currently undergoes oral administration of pregabalin 300 mg / day and nortriptyline (sensival, ilsung pharm) 10 mg / day and this was followed up at the hospital for 9 months without particular exacerbation of the pain or any other inconvenience in her daily tasks . Pain after breast surgery, which is commonly complaint by patients, is known to be related with the injury, ischemia and inflammation of the soft tissue . If the pain in the affected part and arm continues for one year after the surgery, it is considered as chronic pain in general . The mechanism is not yet accurately known, but the chronic pain may be caused by injuries in various peripheral nerves that arise during the surgery and can develop into neuropathic pain such as stabbing, pricking, burning, shooting and sharp pains . Wallace et al . Investigated 282 women who underwent different types of breast surgery, and their result showed that 31% of women who underwent mastectomy, 49% of those who underwent mastectomy with reconstruction, 38% of those who underwent cosmetic augmentation and 22% of those who underwent breast reduction complained of pain up to one year after the surgery . Particularly, as the survival rate of breast cancer patients has increased, the number of patients who complain of chronic pain after breast cancer survey has also increased . The patient in this case study was also a chronic neuropathic pain patient whose pain had continued for 3 years following breast reduction surgery . She complained of pricking, shooting and burning sensations at the site of the operation . Although the patient complained of pain immediately after the surgery, she continued to suffer neuropathic pain for 3 years without being given appropriate pain treatment because she was not able to take medicine due to the side effects of the drugs . Macrae stated that severe acute pain after the surgery may be a risk factor for chronic pain . This can be one possible cause of the chronic pain of the patient in this case report, because she complained severe pain at vas 70 - 80/100 mm immediately after the surgery but the pain was not properly controlled . In general, it is thought that the intercostal nerve (icn) from t1 to t6 and the nerves that originate from those braches can be damaged by breast surgery . For the patient in this case report, because she complained of the pain at the dermatome of the t4 spinal nerve, neuropathic pain caused by damage at the 4th icn and at the branch was suspected . The effect of a nerve block in controlling pain after breast surgery is well known . In particular, it was reported that a paravertebral block (pvb) reduced pain, nausea and vomiting after breast surgery . In addition, kairaluoma et al . Reported that preoperative pvb reduced chronic pain after breast surgery . These results show that a nerve block can be used in controlling pain following breast surgery effectively, preventing it from becoming chronic . A nerve block using a local anesthetic is easy to perform in the treatment of pain and is effective in reducing pain . However, because the duration of desensibilization may not be sufficient depending on the disease causing the pain and because many repeated procedures may be required, radiofrequency thermocoagulation is sometimes employed to maintain the effect of the nerve block . Radiofrequency thermocoagulation was first introduced in 1930's by kirschner, who applied it treating trigeminal neuralgia at the gasserian ganglion . Recently, the application of radiofrequency thermocoagulation in the case of various diseases has gradually increased as quality of the radiofrequency generator, the associated equipment, and the catheter needle has been improved . This treatment is highly advantageous, in that a more accurate lesion can be generated compared to other nerve - destructive procedures . Moreover, the mechanism of radiofrequency thermocoagulation is known to change the nerve tissue due to the heat around the electrode, blocking and the inflow of the nerve stimulus . On the other hand, prf was introduced as a new method because another mechanism of radiofrequency - aided treatment arises in that a clinical effect is noted by the heat applied to the nerve and the electromagnetic field that forms around the electrode . Prf is a radiofrequency - aided treatment in which pulsed radiofrequency stimulus of 20 msec is generated two times every 0.5 second at a temperature of 42, which is low enough for the nerve tissue to remain undamaged . Prf is a novel treatment method that has corrected the problems of previous radiofrequency - aided treatments based on heat . It does not cause nerve destruction, side effects such as neuritis, or the complications of other types of radiofrequency - aided treatments based on heat . It can be performed to treat neuropathic pain even for body parts where side effects take place frequently due to radiofrequency thermocoagulation . It can be also performed on parts near bone or scar tissue, where the risk of complications is high when radiofrequency thermocoagulation is performed . Rohof applied prf to the suprascapular nerve in the treatment of chronic shoulder pain and reported it to be a novel treatment method that is free from side effects or complications, in contrast to the conventional thermocoagulation . Moreover, positive effects were reported when prf was applied to peripheral nerves such as the facial nerve, superior laryngeal nerve, suprascapular nerve, intercostals nerve, obturator nerve and the joint - dominating peripheral nerve articular branch, whose main nerve is sensory . In this case report as well, although the pain was controlled by an epidural block with a local anesthetic, repeated procedures were required due to the short duration of the first treatment . Long - lasting pain reduction was achieved without any specific side effect, as the prf was carried out on the spinal nerve and its root under monitoring by a c - arm device . In this article, we report a case in which prf was applied to control the pain of a patient who came to the hospital complaining of chronic severe neuropathic pain at the operation site that arose after breast reduction surgery . Appropriate pain control after breast surgery can reduce the suffering of the patient due to early pain and greatly affect the quality of life of the patient by preventing the pain from being chronic . If an appropriate pain treatment had been given after breast surgery to the patient in this case report, she would have not suffered from chronic pain . In the case of breast surgery, considerable attention should be paid to postoperative pain as well as surgical pain, and pain treatment should be carried out positively . It is thought that a nerve block as well as general analgesics can be helpful as a pain control strategy . In addition, prf may be helpful in reducing the pain of the patients who are not responsive to a nerve block using analgesics or local anesthetics . Furthermore, additional studies are needed regarding the reduction of chronic neuropathic pain by prf after breast surgery.
|
The generation of expressed sequence tags (ests) was originally proposed as a strategy for cdna characterization over a decade ago (1). Subsequent improvements in sequencing methods and dramatically reduced unit costs have increased the attractiveness of the est - based research, such that it is now one of the most widely employed methods used for gene discovery and genome characterization . Consequently, the number of organisms with est sequences deposited in the genbank dbest database is increasing rapidly (). To maximize the value of these ests, ncbi has built unigenes that incorporated est data for a number of species (), and the institute for genomics research (tigr) has been working on the gene indices for more than 70 species (). Annotating est and cdna sequences two tools that have been designed for locating protein - coding regions in cdna and est sequences are orffinder () and estscan (), respectively . The estscan server is designed for processing a batch of est sequences for identifying the protein - coding regions with a function for correcting insertions or deletions, but it is only trained for mammals and yeast . We tested estscan with our aspergillus niger est sequences and found that the results were not satisfactory . For example, using a full - length cdna sequence encoding glucoamylase, a well - characterized enzyme in a.niger, we found that estscan could not identify its correct coding region and had the undesired side effect of inserting nucleotides even when the test sequence was correct . We have implemented a web server called orfpredictor for the prediction of protein - coding regions within est - derived sequences . The algorithm uses the translation reading frames predicted by using blastx (2) as a guide for the identification of the coding region in sequences that have a hit (3) and predicts a coding region ab initio for sequences without a hit . A mature eukaryotic mrna molecule, starting from the 5 end, typically consists of a 5 cap, a 5-untranslated region (5-utr), a protein - coding region [open reading frame (orf)] and a 3-utr followed by a poly(a) tail . The protein - coding region extends from the start codon aug (atg in a cdna) and continues until the reading frame defined by the start codon is terminated by one of three translation stop codons, uga, uaa or uag . Most cdna libraries are constructed using oligo(dt) primers to direct first - strand synthesis by reverse transcriptase . Essentially, all clones in oligo(dt) primed cdna libraries will therefore include information for the 3 end of the processed transcript and a poly(a) region . Ests are single - pass sequencing reads obtained from either the 5 or 3 end of the cdna insert . The high - quality sequence obtained using systems, such as abi 3730xl, is typically 700800 nt per read . Given that the 3- and 5-utrs are typically much shorter than 500 nt, most ests and the consensus sequences (contigs) generated by an est assembler are expected to include some coding sequence useful for predicting gene function . In the annotation and analysis of ests, overlapping est sequences are often assembled into contigs to remove redundancy, reduce the frequency of sequencing errors and extend the length of sequence derived from each mrna species . Assuming the ests are sequenced from the 5 end, sequence information from contigs and individual ests fall into 10 categories (figure 1) as follows: a full - length sequence that includes the 5-utr with one or more stop codons (5 stop codon), translation start codon, complete protein - coding region, translation stop codon and the 3-utr . The protein - coding orf may have internal atg codons and the 3-utr may possess multiple stop codons . The 5-utr may be truncated.a full - length sequence as defined for category (a), except that it does not contain any 5 stop codons.a partial sequence that has a portion of the 5-utr, one or more 5 stop codons, the start codon and a portion of the coding region.a sequence that contains only 5-utr sequence and there is a 5 stop codon.a sequence that contains a 5-utr sequence, the start codon and a portion of the protein - coding orf.a sequence that contains only 5-utr sequence without a 5 stop codon.a sequence that contains a portion of the protein - coding region, but does not contain the start codon or the stop codon.a sequence with the potential protein - coding region truncated at its 5 end, one or more atg codons in the truncated orf, the stop codon and a 3-utr.a sequence that contains a portion of the potential protein - coding region and the 3-utr sequence.a sequence that contains a portion of the 3-utr and a poly(a) sequence at its 3 end . A full - length sequence that includes the 5-utr with one or more stop codons (5 stop codon), translation start codon, complete protein - coding region, translation stop codon and the 3-utr . The protein - coding orf may have internal atg codons and the 3-utr may possess multiple stop codons . The 5-utr may be truncated . A full - length sequence as defined for category (a), except that it does not contain any 5 stop codons . A partial sequence that has a portion of the 5-utr, one or more 5 stop codons, the start codon and a portion of the coding region . A sequence that contains only 5-utr sequence and there is a 5 stop codon . A sequence that contains a 5-utr sequence, the start codon and a portion of the protein - coding orf . A sequence that contains only 5-utr sequence without a 5 stop codon . A sequence that contains a portion of the protein - coding region, but does not contain the start codon or the stop codon . A sequence with the potential protein - coding region truncated at its 5 end, one or more atg codons in the truncated orf, the stop codon and a 3-utr . A sequence that contains a portion of the potential protein - coding region and the 3-utr sequence . A sequence that contains a portion of the 3-utr and a poly(a) sequence at its 3 end . For sequences generated by sequencing cdna inserts from their 3 ends, the categories of their reverse complementary sequences only include (a), (b), (h), (i) and (j). Therefore, it is more challenging to predict the coding region within an est than it is to predict the coding region of a fully sequenced cdna . Distinguishing the translation start codon from other atg codons remains a difficult task . Identifying start codons is further complicated because there is not a universal consensus sequence surrounding eukaryotic start codons, although the conserved consensus sequence, gccrccaugg (r: purine; aug: start codon) is present in mammals (4). However, blastx using a nucleotide query against a protein database is able to reliably identify protein - coding regions within a dna sequence if sufficient similarity exists between the translated query and an entry in the database (3). Sequencing errors may disrupt the conceptual translation of orfs, blastx could also detect frame shifts if there are insertions / deletions in the coding regions of the query sequences . When significant blastx alignments can be generated our algorithm uses them as a guide to identify the translation reading frames and coding regions . For est - derived sequences without a database match, their frames and coding sequences are predicted based on the presence and the location of intrinsic signals in a sequence that include start codons, 5 or / and 3 stop codons and stretches of poly(a) (figure 1). Our algorithm uses the following rules to locate protein - coding regions and predict the translation reading frame . For cases where blastx identified a significant database match (e - value lower than a user chosen threshold), the frame assignment in the blastx output will be used and rules 19 are applied . If there is a conflict, rules 1 and 2 will override the other rules . For sequences that do not produce a significant blastx alignment rules 310 rule 1: the predicted coding region must contain at least a portion of the translated query aligned by using blastx.rule 2: if there is a frame shift, the first frame assignment in the blastx alignment is used.rule 3: when there are no internal stop codons within a potential protein - coding region that is flanked by translation start and stop codons, the predicted coding region extends from the start codon to the stop codon (figure 1a).rule 4: a sequence that contains a poly(a) signature but does not contain a stop codon does not include any portion of the coding region (figure 1j).rule 5: if there are one or more atg codons in a sequence and they are all downstream from one or more stop codons, the first atg following the last 5 stop codon is selected as the start codon (figure 1a and c).rule 6: to be considered a potential coding region, an orf that is flanked by a 5 stop codon and a 3 stop codon must be at least 90 nt (code for a protein that has at least 30 amino acids).rule 7: if a sequence includes a poly(a) signature preceded by one or more 3 stop codons, but does not include a 5 stop codon, the sequence upstream of the stop codons is considered the coding region (figure 1b, h and i).rule 8: if a sequence lacks a poly(a) signature and encodes an orf without any stop codons, it is assumed that the entire sequence is the coding region (figure 1e, f and g). Although in rare cases (such as in figure 1f), the 5-utr will be considered as a coding sequence.rule 9: for cases like that presented in figure 1d, it is impossible to know if the stop codon is a 5 stop codon or a 3 stop codon, if it lacks a poly(a) signature . However, because cdna clones are more likely to be truncated at their 5 end, the program assumes in this case that the sequence upstream of the stop codon is the coding sequence.rule 10: the longest stretch of orf present in the six possible reading frames is selected as the coding region . Rule 1: the predicted coding region must contain at least a portion of the translated query aligned by using blastx . Rule 2: if there is a frame shift, the first frame assignment in the blastx alignment is used . Rule 3: when there are no internal stop codons within a potential protein - coding region that is flanked by translation start and stop codons, the predicted coding region extends from the start codon to the stop codon (figure 1a). Rule 4: a sequence that contains a poly(a) signature but does not contain a stop codon does not include any portion of the coding region (figure 1j). Rule 5: if there are one or more atg codons in a sequence and they are all downstream from one or more stop codons, the first atg following the last 5 stop codon is selected as the start codon (figure 1a and c). Rule 6: to be considered a potential coding region, an orf that is flanked by a 5 stop codon and a 3 stop codon must be at least 90 nt (code for a protein that has at least 30 amino acids). Rule 7: if a sequence includes a poly(a) signature preceded by one or more 3 stop codons, but does not include a 5 stop codon, the sequence upstream of the stop codons is considered the coding region (figure 1b, h and i). Rule 8: if a sequence lacks a poly(a) signature and encodes an orf without any stop codons, it is assumed that the entire sequence is the coding region (figure 1e, f and g). Although in rare cases (such as in figure 1f), the 5-utr will be considered as a coding sequence . Rule 9: for cases like that presented in figure 1d, it is impossible to know if the stop codon is a 5 stop codon or a 3 stop codon, if it lacks a poly(a) signature . However, because cdna clones are more likely to be truncated at their 5 end, the program assumes in this case that the sequence upstream of the stop codon is the coding sequence . Rule 10: the longest stretch of orf present in the six possible reading frames is selected as the coding region . The server provides a user interface for copy and paste, or for loading the users' sequences and blastx outputs . These various inputs are summarized as follows: a sequence file in the fasta format . The poly(a) or poly(t) signatures that identify mrna poly(a) tails should be retained, as they are used to determine the strand to be used for coding region and reading frame prediction.blastx output for all the est - derived query sequences . Although it is optional, the user is encouraged to provide a pre - run blastx output . The user can choose a cut - off e - value when setting up the blastx run . If a blast output file is provided by a user, the frame used in blastx for alignments will be used for the prediction of the protein - coding region . For query sequences without a blastx hit or for which the blastx output is not provided, predictions will be performed based on the intrinsic signals of the query sequences using the rules described above . Users can also use our targetidentifier server () to obtain blastx outputs for their query sequences . Targetidentifier server uses the uniprot / swiss - prot protein database.e - value: the user can also set a threshold e - value for their blastx file . If the e - value in the blastx file is larger than the user selected threshold, the query sequence will be taken as no hit. The default threshold is 1 10.strand: the user can choose which strand will be used for prediction . If the sequences were obtained by sequencing cdnas from the 5 ends, the + strand should be chosen . If the file contains sequences obtained by sequencing from both ends, both strands should be used for prediction . In this case, the default setting, users can select download or use email for receiving their results . A sequence file in the fasta format . The poly(a) or poly(t) signatures that identify mrna poly(a) tails should be retained, as they are used to determine the strand to be used for coding region and reading frame prediction . Although it is optional, the user is encouraged to provide a pre - run blastx output . The user can choose a cut - off e - value when setting up the blastx run . If a blast output file is provided by a user, the frame used in blastx for alignments will be used for the prediction of the protein - coding region . For query sequences without a blastx hit or for which the blastx output is not provided, predictions will be performed based on the intrinsic signals of the query sequences using the rules described above . Users can also use our targetidentifier server () to obtain blastx outputs for their query sequences . E - value: the user can also set a threshold e - value for their blastx file . If the e - value in the blastx file is larger than the user selected threshold, the query sequence will be taken as strand: the user can choose which strand will be used for prediction . If the sequences were obtained by sequencing cdnas from the 5 ends, the + strand should be chosen . If the sequences were obtained by sequencing cdnas from their 3 ends, the strand should be chosen . If the file contains sequences obtained by sequencing from both ends, both strands should be used for prediction . In this case, the default setting, an identifier for the sequence, the reading frame for the predicted coding region, the location of the beginning and end of the predicted coding region, a flag shown as fs that locates any translation frame shifts detected in the blastx alignment and the predicted protein sequence . The other file contains the query identifiers for those sequences that do not have predicted protein - coding regions (figure 1j). Most ests encompass only a portion of the mrna sequence . Therefore, it is more challenging to predict the coding region within an est than it is to predict the coding region of a fully sequenced cdna . Distinguishing the translation start codon from other atg codons identifying start codons is further complicated because there is not a universal consensus sequence surrounding eukaryotic start codons, although the conserved consensus sequence, gccrccaugg (r: purine; aug: start codon) is present in mammals (4). However, blastx using a nucleotide query against a protein database is able to reliably identify protein - coding regions within a dna sequence if sufficient similarity exists between the translated query and an entry in the database (3). Sequencing errors may disrupt the conceptual translation of orfs, blastx could also detect frame shifts if there are insertions / deletions in the coding regions of the query sequences . When significant blastx alignments can be generated our algorithm uses them as a guide to identify the translation reading frames and coding regions . For est - derived sequences without a database match, their frames and coding sequences are predicted based on the presence and the location of intrinsic signals in a sequence that include start codons, 5 or / and 3 stop codons and stretches of poly(a) (figure 1). Our algorithm uses the following rules to locate protein - coding regions and predict the translation reading frame . For cases where blastx identified a significant database match (e - value lower than a user chosen threshold), the frame assignment in the blastx output will be used and rules 19 are applied . If there is a conflict, rules 1 and 2 will override the other rules . For sequences that do not produce a significant blastx alignment rules 310 rule 1: the predicted coding region must contain at least a portion of the translated query aligned by using blastx.rule 2: if there is a frame shift, the first frame assignment in the blastx alignment is used.rule 3: when there are no internal stop codons within a potential protein - coding region that is flanked by translation start and stop codons, the predicted coding region extends from the start codon to the stop codon (figure 1a).rule 4: a sequence that contains a poly(a) signature but does not contain a stop codon does not include any portion of the coding region (figure 1j).rule 5: if there are one or more atg codons in a sequence and they are all downstream from one or more stop codons, the first atg following the last 5 stop codon is selected as the start codon (figure 1a and c).rule 6: to be considered a potential coding region, an orf that is flanked by a 5 stop codon and a 3 stop codon must be at least 90 nt (code for a protein that has at least 30 amino acids).rule 7: if a sequence includes a poly(a) signature preceded by one or more 3 stop codons, but does not include a 5 stop codon, the sequence upstream of the stop codons is considered the coding region (figure 1b, h and i).rule 8: if a sequence lacks a poly(a) signature and encodes an orf without any stop codons, it is assumed that the entire sequence is the coding region (figure 1e, f and g). Although in rare cases (such as in figure 1f), the 5-utr will be considered as a coding sequence.rule 9: for cases like that presented in figure 1d, it is impossible to know if the stop codon is a 5 stop codon or a 3 stop codon, if it lacks a poly(a) signature . However, because cdna clones are more likely to be truncated at their 5 end, the program assumes in this case that the sequence upstream of the stop codon is the coding sequence.rule 10: the longest stretch of orf present in the six possible reading frames is selected as the coding region . Rule 1: the predicted coding region must contain at least a portion of the translated query aligned by using blastx . Rule 2: if there is a frame shift, the first frame assignment in the blastx alignment is used . Rule 3: when there are no internal stop codons within a potential protein - coding region that is flanked by translation start and stop codons, the predicted coding region extends from the start codon to the stop codon (figure 1a). Rule 4: a sequence that contains a poly(a) signature but does not contain a stop codon does not include any portion of the coding region (figure 1j). Rule 5: if there are one or more atg codons in a sequence and they are all downstream from one or more stop codons, the first atg following the last 5 stop codon is selected as the start codon (figure 1a and c). Rule 6: to be considered a potential coding region, an orf that is flanked by a 5 stop codon and a 3 stop codon must be at least 90 nt (code for a protein that has at least 30 amino acids). Rule 7: if a sequence includes a poly(a) signature preceded by one or more 3 stop codons, but does not include a 5 stop codon, the sequence upstream of the stop codons is considered the coding region (figure 1b, h and i). Rule 8: if a sequence lacks a poly(a) signature and encodes an orf without any stop codons, it is assumed that the entire sequence is the coding region (figure 1e, f and g). Although in rare cases (such as in figure 1f), the 5-utr will be considered as a coding sequence . Rule 9: for cases like that presented in figure 1d, it is impossible to know if the stop codon is a 5 stop codon or a 3 stop codon, if it lacks a poly(a) signature . However, because cdna clones are more likely to be truncated at their 5 end, the program assumes in this case that the sequence upstream of the stop codon is the coding sequence . Rule 10: the longest stretch of orf present in the six possible reading frames is selected as the coding region . The server provides a user interface for copy and paste, or for loading the users' sequences and blastx outputs these various inputs are summarized as follows: a sequence file in the fasta format . The poly(a) or poly(t) signatures that identify mrna poly(a) tails should be retained, as they are used to determine the strand to be used for coding region and reading frame prediction.blastx output for all the est - derived query sequences . Although it is optional, the user is encouraged to provide a pre - run blastx output . The user can choose a cut - off e - value when setting up the blastx run . If a blast output file is provided by a user, the frame used in blastx for alignments will be used for the prediction of the protein - coding region . For query sequences without a blastx hit or for which the blastx output is not provided, predictions will be performed based on the intrinsic signals of the query sequences using the rules described above . Users can also use our targetidentifier server () to obtain blastx outputs for their query sequences . Targetidentifier server uses the uniprot / swiss - prot protein database.e - value: the user can also set a threshold e - value for their blastx file . If the e - value in the blastx file is larger than the user selected threshold, the query sequence will be taken as no hit. The default threshold is 1 10.strand: the user can choose which strand will be used for prediction . If the sequences were obtained by sequencing cdnas from the 5 ends, the + strand should be chosen . If the file contains sequences obtained by sequencing from both ends, both strands should be used for prediction . In this case, the default setting, users can select download or use email for receiving their results . A sequence file in the fasta format . The poly(a) or poly(t) signatures that identify mrna poly(a) tails should be retained, as they are used to determine the strand to be used for coding region and reading frame prediction . Although it is optional, the user is encouraged to provide a pre - run blastx output . The user can choose a cut - off e - value when setting up the blastx run . If a blast output file is provided by a user, the frame used in blastx for alignments will be used for the prediction of the protein - coding region . For query sequences without a blastx hit or for which the blastx output is not provided, predictions will be performed based on the intrinsic signals of the query sequences using the rules described above . Users can also use our targetidentifier server () to obtain blastx outputs for their query sequences . E - value: the user can also set a threshold e - value for their blastx file . If the e - value in the blastx file is larger than the user selected threshold, the query sequence will be taken as no hit. The default threshold is 1 10 . Strand: the user can choose which strand will be used for prediction . If the sequences were obtained by sequencing cdnas from the 5 ends, the + strand should be chosen . If the sequences were obtained by sequencing cdnas from their 3 ends, the if the file contains sequences obtained by sequencing from both ends, both strands should be used for prediction . In this case, the default setting, it contains the following information for each input sequence . An identifier for the sequence, the reading frame for the predicted coding region, the location of the beginning and end of the predicted coding region, a flag shown as fs that locates any translation frame shifts detected in the blastx alignment and the predicted protein sequence . The other file contains the query identifiers for those sequences that do not have predicted protein - coding regions (figure 1j). We evaluated the accuracy of orfpredictor using 2127 arabidopsis cdna sequences that have annotated protein sequences in genbank, and 4289 a.niger and 3065 phanerochaete chrysosporium sequences assembled from ests with phrap (). We first compared the predicted arabidopsis protein sequences obtained when blastx alignments were used as a guide with the annotated protein sequences in genbank, and confirmed that our program was able to predict the protein - coding regions with 100% accuracy . Then, we compared the ab initio predicted protein sequences with the results obtained by using blastx . We then examined the prediction accuracy using the a.niger and p.chrysosporium sequences, which had a blastx hit in the ncbi nr database with an e - value 1 10 . The ab initio predicted frames were then compared with the frames identified by using blastx . We found that the reading frame predicted ab initio was identical with the frames predicted by using blastx for 3943 (91.9%) of the a.niger sequences and 2867 (93.5%) of the p.chrysosporium sequences . We implemented a web server, orfpredictor, for predicting protein - coding regions in est - derived sequences . Orfpredictor uses the reading frame predicted by using blastx when a significant alignment is produced, whereas for sequences that do not return a significant blastx alignment protein - coding regions are predicted ab initio . The predicted protein sequences can then be used as the input for additional annotation tools, such as interproscan (5), for identifying protein families, domains and functional sites, the conserved domain search service (6) for the detection of structural and functional domains, and signalp (7) for locating potential signal peptides . Categories of information derived from the est sequences . (a) a typical full - length cdna sequence including one or more stop codons in the 5-utr, a start codon and a stop codon . The coding region may contain multiple atg codons encoding methionine and the 3-utr may harbor additional stop codons . (b) a full - length cdna without a stop codon in the 5-utr . (c) a sequence containing a 5-utr with a stop codon and a portion of the coding region . (d) a sequence containing a 5-utr with a stop codon . (e) a sequence containing a 5-utr without a 5 stop codon, and a portion of the coding region . (f) a sequence containing a portion of 5-utr without a 5 stop codon . (g) a sequence containing the internal portion of a coding region with or without internal atg codons . (h) a sequence containing a portion of the coding region with an internal atg codon, a 3 stop codon and 3-utr . (i) a sequence containing a portion of the coding region with no internal atg codons, a 3 stop codon and a 3-utr . Red star: stop codon at 5 end; green circle: start codon; blue circle: internal atg codon; red hexagon: stop codon; solid line: sequenced portion of the full - length cdna; and dashed line: unsequenced or truncated portion of the full - length cdna . The orfpredictor server interface for loading data and choosing other parameters.
|
Nature evolved a very limited number of chromophores in the different evolutionary branches of the tree of life because of the similar needs of the most diverse organisms for both the detection of the external world and the interaction with it . The study of these chromophores and their distribution inside cellular structures is usually based on extractive procedures, followed by biochemical or spectroscopic assays . Extractive techniques often include disadvantages: they can modify the nature of the components and they are not successful in isolating the chromophores . Direct investigation by means of microspectrophotometry of on intact samples has the advantage of preserving the integrity of biological structures or substructures . A microspectrophotometer is a simple apparatus consisting of a modified microscope that can measure absorption or emission spectra of very small areas inside a cell 1 . A high quality microscope is equipped with a polychromator, i.e. A flat field concave grating, which is connected to the slit - shaped exit pupil of a 19 light - guides probe . The dispersion image of the exit pupil produced by the polychromator is focused onto a digital slow scan cooled ccd camera . The main feature of this instrumentation is the possibility to measure in vivo absorption or emission spectra at the same time on different sub - cellular compartments using extremely low light intensities . This set - up represents a better strategy with respect to traditional instruments, since it eliminates errors typical of microspectrophotometry, such as photobleaching, distributional errors, the schwarzschild - villiger effect, and allows in vivo reliable spectroscopic investigations 2, 3 . The photosynthetic and the photoreceptive compartments are the main location of chromophores inside algal cells . Absorption and emission spectra measured in vivo on these compartments can provide very precise and accurate information about the spectral range in which chromophore molecules capture photons in their natural environment and their de - excitation pathways 4 . We tested our apparatus by measuring absorption spectra on the eyespot and chloroplast of the unicellular alga dunaliella and emission spectra on the photoreceptor and chloroplast of the unicellular alga euglena gracilis . Cultures . Euglena gracilis strain z (sammlung von algenkulturen gttingen, 1224 - 5/25) cells were grown axenically in cramer - myers medium 0.025 m in sodium acetate (ph 6.8) 5; cultures of dunaliella spp . (sammlung von algenkulturen gttingen, 19 - 5) were grown axenically in johnson's medium 6 . Both cultures were kept under constant temperature (24 c) and continuous illumination (2x10 mol photons m sec). The hardware platform consists of a zeiss axioplan microscope (zeiss, oberkoken, de), equipped with an epifluorescence system, 100x (n.a . The emission spectra were acquired with a combination of a uv - blue filter set (8 nm band pass excitation filter, 365 nm; chromatic beam splitter, 395 nm; barrier filter, 397 nm; irradiance 800 w / cm), and a blue - violet filter set (8 nm band pass excitation filter, 436 nm; chromatic beam splitter, 460 nm; barrier filter, 470 nm; irradiance 1100 w / cm). 77423 oriel, stratford, connecticut, usa) connected to a schott kl 1500 probe illuminator system (schott corporation, mainz, de) was mounted in the back focal plane of the ocular of the microscope (figure 1). This probe consists of an outer bundle of 24 light - guides and a central bundle of 19 light - guides (figure 2a). The outer bundle is used for centering the objects, while the central bundle of the probe is used for acquiring transmitted or emitted light . The sub - cellular components on which the spectra have to be measured, are placed in the microscope field and finely adjusted . The exit pupil of the probe (figure 2b) is connected to a flat field imaging concave grating polychromator (mod . 52300070, jobin yvon, longjumenau, france) that produces a dispersion image of the probe . This image is in turn focused onto a digital slow scan cooled ccd camera (dta discovery ds260e, pisa, italy), and it consists of 19 multi - lines strips showing the distribution of light intensity according to the wavelength . The microspectophotometer instrumentation possesses a graphical interface that allows the set - up of both the optics and the frame grabber (scion corporation, frederick, maryland, usa) and controls the measurements . Once the instrumental has been set - up, the operator, on the basis of the light guide positions upon the cell, selects the zones of the dispersion image displayed on the top of the graphical layout (in the layout r stands for reference, and s for sample). The resulting spectrum is displayed at the bottom of the graphical layout, (figure 3). Absorption measurements are based on the comparison of two radiant fluxes density is and ir . Is results from the interaction of light with the sample (it is related to absorption cross section of the molecules and the number of absorbing molecules) 7, while ir results from the interaction of light with the reference material . Therefore, we can consider the absorbance of a sample (as) as derived from the measures as follows: this equation is known as the lambert - beer's law . For the discussion on the theoretical aspects of image formation and the light transmission in microspectrophotometry see barsanti et al . Absorption spectra were performed on both the eyespot (screening device) and the chloroplast (photosynthetic apparatus) of the unicellular alga dunaliella . The central bundle of the probe was centered on both the structures in the apical portion of the cell (is), in such a way that some light - guides were located outside the cell; these guides measure ir . Measurements of emission microspectroscopy are based on the radiant flux density f. this density is given by: where ia is the amount of light absorbed by the chromophores; f is their fluorescence quantum yield and z represents the fraction of fluorescence collected by the objective, 9 . Emission spectra were performed on both the photoreceptor and chloroplast of the photosensitive alga euglena gracilis . The outer bundle of the probe was used for centering the photoreceptor and the chloroplast in the apical portion of the cell, while the central bundle of the probe was used for acquiring light emitted by the two structures . Photographs were taken with an olympus camedia c-30303 digital camera (olympus, tokyo, japan) mounted onto the microscope . The eyespot is recognizable as a the bright orange spot located on the left side of the cell in the apical portion . The size of the eyespot is about 3 and the size of the chloroplast is about 10; the probe is superimposed on the structures in order to show their relative position (figures 4b). This spectrum closely resembles the spectrum obtained by batra and tollin 10 on a suspension of eyespot granules, and the other in vivo spectra previously recorded by strother and wolken 11, by benedetti et al . Major peaks are due to lutein whose bands are centered at 410, 479.5, and 510 nm and -carotene whose bands are centered at 455.5, 481.5, and 510.5 nm (not shown). It clearly shows that dunaliella belongs to the green lineage of eukaryotic algae since only chlorophylls a and b and carotenoids are present in this spectrum . Gaussian bands decomposition of this spectrum is easily explained as a combination of chlorophyll a bands centered at (410, 435, 444, 585, 615, 626, 634.5, 663, 672, 678, 683, 695 nm, chlorophyll b bands centered at 412, 428.5, 445, 452, 582, 594, 607, 621.5, 652 nm, and carotenoids lutein and bands centered at 410, 479.5, and 510 nm, (not shown), 14 . The photoreceptor is recognizable as a the bright green spot located in the apical portion of the cell . The size of the photoreceptor is about 2 and the size of the chloroplast is about 10; the probe is superimposed on the structures in order to show their relative position (figure 6b). Figure 7a shows the emission spectrum of a single photoreceptor under 436 nm excitation light, after 10 seconds of excitation with the 365 nm light . Gaussian bands decomposition of the emission spectrum reveals 3 bands with different intensity centered at about 500 nm, 525 nm, and 556 nm (not shown). The bands obtained by the gaussian decomposition indicate the presence of a mixture of very similar conformers in the photoreceptor, each one capable of photocycling between a non - fluorescent parent species and a fluorescent excited species 15 . The presence in the photoreceptor of euglena of a photochromic chromophore, which undergoes light - driven reversible photochromism has been well established by means of digital and fluorescence microscopy 16 . The photoreceptor possesses optical bistability, i.e. Upon photoexcitation the ground state generates a stable excited state, which can be photochemically driven back to the ground state . The 27 kda protein extracted from the photoreceptor shows a similar behavior, the photochromic reaction cycling between two different stable conformers, the parent and the excited conformers 17 . Figure 7b shows the emission spectrum of the thylakoid compartment of euglena gracilis excited at 463 nm . It is the typical emission spectrum of a chloroplast that contains only chlorophyll a and b whose bands are centered at 685 for the photosystem ii and at 725 nm for the photosystem i, 18 . Set - up of the polychromator - based microspectrophotometer entrance (a) and exit (b) pupils of the light guide probe layout of the software interface a) bright field image of dunaliella . B) position of the probe upon dunaliella absorption spectra of the eyespot (a) and a chloroplast (b) of dunaliella a) fluorescent image of euglena gracilis; b) position of the probe upon euglena gracilis emission spectra of the photoreceptor (a) and a chloroplast (b) of euglena gracilis
|
The rostral ventromedial medulla (rvm) is an important relay region that contributes to the descending pain control pathway from the periaqueductal gray (pag) to the superficial laminae (laminae i and ii) of the spinal cord [1, 2]. It is well known that the rvm is closely linked to long - lasting activation of descending control circuits that involve descending facilitation, which significantly contributes to the development of persistent pain induced by tissue and nerve injury . Although many studies have focused on this region, the cellular and molecular mechanisms of descending pain facilitation control remain poorly understood . Due to the role of the descending pain facilitation pathway, several types of injuries, such as tissue and nerve injury, often become chronic and persistent, eventually leading to neuropathic pain ., significant progress has been made in basic and clinical studies; however, the currently available therapies for neuropathic pain remain inadequate, and the search continues not only for improved treatments but also for novel targets . The mammalian target of rapamycin (mtor), a conserved serine - threonine protein kinase that is inhibited by the effective clinical immunosuppressant rapamycin, regulates several intracellular processes in response to various extracellular signals and thereby modulates mrna translation . Thus, mtor plays a critical role in the modulation of long - term plasticity and memory processes [57]. Activation of the mtor complex with the protein raptor (mtorc1) promotes the phosphorylation of mtor downstream targets, including eukaryotic initiation factor 4e - binding protein (4e - bp1/2) and s6 kinase (s6k), which can further lead to local protein synthesis . It has been reported that deletion of either the 4e - bp1/2 or the s6k gene in mice results in deficits in synaptic plasticity and long - term memory [8, 9]. Moreover, phosphorylated mtor (p - mtor), which is the activated form, is upregulated in the peripheral nervous system as well as at the spinal cord level in several pain models [1015]. Inhibition of spinal cord mtor by intrathecal administration has proven to be effective in alleviating the nociceptive behaviors of animals under pain conditions [10, 11, 16, 17]. Synaptic plasticity changes in chronic pain conditions can occur not only at the spinal cord level but also at the supraspinal level, including the rvm . Therefore, considering the important role of the rvm in descending pain facilitation, targeting mtor in the rvm might be a promising way to combat pain . Because serotoninergic (5-htergic) neurons are the primary constitutive element in the rvm and can send projections to the superficial spinal dorsal horn (sdh) [1820], we thus hypothesize that 5-htergic spinally projecting neurons in the rvm contain mtor, the activation of which could in turn increase the excitability of the 5-htergic neurons and thus may potently potentiate the descending facilitation pain control pathway and exaggerate neuropathic pain conditions . Accordingly, we used a spared nerve injury (sni) model to evaluate the role of mtor in the rvm in neuropathic pain in rats . Adult male sprague - dawley (sd) rats (weighing 250290 g) were used in the present study . The ethics committee for animal experiments of the fourth military medical university (xi'an, china) approved the animal experiments (permit number: 10071). Briefly, rats were anesthetized with pentobarbital (45 mg / kg, i.p . ), and three terminal branches of the sciatic nerve were exposed by direct incision of the skin and a section of the biceps femoris muscle in the left thigh . The tibial and common peroneal branches were carefully tight - ligated with 5 - 0 silk sutures and sectioned distal to the ligation, removing 24 mm of the distal nerve stump . The surgical procedures for the sham - operated group were identical to those for the sni group, except that the nerves were not lesioned . Mechanical allodynia, as a behavioral sign of sni - induced neuropathic pain, was assessed by measuring the 50% paw withdrawal threshold (pwt) as described previously . The 50% pwt in response to a series of ascending von frey filaments (stoelting, kiel, wi, usa) was determined by the up - and - down method . Von frey force was delivered perpendicularly to the plantar surface of the hind paw for 2 to 3 seconds . An abrupt withdrawal of the hind paw during stimulation was recorded as a positive response . The 50% pwt was calculated using the following formula: 50% pwt = 10 . Mechanical allodynia was assessed by measuring the 50% pwt of the ipsilateral hind paw in sni- or sham - operated rats . Measurements of the paw withdrawal latency (pwl) were obtained using a timer that was started by the activation of the heat source and stopped when withdrawal of the paw was detected with a photodetector . Three measurements of the pwl were taken for each hind paw and were averaged as the result of each test session . The ipsilateral hind paw was tested with intervals of more than 5 min between consecutive tests . Fluoro - gold (fg) was used as a retrograde tracer to label the rvm neurons that project to the sdh . The procedures for fg injection were essentially the same as in our previous studies [20, 27]. Briefly, after exposing the lumbar cord, 0.1 l of a 4% solution of fg (fluorochrome, denver, co, usa) dissolved in 0.9% saline was stereotaxically injected into the left side of the lumbar dorsal horn with a microsyringe attached to a glass micropipette by pressure injection . Due to the transportation period of the tracer, after perfusion, the brains and spinal cords of the rats were cut into sections . The sections were used to evaluate the fg injection sites in the sdh as well as the distribution patterns of the retrogradely fg - labeled neurons in the rvm under an epifluorescence microscope (bx-60; olympus, tokyo, japan) using an appropriate filter for fg (excitation 350395 nm; emission 430 nm). After the rats were anesthetized with pentobarbital (45 mg / kg, i.p . ), a 26-gauge stainless steel guide cannula was stereotaxically implanted into a site above the rvm (10.52 mm posterior to bregma, 0 mm lateral from the midline, and 10.20 mm beneath the surface of the skull). Intra - rvm microinjections were delivered via a 33-gauge injector needle cannula that was lowered 0.5 mm deeper into the brainstem than the guide cannula . The microinjection apparatus consisted of a hamilton syringe (10 l) connected to an injector (33-gauge) by a thin polyethylene tube and a motorized syringe pump . Rapamycin (250 m/1 l, dissolved in a saline / dmso mix comprising 25% dmso, tocris bioscience, minneapolis, mn, usa), the specific inhibitor for mtor, was infused into the rvm at a rate of 0.1 l / min; an equivalent volume of 25% dmso was used as a vehicle . After injection, the microinjection needle was left in place for at least 2 min . The injection sites were verified at the end of all of the experiments by nissl staining, and injection sites outside the rvm region were excluded from the study . These rats were randomly divided into two groups designed for different purposes, as shown in figure 6(c): group 1: to investigate whether rapamycin could influence the induction stage of sni - induced neuropathic pain, behavioral tests were performed before the first drug or vehicle injection, followed by sni (pre - sni), and 30 min after the second injection on day 1 after sni (sni - d1) (figure 6(c), top) and group 2: behavioral tests were performed before sni (pre - sni), 6 days after sni (sni - d6), and 30 min after drug or vehicle injection on day 7 after sni (sni - d7) for the purpose of demonstrating the effect of rapamycin on the maintenance stage of sni - induced neuropathic pain (figure 6(c), bottom). The rats were transcardially perfused with 150 ml of 0.01 m phosphate - buffered saline (pbs, ph 7.4), followed by 500 ml of 4% paraformaldehyde in 0.1 m phosphate buffer (pb, ph 7.4). The brainstems and/or spinal cords were transversely sliced into 25 mm thick coronal sections using a freezing microtome (cm1950, leica, heidelberg, germany). Double - immunofluorescence staining for p - mtor / neun, p - mtor / fg, or p - mtor/5-ht was performed . The sections were sequentially incubated at room temperature with primary antisera in 0.01 m pbs containing 5% normal donkey serum (nds), 0.3% triton x-100, 0.05% nan3, and 0.25% carrageenan (pbs - nds, ph 7.4) for 24 h. then, the sections were incubated with fluorescein - labeled igg (secondary antisera) for 6 h. a negative control experiment, in which the primary antisera were omitted, and a peptide competition assay were both carried out . After the immunofluorescence histochemical staining, the sections were observed and images were captured using a confocal laser - scanning microscope (clsm, fv1000, olympus). Micrographs of 1012 sections per rat, which were 150 m apart within bregma 9.30 to 11.60 mm, were analyzed for p - mtor expression . Using imagej software, the rvm area, including the nucleus raphe magnus (rmg) and the nucleus reticularis gigantocellularis pars, the p - mtor - positive cells within the area were counted manually by an observer blinded to the treatment conditions . The same counting method was used to evaluate the coexpression of 5-ht / p - mtor as well as that of p - mtor / fg within the rvm . Cells with visible green cytoplasmic staining represent 5-htergic or fg - labeled cells, while red staining represents p - mtor - positive cells; thus, cells with 5-ht or fg double - labeling with p - mtor appear yellow . The rats were decapitated, and brain slices (400 mm) containing the rvm were cut at 0c with a vibratome (vt1200s, leica) in a sucrose cutting solution containing the following (in mm): kcl 2.5, nah2po4 1.2, nahco3 26, sucrose 252, mgso47h2o 6, cacl2 0.5, and glucose 10, bubbled with 95% o2/5% co2 (ph 7.4). For the electrophysiology studies, the brain slices were transferred to a submerged recovery chamber with oxygenated artificial cerebrospinal fluid (acsf) containing the following (in mm): nacl 124, kcl 2.5, mgso47h2o 2, nah2po4 1, nahco3 25, cacl2 2, and glucose 37 for 2 hours at room temperature before recording . For the biochemical experiments, the slices were slowly brought to a final temperature of 30c in acsf gassed with 95% o2/5% co2 and incubated for at least 1 hour before the experiments . The brain slices were treated with rapamycin (250 m) and vehicle for 30 min . Subsequently, the rvm regions were microdissected and snap - frozen over dry ice . Following the standard western blot protocol, rats were anesthetized with an overdose of pentobarbital (60 mg / kg, i.p . ), and the rvm regions were carefully dissected and harvested for western blotting . To obtain total protein extracts, the tissues were lysed in 300 l lysis buffer containing 10 mm tris, 150 mm nacl, 1% triton x-100, 0.5% np-40, and 1 mm edta at ph 7.4 . The samples were adequately mixed at a 100: 1 (v / v) ratio of protease inhibitor cocktail and phosphatase inhibitor cocktail (roche, tucson, az, usa). The procedures for the in vitro - infused brain slices were similar to those of the tissue protocols . Then, 30 g of cell lysis material (quantitatively measured using the bca protein assay; thermo scientific, rockford, il, usa) was resolved by sodium dodecyl sulfate - polyacrylamide gel electrophoresis (sds - page) and transferred to pvdf membranes (immobilon - p, millipore). After blocking in nonfat milk for 1 h, the membranes were incubated overnight at 4c with the following primary antibodies: rabbit anti - mtor (1: 1000, cell signaling technology); rabbit anti - p - mtor (1: 1000, cell signaling technology); rabbit anti - s6k (1: 1000, cell signaling technology); rabbit anti - p - s6k (1: 1000, cell signaling technology); and mouse anti--actin (1: 5000, sigma, st . The immunoblots were then reacted with the corresponding horseradish peroxidase- (hrp-) conjugated secondary antibodies (anti - rabbit 1: 5000, anti - mouse 1: 5000; amersham pharmacia biotech, piscataway, nj, usa). All of the reactions were detected by the enhanced chemiluminescence (ecl) detection method (amersham) and exposure to film . Target protein levels were normalized against -actin levels and expressed as fold changes relative to the nave control group . Neurons in the rvm region were targeted for recording using an upright microscope equipped with zeiss (oberkochen, germany) infrared - differential interference contrast (ir - dic) optics, a 40 water - immersion objective, and a video - imaging camera . The patch pipette was filled with intracellular solution containing the following (in mm): k - gluconate 130, nacl 5, kcl 15, egta 0.4, hepes 10, mg - atp 4, and tris - gtp 0.2, ph 7.257.35, with an osmotic pressure of 290300 mosm / l . The pipette resistance, as measured in the bath, was typically 4 0.5 m. the voltage was held at 60 mv, and neurons were given at least 3 min to stabilize before data were collected . Spontaneous discharge and the number of action potentials were used to investigate sni - induced changes in neuronal excitability in the rvm . The excitatory postsynaptic currents (epscs) of the rvm 5-htergic neurons, which are mediated by ampa receptors, were voltage - clamped and recorded at 60 mv with an axon 700b amplifier (molecular devices, sunnyvale, ca, usa) after blocking gabaergic transmission by picrotoxin (100 mm, sigma), a gabaa receptor antagonist . The membrane excitability of the recorded neurons was measured in current - clamp mode by determining the number of action potentials elicited by intracellular injection of 0, 10, 20, 30, 40, 50, and 60 pa depolarizing currents for 400 ms . The spike number was determined to estimate the influence of rapamycin on the recorded neurons . In all cases, biocytin (0.5%) was introduced into the intracellular solution to identify the morphological properties of the recorded neurons . After recording, the brain slices were immediately fixed in 4% paraformaldehyde in 0.1 m pb for 4 h at room temperature . Then, sections were rinsed with 3% hydrogen peroxide in 0.01 m pbs for 30 min . After thorough washing with pbs, the tissue was incubated with a goat anti-5-ht (1: 500, immunostar) antibody in pbs - nds (ph 7.4) for 24 h, followed by incubation with alexa 594 avidin d (1: 1000, invitrogen) and alexa 488 donkey anti - goat (1: 500, invitrogen) antibodies in pbs for 6 h at room temperature . The sections were then observed, and images were captured with a confocal microscope (olympus). Two - way anova with bonferroni multiple comparisons tests or one - way anova with tukey's multiple comparisons post hoc tests were used for between - groups comparisons (e.g., the western blot data with surgery and drug administration as main effects). Student's paired t - test was used to analyze the differences between two groups (e.g., the difference in the numbers of p - mtor - positive cells between the sni - induced neuropathic pain group and the sham group). Spared nerve injury (sni) produced increased nociceptive responses to innocuous mechanical stimulation (mechanical allodynia) of the ipsilateral hind paw in rats from as early as post - sni operation day 1, and this effect was maintained for at least 2 weeks (figure 1(a)). However, sni had no impact on the latency of withdrawal to the radiant heat stimulus (no thermal hyperalgesia) (figure 1(b)). In fact, our present data are consistent with a previous report demonstrating that the low mechanical threshold induced by sni could persist even for 9 weeks after surgery, but there was no reported decrease in the hind paw withdrawal latency to the radiant heat stimulus . By using double - immunofluorescence staining, we found that the activated form of mtor, p - mtor, was expressed in the rvm, and it was exclusively expressed by neurons based on the observation that p - mtor was almost completely colocalized with neun, a marker for neurons, in rats in both the sham (figures 2(a)2(c)) and post - sni day 7 groups (figures 2(d)2(f)). We observed that the number of p - mtor - positive neurons was significantly increased in the rvm on day 7 after sni compared to the sham group (figures 2(a), 2(d), and 2(f)), indicating that activation of mtor in the rvm may contribute to sni - induced neuropathic pain . It has been reported that s6k, a main downstream substrate for mtor, is involved in several intracellular processes, including neuronal plasticity and long - term memory . Therefore, we used western blot analysis to further evaluate the mtor signaling pathway, including mtor and s6k, in the rvm after sni . Compared with nave control rats, the expression of both phosphorylated mtor and phosphorylated s6k (p - mtor and p - s6k) was not significantly altered in the sham rats (figures 2(h), 2(i), and 2(k)). As indicated in figure 2(h), p - mtor and p - s6k were significantly elevated in the rvm 3 days after sni, and phosphorylation was maintained for at least 14 days compared to the control group (figures 2(h) and 2(i); p - mtor: sni d3: 1.42 0.25; sni d7: 1.86 0.39; sni d14: 1.49 0.28-fold of naive control, p <0.05; p - s6k: sni d3: 1.75 0.23; sni d7: 1.96 0.57; sni d14: 1.61 0.28-fold of nave control, p <0.05, n = 4). The change in p - s6k was similar to that in p - mtor, indicating that the mtor signaling pathway in the rvm was activated by sni 3 days after surgery . Compared with the nave control group, p - mtor and p - s6k expression was slightly increased, but no significant difference was detected at 1 day after sni (figures 2(h), 2(i), and 2(k), p - mtor: sni d1: 1.17 0.36-fold of nave control, p> 0.05; p - s6k: sni d1: 1.14 0.38-fold of nave control, p> 0.05, n = 4). Total mtor and s6k were not changed in any of the groups in the present study (figures 2(h), 2(j), and 2(l)). In summary, these data suggest that the mtor signaling pathway, including mtor and s6k, was activated in the rvm, which might indicate new protein synthesis and could result in changes in neuroplasticity . Injections of fg into the lumbar sdh (figure 3(a) and 3(b)) resulted in many retrogradely labeled spinally projecting neurons in the rvm (figure 3(d)). Although fg was injected unilaterally into the (left) lumbar sdh, 81.9% (203/248) of the retrogradely labeled spinally projecting neurons contained p - mtor - immunoreactive (ir) staining (figures 3(c)3(e)), which indicates that more than three - quarters of the spinally projecting neurons in the rvm express p - mtor . Because 5-htergic neurons have previously been shown to be involved in the descending pain control pathway, particularly those localized within the rvm, we further investigated the relationship between 5-ht and p - mtor . Our immunofluorescence staining results showed that a majority of the p - mtor - ir neurons contained 5-ht (figures 4(a)4(f)). The number of 5-htergic neurons was slightly increased within the rvm in the sni rats, but no statistical significance was detected compared to the sham control group (25.52 5.13 per section in the sni d7 group versus 20.8 4.02 in the sham control group, n = 3 rats / group, p> 0.05). Interestingly, 5-ht - positive p - mtor - ir neurons were remarkably increased in the rvm 7 days after sni compared to sham rats (figure 4(g)). In contrast, 5-ht - negative p - mtor - ir neurons were not significantly altered 7 days after sni (figure 4(h)). These results indicate that sni - induced neuropathic pain caused a substantial upregulation of p - mtor, which primarily occurred in 5-htergic neurons in the rvm . As reported previously, rapamycin is a specific and effective inhibitor of mtor . To investigate the inhibitory effect of rapamycin in vitro, we incubated brain slices containing the rvm with rapamycin (250 m) for 30 min . We found that sni significantly increased the expression of both p - mtor and its downstream substrate p - s6k (figure 5(a), p - mtor: sni d7 + vehicle: 1.80 0.48-fold of sham + vehicle, p <0.05; p - s6k: sni d7 + vehicle: 1.77 0.45-fold of sham + vehicle, n = 4, p <0.05), which is inconsistent with our tissue western blot data . Moreover, rapamycin (250 m) significantly reversed the upregulation of p - mtor as well as p - s6k after 30 min of drug infusion (p - mtor: sni d7 + rapamycin: 1.11 0.27-fold of nave control versus sni d7 + vehicle: 1.80 0.48-fold of nave control, p <0.05; p - s6k: sni 7d + rapamycin: 1.17 0.29-fold of nave control versus sni d7 + vehicle 1.77 0.45-fold of nave control, n = 4, p <0.05), indicating that rapamycin could rapidly inhibit the activation of mtor after sni in vitro . To further investigate the neuronal excitability of 5-ht and the effect of rapamycin on 5-htergic neurons in the rvm a total of sixty 5-ht - positive neurons (n = 60) from 12 rats were identified by biocytin introduction in combination with 5-ht immunofluorescence staining (figure 5(b)). Moreover, they showed a relatively higher membrane capacitance (cm) and a smaller membrane resistance (rm) compared to other small neurons in the rvm, indicating that they have a larger membrane surface and smaller electrical resistance . We first investigated the frequency and amplitude of spontaneous excitatory postsynaptic currents (sepscs) in the rvm neurons . Most of the 5-htergic neurons recorded in the rvm that were responsive to rapamycin showed increased activity . Inconsistent with previous reports, the frequency and amplitude of sepscs were significantly increased after sni (figures 5(c)5(f)), which indicates that the probability of presynaptic transmitter release and the postsynaptic neuronal excitability, respectively, was elevated . Subsequently, we used rapamycin (250 m) to evaluate whether the enhanced presynaptic and postsynaptic excitability could be reversed . We found that the amplitude (baseline, 45.26 1.89 pa; rapamycin, 35.83 2.58 pa . P <0.05, n = 15, paired t - test), but not the frequency (baseline, 3.41 0.12 hz; rapamycin, 3.29 0.33, p> 0.05, n = 15, paired t - test), of the sepscs was inhibited by rapamycin application in rats with sni but not in the sham control rats (frequency: baseline, 1.22 0.11 hz; rapamycin, 1.20 0.19 hz . P> 0.05, n = 15, paired t - test; amplitude: baseline, 29.79 1.80 pa; rapamycin, 28.14 1.28 pa . P> 0.05, n = 15, paired t - test) (figures 5(c)5(f)). These results suggest that rapamycin can decrease the postsynaptic excitability of 5-htergic neurons in the rvm after sni . We next compared the effects of rapamycin on the action potentials of the 5-htergic neurons and determined that the spike number of the recorded neurons was obviously increased after sni (figures 5(g) and 5(h)). Rapamycin (250 m) did not change the spike number in recorded neurons from the sham group (f(1,62) = 2.25, p> 0.05, n = 15, two - way repeated measures anova) (figure 5(g)). However, in the presence of rapamycin, the spike number of 5-htergic neurons in the sni group was significantly reduced (f(1,48) = 8.56, p <0.05, n = 15, two - way repeated measures anova) (figure 5(h)). These results indicate that rapamycin inhibited the excitability of 5-htergic neurons in the rvm under neuropathic pain conditions . We preliminarily investigated nociceptive behaviors in the sni rats mentioned above . In agreement with previous reports, significant mechanical allodynia rather than thermal hyperalgesia was observed in the present study (figure 1). Based on this observation, we next used mechanical pwt instead of heat pwl to assess the nociceptive behaviors . To determine whether rapamycin could prevent the development of the induction stage of mechanical allodynia, we microinjected rapamycin via a cannula implanted into the rvm (figures 6(a) and 6(b)) immediately before sni surgery and at day 1 after sni, which was followed by behavioral testing 30 min later (figure 6(c)). After treatment with rapamycin, the pwt in the sni + rapamycin group showed no significant change compared to that in the sni + vehicle control group at day 1 after sni (figure 6(d)), indicating that rapamycin could not alleviate the neuropathic pain induced by sni in the induction stage . Subsequently, we investigated whether rapamycin could reverse established neuropathic pain . On day 6 after sni, the rats demonstrated typical increased nociceptive responses to nonnoxious mechanical stimulation (figure 6(e)). Compared with the vehicle control group, the mechanical allodynia was significantly reduced after microinjection of rapamycin into the rvm on day 7 after sni (figure 6(e)). Because our biochemical results showed that the amount of both p - mtor and p - s6k was increased after sni (figures 2(h), 2(i), and 2(k)) and because rapamycin infusion into the brain slices could effectively reverse the upregulated level of p - mtor and p - s6k (figure 5(a)), we concluded that the effect of rapamycin in partially reversing the mechanical allodynia was exerted via inactivation of the mtor signaling pathway, thus decreasing the excitability of 5-htergic spinally projecting neurons in the rvm . In the current study, we provide the first demonstration of the following: (1) mtor is expressed in the rvm region and can be activated in nerve injury - induced neuropathic pain; (2) this mtor is largely expressed in 5-htergic neurons, which mainly comprise the descending pain control pathway; (3) inhibition of the activated mtor restores the overexcitability of the 5-htergic neurons to normal; and (4) inactivation of mtor by intra - rvm rapamycin microinjection alleviates established hyperalgesia (abolished at the maintenance stage of neuropathic pain) rather than influencing the beginning priming (induction stage) of neuropathic pain . These findings suggest that the mtor signaling pathway in the rvm is involved in the maintenance of nerve injury - induced neuropathic pain and that inhibition of mtor in the rvm could effectively alleviate neuropathic pain in sni rats . Due to the importance of the descending pain control pathway in mammals, it has been demonstrated that blockade of rvm activity with lidocaine produced conditioned place preference (cpp), which is linked to pain relief, in nerve injury models, indicating that descending pain facilitation pathways modulate injury - induced spontaneous tonic pain . Wei et al . Have reported that selectively depleting functional 5-ht phenotypes in rvm neurons with shrna interference (rnai) of tryptophan hydroxylase-2 (tph-2, the rate - limiting enzyme in the synthesis of neuronal 5-ht) attenuated tissue or nerve injury - induced allodynia and hyperalgesia . This finding provides strong evidence that descending 5-ht from the rvm is an important contributor to pain facilitation during the development of persistent pain . Recently, by taking advantage of optogenetic methods, optogenetic stimulation in tph2-channelrhodopsin 2 (chr2) transgenic mice was shown to decrease both mechanical and thermal pain thresholds . However, in contrast, several studies showed the opposite results [3235], that 5-ht from the rvm is important for the descending inhibitory pathway . These controversial arguments regarding whether rvm 5-ht plays a facilitatory or inhibitory role might be explained by the different subtypes of 5-ht receptors located in the sdh, according to the reports . For example, 5-ht3 receptors are reported to mediate descending facilitation and to contribute to pain hypersensitivity, whereas the activation of 5-ht2 receptors can potentiate glycine release in the sdh to inhibit pain transmission . In addition, a previous study also provided evidence that, under conditions of experimental pain, activation of 5-ht7 receptors leads to antinociceptive effects in the spinal cord . In the present study, we found that 5-htergic neurons were slightly, although not significantly, increased after nerve injury . However, the excitability of these 5-htergic neurons was elevated after sni (figure 5). Rapamycin could effectively inhibit 5-ht overexcitability and thus attenuate hyperalgesia (figure 6), which indicates that 5-ht in the rvm is probably involved in the descending pain facilitation pathway under nerve injury - induced neuropathic pain conditions . Mtor has been extensively studied in tumors, cardiovascular diseases, and neurodegenerative disorders [40, 41]. Recently, emerging evidence has indicated that mtor plays a role in pain processing, and it is becoming clear that mtor is important in the regulation of nociception, at both the peripheral and spinal cord levels [1017]. To date, however, no report has investigated mtor at the supraspinal level and its role in nociceptive modulation . Here, we provide potent evidence that mtor contributes to neuropathic pain by increasing the neuronal excitability of 5-htergic neurons in the rvm, thus potentiating descending pain facilitation . 4e - bp1/2 and s6k are involved in the regulation of cell physiology through the modulation of protein synthesis . 4e - bp1/2 inhibits the interaction of the cap - binding translation initiation factor eif4e with other elongation factors, which is a key regulatory process in translation . Mtor - mediated phosphorylation of 4e - bp1/2 releases this inhibition, allowing translation initiation to proceed . S6k - mediated phosphorylation of s6 promotes the unwinding and initiation of translation of a subgroup of mrnas called 5-terminal oligopyrimidine tract (top) mrnas . Top mrnas encode ribosomal proteins and elongation factors 1a and 2, which are important in translational control . In the present study, we detected that p - mtor and p - s6k levels were significantly elevated in the rvm after sni (figure 2), which suggests that mtor - mediated protein translation and synthesis are increased . In contrast, the number of 5-htergic neurons was slightly increased within the rvm in the sni rats, but no statistical significance was detected compared to the sham control group . However, by using whole - cell patch recording, we found that the 5-htergic neurons were overexcited, with significant increases in the amplitude and frequency of sepscs as well as the number of action potentials (figure 5). In addition, rapamycin inhibited only the amplitude and not the frequency of sepscs (figure 5); we thus propose that the postsynaptic overexcitability of the 5-htergic neurons, which primarily depends on an increase in glutamate receptors, is mainly due to the activation of mtor . It has been reported that mtor signaling can potentiate the insertion of ampa (-amino-3-hydroxy-5-methyl-4-isoxazole - propionic acid) receptors into the postsynaptic membrane and lead to long - term potentiation (ltp) [44, 45]. Thus, the data collected from our immunofluorescence staining and electrophysiology are consistent with previous reports and suggest that the activation of mtor might lead to an increase in ampa receptors and their insertion into the postsynaptic membrane, resulting in the elevated neuronal excitability of the 5-htergic neurons in the rvm . As an effective immunosuppressant, rapamycin is widely used to prevent transplant rejection . Chronic treatment of patients with mtor inhibitors is associated with an increased incidence of pain [46, 47], including the possible development of complex regional pain syndrome (crps) [48, 49]. These conflicting results might be due to the following reasons: (1) the drug concentration of rapamycin or its analogues was not the same as in the other reports in which the inhibition of mtor produces antinociception; (2) long - term treatment might lead to feedback activation of other pronociceptive signal proteins or molecules; and (3) intrathecal administration of rapamycin (at the spinal cord level) might play a very complicated role in pain transmission with unknown mechanisms . The present study used intra - rvm, instead of intrathecal, administration of rapamycin (250 m, 30 min before the behavioral tests), and this treatment remarkably attenuated the nociceptive behaviors induced by sni (figure 6). Moreover, intra - rvm rapamycin treatment was effective on day 7 after sni (the maintenance stage of neuropathic pain) but not on day 1 after sni (the induction stage). The behavioral pharmacological data suggest that inhibition of mtor in the rvm at the late phase (maintenance stage) of neuropathic pain might be effective, even though pain has already been well established . By contrast, inhibition of mtor in the rvm had no effect on the development (induction stage) of neuropathic pain . All of these results are consistent with our biochemical data showing that rvm p - mtor was not greatly enhanced at day 1 but showed a significant increase at 7 days after sni (figure 2). Combining our current results with previous findings, we conclude that the specific inhibition of mtor by rapamycin in the rvm is a promising avenue for the management of neuropathic pain . This effect probably occurs via deactivation of 5-htergic spinally projecting neurons in the rvm, which are required for descending pain facilitation . Due to the lack of a specific mtor activator, reverse experiments involving the activation of mtor in the rvm, which should produce or enhance nociception, are difficult to achieve . Moreover, optogenetic methods as well as transgenic animals should be further introduced to confirm the role of mtor in the rvm, not only in neuropathic pain but also in inflammatory pain . Through the deactivation of 5-htergic spinally projecting neurons in the rvm and thus the weakening of descending pain facilitation, specific targeting of the activation of mtor in the rvm is a promising avenue for the management of neuropathic pain.
|
Traditional diagnostic methods and liberal indications for surgery have resulted in negative laparotomy rates ranging from 12 - 40% . While negative laparotomy was previously accepted as the inevitable and innocuous result of this policy, recent reports by renz and others have highlighted the 6 - 40% incidence of complications that accompany nontheraputic abdominal exploration . In view of these data, and dissatisfied with our own 33% negative laparotomy rate, prospective evaluation of the role of diagnostic laparoscopy in the evaluation of suspected penetrating abdominal injury was undertaken in september 1995 to identify those patients who could safely avoid surgical intervention, with the expectation that the rate of negative trauma celiotomy would markedly decrease . In this report we review our experience with 70 consecutive patients who underwent diagnostic laparoscopy, and discuss the benefits and pitfalls in diagnosis we encountered utilizing this technique . A prospective study of patients with penetrating injuries to the lower thorax and anterior abdomen admitted to the bellevue hospital trauma and shock unit, a level i trauma center in new york city, was performed between september 1995 through november 1997 . Patients who were hemodynamically stable without obvious evidence of peritoneal penetration or free intra - abdominal air on upright chest radiograph were entered into the protocol . In light of evidence that co2 pneumoperitoneum may result in an increase in intracranial pressure, patients with known or suspected central nervous system injuries were initially excluded from the protocol . However, the use of diagnostic laparoscopy may be appropriate in head - injured patients when intracranial pressure monitors are in place . After initial evaluation in the emergency room, informed consent was obtained and the patient was transferred to the operating room . General endotracheal anesthesia was induced, orogastric tube and foley catheter inserted, and open laparoscopy performed with the hasson trocar positioned infraumbilically . After insufflation with carbon dioxide gas to 15 mm hg, a 10 mm laparoscope with attached video camera was inserted into the peritoneal cavity, and exploration performed . In patients with thoracoabdominal injuries and suspected diaphragmatic tears, a low pressure pneumoperitoneum of 8 - 10 mm hg was created, the diaphragms visualized, and if no diaphragmatic injuries were present, the pneumoperitoneum was raised to 15 mm hg . Routine thoracostomy tubes were not placed prophylactically in light of zargut's reported 1% pneumothorax rate following carbon dioxide insufflation (5 of 510 patients); rather, the anesthesia and surgical teams were alerted to the possible development of a tension pneumothorax in patients at risk for diaphragmatic injury . If no peritoneal violation was noted, or an isolated non - bleeding injury to the liver was present beneath the site of peritoneal penetration, the procedure was terminated, and the patient subsequently discharged from the hospital . If peritoneal violation, major organ injury or hematoma were noted, the procedure was converted to open celiotomy . During this period we did not utilize the technique of gasless laparoscopy, or perform minilaparoscopy in the emergency department with local anesthesia utilizing 3 - 5 mm videoscopes . Trauma service records were reviewed for the two years which preceded this study (1993 1994); the overall negative exploration rate for all patients with penetrating abdominal trauma during that time period was 33% . Sixty - four (91%) patients were male and six (9%) female . Forty - four patients (63%) suffered stab wounds to the anterior abdomen, eleven (16%) stab wounds to the left chest with suspicion of intra - abdominal injury, (19%) with abdominal gunshot wounds . Two additional patients (3%) involved in motor - vehicle accidents were evaluated laparoscopically after indeterminate computed tomo - graphic (ct) scans . The mean operative time for laparoscopy was 16 minutes (range: 3 60). The mean time for negative laparoscopy was 23 minutes, and 10.8 minutes for laparoscopy with positive findings . Forty - one (59%) procedures met criteria for positive laparoscopy: thirty - nine were converted to celiotomy and two additional nonbleeding liver injuries were treated nonoperatively . Twenty - five (65%) of the 39 laparotomies were considered therapeutic by the operating surgeon . Among the 14 nontheraputic laparotomies, ten were performed in patients with peritoneal penetration visualized on laparoscopy but found to have no intraperitoneal injury at laparotomy, three revealed only minor nonbleeding liver injuries early in our study that the individual attending surgeon was unwilling to treat nonoperatively, and one was performed for free blood secondary to a minor omental laceration . In patients without associated injuries, the mean length of stay following negative laparoscopy was 1.5 days in 21 patients (range: 1 4; the single 4-day stay was due to social service issues), compared to 5.2 days (range: 3 8) for 12 negative explorations following positive laparoscopy . There were no anesthetic complications in the study group, and no tension pneumothoraces or air emboli occurred . One small bowel injury resulted from insertion of the hasson trocar, and was repaired primarily in a patient during laparotomy for a thoracoabdominal gunshot wound with liver, adrenal and diaphragmatic injuries . No intra - abdominal injuries were missed in the negative laparoscopy group (table 1). However, two of ten patients (20%) who underwent negative laparoscopy for lower left chest stab wounds required urgent return to surgery from the recovery room for missed ongoing hemothoraces . One was a 23-year - old female stabbed in the left anterior axillary line at the 7th intercostal space . A closed tube thoracostomy was per - formed for a nonbleeding pneumothorax upon initial presentation to the emergency room, and she was transferred to the operating room, where laparoscopy revealed no evidence of peritoneal penetration . Soon after arrival in the recovery room she drained 750 milliliters of blood from her chest tube and became hypotensive . She was returned to the operating room, where thoracotomy revealed an actively bleeding injury to the lingula which was successfully controlled by stapled wedge resection . The second patient also required a left thoracotomy to oversew bleeding from the lung parenchyma . The mean operative time for laparoscopy was 16 minutes (range: 3 60). The mean time for negative laparoscopy was 23 minutes, and 10.8 minutes for laparoscopy with positive findings . Forty - one (59%) procedures met criteria for positive laparoscopy: thirty - nine were converted to celiotomy and two additional nonbleeding liver injuries were treated nonoperatively . Twenty - five (65%) of the 39 laparotomies were considered therapeutic by the operating surgeon . Among the 14 nontheraputic laparotomies, ten were performed in patients with peritoneal penetration visualized on laparoscopy but found to have no intraperitoneal injury at laparotomy, three revealed only minor nonbleeding liver injuries early in our study that the individual attending surgeon was unwilling to treat nonoperatively, and one was performed for free blood secondary to a minor omental laceration . In patients without associated injuries, the mean length of stay following negative laparoscopy was 1.5 days in 21 patients (range: 1 4; the single 4-day stay was due to social service issues), compared to 5.2 days (range: 3 8) for 12 negative explorations following positive laparoscopy . There were no anesthetic complications in the study group, and no tension pneumothoraces or air emboli occurred . One small bowel injury resulted from insertion of the hasson trocar, and was repaired primarily in a patient during laparotomy for a thoracoabdominal gunshot wound with liver, adrenal and diaphragmatic injuries . No intra - abdominal injuries were missed in the negative laparoscopy group (table 1). However, two of ten patients (20%) who underwent negative laparoscopy for lower left chest stab wounds required urgent return to surgery from the recovery room for missed ongoing hemothoraces . One was a 23-year - old female stabbed in the left anterior axillary line at the 7th intercostal space . A closed tube thoracostomy was per - formed for a nonbleeding pneumothorax upon initial presentation to the emergency room, and she was transferred to the operating room, where laparoscopy revealed no evidence of peritoneal penetration . Soon after arrival in the recovery room she drained 750 milliliters of blood from her chest tube and became hypotensive . She was returned to the operating room, where thoracotomy revealed an actively bleeding injury to the lingula which was successfully controlled by stapled wedge resection . The second patient also required a left thoracotomy to oversew bleeding from the lung parenchyma . The mean operative time for laparoscopy was 16 minutes (range: 3 60). The mean time for negative laparoscopy was 23 minutes, and 10.8 minutes for laparoscopy with positive findings . Forty - one (59%) procedures met criteria for positive laparoscopy: thirty - nine were converted to celiotomy and two additional nonbleeding liver injuries were treated nonoperatively . Twenty - five (65%) of the 39 laparotomies were considered therapeutic by the operating surgeon . Among the 14 nontheraputic laparotomies, ten were performed in patients with peritoneal penetration visualized on laparoscopy but found to have no intraperitoneal injury at laparotomy, three revealed only minor nonbleeding liver injuries early in our study that the individual attending surgeon was unwilling to treat nonoperatively, and one was performed for free blood secondary to a minor omental laceration . In patients without associated injuries, the mean length of stay following negative laparoscopy was 1.5 days in 21 patients (range: 1 4; the single 4-day stay was due to social service issues), compared to 5.2 days (range: 3 8) for 12 negative explorations following positive laparoscopy . There were no anesthetic complications in the study group, and no tension pneumothoraces or air emboli occurred . One small bowel injury resulted from insertion of the hasson trocar, and was repaired primarily in a patient during laparotomy for a thoracoabdominal gunshot wound with liver, adrenal and diaphragmatic injuries . No intra - abdominal injuries were missed in the negative laparoscopy group (table 1). However, two of ten patients (20%) who underwent negative laparoscopy for lower left chest stab wounds required urgent return to surgery from the recovery room for missed ongoing hemothoraces . One was a 23-year - old female stabbed in the left anterior axillary line at the 7th intercostal space . A closed tube thoracostomy was per - formed for a nonbleeding pneumothorax upon initial presentation to the emergency room, and she was transferred to the operating room, where laparoscopy revealed no evidence of peritoneal penetration . Soon after arrival in the recovery room she drained 750 milliliters of blood from her chest tube and became hypotensive . She was returned to the operating room, where thoracotomy revealed an actively bleeding injury to the lingula which was successfully controlled by stapled wedge resection . The second patient also required a left thoracotomy to oversew bleeding from the lung parenchyma . The optimal management of the asymptomatic patient with penetrating thoracoabdominal trauma has yet to be determined . Prior to september 1995, the criteria for mandatory laparotomy at our institution were broad and included all anterior abdominal gunshot injuries, and stab wounds to the anterior abdomen with posterior fascial penetration demonstrated by local wound exploration . Recent reports have emphasized the complication rate following negative laparotomy for trauma, ranging from a six percent to 20% incidence in renz and feliciano's series of 81 patients with penetrating abdominal trauma without associated injuries, and 22% in sosa's recent comparison of mandatory laparotomy and diagnostic laparoscopy for asymptomatic abdominal gunshot wounds . Leppaniemi et al . From finland reported their 24-year experience of a 40% negative laparotomy and 21% complication rate in 457 patients following mandatory laparotomy for penetrating truncal trauma . While many of the complications following negative laparotomy in these four reports were minor sosa et al . Prospectively studied 85 patients with asymptomatic abdominal gunshot wounds by diagnostic laparoscopy, and compared them to the preceding four - year period when mandatory laparotomy was performed in a similar group of 817 patients . He was able to document a drop in the negative laparotomy rate from 12.4% to 4.7% when routine diagnostic laparoscopy was instituted . Additionally, there was a significant decline in average length of stay from 5.1 to 1.4 days, with no missed intraperitoneal injuries and only one significant complication (urinary retention) following negative laparoscopy . The largest experience to date with the use of diagnostic laparoscopy is a retrospective multicenter study of 510 patients with penetrating abdominal trauma . In this series, 54.3% of exams revealed either nonpenetration or nonsignificant injuries, and the mean hospital stay was 1.7 days in the absence of associated injuries . Laparotomy was considered therapeutic in 155 of the 213 patients (73%) who underwent formal abdominal exploration . Is an additional group of 26 patients who underwent therapeutic laparoscopy, including repair of diaphragmatic and anterior gastric lacerations, and control of hepatic bleeding . While it is not clear from this paper whether laparoscopy resulted in a reduction in the rate of negative laparotomy (which was 25% overall in this combined series), it does indicate that laparoscopy can safely and reliably select those patients without intraperitoneal injury who can be spared a negative laparotomy . In view of these reports, and dissatisfied with our own negative laparotomy rate, prospective evaluation of diagnostic laparoscopy was undertaken with the expectation that insignificant injuries could be reliably identified, thus reducing both the incidence of negative celiotomy and hospital length of stay . In the 70 consecutive patients who underwent diagnostic laparoscopy, the negative laparotomy rate was 20%, and if the trivial liver injuries explored early in our experience are excluded, the rate drops to 16% . This is comparable to the negative laparotomy rates of 11 - 20% following laparoscopy recently reported by other authors . Overall, the negative exploration rate for all patients with penetrating abdominal trauma treated during this time period at our institution fell from 33% to 20% . While a significant decrease in our negative laparotomy rate occurred, it is still not negligible, and this failure to eliminate nontheraputic laparotomy in one - fifth of the cases of penetrating trauma is the achilles' heel of diagnostic laparoscopy as currently practiced . As our ability to laparoscopically explore the peritoneal cavity, reliably examine the large and small bowel, and perform laparoscopic repair of selected injuries improves, the negative laparotomy rate should continue to decline and can be expected to approach five percent . Since bellevue hospital charges a fixed comprehensive daily rate, a true cost analysis could not be made, leaving the length of stay as the only valid index of comparison; during the study period it was 5.2 days following negative laparotomy as compared to 1.5 days after negative laparoscopy . At current charges of $1,000 per day, a 3.7 day decrease in length of stay represents a $3,700 reduction in cost per patient, which translates into an overall savings of $77,700 for the 21 patients who underwent negative laparoscopy and did not require additional hospitalization for associated injuries . While primarily used to evaluate penetrating injuries, laparoscopy also proved to be a useful tool in selected blunt trauma patients with benign clinical exams and indeterminate radiologic studies . One patient had a minimal amount of free fluid in the pelvis on computed tomography (ct); laparoscopy revealed turbid fluid, and a perforation of the antimesenteric border of the proximal jejenum was found and repaired at laparotomy . The second patient was a pedestrian struck by a taxi on the right flank and hip; she was hemodynamically stable and complained only of right hip pain upon evaluation in the emergency room . There was a question of bowel gas above the left hemidiaphragm on chest roentgenogram, and both ct scan and upper gastrointestinal series were equivocal regarding the presence of a diaphragmatic rupture . Laparoscopy revealed free blood in the peritoneal cavity, and a splenic laceration and intact left hemidiaphragm were found at exploration . Another subgroup in whom diagnostic laparoscopy proved efficacious was in the evaluation of the trauma patient infected by the human immunodeficiency virus . Three hiv+ patients with abdominal stab wounds and equivocal physical exams underwent negative laparoscopy, sparing all three an unnecessary abdominal exploration . Laparoscopy has been championed by some authors as a routine maneuver in the evaluation of penetrating lower chest injuries to detect clinically and radiologically occult diaphragmatic injuries . In this study, laparoscopy was selectively employed to evaluate those lower chest injuries felt to be at particular risk for intra - abdominal injuries, and one diaphragmatic injury was detected and repaired . However, two of the remaining ten patients with thoracoabdominal stab wounds who underwent negative diagnostic laparoscopy manifested ongoing thoracic blood loss that necessitated return to the operating room, reinduction of general anesthesia and thoracotomy for definitive control of pulmonary parenchymal bleeding . Clearly, routine diagnostic laparoscopy in these patients resulted in initial evaluation of the wrong body cavity, and lulled us into a false sense of security regarding the extent and severity of injury . Thus, in patients with penetrating thoracoabdominal trauma and negative diagnostic laparoscopy, we now believe that diagnostic thoracoscopy should be performed before the patient leaves the operating room . The applications of thoracoscopy in the trauma patient are expanding; this technique can be used to detect and repair diaphragmatic injuries, evaluate the pericardium, and treat both ongoing and established hemothoraces . This experience confirms that laparoscopy is a safe and accurate tool for identifying peritoneal penetration following penetrating abdominal trauma, and adoption of this technique resulted in significant decreases in both the rate of negative laparotomy, and the hospital length of stay following a negative evaluation . One drawback is that the rate of negative laparotomy, while reduced, remains in the range of 1020% in our experience and recent comparable series . Diagnostic laparoscopy reliably identifies those injuries to the liver that can be safely managed nonoperatively . It also proved useful in the evaluation of the hiv+ patient with equivocal findings on physical exam, and of stable patients with indeterminate or while other authors have demonstrated its sensitivity in the detection of diaphragmatic injuries, we urge caution in its use as the primary diagnostic study in penetrating thoracoabdominal trauma based on our experience with missed major intrathoracic injuries, and are currently investigating the complementary role of thoracoscopy in penetrating lower thoracic injuries.
|
Selenium (se) has been recognized as an essential nutrient for plant, animal, and human body, but at high concentration it can become toxic . The range between the concentration in which selenium is essential and toxic is very narrow [1, 2]. This element plays an important role in elderly people as well as in the prevention of many age - associated diseases and in maintenance of normal immune function . Se is potent antioxidant involved in cellular defense against free radical reactions, and the risk of deficiency seems to increase in proportion to the age . Evidence is accumulating that most of the degenerative diseases have their origin in deleterious free radical reactions . These diseases include atherosclerosis, cancer, inflammatory joint, asthma, diabetes, senile dementia, and degenerative eye disease . But high se concentrations in human can cause loosing hair and nails and irritation of skin and eye . The required daily amount of se is 20 mcg day and 4070 mcg day for 46 years old and adult males, respectively . The essential role of the se is due to its presence in the active site of some enzymes (i.e., glutathione peroxidase and iodotironine-5-deiodinase) and the catalytic effect of selenium compounds on the reaction of intermediate metabolism and inhibition of the toxic effect of heavy metals . It has been established that diets with deficit in se are associated with some human diseases, but diets with se contents higher than 5 mg / kg are toxic and cause important symptoms in humans and animals . Selenium is present as selenocysteine (se - cys) in at least 30 proteins . All these factors, together with the fact that the concentration levels are extremely low, call for sensitive and accurate method for the determination of this element . Selenium can be present in 2, 0, + 4, and + 6 oxidation states . These forms cannot simultaneously be evaluated by direct application of certain analytical techniques such as instrumental neutron activation analysis (inaa) [6, 7], as well as hydride generation atomic absorption spectroscopy (hg - aas), inductively coupled plasma atomic emission spectrometry (icp - aes), electrothermal atomic absorption spectrometry (et - aas), or inductively coupled plasma mass spectrometry (icp - ms), after digestion of sample [810]. The most common methods used for determination of various species of selenium were atomic absorption spectrometry (hydride generation and electrothermal atomization) [1114], molecular [15, 16] and atomic fluorescence spectrometry [1719], high - performance liquid chromatography (hplc) [2022], voltammetry [23, 24], atomic emission spectrometry (aes), such as inductively coupled plasma (icp) and inductively coupled plasma - mass spectrometry (icp - ms), and spectrophotometry methods [2528]. In spite of some of the above methods, spectrophotometric methods are popular because of their simplicity and are based on piazselenol complex formation between the reagents and selenium . An interesting alternative to traditional liquid - liquid extraction is the micelle - mediated extraction, firstly developed by watanabe and tanaka . The cloud point is the temperature above which aqueous solutions of nonionic and zwitterionic surfactant become turbid . Micelles of such well - known nonionic surfactant as triton x-100 or x-114 have a nonpolar core and extended polar layer, where both extractants and extracted complexes can be solubilized . Above the cloud point, the solution is separated into two phases, a rich phase containing a high surfactant concentration in a small volume and a poor phase with a surfactant concentration close to the critical micelle concentration (cmc). Hydrophobic species (hydrophobic organic compounds or metal ions after reaction with a suitable hydrophobic ligand) present in sample are able to interact with the micelles, thus being concentrated in the small volume of the surfactant - rich phase . The aim of this work was to use a simple, rapid, and sensitive spectrophotometric method (dithizone as chromogenic reagent) for determination of trace amounts of selenium (iv) (5100 ng ml) in micellar medium (triton x-100) in cosmetic and pharmaceutical products . To improve the detection limit of this method, cloud point extraction (cpe) has been used . Selenium metal (purity: 99.9%) was obtained from the riedel de haen (germany). Nitric acid (> 99.5%), sodium hydroxide (> 97%), ascorbic acid, hydrochloric acid (36.538%), phenol (> 99.0%), methanol (> 99.8%), and sulfuric acid (95.097.0%) were purchased from merck (germany). All chemicals were used without any further purification . Deionized water from a milli - q system (millipore, usa) was used for preparation of all solutions . Selenium sulphide shampoo (iran), centrum tablet (usa), and selen plus capsule (germany) were obtained from market . A shimadzu double - beam uv - vis spectrophotometer (model 1650 pc, japan) with 1.0 cm quartz cell was used for all spectral measurements . In order to investigate the accuracy of method a perkinelmer (model optima 7000 dv) inductively coupled plasma optical emission spectrometer (icp - oes) separation of surfactant phase and aqueous phase was carried out with a hettich centrifuge (eba 20, uk). A microwave system (microdigest 301, prolabo, france) with a maximum irradiation power of 200 w was used . Ph measurements were made with a metrohm ph meter (model 744, switzerland). The effect of temperature was investigated by a gfl thermostated bath (model 1003, germany). The stock standard solution of selenium (iv) (1000 g ml) was prepared by dissolving 100 mg of selenium metal in hot concentrated nitric acid and diluted to 100 ml with water . From this solution serial dilutions were made to obtain different concentration levels of 5, 15, 30, 40, 55, 70, 80, and 100 ng ml of selenium (iv). The stock solution of dithizone (10 mol l) was prepared daily by dissolving 12.8 mg of the reagent in 5 ml of naoh solution (0.1 m, containing the 50 mg of ascorbic acid for stabilizing the dithizone) and diluting to 50 ml with water . The stock solution was diluted with water to obtain the final dithizone concentration of about 7.5 mol l. the stock solution of triton x-100 (10% (w / v)) was prepared by weighing 10 g of this reagent into 100 ml volumetric flask, dissolving in water by gentle heating, and making up to the mark with water . The final concentration of triton x-100 (0.2%) was prepared by suitable dilution of stock solution with the diluent (solution of 0.5% (w / v) of phenol). An aliquot of 50 ml of a solution containing selenium (iv) (final concentration 5100 ng ml), triton x-100 (0.2% (w / v)), dithizone (7.5 mol l), and hcl (0.35 m) was kept for 15 min to complete the color development . Then the mixture was placed in a water bath at 40c for 10 min, when 0.5% (w / v) of the phenol was used for inducing the cloud point . Phase separation was accelerated by centrifuging the test tube at 3500 rpm for 15 min . The bulk aqueous phases were easily decanted by gently inverting the test tubes, and the surfactant - rich phase (complex rich) was made up to 5 ml by adding methanol . The same procedure was applied for preparation of blank solution without the selenium and dithizone . The absorbance of two methanolic solutions was measured at 424 and 592 nm, against a blank (prepared in the same way without se and dithizone). The absorption maxima of the complex (424 nm) and dithizone (434 nm) were overlapping (figure 1). Hence, the corrected absorbance, a corr, was used to overcome the problem: (1)acorr = a424(a424a592)la592, where a 424 and a 592 are the absorbance of the complex measured at 424 and 592 nm, respectively, and (a 424/a 592)l is the absorbance ratio of dithizone at 424 and 592 nm . The complex does not show any absorbance at 592 nm . Under optimum conditions, a calibration graph was used for determination of selenium in cosmetic and pharmaceutical products . Shampoo (selenium sulphide, iran) sample dissolution was prepared using the procedure described by afkhami et al . . Approximately 1 g of shampoo sample was weighted into a 100 ml beaker . Concentrated sulfuric acid (1 ml) the solution was allowed to cool, and 5 ml of 30% (w / v) hydrogen peroxide was added . The mixture boiled vigorously to eliminate excess hydrogen peroxide and allowed to cool and then the digest transferred to a 100 ml volumetric flask . Finally, 2 ml of this solution was taken for determination of selenium (iv) as in the recommended procedure . A centrum tablet (usa) containing 0.25 mg se (as sodium selenate) was placed in digestion vessel . 5 ml of concentrated nitric acid and 2 ml of hydrogen peroxide were added and the mixture subjected to microwave irradiation (25% of power, 5 min) in order to digest the sample . Then, 10 ml of hydrochloric acid (6 m) was added, and the mixture was irradiated by microwave (75% of power, 5 min) in order to reduce all se to se (iv). . 1 ml of treated sample solution was dropwise passed through an eichrom cation exchange resin (sulfonic acid groups, mesh ranges: 50100 m, 8 cm), for removal of interferences, and selenium was determined with the recommended procedure . A selen plus capsule (germany) was dissolved in 10 ml hcl (6 m), and the mixture was irradiated by microwave (75% of power, 5 min) in order to reduce all se to se (iv). The mixture was then diluted to 50 ml with water, and then 1 ml of this mixture was taken for determination of selenium (iv) as in the recommended procedure . From the plot obtained by job's method of continuous variation, the se- (iv) to- dithizone (h2dz) ratio forming the complex was found to be 1: 4 at ph <1 . The complex can, therefore, be represented as se(hdz)4 which is in agreement with the reported composition in the organic phase . The conditional stability constant of the 1: 4 (se: h2dz) complex was calculated, assuming the following equilibrium in the system: (2)h2seo3 + 4 h2dzse(hdz)4 + 3h2o . Using the plot obtained by job's method, xmax (chdz / ctotal) was found to be 0.8, and therefore the ratio of se: hdz was calculated 1: 4 (figure 1). Selenium (iv) reacts with dithizone (hdz) in micellar medium and forms a hydrophobic complex, se(hdz)4, which is subsequently trapped in the surfactant micelles and separated from the aqueous phase . Figure 2 shows the absorption spectra for the dithizone and selenium - dithizonate complex in surfactant - rich phase against a reagent blank . The absorption maximum of the complex was 424 nm, and the absorption maxima of the dithizone were 434 and 592 nm . Solution ph plays a unique role on metal - chelate function and subsequent extraction . Figure 3 shows the influence of hcl concentration on the corrected absorbance of the selenium dithizonate complex at 424 nm . As can be seen, the complex extraction was increased with the increased hcl concentration and then showed a decrease . The reason for this behaviour might be because of decreasing the dithizone stability at higher phs . Hence, an hcl concentration of 0.35 m was chosen for further studies . The influence of the dithizone (hdz) concentration on analytical response is shown in figure 4 . This figure shows that the absorbance increased up to a known concentration of dithizone (7.5 mol l) and then reached a plateau that can be attributed to complete extraction . Therefore, the concentration of 7.5 mol l of dithizone was selected as the optimum . The nonionic surfactant triton x-100 was chosen because of its commercial availability of high purified homogeneous form, low toxicological properties, and cost . The cloud point temperature of triton x-100 is 63.7c . To decrease the cloud point temperature of triton x-100 to room temperature (desirable temperature in cloud point procedure), this solution was prepared by the diluent (solution of 0.5% (w / v) of phenol). The variation of absorbance at max of complex as a function of the concentration of triton x-100 is shown in figure 5 . At lower concentrations of triton x-100, the low extraction efficiency of the complex may be due to the inadequacy of the assemblies to entrap the hydrophobic complex quantitatively . The concentration of 0.2% (w / v) triton x-100 was selected for further studies . Optimal incubation time and equilibration temperature are necessary to complete the reaction, easy phase separation, and preconcentration as efficient as possible . Providing that the complexation reaction has been completed under certain conditions, corrected absorbance data show that, for equilibration times of 10 to 30 min, extraction efficiency is almost constant . On the other hand, it appears that the phase volume ratio of all nonionic surfactants decreases as the equilibration temperature increases . As can be seen in figure 7, the corrected absorbance increases very gently up to 40c and starts to decrease afterwards due to decrease in the stability of the dithizone and consequently the extraction efficiency . The dependence of corrected absorbance upon centrifugation time was studied within the range of 530 min . It was found that a time of 15 min is adequate for separation of two phases . Calibration graph was obtained by preconcentrating 50 ml of the sample containing 5, 15, 30, 40, 55, 70, 80, and 100 ng ml of selenium (iv) under the optimal experimental conditions . Analytical parameters for the determination of the selenium - dithizonate complex are presented in table 1 . The relative standard deviation was 2.18% for six replicate measurements of standard selenium solution (50 ng ml). The effect of various cations and anions on the determination of 0.05 g ml of se(iv) was studied, and the results are summarized in table 2 . The tolerance limit was taken as the concentration of added ion causing less than 5% relative error . Cations such as ag(i), cu(ii), hg(ii), and fe(iii) were interfered with the determination of se(iv) ion . These cations can be removed using a cation exchange resin (sulfonic acid groups, mesh ranges: 50100, 8 cm). For this purpose, 25 ml solution containing 2.5 g of se(iv) and various amounts of desired cations was passed through 5 g cation exchange resin (8 cm wet resin) dropwise and collected in a 50 ml volumetric flask containing optimum amount of dithizone (7.5 mol l), hcl (0.35 m), and triton x-100 (0.2% w / v). After washing the column with water (three times, with 15 ml), 0.5% (w / v) phenol was added and the solution was diluted to the mark with water and the amount of se (iv) was determined using recommended procedure . To evaluate the analytical applicability, the method was applied to the determination of selenium in two multivitamin tablets (centrum and selen plus) and a selenium sulphide shampoo (for treatment of dandruff). The results for selenium sulphide shampoo, centrum, and selen plus multivitamins are given in tables 3, 4, and 5, respectively . In order to evaluate the accuracy of procedure, selenium was determined in centrum tablet (containing 0.25 mg se as sodium selenate) by icp - oes as reference method . In both methods the results agreed well (table 6). The limit of detection and relative standard deviation of the proposed method were compared with methods in the literature (table 7). As observed from the results limit of detection by the proposed method was lower than other methods . The simplicity, rapidity, and inexpensiveness of the proposed method in combination with the use of dithizone as a chromogenic reagent were utilized for selenium determination in cosmetic and pharmaceutical samples . Precision and recovery data clearly indicated the reproducibility and accuracy of the method . In this investigation, spectrophotometric determination of selenium was carried out in micellar medium without the need for an extraction step . Because of the overlapping of absorption maximum of complex at 424 nm with absorption maximum of dithizone at 434 nm, a corr was applied.
|
Data on individuals aged 029 years diagnosed with any type of diabetes (excluding gestational) from 1 january 1991 to 31 december 2006 were extracted from clinical notes by a dedicated register manager and entered onto the population - based yorkshire register of diabetes in children and young people for residents of west yorkshire, which has a 97.6% level of completeness (1). Type of diabetes was defined in accordance with world health organization guidelines (10) as type 1, type 2, maturity - onset diabetes of the young (mody), original diagnoses of uncertain / unclassified were reclassified as type 1 for 18% (n = 32) and type 2 for 11% (n = 20). Ethnicity was assigned as south asian (pakistani, indian, bangladeshi) or non - south asian (all other ethnicities) using the south asian names analysis program (nam pehchan) and the south asian name and group recognition algorithm (sangra), two independent name recognition programs that are validated and sensitive tools for identifying south asians (11,12). Where the programs disagreed (<1%), a local expert examined the names and assigned ethnicity . Incidence was defined as the number of newly diagnosed cases per calendar year and 100,000 population at risk . Populations for west yorkshire were provided by the office for national statistics, supplemented by estimated midyear population denominators by age, sex, and ethnic group . Effects on incidence of age at diagnosis (5-year groups), sex, ethnicity (south asian or not), and year of diagnosis on all types, type 1, type 2 and uncertain / unclassified diabetes were analyzed using poisson regression . Average annual percentage change (aapc) and 95% cis were derived using the coefficient for year in the poisson model . All analyses were done in stata 11 software (statacorp lp, college station, tx). Diabetes was diagnosed in 2,889 children and young people, with 83% (n = 2,410) type 1, 12% (n = 337) type 2, 0.7% (n = 19) mody, 0.1% (n = 1 of each) j-type or other, 0.1% (n = 4) not recorded, and 4% the incidence (95% ci) of all diabetes (aged 029 years) was 21.0 (20.221.7) per 100,000, with no statistically significant differences between south asians and non - south asians . The incidence of type 1 diabetes was 17.6 (16.918.3), with significantly higher rates in non - south asians (18.3 [18.319.0]) than in south asians (13.1 [11.414.8]). Type 2 incidence was 2.5 (2.22.7), which was significantly lower for non - south asians (1.8 [1.62.1]) than south asians (6.9 [5.68.1]). Incidence of uncertain / unclassified diabetes was 0.8 (0.670.98) and was lower for non - south asians . Aapc was 4.0% (95% ci 3.24.8) overall, and significantly greater in south asians (7.0% [4.89.2]) compared with non - south asians (3.6% [2.74.4]) (fig . 1) and females (5.3% [4.16.4]) compared with males (3.0% [1.94.0]). For type 1 diabetes, aapc was 1.3% (0.42.2) overall, with a significant increasing trend seen in non - south asians (1.4% [0.52.3]) compared with no trend in south asians (0.0% [2.8 to 2.8]). Annual incidence increased significantly for children (aged 014 years) at 2.9% (1.74.0), but was stable for young people aged 1529 years (0.6% [1.9 to 0.7]). For type 2, the incidence in those aged younger than 30 years rose from 0.1 to 4.9 per 100,000 between 1991 and 2006 and aapc was 19.4% (16.522.2) overall, with incidence increasing at a similar rate for both ethnic groups . Incidence increased at a faster rate for children aged 014 (37.4% [21.553.2]) compared with those aged 1529 (a high - quality color representation of this figure is available in the online issue .) The proportion of uncertain / unclassified cases per year rose from 0% in 1991 to 8% in 2006 . Aapc was 26.4% (95% ci 20.732.1) overall, with similar increases for both ethnic groups . The incidence (95% ci) of all diabetes (aged 029 years) was 21.0 (20.221.7) per 100,000, with no statistically significant differences between south asians and non - south asians . The incidence of type 1 diabetes was 17.6 (16.918.3), with significantly higher rates in non - south asians (18.3 [18.319.0]) than in south asians (13.1 [11.414.8]). Type 2 incidence was 2.5 (2.22.7), which was significantly lower for non - south asians (1.8 [1.62.1]) than south asians (6.9 [5.68.1]). Incidence of uncertain / unclassified diabetes was 0.8 (0.670.98) and was lower for non - south asians . Aapc was 4.0% (95% ci 3.24.8) overall, and significantly greater in south asians (7.0% [4.89.2]) compared with non - south asians (3.6% [2.74.4]) (fig . 1) and females (5.3% [4.16.4]) compared with males (3.0% [1.94.0]). For type 1 diabetes, aapc was 1.3% (0.42.2) overall, with a significant increasing trend seen in non - south asians (1.4% [0.52.3]) compared with no trend in south asians (0.0% [2.8 to 2.8]). Annual incidence increased significantly for children (aged 014 years) at 2.9% (1.74.0), but was stable for young people aged 1529 years (0.6% [1.9 to 0.7]). For type 2, the incidence in those aged younger than 30 years rose from 0.1 to 4.9 per 100,000 between 1991 and 2006 and aapc was 19.4% (16.522.2) overall, with incidence increasing at a similar rate for both ethnic groups . Incidence increased at a faster rate for children aged 014 (37.4% [21.553.2]) compared with those aged 1529 (a high - quality color representation of this figure is available in the online issue .) The proportion of uncertain / unclassified cases per year rose from 0% in 1991 to 8% in 2006 . Aapc was 26.4% (95% ci 20.732.1) overall, with similar increases for both ethnic groups . An increasing burden of diabetes was observed in non - south asian and south asian children and young people, with a rising incidence of type 1 diabetes confirmed in children (3,4) and stable rates for young adults (1,2). Although the proportion of south asians in the diabetes population (13%) was similar to the background population, south asians had a lower incidence of type 1 diabetes but an excess of type 2, with an apparent shift from diagnosis of type 1 to type 2 from 2000 onwards . The previously reported steep rise in incidence of type 1 diabetes in south asian children up to 1999 (5) was not sustained, possibly as a result of a change in the recognition that type 2 and other forms of diabetes are emerging in younger age groups . All south asian children diagnosed with type 2 diabetes between 1991 and 2006 were 10 years or older, and a fall in type 1 in those 15 to 29 years old in the second period is unlikely to be attributable to changes in diagnostic classification . There are clinical challenges in the differential diagnosis of type 1 and type 2 diabetes (13,14). Treatment can be based on symptoms with no clear diagnosis, reflected in rising numbers of uncertain / unclassified diagnoses (two diagnoses in the first 5 years, with 91 thereafter). We acknowledge that we may have underestimated the incidence of type 2 especially in earlier years, a problem identified in an earlier survey (15), but these observations confirm the importance of including all forms of diabetes in our analyses.
|
Familial adenomatous polyposis (fap) is a rare cause of colorectal cancer and is caused by a wide spectrum of mutations in the apc gene.1 2 fap usually presents with a 100 to 1,000 of precancerous colonic polyps . Without colectomy, while pathogenic apc mutations have a complete penetrance in the colon, this is not the case in extracolonic manifestations . Gardner and richards first described the association of fap with a variety of extracolonic tumors, especially soft tissue lesions, but also osteomas, thyroid cancer, and hepatoblastoma . The triad of soft tissue lesions, osteomas, and dental abnormalities in fap patients has therefore been named gardner syndrome.3 4 gardner fibromas (gf) have been defined only recently as superficial and poorly circumscribed tumor - like lesions, which consist mainly of thick haphazardly arranged collagen bundles with few interspersed spindle cells of fibroblast type.5 6 7 gf are regarded as a precursor lesion of desmoid tumors which have a more cellular appearance . Both are associated with fap (although it is unknown whether this is always the case).8 9 the most common sites are the back, paraspinal region, and chest wall, but gf may occur in any part of the body . Gf may precede the development of colonic adenomas and therefore lead to an early detection of fap in otherwise asymptomatic patients . Although it is most frequently observed in the first decade of life, with 78% of the cases being diagnosed before 10 years of age,9 neonatal gf has only been reported in a single case report so far.10 in our report, we relate the cases of two patients with neonatal gf and very different findings . A 7-week - old otherwise healthy boy of nonconsangineous parents presented with a subcutaneous tumor on the left parasternal chest wall immediately after birth . Ultrasound was performed and showed a dense structure lying above rib level measuring 1.4 0.5 cm (fig . Analysis of the family history revealed no family members with adenomas, fibromas, or colorectal cancer . 1b). Magnetic resonance imaging (mri) scans at the age of 5.5 and 9 months revealed a tumor size of 4.5 4.0 1.2 and 6.2 5.6 1.8 cm, respectively . Furthermore, the tumor had infiltrated the intercostal space and distal sternum at 9 months, eroding the bone, and was lying adjacent to the pericardium (fig . A radical resection was performed with partial resection of the distal sternum, ribs 7 to 9 on the left side and the medial part of the major pectoralis muscle . Closure of the chest wall was possible with insertion of a 5 4 cm goretexpatch (w. l. gore & associates, inc . Mobilization of major and minor pectoralis muscle as well as the abdominal wall muscles allowed full muscular covering and subsequent primary skin closure . Resection margins were free of tumor except at the inferior end (cartilaginous part of rib 10). Regular mri scans every 6 months during follow - up showed no recurrence (fig . (b) growing tumor size 5 months after first resection: 4.8 3.5 1.4 cm . H&e stain (40) shows thick haphazardly arranged collagen bundles with few interspersed spindle cells of fibroblast type . (image courtesy of a. kaiser, md, klinikum nrnberg, institute of pathology). Mri scans of patient a. (a) tumor at the age of 9 months . (b) tumor site 24 months postoperatively without recurrence . Mri, magnetic resonance imaging . Molecular genetic analysis of the apc gene by polymerase chain reaction (pcr) and subsequent sanger sequence analysis of all coding exons did not show any causative mutation . In addition, multiplex ligation - dependent probe amplification (mlpa, kit p043, mrc - holland, the netherlands) analysis, which allows for the detection of potential deletions and duplications, showed a large heterozygous deletion affecting most of the apc coding region (exons 415 [genbank nm_000038.3], equals exons 718 [genbank nm_000038.5]) up to the most distal part of the gene (fragment w) (fig . The deletion was confirmed on a second blood sample and classified as a bona fide pathogenic alteration because of its large size . Deletion / duplication analysis using multiplex ligation - dependent probe amplification showing monoallelic deletion affecting most of the apc coding region, showing that the gene dose of exon 4 onwards is reduced by 50% and proving the heterozygous deletion of a large portion of apc . Subsequent testing of the parents showed the same apc deletion in the father who had no complaints . After having established the diagnosis he underwent colonoscopy, which led to the diagnosis of cancer of the sigmoid colon . Anal anastomosis, the histological workup verified a pt3, pn2 (11/52), l1, g2 adenocarcinoma . The paternal grandmother did not show the familial apc deletion, the paternal grandfather was unavailable for investigation . The otherwise healthy boy of nonconsangineous parents was diagnosed with a left - sided paravertebral soft tissue tumor measuring 6 3 1 cm at birth . Due to known fap in the father the soft tissue tumor was assumed to be an extracolonic manifestation of fap . Because of tumor progression during the next 4 months (fig . Histology confirmed gf consisting of fatty tissue interspersed with thick collagen bundles, many small blood vessels and some dispersed mast cells . Mri scan 16 weeks after birth tumor size: 8 5 cm . He developed osteomas of the skull and intestinal polyps were confirmed by colonoscopy but without the necessity for surgical intervention so far . The father of the boy had developed clinical symptoms of fap at the age of 27 and underwent prophylactic restorative proctocolectomy and ileal pouch anal anastomosis at the age of 28 . Within 3 years after surgery he developed severe retroperitoneal desmoid disease leading to hydronephrosis necessitating nephroureterectomy . After 6 months he underwent a further desmoid tumor resection in the abdominal wall, the attempted resection of a large pelvic desmoid failed due to poor circumscription . Molecular genetic analysis by pcr and sanger sequence analysis of all coding exons showed a heterozygous frameshift mutation c.4393_4394delag, p.ser1465trpfs*3 in exon 15, segment h (equals exon 18, segment h [genbank nm_000038.5]) of the apc gene leading to introduction of a stop codon at amino acid position 1467, thereby causing a truncated nonfunctional or functionally impaired apc protein . A 7-week - old otherwise healthy boy of nonconsangineous parents presented with a subcutaneous tumor on the left parasternal chest wall immediately after birth . Ultrasound was performed and showed a dense structure lying above rib level measuring 1.4 0.5 cm (fig . Analysis of the family history revealed no family members with adenomas, fibromas, or colorectal cancer . 1b). Magnetic resonance imaging (mri) scans at the age of 5.5 and 9 months revealed a tumor size of 4.5 4.0 1.2 and 6.2 5.6 1.8 cm, respectively . Furthermore, the tumor had infiltrated the intercostal space and distal sternum at 9 months, eroding the bone, and was lying adjacent to the pericardium (fig . A radical resection was performed with partial resection of the distal sternum, ribs 7 to 9 on the left side and the medial part of the major pectoralis muscle . Closure of the chest wall was possible with insertion of a 5 4 cm goretexpatch (w. l. gore & associates, inc . Mobilization of major and minor pectoralis muscle as well as the abdominal wall muscles allowed full muscular covering and subsequent primary skin closure . Resection margins were free of tumor except at the inferior end (cartilaginous part of rib 10). Regular mri scans every 6 months during follow - up showed no recurrence (fig . (b) growing tumor size 5 months after first resection: 4.8 3.5 1.4 cm . H&e stain (40) shows thick haphazardly arranged collagen bundles with few interspersed spindle cells of fibroblast type . (image courtesy of a. kaiser, md, klinikum nrnberg, institute of pathology). Mri scans of patient a. (a) tumor at the age of 9 months . (b) tumor site 24 months postoperatively without recurrence . Mri, magnetic resonance imaging . Molecular genetic analysis of the apc gene by polymerase chain reaction (pcr) and subsequent sanger sequence analysis of all coding exons did not show any causative mutation . In addition, multiplex ligation - dependent probe amplification (mlpa, kit p043, mrc - holland, the netherlands) analysis, which allows for the detection of potential deletions and duplications, showed a large heterozygous deletion affecting most of the apc coding region (exons 415 [genbank nm_000038.3], equals exons 718 [genbank nm_000038.5]) up to the most distal part of the gene (fragment w) (fig . The deletion was confirmed on a second blood sample and classified as a bona fide pathogenic alteration because of its large size . Deletion / duplication analysis using multiplex ligation - dependent probe amplification showing monoallelic deletion affecting most of the apc coding region, showing that the gene dose of exon 4 onwards is reduced by 50% and proving the heterozygous deletion of a large portion of apc . Subsequent testing of the parents showed the same apc deletion in the father who had no complaints . After having established the diagnosis he underwent colonoscopy, which led to the diagnosis of cancer of the sigmoid colon . Anal anastomosis, the histological workup verified a pt3, pn2 (11/52), l1, g2 adenocarcinoma . The paternal grandmother did not show the familial apc deletion, the paternal grandfather was unavailable for investigation . The otherwise healthy boy of nonconsangineous parents was diagnosed with a left - sided paravertebral soft tissue tumor measuring 6 3 1 cm at birth . Due to known fap in the father the soft tissue tumor was assumed to be an extracolonic manifestation of fap . Because of tumor progression during the next 4 months (fig . Histology confirmed gf consisting of fatty tissue interspersed with thick collagen bundles, many small blood vessels and some dispersed mast cells . Mri scan 16 weeks after birth tumor size: 8 5 cm . He developed osteomas of the skull and intestinal polyps were confirmed by colonoscopy but without the necessity for surgical intervention so far . The father of the boy had developed clinical symptoms of fap at the age of 27 and underwent prophylactic restorative proctocolectomy and ileal pouch anal anastomosis at the age of 28 . Within 3 years after surgery he developed severe retroperitoneal desmoid disease leading to hydronephrosis necessitating nephroureterectomy . After 6 months he underwent a further desmoid tumor resection in the abdominal wall, the attempted resection of a large pelvic desmoid failed due to poor circumscription . Molecular genetic analysis by pcr and sanger sequence analysis of all coding exons showed a heterozygous frameshift mutation c.4393_4394delag, p.ser1465trpfs*3 in exon 15, segment h (equals exon 18, segment h [genbank nm_000038.5]) of the apc gene leading to introduction of a stop codon at amino acid position 1467, thereby causing a truncated nonfunctional or functionally impaired apc protein . Whereas early childhood gf have been reported and the assumption has been made that there is a strong connection to fap,9 to our knowledge there is only one report of a neonatal onset of gf leading to the diagnosis of fap in an otherwise asymptomatic child.10 in this report the patient's parents were healthy and had negative genetic testing, so that a de novo mutation is most probable . In contrast, in our patient a, testing of the parents revealed the same mutation in the father and the diagnosis of abundant intestinal polyposis and sigmoid cancer in colonoscopy . This is to our knowledge the first report of a neonatal gf requiring immediate total proctocolectomy in a parent . Coffin et al noted that 29% of all patients with gf developed this lesion under the age of 1 year, with an onset at 2 months of age.9 it is possible that in this series some gf may have existed unnoticed since birth . Although the overall (and possibly underestimated) association rate with fap is as high as 69% in this study, no information is available about relevance of gf as a sentinel lesion for fap in neonatal patients . Viera et al reported two infants with gf which led to previously unrecognized fap in the families.11 in their patients, immunofluorescent staining of -catenin in the tumor, which accumulates in cells with biallelic truncation of apc because of the impairment of apc - mediated degradation of -catenin,4 led to the strong suspicion of underlying fap . This may well be a future diagnostic tool in evaluating the role of gf in detection of fap.12 of note, in our patient a the tumor showed a rapid progression which necessitated extensive surgery, while the lesion remained stable in patient b. although the invasive rapid growth is already a sign of a desmoid tumor, it was histologically still regarded as a gf . It may be discussed if site and type of apc mutations may play a role in disease outcome, since patient a carries a large deletion encompassing most of the apc coding region, whereas patient b has an underlying mutation in the desmoid region of the apc gene.4 screening for somatic apc mutations in the tumor indicating loss of heterozygosity might have been instructive . The loss of the wildtype allele of apc in the tumor has been shown to be a relatively frequent event in desmoid tumors in adult fap individuals.13 unfortunately, these data are not available in our patients . However, it is known that trauma or surgery can be a predisposing factor to desmoid development in fap.9 therefore, the possibility that the first surgery triggered the intensive growth of the gf in patient a cannot be excluded . If surgery is performed, a total excision of gf with a wide margin should be aimed for, but can be technically demanding or even impossible because of the poor circumscription or anatomic boundaries . In general, prediction of gf behavior it has been stated that approximately 5 to 10% appear to resolve spontaneously, 30% undergo cycles of progression and resolution, 50% remain stable after diagnosis, but 10% tend to progress rapidly, growing to massive sizes and infiltrating adjacent tissue.4 it is also known that there is a relationship between frequency of extracolonic manifestations and the position of apc germline mutations in patients with fap.4 14 15 for example, the risk of developing desmoid tumors is increased in patients with an apc mutation 3 to codon 1399,16 and reaches up to 100% in patients with a mutation in codons 1395 to 1493.17 studies correlating the risk of developing gf with a particular genotype are not available . Nevertheless, surgery is the first - line therapy in fast - growing gf . In older patients with advanced cases with progression into desmoid tumor cytotoxic chemotherapy may be discussed, but was not considered promising in our case because of the young age and the gf still being considered a benign entity.18 19 continuous follow - up is mandatory, since early onset of intestinal polyps in children from the age of 4 to 6 years has been reported.20 21 22 in general, routine colonoscopies have been suggested to start at the age of 10 . Because of the unusual early clinical onset of intestinal symptoms (bloody stools and> 75 polyps in colonoscopy) at the age of 4 years in a previously reported patient with neonatal gf, we recommend early annual routine colonoscopy in patient a starting from the age of 2 years.10 since approximately 25% of fap cases are caused by de novo mutations, the development of a gf in a child must raise suspicion of an underlying fap even if the family history is negative . Performing a sound genetic testing for fap including sequencing of the complete coding region of the apc gene and quantitative analysis by, for example, mlpa in every child with gf continuous follow - up is mandatory because of unpredictable growth behavior and early onset of intestinal polyps.
|
Down's syndrome (ds) is one of the common chromosomal disorders and the most common cause of mental retardation . It is well - known that patients with ds have an increased prevalence of autoimmune disorders affecting both endocrine and non - endocrine organs . Although cases of ds associated with diabetes mellitus (dm) have been reported in the past, invariably all cases were associated with type 1 dm . We present two cases of type 2 dm with ds and believe that this is the first report of type dm with ds . A 28-year - old male patient with a body mass index (bmi) of 25.1 kg / m and positive family history of dm reported to the out - patient clinic of the department of endocrinology, medwin hospital with the clinical features of polyuria and polydipsia for last 1 year . Physical examination revealed typical mongolian facies and other features of ds such as short stature (145 cm), brachycephaly, short neck and pot belly, small mouth with protruding tongue, wide occipital region and characteristic small eyes of ds . Laboratory data revealed diabetes with fasting plasma glucose of 256 mg / dl, postprandial plasma glucose of 375 mg / dl and glycated hemoglobin (hba1c) level of 9.9% . C - peptide assay showed fairly well - preserved pancreatic cell function: fasting values of 1.3 pmol and stimulated values of 2.4 pmol / ml (normal values in non - diabetic subjects, fasting> 1.5 pmol / ml and stimulated> 4.0 pmol / ml). Glutamic acid decarboxylase (gad) antibody testing (3.2 iu / ml) was negative . Other investigations (hemogram, renal and liver function parameters, serum electrolytes and lipid profile) were within the normal limits . He was initiated on basal glargine insulin at a dose of 15 units subcutaneously at night along with oral hypoglycemic agent (glimepiride 2 mg / metformin 1000 mg) once daily and l - thyroxine 100 g daily . Later, the doses of insulin were reduced and subsequently withdrawn completely and he is maintained well on oral hypoglycemic agents alone . A 26-year - old female patient with a bmi of 33.4 kg / m with strong family history of dm were admitted in the in - patient department of endocrinology, medwin hospital for proper control of hyperglycemia . Physical examination revealed features of ds (short stature, obesity, brachycephaly, gynecomastia, protruding tongue, simian crease, pot belly, short neck and acanthosis nigricans, wide occipital region with characteristic small eyes). The laboratory evaluation revealed fasting and postprandial sugar levels as 175 mg / dl and 240 mg / dl, respectively hba1c of 8.9% . His fasting and stimulated c - peptide levels were 1.4 pmol / ml and 2.5 pmol / ml with negative gad - antibody test (4.1 iu / ml). A 28-year - old male patient with a body mass index (bmi) of 25.1 kg / m and positive family history of dm reported to the out - patient clinic of the department of endocrinology, medwin hospital with the clinical features of polyuria and polydipsia for last 1 year . Physical examination revealed typical mongolian facies and other features of ds such as short stature (145 cm), brachycephaly, short neck and pot belly, small mouth with protruding tongue, wide occipital region and characteristic small eyes of ds . Laboratory data revealed diabetes with fasting plasma glucose of 256 mg / dl, postprandial plasma glucose of 375 mg / dl and glycated hemoglobin (hba1c) level of 9.9% . C - peptide assay showed fairly well - preserved pancreatic cell function: fasting values of 1.3 pmol and stimulated values of 2.4 pmol / ml (normal values in non - diabetic subjects, fasting> 1.5 pmol / ml and stimulated> 4.0 pmol / ml). Glutamic acid decarboxylase (gad) antibody testing (3.2 iu / ml) was negative . Other investigations (hemogram, renal and liver function parameters, serum electrolytes and lipid profile) were within the normal limits . He was initiated on basal glargine insulin at a dose of 15 units subcutaneously at night along with oral hypoglycemic agent (glimepiride 2 mg / metformin 1000 mg) once daily and l - thyroxine 100 g daily . Later, the doses of insulin were reduced and subsequently withdrawn completely and he is maintained well on oral hypoglycemic agents alone . A 26-year - old female patient with a bmi of 33.4 kg / m with strong family history of dm were admitted in the in - patient department of endocrinology, medwin hospital for proper control of hyperglycemia . Physical examination revealed features of ds (short stature, obesity, brachycephaly, gynecomastia, protruding tongue, simian crease, pot belly, short neck and acanthosis nigricans, wide occipital region with characteristic small eyes). The laboratory evaluation revealed fasting and postprandial sugar levels as 175 mg / dl and 240 mg / dl, respectively hba1c of 8.9% . His fasting and stimulated c - peptide levels were 1.4 pmol / ml and 2.5 pmol / ml with negative gad - antibody test (4.1 iu / ml). A 28-year - old male patient with a body mass index (bmi) of 25.1 kg / m and positive family history of dm reported to the out - patient clinic of the department of endocrinology, medwin hospital with the clinical features of polyuria and polydipsia for last 1 year . Physical examination revealed typical mongolian facies and other features of ds such as short stature (145 cm), brachycephaly, short neck and pot belly, small mouth with protruding tongue, wide occipital region and characteristic small eyes of ds . Laboratory data revealed diabetes with fasting plasma glucose of 256 mg / dl, postprandial plasma glucose of 375 mg / dl and glycated hemoglobin (hba1c) level of 9.9% . C - peptide assay showed fairly well - preserved pancreatic cell function: fasting values of 1.3 pmol and stimulated values of 2.4 pmol / ml (normal values in non - diabetic subjects, fasting> 1.5 pmol / ml and stimulated> 4.0 pmol / ml). Glutamic acid decarboxylase (gad) antibody testing (3.2 iu / ml) was negative . Other investigations (hemogram, renal and liver function parameters, serum electrolytes and lipid profile) were within the normal limits . He was initiated on basal glargine insulin at a dose of 15 units subcutaneously at night along with oral hypoglycemic agent (glimepiride 2 mg / metformin 1000 mg) once daily and l - thyroxine 100 g daily . Later, the doses of insulin were reduced and subsequently withdrawn completely and he is maintained well on oral hypoglycemic agents alone . A 26-year - old female patient with a bmi of 33.4 kg / m with strong family history of dm were admitted in the in - patient department of endocrinology, medwin hospital for proper control of hyperglycemia . Physical examination revealed features of ds (short stature, obesity, brachycephaly, gynecomastia, protruding tongue, simian crease, pot belly, short neck and acanthosis nigricans, wide occipital region with characteristic small eyes). The laboratory evaluation revealed fasting and postprandial sugar levels as 175 mg / dl and 240 mg / dl, respectively hba1c of 8.9% . His fasting and stimulated c - peptide levels were 1.4 pmol / ml and 2.5 pmol / ml with negative gad - antibody test (4.1 iu / ml). Previous studies had suggested that type 1 dm is more prevalent in people with ds than in the general population and vice versa . To the best of our knowledge, impaired cell function and insulin sensitivity are the main factors in the pathogenesis of type 2 dm . Cell function was fairly preserved in these two patients (as indicated by c - peptide levels in the blood) with negative antibody testing for gad - ab . This indicated toward the fact that impaired insulin sensitivity might have contributed to a greater extent in the development of type 2 dm in these two patients . A variety of genetic syndromes have been described in which dm occurs with increased frequency . The etiology of the disturbance in glucose homeostasis in these diverse and unrelated syndromes remain undefined . Since rare forms a disease often provide insight into the possible mechanisms of the disease and since each candidate gene contributes a small amount of genetic risk to the disease, individuals with ds and type 2 dm may therefore provide the clinical insights into possible mechanisms underlying susceptibility to diabetes . Further investigations are warranted to prove whether the presence of type diabetes in patients with ds was a chance association or whether there is a genetic basis for this association . However, these two cases point to the fact that one should screen patients with ds for type 2 diabetes.
|
Recent progress in our understanding of brain development has significantly altered concepts for treating neurodegenerative diseases, including those that affect the retina to cause blindness . Contrary to previous thought, it is now recognized that neurons are generated in the sub ventricular zone (svz) of the lateral ventricle, and the sub - granular zone (sgz) in the hippocampus from neural stem cells (nsc) of glial origin throughout life (1). Outside these discrete regions in the mammalian cns, including the retina, active neurogenesis has not been reproducibly demonstrated under normal conditions (2). However, rare neurogenic changes are observed in the injured adult mammalian retina; the source of injury - induced neurogenesis is traced to mller glia (mg) (35). Recent observations that mammalian mg possess nsc properties and are able to generate retinal neurons in vitro and upon transplantation in vivo posit these cells as the potential target for regenerating diseased or injured photoreceptors and retinal ganglion cells (6). While growing evidence confirms that mg possess evolutionarily conserved neurogenic potential, studies from various labs have observed that, unlike their lower vertebrate counterparts, the injury or disease - activated mammalian mg proliferate, but that they convert to neurons rather infrequently (4, 7, 8). Whether or not the converted neurons are functional, make synaptic connections, and survive for the long term remains unknown . The challenge that remains is how to unlock the neurogenic potentials of the mammalian mg in vivo . This may essentially involve approaches to reprogram these cells to dedifferentiate and regain their lost ability to generate neurons or trans - differentiate them into neurons . To address this challenge, the neurogenic potentials of mg need to be evaluated against the backdrop of two models, with the understanding that examples from lower vertebrates would constitute a framework, but that solutions will be unique to the mammalian retina: (1) svz / sgz model, where mg have nsc properties and thus the capacity for neuronal differentiation like radial glia - derived nscs in svz and sgz . Given the observations that the adult nscs are responsive to environmental cues for neuronal differentiation (1), mg in this model should be amenable to directed differentiation along neuronal lineage through the manipulation of niche - based signals by recombinant growth factors and/or small molecules . (2) extra svz / sgz model, where mg may have neurogenic potential like parenchymal astrocytes but incapable of neuronal differentiation, presumably under the influence of the non - neurogenic niche . For example, both mg and astrocytes express nsc regulators such as sox2 (mg) and pax6 (astrocytes) and when cultured in the presence of mitogens tend to differentiate along neuronal lineage (2, 6, 9, 10). However, in vivo, although they proliferate and express neural progenitor markers such as nestin in response to injury, they maintain their glial phenotype, with rare expression of neuronal markers (2, 5, 10). Given their stable glial identity for supporting neurons despite expressing some of the nsc - specific genes, a trans - differentiation approach for the lineage conversion of mg has emerged as a practical option in this model . This notion is supported by recent observations that injury - activated resident astrocytes differentiate into functional neurons upon enforced expression of nsc regulator, sox2 and/or proneural gene, ascl1 (11). Regardless, information gained in deciphering the two models will be useful . In both cases, knowledge of the developmental mechanism for the lineage switch, the reaction of mg to different kinds of injuries, phenotypes of the activated mg in spatial and temporal contexts, transcriptional and epigenetic status, and niche - related signals will be critical . These approaches will reveal whether the roadblock to regeneration is cell - intrinsic or cell - extrinsic or both, information that will be essential in formulating strategies for making mg - dependent therapeutic regeneration practical and clinically applicable . Toward this effort, the recent success of reprogramming to induce pluripotency in somatic cells and lineage - specific differentiation of pluripotent cells, whether through directed differentiation (svz / sgz model) or trans - differentiation (extra svz / sgz model), is owed directly to the knowledge of developmental mechanisms (12). There is a significant knowledge gap in our understanding of how neurogenesis shifts to the generation of mg in the mammalian retina, information essential to navigate the cellular or molecular roadblocks to neuronal differentiation . For example, although we know that notch signaling regulates the generation of mg, how it is incorporated into the gliogenic program and to what extent it is involved in suppressing neuronal differentiation remains rather unknown (4). Given the contextual role of notch signaling (4), its complexity due to the oscillatory expression of its effector hes1 (13), and its gliogenic interactions with the eye field gene lhx2 (14), this information will be essential to formulate niche - based approaches for facilitating neuronal differentiation of mg . Along this line, it will also be advantageous to know whether genes involved in neurogliogenesis elsewhere in the cns, such as lin28, a heterochronic gene regulating the developmental timing (15) and ezh2, an epigenetic regulator of gene expression (16) participate in mg differentiation and coordinate the influence of the niche . Recent observations that the decision of retinal progenitors during late histogenesis to differentiate along glial or neuronal lineage is influenced by lin28 (17) and that ezh2 plays a role in constraining the generation of mg (18) posit these genes as potential targets for pivoting mg torwards neuronal differentiation . Regardless of whether or not mg possesses dormant stem cell properties according to the aforementioned models they must initiate and complete an intertwined program of activation and neuronal conversion for successful regeneration (4). Given that injuries in general lead to proliferation of mg across species, but not to their neuronal differentiation in higher vertebrates, it is likely that the cross - talk between transcriptional networks sub - serving the activation and neuronal differentiation are either not connected to the process, or the network components are in place but are not epigenetically primed for optimal expression in the mammalian mg . These probabilities could be examined by a genome - wide screening of prospectively enriched mg in select animal models in quiescent and activated states (facilitated by lineage reporters and other enrichment protocols such as the side population (sp) cell profiling by microarrays, rna seq, and chip seq analyses . A similar approach to characterizing mg in different states of activation and differentiation in controlled conditions in vitro will yield corroborative evidence and facilitate the means to test putative mechanism(s) by manipulating gene expression . Together, these approaches may provide insight into molecular axes that can be tested against the background of those operational in zebrafish (7, 8, 19). For example, the molecular axis defined by lin28 and ascl1, which facilitates mg - mediated regeneration in zebrafish, is a valid target for study in mammals . A variety of approaches in higher vertebrates have demonstrated important regulatory roles for lin28 in the maintenance of neural progenitors and neuroglial decision (20). It is likely that lin28 influences different developmental function by contextual recruitment of hmga2, a gene encoding a dna architecture protein (21, 22) and ascl1 (23) by directly regulating the heterochronic mirna let-7 (17, 21, 23). Let-7 targets hmga2 (17, 21) and ascl1 (23); therefore, the lin28-let-7-hmga2/ascl1 axis has emerged as an evolutionary conserved axis that could be a candidate for unlocking neurogenic potential of mg . For example, overexpression of lin28a (24) in the enriched mg (fig . 2a) prompted these cells to acquire neuronal morphology and to express immunoreactivities and transcripts corresponding to neuronal genes (fig . More importantly, neuronal differentiation was accompanied by an increase in levels of mir-124, a proneural mirna (25), hmga2, and ascl1, and a decrease in those of rest, a global inhibitor of neuronal differentiation (26), thus demonstrating the capacity of lin28a in activating the neurogenic program in mg . However, targeting the lin28-let-7-hmga2/ascl1 axis alone may not be sufficient for the functional reprogramming of mg along neuronal lineage, given that its influence may not be able to completely counter the inhibitory resistance of the rest axis . Rest, by suppressing the expression of proneural mirnas, mir-124 and mir-9 - 9 *, whose targets are proglial genes encoding sox9 and he s family of regulators, may keep mg non - neuronal and therefore non - regenerative (25). The existence of the rest - mir-124 - 9 - 9 * -sox9/hes1 axis in mg suggested that either inhibiting rest or ectopically expressing mir-124/mir-9 - 9 * or both may direct mg along the neuronal lineage . It is likely that the ectopic expression of mir-124/mir-9 - 9 * in itself might be effective, as they directly or indirectly influence the expression and function of rest (25). For example, over expression of mir-124 - 9 - 9 * (27) in mg (fig . 2a) facilitated neuronal morphology with accompanied expression and suppression of neuronal- and glial - specific genes, respectively (fig . Expression of both ascl1 and lin28a was up regulated and that of rest was down regulated in the perturbed groups, compared to controls . However, no significant difference in hmga2 transcript levels was observed, suggesting a threshold requirement of lin28a levels for influencing hmga2 expression . That mir-124 and mir-9 - 9 * could facilitate proneural function of ascl1 was demonstrated by the improvement of ascl1-mediated reprogramming of mg by ectopically expressed mirnas (28). Together, these observations posit these molecular axes as valid intrinsic targets for studying and unlocking the dormant regenerative potential of mg . Mg, the guardian of homeostasis in the retina, respond to injuries by proliferating and migrating out of the inner nuclear layer (5). However, despite proliferation and migration as in zebrafish retina, as mentioned, mammalian mg do not initiate regeneration effectively . This raises the possibility that, in addition to internal constraints discussed above, the environment in the mammalian retina might not be conducive for neurogenic conversion of mg . A niche - based approach to unlock neurogenic potential of mg will involve examining the relationship of mg with neighboring retinal cells, microglia, immigrant astrocytes, and endothelial cells in the context of signaling pathways and their capacity to engage the molecular axes involved in reprograming along neuronal lineage . For example, the understanding of the role of microglia, one of the first responders to injury, and which may mediate regeneration through inflammatory signals, is still evolving in the retina (29). Studies have demonstrated that notch (8, 30), wnt (5, 6), fgf (6, 8), insulin and insulin - like growth factor-1 (8), shh (31), and cytokines such as tnf (8, 19), leptin, and il-11 (32) may play important roles in mediating the influence of the niche in reprogramming mg . However, the identity of cells delivering the signals and whether or not these signals and their associated pathways act in concert, which would determine niche - based strategies to promote regeneration, remain largely unknown . However, studies in zebrafish have begun to shed light on these issues . For example, it has been observed that tnf released by dying photoreceptors in mechanically damaged zebrafish retina may constitute one of the early signals for activating mg for regeneration (19). Also, it was reported that zebrafish mg respond to retinal injury by secreting leptin and il-11, which help reprogram cells in an autocrine fashion (32). In both cases, these cytokines facilitated injury - dependent induction of ascl1, a key step in reprogramming of mg (8). Whether or not signaling - mediated by these factors are similarly involved in the mammalian retina remains to be demonstrated . Although the identity of cells delivering notch signaling in mg remains speculative, emerging evidence from zebrafish and higher vertebrates posit it as an important niche - based target for mg - dependent regeneration . It remains active long after facilitating the differentiation of mg, enabling them to launch the proliferative response when injury takes place (4, 5). However, persistence of notch signaling in activated mg, which are poised for neuronal conversion, might be deleterious for regenerative process, given the inhibitory influence of notch signaling on the activation of proneural genes (33). The inability to confine the activation of notch signaling in mg to a narrow temporal window following injury may be one of the reasons for their anemic neuronal conversion in mammals, compared to that in zebrafish (30). Emerging evidence, once again from the zebrafish model, suggests that these pathways, including notch signaling, may act in concert and mg integrate the diverse niche - based influence of a variety of signaling molecules for a calibrated regenerative response to injury (8). Therefore, niche - related information is crucial for understanding the temporal and spatial modulation of signaling required for activating mg and shifting them from the state of activation to neuronal differentiation . This is fundamental information missing from studies of mg - dependent regeneration, without which the underlying mechanisms remain difficult to grasp and the therapeutic target rather illusory . Currently, the identity of the activated mg represents cells in the inner nuclear layer of the retina, which have incorporated brdu in response to injury and express mg - specific markers . Given the transition of mg from a quiescent to a proliferative state and the generation of their progenies in different stages of development, the identity based on brdu incorporation, though important, is of limited value . Attempts have been made to prospectively enrich activated mg by hoechst dye efflux assays and to characterize them as sp cells, a phenotype shared by the majority of stem cells (4, 6). However, since sp cells are also heterogeneous, this functional approach has limitations in the absence of specific cellular markers . Although several signaling pathways (e.g. Notch signaling) and intrinsic factors (e.g., ascl1) have been observed to regulate mg activation in fish, birds, and rodents (8), their status as markers of activated mg in different stages of regeneration remain unspecified . Progress in understanding the regenerative mechanisms in tissues like blood (34), intestine (35), and skin (36) has been facilitated by the identification and characterization of markers of the resident stem cells and their progenies . Within the cns, insight into regeneration in the svz has come from the characterization of b1 quiescent and active progenitors and resulting neuroblasts (37). Therefore, to follow mg - mediated regeneration, spatially and temporally, and to identify the stage - specific intrinsic players, a concerted effort is needed to search for reliable and reproducible markers . Currently, there is no consensus on reliable and reproducible mammalian models to study the activation and neurogenic potential of mg . Rodent models representing retinal injuries, ranging from those caused by the exposure to light, neurotoxins, and genetic mutations have been used . Given the observations that glia respond differently to different types and durations of injuries (2), that their levels of activation differ from species to species (ahmad et al ., unpublished observations), and that within the same species there are strain differences in responses (38), a case may be made for developing injury- and species / strain - specific models for reproducible and unambiguous examination of mg neurogenic potentials . These models will be valuable in incorporating transgenic technology for reliable lineage tracing, and more importantly for molecular characterization of activated mg . Characterization of these cells for gene regulatory network and epigenetic signature is essential to shed light on the status of their neurogenic potential and approaches to unlock it . Furthermore, cell type specific injury models would test the ability of mg to replace specific neuronal types, which will be helpful in designing approaches for mg - dependent therapeutic regeneration . For example, the loss of vision in two of the intractable blinding diseases, age - related macular degeneration (amd) and glaucoma, is due to selective loss of photoreceptors and retinal ganglion cells (rgcs), respectively . The neurotoxin injury models where exposure of the retina to n - methyl - n - nitrosourea (mnu) ablates photoreceptors (39) and nmda causes the degeneration of rgcs (40) would reveal whether or not mg could differentiate along specific neuronal types . Also, it may shed light on if mg - dependent therapeutic regeneration would be a practical approach to address degenerative changes in amd and/or glaucoma . The recent success of reprogramming to induce pluripotency in somatic cells and lineage - specific differentiation of pluripotent cells, whether through directed differentiation (svz / sgz model) or trans - differentiation (extra svz / sgz model), is owed directly to the knowledge of developmental mechanisms (12). There is a significant knowledge gap in our understanding of how neurogenesis shifts to the generation of mg in the mammalian retina, information essential to navigate the cellular or molecular roadblocks to neuronal differentiation . For example, although we know that notch signaling regulates the generation of mg, how it is incorporated into the gliogenic program and to what extent it is involved in suppressing neuronal differentiation remains rather unknown (4). Given the contextual role of notch signaling (4), its complexity due to the oscillatory expression of its effector hes1 (13), and its gliogenic interactions with the eye field gene lhx2 (14), this information will be essential to formulate niche - based approaches for facilitating neuronal differentiation of mg . Along this line, it will also be advantageous to know whether genes involved in neurogliogenesis elsewhere in the cns, such as lin28, a heterochronic gene regulating the developmental timing (15) and ezh2, an epigenetic regulator of gene expression (16) participate in mg differentiation and coordinate the influence of the niche . Recent observations that the decision of retinal progenitors during late histogenesis to differentiate along glial or neuronal lineage is influenced by lin28 (17) and that ezh2 plays a role in constraining the generation of mg (18) posit these genes as potential targets for pivoting mg torwards neuronal differentiation . Regardless of whether or not mg possesses dormant stem cell properties according to the aforementioned models they must initiate and complete an intertwined program of activation and neuronal conversion for successful regeneration (4). Given that injuries in general lead to proliferation of mg across species, but not to their neuronal differentiation in higher vertebrates, it is likely that the cross - talk between transcriptional networks sub - serving the activation and neuronal differentiation are either not connected to the process, or the network components are in place but are not epigenetically primed for optimal expression in the mammalian mg . These probabilities could be examined by a genome - wide screening of prospectively enriched mg in select animal models in quiescent and activated states (facilitated by lineage reporters and other enrichment protocols such as the side population (sp) cell profiling by microarrays, rna seq, and chip seq analyses . A similar approach to characterizing mg in different states of activation and differentiation in controlled conditions in vitro will yield corroborative evidence and facilitate the means to test putative mechanism(s) by manipulating gene expression . Together, these approaches may provide insight into molecular axes that can be tested against the background of those operational in zebrafish (7, 8, 19). For example, the molecular axis defined by lin28 and ascl1, which facilitates mg - mediated regeneration in zebrafish, is a valid target for study in mammals . A variety of approaches in higher vertebrates have demonstrated important regulatory roles for lin28 in the maintenance of neural progenitors and neuroglial decision (20). It is likely that lin28 influences different developmental function by contextual recruitment of hmga2, a gene encoding a dna architecture protein (21, 22) and ascl1 (23) by directly regulating the heterochronic mirna let-7 (17, 21, 23). Let-7 targets hmga2 (17, 21) and ascl1 (23); therefore, the lin28-let-7-hmga2/ascl1 axis has emerged as an evolutionary conserved axis that could be a candidate for unlocking neurogenic potential of mg . For example, overexpression of lin28a (24) in the enriched mg (fig . 2a) prompted these cells to acquire neuronal morphology and to express immunoreactivities and transcripts corresponding to neuronal genes (fig . More importantly, neuronal differentiation was accompanied by an increase in levels of mir-124, a proneural mirna (25), hmga2, and ascl1, and a decrease in those of rest, a global inhibitor of neuronal differentiation (26), thus demonstrating the capacity of lin28a in activating the neurogenic program in mg . However, targeting the lin28-let-7-hmga2/ascl1 axis alone may not be sufficient for the functional reprogramming of mg along neuronal lineage, given that its influence may not be able to completely counter the inhibitory resistance of the rest axis . Rest, by suppressing the expression of proneural mirnas, mir-124 and mir-9 - 9 *, whose targets are proglial genes encoding sox9 and he s family of regulators, may keep mg non - neuronal and therefore non - regenerative (25). The existence of the rest - mir-124 - 9 - 9 * -sox9/hes1 axis in mg suggested that either inhibiting rest or ectopically expressing mir-124/mir-9 - 9 * or both may direct mg along the neuronal lineage . It is likely that the ectopic expression of mir-124/mir-9 - 9 * in itself might be effective, as they directly or indirectly influence the expression and function of rest (25). For example, over expression of mir-124 - 9 - 9 * (27) in mg (fig . 2a) facilitated neuronal morphology with accompanied expression and suppression of neuronal- and glial - specific genes, respectively (fig . Expression of both ascl1 and lin28a was up regulated and that of rest was down regulated in the perturbed groups, compared to controls . However, no significant difference in hmga2 transcript levels was observed, suggesting a threshold requirement of lin28a levels for influencing hmga2 expression . That mir-124 and mir-9 - 9 * could facilitate proneural function of ascl1 was demonstrated by the improvement of ascl1-mediated reprogramming of mg by ectopically expressed mirnas (28). Together, these observations posit these molecular axes as valid intrinsic targets for studying and unlocking the dormant regenerative potential of mg . Mg, the guardian of homeostasis in the retina, respond to injuries by proliferating and migrating out of the inner nuclear layer (5). However, despite proliferation and migration as in zebrafish retina, as mentioned, mammalian mg do not initiate regeneration effectively . This raises the possibility that, in addition to internal constraints discussed above, the environment in the mammalian retina might not be conducive for neurogenic conversion of mg . A niche - based approach to unlock neurogenic potential of mg will involve examining the relationship of mg with neighboring retinal cells, microglia, immigrant astrocytes, and endothelial cells in the context of signaling pathways and their capacity to engage the molecular axes involved in reprograming along neuronal lineage . For example, the understanding of the role of microglia, one of the first responders to injury, and which may mediate regeneration through inflammatory signals, is still evolving in the retina (29). Studies have demonstrated that notch (8, 30), wnt (5, 6), fgf (6, 8), insulin and insulin - like growth factor-1 (8), shh (31), and cytokines such as tnf (8, 19), leptin, and il-11 (32) may play important roles in mediating the influence of the niche in reprogramming mg . However, the identity of cells delivering the signals and whether or not these signals and their associated pathways act in concert, which would determine niche - based strategies to promote regeneration, remain largely unknown . For example, it has been observed that tnf released by dying photoreceptors in mechanically damaged zebrafish retina may constitute one of the early signals for activating mg for regeneration (19). Also, it was reported that zebrafish mg respond to retinal injury by secreting leptin and il-11, which help reprogram cells in an autocrine fashion (32). In both cases, these cytokines facilitated injury - dependent induction of ascl1, a key step in reprogramming of mg (8). Whether or not signaling - mediated by these factors are similarly involved in the mammalian retina remains to be demonstrated . Although the identity of cells delivering notch signaling in mg remains speculative, emerging evidence from zebrafish and higher vertebrates posit it as an important niche - based target for mg - dependent regeneration . It remains active long after facilitating the differentiation of mg, enabling them to launch the proliferative response when injury takes place (4, 5). However, persistence of notch signaling in activated mg, which are poised for neuronal conversion, might be deleterious for regenerative process, given the inhibitory influence of notch signaling on the activation of proneural genes (33). The inability to confine the activation of notch signaling in mg to a narrow temporal window following injury may be one of the reasons for their anemic neuronal conversion in mammals, compared to that in zebrafish (30). Emerging evidence, once again from the zebrafish model, suggests that these pathways, including notch signaling, may act in concert and mg integrate the diverse niche - based influence of a variety of signaling molecules for a calibrated regenerative response to injury (8). Therefore, niche - related information is crucial for understanding the temporal and spatial modulation of signaling required for activating mg and shifting them from the state of activation to neuronal differentiation . This is fundamental information missing from studies of mg - dependent regeneration, without which the underlying mechanisms remain difficult to grasp and the therapeutic target rather illusory . Currently, the identity of the activated mg represents cells in the inner nuclear layer of the retina, which have incorporated brdu in response to injury and express mg - specific markers . Given the transition of mg from a quiescent to a proliferative state and the generation of their progenies in different stages of development, the identity based on brdu incorporation, though important, is of limited value . Attempts have been made to prospectively enrich activated mg by hoechst dye efflux assays and to characterize them as sp cells, a phenotype shared by the majority of stem cells (4, 6). However, since sp cells are also heterogeneous, this functional approach has limitations in the absence of specific cellular markers . Although several signaling pathways (e.g. Notch signaling) and intrinsic factors (e.g., ascl1) have been observed to regulate mg activation in fish, birds, and rodents (8), their status as markers of activated mg in different stages of regeneration remain unspecified . Progress in understanding the regenerative mechanisms in tissues like blood (34), intestine (35), and skin (36) has been facilitated by the identification and characterization of markers of the resident stem cells and their progenies . Within the cns, insight into regeneration in the svz has come from the characterization of b1 quiescent and active progenitors and resulting neuroblasts (37). Therefore, to follow mg - mediated regeneration, spatially and temporally, and to identify the stage - specific intrinsic players, a concerted effort is needed to search for reliable and reproducible markers . Currently, there is no consensus on reliable and reproducible mammalian models to study the activation and neurogenic potential of mg . Rodent models representing retinal injuries, ranging from those caused by the exposure to light, neurotoxins, and genetic mutations have been used . Given the observations that glia respond differently to different types and durations of injuries (2), that their levels of activation differ from species to species (ahmad et al ., unpublished observations), and that within the same species there are strain differences in responses (38), a case may be made for developing injury- and species / strain - specific models for reproducible and unambiguous examination of mg neurogenic potentials . These models will be valuable in incorporating transgenic technology for reliable lineage tracing, and more importantly for molecular characterization of activated mg . Characterization of these cells for gene regulatory network and epigenetic signature is essential to shed light on the status of their neurogenic potential and approaches to unlock it . Furthermore, cell type specific injury models would test the ability of mg to replace specific neuronal types, which will be helpful in designing approaches for mg - dependent therapeutic regeneration . For example, the loss of vision in two of the intractable blinding diseases, age - related macular degeneration (amd) and glaucoma, is due to selective loss of photoreceptors and retinal ganglion cells (rgcs), respectively . The neurotoxin injury models where exposure of the retina to n - methyl - n - nitrosourea (mnu) ablates photoreceptors (39) and nmda causes the degeneration of rgcs (40) would reveal whether or not mg could differentiate along specific neuronal types . Also, it may shed light on if mg - dependent therapeutic regeneration would be a practical approach to address degenerative changes in amd and/or glaucoma . The discipline of mg - based regeneration is a recent one, particularly in mammals . With information on the nature of the activated mg and the molecular axes mediating their response to the niche, aided by reproducible animal models and lineage reporters, a pharmacological recruitment of these endogenous progenitors for therapeutic regeneration is a near possibility . In addition, information emerging from these studies will help us understand how the neurogenic potential in the adult mammalian brain is constrained relative to that of lower vertebrates, currently a significant knowledge gap.
|
The field of utility organometallics is increasingly turning to more complex mixed - metal systems to deliver superior results, whether this be for metal halogen exchange, alkylation, insertion, or the trapping of reactive intermediates . In theory, mixed - metal reagents can offer more flexible, tunable solutions to any problem compared to more traditional monometallic alternatives due to the increased number of components which can be varied . Furthermore, the different metal centers and ligand sets can exhibit cooperativity (or synergism) to produce new reactivities inaccessible to the monometallic components . Hydrogen abstraction is an area in which the lure of such mixed - metal systems is proving to be irresistible . The combination of an alkali metal with a range of different subordinates (i.e., metals that would be expected to be less reactive than the alkali metals - zn, mg, mn, cr, fe, cu, cd, al) have been integrated with a diverse array of ligands (alkyl, amido, alkoxy, halide) and have been efficiently deployed in both ethereal and hydrocarbon media to overcome some of the great challenges facing deprotonation chemistry such as the incapability to metalate low brnsted acidity substrates, lack of compatibility with sensitive functionalities, low selectivity and the need to perform reactions under cryogenic conditions . Recently our own group has started to investigate the use of diamines in a bimetallic context, reporting in a communication the synthesis of the diazaethene zincate complex (tmeda)li[(ipr)nch = chn(ipr)]zn(tbu) 1 . 1,3-diazabutadiene ligands, from which diazaethene ligands are often prepared, are increasingly important within coordination chemistry due to their flexible coordination modes and redox properties . The synthesis of this complex from the fully saturated (ipr)nhch2ch2nh(ipr) (diisopropylethylenediamine) 2 (scheme 1) displayed a new mode of hydrogen activation previously unseen within zincate chemistry . We now report a detailed mechanistic overview of this surprising transformation from both experimental and theoretical perspectives . As reported previously, the cocomplexation of the monolithiated diamine li[(ipr)nch2ch2nh(ipr)] with (tbu)2zn(tmeda) at 0 c gives the expected product (tmeda)li[(ipr)nch2ch2nh(ipr)]zn(tbu)23 (scheme 1). In a fashion similar to that of the two - step mechanism for monoamido zincates originally proposed by uchiyama et al ., the amino n h group of 3 is rapidly deprotonated by a tbu ligand to form the dimetalated diamido (tmeda)li[(ipr)nch2ch2n(ipr)]zn(tbu) 4 with the evolution of ibuh . Although diamido 4 has thus far not crystallized, it has been characterized by multinuclear nmr spectroscopy, and we have succeeded in the crystallographic identification of several analogous structures . Using the homologous (ipr)nhch2ch2ch2nh(ipr) (diisopropylpropylenediamine), the dimetalated diamido (tmeda)li[(ipr)nch2ch2ch2n(ipr)]zn(tbu) 5 (scheme 2 and figure 1) could be crystallized from the corresponding reaction of li[(ipr)nch2ch2ch2nh(ipr)] with (tbu)2zn(tmeda). Unfortunately, the crystal data are of insufficient quality to allow discussion of the geometric parameters of the structure, but the connectivity is definite . Zincate 5 contains an ncccnzn six - membered ring in a boat - type conformation . The diamido ligand thus chelates the zn center while its two ipr arms are oriented out of the plane of the ring . The (tmeda)li cation is coordinated to the hull of the boat, anchored exclusively to the two secondary amido groups to produce a puckered linznn four - membered ring . H nmr spectroscopic studies confirm the fully saturated nature of the propylene bridge with methylene resonances at 3.33, 2.95, and 1.93 ppm, while no characteristic diazaethene resonances were present in the 56 ppm region . Molecular structure of the diamido zincate (tmeda)li[(ipr)nch2ch2ch2n(ipr)]zn(tbu) 5 . Hydrogen atoms and disordered tbu / tmeda components have been omitted for clarity . On utilizing thf as a donor ligand in the absence of tmeda, in a repeat of the synthesis of 4, the dimeric thf - solvated product {(thf)li[(ipr)nch2ch2n(ipr)]zn(tbu)}26 was isolated and subsequently crystallographically characterized (scheme 2 and figure 2). Lithium zincate 6 has a centrosymmetric molecular structure consisting of two [(ipr)nch2ch2n(ipr)]zn(tbu) complex anions, juxtaposed, and bridged by two (thf)li cations to produce an eight - membered (linznn)2 ring . The cyclic conformation of 6 allows for the symmetrical coordination of each amido group to one lithium and one zinc center . Both sets of metal centers occupy distorted trigonal planar geometries . The ipr groups on the amido ligands lie syn with respect to the znnccn ring, while the nonplanar nature of the diamide (n1c4c5n2 torsion angle of 50.0(2)) as well as its n c [1.471(3)] and c c [1.530(3)] bond distances, which are comparable with those found in the ruthenium complex [(ipr)nch2ch2n(ipr)]ruh2(co)5 [n c, 1.48(1); c c, 1.52(1)], establish that the ch2ch2 backbone remains saturated . Thermal ellipsoids are shown at the 50% probability level . Selected bond lengths [] and angles [deg]: zn1n1, 2.019(2); zn1n2, 1.986(2); zn1c9, 2.019(9); li1n1, 2.001(4); li1n2(a), 2.041(4); li1o1, 2.004(4); n1c4, 1.471(3); n2c5, 1.470(3); c4c5, 1.530(3); n1zn1n2, 91.20(7); n1zn1c9, 127.5(2); n2zn1c9, 141.2(2); n1c4c5n2, 50.0(2); n1li1n2(a), 127.0(2); n1li1o1, 117.7(2); n3li1o1, 114.9(2). To gain mechanistic insight a detailed nmr spectroscopic study was carried out on the reaction between the monometallic compounds li[(ipr)nch2ch2nh(ipr)] and (tbu)2zn(tmeda). A li nmr spectrum of isolated crystals of the cocomplexation product (tmeda)li[(ipr)nch2ch2nh(ipr)]zn(tbu)23 in c6d6 solution reveals two major resonances at 0.37 ppm and 0.63 ppm, suggesting a mixture of products . When this solution is gently warmed and reanalyzed, the resonance at 0.37 ppm is absent, intimating that the product associated with this low - frequency resonance has been fully consumed, and only the resonance at 0.63 ppm remains (see figure s24 in supporting information). This is consistent with the disappearing resonance at 0.37 ppm representing the bisalkyl zincate 3 which, via an intramolecular deprotonation and concomitant release of ibuh, forms the diamido complex 4 . Further support for this interpretation can be found when considering how close the signal assigned to complex 4 (0.63 ppm) comes to that of the structurally analogous propylene derivative 5 (0.75 ppm, i.e. A difference of only 0.12 ppm). When the reaction was repeated in situ at 0 c and an aliquot removed and analyzed by li nmr spectroscopy, two pertinent resonances at 2.39 ppm, and 1.71 ppm, as well as the resonance belonging to the previously identified intermediate 4, are present (see figure s24 in supporting information). Li dosy nmr experiments reveal that the intermediate responsible for the resonance at 1.71 ppm has a molecular weight similar to that of 4 (see figure s25 in supporting information), presumably ruling out an aggregation process for the formation of this, as yet, unidentified species . Comparison with the li nmr spectra of the diazaethene 1 in c6d6 reveals that the signal at 2.39 ppm is the result of a trace amount of this final product . Due to the highly reactive, transient nature of the bis - alkylzincate 3, its presence is not detected in this in situ nmr study . Another aliquot of the solution was removed after a 2-day stir at room temperature, but the recorded li nmr spectrum indicated no significant further compositional change had taken place . Aliquots were then removed after 5 min, 1 h, and 2 h reflux time, and the recorded spectra revealed a gradual transformation from the saturated intermediate 4 to the unsaturated final product 1 . After 2 h reflux, decomposition of the reaction mixture is evidenced by the deposition of a black solid . Any further intermediates along the reaction pathway must be too short lived to be visible on the nmr time scale . The next step in the reaction pathway 4 1 has been shown to likely proceed through a hydride intermediate as we successfully trapped a hydride by using the electrophilic ketone (tbu)2co . The hydride produced can then deprotonate the now allylic proton on the ethylene bridge to give the final product . The system must then find a way of solubilizing and activating the produced lih, which is normally insoluble in hydrocarbon solvents . A more typical dehydrogenation pathway involving redox active transition metals, such as those reported by brookhart, can be ruled out as there are no redox - active metals present in our alkali metal instead, the reaction could be envisaged to proceed through a ligand - sited oxidation followed by a reduction (scheme 3). This reaction can thus be said to exploit a unique three - way cooperation, where the chemical properties of the two metals and the ethylenediamide ligand combine to allow a type of chemistry otherwise unavailable . In order to explore the possible pathways by which this reaction could proceed we carried out detailed mechanistic investigations using density functional theory (dft, see the supporting information for full details on the level of theory employed) in order to explore the potential energy surface (pes) associated with the proposed mechanisms . We initially inspected the structure and stability of the monomer species 4 at the dft level of theory . In agreement with the three - carbon bridge analogue (5, figure 1), 4 is found to be a stable minimum on the pes with the diamido ligand coordinated to the zn atom (n zn: 2.04 and 1.99) to form a five - membered ring (nccnzn) in a slightly twisted (nccn torsion of 31.4) envelope conformation with the zn atom below the nccn plane, (figure 3). The (tmeda)li cation is coordinated directly above the two n atoms of the five - membered ring by two essentially equivalent li based on the optimized structure of 4 two different mechanisms by which the proposed zinc hydride species could be formed are possible . All h atoms, except those involved in the reaction, are omitted for clarity . The h atom could be initially abstracted by the li cation to form a zn h bond below the plane of the ring, or direct abstraction by the zn to form the zn h bond above the ring plane . Optimisation of the two hydride intermediate structures revealed that both were stable minima on the pes but were formed in endothermic reactions relative to 4 (figure 4). The intermediate with the h atom above the nccn plane (inta) is destabilized by 14.7 kcal / mol (g) relative to 4, while the intermediate with the h atom below the plane (intb) is destabilized by 8.6 kcal / mol (g), relative to 4 . While both reactions are endothermic, the relative stabilities of the intermediates are not sufficiently different to determine which pathway is more favorable . Therefore, we characterized the transition states leading to the intermediate structures in order to determine whether there was a kinetic preference toward either species . The activation barrier associated with the formation of inta is 23.2 kcal / mol (g *), compared to a barrier of 31.8 kcal / mol (g *) for the formation of intb . An activation barrier of 31.8 kcal / mol is still accessible under the experimental conditions employed in the reactivity of 4; thus, while inta is expected to be preferentially formed as an initial hydride intermediate in the formation of the diazaethene product (1), we also considered intb as a potential intermediate from which the second hydrogen abstraction could occur . Abstraction of the second h atom from inta occurs with a barrier of 17.4 kcal / mol, relative to inta, (g *) in an exothermic reaction (g = 13.2 kcal / mol) to generate h2 and the final product 1 . However, despite exhaustive sampling, no transition state could be located that corresponded to the formation of h2 and 1 starting from intb . Therefore, the overall reaction 4 1 + h2, which is essentially thermoneutral (g = 1.5 kcal / mol, figure 4), appears to preferentially occur via the hydride inta . Free energy (g) profile for the formation of 1 from 4 via a hydride intermediate . The path in red corresponds to the formation of the hydride intermediate above the ring plane (inta), while the path in blue corresponds to the formation of the hydride intermediate below the ring plane (intb). The relative stabilities of ts(4-inta) and ts(4-intb) (figure 4) are dictated by the different roles that the li and zn centers play in the two different mechanisms . In both transition states, in order for the zn h bond to be formed, one zn n bond must be broken such that the zn atom is able to accommodate the incoming h and the unsaturated n = c bond can form . Within the ts(4-inta) n bond breaking is facilitated by the formation of a stabilizing interaction between the n atom and the li . This is evidenced by the rotation around the c c bond [increase in the dihedral angle from 31.4 in 4 (figure 3) to 56.3 (figure 5a)], which decreases the li n distance from 2.02 (figure 3) to 1.98 (figure 5a) and increases the zn n distance from 2.04 (figure 3) to 3.39 (figure 5a). In contrast, the rotation around the c c bond in ts(4-intb) is not as great (34.1, figure 5b). In addition, in ts(4-intb) the li atom is forced to migrate toward the second n atom in order to facilitate the transfer of the h atom beneath the plane of the ring . N distance to 3.60 for the primary n (figure 5b), and consequently, the breaking of the zn n bond length is only slightly increased from 2.04 in 4 (figure 3) to 2.12 in ts(4-intb) (figure 5b). Thus, the formation of the hydride intermediate is truly the result of the synergic interplay between the zn (stabilizing the formation of the zn h bond) and li (stabilizing the breaking of the zn returning to experimental studies, a molecular hydride species [(tmeda)li]2[(ipr)nch2ch2n(ipr)]zn(tbu)h 7 has been isolated by using a variation of this mixed - metal approach with the ethylenediamide ligand, demonstrating that this system has the ability to encapsulate lih (scheme 4 and figure 6). Dilithium hydridozincate 7 was synthesized while attempting to generate [(tmeda)li]2[(ipr)nch2ch2n(ipr)]zn(tbu)2 by the n h deprotonation of (tmeda)li[(ipr)nch2ch2nh(ipr)]zn(tbu)23 with a molar equivalent of nbuli(tmeda) (scheme 4). [(tmeda)li]2[(ipr)nch2ch2n(ipr)]zn(tbu)2 facilitates the -hydride formation and elimination of ibuh to generate the zinc hydride species 7 . Dft calculations have confirmed that such a process [4 + (tmeda)lih 7] would be exothermic (g = 28.4 kcal / mol). Molecular hydride 7 can also be produced via the alternative reaction of the usually kinetically challenged base [(tmeda)li]2zn(tbu)4 with (ipr)nhch2ch2nh(ipr) with an improved yield of 65% relative to 35% . Molecular structure of the zincate hydride complex [(tmeda)li]2[(ipr)nch2ch2n(ipr)]zn(tbu)h 7 with hydrogen atoms (except for the hydride ion) omitted for clarity . Thermal ellipsoids are shown at the 50% probability level . Selected bond lengths [] and angles [deg]: li1h100, 1.96(2); li2h100, 2.07(2); zn1h100, 2.14(2); li1n2, 1.979(4); li2n1, 1.989(4); zn1n1, 2.043(2); zn1n2, 2.074(2); zn1c1, 2.045(3); n1c9, 1.481(3); n2c8, 1.448(3); c8c9, 1.523(4); n1zn1h100, 92.8(6); n1zn1n2, 89.66(8); n1zn1c1, 133.1(1); n2zn1c1, 125.19(9); n2zn1h100, 92.8(5); h100zn1c1, 113.0(6); n2li1n5, 121.8(2); n2li1n6, 129.6(2); n2li1h100, 101.5(6); n5li1n6, 85.7(2); n5li1h100, 115.9(6); n6li1h100, 101.6(6). Mixed - metal zincate hydrides have repeatedly demonstrated their utility in organic synthesis as reagents for chemoselective, diastereoselective, and catalytic reductions . Highly soluble, stable, and well - defined zincate hydride species are thus highly desirable . Despite this, however, structurally characterized alkali metal zincate hydrides are extremely rare . To date the only examples on the ccdb are the zinc zinc bonded arzn(-h)(-na)znar (ar = c6h3 - 2,6-[c6h3-(ipr)2]2), the heterocubanes [(tbuoznh)4n(liotbuthf)n] (n = 03), and the higher - order zincates na2[(et)2znh]2 and na3[(ipr)3zn(-h)zn(ipr)3]. Although metal hydride complexes are notoriously insoluble, a reputation perpetuated by common hydride reagents such as lih and cah2, the hydride carrier 7 is soluble in the nonpolar solvent hexane . The structure of zinc hydride 7 bears a partial resemblance to that of the thf solvated dimer 6, with a [(ipr)nch2ch2n(ipr)]zn(tbu) complex anion having a lithium cation bound to each nitrogen atom . The li n amido bond distances in 7 (average 1.984) are close to those in dimer 6 (average 2.021). Likewise the zn n bond distances in hydride 7 [2.074(2) and 2.043(2)] are only marginally longer than those in alkylamido 6 (average 2.002), owing to the increased number of anions bound to the zinc . The tbu group has been pushed out of the plane of the amido ligand to allow the zinc center to enter a distorted tetrahedral geometry by binding to the hydride ligand . As in the lithium zincate 6, the n c [1.481(3) and 1.448(3)] and c c [1.523(4)] bond lengths in 7 are consistent with an unactivated ethylene bridge . The trapped 3-hydride was successfully located and freely refined in the x - ray diffraction study . It caps a li2zn triangle asymmetrically with unequal li h bond distances [1.96(2) and 2.07(2)] and a longer zn h bond [2.14(2)]. The ccdb at the time of writing contains only 45 compounds exhibiting a zn hydride bond . Excluding an anomalously long contact within a zinc borohydride compound (2.409), zn hydride bond lengths range from 1.4092.167 with an average distance of 1.771 . The zn hydride contact in 7 is thus long - range to the best of our knowledge, the longest zn hydride contact in a non - borohydride complex to date (the value of 2.167 mentioned above also comes from a borohydride complex). There are currently 147 compounds in the ccdb containing li hydride contacts with their lengths spanning the wide range 1.6072.802 . The average distance (2.044) is comparable with those found in 7 . To the best of our knowledge however, there have been various dilithio 3-hydride compounds reported with other metals such as ga, al, zr, w, sm, ta, and fe . Variable - concentration multinuclear (h, c and li) nmr spectroscopic studies of 7, as well as exchange spectroscopic (exsy) experiments, confirm the presence of a dynamic equilibrium in c6d6 solution . As well as resonances consistent with the solid state structure of 7, mixed - metal zincate complex 4 can thus be described as a molecular scaffold for the molecularization of the usually insoluble polymeric lih . An examination of the li nmr spectrum reveals a doublet with a jli h coupling constant of 13.3 hz, confirming the retention of the li only a few examples have been detected since the first measurement by bergman of (cp*)irh2sime3li(pmdeta) (cp * = c5me5, pmdeta = n, n, n,n,n-pentamethyldiethylenetriamine) in 1985 . Those detected have coupling constants ranging from 6.414.7 hz, placing our example at the upper end of the literature examples . Surprisingly, two independent h resonances, at 3.27 and 3.19 ppm, were detected coupling with the doublet in the li nmr spectrum . This result can be tentatively assigned to the li resonance for the zincate hydride 7 sharing the same chemical shift as dissociated (tmeda)lih, in agreement with the presence of a dynamic equilibrium in solution . Given the equilibrium between 4 and 7, the formation of a diazaethene compound, analogous to 1, may also occur using 7 as the starting point . The optimized structure of 7 closely matches the experimental x - ray structure, with a mean unsigned error of 0.07 between the measured and calculated bond lengths . The largest deviation between the calculated and experimental values occurs for the interactions involving the hydride ion (e.g., zn h: 1.94 calculated vs. 2.14 experimental, see table s1 in supporting information for details). The deviations in the hydride ion distances may be due to the uncertainty inherent in the crystallographic determination of hydride positions; however, even with the shorter calculated zn h interaction, at 1.94 the zn h contact is clearly long - range . The introduction of the (tmeda)lih ligand to 4 to form 7 results in a different mechanism for the formation of the diazaethene compound . One of the ethylene c8 hydrogen atoms from 7 (figure 7) is aligned for abstraction by the dilithio hydride to form the intermediate (intc) containing a (lih)2 unit . The formation of intc occurs in an endothermic step (g = 21.7 kcal / mol), relative to 7, with an associated barrier of 30.1 kcal / mol (g *, figure 7). The subsequent abstraction of the h atom from c9 (figure 7) to form h2 and the diazaethene compound 8, occurs with a barrier (g *) of 11.8 kcal / mol, relative to intc, in an exothermic reaction (g = 16.7 kcal / mol). Overall, the reaction from 7 to form 8 is slightly endothermic (g = 5.0 kcal / mol, figure 7). From the intermediate structure (intc) the barriers to the forward and reverse reaction (i.e., the formation of 8 + h2 and 7, respectively) are comparable in energy (g * = 3.4 kcal / mol). Therefore, although the equilibrium from intc will be in the direction of 7, the formation of 8 + h2 from this structure should also occur to some extent . Free energy (g) profile for the formation of 8 from 7 via a dihydride intermediate . The possible formation of a zn hydride intermediate, in analogy to the mechanisms explored for the formation of 1 (via inta) was also investigated . The barrier associated with the formation of this hydride intermediate (g * = 28.4 kcal / mol) is accessible under the experimental reaction conditions and the intermediate produced in this reaction is destabilized by 21.1 kcal / mol, relative to 7 . However, the barrier to the subsequent second hydrogen abstraction (i.e., the formation of 8 + h2) is 34.4 kcal / mol, which results in a strong preference for the reverse reaction back to the reactant 7 (g * = 6.0 kcal / mol). As such, the mechanism resulting in the formation of dihydride intermediate (intc, figure 7) is expected to be the dominant mechanism for the formation of 8 + h2, from 7 . Despite the comparable energetics for the formation of 8 from 7 (via intc) and 1 from 4 (via inta), the mechanisms and the synergic interaction of the two metals are distinctly different . The presence of the second li atom in 7 (relative to 4) allows the zn to stabilize the formation of the c = n bond (the zn n bond increases from 2.07 in 7 to 2.18 in ts(7-intc), figure 8), while the li atom is able to facilitate the c h bond breaking step . Finally, the free energy associated with the loss of a (tmeda)lih ligand from 8 to form 1 is slightly less (g = 24.9 kcal / mol) than the equivalent association / dissociation reaction between 4 and 7 . Therefore, given the similar overall kinetic barriers associated with the generation of the diazaethene species starting from 4 and 7, both reaction mechanisms described in figures 5 and 8, should be competitive and operate in a complementary fashion to generate the observed product 1 . The closest analogy to the synthesis of 1 was reported by veith who formed 1,3-diaza-2-silacyclopentene by the double lithiation of (tbu)nhch2ch2nh(tbu) (di - tert - butylethylenediamine) with nbuli followed by an electrophilic quench with cl2si(me)n(h)tbu . It was acknowledged at the time that the process leading to this dehydrogenation was unclear but it was noted that the reaction was highly concentration dependent . For dehydrogenation to occur the lithiation step needed to be carried out in a highly concentrated nbuli hexane solution (2 m). This concentration dependence infers a different mechanism of hydrogen activation from that which results in the synthesis of 1, possibly involving either larger aggregates or an intermolecular process . Large aggregates of liotbu have previously been found to activate and retain lih in solution . The diamido species was never characterized in veith s study . We have confirmed by nmr spectroscopy that (ipr)nhch2ch2nh(ipr), like its homologue (tbu)nhch2ch2nh(tbu), can be activated when refluxed in a concentrated nbuli solution . When the reaction was carried out at concentrations akin to that used in the synthesis of 1, then the dilithiated species could be crystallized as a tmeda solvate (figure 9). This product, [(tmeda)li(ipr)nch2ch2n(ipr)li]29, has a distorted ladder structure in the solid state with the diamido ligands adopting a trans bent conformation allowing them to bridge between opposite corners of alternate rungs . N bond distances of 2.227(2) and 1.971(2) between the outer rungs and 2.057(2) between the inner rungs . Maintaining the c2 axis of symmetry, the long and short edges of the ladder alternate as the ladder is ascended . Both outer lithium centers adopt distorted tetrahedral geometries, while the internal lithium atoms are three - coordinate . This trapping of a ladder segment instigated by the lewis base tmeda supports gardiner s assertions . Selected bond lengths [] and angles [deg]: li1n1, 2.227(2); li1n2, 1.977(3); li1n3, 2.209(3); li1n4, 2.199(3); li2n1, 2.025(2); li2n2, 1.971(2); li2n1(a), 2.057(2); n1c2, 1.460(2); n2c1, 1.458(2); c1c2, 1.521(2); n1li1n2, 81.23(9); n1li1n3, 125.9(1); n1li1n4, 129.1(1); n2li1n3, 117.3(1); n2li1n4, 125.26(1); n3li1n4, 83.34(1); n1(a)li2n1, 109.6(1); n1(a)li2n2, 151.4(1); n1li2n2, 86.7(1). The activation of (ipr)nhch2ch2nh(ipr) has also been achieved starting from the sodium congener na[(ipr)nch2ch2nh(ipr)] and (tbu)2zn(tmeda) to generate the sodium diazaethene zincate (tmeda)na[(ipr)nch = chn(ipr)]zn(tbu) 10 . Although the initial cocomplexation adduct (tmeda)na[(ipr)nch2ch2nh(ipr)]zn(tbu)2 with one n h bond still remaining is apparently too short - lived to isolate, when the reaction was carried out at 0 c and the resulting solution stored at 30 c, it was possible to isolate and fully characterize the dimeric species {(tmeda)na[(ipr)nch2ch2n(ipr)]zn(tbu)}211 with no n h bond but containing the saturated ethylene diamido backbone (figure 10) which must exist further along the reaction pathway that ultimately produces 10 . Two independent centrosymmetric molecules of dimer 11 as well as a hexane molecule form the asymmetric unit . Sodium zincate 11 is constructed from a 545 fused ring system in a distorted ladder conformation; the two znnccn rings lie anti about the strictly planar central znnznn core . The n c [1.452(6) and 1.463(6)] and c c [1.494(7)] bond distances are indicative of a fully saturated bisamide . Contrary to binding in the lithium monomer 5, the heavier alkali metal binds to only one of the available amido groups, with the core nitrogen atoms (n1, n1a) coordinating exclusively to zinc . Despite the variety of amide environments around zinc, the zn n bond distances show little variation (average 2.11). Due to the narrow bite angle of the diamido ligand (85.9) the zinc center adopts a distorted tetrahedral geometry . A highly distorted tetrahedral geometry around sodium is also completed by a weak agostic interaction [2.977(6)] to a methyl arm of the tertiary butyl ligand on zinc . This is moderately longer than a similar interaction found in the bis - alkylamido zincate (tmeda)na(tmp)zn(tbu)2 (2.75). 545 fused ring systems have been found before in metallate complexes containing saturated nccn diamido ligands . Examples include the lithium lanthanide complexes [(thf)3li[1,2-{n(sime3)}2c6h10]mcl2]2 (m = nd, yb) and the dimeric gallium species [{(bz)nch2ch2n(bz)}li{(bz)nch2ch2n(bz)}gao]2 (bz = benzyl, ch2c6h5). Molecular structure of one of the independent molecules of the dimeric sodium zincate [(tmeda)na[(ipr)nch2ch2n(ipr)]zn(tbu)]211 . A weak agostic nac contact is denoted by a broken bond . Hydrogen atoms, ipr groups, and disordered hexane of crystallization have been omitted for clarity . Selected bond lengths [] and angles [deg]: na1n1, 3.720(4); na2n2, 2.326(5); na1n3, 2.490(6); na1n4, 2.490(5); na1c4, 2.977(6); zn1n1, 2.105(4); zn1n2, 2.103(4); zn1c1, 2.072(5); zn1n1(a), 2.122(4); n1c8, 1.463(6); n2c9, 1.452(6); c8c9, 1.494(7); n4na1n3, 75.4(2); n4na1n2, 121.9(2); n4na1c4, 147.7(2); n3na1n2, 137.7(2); n3na1c4, 91.8(2); n2na1c4, 87.4(2); n2zn1c1, 117.1(2); n2zn1n1, 85.9(2); n2zn1n1(a), 110.5(2); n1zn1c1, 127.6(2); n1zn1n5, 88.8(2); n5zn1c1, 120.0(2). As might be expected from polarity considerations, the sodium reagent proves more reactive than the lithium analogue, providing after a 30 min reflux in hexane, the sodium diazaethene 10 in 61% isolated yield . Although the tmeda solvate 10 could be isolated as a crystalline solid, to obtain crystallographic data of adequate precision, the donor ligand thf had to be used in place of tmeda to produce the analogous thf solvate (thf)3na[(ipr)nch = chn(ipr)]zn(tbu) 10a (figure 11). Here, the zinc atom is chelated symmetrically [zn n bond distances 1.957(2) and 1.971(2)] by the diamide ligand, lying below the plane defined by the nccn core of the diazaethene ligand . The methine carbons of the isopropyl groups lie in the plane of the diazaethene ligand while their methyl groups protrude above and below this plane . The sodium atom lies above the nccn bridge, though slightly off center, coordinating to both pairs of nitrogen and carbon atoms . Three thf molecules complete the coordination sphere of the sodium center . Comparing the c n [1.398 (average)] and c c [1.353(4)] bond distances of the diazaethene core with those found in the lithium analogue (tmeda)li[(ipr)nch = chn(ipr)]zn(me) [1.400 (average) and 1.349(3)] indicates that the change in alkali metal has little effect on the diazaethene ligand . Dissolution of 10a in c6d6 to perform an nmr spectroscopic analysis was achieved by the addition of a drop of d8-thf . Comparing the h nmr spectra of the thf solvate 10a with the tmeda solvate 10 reveals only marginal shift changes of the resonances associated with the diazaethene ligand . Comparing the h nmr spectra of the homologues (tmeda)li[(ipr)nch = chn(ipr)]zn(tbu) 1 and (tmeda)na[(ipr)nch = chn(ipr)]zn(tbu) 10 reveals a 0.24 ppm downfield shift of the signal attributable to the ch = ch backbone of the diazaethene ligand on moving from lithium to sodium . Interestingly, there are two sets of doublets associated with the methyl groups of the isopropyls of the lithium compound but only one set in the sodium congener . This would suggest sterically induced hindered rotation of the isopropyl groups in the lithium compound which is relieved on switching to the larger sodium cation . The synthesis of several alkali metal zincate diazaethene complexes has been achieved previously . However, to the best of our knowledge, all previous examples were synthesized by the reduction of unsaturated bis - imino ligands . Therefore, the synthesis of the sodium zincate 10, along with the lithium zincates detailed in our recent communication, appear to represent the first such complexes to be synthesized via a double ch activation of a saturated diamido ligand . Molecular structure of the diazaethene sodium zincate (thf)3na[(ipr)nch = chn(ipr)]zn(tbu) 10a . Hydrogen atoms and minor disordered thf components have been omitted for clarity . Thermal ellipsoids shown at the 50% probability level . Selected bond lengths [] and angles [deg]: na1o1, 2.350(2); na1o2, 2.312(2); na1o3, 2.312(2); na1n1, 2.587(2); na1n2, 2.662(2); na1c8, 2.612(2); na1c9, 2.649(2); zn1n1, 1.957(2); zn1n2, 1.971(2); zn1c1, 2.009(2); n1na1n2, 60.81(6); n1zn1n2, 85.14(8); n1zn1c1, 139.88(10); n2zn1c1, 134.97(10). Conversions of saturated diamines into unsaturated diazaethenes are usually associated with redox - amenable transition metal catalysts . However here we show through a combination of experimental (nmr spectroscopic, x - ray crystallographic) and theoretical (dft) studies that working co - operatively in a molecular mixed - metal system, an alkali metal (lithium or sodium) and zinc can bring about such transformations under challenging redox - inactive conditions.
|
We reviewed the literature for reports of e. sakazakii disease in infants . Using medical subject heading terms " e. sakazakii " or " enterobacter " in combination with " newborn, " " infant, " or " meningitis, finally, we reviewed e. sakazakii case consultations conducted by the centers for disease control and prevention (cdc) from 1998 to 2005 and reviewed results of a french outbreak reported to cdc in 2005 (14). We defined a case as an infant (<12 months of age) with e. sakazakii cultured from an area of the body that is normally sterile: tissue, blood, cerebrospinal fluid, or urine aspirated through the bladder wall . Infants with cultures of cerebrospinal fluid or brain abscesses yielding e. sakazakii were considered to have meningitis . Because bacteremia is usually an intermediate step during the process of developing meningitis, patients with both bacteremia and meningitis bacteremia was defined as e. sakazakii grown from the blood of a case - patient without evidence of meningitis . Infants with gestational ages <37 weeks, or those reported to be premature, were considered premature . A gestational age of 40 weeks was assigned to 3 (27%) of 11 infants with bacteremia and 4 (14%) of 28 infants with meningitis who were reported as born following term gestation without a specific gestational age mentioned . We defined birthweight <2,500 g as low birthweight (lbw), <1,500 g as very low birthweight (vlbw), and <1,000 g as extremely low birthweight (elbw). Descriptive analysis was performed by using sas software (sas institute, cary, nc, usa). Forty - six infants met the case definition (table 1). Reported onset years ranged from 1958 to 2005; 32 (70%) cases cases were reported in 7 countries in north america, europe, and the middle east . Thirty - three (72%) infants had meningitis, 12 (26%) had bacteremia, and 1 (2%) had a urinary tract infection . Eight (40%) of 20 infants for whom data were available were delivered by cesarean section . Twenty - nine (69%) of 42 infants experienced disease onset within a hospital . Gestational duration was available for 38 infants; 21 (55%) were born prematurely, and the median gestational age overall was 36 weeks (range 23.540 weeks). The median birthweight was 2,063 g (range 5403,401); 18 (56%) of 32 infants had lbw; 9 (28%) of these met the definition for vlbw, and 7 (22%) met the definition for elbw . Median age at the time of infection onset was 8.5 days (range 2300). * lbw, low birth weight; vlbw, very low birth weight; elbw, extremely low birth weight . Although the proportion of infants who experienced nosocomial disease onset was not significantly different between the meningitis and bacteremia groups, other infant characteristics differed by site of infection (figure). The median gestational ages of infants with meningitis and bacteremia were 37 and 27.8 weeks, respectively (p = 0.02). Median birthweights were 2,454 g and 850 g, respectively (p = 0.002). However, median age at infection onset was 6 days in the group with meningitis and 35 days in the group with bacteremia (p <0.0001). Thirty (94%) of 32 infants with meningitis, but only 2 (18%) of 11 infants with bacteremia, were <28 days old when infection was detected . One infant (8%) with bacteremia died; this infant also had necrotizing enterocolitis . The single infant with a urinary tract infection recovered without complication . Of 19 surviving infants, only those with meningitis suffered adverse outcomes, including brain abscess (21%, p = 0.2), developmental delays (53%, p = 0.004), motor impairment (21%, p = 0.3), and ventricular shunt placement (42%, p = 0.01); 74% experienced at least one of these outcomes . Box plot with each box indicating range (vertical lines), first and third quartiles (lower and upper boundaries of box, respectively), and median value (horizontal solid line) for gestational age in weeks, birth weight in grams, and age of onset in days for infants with bacteremia only or meningitis . The dotted lines indicate median values for all cases . * significantly different values (= 0.05) between groups . Twenty - four (92%) received a powdered formula product, including an infant who received powdered breast milk fortifier but no powdered infant formula; 1 additional infant received formula of an unspecified type . E. sakazakii was cultured from formula associated with 15 (68%) of 22 cases investigated . Isolates were obtained from prepared formula, opened formula tins, and previously unopened formula tins associated with 2, 6, and 7 cases, respectively . Thirteen (87%) of the 15 formula isolates were indistinguishable from the corresponding clinical strain by biotype or genotype; multiple formula manufacturers were implicated . In one of the remaining cases, multiple e. sakazakii strains were recovered from powdered formula, but none matched the clinical isolate by pulsed - field gel electrophoresis (cdc, unpub ., 2 e. sakazakii strains were isolated from blood and from rectal swabs; a third strain, as determined by arbitrarily primed pcr, was recovered from the powdered infant formula (9). Although numerous reports include infants with e. sakazakii isolated from nonsterile sites, such as respiratory secretions or stool, 46 infants identified from the literature and cdc sources met the case definition for this analysis (1,9,10,12). Of the infants with sterile - site infection contrary to previous characterizations of e. sakazakii disease, we found that infants with meningitis and bacteremia alone fell into 2 distinct groups . Those in whom meningitis developed tended to be of greater gestational age and birthweight than those with bacteremia alone . In fact, infants in whom meningitis developed tended to attain near - term gestational age and birthweight . In contrast, infants in whom bacteremia alone developed tended to be born very prematurely and have elbw . A second major difference between the group with meningitis and the group with bacteremia was the infants' chronological ages . Infants with meningitis were generally <1 week of age at the onset of infection with e. sakazakii, whereas infants with bacteremia had generally surpassed the neonatal period at the onset of their disease . Rates of adverse outcome also differed between the 2 groups, although this was not unexpected . Most infants with e. sakazakii bacteremia fared better than those with meningitis . Among those in whom meningitis developed, rates of adverse outcome were similar to those reported in the literature: in this case series, 74% of meningitis survivors experienced an adverse neurologic outcome, while other studies cite adverse outcome in 20%78% of neonatal or infant meningitis survivors (2123). The division of the infant population into 2 distinct groups occurred for unclear reasons . That infants <1 week of age comprised the meningitis group was not surprising; the disparities in other infant characteristics, however, are not intuitive . Since infants in the 2 groups experienced similar rates of nosocomial disease onset, the infants with bacteremia were unlikely to have simply received treatment earlier in the disease course than the infants with meningitis . Powdered infant formula is a demonstrated source of e. sakazakii infection . A microbiologic survey of powdered infant formulas published in 1988 found e. sakazakii in 20 (14%) of 141 samples tested (24). However, a survey of 82 powdered infant formula samples in 2003 yielded e. sakazakii in 2 (2.4%), which suggests that recent rates of powdered formula contamination may be lower (25). Powdered formula has also been implicated both epidemiologically and microbiologically as a vehicle in several cases of e. sakazakii disease in infants (1,3,9,10,13). Although we could not explore feeding exposures fully with the data available in this series, infant feeding practices may relate to the differences we describe in chronological age of infants at onset of meningitis and bacteremia . Infants with nearly normal gestational ages and birthweights are likely to be tended in normal newborn nurseries during the first 2472 hours of life . In such nurseries, powdered formula is frequently given to babies who are not breast - fed, and it may also be used as a supplement by mothers who have chosen to breast - feed . Since infants are at highest risk for meningitis during the first several weeks of life, possibly because of immaturity of the blood - brain barrier, exposures to e. sakazakii in powdered formula or other sources during this time may quickly lead to central nervous system disease (26,27). Conversely, in the intensive care settings where immature and low birthweight infants are tended, babies are not often fed powdered formula in the first few weeks of life . They may be given parenteral nutrition initially and may be fed breast milk from their own mothers or from a banked source when they do begin enteral feeds . If breast milk is not available, they are more likely to be given sterile, premixed infant formula than powdered formula, since standard preterm infant formula is only available in this form (28). Powdered breast milk fortifiers are not introduced until premature infants tolerate full - volume feeds, which may not occur for days or weeks after birth . Thus, infants in intensive care settings may not be exposed to nonsterile formula until they are more mature, which would lead to a greater proportion of e. sakazakii bacteremia than meningitis in this group if powdered formula is a source of infection . In this series, we were unable to explore the roles of indwelling enteric tubes, prior gastrointestinal surgery, and antecedent antacid or antimicrobial drug use as risk factors for infection . While the reservoir for e. sakazakii is unknown, e. sakazakii has been isolated from factories used to produce milk powder, chocolate, cereal, potato flour, spices, and pasta (29). It also has been isolated from household vacuum cleaner bags and from the guts of the stable fly, stomoxys calcitrans, and the mexican fruit fly, anastrpha ludens (2931). Although a human vaginal tract culture yielding e. sakazakii has been reported, vertical transmission is unlikely because nearly half of infants with e. sakazakii disease in this review were delivered by cesarean section, and symptoms developed in only 1 infant earlier than 3 days of age (32). Although cases with more severe outcomes might have been investigated and published more frequently than uncomplicated cases, this possible bias would not likely affect the representativeness of baseline infant characteristics . Assigning a gestational age of 40 weeks to term infants without a reported gestational age may have falsely elevated the median gestational ages we report, since most term infants are born at <40 weeks' gestation (33). However, a greater proportion of bacteremic infants than meningitic infants received this assignment, and therefore the significance of the differences in gestational age between the groups may be even greater than we report . We were unable to explore the effects of concomitant medical problems, treatments, and other environmental factors, and we relied on existing reports of feeding practices and formula testing . Clearly, additional study is needed to elucidate the lingering questions about e. sakazakii reservoirs, disease risk factors, and disease course . Other gram - negative organisms, including escherichia coli, enterobacter agglomerans, e. cloacae, klebsiella pneumoniae, k. oxytoca, and citrobacter freundii, can be found in powdered infant formula (24,25). Powdered infant formula also has been associated with outbreaks of illness due to citrobacter and multiple salmonella serotypes (13,3438). The degree to which e. sakazakii is a marker for a range of neonatal infections possibly related to powdered infant formula remains to be defined . Certain steps can be taken immediately, however, to prevent or mitigate e. sakazakii disease . In a joint conference on infant formula safety in february, 2004, the world health organization and food and agriculture organization of the united nations made the following recommendations: 1) encourage industry partners to develop a range of affordable sterile formula options; 2) consider setting an industry standard for enterobacteriaecae and e. sakazakii in infant formula; 3) inform infant caregivers of the risks associated with nonsterile, powdered formula; and 4) consider feeding high - risk infants sterile formula if they cannot breast - feed (39). The findings of our case review suggest that all neonates as well as premature infants should be included in this high - risk infant category . The american dietetic association has issued guidelines for infant formula preparation, storage, and administration; these should be followed by infant caregivers in hospitals and private homes (40). Rapid reporting of cases by clinicians could streamline data collection by local health departments and more rapidly resolve remaining questions about this illness . Manufacturer warning labels on powdered infant formula packages should stress that powdered infant formula is nonsterile and requires proper preparation, handling, and storage, and that sterile, liquid formula alternatives are available . These actions, adopted in whole or in part, may decrease the infectious risks associated with powdered formula and prevent this rare but potentially devastating disease.
|
Sterilization in orthodontics has repeatedly been discussed and emphasized in the dental literature. [16] the orthodontic personnel are at a great risk of various contagious diseases and hepatitis b, acquired immuno deficiency syndrome (aids) and herpes infections are some of the serious conditions encountered in an orthodontic office . Therefore, the center for disease control (cdc) specifies that all instruments which are not expected to penetrate into soft tissue or bone but will certainly contact oral tissues must be sterilized, too . In cases in which barrier techniques are not used, cross - infection between the orthodontic personnel and patients is possible . In addition, since orthodontic clinics have a large number of patients during the day compared to other dental clinics, each clinic requires its own custom - made sterilization processes . That 12% of unused orthodontic wires are not sterile and produce bacterial colonies in a culture . Therefore, the instructions on the packages generally recommended sterilization before use . At present, orthodontic wires are selected in different stages of the treatment procedure not only based on wire diameter, but also biomechanical and deactivation properties of wires in order to achieve the best treatment results . -titanium (tma) wires are alloys of titanium and molybdenum, which were introduced in the early 1979 by goldberg and burstone for use in orthodontic treatment . These wires are becoming more popular because of their excellent balance of mechanical properties and absence of nickel, resulting in better tolerance by many patients; some of these mechanical properties include: lower elastic modulus in comparison to stainless steelhigh formabilityability of direct weldinggood spring - backlow stiffnesslow force delivery[1116] lower elastic modulus in comparison to stainless steel ability of direct welding low force delivery[1116] the limitation of -ti wires is their high coefficient of friction . However, some manufacturers have used different methods to solve this problem, including incorporation of a titanium nitride and titanium oxide layer on the wire surface through ion implantation, changing their composition, highly polishing of the surface and increasing the surface smoothness. [71724] some previous studies have evaluated the effect of sterilization on wires with various alloy combinations (-ti, niti, ss),[82528] with contradictory results in relation to -ti wires . In addition, after the expiration of patent on -ti wires by ormco (glendora, california, usa) various manufacturers produce these wires with different compositions and processing methods, resulting in different mechanical properties and different effects as a result of sterilization processes . The aim of the present study was to evaluate the effect of sterilization with dry heat and steam on load - deflection characteristics of -ti wires, with different brands . In the present study five different types of -titanium wires with a cross - section of 0.43 0.64 mm (0.017 0.025 inch) were evaluated [table 1]. The wires were of the straight type . In cases in which only the preformed arch forms were available their straight posterior segments a total of 30 wire segments from each type were provided; each segment measured 30 mm in length . -titanium wires tested in the present study group i was assigned as the control group . The wire samples in group ii were sterilized by dry heat in an oven (12 bahman digital sterilizer, dsl 40, isfahan, iran) at 160c for 1 hour . The wire samples in group iii were sterilized by steam in an autoclave (melag euroclav, 23 v - s, berlin, germany) at 121c and 15 psi for 15 minutes . The wire samples were left to gradually cool to temperatures near the ambient temperature in the same sterilizers . Both process indicators and test strips were used to ensure the sterilization cycles and processes . Then the samples underwent a three - point load - deflection test in the dry state as described by miura et al . The test was carried out using a universal mechanical testing machine (model 1122, instron corporation, canton, ma, usa) using a specially designed setup, consisting of two metallic half - cylindrical structures placed parallel to each other . A single maxillary first premolar bracket (american orthodontics, master series, wis, usa), with a 0.022 0.028-inch slot size with zero angulation and zero torque was bonded on each of the half - cylinders [figure 1], with a distance of 14 mm between the brackets . The wire sample to be tested was fixed on the brackets using 0.012-inch elastomeric ligatures (ortho organizers, carlsbad, california, usa). The center of each wire was deflected by moving a metallic pole adjusted on the upper head of the testing machine at a crosshead speed of 0.5 mm / min . The load was recorded at 0.1-mm intervals from the inactive position up to 1.5 mm of activation and then returning to the zero point to achieve load - deflection characteristics of each wire . Load - deflection apparatus with the wire in place data was analyzed using repeated measures anova to compare load - deflection properties of the five types of -ti wires and determine the changes in characteristics during loading and unloading separately after sterilization of each wire type . Scheffe is a post - hoc test, done after anova test, to evaluate the differences between each two groups . Tables 2 and 3 present means and standard deviations of loading and unloading forces of different types of -ti wires after 1.5 mm of deflection in the three groups under study at 0.1-mm intervals . Figures 26 show load - deflection curves . Means and standard deviations (sd) for loading forces at 0.1 mm intervals of deflection for wire samples in groups i - iii means and standard deviations (sd) for unloading forces at 0.1 mm intervals of defl ection for wire specimens in groups i - iii load - deflection graph of beta wires in the control group and after sterilization with dry and moist heat load - deflection graph of cna wires in the control group and after sterilization with dry and moist heat load - deflection graph of res wires in the control group and after sterilization with dry and moist heat load - deflection graph of hone wires in the control group and after sterilization with dry and moist heat load - deflection graph of tmal wires in the control group and after sterilization with dry and moist heat repeated measures anova showed that during loading, hone wire had the least force level (p <0.05) and res wire had the highest force level . However, there were no statistically significant differences in force levels between res, cna and beta wires (p> 0.05). No significant differences were observed in force levels between tmal and beta wires (p> 0.05). The force levels of res and cna wires were significantly higher than that of tmal wire (p <0.05). During unloading, tmal and hone wires exhibited the lowest force levels (p <0.05); although the force of tmal wire was a little less than that of hone wire res wire exhibited the highest force level, which was significantly higher than those of beta, tmal and hone wires (p <0.05). Although res wires exhibited force levels slightly higher than those of cna wires, there were no significant differences between the two wires (p> 0.05). There were no significant differences in force levels between beta and cna wires (p> 0.05). Repeated measures anova revealed the following [figures 26]: dry heat sterilization group (ii) exhibited the highest force levels during loading and unloading (p <0.05). The force levels in the group sterilized by steam (iii) were significantly higher than those in the control group (i) during both loading and unloading (p <0.05). The force levels of various groups of beta wires during loading and unloading were as follows: i <iii <ii . The dry heat sterilization group (ii) exhibited the highest force levels during loading and unloading (p <0.05). There were more differences between groups i (control) and ii in the higher deflection ranges [figures 3 and 4]. There were no significant differences in force levels between the control (i) and steam sterilization groups during loading and unloading (p> 0.05). The force levels of various res and cna groups during loading and unloading were as follows: iiii <ii . During loading, the dry heat sterilization group (ii) exhibited the highest force level (p <0.05). There were no significant differences in force levels between the control (i) and steam sterilization (iii) groups (p> 0.05). During unloading, the steam sterilization group (iii) had the highest force levels (p <0.05). There were no significant differences in force levels between the dry heat (ii) and control (i) groups (p> 0.05). The force levels of different hone wire groups during loading and unloading had the following relationships, respectively: iiii <ii and iii <iii . There were no significant differences in force levels during loading and unloading between groups i, ii and iii (p> 0.05) (iiiiii). According to hysteresis evaluation (energy loss upon unloading) of wires before and after sterilization showed that only sterilization with dry heat resulted in an increase in hysteresis of tmal and hone wires; however, autoclave sterilization did not have any effect on hysteresis of the wires under study . Repeated measures anova showed that during loading, hone wire had the least force level (p <0.05) and res wire had the highest force level . However, there were no statistically significant differences in force levels between res, cna and beta wires (p> 0.05). No significant differences were observed in force levels between tmal and beta wires (p> 0.05). The force levels of res and cna wires were significantly higher than that of tmal wire (p <0.05). During unloading, tmal and hone wires exhibited the lowest force levels (p <0.05); although the force of tmal wire was a little less than that of hone wire res wire exhibited the highest force level, which was significantly higher than those of beta, tmal and hone wires (p <0.05). Although res wires exhibited force levels slightly higher than those of cna wires, there were no significant differences between the two wires (p> 0.05). There were no significant differences in force levels between beta and cna wires (p> 0.05). Repeated measures anova revealed the following [figures 26]: dry heat sterilization group (ii) exhibited the highest force levels during loading and unloading (p <0.05). The force levels in the group sterilized by steam (iii) were significantly higher than those in the control group (i) during both loading and unloading (p <0.05). The force levels of various groups of beta wires during loading and unloading were as follows: i <iii <ii . The dry heat sterilization group (ii) exhibited the highest force levels during loading and unloading (p <0.05). There were more differences between groups i (control) and ii in the higher deflection ranges [figures 3 and 4]. There were no significant differences in force levels between the control (i) and steam sterilization groups during loading and unloading (p> 0.05). The force levels of various res and cna groups during loading and unloading were as follows: the dry heat sterilization group (ii) exhibited the highest force level (p <0.05). There were no significant differences in force levels between the control (i) and steam sterilization (iii) groups (p> 0.05). During unloading, the steam sterilization group (iii) had the highest force levels (p <0.05). There were no significant differences in force levels between the dry heat (ii) and control (i) groups (p> 0.05). The force levels of different hone wire groups during loading and unloading had the following relationships, respectively: iiii <ii and iii <iii . There were no significant differences in force levels during loading and unloading between groups i, ii and iii (p> 0.05) (iiiiii). According to hysteresis evaluation (energy loss upon unloading) of wires before and after sterilization showed that only sterilization with dry heat resulted in an increase in hysteresis of tmal and hone wires; however, autoclave sterilization did not have any effect on hysteresis of the wires under study . Dry heat sterilization group (ii) exhibited the highest force levels during loading and unloading (p <0.05). The force levels in the group sterilized by steam (iii) were significantly higher than those in the control group (i) during both loading and unloading (p <0.05). The force levels of various groups of beta wires during loading and unloading were as follows: i <iii <ii . The dry heat sterilization group (ii) exhibited the highest force levels during loading and unloading (p <0.05). There were more differences between groups i (control) and ii in the higher deflection ranges [figures 3 and 4]. There were no significant differences in force levels between the control (i) and steam sterilization groups during loading and unloading (p> 0.05). The force levels of various res and cna groups during loading and unloading were as follows: iiii <ii . During loading, the dry heat sterilization group (ii) exhibited the highest force level (p <0.05). There were no significant differences in force levels between the control (i) and steam sterilization (iii) groups (p> 0.05). During unloading, the steam sterilization group (iii) had the highest force levels (p <0.05). There were no significant differences in force levels between the dry heat (ii) and control (i) groups (p> 0.05). The force levels of different hone wire groups during loading and unloading had the following relationships, respectively: iiii <ii and iii <iii . There were no significant differences in force levels during loading and unloading between groups i, ii and iii (p> 0.05) (iiiiii). According to hysteresis evaluation (energy loss upon unloading) of wires before and after sterilization showed that only sterilization with dry heat resulted in an increase in hysteresis of tmal and hone wires; however, autoclave sterilization did not have any effect on hysteresis of the wires under study . -ti wires have gained great popularity in orthodontics due to their favorable nature to tooth and supporting tissues . Multi - stage processing of orthodontic wires by manufacturers has a significant influence on their mechanical properties . High autoclave or dry heat sterilizer temperatures, too, might influence the mechanical properties of wires . Therefore, it is important for the manufacturers to evaluate the effect of sterilization procedures on -ti wires . Heat sterilization techniques were selected in the present study because they are the most popular type of sterilization technique used in dental offices; in addition, it is the most typical method recommended until now . The load - deflection properties are significant parameters in determining the biologic nature of tooth movement . A modified version of the three - point bending test was used in the present study to evaluate load - deflection properties of orthodontic wires . This technique provides a simple model by determining the nature of forces applied during orthodontic treatment and closely simulates clinical situations . In the clinic, when a wire undergoes deflection to be placed within a bracket on a malaligned tooth, in fact, it undergoes loading . When a wire is inclined to return to its original shape, unloading takes place, which provides the necessary force to elicit a biologic tissue response, resulting in the alignment of teeth . However, laboratory tests do not necessarily reflect the clinical situations; rather, they provide a basis for the comparison of various brands of wires . Of the five brands of wires under study [tables 2 and 3], the wires manufactured by ormco (tmal and hone) exhibited the lowest force during unloading, with tmal forces being higher than those of hone during loading, statically equal to those of beta wires . Therefore, hone wires, compared to the other types tested, are more easily engaged in the brackets of malaligned teeth due to lower force levels needed to deflect . Res and cna wires required higher force levels for deflection; therefore, these wires exhibited greater stiffness in comparison to tmal and hone wires, which might be attributed to differences in composition and processing of the alloys used in the manufacture of each of these orthodontic wires . Given the curves and steepness of load - deflection graphs of the control wires in the present study [figures 26], it appears res, beta and cna wires have different behaviors compared to the two products from the ormco company (tmal and hone). These results are supported by those of kusy et al . Who reported that the same wire manufacturer due to similar composition and surface roughness could have manufactured the -ti new products of res, beta iii and cna . The original -ti alloy from the ormco company could have been manufactured with the same characteristics . The results of the present study showed that dry heat sterilization significantly increases force levels during loading and unloading of cna, beta and res and loading of hone wires, making them stiffer . As indicated by the increased slope of the graphs [figures 25] dry heat sterilization influences the clinical performance of cna, res, beta and hone wires . It also results in increased force delivery by cna, res and beta to teeth . The differences in the effect of sterilization with dry heat and steam might be attributed to the use of longer times and higher temperatures in the sterilization process by dry heat . However, sterilization with dry heat did not result in significant changes in force levels during loading and unloading of tmal wires [figure 6]. Previous studies on the effect of dry heat sterilization on -ti wires have evaluated only tma wires (ormco, glendora, california, usa) with a size of 0.016 inch . Reported that use of dry heat sterilization with a temperature of 375f (191c) for 10 minutes on tma archform wires (ormco, glendora, california, usa) which had already been used clinically did not exert any influence on tensile and load - deflection test results of the wires . The results of the present study with tmal wires are consistent with the results of a study by smith et al . With tma wires evaluated the effect of dry heat sterilization at 375f for 20 minutes on tma wires (ormco, glendora, california, usa) and reported a significant increase in the tensile strength of wires . In addition to the type and size of the wires, other factors, which might have resulted in differences between the results of the present study and other studies, mentioned above might be the differences in the sterilization protocols and the type of the mechanical tests applied . The results of the present study did not show any effect of steam sterilization (autoclave) [figures 26] on load - deflection characteristics of the majority of -ti wires tested; however, it increased force levels during loading and unloading of beta and unloading of hone wires, which is reflected by an increased slope of loading and unloading of beta and unloading of hone wires [figures 2 and 5]. Therefore, these wires will deliver greater forces to teeth after sterilization in an autoclave . Regarding the low force levels of tmal wire, especially during unloading both in the control group and after sterilization, it appears ion implantation process is only related to surface characteristics and a decrease in friction, with no detrimental effects on load - deflection characteristics of the wire even after sterilization . The different effects of sterilization on hone and tmal wires might be attributed to differences in the type and concentration of ions or other factors during the manufacturing processes of these wires . It is suggested that clinicians sterilize tmal, res and cna wires in an autoclave before using them without any worries because their favorable load characteristics will not undergo any changes after sterilization, which is consistent with the results of a study carried out by pernier et al . On the effect of autoclave sterilization at 134c or 274f for 18 minutes on tma, tmal and res wires . They reported no differences in load - displacement curves after sterilization of any wire tested . Reported no effect of autoclave sterilization (250f for 20 minutes) on tensile strength of tma wires . In addition, a study by smith et al . Did not show any perceptible clinical differences between new wires and clinically used wires, which are later, sterilized in an autoclave (274f for 10 minutes). The results of the present study showed differences in force levels during loading and unloading between the five brands of -ti wires under study after 1.5 mm of deflection; res, cna and beta wires exhibited different force deflection behaviors in comparison with the two products of ormco company (tmal and hone).there are different changes in load - deflection characteristics of various -ti wires after sterilization with dry heat and heated steam.the clinicians who want to provide maximum safety for their patients can sterilize res, tmal and cna wires in an autoclave without any worries before placing them in the oral cavity . The results of the present study showed differences in force levels during loading and unloading between the five brands of -ti wires under study after 1.5 mm of deflection; res, cna and beta wires exhibited different force deflection behaviors in comparison with the two products of ormco company (tmal and hone). There are different changes in load - deflection characteristics of various -ti wires after sterilization with dry heat and heated steam . The clinicians who want to provide maximum safety for their patients can sterilize res, tmal and cna wires in an autoclave without any worries before placing them in the oral cavity . However, further in vivo studies are required to substantiate the results of the present study.
|
Most pituitary adenomas are clinically inactive . In patients with long - standing compression of the optic chiasm, ganglion cells may undergo axonal degeneration . Spectral domain optical coherence tomography (sd - oct) is able to identify retinal nerve fiber layer (rnfl) and ganglion cell loss in the retina . We present a case in which sd - oct was used to diagnose an asymptomatic pituitary macroadenoma . Sd - oct identified atrophy of the ganglion cell and nerve layers, with preservation of outer layers bilaterally . As macroadenomas enlarge, they can induce uncrossed axon loss, resulting in nasal field defects and reduced visual acuity . In these cases, there is atrophy of the nasal and temporal portions of the optic disc, thus occupying a horizontal band across the disc . Sd - oct is able to identify rnfl loss in eyes with band atrophy of the optic nerve, which correlates with visual field defects found in perimetry . Sd - oct is a useful tool to assess the structural and functional damage of ganglion cells . In our case the sd - oct demonstrated a symmetrical loss of the rnfl and the ganglion cell layer in both eyes, indicating important optic nerve damage . Pituitary adenoma is the most common cause of the chiasmal syndrome.1 the tumor is classified based on size as microadenoma, smaller than 10 mm, or as macroadenoma when it exceeds 10 mm in diameter.2 some tumors secrete one or more hormones in excess, so - called secretory pituitary adenomas, but most are clinically inactive.3 classically, the nonsecretory tumors present with vision loss,4 whereas patients with secretory tumors are usually referred to ophthalmologists for evaluation due to hormonal imbalances that affect bodily functions.5 in patients with long - standing compression of the optic chiasm, ganglion cells may undergo axonal degeneration4 . Optical coherence tomography (oct) is able to identify retinal nerve fiber layer (rnfl) and ganglion cell loss in retina.6,7 we present a case in which the oct (3d oct-2000 spectral domain oct, topcon corporation, tokyo, japan) was used to diagnose an asymptomatic pituitary macroadenoma . The authors adhere to the international standards developed in the 2 conference on research integrity in singapore (2010), while performing this study . The patient agreed to have their case published, and all information presented is non - identifiable.8 a 48-year - old, caucasian female presented with progressive vision loss in both eyes for several months . Her past ocular, medical, and family history was non - contributory with no fatigue, loss of libido, no mood change, and no weight change . On examination, best - corrected visual acuity was hand motion in the right eye and 2/3 in the left eye . Spectral domain optical coherence tomography (sd - oct) demonstrated diffuse atrophy of the ganglion cell and nerve layers, with preservation of outer layers bilaterally (figure 1 and figure 2). Magnetic resonance imaging of the brain was performed and a pituitary macroadenoma with suprasellar extension was observed (figure 3). Pituitary adenomas are common benign tumors of the pituitary gland that account for 12% of all intracranial tumors.9 people can develop pituitary adenomas at any age . Some adenomas secrete hormones in excess . Of the secretory tumors, the most common are prolactinomas.5 they may be relatively small when detected . The most common symptoms include headaches, menstrual changes in females, sexual dysfunction in males, vision problems, and behavioral changes.5 diagnostic imaging may include a high - resolution, t1 weighted, gadolinium enhanced magnetic resonance imaging.10 other secretory tumors may secrete corticotropin, growth hormone, gonadotropins, or thyroid - stimulating hormone.11 adenomas remain confined to the pituitary gland, but when a pituitary adenoma is 10 mm it is called a macroadenoma . Macroadenomas can compress the rest of the pituitary gland and surrounding structures, such as the crossing retinal ganglion cell axons in the optic chiasm, resulting in bitemporal visual field loss.4 as the tumor enlarges, it has been shown to induce uncrossed axons loss, resulting in nasal field defects and reduced visual acuity . In these cases, there is atrophy of the nasal and temporal portions of the optic disc with relative sparing of the superior and inferior parts where the majority of temporal fibers enter . The optic atrophy occupies a horizontal band across the disc, called bowtie or band atrophy.12,13 oct is a noninvasive technique that allows cross - sectional imaging of the retina and quantifies the thickness of the rnfl around the optic nerve head . A number of studies have demonstrated that oct is able to identify rnfl loss in eyes with band atrophy of the optic nerve.6,7 the degree of rnfl thickness reduction has been shown to correlate with that of visual field defects using goldmann perimetry4 and automated static perimetry.14,15 this fact gives oct prognostic value regarding the visual outcome, as demonstrated in different studies.16,17 oct is a useful tool to assess the structural and functional damage of ganglion cells, objectively and quantitatively.4 in our case the sd - oct demonstrates a symmetrical loss of the rnfl and the ganglion cell layer in both eyes, indicating important optic nerve damage . Sd - oct can help in the diagnosis of adenomas in equivocal situations in which there is only subtle optic nerve pallor in the setting of nonspecific visual complaints or visual field defects, or when patients are referred to screen for subclinical compressive optic neuropathies.
|
Percutaneous nephrolithotomy (pcnl) is a widely accepted treatment for urinary calculi> 2 cm or resistant to other modalities . Complications of this procedure are well reported; however, to our knowledge no mention has occurred in the literature of a retained nephrostomy tube after pcnl . Thus, we will present the management of a retained council tip catheter after pcnl . A 76-year - old gentleman underwent a pcnl for a 2.2x1.4-cm lower pole calculus via an uneventful upper pole puncture . Incomplete stone fragmentation was obtained using the ultrasonic lithotripter; therefore, a 24-french council tip nephrostomy tube was placed, the balloon was inflated with 3 ml of sterile water, and the patient was scheduled for a second look nephroscopy when a holmium laser was available . One week later at the second look nephroscopy, attempts to deflate the catheter balloon were unsuccessful . After transection of the balloon port valve, attempted passage of a 0.038 movable core bentson guidewire down the balloon port was unsuccessful . An antegrade nephrostogram outlined the catheter balloon within the renal pelvis (figure 1). With the c - arm in a vertical orientation, an 18-gauge chiba needle (cook, bloomington in) was advanced through a puncture site directly over the balloon under fluoroscopic guidance . The balloon was successfully punctured by the chiba needle with clear efflux through the needle . Contrast was then instilled through the chiba needle to evaluate the integrity of the balloon and exclude the possibility of retained balloon fragments from a ruptured balloon (figure 2b). Flexible nephroscopy was performed to evaluate for balloon fragments, which were not identified, and to remove the lower pole stone . (a) chiba needle (white arrow) has punctured and drained the catheter balloon . (b) contrast injected via chiba needle has filled the catheter balloon (dark arrow) and confirmed its integrity . A retained urethral catheter due to balloon malfunction is a well - recognized urologic complication . Many solutions to this problem have been attempted, including overinflation until rupture, puncture of the balloon via a wire through the balloon port, and puncture of the balloon under ultrasound guidance via a suprapubic or transvaginal route . Given this infrequent but known complication of balloon - type cystostomy catheters, it is not surprising that a similar complication occurred in our patient . Our familiarity with the use of the chiba needle and 3-dimensional fluoroscopy for percutaneous renal access facilitated percutaneous puncture of the catheter balloon . If equipment or experience limits the urologist's ability to perform this technique, collaboration with an interventional radiologist using conventional c - arm or ultrasound for guidance should be considered . Prevention of a retained catheter due to a balloon - port malfunction requires use of sterile water instead of saline and limiting the time of catheter placement . Malecot tubes have been utilized for nephrostomy drainage, but these tubes are not without difficulties . Tissue bridge formation over flanges of the tube has occurred, requiring endoscopic removal . Tubeless pcnl would avoid these issues entirely; however, the tubeless technique is contraindicated in the face of significant postoperative bleeding, urinary extravasation, ureteral obstruction, or anticipated need for a second - look nephroscopy . Pigtail catheters following pcnl may represent a good alternative for drainage and access, while minimizing the risk of catheter malfunction or retention.
|
Radical prostatectomy (rp) is a common curative surgical treatment option in localized prostate cancer (pca). Pelvic lymph node (ln) dissection is performed in order to determine the disease stage, prognosis, and the necessary future treatment options [1, 2]. The fatty tissue overlying the prostate is removed in order to have a better exposure of the dorsal venous complex, the puboprostatic ligaments, and the prostate apex . However, if this fatty tissue is not examined separately by a pathologist, the presence of lns and possible metastasis might be missed and underreported . This might ultimately have an impact on the postoperative disease stage, treatment, and oncologic outcomes . In our study, we investigated the histopathologic evaluation outcomes of anterior periprostatic fat (appf) tissues that were separately sent for pathologic evaluation in order to examine presence of lns and metastasis . Overall, 129 patients who underwent rarp between january 2012 and october 2014 were included in our study . Surgical procedures were performed by three robotic surgeons (afa, aec and mdb). All of the rarp procedures were performed via a transperitoneal approach and patients who had history of transurethral surgery or radiotherapy were excluded from the study . During the rarp procedures, appf covering prostate, endopelvic fascia, dorsal venous complex, prostatic apex, puboprostatic ligaments, prostate - vesical junction and the bladder neck was dissected en bloc laterally and cephalad . If metastatic ln(s) was /were detected, immunohistochemistry for prostate specific antigen (psa) and prostate specific acid phosphatase were performed . Parameters including serum psa, prostate weight, body mass index (bmi), positive surgical margins (psm) and gleason score (gs) were included for further evaluation . Patients were classified according to bmi (kg / m) as follows: <18.5 underweight, 18.524.9 optimal weight, 2529.9 overweight and> 30 obese . Mean patient age, serum psa, prostate weight and bmi were 62.2 5.5 (range 4574), 9.3 6.3ng / dl (range 0.330.3), 60.3 27.2 grams (range 11.0180) and 26.6 1.9 kg / m (range 20.0 - 30.3), respectively . Overall, lns in appf tissues were detected in 14 (10.6%) patients with a mean ln yield of 1.1 0.7 lns (range, 13). Among those found, no additional complication or morbidity due to excision of the appf was found in any of the patients . Patient characteristics postoperative pathologic stages included pt0 (n = 1, 0.8%), pt2a (n = 22, 17.1%), pt2b (n = 15, 11.6%), pt2c (n = 62, 48.1%), pt3a (n = 21, 16.3%) and pt3b (n = 8, 6.2%). Overall, psm were detected in 32 (24.8%) patients . Of the patients with pt2 disease (n = 99), psm rate was 13.1% (n = 13). Of the patients with pt3 disease (n = 29), psm rate was 65.5% (n = 19). Of the patients with pt2a (n = 22), pt2b (n = 15), pt2c (n = 62) and pt3a (n = 21) disease, lns in appf tissues were detected in 1 (4.6%), 1 (6.7%), 11 (17.7%) and 1 (4.8%) patient in each group, respectively . No ln was detected in appf tissue in patients with pt0 (n = 1) and pt3b (n = 8) disease . Of the patients with postoperative gs 3 + 3 = 6 (n = 63), gs 3 + 4 = 7 (n = 34), gs 4 + 3 = 7 (n = 14) and gs 4 + 4 = 8 (n = 7) diseases, lns in appf tissues were detected in 11 (17.5%), 1 (2.9%), 1 (7.1%) and 1 (14.3%) patient, respectively . No ln was detected in appf tissue in patients with postoperative gs of 5 + 3 = 8 (n = 1), 3 + 5 = 8 (n = 2) and 4 + 5 = 9 (n = 6). We did not have any patient with postoperative gs of 5 + 4 = 9 or 5 + 5 = 10 . Of the patients, lns in appf tissues were detected in 0 (0%), 5 (35.7%), 8 (57.1%) and 1 (7.1%) patients of underweight, optimal weight, overweight and obese patients due to bmi, respectively . No association was detected between bmi and presence of lns or mean ln count in the appf tissue (p> 0.05). We removed appf tissue as an en bloc excision and sent it as one piece for pathologic evaluation . We generally started removing the fat laterally from one side on the endopelvic fascia from, laterally to medially, and then shift to the other side . We accumulated both sides in the middle around the superficial dorsal vein on the prostate . Thereafter, we elevated it above the prostate using maryland bipolar scissors and cauterized and cut its tip over the prostatic apex by applying bipolar energy . We then pushed it back up to the junction between the prostate and bladder neck and excised the tissue by applying monopolar and bipolar cautery . Following excision of the appf tissue, the area of endopelvic fascia, puboprostatic ligaments, prostatic apex, surface of the prostate and junction between prostate and bladder neck are all cleared (figures 1 and 2). Prostate, endopelvic fascia, puboprostatic ligaments, junction between prostate and bladder neck are covered with fat tissue . Prostate, endopelvic fascia, puboprostatic ligaments, junction between prostate and bladder neck are seen clearly following excision of the fat tissue . In our study, we identified lns in appf tissue in 10.9% of the patients . Aning et al . Reported 14.7% (n = 204) lns in appf tissue in their series, respectively . Therefore, our findings are similar to previously published studies . In our study, no metastatic ln was detected in the lymphoid tissue that was obtained from the appf tissue region overlying the prostate . However, finley et al . Found ln metastasis in 4 of 204 patients and jeong et al due to the published literature, ln metastasis rate in anterior periprostatic lymphoid tissue varied between 1.22.5% [58]. In our study, no metastatic ln was detected, which might be related to the limited number of patients in our series compared to the other published articles with a larger number of patients . In addition, studies that identified ln metastasis in anterior periprostatic lymphoid tissue had a higher volume of patients with high and intermediate risk patients, as compared to our study . In a multi - center study, kim et al . Included 4261 rrp and rarp patients and there were 40 patients who had metastasis on periprostatic lns . Of the 40 patients, 31 (77.5%) were in a high - risk group, 6 (15%) of them were in an intermediate group and 3 (7.5%) of them were in a low - risk group according to d'amico risk classifications . Jeong et al . Detected metastatic lns in appf tissue in 3 patients that were all in the high - risk group . In our study, 55 (42.6%) patients were in the high - risk group, 52 (40.3%) patients were in the intermediate - risk group and 22 (17.1%) patients were in the low - risk group . We summarized the outcomes of published literature on appf tissue and presence of lns in table 2 . Outcomes of published literature on periprostatic fat tissue and presence of lymph nodes the european association of urology (eau) and national comprehensive cancer network (nccn) recommended extended pelvic lymph node dissection (plnd) in patients at 10% or greater and 7% or greater calculated risk, respectively, for ln metastases . Likewise, the american urological association (aua) recommended plnd in patients at higher risk for nodal involvement . Prognostic significance of ln metastases in prostate cancer and assessment of rates of lns and ln metastases in periprostatic fat pads in radical prostatectomy were reported before . In our experience, we performed extended plnd in intermediate or high - risk pca patients and in those with at least 5% risk of pelvic ln involvement by pca, according to partin's tables . In addition, we always remove appf tissue and send it separately for histopathologic evaluation in patients with low, intermediate and high - risk in order to identify the presence of lns and possible metastasis that we think could have an impact on identifying the correct stage of the disease . We remove appf tissue in low - risk patients because removal of this tissue leads to better exposure of the prostatic apex, puboprostatic ligaments, endopelvic fascia and junction of bladder and prostate . Kim et al . Suggested that removal of appf tissue leads to more accurate staging of the patients . In their series, due to the identification of metastatic lns in the appf tissue, 0.63% of the patients were up - staged pathologically . This finding might certainly have an impact on postoperative adjuvant treatment requirement in this patient group . The condition of regional lns is one of the most important prognostic indicators of disease free survival and overall survival in pca . If a metastatic ln is detected in appf tissue; patients might require adjuvant hormone therapy or radiotherapy . By dissecting appf tissue anatomically, finley et al . Observed that the anterior fat pad was directly connected to the obturator ln chain at the lateral pelvic wall . Jeong et al . Identified 3 patients with metastatic lns in appf tissue in their series of 258 patients, and 2 of these 3 also had metastasis in pelvic lns . Harnisch et al . Identified 4 patients who had metastasis in appf tissue in their study including 302 patients and 2 of these 4 patients had also pelvic ln metastasis . Identified 4 patients with metastatic periprostatic lns but only one of them had also pelvic ln metastasis . To assess the need of adjuvant therapy, postoperative serum psa follow - up is important as well as detecting metastatic lns . In their multicenter study including 4261 patients, kim et al . Reported that 6 of 40 patients with metastasis on periprostatic anterior fatty lymphoid tissue did not require adjuvant therapy at a follow - up of 1.651 months, which might suggest a therapeutic advantage . However, kim et al . Separately evaluated appf tissue in three pieces as a left packet, middle packet and a right packet . In their results,, increased cost was another issue for pathological evaluation of periprostatic fat tissue . In order to decrease cost, they suggested asking for pathological evaluation of the appf tissue only in intermediate and high - risk patients . In our country, if the surgery is performed in private institutions, pathologic evaluation of the appf tissue increases costs . However, in government institutions, it does not increase overall cost because all expenses are covered by the government . In addition, because we think that complete removal of appf tissue leads to better exposure of the surgical field to the operating console surgeon, we excise it even in patients with low - risk pca . In our study, no association was detected between bmi and presence of lns or ln count in the appf tissue . Bmi might have an impact on the amount of periprostatic fat rather than presence of lns . Not only robotic series but also open retropubic radical prostatectomy (rrp) series have evaluated ln existence in appf tissue . Identified lns in periprostatic region in 19 (5.5%) patients of 356 in their rrp series and 4 (1.2%) of them had metastasis, one of 4 patients had also pelvic ln metastasis . In this study they reported that there is no connection between periprostatic ln meta - stasis and pelvic ln metastasis, but in order to provide exact staging, pathologic examination of periprostatic lymphatic area should be a routine procedure . Our study has some limitations that include limited number of patients and differences in the experiences of the surgeons that performed the cases . With increasing number of patients and having more high - risk pca patients lymph nodes might be present in the appf tissue which should be removed and sent for histopathologic evaluation following rarp . Identification of metastatic lns in the appf might have an impact on postoperative staging and management of the patients . In addition, removal of appf leads to a better exposure of the surgical field.
|
The american marten (martes americana) is an arboreal mesocarnivore that ranges from the boreal forests of northern north america into coniferous and mixed coniferous / deciduous forests of the northern and northeastern united states, including the great lakes region (clark et al ., 1987). The american marten was reintroduced to michigan's upper peninsula (up) and northern lower peninsula (nlp) in the mid-20th century after regional extirpation due to habitat loss and over - harvest (cooley et al ., 2004). Over 200 animals were reintroduced to the up over the course of several reintroductions . Many fewer animals (n = 36) were reintroduced in the huron - manistee national forest of the nlp and 49 martens were reintroduced to the pigeon river state forest of the nlp . In contrast, the species is considered a regional forester sensitive species and there is no harvest in the nlp (usda forest service, 2012). Factors hypothesized to be contributing to the differences in population sustainability between the up and nlp include differences in habitat, genetic diversity, health and others . At the time of the original reintroduction, american marten were not examined for parasitic or infectious diseases (spriggs, unpublished data). Some parasites are of economic or zoonotic importance and may be introduced with animal translocations . Therefore, reintroduction programs should take into account the presence of parasites which are pathogenic or to which the species of concern is not adapted (kimber and kollias, 2000). A collaborative research effort has begun in order to investigate factors that may be contributing to the difference in sustainability between the up and nlp populations . The aim of this parasite survey was to describe the presence and prevalence of parasites in the huron - manistee national forest of the nlp and to determine whether there are differences in presence or prevalence of parasites between the nlp and up . Should future translocation of animals from the up into the nlp be considered for management of the species, a non - invasive and inexpensive method for screening animals would be desirable . Also, american marten are not harvested in the nlp and thus adequate numbers of carcasses are not available for examination . While some information exists regarding the prevalence of endoparasitism in american marten in north american, relatively little information is available for the species in michigan (poole et al ., 1983, veine - smith et al ., 2011). This study reviews previous parasite prevalence reports from american marten in north america, presents data from the parasitological examination of live - trapped american marten in michigan, and identifies a possible association between hookworm infection and anaemia in affected american marten . American marten (n = 49) were sampled from the manistee national forest in the nlp (n = 31), hiawatha national forest in the up (n = 13) and ottawa national forest in the up (n = 5). American marten were trapped and immobilized from 2011 to 2015 as described by desmarchelier et al . Nine american marten were recaptured and re - sampled, resulting in a total of 60 faecal samples included in analyses . Blood was collected from the jugular vein and placed into lithium heparin anticoagulant (bd microtainer tubes, becton dickinson and company). We determined haematocrit using microhematocrit capillary tubes (safecrit) and the statspin vt centrifuge (iris). Individuals were identified as anaemic if the haematocrit was <42% based on a report of normal haematocrit in captive, fed american martens of 47 5% (nieminen et al ., 2007). Other health parameters were collected as part of a complete health assessment (spriggs, unpublished data). Faecal float and sedimentation examinations were performed at michigan state university's diagnostic center for population and animal health using standard methods (zajac and conboy, 2012). Faecal flotation was performed using sheather's sugar solution (specific gravity 1.251.27) alone (n = 30) from may 2011may 2012 or with both sheather's sugar solution and zinc sulfate solution (specific gravity 1.18, n = 30) from june 2012january 2015 and examined by light microscopy . Fifty - nine of the samples, representing 48 individual animals, were sufficient in quantity for faecal sedimentation procedure . Ova were identified based on morphologic characteristics including size and in accordance with parasitologic references and previous reports . Upon consultation with a wildlife veterinary parasitologist (gerhold), 2 nematode species (syphacia muris and aspicularis sp .) Prevalence was calculated as the number of infected hosts divided by the number of hosts examined . Because some american marten were sampled more than once, all parasite species found in an individual were considered together for prevalence calculations . Differences between locations (up and nlp) and sexes were examined with a pearson's test with p <0.05 considered significant . Significant differences between presence or absence of anaemia and hookworm infection were also examined with a pearson's test . Parasite species richness by host was calculated as the number of parasite species present per host; species richness by sample was calculated as the number of parasite species present per sample . An unidentified capillarid species was not included in the prevalence or host species richness if one or more species of capillaria was identified in other samples from the same host . Thus, an individual american marten found with unidentified capillarid at the initial exam and aonchotheca sp . At a subsequent exam if both samples had unidentified capillaria, then the host was included in the calculation of prevalence of unidentified capillaria . Differences between sex and location in species richness were examined with a wilcoxon rank sum test, with p <0.05 considered significant . The capture and handling protocol was approved by the university of tennessee animal care and use committee (protocol #2180), and american marten live - trapping and sample collection was an authorized tribal activity under the 2007 inland consent decree between the state of michigan and the little river band of ottawa indians . Sixty samples from 49 individual american marten (28 males, 21 females) were examined, and results are shown in table 1 . Of 49 individual american marten examined, 91.8% were positive for 1 or more parasites and 69.4% were infected with 2 or more parasites . There was no significant difference in mean species richness by host between sexes or locations (nlp and up). Trematode egg identification was suspected but not confirmed to be alaria sp . During the early part of the study (may 2011may 2012) when sheather's sugar solution alone was used for flotation, as alaria species may be distorted due to the osmotic pressure of sugar solution . Later in the study (june 2012january 2015), trematode ova found on sedimentation were confirmed to be alaria species when the sample was floated with zinc sulfate solution, in which trematode ova will not be distorted . Once the use of zinc sulfate solution was implemented, no trematode other than alaria species was identified, and the authors concluded that trematode eggs identified in the early samples were most likely alaria species, as suspected . In the up, 3 samples that were positive on sedimentation for trematode ova were suspected to be alaria species and 7 were confirmed via zinc sulfate flotation; in the nlp, 14 samples positive on sedimentation were suspected to be alaria species and 5 were confirmed via zinc sulfate flotation . Capillaria eggs were seen in 79% and 78.1% of samples from the up and nlp, respectively . Capillaria eggs were further identified as eucoleus aerophila, eucoleus boehmi, or aonchotheca putorii based on size and morphologic characteristics . A hookworm egg is shown in fig . 1 . There was no significant difference in prevalence of any of the identified parasites between male and female american marten . Of 9 american marten that were sampled more than once, only one had identical results for each time point . The mean haematocrit was 45.6 8.1 (range 3068; n = 49). Haematocrit was reported to be 47 5% in the only other report of american marten haematocrit (nieminen et al ., 2007). Using <42% as a cut - off american marten infected with hookworms were significantly more likely to be anaemic than non - infected american marten (p = 0.01) with an odds ratio of 8.75 (95% confidence interval: 1.456.4). Parasite species richness per host was similar to that reported by veine - smith et al . We identified more parasite species in the nlp than the up, but this result may be a function of the larger sample size from the nlp, and there was no significant difference in richness between the 2 locations . Foreyt and langerquist (1993) found 2 or more parasites in 35% of american marten from eastern washington . In another survey from washington, 9 helminth species were found, and 48.4% of hosts had coinfection of 2 or more parasites, with a maximum of 4 (hoberg et al ., 1990). Overall, parasite prevalences were similar between the up and nlp in our samples and we conclude that the up may be suitable source for a translocation of marten to the nlp from the point of view of parasite translocation . Additional screening of both populations, the use of molecular techniques to definitively speciate parasites, and testing of individual martens marked for translocation are recommended . Parasites in our study were identified to the genus and/or species level as possible by microscopic examination alone . Future research could employ the use of molecular tools such as polymerase chain reaction to provide more specific results . Such techniques were not used in this study because we desired an inexpensive method that could be repeated in any future reintroduction programs that require screening of large numbers of animals . Parasites identified as a concern for reintroduction of north american river otter included alaria canis, strongyloides lutrae, crenosoma goblei, capillaria and coccidia due to potential for pathogenic effects or high prevalence (kimber and kollias, 2000). River otter reintroduction programs tested and treated parasitized otters, and similar methods could be considered for reintroduction of american marten (hoover et al ., 1985, griess, 1987, serfass et al ., of 9 american marten that were sampled more than once, only one had identical results at subsequent sampling, indicating either a change in infection status or inconsistent shedding of ova in the remaining 8 marten . Alaria species are flukes found in the small intestine of definitive hosts including felids, canids and mustelids . Alaria mustelae is known to infect mink (mustela vison) and short - tailed weasels (mustela erminea), as well as american marten (veine - smith et al ., alaria taxidae was identified from 25% (n = 6) of american marten from the district of mackenzie, northwest territories and was identified in manitoba, canada, at prevalences ranging from 36 to 73% depending on the area (holmes, 1963, poole et al ., 1983). A definitive host infected with alaria species in its intestines sheds eggs in its faeces . After 2 weeks in wet soil or water, the eggs hatch, producing a miracidium . The miracidium invades a freshwater snail, at which point it develops into a cercaria . When the tadpole is ingested by an amphibian, reptile, or rodent, the mesocercariae remain in the tissues of the paratenic host . The mesocercariae migrate through the stomach, across the diaphragm and into the lungs where the mesocercariae develops into metacercariae . The metacercariae are able to travel up the trachea and are then swallowed, at which point they develop into adult trematodes in the small intestines . While infection with alaria species typically does not cause disease in the definitive host, there are reports of the mesocercariae causing neurologic disease due to aberrant migration through the central nervous system and of respiratory illness due to migration through the lungs in domestic dogs (kimber and kollias, 2000, kazacos, 2001). Other species of trematodes have caused disease in north american river otters, but the pathogenicity of alaria in american marten is not known (kimber and kollias, 2000). If a pregnant female rodent or carnivore becomes infected with alaria, the mesocercariae can migrate to the mammary glands and can be transmitted to nursing young (bowman et al ., not yet weaned, in the nlp, histopathology revealed infection with alaria species in the duodenum, confirming the potential for lactogenic transmission of mesocercariae in this mustelid . In the report by veine - smith et al . (2011), faeces from the large intestines of 140 american marten carcasses from the up were examined for flukes using a sedimentation technique and found a prevalence of 39% (n = 54). The difference in prevalence between that report and ours (55.6%, n = 10) may be due to differences in sample size, methodology or a true difference (veine - smith et al ., 2011). We recommend the use of both faecal sedimentation and zinc sulfate flotation for identification of trematode eggs in faecal samples obtained from live animals . Euryhelmis squamula has been reported in raccoons (procyon lotor), mink, and american marten in washington and uses amphibian intermediate hosts in this region (hoberg et al . American marten from washington were documented with 6% prevalence from the southern cascades, confirming that marten are ingesting anuran prey in this area (hoberg et al ., e. squamula has been reported in mink in north america and is a common parasite of the polecat in europe (ameel, 1938, miller and harkema, 1964). A related parasite, the mink is the natural host for euparyphium beaveri in michigan, while euparyphium inerme has been reported to infect river otters in the pacific northwest (miller and harkema, 1964, hoberg et al ., 1997). Hymenolepis nana is a zoonotic cestode of rodents, carnivores and humans found worldwide, but other species of hymenolepis infect galliformes, including potential american marten prey species . The parasite may use intermediate hosts or paratenic hosts, including dung beetles, stable flies and fleas (drew, 2003, joslin, 2003, loomis, 2003, sainsbury, 2003). Without knowing the species of hymenolepis found from the american marten in the nlp, it is not known whether this may have been a pass - through finding or was truly an infection of the american marten; the zoonotic potential is not known . Taenia species are cestodes (commonly known as tapeworms) that maintain a completely sylvatic life cycle . The definitive hosts for taenia mustelae and taenia martis americana are primarily mustelids . Adult parasites live in the small intestine and eggs are passed in the faeces of the host . The ingested larvae form cysticercus in skeletal muscle and viscera, and the life cycle is completed when a carnivore consumes the infected intermediate host . While the definitive host typically shows no signs of disease, the intermediate host may suffer morbidity or mortality, including liver damage, as a result of infection (jones and pybus, 2001). T. mustelae has a wide distribution across the northern hemisphere and has been reported in north american mustelids, including american marten, short - tailed weasel (mustela erminea), mink (neovison vison) and least weasel (m. nivalis). The cestode has been found in 2 sciurid definitive hosts, marmota broweri and m. caligata (jones and pybus, 2001). Taenia martis americana infects mustelids, including american marten, fisher (martes pennanti) and the ringtail (bassariscus astutus, family: procyonidae), as definitive hosts . Rodents in north america reported with the larval stage of infection include lemmus sibiricus, microtus xanthognathus, mus musculus and ondatra zibethicus (jones and pybus, 2001). Two american marten from the southern cascades were co - infected with both t. mustelae and t. martis americana (hoberg et al . Adult parasites are found in the small intestine of definitive hosts, which include canids, felids and mustelids (bowman et al ., larval or adult parasites can also infect birds, reptiles and other mammals (wardle and mcleod, 1952). Eggs, or gravid proglottids, are suspected to be ingested by a first intermediate host, a coprophagic insect or a mite (chowdhury and aguirre, 2001, bowman et al ., the insect is consumed by a second intermediate host, which may include birds, mammals, reptiles and amphibians . Lastly, the definitive host becomes infected by ingesting the second intermediate host (bowman et al . Definitive hosts may have clinical signs of infection including anorexia, low serum albumin and vomiting (chowdhury and aguirre, 2001). Humans can be incidental definitive hosts and become infected by consuming undercooked game (chowdhury and aguirre, 2001, fuentes et al . Mesocestoides lineatus was identified in the small intestine of 33% (n = 14) of american marten from eastern washington with significantly higher rates in juveniles than in adults . Current taxonomy, however, suggests that this species may have actually been m. variabilis, which occurs in north america, while m. lineatus is an old world species (fuentes et al ., 2003). Coinfections with m. lineatus and capillaria putorii occurred in 35% of parasitized american marten, and juveniles had statistically higher rates of coinfection than adults (foreyt and langerquist, 1993). Hookworms are zoonotic nematode parasites infecting carnivores (taylor et al ., 2007). Carnivores may become infected via ingestion of larvae or eggs, paratenic hosts, or via percutaneous or lactogenic transmission . Larvae migrate to the lungs, moult, and are coughed up and swallowed to lay eggs in the small intestine . Ingested larvae may bypass pulmonary migration or migrate out of the lungs into the muscle and remain in an infected female mammal until pregnancy occurs, at which point the larvae migrate to the mammary gland leading to lactogenic transmission (taylor et al ., 2007). Hookworm infection in dogs and foxes can result in bloody diarrhoea, anaemia, poor hair coat, poor growth in puppies and respiratory signs (taylor et al ., 2007). We found that the odds of having anaemia (haematocrit <42% as described by nieminen et al ., 2007) were 8.75 higher for american marten infected with hookworms than in uninfected american marten in this study . While there was a significant association between presence of hookworm infection and presence of anaemia in this report, other clinical signs related to hookworm infection in addition, molecular techniques could be used to determine the species of parasite infecting american marten in michigan . Because of the potential for anaemia to affect fitness of an individual american marten or the growth of kits infected via transmammary transmission, treatment of hookworm - infected american marten destined for relocation may be warranted . (previously known as capillaria putorii) infects the gastrointestinal tract of mustelids and other species, while other capillarids infect the respiratory tract, bladder or liver of their respective definitive hosts (bowman et al . A. putorii can have a direct or indirect life cycle in which adult parasites shed eggs in the gastrointestinal tract of the mammalian host . The eggs are capable of infecting other susceptible hosts directly or using an earthworm as an intermediate host (segovia et al ., 2007, taylor et al ., 2007) a. putorii was found in 77.8% (n = 14) of american marten from the up in the current report, which was significantly higher than the 29.0% (n = 9) prevalence in the nlp (p <0.05). However, during the initial stage of this parasite survey, some capillaria ova were not identified to species, and these are represented as if the 42.0% (n = 13) prevalence of unidentified capillaria found in the nlp were in fact a. putorii, then there would not be a significant difference in prevalence of a. putorii between the up and nlp . The prevalence of a. putorii from the up in this report is higher than the 47% (n = 66) previously reported from american marten carcasses from the up (veine - smith et al ., 2011). A. putorii has also been reported in the stomach of ferret, mink, short - tailed weasel, raccoon, fisher and striped skunk (mephitis mephitis) and in the small intestine of bobcats, bears, raccoons, swine, hedgehogs and the domestic cat (foreyt and langerquist, 1993, bowman et al ., 2009). In northeastern washington, c. putorii was found in 86% (n = 13) of american marten carcasses, mostly in the stomach and less frequently in the large or small intestine of american marten . Using faecal flotation alone, capillaria species ova were found in 64% (n = 21) of samples examined from the same population (foreyt and langerquist, 1993). Additional future comparisons between carcass and faecal examinations to determine prevalence of capillaria and other parasites is warranted . Eucoleus aerophilus, previously known as capillaria aerophila, infects the respiratory tract of hosts including american marten and other carnivores, such as fisher, red fox (vulpes vulpes), raccoon, coyote (canis latrans), striped skunk and badger (taxidea taxus) (bowman et al ., 2009). E. aerophilus rarely infects humans (laloevi et al ., 2013). The life cycle of e. aerophilus may be direct or indirect with earthworms serving as intermediate hosts (bowman et al . Aerophilus can lead to respiratory disease and clinical signs include coughing, wheezing, failure to thrive, pneumonia and even death . Cats and dogs have also been infected but typically do not suffer the same degree of clinical signs as foxes since their infections are not as intense (bowman et al ., 2009). E. aerophilus was identified in 4% of the respiratory tracts of american marten from ontario, but it is unknown whether infection resulted in disease or increased risk of being trapped (seville and addison, 1995). Eucoleus boehmi has been reported to infect the respiratory tract of foxes and dogs (bowman et al ., 2009). Its ova can be differentiated from the similar e. aerophilus by its pitted surface (bowman et al ., 2009). The relative contribution of earthworms to the american marten diet in michigan is not known but may be significant given the high overall prevalence of capillarid parasites seen there . Physaloptera species are found in the stomach of infected carnivores, including mink, striped skunk, raccoons, dogs, and cats, and eggs are shed intermittently (chowdhury and aguirre, 2001, veine - smith et al ., 2011). Crickets, beetles or other invertebrates act as intermediate hosts, while rodents and reptiles may be paratenic hosts (chowdhury and aguirre, 2001). While most infections do not cause disease in the host, severe ulcerative gastritis has been reported in the bandicoot, a marsupial (perameles species) (holz, 2003). Crenosoma species is a lungworm found within the respiratory tract of carnivores and insectivores (craig and anderson, 1972). Adult parasites lay eggs in the lungs; larvae are coughed up, swallowed, and passed in host faeces . Heavy infection with crenosoma species can cause clinical signs such as coughing, sneezing, nasal discharge and difficulty breathing (chowdhury and aguirre, 2001). The red fox is the typical host for crenosoma vulpis and is sympatric with american marten in both the up and nlp . Given the global distribution of c. vulpis, it is likely that this parasite exists in the nlp red fox population although the parasite was not identified in american marten from the nlp in this study . Crenosoma petrowi has been reported from free - ranging russian sable, a captive fisher in the united states and a badger from canada (craig and anderson, 1972). A single american marten from ontario was found to be infected with crenosoma petrowi (<1% prevalence), but the reported prevalence in fisher from the same region was 15% (seville and addison, 1995). Olsen (1952) examined 62 carcasses of martes caurina from colorado and found 18 (29%) to be infected with crenosoma, which he designated crenosoma coloradoensis . Crenosoma species was found in the lungs of 2% (n = 3) of american marten from the up of michigan (veine - smith et al ., 2011). Strongyloides martis and s. lutrae have been reported in river otters (hoberg et al ., 1997). Parasites of this genus are generally species or host - specific and undergo both a direct life cycle and a free - living stage . Infective larvae or eggs in the soil are consumed by the host; larvae of some species can also enter the host through the skin (morris and shima, 2003). Pathogenicity of strongyloides species in mustelids is not known, but disease could result from migration of the parasite through the lung (kimber and kollias, 2000). Dioctophyme renale, commonly known as the giant kidney worm, is one of the largest roundworms infecting wild and domestic species worldwide including wolves, bears, foxes and mink, as well as domestic dogs, cattle, horses and pigs . Humans have also been reported with d. renale (chowdhury and aguirre, 2001). The adult worm is typically found in the right kidney because the infective larvae exits the intestinal tract on the right side near the stomach . When the parasite dies, the kidney is essentially destroyed, and the host becomes reliant on the remaining left kidney . Occasionally, both kidneys are infected or the parasite is found elsewhere in the abdomen . An adult female worm lays eggs within the kidney, and the eggs are shed in the urine of the host mammal . It takes about 6 months for the egg to become infective, at which point it may be swallowed by the intermediate host, lumbriculus variegatus, an aquatic annelid commonly known as blackworm . If the annelid is eaten by an american marten, or other mammalian host, the life cycle is completed when the larvae finds its way to a kidney . Fish, frogs and crayfish may act as paratenic hosts by consuming the infected annelid (cheng, 1986, chowdhury and aguirre, 2001). A single american marten from the up was reported with nephritis due to suspected prior infection with d. renale (spriggs, unpublished data). In an examination of 405 american marten from ontario, d. renale was found in only 2% of american marten and only from districts with previous reports of infected mink . In 4 of the 5 infected american marten, there was evidence only of past infection such as the entire right kidney missing or merely a fibrous capsule remaining, while in 1 american marten the actual parasite was identified (seville and addison, 1995). Filaroides martis is a helminth parasite found in the trachea, bronchi and lungs and has been reported to infect mustelids, including mink and american marten, as well as canids (chowdhury and aguirre, 2001). The larvae moults in the stomach mucosa of the definitive host and migrates to the thoracic cavity over the next month . Larvae increase in size over 100-fold during this timeframe (ko and anderson, 1972). Infection with f. martis has been reported to cause pneumonia in other species, but its effect on american marten is not known (chowdhury and aguirre, 2001). Of 405 american marten examined from ontario, 8% had lung or aortic nodules associated with the parasite . Because yearlings had a significantly higher prevalence of infection than other ages, the authors suggest that infection could have an effect on survival of yearlings or that american marten are able to recover from infection at older age groups (seville and addison, 1995). F. martis was found in the lungs of 4% (n = 5) of american marten carcasses from the up of michigan (veine - smith et al ., histopathology revealed lesions consistent with verminous pneumonia in 60% (n = 9) of american marten carcasses from michigan (spriggs, unpublished data). While these were incidental findings and the causative parasite was not identified, it is possible that pneumonia may have resulted in mild respiratory compromise in affected american marten . Pearsonema plica, previously known as capillaria plica, was identified in the urinary bladder of 6% of american marten from ontario (seville and addison, 1995). P. plica has been reported in the urinary tract of the domestic cat, dog, raccoon, red fox, coyote, wolf, striped skunk and fisher, as well as american marten (butterworth and beverley - burton, 1980). The definitive host begins to shed eggs of c. plica in the urine about 8 weeks after consuming an earthworm, the paratenic host (bowman et al ., 2009). Infection usually does not cause disease for the host, but there is a suggestion that p. plica resulted in poor growth in fox kits (bowman et al ., baylisascaris devosi is a nematode reported in both american marten and fisher (kazacos, 2001). Eggs shed from the definitive host become infective after 1114 days, at which point small mammals such as rodents and squirrels become infected by ingesting the eggs while foraging . The larvae migrate throughout the tissues of these paratenic hosts and typically localize to the muscle of the forelimbs and thorax . Neural larval migrans, a neurologic disease, is rare or non - existent with b. devosi (kazacos, 2001). In contrast, the larvae of the related baylisascaris procyonis, or raccoon roundworm, frequently migrate to the central nervous system of non - adapted hosts and cause neural larval migrans . Humans are susceptible to neural larval migrans caused by baylisascaris species, but b. devosi is less likely to cause disease in humans than b. procyonis (kazacos, 2001). Adult b. devosi inhabits the small intestine; the definitive host does not typically show signs, but intestinal blockage is possible with a severe infection (chowdhury and aguirre, 2001). In 42 m. caurina carcasses examined from idaho, one was infected with b. devosi (erickson, 1946, poole et al ., 1983). Soboliphyme baturini, commonly known as stomach worm, is a nematode parasite distributed from central siberia across beringia to the pacific northwest of the united states (koehler et al ., 2009). Other mustelids reported with the parasite include ermine (m. erminea), mink and ferrets (mustelo putorius furo) (levine, 1968, swartz, 1968, koehler et al ., 2009). S. baturini has been reported in other carnivores, including the fox and domestic cat (levine, 1968). Mature female worms are found in the stomach or small intestine of the mustelid host, and eggs are passed in the faeces of the host . Earthworms are the intermediate host, while shrews become paratenic hosts when they ingest the earthworm . American marten may be infected by consuming either infected shrews or earthworms (koehler et al ., 2009). (2009) used genetic molecular data of s. baturini to shed light on the expansion of the ancestral american marten across beringia into north america, its speciation during isolation in glacial refugia, and re - colonization in alaska and reinfection with s. baturini . Clinical manifestation of infection in sable includes anaemia and gastric ulceration (thomas et al ., 2008). There was a 55% (n = 155) prevalence of infection with s. baturini in american marten from prince of wales island in alaska (table 3). There was no correlation between intensity of s. baturini infection and fat deposits which measured to assess nutritional condition (thomas et al . American marten carcasses were collected over an 8-year time period from 3 locations in alaska and stomachs were examined for s. baturini (table 3). None of the american marten in that study had any sign of negative health impact from the parasite infection (zarnke et al ., 2004). A study conducted in idaho examined 42 m. caurina carcasses and found one with s. baturini (erickson, 1946). It is found worldwide except in antarctica and australasia (chowdhury and aguirre, 2001). Adult t. spiralis are found in the small intestine, and the females give birth to larvae which migrate through the body to become encysted in skeletal muscle . An american marten may become infected by consuming a rodent or other mammal with the encysted parasite . Once consumed, the larvae are freed and migrate to the small intestine of the host to complete their life cycle . Humans can acquire trichinellosis by eating undercooked meat (taylor et al ., 2007). The first report of t. spiralis in american marten in north america was from manitoba, canada, where a single yearling was found infected of 139 american marten examined (poole et al ., 1983). Prevalence of trichinella in american marten and other species may vary from year to year (dick et al ., 1986). American marten from the northern and southern cascades of washington were found to have trichinella encysted in the diaphragm, with a prevalence of 50% and 31%, respectively (hoberg et al ., 1990). Another study examined tongue muscle from 42 american marten from northeastern washington and found only 5% prevalence, which the authors attribute to differences in technique and tissues examined (foreyt and langerquist, 1993). A study conducted in ontario found a 3.4% prevalence (n = 68) of infection with t. spiralis in american marten (dick et al ., 1986). The prevalence in fishers in the study was slightly higher at 4.5% (n = 83), and a single mink (of 12 tested) was positive . The authors suggested that american marten and fishers are key in the sylvatic transmission of trichinella in this part of canada (dick et al ., 1986). Other reports of t. spiralis in american marten are found in table 3 . (1986) in which only mustelids were found with t. spiralis, this study found a high prevalence in coyote (61%, n = 22) and confirmed infection in a variety of other mammals including carnivores and rodents (schmitt et al ., 1976). Dracunculus insignis is a parasite known to infect raccoons, dogs, mink, fishers and skunks in the united states east of the rocky mountains and in ontario, canada (crichton and beverly - burton, 1973, cheng, 1986). Experimental infections in ferrets are used as a model for human dracunculiasis (eberhard et al ., 1988). Dracunculus lutrae infects otters in north america (crichton and beverly - burton, 1973). Both species have a similar life cycle to the related the old world parasite didelphis medinensis, commonly called the guinea worm, a zoonotic parasite . Female d. lutrae migrate to the tissues under the skin of the animal to give birth to live larvae while secreting a substance that causes a blister to form . When the blister ruptures and is exposed to water, the infective larvae is released into the water . The free - living larvae can survive for several days until they are consumed by an aquatic copepod, the intermediate host . D. insignis develops through several more stages within the copepod over the next 3 weeks . When a definitive host ingests the copepod while drinking water, the larvae are freed in the stomach or small intestine and migrate to abdominal organs and tissues where they continue to develop into adult worms over the next 812 months (cheng, 1986). D. insignis was found in only a single american marten of 405 examined in ontario despite the parasite being commonly found in raccoons of the same region . The authors suggested a higher true prevalence, but detection was low due to the pelt being removed for commercial reasons in most of the examined specimens (seville and addison, 1995). This parasite is of economic concern as it can affect pelt quality in fur - bearer species . A single american marten from the nlp was found to be shedding sarcocystis species sporocysts . Sarcocystis species is a protozoal parasite that has infrequently been reported in carnivores such as domestic cats, dogs, raccoons, cougars, bobcats, mink, striped skunks, sea otters, fishers and pacific harbor seals (foreyt and langerquist, 1993, gerhold et al ., 2005, larkin et al ., 2011). (2005) reported a case of meningoencephalitis in a fisher caused by sarcocystis neurona in maryland, usa . The virginia opossum (didelphis virginiana) is the definitive host for the parasite in north america, but the natural intermediate host for s. neurona has not been discovered (gerhold et al ., 2005). Sarcocystis species was found in the tongues of 10% (n = 4) of american marten examined from northeastern washington (foreyt and langerquist, 1993). Antibodies to toxoplasma gondii were detected in 10.8% (n = 15) of american marten in ontario . American marten in michigan were found to have a 58% seroprevalence (n = 47), and there was no significant difference between the up and nlp (spriggs, unpublished data). T. gondii has been reported to cause mortality in the related black - footed ferret (mustela nigripes), captive - raised american mink (neovison vison) and southern sea otters (enhydra lutris) (dubey et al ., 2003, burns et al ., 2003, jones et al ., 2006 coccidian parasites have been only rarely reported in american marten, but this is likely because few studies have used faecal flotation and/or histopathology to detect parasites . All coccidian parasites are obligate, intracellular parasites and undergo stages of asexual and sexual reproduction in the life cycle, which may be direct or indirect . Coccidian oocysts from 5 american marten in this report were sporulated to allow identification to the genus level . Eimeria species were identified in 2 of the 5 sporulated samples from american marten in the current study, and cystoisospora species in the remaining 3 samples . It is unknown whether coccidian oocysts seen in faecal samples were pass - through from prey species . Taxonomy of coccidian parasites has been controversial; some have considered cystoisospora species to be synonymous with isospora species, while others believe it to be a distinct genus based on molecular and morphological characteristics (yi - fan et al ., 2012). Cystoisospora species were identified in american marten from michigan in this report based on morphological features of the sporulated oocysts . (2012) reported cystoisospora species in steppe polecats in china and suggested that previously reported isospora species in various other mustelids, including that of sable, should be reassigned to cystoisospora species . Faeces from 33 american marten from eastern washington were examined, and 6% were found with coccidian oocysts (foreyt and langerquist, 1993). Cryptosporidium and giardia species cysts were detected in the faeces of american marten from the up of michigan, both having a prevalence of 4% (n = 5) (veine - smith et al ., 2011). North american marten are infected with a wide variety of endoparasites, but information regarding the pathologic effects of parasitism remains limited . American marten infected with hookworms in the current study were found to be at risk for anaemia, and this association warrants further investigation . Some parasites are infrequently reported in only a single location, while those reported in multiple locations typically have a varying prevalence . Multiple ecological factors, including habitat, prey availability, sympatric carnivore community, and host adaptation, are likely involved in the variation of prevalence at different geographic locations . A number of parasites known to infect american marten have zoonotic potential . As american marten are frequently trapped as a furbearer species, this information could guide prevention of disease transmission to trappers and researchers working with the species . Parasite infections could cause illness under conditions of stress and presumed immunosuppression associated with reintroduction programs (kimber and kollias, 2000). The majority of previous studies examined american marten carcasses for parasitism, which allows characterization and speciation of the adult parasite and information about intensity of infection . However, a non - invasive method of detecting endoparasitism is desired for reintroduction programs and our results provide baseline information about parasites detected by faecal examination from american marten in michigan . Multiple faecal exams from individuals destined for relocation, including sedimentation and molecular techniques when available, are warranted to identify novel parasites and parasites with pathologic or zoonotic potential and to make appropriate treatment or management decisions.
|
In korea, close to 86.8% of the elderly population (aged 65 or older) has chronic degenerative disease1 . Among these degenerative diseases, arthritis has the highest prevalence rate . Osteoarthritis mainly occurs in the hip joints and knee joints, which are weight - bearing joints, and most elderly persons aged 65 years or older have this disease1, 2 . Osteoarthritis induces the growth of osteophytes, leading not only to pain but also to the loss of movement and often to a state of lethargy, in which the individual avoids walking1 . This lethargy hinders the individual from performing functional activities, often resulting in muscle weakening and atrophy, including decrease in muscle force and motor unit activation of the muscles around the joint affected by osteoarthritis3 . Muscle weakening and atrophy further contribute to reduced walking and functional abilities required for daily living3 . Flexion - relaxation phenomenon (frp) refers to the appearance of muscular - electrical silence on the surface of the erector spine during complete trunk flexion4, which could be affected by several factors, including lumbopelvic postures5, repetition of tasks6, and muscle fatigue7 . Chronic osteoarthritis, therefore, often leads to stooped postures as a result of the tension experienced when assuming postures in which the erector spine is elongated3, 4 . The erector spinae muscle is a posture - maintaining muscle that is used in all daily living activities in which trunk forward - tilting and straightening motions are performed . Normal frp of the erector spinae is an important precondition for smoothly performing the functional activities of daily living and is an important measurement variable in the evaluation of treatment effects at clinics8 . There are currently insufficient studies examining the effects of osteoarthritis on the frp of the erector spinae and on how the frp of the erector spinae observed in young adults is different from that of the elderly in whom osteoarthritis has occurred . Therefore, the present study compared the frps of the erector spinae occurring during (1) trunk flexion, (2) complete trunk flexion, and (3) trunk extension motions in both healthy, young females and elderly females with chronic knee osteoarthritis . In addition, data regarding whether the frp of the erector spinae can be used as a method of evaluating the degree of pain in chronic osteoarthritis in the elderly will be presented . If the erector spinae flexion - relaxation rates can be used as a pain scale, it may assist healthcare professionals to improve elderly patients quality of life . This study was a randomized controlled trial, which included healthy adult females attending a university and elderly females aged at least 65 years diagnosed with chronic osteoarthritis in the leg, among the elderly community residing in a metropolitan area of chungcheongnam - do in south korea . The selection criteria for elderly subjects were as follows: those who had no orthopedic or neurologic disease affecting the leg other than chronic osteoarthritis, had not undergone surgical treatment of the leg within the last 6 months, had not experienced any fracture in the leg in the last 6 months, had corrected visual acuity not lower than 0.8 and had no blurred vision, could understand experimenters instructions and cooperate with the experimenters, and had understood the purpose of the present study and voluntarily agreed to participate . The study was approved by the institutional review board of hanyang university, and written informed consent was obtained from all patients prior to the experiments . The general characteristics of the subjects that participated in the present study are shown in table 1table 1.general characteristics of study subjects (n=30)elderly females with chronicosteoarthritis (n=17)healthy adult females (n=13)age (years), m sd 75.8 12.0 * 21.1 0.8height (cm), m sd153.5 6.3159.6 3.7weight(kg), m sd56.5 8.752.9 5.4*p<0.05 . In the present study, surface electromyography (emg) (trigno wireless system, delsys inc ., boston, ma, usa) was used to measure the muscle activity of the healthy adult females and elderly females with chronic knee osteoarthritis while they were performing trunk flexion, complete trunk flexion, and trunk extension . The emg signals measured by the trigno sensor and wirelessly transmitted to the trigno base station were analyzed using emgworks 4.0 (delsys inc ., boston, ma, usa) software . All measured muscle activity values were calculated as percentages of maximal or submaximal voluntary isometric contraction values . The emg signal - sampling rate was 1,024 hz, and the signals were band - pass filtered within a range of 10500 hz . Metronomes were used to enable the experimental subjects of the present study to perform trunk flexion, complete trunk flexion, and trunk extension for 5 s each over a total of 15 s. the beat was set to 60 bpm, and seconds were counted so that the subjects could hear and perform each motion for 5 s. before attaching the emg electrodes, sweat and foreign matter in the experimental muscle regions were removed in order to minimize skin resistance . The attachment points for measuring the thoracic erector spinae were 5 cm to the left and right of the spinous process of the t9, while the attachment points for measuring the lumbar erector spinae were 2 cm to the left and right of the spinous process of the l2 . The manual muscle force postures for measuring of the maximal voluntary isometric contraction (mvic) in healthy adults and the submaximal voluntary isometric contraction in elderly persons with chronic knee osteoarthritis were determined following the method of osullivan et al6 . The values of each subject were measured 3 times for 5 s, in succession, over a total of 15 s. measurements during the first and last seconds of each measurement period were excluded, and the maximum values during the middle 3 s were used for the quantification of the root mean square (rms). To minimize muscle fatigue, 1 the subjects were randomly measured in the order of voluntary participation . During the measurement of the flexion - relaxation rates, three motions were performed: (a) trunk flexion, (b) complete trunk flexion, and (c) trunk extension . Posture 1 was a standing posture, posture 2 was a trunk - bending motion, and posture 3 was a maximum trunk - bending motion . In the complete trunk flexion section, the subjects were instructed to bend the trunk maximally within the range of bending with no pain before measurement . Preliminary instruction was provided to the subjects by the experimenter, who performed the motions in front of the subjects and helped the subjects practice the motions at least one time . The flexion - relaxation rates were determined using both the values obtained by dividing the data for trunk extension by that of complete trunk flexion (c / b) and by dividing the data for trunk flexion by that of complete trunk flexion (a / b). The mean values of the three trunk flexion extension motions were used to determine the flexion - relaxation rates . The means and standard deviations of the general characteristics of the study subjects (age, gender, height, and weight) were calculated using descriptive statistics . In the present study, the independent variable was the presence or absence of chronic knee osteoarthritis, and the dependent variable was the frp of the erector spinae . Independent t - tests were used to examine the erector spine flexion - relaxation rates according to whether the presence or absence of chronic knee osteoarthritis . To test the statistical significance, was set to 0.05, and the collected data were analyzed using pasw ver . The effect of chronic knee osteoarthritis on the frp of the erector spinae was first examined . The values obtained by dividing the data for trunk extension by that of complete trunk flexion were not different for the left and right lumbar erector spinae or right thoracic erector spinae; however, they were significantly different for the left thoracic erector spinae (p<0.05) (table 2table 2.flexion-relaxation phenomenon (frp) values obtained by dividing the data for trunk extension by those for complete trunk flexion from healthy adults and elderly individuals (units:%) musclesmean sdelderly females withchronic osteoarthritishealthy adultfemalesleft thoracic erector spine1.67 0.61 * 1.22 0.45right thoracic erector spine1.87 0.822.31 1.35left lumbar erector spine2.35 1.312.08 1.36right lumbar erector spine2.46 1.031.85 1.81*p<0.05). The values obtained by dividing the data for trunk flexion by that of complete trunk flexion, were not different for the left and right lumbar erector spinae and right thoracic erector spinae, but were significantly different for the left thoracic erector spinae (p<0.05) (table 3table 3.flexion-relaxation phenomenon (frp) values obtained by dividing the data for trunk flexion by those for complete trunk flexion from healthy adults and elderly individuals (units:%) musclesmean sdelderly females with chronic osteoarthritishealthy adult femalesleft thoracic erector spine1.47 0.55 * 1.12 0.31right thoracic erector spine1.41 0.491.99 1.43left lumbar erector spine2.00 1.082.58 2.75right lumbar erector spine1.76 0.901.62 1.31*p<0.05). In the present study, the frp of the erector spinae in elderly females with chronic knee osteoarthritis and healthy young females were measured to determine whether the erector spinae flexion - relaxation rates could act as a useful pain evaluation tool for patients with knee osteoarthritis . Although no significant differences were evident in the flexion - relaxation rates of the left and right thoracic erector spinae or right lumbar erector spinae, significant differences were shown in the flexion - relaxation rates of the left thoracic erector spinae . Degenerative arthritis develops in most people aged 65 or older, with a higher prevalence in females than in males . Lower - limb osteoarthritis is associated with foot postures and affects the dynamic alignment of the lower limbs9 . Reilly et al.9 reported that patients with knee joint osteoarthritis showed changes in the ankle joint postures when compared with healthy individuals, and according to the study of hu et al.10, foot posture and stance widths affected the load - sharing mechanism of the lumbar muscle tissues . Therefore, knee osteoarthritis was believed to affect the frp of the lumbar erector spinae . The frp can act as a quantitative measure for the evaluation of changes in the neuromuscular system functions11 . Varying flexion - relaxation rates among patients are a useful clinical tool that can help in diagnosing chronic lower back pain in patients3 . This argument is supported by strong evidence that those subjects with low back pain do not exhibit the frp during complete trunk flexion12 . Watson et al.13 demonstrated the validity of measuring the frp of the lumbar vertebrae to diagnose lower back issues and reported high specificity and sensitivity . In addition, the flexion - relaxation rates are a valuable tool for distinguishing between patients with cervical pain and those with no cervical pain, and to indicate changes in the neuromuscular control in patients with cervical pain . The flexion - relaxation rates of the cervical spine were reported to be significantly lower in patients with cervical pain14 . Shin et al.15 advised that the knee angles and individuals flexibility levels affected the frp of the lumbar muscles . They reported that in the case of subjects with high flexibility, knee angles affected the flexion - relaxation rates when the trunk angle became 90, and in the case of those with moderate flexibility, the foregoing reactions appeared when trunk angles were 7090. they also reported that in the case of those with poor flexibility, knee angles did not affect the flexion - relaxation rates . According to the study by hashemirad et al.16, muscle activity pattern of the erector spinae varied with flexibility during trunk flexion / extension . The flexion - relaxation reactions are affected by several factors, including trunk loads, lumbosacral postures, trunk angular speed, number of task repetitions, and muscle fatigue6,7,8, 17 . Although previous studies were actively conducted on the effects of loads, angular speed, muscle fatigue, and postures on the flexion - relaxation rates, studies on the effects of changed lumbosacral postures of patients with chronic knee osteoarthritis on the frp of the erector spinae have been insufficient . Therefore, the present study intended to examine the differences in the frp of the erector spinae between elderly persons with degenerative knee osteoarthritis and healthy adults . Although not clinically significance, the results showed significant differences only in the left thoracic erector spinae, but not in the left and right lumbar erector spinae or right thoracic erector spinae . First, the study sample was small and was limited to females with chronic knee osteoarthritis second, although the same voice signals were given using a metronome during trunk flexion and extension, trunk speeds were different among individual subjects . Third, the levels of knee pain were different among individual patients with chronic knee osteoarthritis, and the effects of medication and previous treatment could not be eliminated . To further determine the frp of the erector spinae in elderly females with chronic knee osteoarthritis, further studies that account for the limitations of the present study may be required.
|
New - onset diabetes after transplantation (nodat) represents a common comorbidity after solid organ transplantation . Nodat after kidney transplantation is associated with inferior outcomes, including higher risk of infections, decreased graft survival, higher rates of cardiovascular disease, and increased overall mortality [15]. Risk factors for nodat include use of immunosuppressants, in particular corticosteroids and calcineurin - inhibitors, as well as traditional risk factors for type 2 diabetes including obesity, family history, age, and ethnicity [68]. Metformin is the first - line agent of choice for the treatment of type 2 diabetes in the general population . Though some data suggests metformin is safe in the setting of chronic kidney disease, the use of metformin in kidney transplant patients is still quite controversial due to the concern about lactic acidosis and lack of data regarding metformin use in this patient population [911]. Therefore, it is important to identify an alternative first - line oral agent for the treatment of nodat in kidney transplant recipients . Short - term studies have shown some oral antihyperglycemic agents to be effective in patients with nodat [1214]. However, use of these agents is limited by adverse effects including fluid retention and bone loss with pioglitazone and hypoglycemia and weight gain with insulin secretagogues [12, 15, 16]. Sitagliptin, an oral dipeptidyl - peptidase-4 (dpp-4) inhibitor, was approved in the united states in 2006 for the treatment of type 2 diabetes . Sitagliptin has a low incidence of hypoglycemia and does not promote weight gain, and the dosage can be adjusted based on renal function . Additionally, in a 3-month trial of kidney transplant recipients, sitagliptin use did not alter immunosuppressant levels . However, evidence supporting the efficacy and safety of long - term use of sitagliptin in kidney transplant recipients is lacking . We hypothesized that in kidney transplant recipients sitagliptin would improve nodat control, as assessed by hemoglobin a1c (hba1c), with a favorable safety profile including no effect on immunosuppressant levels or graft function . In this single center study, we performed a retrospective analysis of kidney transplant recipients in the multidisciplinary transplant clinic at the university of nebraska medical center (unmc) between october 2006 (release date of sitagliptin in the united states) and december 2012 . All subjects in this study received their kidney transplant at unmc . Between 2009 and 2013, 125 to 149 kidney transplants were performed per year at unmc (http://optn.transplant.hrsa.gov/). We have previously reported an incidence of nodat of 18% in our kidney transplant population . The study was approved and monitored by the unmc institutional review board . A general query was performed to identify all kidney transplant recipients who had been prescribed sitagliptin during the study dates . Data for the query and subsequent data collection for the study were obtained from review of the electronic medical records centricity (ge healthcare), ottr (ottr chronic care solutions), and epic (epic systems corporation). Inclusion criteria for the study included diagnosis of nodat by the 2003 international consensus guidelines criteria (fasting plasma glucose 126 mg / dl or 7.0 mmol / l after no caloric intake for at least 8 hours or random plasma glucose 200 mg / dl or 11.1 mmol / l with symptoms of diabetes or 2 h plasma glucose in a 75 g oral glucose tolerance test (ogtt) 200 mg / dl or 11.1 mmol / l) and diabetes care received at the unmc diabetes center to allow for accurate record of diabetes medication changes and reporting of side effects . Additionally, to specifically understand the efficacy and safety of sitagliptin for the treatment of nodat, patients included in the study either used sitagliptin as the initial agent for nodat or had other diabetes medications stopped prior to or at the time of sitagliptin initiation . Exclusion criteria included diagnosis of diabetes prior to transplant and death or loss of followup prior to 12 months after initiation of sitagliptin . Sitagliptin dosing was performed based on the patients' renal function, as directed by the prescribing information for sitagliptin (https://www.merck.com/). Initiation of sitagliptin therapy marked the start of followup for each patient and patients were followed up until discontinuation of sitagliptin or december 2012, whichever came first . The first was a 12-month followup to assess the subacute efficacy and safety of sitagliptin in terms of diabetes control, side effects, immunosuppressant levels, and graft function . The second endpoint was at discontinuation of sitagliptin or, for those patients who continued on sitagliptin through the entire study, in december 2012 . This longer followup allowed for assessment of long - term efficacy and safety in terms of diabetes control, acute rejection episodes, allograft function, and other side effects . The patient medical records were reviewed in detail for a number of different diabetes and transplant - specific outcomes including dates of sitagliptin initiation / discontinuation; dates of initiation / discontinuation of any other diabetes medications; patient or physician - reported side effects; reason for discontinuation of sitagliptin; acute rejection episodes; graft loss; immunosuppressant regimens and dosages; opportunistic infections; and death . Body mass index (bmi) was obtained at the time of transplant, at the time of sitagliptin initiation, after 12 months of sitagliptin therapy, and at the end of followup . As part of routine posttransplant and diabetes care, patients underwent fasting labs weekly to monthly at the clinical laboratory of the nebraska medical center including serum creatinine, tacrolimus and/or sirolimus trough levels (as appropriate), and fasting glucose levels . Hba1c was performed every 3 months and fasting lipid panel every 3 to 6 months . Serum creatinine, fasting serum glucose, hdl cholesterol, and ldl cholesterol measurements were performed using standard calibration protocols and dedicated analyzers and were assayed by colorimetric means . Tacrolimus and hba1c was performed on a national glycohemoglobin standardization program (ngsp) certified high - pressure liquid chromatography (hplc) analyzer . Estimated gfr (egfr) was calculated using the modification of diet in renal disease (mdrd) equation . A total of 65 patients were identified to have received sitagliptin after kidney transplant during the study dates . Of these, 37 patients met criteria for nodat (figure 1). Of these 37 patients, a total of 15 were excluded from the study: 9 patients who obtained their diabetes care at outside clinics and clear records of diabetes medication adjustments were not available; 1 patient who was deceased 8 months after sitagliptin initiation; and 5 patients because sitagliptin was added to other diabetes medications . The remaining twenty - two (22) patients met inclusion criteria and had at least one year of followup and were subsequently analyzed . This cohort of 22 patients does include long - term followup of eight of the fifteen patients analyzed previously at our center in a 3-month prospective study of sitagliptin for the treatment of nodat . Baseline characteristics of the 22 patients included in the study are shown in table 1 . Of the 22 patients, nodat was diagnosed in 21 by fasting blood glucose 7.0 mmol / l on two occasions; one patient was diagnosed with random blood glucose> 11.1 mmol / l with symptoms of diabetes . A majority of patients utilized tacrolimus - based immunosuppression with the addition of either sirolimus or mycophenolate mofetil (table 1). Hepatitis c has been reported to be a risk factor for nodat; however, none of our subjects were hepatitis c positive . Sitagliptin was the initial diabetes medication for a majority of the patients (16/22). A total of twenty - two patients were analyzed at the end of 12 months of sitagliptin therapy . Of these, 19 patients remained on sitagliptin alone as their only diabetes medication, one patient required initiation of an additional oral diabetes medication, and 2 patients had sitagliptin discontinued in favor of other diabetes medications due to hyperglycemia . Diabetes control, as noted by hba1c, was significantly improved at the end of 6 months and this effect persisted at 12 months (figure 2(a)). Significance remained when analyzing just those patients (n = 19) who remained on sitagliptin alone for the entire 12 months (data not shown). There was a modest but significant decrease in bmi from the start of sitagliptin to the 12-month followup (figure 2(b)), though certainly this weight loss may have been due to multiple factors including lifestyle modifications . Ldl and hdl cholesterol values remained unchanged with sitagliptin therapy (figures 2(c) and 2(d)). At the 12-month followup, graft function as noted by serum creatinine and estimated gfr (egfr) was no different than at start of sitagliptin (figures 3(a) and 3(b)). We then reviewed immunosuppressant levels over the 12 months of followup and also meticulously reviewed medical records for immunosuppressant dose changes and, if changes to dose were made, the impetus for doing so . Tacrolimus and sirolimus levels remained stable throughout the 12-month followup (figures 3(d) and 3(e)). In tacrolimus - treated patients, for the remainder of tacrolimus - treated patients only 3 patients required a single protocol dose adjustment and the rest maintained consistent tacrolimus doses . Similarly, the patient with noncompliance required frequent sirolimus dose adjustments during the follow - up period while 3 patients had single, protocol - related sirolimus dose adjustments . To assess the long - term efficacy and risk for adverse effects of sitagliptin in kidney transplant recipients, we followed our cohort from the initiation of sitagliptin until december 2012 or discontinuation of sitagliptin, whichever came first (mean followup for all 22 patients = 32.5 17.8 months). In the cohort, 17/22 patients remained on sitagliptin throughout the study period, for a mean duration of sitagliptin use of 37.9 16.5 months . Of these 17 patients, 9 remained on sitagliptin alone for the entirety of the study (31.8 18.7 months). Diabetes was well controlled in this group, with hba1c maintained below 7% (6.5 0.5%) at the end of followup (figure 4(a)). Eight patients continued on sitagliptin for the duration of the study (44.9 10.9 months) but required addition of other diabetes medications to maintain glycemic control (oral agents, n = 4; insulin, n = 4). Hba1c remained well controlled in this group (figure 4(b)) and two of the four patients on insulin required only basal insulin in addition to sitagliptin . Therefore, five patients discontinued sitagliptin in favor of other diabetes medications after 14 4.2 months . Of these, 4 patients discontinued sitagliptin due to worsening hyperglycemia (figure 4(c)) and need for intensive insulin therapy while one patient was switched from sitagliptin to a sulfonylurea due to cost . Hemoglobin a1c was significantly lower at baseline in patients who were able to continue on sitagliptin alone for the duration of the study (n = 9) compared to patients who discontinued sitagliptin and were switched to more aggressive diabetes management (n = 5) (figure 4(d)). Change in bmi, from sitagliptin initiation to the end of followup, was no different between these groups (sitagliptin alone: 0.8 2.2 kg / m versus sitagliptin discontinued: 1.1 1.7 kg / m, p = ns) suggesting the need for intensification of diabetes therapy in the sitagliptin discontinuation group was not necessarily related to weight gain . Glucagon - like peptide-1 (glp-1) therapies have been implicated to potentially increase the risk of pancreatitis, a matter of significant controversy . In the current study, no episodes of pancreatitis were reported during the follow - up period . Additionally, other transplant - specific adverse events were rare in our cohort, including one episode of acute rejection (47 months after sitagliptin initiation); two episodes of opportunistic infections (13 and 14 months after sitagliptin initiation); no graft loss; and one death (due to end - stage liver disease). Our study represents the largest cohort investigating the safety and efficacy of sitagliptin for the treatment of nodat in kidney transplant recipients . Though our study was retrospective, through meticulous review of the medical records of patients followed up primarily in our transplant endocrine clinic we were able to closely follow medication prescribing changes, laboratory values, and reports of potential side effects and transplant - related comorbid events . In our cohort, sitagliptin was efficacious with a majority of patients meeting a goal hba1c <7% . Specifically, sitagliptin alone was adequate to improve and maintain glycemic control in a majority of patients (19/22) for 12 months after sitagliptin initiation, consistent with its efficacy in the nontransplant population [21, 22]. Sitagliptin inhibits dpp-4 with several subsequent effects that improve blood glucose control including potentiation of insulin secretion and inhibition of glucagon secretion . In studies utilizing animal models of type 2 diabetes, sitagliptin has also been shown to reduce islet inflammation and protect beta cell mass [2325]. Beta cells exposed to glp-1 in vitro are resistant to toxicities associated with immunosuppressants, suggesting another potential benefit to dpp-4 inhibitor therapy for the treatment of nodat . These beta cell - specific protective effects of sitagliptin may explain why, in our cohort, patients with lower baseline hba1c responded better to sitagliptin monotherapy as these patients may have been earlier into the disease and may have had more beta cell mass that was subsequently protected by sitagliptin . Overall, these findings suggest that initiating sitagliptin therapy early in the treatment of nodat, when average glucose levels are only modestly elevated, may provide long - term benefits in terms of glycemic control . Larger cohorts are needed to investigate this point further . In solid organ transplant recipients, drug - drug interactions and adverse effects of medications on graft function we set out to better define the safety profile of sitagliptin in kidney transplant recipients in terms of effects on immunosuppressant levels / dosing, graft function, and other side effects . Renal function and tacrolimus and sirolimus dosing and trough levels remained stable during the initial 12-month follow - up period, indicating sitagliptin does not adversely affect renal function or interfere with immunosuppressant dosing . Hypoglycemia was not encountered in our cohort, consistent with reports of sitagliptin use in the nontransplant population . The use of dpp-4 inhibitors for the treatment of hyperglycemia and nodat in kidney transplant recipients is gaining more interest . Recently, a 3-month clinical trial of vildagliptin, another oral dpp-4 inhibitor, revealed that this agent improved oral glucose tolerance test outcomes and modestly improved hemoglobin a1c in kidney transplant recipients with impaired glucose tolerance (igt). Similarly, a small, randomized control trial recently revealed vildagliptin to be a safe and effective therapy for the treatment of nodat in kidney transplant recipients . Finally, a 24-week retrospective study of linagliptin suggests this agent may be beneficial for treating nodat, as well . However, data regarding sitagliptin for the treatment of nodat in kidney transplant recipients is scarce . A single pilot study of 15 patients followed up for 3 months revealed no significant effect of sitagliptin on renal function (as measured by estimated gfr) or tacrolimus or sirolimus levels . Additionally, iuppa et al . Presented an abstract discussing the use of sitagliptin in solid organ transplant recipients and, although most of the subjects were liver transplant recipients, 18 kidney transplant recipients were reported on with a median followup of all patients (kidney and liver transplant recipients) of 178 days . These small trials and a case report of a single kidney transplant recipient treated with sitagliptin for 2.5 years encompass the entire literature available on this subject . Our study provides the most person - years of followup of any trial of sitagliptin for the treatment of nodat in kidney transplant recipients . Additionally, though retrospective, our study provides the longest followup of any dpp-4 inhibitor used for the treatment of nodat in kidney transplant recipients . Limitations of our study include the retrospective nature of our study and the small cohort size . However, large, prospective studies regarding glucose - lowering therapy for nodat do not exist currently (as reviewed) and our study represents the largest study to date examining the use of sitagliptin in the setting of nodat after kidney transplantation . Our cohort was comprised mostly of caucasian males and steroids were not part of the maintenance immunosuppressant regimen . These factors may limit the ability to generalize our findings . Finally, our mean time to diagnosis of nodat (56.3 57.7 months after transplant) was longer than many studies of nodat . This likely reflects that the patients in our cohort had slower, less aggressive development of nodat and did not require insulin therapy . Kidney transplant recipients with viable grafts remain at higher risk of diabetes development, a significant portion of the risk being ascribed to immunosuppressant therapy . Safe, effective therapies are needed for patients who develop nodat regardless of the timing of the diagnosis, and sitagliptin may be useful for this purpose given the favorable side effect profile and lack of interaction with immunosuppressant medications . In conclusion, we have shown that, in a small cohort of kidney transplant recipients who developed nodat, sitagliptin was efficacious as a single agent or in combination with other glucose - lowering medications . Sitagliptin was also well tolerated and renal function and immunosuppressant levels and dosing were stable during 12 months of therapy . Sitagliptin may be valuable as a first - line agent in kidney transplant recipients diagnosed with nodat who are candidates for oral therapy.
|
Substantial improvement in survival of people living with hiv has been observed with the introduction of antiretroviral therapy (art) in sub - saharan africa . However, the introduction of art has led to new immune - mediated complications from dysfunction of the recovering immune system, termed immune reconstitution inflammatory syndrome (iris). In patients with cryptococcal meningitis (cm), a very common opportunistic infection in sub - saharan africa, iris is a frequent complication that is most often associated with exaggerated inflammatory responses in the central nervous system . Although cm remains the most common cause of adult meningitis in the overall population in sub - saharan africa, there are only a few recognized, reported cases of gastrointestinal (gi) involvement with cryptococcus in the literature . An hiv - infected patient on art with a history of recent cm presented with chronic abdominal pain, thickened ileum, and abdominal lymphadenopathy . He was initially treated for abdominal tuberculosis (tb) but later, he was shown to have a histologically confirmed cryptococcoma in the ileum . The major objective of this case report is to highlight the challenges in diagnosis and management of intra - abdominal cryptococcosis, especially in the setting of recent initiation of art . A 37 year old hiv - positive male was initially diagnosed and treated for cm in may of 2009 with amphotericin induction therapy for 2 weeks followed by fluconazole 400 mg / day . He had a protracted hospital course lasting 4 weeks because of persistently high intracranial hypertension despite sterilization of his cerebrospinal fluid, and he, required repeated therapeutic lumber punctures . He started art (zidovudine, lamivudine, and efavirenz) on the 11th june 2009 with a baseline cd4 count of 5 cells/l . At day + 21 of art, he reported abdominal pain with hypogastric tenderness that was empirically treated as urinary tract infection with a 5 day course of ciprofloxacin, and he noted some improvement . His cd4 count at the time had risen to 29 cells/l . At day + 35 of art, his general exam was unremarkable, except for a tachypnea of 28 breaths per minute . The patient was managed as a possible atypical pneumonia with doxycycline, and his respiratory symptoms improved . However, the abdominal pain persisted intermittently with occasional vomiting . At day + 84 of art and in view of the persistent abdominal pain and an occasional dry cough, another chest radiograph was performed to exclude tb, which was also unremarkable . At this time, his cd4 was only 14 cells/l, and the hiv-1 viral load was 22,000 copies / ml . He reported 100% adherence to his art, and pill counts verified his adherence . At day + 112 of art, the patient still had similar complaints of abdominal pain and occasional vomiting . Repeat cd4 was 8 cells/l, and the viral load was minimally decreased at 15,475 copies / ml . The patient initially declined an ultrasound - guided biopsy but consented to the procedure at day + 140 of art . This second ultrasound revealed a thickened ileum up to 6 mm, with adjacent 1 cm lymph nodes . Two biopsy specimens from the lymph nodes demonstrated no abnormality at histology . At day + 168, the patient still had the same complaints with almost unchanged cd4 of 24 cells/l and viral load of 23,755 copies / ml . He was presumed to be failing art, possibly due to poor absorptive surface because of the thickened gut wall . A decision was made to initiate empiric anti - tb treatment for possible gastrointestinal tb . After one week of tb empiric therapy, the patient presented with an acute abdomen, having signs of focal peritonitis in the right iliac fossa . An upright abdominal radiograph demonstrated evidence of perforation with free air visible under the right hemidiaphram . An emergency laparotomy was performed, revealing fecal matter with purulent fluid, adhesions, pneumoperitonium, and intestinal perforation at 10 cm proximal to the ileocecal junction . The confirmatory histopathology report received 2 weeks later revealed a cryptococcoma in the ileal wall as the cause of the perforation with exuberant inflammation demonstrated by the multinucleated giant cell (figs . 2 and 3 on hematoxylin and eosin stain and figs . 4 and 5 on periodic acid - schiff stain). The patient's marked clinical improvement after surgery, the lack of any evidence of cryptococcal infection elsewhere in the body especially in the central nervous system and a well formed granuloma formed the basis for the patient's continuation with maintenance dose of fluconazole 200 mg / day under observation . At this point, his tb medications were stopped and he was switched to second line art with subsequent viral suppression . Through december 2014, he continues to remain in care on second line art without any complaints . We have presented a 37 year old hiv positive male, with a history of recent cm who subsequently developed chronic abdominal pain, eventually manifesting as a cryptococcoma of the ileum . After treatment for cm and initiating art, he had presented with chronic abdominal pain and low grade fever without diarrhea . He subsequently developed an intestinal perforation and presented with an acute surgical abdomen requiring bowel resection . We suspected an iris phenomena, in accordance with the patient presentation shortly after initiation of art, recent history of cm, and exuberant inflammation in the granuloma on histology . Although, the initial immune recovery coupled with falling hiv-1 viral loads is consistent with iris, the subsequent virological failure makes the diagnosis of paradoxical iris less clear . In cryptococcosis, ideally, intra - operative cultures would have been performed which could have helped distinguish iris from cryptococcal relapse, based on culture sterility vs. growth, respectively . Cryptococcus organisms can be acquired in the gut primarily through hematogenous dissemination or less commonly through direct inoculation during paracentesis or via a neurosurgical shunt . The presentation in these gi cases of cryptococcal infection is usually vague, as seen in our patient, with subacute fevers, constitutional symptoms, asthenia, and anorexia . Virtually every intra - abdominal organ has been reported to be affected by cryptococcal infection . The diagnosis of gi cryptococcosis requires a high index of suspicion, yet as in this case, clinicians may often initially focus on other common etiologies in immunocompromised persons, such as tb . Although abdominal tb was found to be the most common diagnosis in patients with hiv / aids presenting with chronic abdominal pain and abdominal lymphadenopathy, these studies were conducted predominantly in persons without cryptococcosis . Among persons with a known pre - existing opportunistic infection, such as cm, the pre - test probability changes as paradoxical iris enters into the differential diagnosis . In our case, the characteristics of granulomas found in hiv - infected persons varies depending on whether or not they are receiving art . In pulmonary cryptococcomas, persons not receiving art demonstrate yeast proliferation with a histiocytic response but only minor lymphocytic and neutrophilic components . Conversely, cryptococcal granulomas in persons on art are characterized by the presence of cd4 t cells, greater response of histiocytes, and multinucleated giant - cell formation, as demonstrated in our patient . There is a paucity of evidenced - based data for the management of cryptococcomas . In our case, the initial abdominal lymph node biopsy (5 weeks prior to the perforation) did not reveal a diagnosis . The question raised is, if we had confirmed the diagnosis of gi cryptococcoma before the perforation, would we have been able to effectively intervene . To answer this question, it might be important to know if the cryptococcoma were due to iris or cryptococcal relapse . Could the patient have benefited from immunosuppressive therapy to treat iris and perhaps, avoid the perforation, or would more enhanced fungal therapy be needed to eradicate the cryptococcus? Two case reports have described cryptococcomas due to paradoxical iris; one in the brain and the other in the retroperitoneal abdomen . In both cases, they simply observed the patients but also emphasized the importance of confirming sterility of contents in the cryptococcoma by culture . In a case report by katchanov et al ., a similar presentation of a central nervous system cryptococcoma was initially treated with antifungals exclusively with radiological worsening until steroids were added to direct therapy at paradoxical iris . We have previously reported the challenges and dangers of using corticosteroids for cm because they may be contraindicated in cases of fluconazole - resistant cryptococcal relapse . Surgery, corticosteroids, and interferon - gamma have been tried in iris - like cryptococcomas due cryptococcus gattii . Empiric tb therapy, including rifampin, could have induced the metabolism of fluconazole, possibly lowering plasma levels by ~50% . These lower levels may have removed the fungistatic control of the cryptococcus, precipitating the perforation . However, after the surgery, the patient was observed on secondary prophylaxis doses of fluconazole, and he did well . To treat a cryptococcoma in the setting of recent initiation of art, where iris versus relapse cannot be determined due to the absence of culture results, treatment with a combination of enhanced antifungal therapy and anti - inflammatory therapy gi cryptococcosis has been described as a rare occurrence, with only a few published case reports . We have discussed an hiv - infected patient with profound immunosuppression and recent cm who developed a gi cryptococcoma during initial immune recovery followed by virological failure after initiation of art . The cryptococcoma was not identified and he developed perforation of the ileum, requiring surgery . We anticipate that with the roll out of art in sub - sahara africa, we are bound to see rare presentations of some of common conditions such as cm . We recommend that health workers have a high index of suspicion for unusual complications of opportunistic infections in the setting of art - associated iris . Often treatment of iris requires only observation or anti - inflammatory drugs, but the presence of active infection needs to be excluded . The authors declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.
|
Dermatophytosis is a common clinical entity characterized by the infection of keratinized tissues such as skin, hair, and nails . These dermatophytes are closely related filamentous fungi and cause the disease by virtue of their unique ability to degrade keratin and invade the skin and its appendages . Dermatophytic infections are of major importance, as they are widespread and cause discomfort . Reactions to dermatophyte infection may range from mild to severe . The mildness and severity depend on a variety of factors such as the host reactions to the metabolic products of the fungus, the virulence of infecting species or particular strain, anatomical location of the infection and local environmental factors . Dermatophytic infections are a common clinical problem encountered in more than 50% of patients attending the dermatology outpatient departments . Overcrowding, poor hygiene, low standards of living along with high humidity environments are contributing to the increased prevalence of these fungal infections . The present study was conducted to know the prevalence, etiology and common clinical presentations of dermatophytosis involving skin and hair . A total of 110 samples which included 101 skin samples and 9 hair samples, from clinically suspected to have dermatophytosis were collected . A detailed history regarding age, sex, occupation, social status, duration of complaint and others were taken . Samples were collected after cleaning the affected surface with 70% alcohol . From skin lesions, scales were collected from erythematous growing margins of the lesion with a sterile blunt scalpel, and in case of tinea capitis, hairs were plucked with sterile surgical forceps . Samples were collected in sterilized whatman filter paper envelope and transported to the microbiological laboratory . Direct examination of fungal elements from skin scales and hair samples was done by using 10% and 20% koh mounts respectively . All the samples were cultured on sabouraud's dextrose agar (sda) with gentamicin and cycloheximide (sda with actidione) and dermatophyte test medium (dtm) (hi - media). Fungal growth was identified by colony morphology; pigment production and microscopic examination by tease mount technique in lactophenol cotton blue . Urease test and in - vitro hair perforation tests were also performed to differentiate trichophyton rubrum and trichophyton mentagrophytes when there was difficulty in identification by microscopic and macroscopic examination . Samples were collected after cleaning the affected surface with 70% alcohol . From skin lesions, scales were collected from erythematous growing margins of the lesion with a sterile blunt scalpel, and in case of tinea capitis, hairs were plucked with sterile surgical forceps . Samples were collected in sterilized whatman filter paper envelope and transported to the microbiological laboratory . Direct examination of fungal elements from skin scales and hair samples was done by using 10% and 20% koh mounts respectively . All the samples were cultured on sabouraud's dextrose agar (sda) with gentamicin and cycloheximide (sda with actidione) and dermatophyte test medium (dtm) (hi - media). Fungal growth was identified by colony morphology; pigment production and microscopic examination by tease mount technique in lactophenol cotton blue . Urease test and in - vitro hair perforation tests were also performed to differentiate trichophyton rubrum and trichophyton mentagrophytes when there was difficulty in identification by microscopic and macroscopic examination . All the samples were cultured on sabouraud's dextrose agar (sda) with gentamicin and cycloheximide (sda with actidione) and dermatophyte test medium (dtm) (hi - media). Fungal growth was identified by colony morphology; pigment production and microscopic examination by tease mount technique in lactophenol cotton blue . Urease test and in - vitro hair perforation tests were also performed to differentiate trichophyton rubrum and trichophyton mentagrophytes when there was difficulty in identification by microscopic and macroscopic examination . Males were more predominant 74 (67.27%) compared to females 36 (32.73%). More number of cases were observed between age groups of 2140 years 71 (64.54%) [table 1]. Clinical presentations of dermatophytosis observed were tinea corporis 44 (40%), followed by t. corporis with cruris 28 (25.45%), tinea cruris 10 (9.09%), tinea capitis 9 (8.19%), tinea faciei 7 (6.36%), tinea manuum 6 (5.45%), tinea pedis 5 (4.55%) and tinea barbae 1 (0.91%). T. corporis and t. corporis with cruris were more common in the age groups of 2140 years . Age- and sex - wise distribution of cases fungal elements by koh mount were observed in 64 (58.18%) and culture was positive in 62 (56.36%). Of 64 (58.18%) koh positive cases 55 (85.9%) yielded growth in culture . Among koh negative 46 (41.82%) cases, 7 (15.2%) were culture positive . Culture positivity was highest in t. corporis (38.71%) and no culture positivity was noted in tinea barbae and tinea pedis . Dermatophytic species isolated were t. rubrum 58.06% [figure 1], t. mentagrophytes 22.58% [figure 2], epidermophyton floccosum 6.45% [figure 3], trichophyton violaceum 6.54% [figure 4], trichophyton tonsurans 3.22% [figure 5] and trichophyton schoenleinii 3.22% [figure 6]. (c) lacto phenol cotton blue mount showing tear drop shaped microconidia (400). (d and e) lacto phenol cotton blue mount showing pencil shaped macroconidia (400) trichophyton mentagrophytes . (d) lacto phenol cotton blue mount showing nodular organ (400) epidermophyton floccosum . (c and d) lacto phenol cotton blue mount showing club shaped macroconidia (400). (e) lacto phenol cotton blue mount showing characteristic chlamydospores (400) trichophyton violaceum . (a) growth on sabouraud's dextrose agar (obverse with violet color pigmentation). (b) lacto phenol cotton blue mount showing hyphae with chains of chlamydospores (400) trichophyton tonsurans . (d) lacto phenol cotton blue mount showing match stick like microconidia (400). (e) lacto phenol cotton blue mount showing macroconidia (400) trichophyton schoenleinii . Lacto phenol cotton blue mount showing antler hyphae and chlamydospores (400) t. rubrum was predominantly recovered in each clinical presentation but t. violaceum was the most common isolate in tinea capitis, followed by t. rubrum, t. tonsurans and t. schoenleinii [table 2]. Dermatophyte species causing different clinical presentations all culture positives were grown both on sda with actidione and dtm on primary isolation . On dtm first appearance of growth was within 10 days of inoculation for most of the isolates that is, 56 (90.32%) [figure 7]. But, the appearance of growth was only after 10 days for most of the isolates when grown on sda with actidione 57 (91.94%). Species level identification on primary isolation was possible for 42 (67.74%) of culture positives when grown on sda with actidione . But, no culture positive was identified up to species level from dtm on primary isolation . (f) trichophyton violaceum among culture positive cases 19.35% were from rural area, and 80.65% were from urban area and 67.74% were from low socio - economic status, 30.65% were from middle socioeconomic status and 1.61% were from high socioeconomic status . In this study, 8.06% of patients were diabetics, 6.45% were anemic, 3.23% of patients had a history of atopy and 1.61% were hiv positive . Use of occlusive or synthetic fabric dressing regularly was there in 40.32% of patients and 32.25% of patients were in contact with soil regularly because of their occupation . All culture positives were grown both on sda with actidione and dtm on primary isolation . On dtm first appearance of growth was within 10 days of inoculation for most of the isolates that is, 56 (90.32%) [figure 7]. But, the appearance of growth was only after 10 days for most of the isolates when grown on sda with actidione 57 (91.94%). Species level identification on primary isolation was possible for 42 (67.74%) of culture positives when grown on sda with actidione . But, no culture positive was identified up to species level from dtm on primary isolation . (f) trichophyton violaceum among culture positive cases 19.35% were from rural area, and 80.65% were from urban area and 67.74% were from low socio - economic status, 30.65% were from middle socioeconomic status and 1.61% were from high socioeconomic status . In this study, 8.06% of patients were diabetics, 6.45% were anemic, 3.23% of patients had a history of atopy and 1.61% were hiv positive . Use of occlusive or synthetic fabric dressing regularly was there in 40.32% of patients and 32.25% of patients were in contact with soil regularly because of their occupation . In this study, highest incidence of dermatophytosis was observed in the age group of 2140 years and in males . This may be due to greater physical activity and increased sweating in this age group favoring the growth of dermatophytes . T. corporis, followed by t. corporis with cruris were common clinical presentations of dermatophytosis in the present study which was in correlation with other studies from india . T. capitis was more common in children below the age group of 10 years, which was also observed in some studies . T. rubrum was the most common dermatophyte to cause all clinical types of dermatophytoses followed by t. mentagrophytes . Chronic nature of infection and adaptation to human is mainly responsible for predominance of t. rubrum to cause dermatophytosis . T. violaceum was predominant species to cause tinea capitis, followed by t. rubrum, t. tonsurans and t. schoenleinii . Culture positivity was more in koh positive cases 85.9% compared to koh negative cases 15.2% . This difference is statistically significant = 55.29; p <0.001, this shows that direct microscopy by koh mount is a good screening test in the laboratory diagnosis of dermatophytosis . Efficacy of sda with actidione and dtm in isolation of dermatophytes is equal in the present study . This was in correlation with the study of singh and beena who reported that 96.55% of culture positives were grown on sda and 98.3% of culture positives were grown on dtm . But dermatophytes grow earlier on dtm compared to sda with actidione . In the present study even though all 62 culture positive samples yielded growth both on sda with actidione and dtm on primary isolation, appearance of growth was earlier on dtm that is, within 10 days (90.32%) compared to sda with actidione (8.06%). For species level identification of dermatophytes, sda with actidione is preferable compared to dtm . In the present study, species level identification was possible for 67.74% of isolates on primary isolation on sda with actidione . But species level identification was not possible with the growth on dtm on primary isolation, as conidial production was low on dtm, which is required for identification . Moreover, it was not possible to observe pigment production on dtm . For identification of growth on dtm, dermatophytic infections were more common in people living in urban areas (80.65%) compared to rural areas (19.35%). This may be because the study included patients attending the outpatient department of dermatology of tertiary care teaching hospital, where most of the people were from the urban area . High incidence of dermatophytic infections was observed in the low socioeconomic group of people (67.74%). This is because of unhygienic living conditions, overcrowding, illiteracy and poor nutrition among them . Daily wage workers (35.48%) and students (33.87%) were predominantly affected compared to others . This could be because of increased physical activity and hot environmental conditions which results in increased sweating and excessive moisture favoring the growth of dermatophytes . This is in correlation with the study of prasad et al . In the present study systemic predisposing factors like diabetes (8.06%), anemia (6.45%), atopy (3.23%), and hiv (1.61%) were observed which are in correlation with other authors . Local predisposing factors like occlusive or synthetic fabric dressing in 40.32% and contact with soil regularly because of their occupation in 32.25% were noted . Dtm is a good screening medium in laboratory diagnosis of dermatophytosis compared to sda with actidione.
|
Gemcitabine is a modified cytidine analog having two fluorine atoms at the 2-position in the deoxyribose sugar moiety (scheme 1). For nearly 20 years, it has been widely used to treat specifically pancreatic cancer . It has been proposed that gemcitabine inhibits ribonucleotide reductase (rnr) activity as well as acting as a replication stop, thereby affecting dna synthesis and elongation . The two highly electronegative f - atoms at c2 substantially increase the acidity of h3 through the inductive effect . It is well established that in the absence of oxygen, thiyl radicals are able to abstract hydrogen (h) atoms to form neutral c - centered radicals . For example, h - atom abstraction by thiyl radicals has been shown to induce isomerization of cis-2,5-dimethyltetrahydrofuran to the trans-2,5-dimethyltetrahydrofuran . On this basis, stubbe et al ., in their enzymatic and electron spin resonance (esr) studies with gemcitabine, have proposed that inhibition of the rnr activity by gemcitabine should occur via radical formation at the c3 site by direct h - atom abstraction to produce a c3 via a enzymatic thiyl radical (reaction 1). Subsequently, the c3 intermediate has been proposed to form 3-keto c2 via hf loss . This c2 is stabilized by an oxy radical resonance contribution (reaction 2). C2 and its immediate precursor c3 (reactions 1 and 2) play a key role in the rnr inactivation.12 the h - atom abstraction reaction (reaction 1) is not only important in rnr activation but also plays a very key role toward stable product formation in other biologically damage processes in dna, such as oxidative intrastrand cross - link formation and in the formation of sugar radicals that are strand break precursors . It is noteworthy that pulse radiolysis experiments with a 1,4-anhydro-5-deoxy-6-thio - d - ribo - hexofuranitol detected the formation of ribosyl - based carbon - centered radical(s) after h - atom abstraction by thiyl radicals . These studies are supportive of reactions 1 and 2 but unequivocal, and direct detection of c3 and c2 employing esr or pulse radiolysis during rnr - catalyzed deoxygenation of the natural substrates or during inactivation by gemcitabine still remains elusive . In this work, we report the formation of c2 from a likely c3 in a gemcitabine analog which mimics the mechanism proposed above . From the structural formula of gemcitabine (scheme 1), it is expected that the negative inductive effect (i) of two highly electronegative f - atoms at c2 should increase the acidity of h3. From our previous work on nucleoside cation radicals, the gemcitabine cation radical formed upon one - electron oxidation is expected to produce c3 after deprotonation of the acidic proton h3. In this work, esr spectroscopy has been employed to investigate one - electron oxidation of gemcitabine and other 2-modified derivatives, for example, 2-deoxy-2-fluoro-2-c - methylcytidine (mefdc (psi-6130); scheme 2) and 2-fluoro-2-deoxycytidine (2-fdc, scheme 2), in order to test the influence of 2- substituent on radical site formation . It is noteworthy that mefdc is a well - known clinically efficacious inhibitor of hepatitis c virus . The esr results clearly identify the c3 formation in one - electron oxidized gemcitabine and the production of c2 in one - electron oxidized mefdc . These calculations show that in the case of one - electron oxidized mefdc, the lowest energy path is the rapid formation of c2 from c3 via f loss . This f loss is a barrierless reaction between the 2-f - atom and the proximate h3o which was formed via deprotonation of h3 in the cation radical . Gemcitabine (scheme 1) and 2-fdc (scheme 2) were obtained from carbosynth ltd . Mefdc (scheme 2) was prepared as described or purchased from adooq bioscience (irvine, ca). Lithium chloride (licl) (ultra dry, 99.995% (metals basis)) was obtained from alfa aesar (ward hill, ma, usa). 2-deoxycytidine (2-dc) was obtained from sigma chemical company (st louis, mo, usa). Deuterium oxide (d2o) (99.9 atom% d) was purchased from aldrich chemical co. inc . (paris, ky, usa). Cytidine-5,6-d2 ([5,6-d, d]-cyd, 99 atom% d) was purchased from cdn isotopes (quebec, canada). Homogeneous solutions of gemcitabine were prepared by dissolving 210 mg / ml either in 7.5 m licl in d2o or in h2o . Solutions of other compounds (2-dc, 2-f - dc, mefdc, and [5,6-d, d]-cyd) were prepared by dissolving ca . K2s2o8 (616 mg / ml) was added as an electron scavenger so that only the formation of the one - electron oxidized species and its subsequent reactions can be followed by employing esr spectroscopy . The above - mentioned procedure for preparation of solutions is according to our ongoing studies on various model systems of dna and rna . The ph of gemcitabine in 7.5 m licl / d2o was adjusted to the range of ca . The ph of gemcitabine in 7.5 m licl / h2o and the ph of other compounds (2-dc, 2-f - dc, mefdc, and [5,6-d, d]-cyd) in 7.5 m licl / d2o was adjusted at ph ca . 10 . These ph adjustments were performed by adding l amounts 1 m naoh as per our previous efforts . These solutions have high ionic strength (7.5 m licl); therefore, the ph meters would not provide accurate ph measurements of these solutions . Instead, as per our previous works, ph values reported in this work were obtained using ph papers and are approximate measurements . As per our previous works, these ph - adjusted homogeneous solutions were thoroughly bubbled with nitrogen to remove the dissolved oxygen . Immediately, these solutions were drawn into 4 mm suprasil quartz tubes (catalog no . Buena, nj, usa) and were rapidly cooled in liquid nitrogen (77 k). The rapid cooling of these homogeneous liquid solutions at 77 k leads to the formation of transparent homogeneous glassy solutions . These glassy solutions were later used for the irradiation and subsequent progressive annealing experiments . All glassy samples were stored at 77 k in teflon containers in the dark . All samples were (co)-irradiated (absorbed dose = 1.4 kgy) at 77 k and stored at 77 k in teflon containers in dark following our previous efforts . A variable - temperature assembly was employed which passed liquid nitrogen cooled nitrogen gas past a thermister and over the sample as described in our earlier studies . The glassy samples have been annealed anywhere from (140170) k for 15 min . Annealing leads to one - electron oxidation of the solute by the matrix radical cl2 thus, forming only the cation radical of the solute, e.g., gemcitabine . Following our earlier studies, immediately after -irradiation of the glassy sample at 77 k, the esr spectrum was recorded at 77 k. also, immediately after each annealing step, the sample was cooled to 77 k by immersing in liquid nitrogen (77 k), and the esr spectrum was recorded at 77 k which maximizes signal height and allows for comparison of signal intensities . A varian century series x - band (9.3 ghz) esr spectrometer with an e-4531 dual cavity, 9 in . Magnet, and a 200 mw klystron was used, and fremy s salt (gcenter = 2.0056, a(n) = 13.09 g) was employed for the field calibration . All esr spectra have been recorded at 77 k and at 40 db (20 w). Anisotropic simulations of esr spectra have been performed using the win - epr and simfonia programs of bruker as per our previous works . The simulated spectra thus obtained were compared to experimental spectra, and esr parameters were adjusted for the best fit (also supporting information figure s3). Gaussview and jmol programs were used to plot the spin densities and molecular structures . The geometries of all the radicals considered in the present study were fully optimized using the b97x functional and 6 - 31g(d) basis set . We note here that b97x functional was developed by the group of head gordon and found to be very successful for the calculations of various properties of molecules in their different spin states . The hyperfine coupling constants (hfccs) of the radicals were calculated using the same method and basis set, i.e., b97x/6 - 31g(d) in the gas phase . In order to treat the effect of solvent on hf loss from the c3 in gemcitabine and in mefdc, we employ the integral equation formalism polarized continuum model (ief - pcm) as implemented in gaussian 09 . In addition to pcm, for c3 in both systems a h3o is placed in the vicinity of the c3-oh bond for c3 in gemcitabine and for c3 in mefdc and have optimized the structures . The electronic energy profile of f dissociation from c2 site of c3 in mefdc as well as the electronic energy profile of f dissociation for each of the two f - atoms from c2 site of c3 in gemcitabine were obtained in the presence of a single water molecule at the same level of theory (supporting information figure s4c, d). Furthermore, employing the wb97x/6 - 31++g(d, p) method along with the ief - pcm model for the solvent effect, the pka of the c3-oh group for the c3 of gemcitabine and also of the c3-oh group for the c3 of 2-dc was calculated . In figure 1a, we show the experimentally recorded (77 k) esr spectrum (green) of one - electron oxidized gemcitabine at ph (pd) ca . 7 in a homogeneous glassy 7.5 m licl / d2o solution . The one - electron oxidation of gemcitabine was induced by cl2 attack after annealing at 155 k in the dark . 912 showed identical spectra after one - electron oxidation of gemcitabine by cl2 on annealing at 150155 k. thus, only the spectrum obtained from the gemcitabine sample at pd ca . 10 is presented in figure 1b along with the simulated spectrum in blue . It is evident from figure 1a, b, the line shape, total hyperfine splitting, and the center of the simulated spectra match with those of the experimentally recorded spectra quite well . Each of the spectra in figure 1a, b show two anisotropic -f - atom hyperfine couplings and a -h - atom hyperfine coupling . The -h - atom hyperfine coupling creates the doublet splitting in the line components in figure 1a, b . Figure 1a is best matched with a simulation employing the two different anisotropic -f - atom (nuclear spin = 1/2) hfcc values of (15.0, 15.0, 105) g and (15.0, 15.0, 69.0) g, one -h hfcc as (15.0, 15.0, 24.0) g, gxx, gyy, gzz (2.0080, 2.0050, 2.0020) along with a mixed (lorentzian / gaussian (1:1)) line - width of 14 g. the simulated spectrum in blue is superimposed on the experimentally recorded spectrum in figure 1a . On the other hand, the best fit for figure 1b is obtained employing the two identical anisotropic -f - atom (nuclear spin = 1/2) hfcc as (17.0, 17.0, 86.0) g, one -h hfcc as (15.0, 15.0, 24.0) g, gxx, gyy, gzz (2.0060, 2.0050, 2.0020) along with a mixed (lorentzian / gaussian (1:1)) line - width of 10 g. following our work on the radicals produced in monomers of dna and rna, the a (i.e., the azz) component of each of the two anisotropic -f - atoms (see table 1) as well as the a of the -h are directly measured from the width of the experimentally recorded spectra with an uncertainty of 2 g (see supporting information figure s3). On the other hand, the theoretically obtained values of axx and ayy components of each of the two anisotropic -f - atoms and of the -h - atom in table 1 were adjusted to fit the experimentally recorded spectra with estimated uncertainty of 4 g (see supporting information figure s3). 7 show two nonequivalent anisotropic -f - atom hfccs, whereas, the one - electron oxidized gemcitabine spectrum at ph ca . The -h - atom hfcc does not show any observable change in the one - electron oxidized gemcitabine spectrum throughout the ph range ca . The coupling to two -f - atoms (c2) and one -h - atom (c4) is clear evidence for the generation of c3 after one electron oxidation of gemcitabine at 150155 k. the electron - withdrawing effect of the two electronegative f - atoms at c2 increases the acidity of h3, which leads to deprotonation (see supporting information table t2) and prevents observation of the initially formed cytosine base -cation radical (c) in gemcitabine as indicated in reaction 3 . Therefore, the mechanism of c3 formation due to one - electron oxidation of gemcitabine is proposed as follows: one - electron oxidation of gemcitabine results in the formation of metastable c, which is unstable even at ca . 155 k. the metastable c quickly deprotonates at c3 in the sugar moiety producing c3 (reaction 3) via a proton - coupled electron - transfer (pcet) mechanism.3 esr spectra obtained from matched gemcitabine samples [concentration of gemcitabine in each sample = 2 mg / ml in 7.5 m licl / d2o] in the presence of the electron scavenger k2s2o8 (8 mg / ml in each sample). Each sample has been -irradiated (absorbed dose = 1.4 kgy at 77 k), subsequently annealed to 155 k for 15 min in the dark at various phs (a) ph ca . 7 (green) and (b) ph ranging ca . 912 (pink). Here the blue spectra that are superimposed on the experimentally recorded spectra are the simulated spectra of c3. See text for the details of simulation . All esr spectra are recorded at 77 k. the three reference markers (open triangles) in this figure and in the subsequent figures show the position of fremy s salt resonance with the central marker at g = 2.0056 . The spacing separating the markers is 13.09 g. as is evident from the hfcc values of the spectra shown in figure 1 and also in table 1, the ph of the solution clearly affects the individual -f - atom anisotropic hfcc but not the sum of the two -f - atom anisotropic hfcc along with the c4 -proton hfcc (see section above). At ph ca . 912, the two -f - atom anisotropic hfccs are equivalent; whereas, at ph ca . 7, the sum of the two -f - atom anisotropic hfccs remain the same, but they individually differ . The presence of two 2-f - atoms in gemcitabine will lower the pka value of both h3 and c3-oh hydrogens . For example, the oh in 2,2-difluoroethanol has its pka lowered by 3.5 units in comparison with ethanol . Further, radical formation has also been shown to lower the pka of the alcoholic oh group (e.g., pka (ch3)2choh = 17.1, pka (ch3)2coh = 12.03). Based on these factors, the pka value of the c3-oh group for c3 in gemcitabine is estimated to be in the range of 79 . Employing dft/b97x/6 - 31++g(d, p) method along with the ief - pcm model for the solvent effect, the pka value of the c3-oh group for c3 in 2-dc has been calculated as 14.2 . The same level of calculation for the c3-oh group of c3 in gemcitabine which replaces each of the two hydrogens at c2 with fluorine predicts a pka of 6.8 (see supporting information pages s8, s9). Therefore, the two 2-f - atoms are predicted to lower the pka of the c3-oh group in c3 by 7 full units . Considering the sensitivity of the calculations for predicting pka to the small changes in free energy, these results are very reasonable . Furthermore, the theoretically calculated pka value 6.8 of the c3-oh group for c3 in gemcitabine is in good agreement with its experimentally estimated value (79). The spectrum in figure 1a (ph ca . 7) should therefore be for c3 in gemcitabine with a c3-oh group and the spectrum in figure 1b (ph ca . 912) should be for c3 with the deprotonated group, i.e., c3-o (reaction 4). Thus, we attribute the variation of the two -f - atom anisotropic hfcc to the deprotonation of the c3-oh group at higher phs.4 esr spectral studies of one - electron oxidation of gemcitabine in h2o glasses (7.5 m licl / h2o) were performed and compared with the results found in d2o glasses (7.5 m licl / d2o). No observable difference in spectra other than a small line broadening was observed on formation of c3 in h2o glasses versus in d2o glasses . Since c3 only has the c3-oh as an exchangeable proton at ph 7 and this does not contribute to a significant hyperfine coupling, the esr spectrum found on formation of c3 is not altered by a change of the solvent from d2o to h2o . Similar experiments to those performed for gemcitabine were carried out for the methyl / fluoro analog mefdc (scheme 2). Using mefdc, we investigated whether the formation of c3 observed in gemcitabine bearing geminal difluoro unit at c2 (figure 1) is affected by the substitution of one of the f - atoms (i) with a methyl (me) group (+ i). (a) esr spectrum (black) obtained from mefdc [concentration = 2 mg / ml in 7.5 m licl / d2o] in the presence of the electron scavenger k2s2o8 (8 mg / ml), ph ca . 10, -irradiated to a dose of 1.4 kgy at 77 k and subsequently annealed to 155 k for 15 min . (c) spectrum (black) obtained after subtraction of 60% of spectrum (b) from spectrum (a). For comparison, the c spectrum (blue) in 2-dc (supporting information figure s2 and pp s3s5) is superimposed . (d) spectrum (black) assigned to c2 is obtained after subtraction of 50% of spectrum (c) from spectrum (a). The simulated c2 spectrum (for simulation parameters see figure 2 and text) is superimposed on the experimentally isolated spectrum for comparison . All the spectra are recorded at 77 k. shown in figure 2a is the esr spectrum (black) of a matched sample of mefdc that has been -irradiated (absorbed dose = 1.4 kgy), subsequently annealed to 155 k for 15 min in the dark, and recorded at 77 k. figure 2b was obtained by annealing this sample for 15 min to 170 k. comparison of spectrum 2a with spectrum 2b shows clearly that a central doublet decreases along with an increase of the other line components upon annealing . Therefore, the central doublet (black) shown in figure 2c is isolated by subtraction of 60% of the spectrum 2b from spectrum 2a . The doublet due to c spectrum (blue) in 2-dc (see supporting information figure s2 and its discussion (pp s3s5)) is superimposed on it for comparison . From the spectral similarities of both doublets, the doublet in black shown in figure 2c subtraction of 50% c spectrum 2c (black) from spectrum 2a results in the black spectrum shown in figure 2d . This overall quintet spectrum arises from 4 isotropic -proton couplings: three methyl -protons (ca . 25.5 g due to a -proton assigned to the c1-h (vide infra). The experimental (black) spectrum is simulated using the above - mentioned hfcc values along with a 10 g line - width and g - value = 2.0033 (this g - value is typical for c - centered sugar radicals). The simulated spectrum (red) in figure 2d matches the overall line components of the experimental spectrum well . Since the c2 (reaction 5) is the only likely radical structure that would explain the large hyperfine coupling to a methyl group and the additional -proton hyperfine coupling (assigned to c1), the experimental spectrum in figure 2d has been assigned to c2 (reaction 5). The spectra 2a and 2b are a composite of c (black, figure 2c) and c2 (black, figure 2d) in different amounts . Under the same constant gain and constant microwave power and upon gradual and stepwise annealing of the sample from 155 k (spectrum 2a) to 170 k (spectrum 2b), no loss of spectral intensity was observed, and our analyses show an additional (ca . 20%) conversion of the c to c2. Consideration of the results presented in figures 1 and 2 suggest that for mefdc, c is produced first and on annealing converts to a transient c3, which is not observed . In contrast, the line shape, line width, and the overall hyperfine splitting of the c3 spectrum in gemcitabine do not change upon annealing to ca . Thus, unlike the rapid conversion of c3 to c2 found in one - electron oxidized mefdc, a similar conversion of c3 to c2 is not observed for one - electron oxidized gemcitabine at these low temperatures . The lack of observation of the transient c3 in one - electron oxidized mefdc and the low temperatures employed in these experiments implies a very low activation barrier for the conversion of c3 to c2; whereas, the activation barrier for the conversion of c3 to c2 for one - electron oxidized gemcitabine should be 4 kcal / mol . Calculations suggest that the proximity of the lost h3 proton as h3o to the 2-f - atom quite likely provides the driving force for this rapid unimolecular reaction (see figure 3). Therefore, we propose that c3 in one - electron oxidized mefdc readily converts to c2 via a barrierless f loss (see reaction 5, figure 3, and supporting information s5). The b97x/6 - 31g(d) calculated hfccs of c3 and c2 found in gemcitabine and in mefdc along with experimental hfccs (in gauss) are presented in table 1 . It is evident from table 1 that experimental and theoretically calculated hfccs are in reasonably good agreement . Estimated errors are of 2 g for azz and 4 g for axx and also for ayy . Calculated in the presence of one water molecule only isotropic hfcc values have been considered . To explore the reaction mechanism of c2 formation from c3 in one - electron oxidized mefdc and gemcitabine, using the dft b97x/6 - 31g(d) method, we considered three possible reaction paths: (i) hf loss due to deprotonation of 3-hydroxyl group, (ii) hf loss due to fluorine dissociation, and additionally, (iii) hf loss in the presence of a hydronium ion (h3o). The electronic energy profile of hf loss from c3 in mefdc and also from c3 in gemcitabine in the presence of a water molecule is shown in figure s4 in the supporting information . From supporting information figure s4a, it is evident that for c3 of mefdc, the formation of c2 via hf loss with deprotonation of 3-oh has a significant barrier of ca . 18 kcal / mol . For c3 in gemcitabine, the hf loss associated with deprotonation of 3-hydroxyl group was calculated to be ca . We have also considered the dissociation of fluorine in c3 of mefdc and in c3 of gemcitabine and found that stretching the c2-f bond up to 1.8 needs ca . This shows that dissociation of fluorine for c3 in mefdc occurs at lower energy than dissociation of fluorine for c3 in gemcitabine (supporting information figure s4). Alternatively, we consider the fact that deprotonation of h3 will form h3o initially in close proximity of the c2-c3 bond which may then induce hf loss (reaction 5). Employing the b97x/6 - 31g(d) method and considering the full solvent effect through the polarized continuum model (pcm), this mechanism have been modeled by placing a h3o in the vicinity of the c3-oh bond for c3 in gemcitabine and for c3 in mefdc and have optimized the structures . From our calculations, we have observed that for c3 in gemcitabine, a minimum structure exists in the electronic energy profile in which the h3o stabilizes the f-atom through forming a hydrogen bond (1.57) (see figure 3a and supporting information figure s4c). A second minimum structure was also found in the electronic energy profile in which the h3o stabilizes the f-atom through forming a hydrogen bond of identical length, 1.57 (see supporting information figure s4d). A barrier of 5 kcal / mol and the overall reaction energy of 7 to 8 kcal / mol were found for hf formation in both cases (see figure 3a and supporting information figures s4c, d). However, for c3 in mefdc, the h3o reacts with the 2-f - atom without a barrier and forms hf and c2 (see figure 3b). The bond distances of c3-o3 and o3-h bonds for c3 in gemcitabine are calculated as 1.34 (primarily c o single bond character) and 0.97, respectively . The values of the corresponding bond distances of c3-o3 and o3-h bonds for c3 in mefdc are obtained as 1.28 (mainly double bond character and 1.0 respectively). Thus, these calculations show that the hf loss from c3 in gemcitabine has a ca . 5 kcal / mol barrier (supporting information figure s4c, d) while for c3 in mefdc, the loss of hf is barrierless, and the c2 production is exothermic in nature as shown in figure 3 . These findings support our experimental observations that in mefdc, c3 is too unstable to be observed, and only c2 is found . In contrast, in gemcitabine only c3 formation is observed without any conversion to c2 in the same temperature range . Pcm-b97x/6 - 31g(d) calculated structures of c3 in (a) gemcitabine and in (b) mefdc . As indicated in (a) the c3 in gemcitabine involves a barrier of 5 kcal / mol (detailed electronic energy profiles are provided in supporting information figure s4c, d) to hf loss in the presence of h3o . In (b), the c3 in mefdc is unstable in the presence of h3o and reacts without a barrier to form c2 via hf loss . The animations (movies) of the optimization steps for reaction involving h3o for c3 in both gemcitabine (a) and mefdc (b) are provided in the supporting information (s5). Our work has the following two salient findings: (i) one electron oxidation leads to cytosine base -cation radical (c) in 2-dc and 2-f - dc but to c3 in gemcitabine . As expected from the one - electron redox potentials of the bases and the backbone, one - electron oxidation of 2-dc and 2-f - dc leads to c formation as evidenced by the ca . 16 g doublet that is characteristic of c. however, gemcitabine (scheme 1) leads to the formation of c3 on one - electron oxidation . The two highly electronegative f - atoms at 2-position, through their negative inductive effect, lead to a substantial increase in the acidity of h3. Therefore, c in gemcitabine is highly unstable toward the loss of h3 as deprotonation at 150155 k. this is evidenced by the free energy changes of the cation radical for the loss of h3 as deprotonation to the surrounding solvent (see supporting information table t2); this deprotonation shifts the unpaired spin from the cytosine base of metastable c in gemcitabine to sugar at c3 via a pcet process . (ii) c2 formation does not occur in gemcitabine but does in its analog mefdc . It has been proposed in the literature that in gemcitabine both c3 and c2 (reactions 1 and 2) play an important role in the rnr inactivation . Conversion of c3 to c2 takes place via an irreversible f loss from c2 during rnr inactivation by gemcitabine . However, experimental and theoretical results shown in this work have clearly demonstrated that in our system (supercooled homogeneous glassy solutions), c3 in gemcitabine does not convert to c2 on annealing up to 170 k owing to theoretically predicted barrier of greater than 5 kcal / mol . Theoretically, dft calculations support the mechanism involving a h3o induced barrierless conversion of c3 to c2 in one - electron oxidized mefdc . Experimentally, c2 is observed in one - electron oxidized mefdc upon annealing to ca . 160170 k. thus, our study in one - electron oxidized mefdc provides the first evidence of formation of c2 (via the unstable intermediate c3 (reaction 5)) in a nonenzymatic system even at low temperature.5
|
It has a significant impact on the patient s quality of life (1). Post - prostatectomy urinary incontinence (ppi) is a potential complication of prostate surgery and although it is more frequently seen after radical prostatectomy it can also occur after endoscopic or open surgery for benign prostate hyperplasia (bph) (2). Initial management is usually conservative and includes the use of diapers or pads, penile clamps, or various collecting systems (such as a condom catheter). Mild degrees of ppi in the early postoperative period may be improved by pelvic muscle exercises, physiotherapy, and pharmacotherapy (3). However, for most patients who have moderate to severe ppi, conservative methods are not sufficient to return to their normal lives . The present study reports our intermediate experience in men who underwent implantation of adjustable perineal male sling using a tissue expander for ppi . This prospective study was approved by the local ethics committee and a comprehensive informed consent was obtained from all the patients before the surgery . Between september 2007 and may 2013, a total of 21 men with ppi underwent implantation of adjustable perineal male sling using a tissue expander . The underlying etiologies of ppi in patients were: radical prostatectomy for prostate cancer in 13 patients (open radical retropubic prostatectomy=12, transperitoneal laparoscopic radical prostatectomy=1), open prostatectomy in 5 patients and transurethral prostate resection for bph in 3 patients . Patient evaluation consisted of medical history, physical examination, blood and urine laboratory tests . All the patients underwent a standard urodynamic study including both cystometry and pressure - flow study to evaluate bladder storage and voiding capabilities, and to exclude overactive bladder . Also, an urethrocystoscopy was conducted in all the patients to exclude urethral stricture and/or bladder neck contracture . The patients who had a history of previous surgery for ppi were not included in the study . Incontinence in the patients was defined according to the use of incontinence pads over a 24 hours period: mild (using 1 to 2 pads), moderate (3 to 5 pads) and severe (more than 5 pads) (4). The post - operative follow - up was carried out in the second week and every 6 months thereafter consisting of daily pad use, physical examination, maximum urine flow rate (qmax) and post - voiding residual urine volume (pvr) measurement . All patients received prophylactic antibiotics (3rd generation cephalosporin) before the induction of anesthesia . Under general or regional anesthesia after the insertion of a urethral catheter, a midline perineal incision of 40 to 50 mm was made . The critical point is not to remove periurethral fat tissues from urethra . Both sides of urethra a eurosilicone (laboratoires eurosilicone, france) tissue expander device was used with an adjustable male sling in our patients . The device contains a silicone balloon expander, a connecting tube and an inflation component (injection port) that allows the expander to gradually fill up to a volume of 25 ml saline solution (figure-1b). Figure 1a) both sides of urethra are dissected; b) a balloon expander; c) a balloon expander between two layers of the mesh; d) the mesh is stapled to the pubic bone using autosuture stat tacktm; e) prepared scrotal pouch for placing the inflation component . A standard polypropylene mesh of 100 x 100 mm was used as the sling material . First, the mesh was folded and a balloon expander was placed between the two layers of the modification . Secondly, the balloon was completely filled with the saline solution, and the two layers of the mesh were sutured using 2/0 polypropylene suture to create a pocket between the two layers of the mesh (figure-1c). During this procedure third, the mesh was stapled on both sides of the lower border of the pubic bone using an autosuture stat tacktm (tyco healthcare, uk) stapler (figure-1d). The original surgical method defined by inci, et al . (5) used a polypropylene mesh that was fixed on the pubic bone with non - absorbable sutures . In our case, this method was modified and staples were used to prevent the sutures and the mesh from loosening and moving . After the sling tension was properly adjusted, the sling was placed as tightly as possible in all patients since urinary leakage had been observed in our patients postoperatively . The inflation component has two sides (figure-1e). Finally, the wound was closed with careful hemostasis . After the surgery, all the patients were asked to take an oral antibiotic (2th generation cephalosporin) for 7 days . Post - operative success was assessed by the number of pads used per 24 hours as follows; zero to 1 safety pad - dry, 1 to 2 pads - mild, and 3 to 5 pads - moderate . At a minimum of 1 week after surgery, patients were questioned regarding their daily pad use . If incontinence persisted 7 to 10 days after surgery, tension over the urethra was increased by saline injection to expand the tissue expander via the injection port using an insulin needle . Injection was started with 3 cc and increased by 2 cc at each injection . In this way the patients were asked to return 2 days after each adjustment to confirm the status of continence . The mean values of the parameters were calculated using the statistical package for social sciences version 13.0 for windows (spss inc ., chicago, il, usa). The mean values of the parameters were calculated using the statistical package for social sciences version 13.0 for windows (spss inc ., chicago, il, usa). The mean age of the patients was 66.27.3 (50 - 79) years and the mean pad usage was 6.40.6 (6 - 8) per day . The mean volume of the postoperatively inflated balloon was 11.65.7 (5 - 25) ml . After the follow - up period, 16 of the 21 patients (76.2%) were dry (11 patients, 0 pads; 5 patients using safety pads), 3 patients (14%) had mild degree ppi and 2 patients (9.8%) had moderate degree ppi . In the last assessment of the patients, qmax and estimated pvr were found to be 15.64.7 (10 - 31) ml / s and 10 ml, respectively . In these two patients, the polypropylene mesh with balloon, connecting tube and inflation component were removed and they did not undergo any additional intervention . Local scrotal infection developed around the inflation component in three patients . In these patients, only the inflation component was removed, the connecting tube was clipped and the polypropylene mesh with inflated balloon was kept in place . In these patients, polypropylene mesh with inflated balloon provided suitable pressure on the urethra . In the follow - up period, they were completely dry . No complications occurred in relation to mesh erosion, voiding dysfunction, voiding difficulty or mechanical failure . Six patients reported mild perineal pain in the early postoperative period but this was resolved using non - steroidal anti - inflammatory drugs . The rising elderly population and the increasing number of surgical interventions for prostate cancer mean that the incidence of ppi will rise . Since its introduction in 1973, the artificial urinary sphincter (aus) has been considered the gold standard treatment for stress urinary incontinence after prostatectomy, offering the patient the greatest chance of a cure (6). The success rates of aus range from 59 to 90% (7 - 9). Although, aus is an effective and durable treatment, many patients are hesitant about implantation or refuse the procedure . Most patients could not manipulate the scrotal pump (10). Furthermore, aus is expensive and requires a complex surgical procedure that is associated with significant rates of complications . A recent systematic review about aus reported that infection or erosion occurred in 8.5% of cases (3.327.8%), mechanical failure in 6.2% (213.8%), and urethral atrophy in 7.9% (1.928.6%). Re - operation rate was reported to range from 14.8% to 44.8% (11). The proact (uromedica, us) system was first described in 2005 by hubner et al . (12). In theietlr study, there were 117 patients with ppi followed for a mean period of 13 months, after which 67% of the patients were found to be dry . (13) reported the results of the proact intervention in 62 men with ppi and found that 71% of the patients wore no pads or used 1 pad per day after 6 months (following the adjustment). However, in 19 men the device was removed due to infection and erosion (n=5), migration (n=1), and iatrogenic traumatism (n=2). Moreover,, the authors evaluated the results of proact in 114 men with ppi at a mean follow - up time of 58 months and reported an overall dry rate of 50% . In that study, complications included balloon leakage (11%), migration (5%) and wound erosion (4%). The authors reported that there was a total re - operation rate of 27%, and 12% of the patients underwent aus or a urethral sling procedures due to proact not being effective . The argus (promedon sa, argentina) sub - urethral sling with an adjustable system is another treatment option in men with ppi that was first described by romano et al . The authors reported a cure rate of 73% and the improvement rate was 10% in 48 men with ppi after a mean follow - up of 7.5 months . (16) reported mid - term complications after the placement of the argus sling in 29 men with ppi at a mean follow - up of 35 months . Overall, 24 patients (83%) experienced complications, consisting of acute urinary retention (35%) and removal of the sling (35%) owing to urethral erosion, infection, system dislocation, urinary retention, and persistent pain . Furthermore, 27% of the patients complained of significant perineal pain . The authors concluded that the argustm sub - urethral sling was associated with serious mechanical and infectious complications, and sparse functional results with negative impact on the patient s quality of life . A bone anchored sling (bas) compresses the bulbar urethra with a silicone - coated polypropylene mesh by attaching the sling to the inferior pubic ramus with bone screws . Following initial reports of degradation of organic materials, synthetic mesh (invance, american medical systems, us) has become the most commonly utilized material with the bas (17). (4) reported their results in 46 patients with ppi who undergo bas implantation . In their study, the total cure rate was 37% . Furthermore, 37% of the patients significantly improved, and the treatment of 26% patients failed after an average of 24 months follow - up . They concluded that the male sling procedure is an effective and safe procedure for the management of stress urinary incontinence . Guimaraes et al . (18) reported their intermediate results of up to 4 years with the invance sling . Their cure rate was 65% and the improvement rate was 23% in 54 men with ppi after a mean follow - up of 28 months . The authors claimed that the invance sling offers a good intermediate cure and improvement rates with acceptably low rate of complications in patients suffering from ppi . Another study investigated the use of the invance sling in 40 patients with ppi (19). The authors observed perineal pain in 73% of the patients, detrusor overactivity in 5% and sling infection in 15% . The traditional bas procedure does not provide for the adjustment of the tension of the sling material in the post - operative period and this can result in progressive failure over time . In a study by castle et al . Social continence was achieved in 67% 50% and 0% of mild, moderate and severe cases, respectively . Comiter (20) speculated that the surgeons left the fatty tissue over the bulbospongious intact, and additionally used a piece of porcine dermis between the urethra and the sling a combination of fat necrosis and absorption of the dermis over time likely contributes to diminution of the compression provided by the sling over the bulbar urethra . (21) reported a median time to recurrent incontinence as 3 months after bas procedure . Similarly, cespedes and jacoby reported an early failure (within 6 months) in 5% of their patients (22). In another study (23), the authors retrospectively reported objective and subjective outcomes in 40 male patients who underwent bas positioning for stress urinary incontinence due to intrinsic sphincter deficiency . Patients with stress urinary incontinence due to radical retropubic prostatectomy (n=32), robot assisted laparoscopic prostatectomy (n=3) and transurethral prostate resection (n=5) underwent the bas procedure over a 5 years period . Previous anti - incontinence procedures, radiotherapy and transurethral procedures due to urethral stricture were performed in 5, 11 and 5 patients, respectively . At a mean follow - up of 35.2 months, 22 patients (55%) were cured, the condition of 5 patients (12.5%) improved and the treatment of 13 patients (32.5%) failed . The authors concluded that bas is a simple and effective procedure that can produce immediate good results with low morbidity, especially when strictly selected patients are treated . An adjustable perineal male sling technique was used for the treatment of ppi as described previously (5). In that study an adjustable perineal male sling with a 10 ml tissue expander was implanted in 19 consecutive men with severe ppi . According to the results of that study, at a mean follow - up of 17.3 months 15 patients (78.9%) were completely dry and 2 (10.5%) improved significantly using only 1 to 2 pads per day . A total of 11 patients required volume adjustment injections . The average number of adjustments was 2 (range 1 to 3) and the average injected volume was 6.3 cc (range 5 to 10). Regarding the complications, 1 patient had a superficial wound infection, 1 patient required surgical revision due to infection and 8 patients reported mild to moderate perineal pain . The authors concluded that the short term results indicate that this minimally invasive technique seems to be safe and effective, and patient satisfaction appears to be high . The same group presented their long term results in the international continence society annual meeting 2013 . In a study by ergen and ozdemir the mean follow - up time was 52 months . The completely dry rate decreased from 78.9% to 58% in the long term period . The authors concluded that adjustable male sling using a 10 ml tissue expander is an effective method for severe ppi, in the early period, but the effectiveness gradually decreases in the long term . The review of our intermediate results at 40.1 months showed that 16 of the 21 patients (76.2%) were completely dry, 3 patients (14%) had mild incontinence and 2 patients (9.8%) had moderate incontinence . The success rate of the current study is better than that of the other studies mentioned above (5, 24). A possible explanation for our high success rate may be associated with the high capacity of the silicone balloon . In our patients, we used a larger size of silicone balloon (25 ml) than the other two studies . Additionally, we used a stapler which allows the easier attachment of the polypropylene mesh on the lower border of the pubic bone in both sides . Although previous pelvic radiotherapy history has also been claimed to be a negative predictor of success rate in ppi surgery (19, 23), 2 patients in current study whom had a previous history of pelvic radiotherapy were dry in the intermediate follow - up . A new device is a perineal sling with a tissue expander, composed of 2 silicone components, a balloon expander and an injection port, connected by a tube . In turkey, this device is relatively cheap compared with aus, proact, argustm ($500 vs. $5.000 vs. $2330 vs. $2400) and easy to implant, even in difficult cases . Although complications occurred in this study, including the removal of the device and the removal of inflation component due to local scrotal infection, our intermediate follow - up study suggests that an adjustable perineal male sling using a tissue expander appears to be an efficient and safe alternative surgical treatment option for patients suffering from ppi . The major limitations of our study were the small number of patients and the duration of the follow - up period . Additional follow - up and larger series of patients are necessary to confirm our results.
|
Fibromyalgia syndrome (fms) is a prevalent chronic pain condition among middle - aged females and is characterized by chronic widespread pain . Various comorbid symptoms of fms include fatigue, cognitive disturbances, depression, sleep impairments, and weight gain, to name but a few . It is a challenging disorder, and thus assessment and diagnosis might pose some difficulties in various health care settings . Patients may visit their general practitioners repeatedly with numerous symptoms before a diagnosis of fms is made1, 2 . Patients are encountered at not only primary but also secondary health care settings and by various subspecialities including rheumatologists, pain specialists, physiatrists, and psychologists . This has led to debate about whether fms is a clinical or epidemiological disease3 . The 1990 american college of rheumatology (acr) criteria included 2 major sections: history of widespread pain and pain in 11 of 18 tender points on digital palpation . Debates over reliability, validity, and number of tender points required to make a diagnosis were settled . Many controversies arose over tender points4, and some authors argued against tender points, claiming that they are a measure of general stress3, 5, 6 . It was then suggested that dealing with the symptoms rather than tender points would be more realistic and that use of 1990 criteria should be stopped7 . The acr 2010 criteria eliminated the controversial tender point examination and included the following headings: widespread pain index, including 19 pain locations, and symptom severity score for 3 symptoms plus the extent of 41 somatic symptoms in general . 2010 criteria further modified to the 2011 modified criteria (2011modcr) with 6 self - reported symptoms instead of 41 somatic symptoms . The most recently developed criteria are the alternative diagnostic criteria (acr 2013altcr), which include more pain locations than the 2011modcr (28 instead of 19) and 10 symptoms instead of 6 . Compared to the 2011modcr, the acr 2013altcr have comparable diagnostic sensitivity, better specificity, and a smaller number needed to diagnose8 . In addition to the search for best criteria, some other tools were developed for epidemiological studies such as the london fibromyalgia study screening questionnaire or survey criteria . However, they included only items related to pain and fatigue, neglecting other aspects of the condition9 . To address these problems, some screening procedures have been suggested; however, they have been argued against due to psychometric validation problems and sensitivity and specificity issues10 . Thus, a need for a short, easy - to - use, psychometrically validated screening tool has arisen in both clinical and research settings . The french rheumatic pain study group decided to develop a short, psychometrically sound, self - reported screening tool considering the major symptoms and aspects of fms9 . The original version of the fibromyalgia rapid screening tool (first) was demonstrated to have excellent discriminative properties, especially divergent validity in terms of psychological aspect, which is an important property for an fms screening tool9 . The spanish version of the first was also demonstrated to have acceptable internal consistency, reliability, and criterion validity10 . We aimed to study the reliability and validity of the turkish version of the first by correlating this tool with the acr 2013altcr and the hospital anxiety and depression scale (hads). Two hundred and sixty - nine patients (257 females and 12 males) with an average age (years) of 48.29 12.78 (range 2279) were included in the study . The principles of the declaration of helsinki were followed and the study protocol was approved by the uludag university ethical committee (no: fr - hyh-19). Subjects were recruited from outpatient physical medicine and rehabilitation clinics from 9 medical faculty hospitals and ministry of health research and training hospitals . A convenience sample of patients with chronic diffuse pain was included in the study . Literate patients who could read and understand turkish and who were able to complete the questionnaire were invited to participate in the study . Patients with psychiatric disorders (severe depression, schizophrenia) or systemic or neurological disorders that could adversely affect quality of life or social functioning (such as end - stage heart failure, hemiplegia, spinal cord injury, etc .) Were excluded from the study . We obtained permission from mapi research trust (contact information and permission to use: mapi research trust, lyon, france . E - mail: proinformation@mapi-trust.org-internet: www.proqolid.org .) Cross - cultural adaptation was accomplished according to the suggestions of the mapi research institute in 3 steps: forward translation, backward translation, and patient testing . The first was translated into turkish by 2 professional native turkish speakers bilingual in turkish and english . They discussed on the translated forms with the local project manager (r.c .) To resolve discrepancies and produced a pooled version, which is the first version of the translation (step 1). Then, english back - translation was done by the professional native english - speaking translator bilingual in english and turkish . He translated the first version of the questionnaire back to english without access to the original questionnaire . The local project manager compared the backward version with the original during a meeting with the backward translator and prepared the second version (step 2). The second version was tested on 5 patients, all of whom were native turkish speakers, and comprehension was determined through face - to - face interviews . After this final step, a third version of the questionnaire patients were asked to complete the questionnaire including the first, 2013altcr, and hads . They completed the first twice; the time interval for the 2 first scales was 6 hours . The first includes 6 items, and a score of 1 is given for the response of yes and 0 if the response is no for each item . The total score is calculated as the sum of scores; the cut - off value is designated as 5/69 . The examiners were physiatrists and they were blinded to the results of first and hads . We used the acr 2013altcr8, which includes the pain location inventory (pli) including 28 sites and the symptom impact questionnaire (siqr) consisting of 10 symptom items (pain; energy; stiffness; sleep; depression; memory problems; anxiety; tenderness to touch; balance problems; and sensitivity to loud noises, bright colors, odors, and cold). Pli score is between 0 and 28, and the siqr range is 0100 divided by 2 . For a patient to fulfill the acr 2013altcr criteria, the symptoms and pain locations should have been persistent for at least 3 months, pli17 and siqr21 . One for anxiety and the other for depression and is a questionnaire completed by the patient . Each item has 4 possible answers (range 03), and the maximum possible score is 21 . The validity and reliability of the turkish version of the hads was demonstrated previously11 . Concurrent validity of anxiety subscale with spielberger s trait anxiety inventory, correlation coefficient was 0.7544 and of depression subscale with beck depression inventory it was 0.7237 . Testing the reliability of had scale, cronbach alfa coefficient for anxiety subscale was 0.8525 and for depression subscale it was 0.778411 . We analyzed the data using the statistical package for the social sciences (spss) version 16 (chicago, il, usa). The reliability of the hads was tested using cronbach s alpha coefficient . For criterion validity of the first, we used the acr 2013altcr for comparison . The concordance between the acr 2013altcr and the first was evaluated using a mcnemar test . The sensitivity, specificity, and positive and negative likelihood ratios of the first were calculated according to acr 2013altcr criteria . We compared the 2 first measurements using wilcoxon signed rank test, and the 2 measurements were statistically similar (p=0.169). One hundred fifty - six (58%) patients had score of 5, which is the cut - off score for the first; 116 of these patients (74.4%) were diagnosed as having fms according to acr 2013altcr criteria . One hundred thirteen patients (42%) had first scores lower than 5, and 93 of these patients (82.3%) did not meet the 2013altcr criteria . The first was not statistically different from the acr 2013 altcr in defining patients with fms (table 1table 1.sensitivity, specificity, and positive and negative likelihood ratios of the first to discriminate patients with and without fms according to the 2013 altcrvalueconfidence intervalsensitivity83.8276.589.6specificity68.4259.876.2+lr2.652.33.0lr0.240.10.4lr: likelihood ratio). First total score was correlated with subscores of the acr 2013altcr, namely pli (r=0.619, p<0.001) and siqr scores (r=0.408, p<0.001). Similarly, the first and hads were significantly correlated (r=0.424, p<0.001) (table 2table 2.the coefficient of determinations between first total score and acr 2013 subscores (pli and siqr score) and hads scores.plisiqrhadsfirst total score0.383 * 0.166 * 0.18*pli0.196 * 0.131*siqr0.194*data expressed as squared spearman s rho correlation coefficients . First: fibromyalgia rapid screening tool; hads: hospital anxiety and depression scale; pli: pain location inventory; siqr: symptom impact questionnaire, * p<0.001 statistically significant). First: fibromyalgia rapid screening tool; hads: hospital anxiety and depression scale; pli: pain location inventory; siqr: symptom impact questionnaire, * p<0.001 statistically significant logistic regression analysis was carried out to find the confounding effect of the hads on the first to discriminate the patients with fms . The model was able to discriminate patients with fibromyalgia and without fibromyalgia (2 log likelihood=274.82; =95.29, d.f=2; p <0.001; nagelkerke r= 0.4). The first global score explained 30% of the proportion of uncertainty; each point increase in first global score meant 10 times greater odds of experiencing fms . In this study, we showed that the turkish version of the first is a reliable patient - completed instrument for identifying patients with fms . The acr 2013altcr was used for comparison, and the first was similar to the acr criteria in terms of defining patients with fms . The first demonstrated high correlation with acr 2013altcr subscores and hads scores . In our study, we examined the consistency of the first over time . We used the acr 2013altcr because these criteria were equally efficient with somewhat better specificity, and a smaller number was needed to diagnose than in the 2011modcr8 . The acr 2013altcr were also marginally more efficient in differentiating common chronic pain disorders from fms8 . Torres et al.10 used acr 1990 criteria, and perrot et al.9 stated that they diagnosed patients on the basis of acr criteria, referring to the article by wolfe et al ., who used the symptom intensity scale, which is a combination of pain counts in 19 nonarticular regions with a visual analogue scale for fatigue12 . Torres et al . Reported the sensitivity of the first as 90.5% and its specificity as 85.7% . The turkish version demonstrated similar sensitivity and specificity . In this study by torres et al . Positive likelihood ratio was calculated as 1.99 and negative likelihood ratio as 0.2 for cut - off point of 5 which is the established score for the original version of first . In our study positive and negative likelihood ratio values were 2.65 and 0.24 respectively, with fairly narrow confidence intervals . Our study group was similar to torres et al.10; the majority of the patients in the study by torres were female, as in our study group . In the original study of the first by perrot et al.9, first total score was not significantly correlated with the beck depression inventory, hads - depression, and hads - anxiety scores . In our study, we were able to demonstrate that first scores are correlated with hads scores; however, despite the correlation of first with hads scores, the first was still able to discriminate between patients with and without fms . Different from previous studies, we included patients with various chronic pain problems at a tertiary care level . Fitzcharles et al . Argued that, if patients in a study have an established diagnosis of fms, they may express symptom severity at the extreme end of the spectrum, thus increasing construct validity13 . Similar to our study, bennett et al.8 included a wide range of common pain disorders as the dominating principle of their study and claimed to simulate everyday clinical practice . Both rehabilitation specialists and physical therapists are dealing with various pain conditions . Among these disorders fms is a prevalent condition and can be encountered secondarily as in case of rheumatologic disorders . First includes 6 items with either yes or no answer, thus enables easy and quick scoring . It can be used as an adjunct to physical examination or evaluation of patients undergoing physical therapy . . Patients were recruited from tertiary care hospitals however study population is not limited to patients referred from primary care clinics . An important consideration for the first is ease of use and scoring in the settings involved with chronic pain patients . It can be completed in less than 3 minutes and seems to be acceptable and relevant for the patients10 . Since it is a single page and evaluation requires simple addition, use of the first may be advantageous in a busy clinical setting such as surgical units . It was demonstrated that patients with fms were more likely to have surgical interventions including back or neck surgery14 . Surgeons and interventionalists may also benefit from using an easy - to - administer patient - completed screening tool to avoid unnecessary procedures.
|
Overweight and obesity are conditions that have been increasing in the united states and these risk factors for diseases are estimated to affect more than one - half of those over the age of 20 . Over the last few years obesity is a major public health concern because it increases the risk for many chronic conditions, such as cardiovascular diseases, particularly diabetes, hypertension, coronary artery disease, and cancer [1,811]. Public health officials have begun to monitor the health status of school - aged children because it is believed that many of them exhibit risk factors that create the potential for developing chronic disease as adults . In 1994, 10.4% among 2 to 5-year - old children, compared to 11.3% and 7.2% respectively for the same age groups in 1988 . This increase in overweight children has underscored the challenges faced by young people as they grow into an adult group where over 50% are overweight, and at significant risk for developing cardiovascular and other metabolic disorders [1, 12]. Effective management of risk factors among the youth, such as reducing / eliminating improper dietary practices and incorporating adequate physical activity, must become a universal health priority in order to effectively precipitate any noticeable decline in the adult morbidity and mortality statistics . Childhood obesity is also associated with several immediate health risk factors, such as orthopedic, neurological, pulmonary, gastroenterological, and endocrine conditions . Obesity has been linked to negative psychosocial outcomes in children, such as low self - esteem and depression [1523], making obesity indirectly linked to academic performance and adverse social outcomes over time [2429]. Cardiovascular disease is not only the leading cause of death, but also the single greatest contributor to excess mortality in african - americans . Unhealthy eating contributes to at least 300,000 preventable deaths each year, and is one of the most identifiable contributors to premature death, second only to tobacco use . Premature deaths due to cardiovascular disease remain higher for african americans than any other group [3137]. The highest rates of premature coronary heart disease in adults age 3564 occurred in the rural southern region of the united states . The rate of cvd for african americans in mississippi was deemed serious enough to compel the national institutes of health (nih) to initiate the jackson heart study to focus on identifying risk factors for the development of cvd in african - americans . Among the known risk factors for cvd according to tom walden of the north american association for the study of obesity, schools can play a key role in preventing the risk behaviors by providing instruction on proper nutrition and physical activity . Based on this premise, this study was designed to examine the students possible role in changing their own negative practices, by first assessing their perceptions of the obstacles to positive dietary practices and increased physical activity . The study also solicited students recommendations for reducing the negative practices that are associated with the rise in obesity and the development of cardiovascular diseases . The implementation of the study was intended to grant the students an opportunity to provide their own ideas, suggestions and recommendations for what they feel could be done to improve their quality of life and to prevent premature morbidity and mortality . The sample for this study included 300 students from a high school, located in rural, mississippi . The high school under investigation in this study educates students in grades 912, and all students enrolled in the health and physical education courses comprised the sample for this project . Students were first asked to complete an assent form and to have their parents sign a consent form before they could participate in the survey . Only students who returned completed assent and consent forms were permitted to participate in the study . The data for the study were obtained from the administration of the project health high school survey (phhss), which was a modification of the mississippi youth risk behavior survey (yrbs) that was developed by the centers for disease control and prevention (cdc). The phhss was designed to measure the prevalence of risk behaviors associated with leading causes of illness and death . The survey was modified to include three additional questions that served to fulfill the objectives of this study . These questions specifically asked students to respond about their perceptions, and were the following: what do you think is keeping you or other students from eating more nutritious, healthier foods? What do you think is preventing you or other students from taking part in daily physical activity? What suggestions do you have that would help students to start eating better and exercising more? These were open - ended questions and the students had the freedom to think and enumerate their perceptions . The students were assured that their responses would be confidential and their honest responses could shed some light on a perplexing health dilemma that currently faced public health officials . All students enrolled in health and physical education classes, which included students in the 912 grades, were administered the phhss survey during the regular classroom session by the regular health and physical education teacher . The students responses on each of these issues were recorded and analyzed to fully understand their perceptions and recommendations . This descriptive study sought to ascertain the students perceptions through the use of questions that were presented in the form of a self - administered questionnaire . Upon completion of the survey, the statistical package for the social sciences (spss) was used to evaluate the student responses . The high school students perceptions about current practices and possible solutions were calculated and presented in the tables that follow . The students perceptions on each of the areas under investigation were recorded and reported based on the rankings (highest number of responses received and recorded) from highest to lowest . Completed phhss surveys were returned for 126 students which represented 42% of the 300 students enrolled in the health and physical education classes . All of the students were between the ages of 14 and 18, and they were all enrolled in grades 912 . The breakdown according to race was as follows: 94.9% were african american; 2.5% were hispanic; 1.3% were asian; and 1.3% were native americans, the participants were 69% female and 31% male . Students at the high school were asked to respond to the question what do you think is keeping you or other students from eating better (more nutritious foods? Figure 1 provides a graphical image of the students responses about this issue . Love of sweets, junk food and fatty foods occupied the highest ranked reason selected by 19.8% of the students . The students also admitted that most of them ate what they were accustomed to eating . They ate what they liked to eat, and the decision about what to eat was made because of the taste of the food without regard for any health consequence or negative health outcomes . The number two reason for not eating healthy was that students believed that the food they were served in the school s cafeteria was of poor quality: 15.7% of the students responses supported this view . The number three reason given for not eating more nutritious foods was family background, family customs and family heritage: 14.1% of the students acknowledged that they ate the way they did simply because they inherited those patterns from their family . In other words, they ate what their parents could afford to buy and prepare for meals . Many of them asserted that they were simply not accustomed to eating nutritious foods daily . These students stated that they buy the types of food they want, and, in some instances, they want the fast foods more than anything else . The students placed fast food restaurants as number five among the reasons why they found it difficult to practice positive eating habits . Ranked number six as a factor that inhibits them from healthy eating habits is the easy access to junk foods and other unhealthy foods: 6.6% of them blamed the easy accessibility of junk foods as a perpetrator of the unhealthy dietary choices and practices . Another 6.6% of the students cited lack of care and guidance from responsible adults as a factor that prevents them from practicing good dietary habits . These students admitted that pressure from videos and corporate advertisements helped to steer them in the wrong direction in reference to the choices they make . The negative influences perpetrated by famous actors, sports personalities and performers usually project the wrong messages and oftentimes influence many students to act spontaneously and without proper judgment . As a result, many of them make the decision to eat daily at fast food restaurants, where they often consume an over abundance of unhealthy meals . Several students reported that there was no one in their life to motivate them with positive messages or inspiration, and not many people cared enough . The number eight ranked reason for students not practicing positive eating habits was the presence of snack machines at school, laden with junk food . About 5.0% of the students cited this as a possible obstacle to good eating practices . Approximately 19.8% of the students did not express an opinion about what is keeping them and other students from eating better (more nutritious foods). The students were also asked what do you think is keeping you or other students from taking part in sufficient exercise (daily physical activity)? The number one reason offered by students for inadequate participation in physical activity is laziness . Some students insisted that there are many students who believe that they are too cute to dress in workout gear, and do not want to sweat during physical activity . Approximately 38.9% of the students perceived that as the main reason why many students do not participate in activities today . The next reason cited by 14.3% of the students was that they preferred to hang out with friends rather than participate in physical activity . Since it is not required daily many of them would prefer to attend parties, talk on the telephone, ride around in cars or watch television, rather than participate in physical activity . And, besides, as some of them insisted, the school has not been helpful in encouraging them to look at the positive benefits of daily exercising . The third ranked reason was that they simply have no desire to take part in physical activity (see figure 2). About 6.3% of the students cited self esteem issues and the feeling of embarrassment as a major contributing factor . The number five ranked reason for non - participation was the volume of homework assignments they have . These students felt that they just do not have the time to participate in physical activity . Approximately 3.2% of the students explained that their inadequate participation is due to a lack of adequate mixture of games available at school . Health problems were cited by 2.4% of the students as obstacles, and 1.6% of them indicated that disagreements with the gym teacher resulted in their non - participation . A small number of students believe that being fat or overweight was a contributing factor to their failure to participate in physical activity . There were approximately 19.0% of the students who had no opinion about what was keeping them and other students from taking part in sufficient exercise (daily physical activity). The students also responded to the question what do you think is needed to help students to start eating better and exercising more? The number one suggestion given by students for improving their quality of life was that the school should provide better and more nutritious cafeteria food (see figure 3). This was equaled in number by the need for guidance by school personnel and parents in the area of healthy eating practices . They felt that the adults should show more interest and concern, and do more to provide adequate instruction and direction, possibly implementing new programs or activities and increased time in health class to address these important issues . They also believed that the parents have a major responsibility to lead the way by providing positive alternatives . This was followed by the need for more encouragement and motivation, as expressed by 14.1% of the students . About 11.3% of the students felt that the school should increase the volume of physical activity and exercise offered to students daily . Number five among the students suggestions was the recommendation that the school make exercise mandatory for students . The students felt that, as incentives, school officials should use prizes, grades or money to encourage students to participate . Another 6.3% of the students suggested that school should make exercise and nutrition programs more fun to encourage students to participate . Some students concluded that increased conversation about the topic would lead to heightened motivation among students to participate in activities that are offered in their health and physical education classes . About 4.2% of the students believed that parents and teachers do not care enough to provide them with adequate guidance and opportunity . The students felt that the school needs to implement a healthy life program within its curriculum . Approximately 4.2% of the students indicated that the students themselves should eliminate junk food and fast foods from their daily lunch menus . Another group of students suggested that more positive advertising of nutritious foods should be encouraged and should be a major part of the plan to improve the students quality of life . Students felt that they should be constantly apprised of the dangers of negative practices regarding poor eating practices and inadequate physical activity . This would facilitate their change to healthier daily practices which could possibly add years to their lives . Approximately 11.3% of the students said they did not know the answer and could not present any suggestions . The major limitation of this study was the fact that only 42% of the total number of students eligible to participate in the study provided surveys that could be analyzed . . However, their responses are valuable enough to shed some light on obstacles to good health and possible solutions to improve the quality of life and develop ways of helping them to eliminate negative practices and reduce risk factors . The major limitation of this study was the fact that only 42% of the total number of students eligible to participate in the study provided surveys that could be analyzed . . However, their responses are valuable enough to shed some light on obstacles to good health and possible solutions to improve the quality of life and develop ways of helping them to eliminate negative practices and reduce risk factors . The interpretation of the students responses to these critical health issues identifies certain urgent needs that could and should be addressed by the academic institutions . Many students understand that there may be negative consequences resulting from the daily choices that they make . It is clear that culture and family customs have a great influence on the direction students take in their dietary practices, as well as their involvement in physical activity . The convenience and easy accessibility of low nutritious foods is also seen as a contributing factor, as are the negative influences that are presented through advertising of non - nutritious foods . It is evident that adequate support and guidance from adults are not available often enough to facilitate the kind of learning and training that could ensure that students are afforded the opportunity to acquire knowledge to help them make positive responsible choices and decisions . So children have little desire to take the initiative to make improvements in their daily practices . The students suggested that modifying the schools curriculum to address student risk behaviors should become an embedded characteristic of their educational systems . The current absence of learning strategies to adequately address and educate students about the pitfalls of negative dietary and physical behaviors is a major shortcoming of the school s education system . Recommendations for future studies should involve examining the responses of students enrolled in predominantly white institutions with those of the predominantly african american canton public school district . Studies could also be designed to compare the responses of students from urban schools and rural schools to determine what their perceptions and recommendations are concerning risk factors and ways of reducing them.
|
Vascular diseases are among the most common causes of morbidity and mortality, and both number and severity of morbid vascular conditions increase with age . Regulations of angiogenesis, coagulation, and inflammation are very important issues in vascular biology, both in normal physiology and pathology . It is now well established that disruption of endothelial integrity represents a crucial event in the initiation and development of cardiovascular (cv) diseases . Numerous studies have reported that microparticles (mps) play an important role in endothelial dysfunction . Endothelial dysfunction occurs when a perturbed homeostatic endothelium disrupts vascular competency resulting in reduced vasodilatation and increased proinflammatory and prothrombotic properties of the vascular network . Recently, mps originating from various cells have been found to be associated with several vascular related diseases . Moreover, exposed procoagulant phospholipids and specific receptors at the surface of mps act as biomessengers linking inflammation, coagulation, and angiogenesis [35]. Although mps were first described as cellular debris that are believed to have no biological significance, recent studies documented that mps of endothelial and other origins are biological effectors in inflammation, vascular injury, angiogenesis, and thrombosis [68]. Mps isolated from granulation tissue are derived from endothelial cells, monocytes, platelets, erythrocytes [913], and myofibroblasts . They exchange biological signals and information intercellularly and each kind of mp carries the antigens and receptors of the cells they originated . Mps may transfer part of their components and content to the selected target cells, thus mediating cell activation, phenotypic modification, and reprogramming of cell function . Although 70% to 90% of all circulating mps in the peripheral blood of healthy individuals are derived from platelets, marked elevations of all kinds of mps have been observed in many vascular diseases . Specifically, endothelium - derived microparticles (emps) represent a relatively small (515%) but very important subset of all circulating microparticles [1618]. This number may vary in different cardiovascular and inflammatory diseases [18, 19]. New insights into endothelial dysfunction and alterations in angiogenesis are emerging from studies of vascular microparticles, particularly endothelial microparticles in elderly populations . Vascular aging with impairment of endothelial cell function leads to altered angiogenesis, a key factor in the etiology of various cardiovascular disorders . 73% of individuals aged 6079 have a cv disease, including stroke, hypertension, or heart failure, and at> 79 years of age prevalence of these diseases increased to 86% in females and 82% in males (2012 nhlbi fact book). Recently published data have shown that these diseases are the leading cause of death for individuals aged> 65 and morbidity increased from 32% for individuals aged 66 to 48% for individuals aged 85 . An important factor which significantly decreases the incidence of coronary heart diseases in postmenopausal women is estrogen [2224]. In women already having coronary artery disease or ischemic stroke, the therapeutic benefit of estrogen is not clear [25, 26] although it has been reported that estrogen induces rapid vasodilation, exerts anti - inflammatory activity, and regulates vascular cell growth, migration, and protection of cardiomyocytes from injury, all of which prevent atherosclerotic deterioration in vessels . This review focuses on the role of emps in angiogenesis, coagulation, and inflammation during age - related vascular diseases and the contribution of estrogen to these diseases . Emps are small vesicles that are released from endothelial cells and can be found circulating in the blood . Defined by their small size (0.1 to 1.0 m), they are a heterogeneous population of vesicles which are shed from plasma membranes in response to cell activation, injury, angiogenesis / neovascularization, and/or apoptosis . Emps consist of a small amount of cytosol surrounded by a plasma membrane and display negatively charged phospholipids on their surface that can initiate and accelerate coagulation . Circulating emps have been demonstrated as a marker of preeclampsia [29, 30], acute coronary syndromes, and severe hypertension [30, 32, 33] suggesting their association with pathological processes within the endothelium . Furthermore, circulating emp levels are also implicated in the progression of atherosclerotic lesions, heart failure, arrhythmias, inflammatory vascular disease, sickle anemia, and endotoxemia . Jimenez et al . Demonstrated that the surface antigens of emps are distinctive depending on the type of endothelial cell injury, as in apoptosis versus activation . High levels of the surface antigens e - selectin, intracellular adhesion molecule-1 (icam-1), and vascular cell adhesion molecule-1 (vcam-1) are on emps derived from activated endothelial cells . In contrast, the low levels of these antigens are on emps derived from apoptotic endothelial cells . Platelet cell adhesion molecule (pecam-1), endoglin, and vascular endothelial - cadherin (ve - cadherin) are at low levels on emps derived from activated ecs [3740] (figure 1). Additionally, emps generated from apoptotic endothelial cells have higher levels of phosphatidylserine on their surface and different phospholipid composition and oxidation status compared with emps generated from activated endothelial cells [41, 42]. These data suggest that there are distinct mechanisms for the formation of emps in apoptotic and activated cells and several studies suggest that these types of emps have different functions in vascular diseases [40, 44]. Both inflammatory cytokines and coagulation factors participate in the generation of emps (figure 2). Recently, it has been shown that p38 mitogen - activated protein kinase (mapk) is a critical molecule in the production of proinflammatory emps and increased icam-1 production by endothelial cells, providing a paracrine loop to enhance the endothelial response to inflammation . In vitro studies have shown that the proinflammatory agent, tnf, activates endothelial cells and induces release of emps (figure 2). Another potent stimulus for emp formation both in vivo and in vitro is angiotensin ii (ang ii). This effect is mediated by ang ii receptor type i that signals through nadph oxidase and rho kinase . Furthermore, in ang ii - infused apoliprotein e (apoe /) hyperlipidemic mice, a model of significant endothelial dysfunction, ang ii has been shown to increase emp formation by a redox - sensitive and blood - pressure - independent process . Another important factor pai-1 (plasminogen activator inhibitor type 1) plays an important role in the formation of emps . It has been shown by brodsky et al . That pai-1 promotes formation of emps with reduced transmembrane asymmetry of phospholipids in a dose dependent manner . These findings could possibly link elevated levels of pai-1 with endothelial dysfunction and tendency toward thrombosis [4850]. Increased levels of pai-1 might serve as an initiator of emp formation followed by increased procoagulant activity and thrombin generation . In addition, it is also known that thrombin stimulates pai-1 synthesis suggesting constant production of these two factors . All these data indicate that formation of emps links together inflammation, coagulation, and angiogenesis and causes the impairment of the last two phenomena (figure 3). Among many signaling molecules, t - cadherin (t - cad) on the surface of ecs might be upregulated and may serve as a characteristic marker of ec activation and stress . Recently, philippova et al . Have demonstrated a mechanism of t - cad - dependent signaling in the vascular endothelium . The authors identified that t - cadherin levels in plasma are increased in early atherosclerosis and correlate with endothelial dysfunction, which may lead to increased release of emps from ecs . Increasing evidence has also accumulated to implicate an impaired coagulation system in many vascular diseases . This coagulation imbalance is the net result of activation of coagulation, impaired activity of natural coagulation inhibitors, and suppressed fibrinolysis . Activation of coagulation proteases, for example, thrombin, is one of the earliest events following tissue injury . Thrombin modulates tissue repair responses by altering vascular permeability, stimulating endothelial cell, fibroblast, and neutrophil migration, and promoting their spreading and adhesion . It activates various cell types and induces secretion of several proimmune, profibrotic, and proinflammatory factors [45, 56, 57]. Recent studies by sapet et al . Have shown that release of emps by endothelial cells in response to thrombin involves a group of genes that regulate angiogenesis and are linked to the cytoskeleton reorganization family . Among these genes, rho - kinase rock - ii was transcribed at a high rate and was identified as a target of thrombin in emp generation . The involvement of caspase-2 in rock - ii activation, independent of cell death, points out a novel signaling pathway that emphasizes the proteolytic activity of caspase in emp generation in response to cell activation (figure 1). However, further studies are needed to determine the molecular mechanisms involved in emp release . Emp release is initiated when thrombin binds to its receptor, proteolytically activated receptor-1 (par-1), which induces gene transcription that is mediated by thrombin via trail / apo2l, a cytokine belonging to the tumor necrosis factor alpha (tnf) superfamily . This mechanism of emp generation depends on the nuclear factor (nf) b activation and involves the soluble form of trail, which is secreted by the endothelial cells under thrombin or inflammatory stimulation [4, 59] (figure 2). Phospholipids expressed on emps bind coagulation factors leading to a prothrombotic state and an increase in procoagulant activity of tissue factor (tf). These phospholipids are exposed on the outer membrane of mp and are considered to be the main initiators of the coagulation cascade . Additionally, it has been demonstrated that sphingosine 1-phosphate (s1p) strongly potentiates thrombin - induced tf expression in ecs suggesting its role in blood coagulation . S1p has also been shown to be involved in the process of angiogenesis and inflammation [6264]. Another important role of mps is their contribution to the development of platelet- and fibrin - rich thrombi at sites of vascular injury via the recruitment of cells and the accumulation of tf . Data suggest that emp - mediated coagulation has clinical significance; for example, an association between the number of circulating mps and the risk of thrombolytic complication has been reported . Because emps interact with coagulation proteins and with inflammatory or vascular cells, their role in cardiovascular diseases has been intensively studied . It has also been observed by jy et al . That emps carry von willebrand factor (vwf) and factor viii that promote platelet aggregates and increase their stability (figure 1). Moreover, the authors postulated that emps released during vascular injury may arrest bleeding by rapid interaction with platelets via membrane - associated vwf multimers and adhesions to stabilized platelet aggregates in the microenvironment . Sabatier demonstrated that emps also carry tf and bind to monocytes causing further tf expression and resulting in enhanced transmigration of monocytes through endothelial junction [66, 67]. One of the important key genes for aging - associated cardiovascular disorders is plasminogen activator inhibitor-1 (pai-1), a main inhibitor of fibrinolysis . The expression of pai-1 is not only elevated in the elderly but also significantly induced in a variety of pathologies associated with the process of aging . Increased levels of pai-1 and its procoagulant activity have been recognized as hallmarks of endothelial dysfunction in vascular aging (figure 4). Furthermore, elevated levels of pai-1 were found in werner syndrome, a disease characterized by premature aging [68, 69] and atherosclerosis, which in advanced stages may lead to myocardial infarction and death . Recently, it has been shown that emps expressing both activators and inhibitors of coagulation have fibrinolytic properties that counteract their procoagulant activities, which may enable them to contribute to haemostatic balance . It has been observed that endothelial and leukocyte microparticles generate fibrinolytic activity, whereas erythrocyte and platelet microparticles do not have this property . Additionally, different plasminogen activators were identified on leukocyte microparticles, urokinase - type plasminogen activator (upa), and emps where tissue plasminogen activator (tpa) has been found . The authors provide evidence that microparticles with plasminogen activators are rare in healthy populations but are observed more frequently in pathological conditions suggesting that plasmin generation on microparticles may be important in the modulation of hemostatic balance . Therefore, complex functions of emps have an ambivalent role both in physiological and pathological conditions, either promoting or inhibiting coagulation, inflammation, or angiogenesis . Inflammatory mediators increase several procoagulant factors, inhibit endogenous anticoagulants, and attenuate the fibrinolytic response . However, the interaction between these two systems is bidirectional, as coagulation is also capable of modulating inflammatory activity . Thrombin mediated inflammatory molecules such as il-8 and il-1ra and il-1 participate in emp release [4, 59] (figure 2) and are key factors involved in coagulation, inflammation, and angiogenesis . Inflammation and coagulation are linked processes in many diseases and emps may amplify the responses by activating the endothelium . It has been reported that in addition to activation of d - dimers and c - reactive proteins in coagulation, the inflammatory cytokine il-6 is associated with mortality, declines in all measures of function, and leads to the frailty phenotype in the elderly . Recently, it has been shown that increased levels of il-6 are present in aged aortas and that aging induces a proinflammatory phenotype in vascular smooth muscle cells (vsmc) due in part to increased signaling of toll - like receptor 4 (tlr4) and its signaling adaptor myd 88 . These observations support the notion of a high prevalence of proinflammatory conditions in advanced age . All of these factors lead to increased generation of emps and impaired coagulation, inflammation, and angiogenesis in cv diseases (figures 3 and 4). The process of angiogenesis is complex and requires endothelial cells (ecs) to detach from pericytes and the extracellular matrix (ecm), proliferate, invade the surrounding tissues, migrate, and differentiate to form capillary tubes that connect to newly developed vascular networks leading to vascular stabilization [7476]. Defective angiogenesis has been found in many vascular diseases and it has been established that emps play an important role in this process . Mps can act on angiogenesis directly through ligand / receptor interaction or indirectly by modulating production of soluble factors involved in endothelial cell differentiation, proliferation, migration, and adhesion . Brodsky et al . Have shown that in low concentration, emps did not affect the endothelium . However, increased levels of circulating emps are an important factor in the pathophysiology of cv diseases, directly affecting the endothelium and other circulating cells . Brodsky et al . Have demonstrated that emps directly impair vasorelaxation via diminishing production and/or bioavailability of nitric oxide . This result was correlated with increased superoxide levels in aortic rings isolated from rats and cultured endothelial cells treated with microparticles . Other studies have demonstrated that mps of endothelial origin induce the expression of endothelial cyclooxygenase type 2, different adhesion molecules, release of cytokines, and impaired release of nitric oxide from vascular endothelial cells . A pathological concentration (10) of emps affects angiogenesis by diminishing the cell proliferation rate and decreasing the total capillary length of human umbilical vein endothelial cells (huvec) plated on a matrigel substrate . Moreover, huvecs or human microvascular endothelial cells (hmvecs) treated with emps demonstrated disorganized tube formation in the presence or absence of vegf . Impairments in the regulation of vascular tone, coagulation, and hemostasis contribute to damage of the vascular system and dysfunctional angiogenesis [8183]. Recently, in vitro studies published by burger et al . Have proved that a long term culture of mouse aortic ecs leads to a senescent phenotype with increased rock activity and formation of mps (figure 4). Furthermore, it has been shown that mps promote premature ec senescence through the stimulation of endothelial cell ros production (figure 4). Brodsky et al . Demonstrated a significant increase in the number of circulating emps in obesity - induced diabetes rats as well as premature endothelial cell senescence and vasculopathy . This disorder was characterized by impaired vasorelaxation, nitric oxide production, and defective angiogenesis . An increased number of circulating emps have been identified in patients with certain diseases, such as hypertension, coronary artery disease, acute coronary syndrome, and stroke . In patients with established endothelial dysfunction, levels of circulating emps are inversely correlated with the amplitude of flow - mediated dilation, independent of blood pressure [11, 8587]. Another study published by thomasow et al . Has shown elevated levels of cd31 (pecam-1), which are suggestive of ec apoptosis, in severe and mild chronic obstructive pulmonary disease (copd) and emphysema . Cd31 emps were positively related to emphysema and were inversely associated with pulmonary microvascular blood flow . In contrast, cd62e (e - selectin) emps indicative of endothelial activation were elevated in severe copd and hyperinflation . Previous studies have demonstrated an impairment of cell proliferation, migration, tube formation, and sprouting in older individuals (> 65 years, male or female) when compared to their younger counterparts (<65 years, male or female) suggesting that these changes contribute to the decrease in effective blood vessel growth and repair mechanisms in the elderly . A decrease of proangiogenic factors and loss of circulating endothelial progenitor cells (epcs) have also been observed with increased aging (> 50 years, male), which may lead to compromised angiogenesis . Furthermore, age - related changes in epc number and function may directly correlate with the degree of senescent endothelial impairment . Furthermore, in older men (> 60 years) with myocardial infarction, circulating microparticles selectively impair the nitric oxide transduction pathway in endothelial cells, which contributes to the general vasomotor dysfunction observed after myocardial infarction . Additionally, an environmental alteration such as a decrease in ecm proteins particularly fibrillar collagen production and small leucine rich proteoglycans (slrps) and changes in the expression of matrix metalloproteinases (mmps) have also been observed with increased aging . Emps are clearly implicated in the impairment of angiogenesis in vascular diseases associated with aging however, the specific pathways through which emps augment this process are unknown . Moreover, emps may be one of the major factors leading to reduced effectiveness of therapies for treating impaired angiogenesis in humans and should be further explored . Furthermore, estrogen levels have been connected to thrombin generation, a central molecule in the coagulation cascade in postmenopausal women . In particular, estradiol increases migration, proliferation, and formation of capillary - like networks of huvecs by the classic estrogen receptor (er) pathway [9698]. Most reports have concentrated on the role of ers in mediating big vessel relaxation and contraction . In a rat model of acute myocardial infarction it has been shown that estradiol promotes myocardial angiogenesis by increasing microvascular density through estrogen receptors . Furthermore, in ovariectomized rats it has been demonstrated that an increased number of genes in the aged heart, including tnf and map kinase - activating death domain protein (madd), play a role in the release of emps [100102] (figure 4). Another in vivo study has shown that ovariectomy in female rats is associated with reduced pai-1 expression, while estrogen replacement counteracts this change promoting emp formation . In vitro studies other mechanisms have also been revealed to be involved in the proangiogenic effect of estrogen including increased expression of both vegf and its receptors [104, 105] and bfgf, as well as expression of vascular adhesion molecules . Moreover, estrogen is known to enhance nitric oxide production and release by endothelial cells . Studies published by reed and edelberg have suggested that a physiological decrease in the concentration of steroid hormones (e.g., estrogen and testosterone) as a result of menopause and chronological aging may contribute both directly and indirectly to subsequent deficits in the synthesis and function of the angiogenic growth factor tgf- . In humans endogenous estrogen contributes to the anticoagulant, anti - inflammatory, and antithrombotic properties of the endothelium . The numbers of endothelium, platelet, and monocyte - derived microparticles have been found to be elevated in low - estrogen menopausal women . The authors implied that increased numbers of procoagulant microparticles provide a resource to study mechanisms for cardiovascular risk development in newly menopausal women . On the other hand, studies demonstrated by rank et al . Had shown that hormone replacement therapy in postmenopausal women increased the concentration of mps derived from platelets . The emp levels were unchanged excluding their primary role in the initiation of a thromboembolic event in these women . Another study has shown that emp concentration was diminished in older patients (> 80 years, male or female) but mp procoagulant activity was preserved in comparison to younger patients . The authors suggested that a decreased emp level was associated with age and any effect of gender was ruled out by multivariate analysis . The study performed by mateos - caceres had shown an increased level of circulating emps in elderly (> 66 years) male and female patients with acute stroke and that tnf activated emps were the major player in stroke induction . Furthermore, simak et al . Demonstrated that circulating emp phenotypes may be associated with the severity, lesion volume, and outcome of acute ischemic stroke (ais) in male patients (> 78 years). On the other hand, studies published by williams et al . Have shown that in elderly patients of both genders (> 66 years), emp levels were similar in ais and stroke mimic patients . Moreover, they demonstrated that emps were generated via activation and not by apoptosis / necrosis of endothelial cells . This suggested that emps may not be an appropriate marker for ais, given the incapability to distinguish between ais and stroke mimic . The tree - city cohort studies have shown that increased thrombin generation is an independent predictor of ais in elderly women suggesting that hypercoagulability may play an important role in the pathogenesis of ais . Indicated that elevated plasma pai-1 levels are a strong risk factor for stroke at old age in people of both genders; however, the 4g/5 g polymorphism variant of pai-1 is associated with reduced incidence of stroke . It has been shown that the single polymorphism pai-1 4g/5 g genotype is associated with higher central systolic, diastolic, and mean arterial blood pressure in women (> 70 years), while no association was found in men suggesting gender specific biology of pai-1 in addition to an advanced age specific factor . Moreover, elevated levels of circulating mps have been reported in patients (> 58 years, male or female) with acute myocardial infarction and coronary artery disease . Studies published by sinning et al . Have shown that circulating emps, but not mps of other cellular origin, are a strong predictor of cardiovascular mortality and major cardiovascular events in patients (> 66 years, male or female) with coronary artery disease and pulmonary hypertension . All these data may indicate that estrogen probably does not exert its protective effects on cv diseases through the emp axis . However, more analyses are needed in order to confirm if a direct connection occurs between estrogen and emps in age - related vascular diseases (figure 4). Endothelial microparticles, as pleiotropic factors, play a role in both physiological and pathological conditions and thus may contribute to regulation of vascular homeostasis . Emps not only reflect the stage of disease but also play a causative role in the development of various vascular diseases . They can modulate coagulation, and their elevated levels have been observed in many conditions associated with inflammation and angiogenesis . The prothrombotic properties and proinflammatory effects of microparticles on endothelial cells affect vascular aging and lead to structural changes in the heart and other organs . Thrombin and pai-1 seem to be key factors involved in emp generation in age - related vascular disease . Furthermore, in age - related vascular diseases, steroid hormones are among the factors that have been shown to have an influence on vascular homeostasis . Specifically, estrogen plays a regulatory function on vessel inflammation, injury, and repair . Lack of estrogen has been suggested to be directly involved in the endothelial cell injury with emp release that is observed in ischemic diseases . However, the direct link between emp generation, emp release, and estrogen is understudied and the further investigation of cellular and molecular mechanisms of these correlations is imperative for understanding and providing a basis for new translational investigations . Furthermore, circulating emps show great promise not only as biomarkers in the diagnostics of vascular diseases but also as a target for the treatment of these disorders, especially in elderly patients.
|
Type 2 diabetes is the most common metabolic disorder worldwide and its prevalence is growing at an alarming rate in both developed and developing countries . It is characterized by abnormalities in carbohydrate, lipid and lipoprotein metabolism, which lead to hyperglycemia and many complications such hyperlipidemia, hyperinsulinemia, hypertension and atherosclerosis . Lifestyle changes, weight control, physical activity and healthy nutrition practices are vital for persons with diabetes to maintain quality of life and longevity . Also as an alternative approach, medicinal herbs with antihyperglycemic activities are increasingly sought by diabetic patients and health care professionals . Cinnamon is the bark of cinnamomum zeylanicum and has been used as traditional folk herbs to treat disease thousands of years in asia . Both in vitro and in vivo studies have shown that cinnamon is an insulin sensitizer. [610] in 3t3 l1 adipocyte, cinnamon extract stimulates glucose uptake, glycogen synthesis and activated glycogen synthase . In rats cinnamon enhanced glucose uptake by enhancing insulin stimulated tyrosine phosphorylation of insulin receptor, insulin receptor substrate 1, and phosphatidylinositol 3 kinase in a dose dependent fashion . Several clinical trials[1216] have investigated the impact of cinnamon on glucose and plasma lipid concentrations in patients with diabetes but yielded conflicting results . Khan et al . Presented the first data on the effects of cinnamon supplementation in humans . They reported a substantial reduction in fasting serum glucose (18 - 29%) and blood lipid profile after 40 d of daily supplementation with one, three, or six grams of whole cinnamon in patients with type 2 diabetes . More recently, mang et al . Reported a 10.3% reduction in fbg after four months of supplementation with a purified aqueous cinnamon extract . However, data from vanschoonbeek et al . Shows no effect of cinnamon spice ingestion on whole body insulin sensitivity, oral glucose tolerance or lipid profiles in postmenopausal type 2 diabetic patients . The present study investigated the proposed benefit of cinnamon use in patients with type 2 diabetes . Therefore a randomized, placebo controlled, double blind study was performed in 44 patients with type 2 diabetes . In this study, we assessed the effects of eight weeks of three grams per day cinnamon supplementation (cinnamomum zeylanicum) on glycemic status, lipid profiles, blood pressure and body composition in type 2 diabetic patients . The study was approved by the medical ethical committee of tehran university of medical science (code p/26/d5/147) and was supported by grants from vice chancellor of research (grant number p/608). A total of 44 individuals with type 2 diabetes were selected to participate in this study . Type 2 diabetes was verified according to the criteria set by the who in 1999 . The objectives of study and risks of experimental procedures were explained to the volunteers, after which their written informed consent was obtained . Inclusion criteria were non - insulin dependent type 2 diabetes, aged between 30 - 65 years, hba1c between 6 - 8% and fbg levels between 126 - 160 mg / dl . Exclusion criteria were cholesterol> 240 mg / dl, triglyceride> 400 mg / dl, smoking and alcohol consumption, pregnancy and lactation, allergy to cinnamon, liver or renal or thyroid diseases and hemolytic anemia . All subjects were stable because medication had not modified over the last month and there were homogeneity regarding their treatments (metformin: 1 - 1.5 gr / d, gliclazide: 160 - 240 mg / d). Subjects were selected based on inclusion criteria among patients who came to the endocrinology and metabolism center, tehran university of medical sciences and randomly assigned to cinnamon (n=22) or placebo group (n=22). Cinnamon and wheat flour were ground finely and put into capsules which could not be distinguished by color, odor, or taste . Subjects were instructed to ingest two capsules at each main meal (breakfast, lunch and dinner) for eight weeks . Compliance to the supplementation protocol was supervised by a research technician who contacted the subjects once a week . Each subject was required to return the original bottle of their respective supplement for capsule counts and compliance was monitored by counting the unconsumed capsules each week . We chose this dose because it is achievable if we want to use it as a spice in future and there is no side effect for this dose in this target group based on literature. [1316] all medication was continued as usual and subjects were advised to maintain their normal diet and continue their habitual physical activity throughout the study . To verify this, subjects completed three day food records (two weekday and one weekend day) at baseline and end of study . Food records were analyzed by nutritionist iv (n squared computing, san bruno ca). Physical activity levels were measured with international physical activity questionnaire at baseline and end of study . Two moved and five were unwilling to continue; so 37 patients completed the study (19 patients in the intervention group and 18 in the control group). Weight, height, body composition and blood pressure were measured in the fasting state with minimal clothing and without shoes in the beginning and end of study . Standing height was measured using a wall mounted stadiometer and body composition was measured with e body 205 (body composition analyzer). After 10 - 12 h overnight fasting, blood sample was collected from each subject at the beginning and at the end of eight week trial . All blood samples were taken in the morning at approximately the same time of day to minimize diurnal variation and immediately centrifuged at 3000 g for 10 min at 20c . Fasting plasma glucose and hba1c were analyzed immediately; aliquots of plasma were stored at 70c until lipid profile and insulin analysis . Fasting plasma glucose was analyzed by the glucose oxidase method (pars azmoon kit, iran). Insulin was analyzed by immunoradiometric assay (irma) method (immunotech co. kit, france). Serum concentrations of triglyceride and total cholesterol were analyzed using the glycerol-3-phosphate oxidase - phenol+aminophenazone (gpo pap) kit as described in our previous study and the cholesterol oxidase - phenol+aminophenazone (chod pap) kit, respectively (pars azmoon kit, iran). Apo lipoproteins ai and b were analyzed by immunoturbidometry method by using auto analyzer cobas (pars azmoon kit, iran). Statistical analyses were performed using statistical package for the social sciences (spss) software (version 14; spss inc, chicago, usa). Qualitative variables, such as physical activity, were analyzed using chi square test . For comparison variables before and after the intervention within each group, paired t test was used . Adjustment for differences in baseline covariates and changes in variables during study were performed by analysis of covariance (ancova). The study was approved by the medical ethical committee of tehran university of medical science (code p/26/d5/147) and was supported by grants from vice chancellor of research (grant number p/608). A total of 44 individuals with type 2 diabetes were selected to participate in this study . Type 2 diabetes was verified according to the criteria set by the who in 1999 . The objectives of study and risks of experimental procedures were explained to the volunteers, after which their written informed consent was obtained . Inclusion criteria were non - insulin dependent type 2 diabetes, aged between 30 - 65 years, hba1c between 6 - 8% and fbg levels between 126 - 160 mg / dl . Exclusion criteria were cholesterol> 240 mg / dl, triglyceride> 400 mg / dl, smoking and alcohol consumption, pregnancy and lactation, allergy to cinnamon, liver or renal or thyroid diseases and hemolytic anemia . All subjects were stable because medication had not modified over the last month and there were homogeneity regarding their treatments (metformin: 1 - 1.5 gr / d, gliclazide: 160 - 240 mg / d). Subjects were selected based on inclusion criteria among patients who came to the endocrinology and metabolism center, tehran university of medical sciences and randomly assigned to cinnamon (n=22) or placebo group (n=22). Cinnamon and wheat flour were ground finely and put into capsules which could not be distinguished by color, odor, or taste . Subjects were instructed to ingest two capsules at each main meal (breakfast, lunch and dinner) for eight weeks . Compliance to the supplementation protocol was supervised by a research technician who contacted the subjects once a week . Each subject was required to return the original bottle of their respective supplement for capsule counts and compliance was monitored by counting the unconsumed capsules each week . We chose this dose because it is achievable if we want to use it as a spice in future and there is no side effect for this dose in this target group based on literature. [1316] all medication was continued as usual and subjects were advised to maintain their normal diet and continue their habitual physical activity throughout the study . To verify this, subjects completed three day food records (two weekday and one weekend day) at baseline and end of study . Food records were analyzed by nutritionist iv (n squared computing, san bruno ca). Physical activity levels were measured with international physical activity questionnaire at baseline and end of study . Two moved and five were unwilling to continue; so 37 patients completed the study (19 patients in the intervention group and 18 in the control group). Weight, height, body composition and blood pressure were measured in the fasting state with minimal clothing and without shoes in the beginning and end of study . Standing height was measured using a wall mounted stadiometer and body composition was measured with e body 205 (body composition analyzer). After 10 - 12 h overnight fasting, blood sample was collected from each subject at the beginning and at the end of eight week trial . All blood samples were taken in the morning at approximately the same time of day to minimize diurnal variation and immediately centrifuged at 3000 g for 10 min at 20c . Fasting plasma glucose and hba1c were analyzed immediately; aliquots of plasma were stored at 70c until lipid profile and insulin analysis . Fasting plasma glucose was analyzed by the glucose oxidase method (pars azmoon kit, iran). Insulin was analyzed by immunoradiometric assay (irma) method (immunotech co. kit, france). Serum concentrations of triglyceride and total cholesterol were analyzed using the glycerol-3-phosphate oxidase - phenol+aminophenazone (gpo pap) kit as described in our previous study and the cholesterol oxidase - phenol+aminophenazone (chod pap) kit, respectively (pars azmoon kit, iran). Apo lipoproteins ai and b were analyzed by immunoturbidometry method by using auto analyzer cobas (pars azmoon kit, iran). Statistical analyses were performed using statistical package for the social sciences (spss) software (version 14; spss inc, chicago, usa). Qualitative variables, such as physical activity, were analyzed using chi square test . For comparison variables before and after the intervention within each group, paired t test was used . Adjustment for differences in baseline covariates and changes in variables during study were performed by analysis of covariance (ancova). The study was approved by the medical ethical committee of tehran university of medical science (code p/26/d5/147) and was supported by grants from vice chancellor of research (grant number p/608). A total of 44 individuals with type 2 diabetes were selected to participate in this study . Type 2 diabetes was verified according to the criteria set by the who in 1999 . The objectives of study and risks of experimental procedures were explained to the volunteers, after which their written informed consent was obtained . Inclusion criteria were non - insulin dependent type 2 diabetes, aged between 30 - 65 years, hba1c between 6 - 8% and fbg levels between 126 - 160 mg / dl . Exclusion criteria were cholesterol> 240 mg / dl, triglyceride> 400 mg / dl, smoking and alcohol consumption, pregnancy and lactation, allergy to cinnamon, liver or renal or thyroid diseases and hemolytic anemia . All subjects were stable because medication had not modified over the last month and there were homogeneity regarding their treatments (metformin: 1 - 1.5 gr / d, gliclazide: 160 - 240 mg / d). Subjects were selected based on inclusion criteria among patients who came to the endocrinology and metabolism center, tehran university of medical sciences and randomly assigned to cinnamon (n=22) or placebo group (n=22). Cinnamon and wheat flour were ground finely and put into capsules which could not be distinguished by color, odor, or taste . Subjects were instructed to ingest two capsules at each main meal (breakfast, lunch and dinner) for eight weeks . Compliance to the supplementation protocol was supervised by a research technician who contacted the subjects once a week . Each subject was required to return the original bottle of their respective supplement for capsule counts and compliance was monitored by counting the unconsumed capsules each week . We chose this dose because it is achievable if we want to use it as a spice in future and there is no side effect for this dose in this target group based on literature. [1316] all medication was continued as usual and subjects were advised to maintain their normal diet and continue their habitual physical activity throughout the study . To verify this, subjects completed three day food records (two weekday and one weekend day) at baseline and end of study . Food records were analyzed by nutritionist iv (n squared computing, san bruno ca). Physical activity levels were measured with international physical activity questionnaire at baseline and end of study . Two moved and five were unwilling to continue; so 37 patients completed the study (19 patients in the intervention group and 18 in the control group). Weight, height, body composition and blood pressure were measured in the fasting state with minimal clothing and without shoes in the beginning and end of study . Standing height was measured using a wall mounted stadiometer and body composition was measured with e body 205 (body composition analyzer). After 10 - 12 h overnight fasting, blood sample was collected from each subject at the beginning and at the end of eight week trial . All blood samples were taken in the morning at approximately the same time of day to minimize diurnal variation and immediately centrifuged at 3000 g for 10 min at 20c . Fasting plasma glucose and hba1c were analyzed immediately; aliquots of plasma were stored at 70c until lipid profile and insulin analysis . Fasting plasma glucose was analyzed by the glucose oxidase method (pars azmoon kit, iran). Insulin was analyzed by immunoradiometric assay (irma) method (immunotech co. kit, france). Serum concentrations of triglyceride and total cholesterol were analyzed using the glycerol-3-phosphate oxidase - phenol+aminophenazone (gpo pap) kit as described in our previous study and the cholesterol oxidase - phenol+aminophenazone (chod pap) kit, respectively (pars azmoon kit, iran). Apo lipoproteins ai and b were analyzed by immunoturbidometry method by using auto analyzer cobas (pars azmoon kit, iran). Statistical analyses were performed using statistical package for the social sciences (spss) software (version 14; spss inc, chicago, usa). Qualitative variables, such as physical activity, were analyzed using chi square test . For comparison variables before and after the intervention within each group, paired t test was used . Adjustment for differences in baseline covariates and changes in variables during study were performed by analysis of covariance (ancova). Baseline characteristics did not differ between the two groups of the study population [table 1]. Energy intake, macronutrient and micronutrient composition of the diet did not differ between groups at baseline and did not change in the placebo or cinnamon group during the intervention period . Physical activity levels did not differ between groups at baseline and did not change during the study . Table 2 shows the fasting plasma glucose concentrations, hba1c, serum lipids, anthropometric variables and the corresponding differences of these variables for the cinnamon and placebo groups . While the fbg, hba1c and triglyceride levels in the cinnamon group was significantly reduced after the intervention compared with baseline (p=0.005, p=0.008, p=0.038 respectively), no such effect were observed in the placebo group . No significant intragroup differences were observed in insulin or lipid profile (total cholesterol, hdl cholesterol, ldl cholesterol, apo lipoproteins ai and b). Body weight and bmi in both groups were significantly reduced after the intervention compared with baseline (p=0.017, p=0.010 respectively). Fat body mass was significantly reduced in cinnamon group, (p=0.047) but not in placebo group . No significant intergroup differences were observed in glycemic parameters, lipid profile, anthropometric variables and blood pressure . Baseline characteristics of the study population biochemical and anthropometric variables at baseline and after the intervention period our findings indicate that consuming three gram per day of cinnamon for eight weeks leads to significant reduction in some biochemical and anthropometric variables compared with baseline (i.e., fbg decreased by 9.2%, hba1c decreased by 6.12%, triglyceride decreased by 15.38%, body weight decreased by 1.19%, bmi decreased by 1.54% and fat body mass decreased by 1.36%). But these reductions were not significant compare to placebo group . Khan et al . Studied the effects of one, three, and six grams per day of whole cinnamon powder on fbg and serum lipids in 60 people with poorly controlled type 2 diabetes from pakistan . After 40 days of supplementation, fbg decreased by 18 - 29%, cholesterol decreased by 12 - 26%, ldl cholesterol decreased by 7 - 27%, and triacylglycerol decreased by 23 - 30% . Consequently the authors concluded that small amount of cinnamon represent a safe and effective mean to reduce the risk factors associated with type 2 diabetes . In the cinnamon group, we observed a significant reduction of plasma glucose (9.2%) after eight weeks of treatment but not in the placebo group . The observed reduction in fbg in our study is less than that of khan et al . And similar in magnitude to mang et al . Who supplemented 79 diabetic patients with three grams per day cinnamon powder or a placebo for four months although no changes in blood lipids or hba1c were noted in their study, researchers did find a 10.3% reduction in fbg . Also the decrease in plasma glucose correlated significantly with the baseline concentrations indicated that subjects with a higher initial plasma glucose level may show more reduction after cinnamon intake . However data from vanschoonbeek et al . Showed no effect of cinnamon spice ingestion on whole body insulin sensitivity, oral glucose tolerance or lipid profiles in a postmenopausal type 2 diabetes mellitus (t2 dm) group . The positive correlation between baseline plasma glucose and the decrease of plasma glucose in mang et al . Study and the strong decrease of serum glucose in the poorly controlled pakistani diabetics (mean fasting glucose (140 - 400 mg / dl) concentrations), suggest that subjects with poor glycemic control may benefit more from cinnamon intake . No significant intergroup and intragroup differences were observed in lipid profile except in triglyceride that decreased significantly in cinnamon group compared with the baseline . Insulin resistance leads to the overproduction of very low density lipoproteins (vldls) and to reduce lipoprotein lipase activity, thereby resulting in dyslipidemia . Obviously, the decrease of plasma glucose concentrations in our study was not sufficient to induce an improvement in the lipoprotein concentrations . Also our subjects lipid levels were not abnormal, while pakistani subjects in khan et al . No significant intergroup differences were observed in anthropometric variables . There were no changes regarding the systolic / diastolic blood pressure after the intervention compared with baseline in our study . Ziegenfuss et al . Reported statistically significant decrease in systolic bp (from 133 to 129 mm hg) and increases in lean mass (+ 1.1%) compared with the placebo group . Additionally, within - group analyses uncovered small, but statistically significant decreases in body fat (0.7%) in the cinnamon group . It is possible that the improvements in fbg, as well as plasma antioxidant status are responsible, at least in part, for cinnamon's beneficial effects on body composition and features of the metabolic syndrome like blood pressure . Couturier et al . Suggested that in animals fed a high fat / high fructose diet to induce insulin resistance, cinnamon alters body composition in association with improved insulin sensitivity . The decreases of plasma glucose and insulin concentrations and weight in our study were not sufficient to induce an improvement of the blood pressure . Regarding the limitations of our study, we can point to the duration of study (eight weeks) and dose of the cinnamon (three grams per day). There are some studies with longer duration and it would be better if we could have possibility for continuing the intervention which it was impossible because subjects had time limitations to come to the study center (endocrinology and metabolism center, tehran university of medical sciences) and compliance was limited if we extend the time . There are some studies that use more than three grams per day cinnamon and detect significant effects and it would be better if we could have another group with higher dose of cinnamon for comparing doses that was impossible because of financial limitations . In conclusion, our study shows that in type 2 diabetic patients, the intake of three grams per day cinnamon may lead to a moderate effect on glycemic status indicators, but does not improve blood pressure, blood lipid profile or body composition parameters.
|
. Failed endotracheal intubation and inadequate ventilation with insufficient oxygenation may lead to serious complications, even death . Management of an unexpectedly difficult airway consists of laryngeal mask ventilation, gum - elastic bougie and video laryngoscopy - assisted intubation . Gum - elastic bougie is the easiest and cheapest tool used in case of an unexpected difficult intubation occurring in the operating room . A 53-year - old male patient with hypogonadotropic hypogonadism presented as an unexpected difficult intubation after the induction of anesthesia . A difficult airway has been described in patients with a variety of endocrine disorders, including pituitary diseases, but not with hypogonadism . There may be an unrevealed relationship between hypogonadism and difficult airway . Gum - elastic bougie is still the most attainable and effective tool in the operation room in this situation . Anesthesiologists are responsible for maintaining a patent airway in the anesthetized patient . Failed endotracheal intubation and inadequate ventilation with insufficient oxygenation may lead to serious complications, as even a few minutes of deoxygenation can result in catastrophic outcome like brain damage or even death.1 anesthesiologists are occasionally faced and challenged with this significant problem in practice . A difficult airway has been described in patients with pituitary endocrine disorders such as acromegaly and dwarfism; however, airway problems with hypogonadism have not been well identified in the literature.2 a 53-year - old married man (weight: 85 kg, height: 187 cm, body mass index: 24 kg / m) presented with a history of nasal obstruction for two years . He had not had any prior operation under general anesthesia, so he did not have any history of difficult intubation, and he did not have any chronic systemic disease . The patient was evaluated for obstructive sleep apnea syndrome (osas) with a comprehensive questionnaire on his sleeping habits and medical history; no complaints or predictors pertaining to osas were identified . The patient s preoperative airway assessment was normal, mallampati class was ii, thyromental distance was 7 cm, inter - incisor gap was 5 cm, and head extension was> 35. his physical examination was characterized by lack of secondary sexual characteristics and presence of fine facial wrinkles . Although, as previously indicated, the patient was married, he had had no children . His hormone profile was: testosterone 0.3 ng / ml (reference range 1.757.81), free testosterone 0.91 (reference range 4.542.0), prolactin 1.31 ng / ml (reference range 2.6426.72), luteinizing hormone (lh) 0.33 miu / ml (reference range 1.24103.03). No other pathological finding was obtained as the result of magnetic resonance imaging of the pituitary gland . He was admitted to the operating theater, and following the induction of anesthesia with a dose of 5 mg / kg intravenous thiopental, bag - mask ventilation was barely sustained . Fentanyl (12 gr / kg) and, as a muscle relaxant, rocuronium (0.6 mg / kg) were administered . While the patient s head was in the sniffing position, direct laryngoscopy and intubation of the trachea were attempted three times with different sizes of macintosh and miller blades by an assistant professor of anesthesiology with 5 years experience . However, unfortunately, the intubation failed . The lungs were then ventilated with 100% oxygen via a face mask in order to avoid desaturation . Glottic visualization was assessed with cook s modification of the cormack lehane classification; a grade of 3a (with direct laryngoscopy, only the epiglottis can be visualized; the epiglottis can be lifted using an introducer or bougie) was assigned.3 the patient was subsequently successfully intubated with a gum - elastic bougie . After the operation, the patient was extubated successfully without any complication and then examined by otorhinolaryngologists via fexible laryngoscopy . The epiglottis was found to be in a slightly lower than normal position (figure 1). The overall incidence of unexpected difficult intubation is estimated to be 1%3%, while failed intubation incidence is 0.05%0.35% in europe.1 difficult endotracheal intubation has been described in patients with pituitary diseases like acromegaly, cushing s disease, lh / follicle - stimulating hormone - secreting adenoma, thyroid - stimulating hormone - secreting adenoma, nonfunctional adenoma and prolactinoma.4 difficult airway with dwarfism has also been described . However, difficult airway with a hypogonadotropic patient has not yet been clearly defined . In our case, further, magnetic resonance imaging of the pituitary gland did not reveal any adenoma or mass lesion.2 pulsatile release of follicle stimulating hormone and lh in puberty instigates the development of the male larynx and secondary sexual characteristics . The growth of laryngeal cartilages and maturation of the male larynx is also facilitated by androgen . High - affinity androgen receptors have been found in the human larynx.5,6 in this case, the patient s laryngeal development was compatible with his age and sex . Only the epiglottis was located in a slightly lower position than normal, partially leaning toward the laryngeal passage . The patient was infertile and lacked secondary sexual characteristics due to insufficient exposure to androgens . The rate of difficult intubation has been found to be higher in osas patients than the normal, healthy population.7 body mass index, mallampati grading, cormack lehane classification, sternomental distance, and thyromental distance evaluation might be predictive factors for difficult airway in osas patients . As such, anesthesiologists must be aware of this fact and be prepared for difficult intubation in osas patients.7 however, the rate of difficult intubation has not been found to be related to the severity of osas.8 no significant relationship between the apnea hypopnea index and difficult intubation has been found.8 in our patient, no apnea and daytime sleepiness were present in his history . Only snoring was present, which might well have been associated with nasal septal deviation . His body mass index was 24 kg / m, mallampati class was ii, thyromental distance was 7 cm, inter - incisor gap was 5 cm, and head extension was above 35. these findings did not suggest any evidence of osas or difficult airway . This multiparameter test reveals the presence and severity of osas.9 in this case, as there was no clinical index of suspicion for osas and to keep costs down, polysomnography was not required by the otorhinolaryngologists . Thus, anesthesiologists must take into account difficult airway in endocrinological disorders like hypogonadotropic hypogonadism and be prepared for difficult intubation.
|
We reviewed the medical records of patients who had l. monocytogenes isolated from blood and body fluids from sterile sites during 19962008 at the national taiwan university hospital (ntuh), a 2,500-bed hospital in taiwan . We evaluated disease severity using modified acute physiology and chronic health evaluation ii scores (8). Incidence of nontyphiodal salmonella bacteremia (ntsb) during 20002008 in ntuh was calculated for trend comparison of the 2 foodborne illnesses . Only 1 episode was calculated during the same admission for ntsb to avoid the influence of repetitive bacteremia . Isolates from patients with fetomaternal listeriosis (i.e., paired isolates from mother and neonate who had listeriosis) were considered to be the same and only 1 of them was analyzed . All isolates were analyzed for their serotype by pcr as described, and genetic relatedness was evaluated by pulsed - field gel electrophoresis (pfge) by using pulsenet standardized protocols and 2 restriction enzymes (asci and apai) (2,9). Strains were considered to be of the same cluster if their bands had indistinguishable restriction patterns by both enzymes . Strains with pfge patterns with> 80% similarity by asci and apai profiles were considered to be closely related . A forward stepwise model with a p value of 0.1 was used, and p<0.05 was considered statistically significant in the multivariate cox proportional hazards model . During the study period, listeriosis was diagnosed in 48 patients, and 46 nonduplicated isolates were obtained for further microbiological analysis . Average annual incidence increased from 0.0287 cases per 1,000 admissions during 19962004 to 0.118 cases per 1,000 admissions during 20052008 (figure 1). The increase in annual incidence of listeriosis was significantly correlated with years (p = 0.0045). The average annual incidences of ntsb were 1.189 and 1.118 per 1,000 admissions during 20002004 and 20052008, respectively; it was not significantly correlated with years (p = 0.50). Age - specific incidence of listeriosis increased at both extremes of age, but especially among patients> 80 years (figure 2). All of the patients with listeriosis lived in northern taiwan, and no obvious geographic correlation was observed between listeriosis patients in each year . Incidence (cases per 1,000 admissions) of human listeriosis and serotype distribution of all isolates, national taiwan university hospital, taipei, taiwan, 19962008 . Forty - six isolates were available for analysis, including 2 serotype 4b isolates from fetomaternal transmission in 2005 and 2006 and 1 serotype 4b from a pediatric patient (2005). Patient distribution and incidence of human listeriosis, by age group, national taiwan university hospital, taipei, taiwan, 19962008 . All 43 patients had underlying predisposing conditions, and 18 (42%) were> 65 years of age . Of the 30 patients with malignancies, 23 (77%) one female patient had coexisting non - hodgkin lymphoma and colon cancer; 1 male patient had coexisting non - hodgkin lymphoma, gastric cancer, and bladder cancer . Initial modified acute physiology and chronic health evaluation ii score, mean sd: 18.8 7.3 . Among the 46 isolates, serotype 1/2b was identified most frequently (46%), followed by 1/2a (28%) and 4b (26%). All 46 isolates were susceptible to ampicillin, ertapenem, meropenem, and vancomycin; 3 isolates were intermediately susceptible to trimethoprim / sulfamethoxazole; and 4 isolates were nonsusceptible to linezolid (10). Sixteen (37%) patients received cephalosporin alone as initial treatment regimens and empirical treatment was effective for only 14 (33%). The presence of solid - organ malignancies was a significant negative prognostic factor for 14-day mortality in the univariate analysis (95% confidence interval [ci] 1.16516.694; p = 0.029) but not in the multivariate analysis . The results of the multivariate analysis for 14-day mortality showed that hepatic decompensation at disease onset was a significant negative prognostic factor (hazard ratio 12.02, 95% ci 1.84278.470; p = 0.009) and that the use of effective antimicrobial drugs after culture results were reported was a significant positive prognostic factor (hazard ratio 0.014, 95% ci 0.0020.131; p<0.001). Log - rank tests performed to compare the difference in survival between patient groups for the 2 variables also had the same results (p<0.001). We observed an upsurge of listeriosis beginning in 2005 in ntuh . The increase might not be attributable to common - source outbreaks because no clustering was detected . The annual incidence of listeriosis has been on the rise in europe since 2000 (2,3,11). The reason is not clear because the increase could not be attributed to outbreak clusters and no increase in pregnancy - related listeriosis was observed (2,3). Wong et al . Found that l. monocytogenes was isolated in> 50% of pork samples and chicken carcasses (6). Semiready foods (dumplings and meatballs) and frozen dim sum examined also carried the pathogen (34.0% and 4.4%, respectively), and> 60% of the isolates were serotype 1 or 4 (6). If served undercooked, these foods could be potential transmission sources . Taiwan currently has no strict regulatory policy regarding listeriosis in the food industry and no disease surveillance system . In france, serotype 4b was the predominant serotype (42%56%), whereas serotype 1/2b was more common (46%) in our study (2). None of the isolates were resistant to the tested agents, except for 4 isolates, which were resistant to linezolid . The contributions of disease severity and antimicrobial drug treatment are difficult to evaluate in population - based studies (12). Brouwer et al . Reported that up to 30% of adults with l. monocytogenes meningitis did not receive initial adequate antimicrobial drug therapy, and they found no association between that variable and outcome (13). A high proportion (37%) of patients in our study initial disease severity and initial adequate antimicrobial drug therapy was not associated with overall mortality . We found that mortality was related to hepatic decompensation and effective antimicrobial drug therapy after culture results were reported . Therefore, the incidence of and risk factors for human listeriosis in taiwan could not be determined precisely, and potential outbreaks might have been overlooked . The retrospective design of our study limited the possibility of identifying the potential vehicles and disease - acquiring behaviors . An increase of listeriosis was noted since 2005 in our hospital, and all of the affected patients had predisposing factors that hampered their immunity . Dietary education and food management information should be provided to high - risk groups in taiwan . Food monitoring and human disease surveillance systems need to be established in taiwan to control this potentially fatal foodborne disease.
|
Three cats, siamese or siamese cross, were presented with a chronic thoracic limb weightbearing lameness . Previous anti - inflammatory administrations were unable to improve lameness consistently in the three cats . Two of the three cats had undergone onychectomy several years before presentation . A permanent flexion of the proximal interphalangeal joint of one or more digits, associated with a difficult and painful extension of the proximal interphalangeal joint, for all cats, treatment consisted of a tenectomy or tenotomy of the superficial and deep digital flexor tendons in order to release the contracture . The three cats responded well to the surgical treatment and became sound around 24 weeks after surgery . It should be considered in a differential diagnosis of feline lameness whenever onychectomy has been performed in the past . The precise etiology that explains this tendon contracture is unknown, but trauma or breed predisposition could represent potential causes . Digit lesions are most often associated with fractures, luxations, wounds, shearing injuries or tumors, and, less commonly, osteomyelitis or osteoarthritis . Various surgical interventions are feasible, and digit amputation or luxation reduction is the most frequently performed treatment . Feline onychectomy is also a common surgery in north america, despite debate over the ethics of this procedure . Feline digital flexor tendon pathology, especially tendon contracture, is not well described . To our knowledge, the term contracture refers to an abnormal pathologic process resulting in fibrosis and permanent damage to a muscle, characterized by replacement of the muscle and/or associated tendon with fibrous connective tissue . This phenomenon leads to shortening of the tendon or the muscle, and can have functional consequences on the range of motion of adjacent joints . Most contractures are associated with a previous trauma, weeks to months before the contracture occurs, but repetitive strains, infectious diseases, ischemia, compartment syndrome or neoplasia may also lead to contracture . This case series reports three different clinical presentations of digital flexor tendon contracture in three cats, all successfully treated by tenectomy . A 4-year - old neutered male siamese cat weighing 4.8 kg was presented to a referral hospital for chronic left forelimb weight - bearing lameness of 1 year s duration . The cat showed mild and transient lameness improvement with meloxicam (0.05 mg / kg po q24h metacam; boehringer ingelheim), but long - term medication did not show any additional benefits . The cat showed very mild lameness, with the left forelimb constantly non - weight bearing at rest . A permanent flexion of the proximal interphalangeal joint of the left forelimb second digit was noted . Extension of the proximal interphalangeal joint was possible but very difficult and palpation of this digit was significantly painful . Six months after initial presentation, the cat was presented for follow - up, without improvement . Radio - graphic views of the left forelimb extremity revealed an abnormal positioning of the middle phalanx . Indeed, the angulation between the middle and proximal phalanges was decreased and reached almost 90 between these two phalanges on the second digit . There was no evidence of retention of remnants, osteomyelitis or hyperostosis of the distal phalanx . Following premedication with hydromorphone (0.1 mg / kg iv hydromorphone; summit) and acepromazine (0.02 mg / kg iv atravent; boehringer ingelheim), general anesthesia was induced with propofol (4 mg / kg iv diprivan; astrazeneca) and maintained with 2% isoflurane (forane; baxter) in 100% oxygen after orotracheal intubation . The cat was placed in dorsal recumbency, and the palmar surface from mid - radius to the extremity of the limb was clipped and aseptically prepared . Surgery involved a palmar approach to the proximal interphalangeal joint of the second digit, with a midline skin incision extending from the distal aspect of the carpal pad to the proximal aspect of the metacarpal pad . Following blunt dissection, the deep and superficial digital flexor muscle tendons were visualized and elevated, and a portion of the tendons (5 mm) were transected with a #15 scalpel blade (figure 1). The surgical wound was copiously lavaged with 0.9% sodium chloride (0.9% sodium chloride irrigation; baxter). The subcutaneous tissues were closed with a continuous pattern, using a 4 - 0 absorbable monofilament (poliglecaprone 25, monocryl; ethicon). The skin was closed with an interrupted pattern, using a 4 - 0 non - absorbable monofilament (polyamide 6, ethilon ii; ethicon). The patient was discharged from the hospital the day after the surgery with strict rest instructions for 3 weeks and meloxicam (0.05 mg / kg q24 h po) for 2 weeks . Two weeks after surgery, the owner mentioned that the cat was very active, walking normally at home and was more playful than before surgery . Upon follow - up examination no lameness was observed, and manipulation of the left proximal interphalangeal joint of the second digit was normal and pain free . Two years after surgery the owner reported that the cat was totally sound, very active and had returned to its usual activity level . Intraoperative plantar visualization of the flexor tendons of the third digit before tenectomy (black arrow), exposed with a periosteal elevator (*). Left is distal, right is proximal, up is medial, down is lateral) a 7-month - old neutered female siamese weighing 3 kg was presented for a lameness of the left forelimb of 2 months duration . The owner reported that the lameness was most likely due to a trauma that occurred 2 months previously and was permanent since the incident . The cat received two different unknown non - steroidal anti - inflammatories before presentation at our hospital and did not show any improvement . The lameness was moderate at a walk and severe and non - weight bearing when the cat was running . At rest, a non - weight bearing stance was also obvious on the left forelimb . A permanent flexion of the proximal interphalangeal joint was noted on the fourth digit of the left forelimb . Five months after initial presentation, the cat was presented for the same condition, without any improvement regarding lameness or comfort upon palpation . Radiographic views of the left forelimb extremity revealed an abnormal positioning of the middle phalanx compared with the proximal phalanx, characterized by a decreased angulation between these two phalanges on the fourth digit . Following premedication with butorphanol (0.1 mg / kg iv torbugesic; pfizer), general anesthesia was induced with propofol (4 mg / kg iv) and maintained with 2% isoflurane in 100% oxygen after orotracheal intubation . A tenectomy of the deep and superficial digital flexor muscle tendons was performed as previously described for the first case . The surgical preparation and operative technique were similar to those used in case 1, except that the surgical site was the tendons of the fourth digit . The cat was discharged from the hospital the day after surgery with strict rest instructions for 3 weeks and meloxicam (0.05 mg / kg q24h orally) for 2 weeks . At the 2 week re - evaluation, the cat still presented a mild lameness of the left thoracic limb, although the extension of the proximal interphalangeal joint of the fourth digit was improved compared with preoperative examination . One month after surgery, the cat was totally sound and manipulation of the digit was not painful . At a 1.5 year postoperative follow - up, the owner reported that the cat was not limping anymore, was pain free and had returned to its normal activity . A 7-year - old neutered male siamese cross weighing 6 kg presented with right forelimb lameness, which had appeared a month earlier . The owner also reported that the cat had undergone onychectomy at 6 months of age . The cat received a non - steroidal anti - inflammatory treatment (0.05 mg / kg q24h po meloxicam) for 2 weeks before presentation and did not show any improvement in lameness . Upon examination, the cat s right forelimb was non - weight bearing at rest, and the cat was uncomfortable while walking on both forelimbs . A permanent flexion of the proximal interphalangeal joint was noted in all four digits of both forelimbs (figure 2). Moreover, a 3 mm diameter white firm and painful callus was palpable at the craniodistal aspect, bilaterally, of the third and fourth digital pads . Radiographic views of the forelimb extremity revealed an abnormal positioning on both limbs between the middle and the proximal phalanx . Indeed, the angulation between these two phalanges was decreased and reached almost 90 in all digits . No bony or articular lesion or osteomyelitis of the proximal and middle phalanges was observed . Remnants of the distal phalanx were not observed in the radiographs (figure 3). A digital flexor tendon contracture of both forelimb digits was then suspected, and, after discussion, the owner agreed to surgical treatment . Flexor contracture of all digits can be visualized (left is distal, right is proximal, up is dorsal, down is plantar) forelimb oblique extremity radiographic view of the left limb in case 3 . An abnormal positioning between the middle and the proximal phalanx is observed in the four digits . The angulation between these two phalanges is decreased and reached almost 90 in all digits following premedication with hydromorphone (0.1 mg / kg iv), general anesthesia was induced with alfaxalone (2 mg / kg iv alfaxan; abbott laboratories) and maintained with 2% isoflurane in 100% oxygen after orotracheal tube placement . A local regional anesthetic bloc was performed bilaterally with bupivacaine (0.5 mg / kg sc marcane 0.5%; hospira healthcare corporation). The surgical procedure was performed as described in case 1 for digits iii and iv of both forelimbs, and a tenotomy was performed on digits ii and v on both forelimbs (figure 4). The cat was discharged from the hospital the day after the surgery with strict rest instructions for 3 weeks, meloxicam (0.05 mg / kg q24h po) for 6 days and buprenorphine (20 g / kg q8h sublingually buprenorphine; chiron compounding pharmacy) for 7 days . Perioperative dorsal view of an operated limb (ol) and a preoperative limb (pl) in case 3 . Flexor contracture is well visualized in pl compared with ol ol = on the left; pl = on the right at the 2 week follow - up, the cat was totally sound and manipulation of the forelimb digits was very comfortable . At rest, digits were in hyperextension (figure 5). Histopathologic examination of some parts of the flexor tendons revealed dense and thick collagen bundles associated with a few non - reactive small fibroblasts . These observations were considered to be consistent with a chronic degeneration or trauma of this tendon . A definitive diagnosis of flexor tendon contracture was made (figure 6). Thoracic limbs of case 3, 4 weeks after flexor tendon tenectomy and tenotomy photomicrograph of a tendon section from a domestic cat . Note the presence of increased well - differentiated fibroblasts (large arrows) in the tendon accompanied by few small - caliber blood vessels (arrowhead) and thin collagen fibers (thin arrows). The three cats reported in this study presented with chronic mild forelimb lameness associated with reduction of the normal extension of the proximal interphalangeal joint of one or more digits . A contracture of the digital flexor tendon was suspected and confirmed by histopathologic analysis in one case . This case series is of particular interest because it describes three different presentations of digital flexor tendon contracture in cats . In case 1, which involved an onychectomized cat, tendon contracture involved only one digit, which is different from the two cases reported by cooper et al . In case 2, the cat developed a tendon contracture on a digit, although it had not undergone onychectomy . Case 3 is more comparable to the cases reported by cooper et al because this case involved tendon contracture of all digits in both forelimbs after onychectomy . However, such an important delay, as seen in this case, between onychectomy and the development of digital flexor tendon contracture has not been previously reported . We elected to perform only tenotomy on digits ii and v in case 3 because of a satisfactory intraoperative contracture release after tenotomy . However, although we thought that tenectomy was not mandatory to relieve contracture in theses digits, it could have been a valuable option for treatment of contracture . The surgical outcome was excellent in all cats, as in the two cases reported elsewhere . Flexor contracture can be painful and disabling and can induce abnormal contact on normally non - contact areas of the digits . Contracture release by tenectomy or tenotomy seemed to improve the lameness quickly, while long - term anti - inflammatory treatments failed in each of the cases reported here . The deep and superficial digital flexor tendons provide digital flexion through contraction of the muscle bellies . More precisely, the proximal interphalangeal joint is flexed by the action of the superficial digital flexor and the distal interphalangeal joint is flexed by the deep digital flexor . The superficial digital flexor (flexor digitorum superficialis) tendon runs on the palmar surface of the deep digital flexor tendon (flexor digitorum profondus). It splits distally into four parts, which diverge to the second to fifth metacarpophalangeal joints, with the corresponding terminal tendons of the deep flexor tendon . Each superficial digital flexor ends on the proximal aspect of the palmar surface of the middle phalanx after being perforated by its respective deep flexor tendon, which ends on the tuberosity of the distal phalanges of digits ii those superficial and deep tendons are bridged by three transverse ligaments, at the metacarpophalangeal joints and at the proximal and middle phalangeal joints, on each of the four main digits . In two of the cases reported here, tendon therefore, the cause of the contracture must have been distal to the common tendon . With the third cat, the contracture could have been located more proximally than the tendon division, but multiple contractures of the distal portion of each superficial digital flexor tendon were confirmed by histopathologic analysis . Distal aspect of flexor tendon anatomy on a third thoracic digit (distal digital annular ligament has been removed). * deep flexor tendon; p1 = proximal phalanx; p2 = middle phalanx; p3 = distal phalanx; (+) = superficial flexor tendon a precise etiology is unknown in these cats . However, a traumatic episode was reported by the owner of case 2, and this could have been the initial cause of the flexor tendon damage that led to a chronic problem . Two cats presented for bilateral and painful flexor tendon contracture following onychectomy have been previously reported . Both cats underwent onychectomy 6 weeks and 3 months before presentation, respectively, and had all digits of both front paws fixed in flexion . Tenectomy of each deep digital flexor tendon successfully resolved the condition, and the cats were sound 2 months after surgery . The authors hypothesized that the postoperative contracture was the result of inflammation due to a suboptimal surgical technique (excessive or rough tissue manipulation, use of a dull scalpel blade, improper use of tissue adhesives or poor aseptic technique). These factors could elicit an abnormal inflammatory response and result in flexor fibrosis, adhesion formation and evolution toward flexor tendon contracture . Tobias et al reported that the duration of the surgery, which was potentially secondary to a suboptimal surgical technique, was correlated with the occurrence of postoperative lameness . This association could also be observed with persistent long - term lameness but the number of cases observed was considered too low to determine such an association . The anatomic relation between the deep digital flexor tendon and the middle phalanx could explain the long - term contracture . Indeed, traumatic resection of the distal phalanx could be the cause of an inflammatory reaction in the area of the distal extremity of the middle phalanx and the deep digital flexor tendon . In addition to contracture of the digital flexor, other complications have been associated in 040% of cases of onychectomy in cats, such as pain, hemorrhage, lameness, swelling, non - weightbearing, infection, claw regrowth, middle phalanx protrusion and palmigrade stance . Lameness is usually an early postoperative complication and is associated with pain, which resolves in 2 days but can persist for up to 2 months . The postoperative flexor contracture was previously reported in the first months after onychectomy but long - term postoperative contracture after onychectomy could explain undiagnosed chronic pain in some cats and particularly in cats 1 and 3 . Thus, digital flexor tendon contracture cannot be ruled out because of an increased delay from the onychectomy . A trauma was suspected for the second cat, as no previous onychectomy was performed on this patient . Digital flexor tendon injuries in dogs and cats are uncommon and most often result from laceration by sharp or penetrating foreign objects . Other conditions of digital flexor tendons are rare, and only a few cases have been reported . A report of a 10-month - old male great dane affected by an excessive non - painful exion of the digits of the rightforelimb (more pronounced on the fourth digit) has been published . This dog was lame for 2 months . Restricted extension of the fourth digit was conrmed under general anesthesia, and a modied z - tenotomy was performed . Surgery provided a very good outcome, as postoperative extension of the affected digit was possible and pain free, and no lameness was noted 7 months after surgery . A 5-month - old basset hound was also reported with simple incomplete syndactyly (fusion of the third and fourth digital pads on a hindlimb) and secondary contracture of the deep digital flexor tendon of the third and fourth digit . With this dog, the deep digital flexor tendon contracture was suspected to be secondary to the primary congenital anomaly and was treated by palmar tenotomy . The first two cats reported here were middle - aged indoor siamese cats, and the third case was a siamese cross . They are known to be predisposed to many diseases, including cardiovascular, dermatologic, endocrine, gastrointestinal, hematologic, infectious and musculoskeletal conditions, such as congenital myasthenia gravis, mucopolysaccharidosis vi or hip dysplasia . However, this hypothesis needs to be confirmed with additional cases and with tendon histopathologic analysis to find a more specific cause to the digital flexor contracture . This pathology is a flexor tendon entrapment of the digits that is characterized by locking of the fingers, with or without pain . The flexor entrapment is due to hypertrophy, narrowing and relative stenosis of the palmar retinacular sheath (most often the transverse ligament at the metacarpophalangeal joint), which progressively restricts the motion of the flexor tendon . The precise etiology is not well understood and repetitive finger movements or local trauma leading to a progressive loss of fingers extension is currently the most plausible hypothesis . Different treatments, such as medical treatment, joint immobilization, or corticosteroid injections, have been tried to manage the disease but surgical treatment is indicated when conservative management fails to resolve the pain and clinical signs . The surgical treatment consists of resection of the metacarpophalangeal transverse ligament, with or without resection of the superficial flexor tendon, and is highly effective with low associated complication and recurrence rates . Digital flexor contracture can affect an isolated digit or all digits of a limb and is characterized by a chronic lameness and a painful permanent flexion of the affected digit . In contrast to medical management, tenectomy of the deep and superficial flexor tendons is associated with a good - to - excellent surgical outcome for this condition . Etiology of this contracture is unknown but trauma, whether related to an onychectomy or not, seems to predispose a cat to this condition . This pathology could therefore be considered as a long - term complication of onychectomy in some cases . However, further cases need to be reported to better understand the pathogenesis of this condition . Digit evaluation seems to be of paramount importance when investigating cases of chronic lameness in cats.
|
One of them, adiponectin, also known as acrp30, adipoq, gbp28, and apm1, was discovered by four independent research teams in 1995/1996, [25] as the most abundant product of the adipose tissue . The hormone is a 244-amino acid protein with 30 kda molecular weight that circulates in the serum in different multimeric forms . Actions of adiponectin are mediated by two types of receptors: adiponectin receptor 1 (adipor1) and 2 (adipor2). The receptors are highly related and share 67% sequence identity in mice, but they differ in their tissue distribution and the ability to bind various forms of adiponectin . Adipor1 shows high affinity for the globular form of adiponectin, whereas adipor2 is characterized by intermediate binding affinity for both globular and full - length adiponectin . The highest levels of adipor1 expression are observed in skeletal muscles, whereas adipor2 is most highly expressed in the liver [7, 8]. Due to the extensive distribution of adiponectin receptors in peripheral tissues and organs, adiponectin exerts pleiotropic effects on metabolism, including regulation of homeostasis by fatty acid oxidation, stimulation of glucose uptake and gluconeogenesis inhibition, which leads to intensified thermogenesis and weight loss . Consequently, adiponectin level correlates negatively with body fat and positively with insulin sensitivity . The existing evidence points to the presence of a common endocrine system comprising several hormones, including ghrelin, leptin, and orexin that controls metabolism and reproductive functions [1215]. Adiponectin mrna and protein were found in the ovaries of several species, including humans, rats, and cows [1619]. Adiponectin mrna and protein were also detected in the ovaries of prepubertal but not sexually mature gilts . The influence of the hormonal status of swine related to the stage of the oestrous cycle on adiponectin expression in corpora lutea, granulosa, and theca interna cells remains unknown . Studies indicating higher concentrations of adiponectin in female than in male blood suggest that ovarian steroids may regulate adiponectin secretion [20, 21]. Similar conclusions can be drawn from varied plasma levels of adiponectin during the oestrous cycle in pigs . Despite the above, the possible influence of adiponectin on the production of steroid hormones by porcine ovarian cells remains unexplored . Therefore, the aim of this study was to investigate the expression of the adiponectin gene by real - time pcr, to determine the concentrations of adiponectin protein in the porcine ovary (corpora lutea, granulosa and theca interna cells) and to compare gene and protein expression levels during different stages of the oestrous cycle in pigs . Additionally, we sought to determine the in vitro effect of adiponectin on the secretion of steroid hormones (progesterone, oestradiol, testosterone, and androstenedione) by ovarian luteal, granulosa, and theca interna cells of sexually mature swine . All experiments were carried out in observance of the ethical standards of the animal ethics committee at the university of warmia and mazury in olsztyn . The experimental material comprised mature gilts (large white and polish landrace) from a private breeding farm, aged 7 - 8 months and weighing 130140 kg . Twenty gilts were divided into four experimental groups as follows: days 2 - 3, 1012, 1416, and 1719 of the oestrous cycle . The day of the second oestrus was designated as day 0 of the oestrous cycle . The phase of the oestrous cycle was also determined based on ovarian morphology . Additionally, to fully confirm correctness of the evaluation of the oestrous cycle phase, the level of progesterone was determined . Dissected corpora lutea (cls) from different stages of the oestrous cycle (days 2 - 3-corpora haemorrhagica, 1012-mature cls, and 1416-regressing cls) were either immediately frozen in liquid nitrogen and stored at 80c until rna and protein analysis or, similarly to the ovaries from days 1719 of the cycle, placed in cold pbs buffer and transported to the laboratory where luteal, follicular granulosa, and theca interna cells were isolated . Granulosa and theca interna cells are precursor cells of large and small luteal cells, respectively . Dissected corpora lutea from ovaries on days 2 - 3, 1012, and 1416 were minced into small fragments and dispersed in f-12 medium containing bovine serum albumin fraction v (bsa; 1%) and antibiotics . Corpora lutea were enzymatically dissociated in 0.125% trypsin solution (46 times) at 37c, centrifuged (300 g, 10 min, 4c), and washed three times . Isolated luteal cells were filtered through nylon mesh (40 m in diameter) and resuspended in fresh f-12 medium . The cells were counted using a haemocytometer, and their viability (~90%) was determined by 0.4% trypan blue dye exclusion . Granulosa and theca interna cells were isolated from large follicles (diameter> 6 mm) without signs of atresia . Granulosa cells were aspirated with a syringe and additionally washed out with a strong stream of media directed to the internal wall of the follicle . The theca interna layer was scraped off from granulosa cells and enzymatically dispersed in 0.25% trypsin solution . Dispersed cells were centrifuged (800 g for 10 min) and washed two and three times to isolate granulosa and theca interna cells, respectively . The cells were filtered through nylon mesh (40 m in diameter) and resuspended in eagle's medium enriched with bsa (5%) and antibiotics . The cells were counted using a haemocytometer, and their viability (~98%) was determined by 0.4% trypan blue dye exclusion . Some of granulosa and theca interna cells (5 10 viable cells within each experiment) were immediately resuspended in trizol reagent (invitrogen, usa) and stored at 80c until processing for rna analysis . Total rna was extracted from luteal tissues from days 2 - 3, 1012, and 1416 of the oestrous cycle using the absolutely rna miniprep kit (stratagene, usa). In the case of granulosa and theca cells approximately 1 g of rna was reverse - transcribed into cdna in a total volume of 20 l with 0.5 g oligo (dt)15 primer (roche, germany) using the omniscript rt kit (qiagen, usa) at 37c for one hour and was terminated by incubation at 93c for 5 min . Quantitative real - time pcr analysis was performed using a pcr system 7300 (applied biosystems, usa). Sense and antisense primers (adiponectin, cyclophilin a) were chosen according to lord et al . The chosen primers were as follows: adiponectin forward: 5atgatgtcaccactggcaaattc-3, reverse: 5-gaccgtgacgtggaaggaga-3; cyclophilin a, forward: 5-gcactggtggcaagtccat-3, reverse: 5-aggacccgtatgcttcagga-3; gapdh forward: 5-ccttcattgacctccactacatggt-3, reverse: 5-ccacaacatacgtagcaccagcatc-3. Adiponectin primers (access no: ay135647) were complementary to positions 514536 (f) and 565584 (r) of pig adiponectin gene sequence; cyclophilin a primers (access no: ay266299) were complementary to positions 219237 (f) and 269299 (r) of pig cyclophilin a gene sequence, gapdh primers (access no: u48832) were complementary to positions 6185 (f) and 219243 (r) of pig gapdh . A constitutively expressed genes, cyclophilin a and gapdh, were used as the internal control to verify the quantitative real - time pcr . To ensure that cyclophilin a and gapdh were the suitable reference genes for this study, we revealed that there were no statistically significant differences in ct values between the examined ovarian structures throughout all investigated stages of the oestrous cycle . Both of the housekeeping genes were also indicated as suitable reference genes (internal controls) in the independent studies . The pcr reaction included 20 ng cdna, 900 nm (adiponectin forward), 300 nm (adiponectin reverse, cyclophilin a forward and reverse) and 60 nm (gapdh forward and reverse) primers, 12.5 l sybr green pcr master mix (applied biosystems, usa), and rnase free water in a final volume of 25 l . Quantitative real - time pcr cycling conditions were as follows: initial denaturation and enzyme activation at 95c for 10 min, followed by 40 cycles of denaturation at 95c for 15 s and annealing at 59 for 1 min . Negative controls were performed in which water was substituted for cdna, or reverse transcription was not performed prior to pcr . The specificity of amplification was tested at the end of the pcr by melting - curve analysis . Calculation of relative expression levels of adiponectin was conducted based on the comparative cycle threshold method (ct) and normalized using the geometrical mean of reference genes expression levels: gapdh and cyclophilin a. western blotting analysis was performed as described by smolinska et al . . Briefly, equal amounts of porcine corpora lutea as well as granulosa and theca cells lysats (10 g) were resolved by sds - page on 12.5% polyacrylamide gel and then transferred to a nitrocellulose membranes (whatman, usa). Blots were blocked for 5 h at 4c in 1 tbst containing 5% skimmed milk powder and then incubated overnight at 4c with the rabbit polyclonal adiponectin antibodies at the dilution of 1: 150 (santa cruz biotechnology, usa) or rabbit polyclonal actin antibodies (sigma, usa) diluted 1: 200, which were used as an internal control for equal loading and to quantify porcine adiponectin protein . To identify immunoreactive bands, membranes were incubated for 1.5 h at room temperature with mouse anti - rabbit igg for adiponectin (sigma, usa; diluted 1: 2000), goat anti - rabbit igg for actin (diluted 1: 5000) conjugated with alkaline phosphatase (santa cruz biotechnology, usa). Nonspecific foetal calf serum (mp biomedicals, usa) was used instead of primary antibodies to produce negative control blots . The immunocomplexes were visualized using 4-nitroblue tetrazolium chloride (nbt) and 5-bromo-4-chloro-3-indolyl phosphate (bcip), according to the manufacture's protocol (promega, usa). The results of western blotting were quantified by densitometric scanning of immunoblots with gelscan for windows ver . 1.45 software (kucharczyk, poland). Data were expressed as a ratio of adiponectin protein relative to actin protein in arbitrary optical density units . Luteal cells (250000/1 ml medium) were resuspended in f-12 medium enriched with foetal calf serum (fcs; 20%), bsa (1%) and antibiotics and preincubated for 48 hours in a humidified incubator with 95% air and 5% co2 atmosphere . The serum - containing medium was discarded, and the cells were washed using serum - free f-12 medium . After washing, luteal cells were cultured for 24 hours in f-12 medium with bsa (1%) and antibiotics, with or without treatment agents . Granulosa and theca interna cells (250000/1 ml medium) were resuspended in eagle's medium supplemented with 10% fcs, 5% bsa, and antibiotics . After 24 hours of preincubation, the medium was discarded, and the cells were washed and cultured for 24 hours in eagle's medium with 5% bsa and antibiotics, with or without treatment reagents . The cultured cells were treated with 1 or 10 g / ml of recombinant human adiponectin (biovendor, usa) alone or in combination with insulin (granulosa and theca interna cells; 10 ng / ml; sigma, usa), fsh (granulosa cells; 10 ng / ml; nhpp, usa) and lh (theca interna cells; 10 ng / ml; nhpp, usa), and combination of those treatments (insulin + fsh for granulosa cells and insulin + lh for theca interna cells). Adiponectin doses used in the experiment were close to physiological concentrations of this hormone in the porcine blood . Those cells are thought to be generally more autonomic than follicular cells which is a reason of luteal cells' hard response to stimulators [3133]. The alamar blue test revealed that none of the treatments affected the viability of the cultured cells . Following incubation, the media were harvested, centrifuged (800 g for 10 min), and the supernatants were collected and stored at 20c until analyses of progesterone (cultures of luteal, theca interna, and granulosa cells), oestradiol (cultures of theca interna and granulosa cells), androstenedione, and testosterone (cultures of theca interna cells). Progesterone (p4) was analysed according to the method described by ciereszko et al ., oestradiol (e2) was determined according to the method of hotchkiss et al . Modified by kotwica, androstenedione (a4) as described by dziadkowiec et al ., and testosterone (t) according to kotwica and williams . The specificity of the antibodies against a4, t, and e2 has been reported by ciereszko et al . And szafranska et al . . The sensitivities of the assays for p4 and a4 were 1 pg / ml and for e2 and t were 0.5 pg / ml . Intra- and interassay coefficients of variation of the p4, e2, a4, and t assays were 0.91%, 0.7%, 0.81%, 0.97% and 8.5%, 10.1%, 14.2%, and 7.8%, respectively . Data from real - time analysis and western blot were analysed by one - way anova and least significant difference (lsd) post hoc test and are reported as the means sem from five independent observations . All data concerning in vitro cell cultures were analysed by anova for repeated measurements and least significant difference (lsd) post hoc test and are reported as the means sem from five (for all types of cells) independent observations . Each experiment was performed on different day using separate pool of luteal or follicular cells . The expression of adiponectin mrna was significantly higher in corpora lutea during all investigated days of the luteal phase than in theca interna cells isolated on days 1719 of the cycle (p <0.05). No significant differences were noted in adiponectin gene expression in granulosa cells compared with theca interna cells and cls (figure 1(a)). In general, adiponectin protein concentration in the porcine ovary was higher in the luteal phase than in the follicular phase . In particular, the adiponectin protein content was the greatest in cls from days 2 - 3 in comparison with cls and follicular cells from the remaining stages of the oestrous cycle (p <0.01). Within the luteal phase adiponectin concentration was the lowest in cls during days 1012 (p <0.01). There was no significant differences in protein expression between granulosa and theca interna cells (figure 1(b)). Treatment of luteal cells from days 1012 of the oestrous cycle with adiponectin at both doses (1 g / ml; 10 g / ml) resulted in significant (p <0.05) decrease in progesterone secretion (figure 2). Adiponectin at any dose did not affect p4 secretion by luteal cells collected on days 2 - 3 and 1416 (data not shown). Adiponectin at the higher dose (10 g / ml) in combination with insulin provoked the increase in p4 secretion in comparison with the cells stimulated by insulin alone (p <0.05). In contrast, there was no effect of adiponectin (both doses) on fsh- and fsh + insulin - induced production of p4 in porcine granulosa cells (figure 3). Basal secretion of p4 was unaffected independently on adiponectin dose (data not shown). Adiponectin at the higher dose (10 g / ml) increased basal secretion of e2 (p <0.05) (figure 4). Adiponectin did not change secretion of e2 by granulosa cells cultured with insulin and/or fsh (data not shown). Adiponectin at both doses reduced basal secretion of t by porcine theca interna cells (p <0.05) (figure 5). The effect of adiponectin on basal p4, e2, and a4 release was negligible (data not shown). Adiponectin (10 g / ml) decreased lh + insulin - stimulated secretion of p4 by theca interna cells (p <0.05). There was no effect of adiponectin on lh- or insulin - induced production of p4 by these cells (figure 6(a)). Adiponectin did not influence lh- or insulin - stimulated secretion of e2 by theca interna cells . However, lh + insulin - induced secretion of e2 by the cells was increased in response to the higher dose (10 g / ml) of adiponectin (p <0.05) (figure 6(b)). Secretion of a4 by theca interna cells was inhibited by combination of adiponectin (10 g / ml) with insulin compared to insulin alone (p <0.05). Adiponectin at the lower dose (1 g / ml) increased lh + insulin - induced a4 secretion by the cells (p <0.05) (figure 6(c)). Induced secretion of t was not changed under adiponectin influence (data not shown). This is the first ever study to demonstrate the changes in adiponectin gene and protein expression in the porcine ovary throughout the oestrous cycle . Our results indicate that adiponectin is more highly expressed in luteal cells derived from ovaries in all examined stages of the luteal phase than in follicular granulosa and theca interna cells . Adiponectin was also found to affect basal and stimulated secretion of steroid hormones by porcine ovarian cells . In addition to porcine ovarian structures, adiponectin gene expression and the presence of the hormone protein were also found in woman theca interna cells and in theca interna cells, granulosa cells, corpora lutea, and oocytes of rats and cows [18, 19]. Singh and krishna localized the adiponectin protein in bat ovarian structures that showed positive immunostaining in theca interna cells, oocytes of growing follicles, and the corpus luteum . The expression of adiponectin gene and protein was also determined in porcine granulosa cells of prepubertal gilts . The levels of adiponectin expression and also its receptors seem to vary subject to cell type and the stage of follicle and corpora lutea development . In the bovine ovary, the expression of adiponectin and its both receptors was lower in granulosa cells than in theca interna cells and oocytes . Contrary results were presented by ortega et al . Who observed the highest levels of adiponectin expression in granulosa cells of sheep ovaries . Throughout follicular development, adiponectin mrna increased in granulosa cells and decreased in theca interna cells of cows . In the corpora lutea, bovine theca interna cells derived from large follicles revealed higher expression of both receptors than cells isolated from medium - sized and small follicles, indicating that follicular growth influences the transcript levels of adiponectin receptors . The synthesis of ovarian adiponectin and the expression of adipor1 and adipor2 are probably hormonally controlled, as suggested by an increase in adiponectin concentrations in ovarian follicular fluid of women administrated lh in the in vitro fertilization procedure . Following pmsg pretreatment, an injection of hcg also significantly increased the expression of adiponectin and adipor1 (but not adipor2) genes in rat ovaries . In bovine theca interna cells, lh increased the concentrations of adipor2 mrnas, whereas igf - i suppressed the expression of the above gene . The results of the present study seem to confirm the hypothesis that adiponectin production is regulated hormonally . Higher levels of adiponectin gene and protein expression during the luteal phase and lower expression levels during the follicular phase could point to the stimulatory effect of progesterone and the inhibitory influence of oestradiol on ovarian adiponectin production . In our previous study, adiponectin serum concentrations were higher during the luteal phase than the follicular phase, which suggests that ovarian steroids influence plasma adiponectin levels . In this study the results of our in vitro studies and the presence of both adiponectin receptors in porcine ovaries indicate that adiponectin may directly affect ovarian steroidogenesis . In fact, progesterone secretion decreased due to adiponectin's influence on luteal cells in mid - luteal phase (days 1012). Greater variations in adiponectin action were observed in porcine follicular cells . Induced progesterone production increased in granulosa cells and decreased in theca interna cells . Basal testosterone output and insulin - induced androstenedione secretion were inhibited, while lh + insulin - stimulated release of androstenedione was enhanced by adiponectin . The effect of adiponectin on ovarian steroidogenesis was also suggested in studies of cows, rats, and humans . Adiponectin was found to inhibit insulin - induced secretion of progesterone and oestradiol by bovine granulosa cells . In a study of theca interna cells of bovine ovaries, lagaly et al . Observed that adiponectin decreased lh + insulin - induced production of progesterone . The above authors also noted that adiponectin inhibited the mrna expression of lh receptor in granulosa cells . Granulosa cells of rats and women treated with igf - i responded to adiponectin by increasing progesterone and oestradiol secretion [16, 17]. In the cited studies, adiponectin did not influence fsh - induced production of progesterone and oestradiol in human and rat granulosa cells which is consistent with the response of porcine cells noted in this study . It seems that adiponectin affects ovarian functions by binding adipor1 and adipor2, in two ways . An experiment where rnai was used to block adipor1 and adipor2 expression in the kgn cell line derived from human granulosa cells contributed to new information about adiponectin's role in the ovaries . The absence of adipor1 in the analysed cells enhanced apoptosis, whereas the elimination of adipor2 reduced fsh- and igf - i - induced the production of progesterone and oestradiol and inhibited mitogen - activated kinase activity, relative to control, in response to adiponectin or fsh treatment . The above results suggest that adipor1 is more involved in the survival of granulosa cells, whereas adipor2 regulates steroidogenesis through mapk activation . The influence of adiponectin on the ovaries of sexually mature pigs has not been studied to date, but the response of granulosa cells derived from prepubertal gilts to the analysed hormone was described by ledoux et al . . The above authors observed higher levels of cyclooxygenase-2, prostaglandin e synthase, and vegf gene expression in cells primed with adiponectin, an increase in the expression of the star gene and a decrease in the expression of the p450 aromatase gene . Adiponectin treatment contributed to an increase in progesterone levels and a decrease in androstenedione and oestradiol plasma concentrations in comparison with control bats . In the same study, adiponectin treatment increased p450scc and 3-hsd enzyme levels but decreased aromatase, star and lh - r levels in comparison with controls . An in vitro study by caminos et al . Demonstrated that adiponectin significantly inhibited basal and hcg - stimulated testosterone secretion by testicular explants . In another study, adiponectin decreased corticosterone secretion by freshly isolated rat adrenocortical cells but did not affect aldosterone production . Adiponectin treatment enhanced cortisol secretion, which was accompanied by increased expression of steroidogenic pathway genes, including star protein expression, via erk1/2 and ampk - dependent pathways . In addition to its direct effects on steroidogenesis in the ovary, adiponectin could also indirectly affect gonadal functions by controlling the secretory activity of the hypothalamus and pituitary . A study by wen et al . Demonstrated the inhibition of gnrh release from gt1 - 7 hypothalamic gnrh neurons after the administration of adiponectin . In in vivo study by cheng et al . Adiponectin also lowered gnrh secretion by activating the ampk and inhibiting the erk pathways . In the lower branch of the hpg axis, the release of lh from rat pituitary cells and the murine lt2 cell line was decreased after the administration of adiponectin alone and in combination with gnrh [53, 54]. In vivo observations also demonstrated an inhibitory effect of adiponectin on lh secretion: the intravenous administration of the adenovirus expressing the adiponectin gene to male mice decreased plasma lh levels without changes in fsh levels . The inhibitory influence of adiponectin on lh secretion could be attributed to a decrease in gnrh receptor gene expression in the pituitary . The presence of adiponectin mrna and protein in porcine ovaries observed in this study as well as the presence of adiponectin receptors 1 and 2 in the gonads noted in our previous work could provide evidence for auto / paracrine actions of the analysed hormone . The variations in adiponectin gene and protein expression during the oestrous cycle indicate that adiponectin expression is determined by the hormonal status of pigs . The effect of adiponectin on ovarian steroidogenesis suggests that this adipokine influences reproductive functions in pigs . Yet for definitive conclusions to be drawn, especially concerning precise localization of adiponectin mrna and protein in different ovarian structures, intracellular mechanisms of adiponectin influence on the gonadal steroidogenesis and its possible effect on other functions of the ovaries, further studies are required to determine the role of adiponectin in ovarian physiology.
|
Molecular and morphological evidence together support the idea that the anterior end of the amphioxus nerve cord contains regions homologous with vertebrate forebrain and hindbrain 1,2, though it is generally the ventral portion of these regions that are best represented 3 . Its most probable position, as defined by gene expression patterns, would be from somewhere forward of the caudal limit of otx expression, which in vertebrates extends through the midbrain, to a point close to the beginning of the zone of hox gene expression . In young amphioxus larvae, this corresponds with a region extending from the infundibular cells, which lie at a level roughly midway along somite 1, through the posterior part of the cerebral vesicle to a level somewhere near or just beyond the middle of somite 2 (fig . This domain begins with an anterior zone of ventral neuropile and commissural fibers followed, near the junction between somites 1 and 2, by a complex of ventrally - positioned somatic motoneurons and interneurons with caudal projections that initiate and control larval swimming behavior 4 . The first members of the visceral motoneuron series lie further back, near the caudal end of somite 2 . From there, visceral motoneurons recur at regular intervals along the anterior nerve cord and innervate the body via an extended series of peripheral nerves . Any attempt to identify an amphioxus homolog of the vertebrate midbrain is hampered by the fact that we currently lack unambiguous criteria for recognizing its presence . The quintessential identifying feature in vertebrates is the dorsal optic tectum, but this is absent in amphioxus . In fact, except for a pineal homolog, amphioxus appears to lack all of the dorsal structures of the vertebrate brain . Further, because the amphioxus nerve cord is of uniform dimension along its length, there are no morphological constrictions to separate sub - domains in the anterior cord from one another in the way vertebrate isthmus separates midbrain from hindbrain . The isthmus is notable as the site of an important organizing center, the midbrain - hindbrain boundary (mhb), characterized in vertebrates by the expression of a highly conserved set of gene, including fgf8, engrailed, pax2, and wnt1 5,6 . The comparable site in amphioxus lies somewhere close to the caudal limit of somite 1, which is where the anterior zone of otx expression abuts that of gbx 7 . However, though engrailed is expressed in small clusters of cells in the embryonic nerve cord 8, these lie further forward in the cerebral vesicle, at a level near the midpoint of somite 1 . In addition, wnt1 is not expressed at all in the anterior cord, nor does the expression of the amphioxus pax2 homolog, amphipax2/5/8, match the vertebrate pattern . Instead, the latter is expressed caudally through much of the nerve cord 9, and though there is a small anterior zone of later expression, it is too far forward for an mhb marker . There is thus no clear molecular evidence for a focal center in amphioxus with the expression profile of an mhb . This is perhaps not surprising, considering that the structures organized by the mhb are primarily dorsal ones not present in amphioxus . The mhb is, however, also required for normal organization of some ventral brain regions in vertebrates 10 . Since the ventral midbrain of vertebrates very likely combines vertebrate - specific neuronal cell types along with cell groupings with more primitive organizational features, it would be useful to know whether all of these are mhb - dependent or only the former . It may well be that only vertebrate innovations, whether dorsal or ventral, are under the specific control of the mhb . This leaves open the question of whether the amphioxus pattern differs from that of vertebrates because it reflects an earlier stage in the evolution of a vertebrate - type mhb 7, or whether amphioxus has secondarily diverged from a pattern that was once closer to the vertebrate one . In addition, the vertebrate midbrain marker dmbx is not expressed in the amphioxus nerve cord 11 . The available molecular data thus argues against the presence, in amphioxus, of precise homologs of either the vertebrate midbrain or mhb . Among tunicates, the other group of protochordates, it is the ascidians that are best studied, and for these there is again good molecular evidence for homologs of both forebrain and hindbrain in the larval cns 11,12, corresponding roughly with the sensory vesicle and caudal ganglion respectively . In addition, cells in the narrow neck region that separates these structures express at least some characteristic mhb genes (fig . Data on pax2/5/8 led initially to the proposal that ascidians had an exact counterpart of the vertebrate mhb and that amphioxus, being a later offshoot of the chordate lineage, must have lost this feature secondarily 12 . However, the precise spatial arrangement of the expression zones for several key genes in ascidians differs from that in vertebrates, e.g. Fgf and dmbx in ascidian larvae are expressed in cells immediately caudal to those expressing pax2/5/8 and en, whereas in vertebrates, dmbx lies forward of the other three genes, whose expression overlaps . Expression patterns of the same genes in larvaceans, another group of tunicates, is somewhat different yet again 13, which further complicates the problem of determining the nature of the ancestral pattern . The molecular data is thus somewhat inconclusive regarding protochordate homologs of either the vertebrate midbrain or mhb . If anatomical and functional considerations are taken into consideration, however, a somewhat stronger case can be made that amphioxus may have an approximate counterpart of the midbrain . The key point is that some of the cell types and neural circuits located in the caudal part of the zone of otx expression are similar to those found in the ventral midbrain in vertebrates . In amphioxus, as pointed out above, only ventral markers are available for comparison . Of these, the infundibular cells probably mark the anterior limit of any prospective midbrain - like territory, as their homology with the ventral infundibular region of the vertebrate diencephalon seems to be fairly well accepted . Immediately behind this point, in amphioxus, there is a zone of ventral neuropile in some ways comparable with the ventral tegmental commissure, which forms part of the early axonal scaffolding in embryonic vertebrate brains . This same region in amphioxus also contains the anterior - most motoneurons in the nerve cord along with populations of large interneurons with descending projections, features found in the tegmentum and the reticulospinal plexus of lower vertebrates beginning at midbrain level . The ventral midbrain in vertebrates is also where dopaminergic neurons with projections to the forebrain first develop, and these are a key component of the motivational circuitry linking basal brainstem centers with the forebrain . Dopaminergic neurons are found in the cerebral vesicle in amphioxus and nowhere else in the nerve cord . Two main populations develop, one in a dorsal position in the anterior cerebral vesicle, the other more ventrally near the junction between somites 1 and 2 14,15 . Further research is needed on these cells to determine their precise pattern of projections and function, but the more caudal of the two populations is well positioned to be a homolog of the midbrain dopaminergic neurons in vertebrates . If the anatomical and functional criteria outlined above are meaningful indicators that amphioxus does indeed have a midbrain homolog, the value of the molecular markers used to date to test this would have to be reconsidered . The same could be said of ascidian larvae, but for a different reason, for here there is an alternative explanation for the expression patterns observed . The cns of adult ascidians consists of a simple brain - like dorsal ganglion, from which nerves radiate to the body musculature and visceral organs . The ganglion is present in only a rudimentary form in the larva, however, and the source of its cells has never been clear . In the few species where this has been investigated in the past, the ganglion develops in contact with the neck region of the larval nerve cord near the site where it contacts the neurohypophyseal duct . The latter is partly a stomodeal derivative, which raises the question of whether a significant part of the ganglion might be derived from stomodeal ectoderm . An analysis of the salp ganglion, compared with the data available on compound ascidians 16,17, supports the idea that most if not all of the dorsal ganglion is of neural origin and that, in ascidians, it develops as part of the neck region . Recent data on ciona 18 tends to support this interpretation, as its ganglion develops in contact with the base of an outgrowth that arises from the caudal part of the sensory vesicle very near the neck . More importantly, experimental work now in progress on ciona is confirming the neck region as the source of major classes of neurons within the adult ganglion, including motoneurons innervating the visceral organs [j.f . Brunet, personal communication]. Evidently then, the cells of the neck region in ascidian larvae serve as a pool of precursors from which most if not all post - metamorphic cns neurons are derived . Assuming the genes expressed in the vertebrate mhb include major players in the overall process of neuronal specification and differentiation, one can argue that their expression in the neck region is to be expected, irrespective of any homology between this site and the mhb . One would predict the genes would be expressed in combinatorial patterns and in a few cells at most, which is precisely what is observed . Current thinking on the nature of ancestral chordates favors the view that the separation of adult and larval tissues in ascidians is a secondary specialization, and that the ancestral body plan was a more fully integrated one, as in amphioxus 19,20 . This may explain why the expression patterns of some key developmental control genes differ so dramatically between ascidians and amphioxus . Consider pax2/5/8, which has an extended zone of expression in amphioxus, but a very restricted one in ascidians (cf . Figs . Paralleling these, there are differences in innervation patterns of, for example, the visceral organs . These are strictly adult structures in ascidians, and the cells responsible for their innervation arise from the neck region, whereas the hox - expressing part of the nerve cord, which innervates the tail, is entirely lost at metamorphosis . In amphioxus, in contrast, visceral motoneurons, along with the rest of the locomotory control system, arise from an extended region of the nerve cord extending well into the hox zone . Whether the zone supplying visceral innervation corresponds precisely with that expressing pax2/5/8 has yet to be determined . One can nevertheless predict that any gene essential to the development of the visceral innervation will necessarily be expressed over a much greater length of the nerve cord in amphioxus than in ascidians . For at least some of the genes associated with the mhb, therefore, the reason their homologs have a very restricted expression zone in ascidian larvae likely has less to do with the presence of a vertebrate - type mhb, and more with the functional necessity of generating a full complement of adult neurons from a single site within the nerve cord . What one then wants to know, to determine whether the ascidian pattern and the vertebrate one are more than coincidentally related, is what functional role the genes play in each instance . With regard to pax2/5/8 specifically, a further clue might come from knowing whether its expression in hemichordate embryos is restricted, as in ascidians, or extended, as in amphioxus . If the latter, this would be further evidence for the view that the ascidian pattern is indeed the derived one . From the above it is clear that there is a certain plasticity in the way expression patterns of genes identified with the mhb have diverged among chordates . In fact, the vertebrates seem to be most conservative: it is their pattern that most closely resembles that of hemichordates 19,20, the closest available model for an ancestral deuterostome, and there are remarkably similar patterns in protostomes, e.g. Drosophila . In hemichordates an mhb - like region can nevertheless be recognized, consisting of overlapping zones of en, pax2/5/8, fgf8 and wnt1 expression near the junction between the collar and trunk in a region where otx and gbx expression overlaps 21 . If, however, as argued above, the specific organizer functions of the vertebrate mhb evolved with vertebrates, why are hemichordate expression patterns so close to vertebrate ones? It could be, that despite the anatomical differences in their nervous systems, homology dictates the position along the body axis at which particular neural functions and cell types are localized . This might be due, for example, to their association with conserved structures like the mouth or the first gill slit . Too little is currently known of hemichordate neuroanatomy to speculate much further, though some essential aspect of ectodermal and/or neural patterning is presumably involved . A further problem is to discover why amphioxus and ascidians have altered their mhb - related expression patterns when they are elsewhere so well conserved . In the case of ascidians, there have evidently been major changes in the way key patterning genes, notably those of the hox cluster, are structured and regulated . This probably relates to the presence of alternative mechanisms for cell specification in ascidians, which has relaxed some constraints on genome organization 22 . It is otherwise somewhat surprising that such comparatively distant relatives as vertebrates and hemichordates are so similar in terms of their mhb - related expression patterns when the main protochordate groups are both so different from vertebrates and from each other . There is a second issue integral to any consideration of chordate cns origins that relates to how the main organ systems of the body, including the nervous system, are positioned in relation to the dorsoventral axis . Comparatively strong evidence now supports the idea that the body of chordates is dorsoventrally inverted relative to that of insects and the other main groups of protostomes . A full account of how this might have happened has been difficult to piece together, at least until now, because there was little relevant data on the basal offshoots of the lineage leading to chordates, namely hemichordates and echinoderms . Their anteroposterior maps are very similar to vertebrates 21 and, while the data on dorsoventral patterning is more ambiguous, it appears that hemichordates are oriented the same way as protostomes, such that the mouth is ventral and the expression domain for homologs of the dorsoventral patterning genes bmp2/4 and bmp7 is dorsal 20 . Removal of all influence of the latter in hemichordates results in a much expanded mouth, while over - expression suppresses the mouth and generates radialized embryos . In vertebrates, bmp expression and the mouth are both ventral, but suppressing bmps has equally dramatic radializing effects 23 . The genes thus appear to be performing essentially similar functions in these two groups, which implies that dorsal in basal deuterostomes has become ventral in vertebrates and, hence, in all chordates . Inversion must therefore have occurred between the separation of the clade comprising hemichordates plus echinoderms from chordates, possibly in an organism that did not yet have an internalized cns . The transition is somewhat easier to imagine, in fact, if the starting point is an animal with circumferential expression zones of all the key patterning genes (fig . It should then be equally easy to concentrate both the expression zones and the structures they pattern either to the dorsal surface or the ventral one (fig . Walter garstang's ideas about chordate origins are fairly typical of hypotheses that predate the renewed interest in dorsoventral inversion . He derived neural tube from the dorsal portion of an ancestral system of larval ciliary bands, in that way preserving the dorsoventral orientation of the ancestor (fig . If inversion did, in fact, occur, the brain and nerve cord would have had to come instead from the ventral surface of the ancestral body (fig . 2c), an alternative explored by claus nielsen in a 1999 analysis 24 . A major premise of garstang's hypothesis, that the whole of the neural tube should to arise as a single entity, is no longer widely accepted 19, but it is still useful to consider the consequence of dorsoventrally inverting his hypothetical ancestor . As nielsen points out, so long as the brain arises at the anterior end of an originally ventral neuraxis, it must necessarily form in the postoral region, most likely immediately caudal to the mouth . This may seem counterintuitive, but the zone of expression for mhb - type genes, which mark a core brain region in vertebrates, is also postoral in hemichordates . The ancestral chordate in this scenario, in its inverted position, would have both its mouth and brain on the dorsal surface of the body . While this may seem peculiar what is then needed to generate the body of more advanced chordates like amphioxus and vertebrates is for differential growth of the ectoderm separating the mouth and brain to move the former forward, over the front or side of the snout, to what is now the ventral surface . The site of the ancestral apical organ must move as well, and will eventually find itself behind the now - ventral mouth, roughly in the position of the adhesive gland, which is also exactly the path the polar bodies follow from the apical pole of the egg during amphibian development 24 . In consequence, the anterior most part of our brain cannot be homologous with the anterior - most parts of protostome brains, because the latter are in part derived from apical structures . This is despite the supposed homology between the anterior otx - expressing regions of protostome and deuterostome brains, because in embryos and larvae in both groups, otx can be expressed both pre- and post - orally 25,26 . In summary, though there is good reason to doubt that the chordate neural tube actually derives evolutionarily from larval ciliary bands 19, nielsen's point about the site of brain formation being post - oral, though counterintuitive, is largely consistent with current molecular data . In addition, the larvae of hemichordates and echinoderms have neurons at this location, and these form comparatively complex ganglion - like assemblages in some instances . The function of these simple neural centers is to innervate the larval oral region and pharynx, presumably to control basic feeding behaviors and digestion . If these did indeed serve in some way as the core of the evolving chordate brain, then the progressive incorporation of centers for locomotory control into the brain is yet another story, and one that would have unfolded quite independently of the evolutionary process by which a centralized brain and nerve cord arose in the protostome lineage . In this version of events, it is quite unlikely that the internalized neural tube of chordates can be explained by a simple inversion of a protostome - like ancestor with an already - internalized brain and nerve cord, as has sometimes been supposed . Dorsal views of the larval nerve cords of (a) amphioxus and (b) ciona, a representative ascidian, showing expression domains for the main cns patterning genes . This is somewhat simplified, as the exact extent of the expression domains can vary with developmental stage, and the ascidian hox genes, in particular, are expressed in non - overlapping domains with some gaps . Two alternatives for explaining the origin of a dorsally positioned brain in chordates, using the hemichordate embryo (a) as a starting point; indicates the mouth (m), anus (a), apical plate (orange), and the ancestral dorsal (a - dorsal) and ventral (a - ventral) surfaces; the light blue rectangle is the expression hot zone (hz) in which homologs of genes characteristic of the vertebrate mhb are expressed, typically in circumferential bands within ectoderm of the collar and anterior trunk . Older explanations of chordate origins, e.g. Garstang's hypothesis, retain an ancestral dorsoventral orientation (as in b). This allows the dorsal condensation of tissue that became the brain (dark blue) to form within the hot zone of mhb - like expression, co - opting the latter for neural patterning functions . With inversion (c, left side), the ancestral ventral surface becomes dorsal . In contrast with b, any brain - like condensation that forms on the new dorsal surface would necessarily then be post - oral in position, but it could still incorporate the mhb - like hot zone . Then, to generate the vertebrate condition (c, right side), with mouth and brain on opposing sides of the body, one needs to move the mouth over the front or side of the snout by differential growth of an expansion zone (ez) located somewhere forward of the brain.
|
A seventy five year old libyan man was seen in the urology department of tripoli medical centre, tripoli, libya with six month history of left loin pain . The patient noted a mass in the left loin two days before he was assessed in the hospital . The urine analysis revealed pus cells, protein, and no sugar, but urine culture yielded no bacterial growth . Liver function tests showed slightly elevated alkaline phosphatase at 160 iu / l (44 to 147 iu / l), and lactate dehydrogenase at 152 iu / l (105 - 333 full blood count revealed haemoglobin of 8.3g%, (1315g%), white cell count of 14.7103/mm3 (411103/ mm3), and platelets of 3.4 105/ mm3 (1.54.5 105/ mm3). The patient's vomiting subsided with proton pump inhibitors, but the loin pain showed partial response to analgesic . Abdominal ct - scan showed an irregular mass in the upper pole of left kidney . The patient was posted for partial nephrectomy with the provisional diagnosis of renal tuberculosis or renal infarction involving upper pole . Pathologically, the kidney was noted to have greyish white soft tissue mass, firm in consistency measuring 6x4x2 cms, with adjacent dilated calyces . The renal resection margin and external surface appeared free of tumour (figure 2). Microscopically, the tumour consisted of pleomorphic squamoid cells arranged in nests and sheets with few foci of epithelial pearl formation and keratinisation . Areas of necrosis and frequent mitosis were noted . The malignant cells nore were seen to infiltrate the adjacent renal parenchyma as nests of cells and also focally renal capsule (figures 3 & 4). The dilated calysis showed areas of squamous metaplasia and severe dysplasia with focal invasion of basement membrane into renal parenchyma to form the tumour (figure 5). Photomicrograph revealing calyseal subepithelial invasion of malignant cells (left) and invasion of renal parenchyma adjacent to glomerulus with epithelial pearl formation (right). Postoperative chest x - ray (pre - operative chest x - ray was normal) revealed massive pleural effusion in the left lower lobe (figure 6). However, no histological typing is available as tissue showed only necrotic material with scanty malignant cells . He was put on cisplatin and sunitinib on the suspicion of primary lung tumour and showed no response . The patient was suspected clinically to have renal tuberculosis and was later found to have renal squamous cell carcinoma with possible lung secondaries . The common renal malignancy in adults is of clear cell type, followed by papillary carcinoma and chromophobe cell carcinoma [1, 2]. Primary neoplasms of the renal collecting system are rare, accounting for less than 5% of urothelial tumours in urinary system [4, 5]. The transitional cell type is the most frequent (85%95%), followed by squamous cell carcinoma (6%15%) and adenocarcinoma (7%). Usually, renal squamous carcinoma is highly aggressive and of a high grade at presentation . Haematuria, the classical presenting complaint of renal cell carcinoma, is not common in this entity as in this case . The incidence of co - existing stone was reported in a wide range of 18% to 100% . The present case demonstrates the transition from calyseal urothelium to squamous metaplasia, dysplasia and invasive squamous malignancy . There is a well known association between chronic pyelonephritis, renal pelvic stones, phanecetin ingestion and radiotherapy with squamous cell carcinoma . The case was clinically suspected as renal tuberculosis because of sterile pyuria and past history of cough with fever . The renal malignancy was not considered due to loin pain and absence of haematuria as the renal cell carcinoma classically presents as painless haematuria . The tumour can be difficult to diagnose by imaging modalities as the usual features are the presence of calculi and hydronephrotic changes with ureteral obstruction . Filling defects or obstructive lesions in the renal pelvis by intravenous / retrograde urography or detection of a solid mass by ultrasonography can be the signs of the tumour . Central renal squamous cell carcinoma presents more with intraluminal components and is usually associated with lymph node metastasis whereas peripheral renal squamous cell carcinoma presents with prominent renal parenchymal thickening and might invade the perirenal fat tissue before lymph node or distant metastasis could be identified . The survival of patients with central renal squamous cell carcinoma was reported to be significantly shorter than those with peripheral renal squamous cell carcinoma . Nativ and colleagues reported that patients with locally invasive renal squamous cell carcinomas had 1 and 2 yearsurvival rates of 33% and 22%, respectively . If metastasis develops, adjuvant chemotherapy or irradiation has little effect on the unfavourable prognosis . Our patient underwent partial nephrectomy because of suspicion of renal tuberculosis and was later found have pulmonary metastasis . In conclusion, this patient presented with lion pain and a mass without haematuria and was found to have renal squamous cell carcinoma with lung metastasis . As renal calyseal tumours could present with atypical features, a proper preoperative workup may help in better management though outcome is short lived.
|
Medicinal plants have been used for centuries in traditional medicine because of their therapeutic value . Mentha piperita, (family lamiaceae) is a species found in iran and many parts of the world which has an economical value for its flavoring, odor, and therapeutic properties in foods and cosmetic industrial products . In addition, the leaves and flowers of m. piperita have medicinal properties [2, 3]. Essential oils are valuable natural products used as raw materials in many fields including perfumes, cosmetics, aromatherapy, phototherapy, spices, and nutrition . Peppermint (m. piperita) oil is one of the most popular and widely used essential oils, mostly because of its main components, menthol, and menthone . Previous studies have shown antiviral, antibacterial [6, 7], antifungal [6, 810], antibiofilm formation [1113], radioprotective, antioedema, analgesic, and antioxidant activities of the eo and methanolic extracts of herbal parts and callus cultures of m. piperita . In addition, m. piperita eo has been shown to cause inhibitory effects against radial fungal growth and aflatoxin production by aspergillus species . In the past two decades, azole - resistant candida and aspergillus species are the top pathogens responsible for nosocomial or food - borne infections [18, 19]. In addition, the formation of biofilms by candida species have raised concerns due to their increased resistance to antifungal therapy and protects the microbial cells within biofilms from the host immune defenses [2023]. An alternative approach to overcome antibiotic resistance might be using natural products and phytochemicals . It has also been shown that some plant extracts efficiently inhibit the biofilm formation of c. albicans . Moreover, eos especially with known antibacterial effects have the potential to be used in food industry as preservatives and to increase the shelf life of products . Therefore, determining the antimicrobial properties of eos might help to overcome microorganism resistance to antibiotics and prevent food spoilage . The chemical composition of aromatic plants depends largely on the individual genetic variability and different plant parts [2527]. The presence and concentration of certain chemical constituents of eos also fluctuate according to the season, climatic condition, and site of plant growth [25, 26]. The goal of this study was to investigate the chemical composition and in vitro antifungal and antibiofilm activities of essential oils of the leaves of m. piperita collected in the region of fars from iran . At full flowering stage, the aerial parts of the m. piperita were hydrodistillated for 2.5 h, using an all - glass clevenger - type apparatus, according to the method outlined by the british pharmacopoeia . The sample oils were dried over anhydrous sodium sulfate and stored in sealed vials at 4c before gas chromatography and gas chromatography - mass spectrometry (gc - ms) analysis . The analysis was carried out on a thermoquest - finnigan trace gc - ms instrument equipped with a db-5 fused silica column (60 m 0.25 mm i.d ., film thickness 0.25 mm). The oven temperature was programmed to increase from 60c to 250c at a rate of 4c / min and finally held for 10 min; transfer line temperature was 250c . Helium was used as the carrier gas at a flow rate of 1.1 ml / min with a split ratio equal to 1/50 . The quadrupole mass spectrometer was scanned over the 35465 amu with an ionizing voltage of 70 ev and an ionization current of 150 ma . Gc - flame ionization detector (fid) analysis of the oil was conducted using a thermoquest - finnigan instrument equipped with a db-5 fused silica column (60 m 0.25 mm i.d ., nitrogen was used as the carrier gas at the constant flow of 1.1 ml / min; the split ratio was the same as that for gc - ms . The oven temperature was raised from 60c to 250c at a rate of 4c / min and held for 10 min . The injector and detector (fid) temperatures were kept at 250c and 280c, respectively . Retention indexes (ris) were calculated by using retention times of n - alkanes (c6c24) that were injected after the oil at the same temperature and conditions . The compounds were identified by comparing their ri with those reported in the literature, and their mass spectrum was compared with those reported in wiley library . The antifungal activities of the eo against 25 standard strains of fungi, including c. albicans (atcc 5982, 1912, 562, 1905, 1949, 10261, and 2730), c. tropicalis (atcc 750), c. krusei (atcc 6258), c. glabrata (atcc 863, 2192, 2175, 6144, and 90030), c. dubliniensis (cbs 8501, atcc 8500, 7987, and 7988), c. parapsilosis (atcc 4344), c. neoformance (atcc 9011), aspergillus flavus (atcc 64025), a. fumigatus (atcc 14110, cbs 144.89), a. clavatus (cbs 514.65), and a. oryzae (cbs 818.72) were determined . In addition, the antifungal activities of the eo against 35 clinical isolates of yeasts identified by polymerase chain reaction - restriction fragment length polymorphism (pcr - rflp) were also examined [29, 30]. The antifungal susceptibility of clinical isolates of the tested fungi against fluconazole was examined by microdilution and disk diffusion methods [31, 32]. Minimal inhibitory concentrations of the eo against standard and clinical species of the fungi were determined by the broth microdilution method as recommended by the clinical and laboratory standards institute (clsi), with some modifications [31, 32]. Briefly, the rpmi-1640 (with l - glutamine and phenol red, without bicarbonate) (sigma, usa) was prepared and buffered at ph 7.0 with 0.165 mol 3-(n - morpholino)propane sulfonic acid (mops) (sigma - aldrich, steinheim, germany). Serial dilutions of the eo (0.06 to 16 l / ml) were prepared in 96-well microtiter trays using rpmi-1640 media (sigma, st . Double dilutions of fluconazole were also prepared for each of the tested fungi with the final concentration of 0.25 to 128 g / ml . Stock inoculums were prepared by suspending three colonies of the examined yeast in 5 ml sterile 0.85% nacl and adjusting the turbidity of the inoculums to 0.5 mcfarland standard at 630 nm wavelength (this yields stock suspension of 15 10 cells / ml). For moulds (aspergillus spp . ), conidia were recovered from the 7-day - old cultures grown on potato dextrose agar by a wetting loop with tween 20 . The collected conidia were transferred in sterile saline and their turbidity was adjusted to optical density of 0.09 to 0.11 that yields 0.45 10 conidia / ml . Working suspension was prepared by making a 1/50 and 1/1000 dilution with rpmi of the stock suspension for moulds and yeasts, respectively . After the addition of 0.1 ml of the inoculums to the wells, the trays were incubated at 30c for 2448 h in a humid atmosphere . 200 l of the uninoculated medium was included as a sterility control (blank). In addition, growth controls (medium with inoculums and 5% (v / v) without the eo or fluconazole) were also included . Mics were visually determined and defined as the lowest concentration of the eo that produced no visible growth . In addition, minimum fungicidal concentrations (mfcs) of all the examined agents were also determined by culturing 10 l from the wells showing no visible growth onto sda plates . Mfcs were of the lowest concentration that showed either no growth or fewer than 4 colonies, which corresponded to 98% killing activity of the initial inoculums . Mfcs were determined as the lowest concentration yielding no more than 4 colonies, which corresponds to a mortality of 98% of the fungi in the initial inoculums . According to behnam et al ., c. albicans and c. dubliniensis strains were maintained on sabouraud dextrose agar (difco) plates . After 48 hrs one loop of the colonies was transferred to 20 ml sabouraud broth in 250 ml erlenmeyer flasks and incubated overnight in an orbital shaker (100 rpm) at 30c under aerobic condition . Yeast cells were harvested and washed twice in sterile phosphate - buffered saline (pbs) (0.8% [w / v], nacl (merck); 0.02% [w / v], kh2po4 (merck); 0.31% [w / v], na2hpo4 + 12h2o (merck); 0.02% [w / v], kcl (panreac); ph 7.4). Then, they were resuspended in rpmi 1640 supplemented with l - glutamine (gibco) and buffered with morpholinopropanesulfonic acid (mops) and the cell densities were adjusted to 1.0 10 cells / ml after counting with a hemocytometer . Serial dilution of the eos (0.0158 l / ml) in rpmi 1640 was prepared in a presterilized, polystyrene, flat - bottom, 96-well microtiter plates (nunc). After the addition of 0.1 ml of the yeast inoculums to the wells, 200 l of the uninoculated medium was included as a negative control (blank). In addition, rpmi with yeasts but without the eos served as positive controls . A semiquantitative measure of biofilm formation was assayed using a 2, 3-bis(2-methoxy-4-nitro-5-sulfo - phenyl)-2h - tetrazolium-5-carbox - anilide (xtt) reduction assay . Xtt (sigma chemical co.) was prepared as a saturated solution at a concentration of 0.5 mg / ml in ringer's lactate . This solution was filter - sterilized through a 0.22 m - pore - size filter, divided into aliquots and then stored at 70c . Prior to each assay, an aliquot of the xtt stock solution was thawed and treated with menadione sodium bisulfite (10 mm prepared in distilled water; sigma chemical co.) to obtain a final concentration of 1 m of menadione . A 100 l aliquot of xtt menadione was then added to each prewashed wells . The plates were then incubated in dark for 2 hours at 37c, and the colorimetric change at 490 nm (a reflection of the metabolic activity of the biofilm) was measured with a microtiter plate reader (titertekplus - ms2 reader, uk). The qualitative and quantitative compositions of the eo of m. piperita are presented in table 1 . Gc / ms analyses showed that the main constituent of the eo was menthol (53.28%) followed by menthyl acetate (15.1%) and menthofuran (11.18%). The antifungal activities of m. piperita eo against the tested yeasts are shown in table 2 . The eo inhibited the growth of all of the tested yeasts at concentrations of 0.124 l / ml . Furthermore, the eo exhibited fungicidal activity (mfc) for all of the above - mentioned yeasts at concentrations ranging from 1 to 8 l / ml . No significant differences in inhibitory concentrations were found between azole - resistant and -susceptible strains . In addition, the eo inhibited the growth and killed the standard strain of cryptococcus neoformance at the concentration of 4 l / ml . All of the aspergillus standard strains were susceptible to m. piperita eo at concentrations of 0.54 l / ml (table 3). As shown in table 4, the eo completely inhibited the biofilm formation of c. albicans and c. dubliniensis at concentrations of 1 l / ml and 2 l / ml, respectively . The compositions of the eos might be affected by the developmental stages of the plant . Although some authors reported alpha terpinen as the dominant component of m. piperita eo (19.7%), similar to the previous studies [4, 7, 33], we identified menthol as one of the main constituents of the eos . The higher concentration of menthol in this study as compared to some of those of previous reports [4, 34] may reflect variations due to geographical location from which the plants were collected . In this study, the eos exhibited fungistatic and fungicidal activities against both of the standard and clinical strains of candida species at concentrations ranging from 0.5 l / ml to 8 l / ml, which can be best compared to the previous investigations [6, 8, 9, 33]. One of the encapsulated yeasts, c. neoformance, is a well - known primarily opportunistic pathogen which produces chronic and life - threatening meningitis . According to the findings of this study, the examined oils killed the standard strain of c. neoformance at concentration of 4 l / ml . Similar to the previous studies [10, 17] the eo of m. piperita exhibited a strong anti - aspergillus activity with mic values ranging from 0.5 to 4 l / ml . Mfcs of the eo against the tested fungi were almost similar or two times greater than those of their corresponding mics . Since the eos exhibited similar antifungal effect against the tested azole - resistant and azole - susceptible strains, it could be assumed that the mechanism of the action of the eos is different with those of the above - mentioned antifungal drug . One of the main characteristics of eos is their hydrophobicity, which enables their incorporation into the cell membrane . It has been shown that this phenolic monoterpene has a hydroxyl group around the phenolic ring and exhibits its antimicrobial activity through the disruption of the cytoplasmic membrane [35, 36]. Biofilm formation by candida species is a phenomenon which helps the survival, pathogenesis, and drug resistance . The most commonly candida species associated with biofilm formation is c. albicans . In the present study, the formation of biofilm was inhibited completely at a concentration of up to 2 l / ml in a dose - dependent manner, which was comparable to the study of agarwal et al . . As the industries tend to reduce the use of chemical preservatives in their products, eo of m. piperita with potential active antimicrobial properties might be considered as a natural source for the maintenance or extension of the shelf life of products . In addition, delectable taste of the eo at the concentrations needed for antimicrobial properties was a bonus to its antimicrobial effects . On the other hand, these eos might also be considered for developing products for controlling fungal infections . As these tests have all been done in vitro, the next step may be further investigations in animal models to see if infection can be inhibited by the eo.
|
Falls of the elderly always lead to serious health issues as the decline of their physical fitness . Fracture is the most common injury in fall of an elderly and there is also a certain possibility to get coma, brain trauma, and paralysis . At most fall situations, the fall process is the main source of injury because of the high impact . But sometimes the late medical salvage may worsen the situation . That means the faster the salvage comes, the less risk the elderly will face . Mems (microelectro mechanical systems) sensors have simplified the design and implementation of sensor system . Location based service (lbs) makes it more convenient to locate the elderly in health monitoring . Beside these cameras are distributed at limited space to offer pictures or videos of human activities to implement fall detection algorithm . External supports such as motion sensors could be used to enhance computer vision based fall detection method, and a data fusion algorithm can operate the validation and correlation among the two subsystems to raise robust performance of fall detection . These computer based methods work effectively in indoor environment, but they are hard to realize in outdoor environment as the deployment of cameras is always limited . There are several kinds of detection methods which differ in constitution of motion sensors and detection algorithms . A single triaxial accelerometer can provide object's accelerations in three directions which include the influence of gravity . The influence of gravity or dynamic acceleration is available by using a low pass filter or a high pass filter . Some kinds of angular movement information can also be calculated based on the relationship between acceleration components and their vector sum . A triaxial magnetometer can detect magnetic strength in three directions, and it can also provide angular motion information in the horizontal plane . But the environment magnetic field may disturb the geomagnetic field which reduces the reliability of the magnetometer outputs, for instance, in some steel structure architecture or near some objects with strong electromagnetism . As angular information can also be extracted from accelerometer measurements, a state space filter such as the kalman filter is a commonly used technique to combine angular motion information . Beside these, sensors such as barometer can also assist pure motion sensors at human gait recognition . But, in fact, using more sensors means more power consumption, and it is a challenge to design a proper algorithm to fuse different kinds of sensors . A single triaxial accelerometer is quite enough for human fall detection as sufficient information could be extracted from its measurements . Besides this, the accelerometer coordinate does not have to be fixed if only the magnitude of sum vector is needed, and that is quite convenient for wearable application . In this paper, a fall detection system based on a wearable device is developed . The hardware and software realization of the device is mainly based on a single triaxial accelerometer and gps / gsm module . The device uses an efficient fall detection algorithm with less resource and power consumption, which means that it is a proper design for outdoor application . Then it will get the elderly's geographic position and send fall alarm short message to caregivers . So the elderly who has fallen can get timely help to minimize the negative influence . Information like linear movements (e.g., displacement, velocity, and acceleration) and angular movements (e.g., angle, angular velocity, and angular acceleration) could be obtained directly or indirectly . Beside these, frequency domain parameters could be extracted from basic sensor measurements by techniques such as fft and wavelet [11, 12]. For single triaxial accelerometer application, accelerations and derived angular parameters could be used as recognition features . Fall detection algorithm design according to the recognition feature, fall detection algorithms are classified as threshold based and machine learning based . For threshold based method, threshold of recognition feature is set by the designer before application which makes the algorithm have rapid response and less resource consumption . But the choice of threshold needs both rigorous schemes and adequate experiments . For machine learning based design, the classification of fall and normal activities is available with the assistance of technologies such as support vector machine (svm) and neural network [14, 15]. Machine learning assistance may enhance system robustness to some extent, but its algorithm design is always high computing resource consumed which limits its application in wearable device . As the compact wearable device requires low power consumption and a single triaxial accelerometer could provide effective information, threshold based fall detection algorithm will be used in this system . Algorithm used in this fall alarm system when a real fall happens, collision between human's body and ground will produce obvious peak value at the sum acceleration a which has magnitude as (1)a = ax2+ay2+az2, where ax, ay, and az present accelerometer measurements of three axes . The system uses the sum acceleration as the first step to distinguish high intensity movements from others . But normal motions such as jumping or sitting also produce peak values, which mean that additional detection features are required . As human's motion has low acceleration, it is feasible to get gravity component in each axis by using a low pass filter . If gravity components could be separated before and after human's fall, then it is possible to calculate the rotation angle of accelerometer coordinate in 3d space, which is also equivalent to the rotation angle of gravity vector relative to fixed coordinate . Quaternion is an effective tool to describe rotation movement in human's gait change which also includes falling . A quaternion could be described as (2)q = q0+q1i+q2j+q3k which has magnitude as (3)q = q02+q12+q22+q32 . Unit quaternion which has magnitude q = 1 can be described as (4)q = cos2+sin2qxi+sin2qyj+sin2qzk. As shown in figure 3, rotation angle of q equals . The rotation axis is orthogonal to the rotation plane and its direction is in accordance with right hand screw rule . Qx, qy, and qz are three components of the unit vector which describes the orientation of the quaternion at the fixed coordinate . Besides rotation movement, quaternion can also describe a vector in 3d space, such as the gravity vector g which could be described as a quaternion (5)g=0+gxi+gyj+gzk.gx, gy, and gz are three components of g which has quaternion magnitude as (6)g = gx2+gy2+gz2=g . A unit quaternion q is used to describe human's falling movement, which can also be divided into three rotation quaternions q1, q2, and q3 to simplify the calculation as shown in figure 4 . With the help of gravity vector information before and after human's falling movement as shown in figure 3, these three separated quaternions are all available . Q 1 could be expressed as (7)q1=cos12+sin12sini+sin12cosj which has rotation angle and rotation axis information as (8)1=arctangbefore, zgbefore, x2+gbefore, y2,sin=gbefore, ygbefore, x2+gbefore, y2,cos=gbefore, xgbefore, x2+gbefore, y2 . Quaternion q2 can be calculated as (9)q2=cos22+sin22k which has rotation angle as (10)2=arctan2gafter, ygafter, xarctan2gbefore, ygbefore, x . Quaternion q3 is (11)q3=cos32+sin32sini+sin32cosj with rotation angle and rotation axis information as (12)3=arctangafter, zgafter, x2+gafter, y2,sin=gafter, ygafter, x2+gafter, y2,cos=gafter, xgafter, x2+gafter, y2 . Then the rotation of the fall movement can be expressed by quaternion multiplication as (13)gafter = qgbeforeq=q3q2q1gbeforeq1q2q3, where q=q0-q1i--q2j--q3k- is the conjugate quaternion of q. quaternion algebra is normally implemented based on basic matrix algebra . Quaternion multiplication used above could be realized by matrix multiplication as (14)qgbefore = mq0gbefore, xgbefore, ygbefore, z = q0q1q2q3q1q0q3q2q2q3q0q1q3q2q1q00gbefore, xgbefore, ygbefore, z . The whole rotation quaternion can also be decomposed as (15)q = q3q2q1=mq3mq2q1.q1, q2, and q3 are all available based on gravity information before and after the falling movement . At last, it is possible to get four elements of quaternion q by the equation above and the rotation angle could be calculated as (16)=2arctanq12+q22+q32q0 . When an object is falling, magnitude of will approach 90 which is also a character different from most normal activities . The wearable device will be mounted on human's waist at first to reflect the motion of human body closely, and the device will record gbefore while the elderly is standing still . There is no special requirement of the device orientation but only keep stationary during the wear . Athreshold means the threshold of sum acceleration magnitude and tthreshold means the threshold of oscillation time duration after the break of athreshold . When measurements in three different axes have been acquired, the sum acceleration |a| will be calculated . When a real fall happens, sum acceleration will reach peak value of |a| athreshold . In a real falling, the fluctuation of acceleration will stop in time duration tthreshold and then the sum acceleration is |a| g as the elderly will lie on the ground . Then the acceleration a is recorded as gafter ., the system will consider it as a fall if the rotation angle || 90. ti's 16 bits mcu msp430f1611 is used to control the whole system and imply the detection algorithm . The measurement range of accelerometer could be set at 2 g, 4 g, 8 g, or 16 g, and the maximal sampling rate is 3.2 khz . As human's activities are normally at low frequency bands, 100 hz is a proper sampling rate for human fall detection . There is an inner digital filter in adxl345 which could weaken noise and reduce the burden of digital signal processing in mcu to some extent . The measurements will be sent through iic (interintegrated circuit) bus communication between the sensor and the mcu . Sim908 can offer gps and gsm service on serial port communication with mcu, and it can also work in low power mode . Each hardware component of the wearable device is working under low voltage and the detection algorithm does not need complex calculation resource, so the power consumption of the whole device is quite low . A 1200 mah, 3.7 v polymer lithium battery is quite enough to provide the need of the wearable device for a couple of days . Hardware structure of the detection device is shown in figure 6, and the pcb board prototype is shown in figure 7 . One of them is the software design in wearable device, and the other is in the caregiver's handset . After initialization of the system, gbefore would be extracted from acceleration measurements by using a low pass filter when the elderly is standing . If a fall has been detected, the wearable device will locate the user and send alarm short message to caregivers immediately . If the user withdraws the alarm by pressing a button manually, the device will get back to fall detection state and a short message will be sent to inform the caregivers . There is a url (universal resource locator) which links to a web map in the alarm short message . The fall location information will be highlighted on a web map when the caregiver opens this link . System test of the fall detection system has been conducted based on the system design described above . The sampling rate of accelerometer is set at 100 hz and the measurement range is 16 g with a maximum precision of 4 mg . Mcu will read raw measurements from sensor's inner fifo and apply the detection algorithm . The test objects are three different volunteers at the ages of 23, 42, and 60, respectively . Based on analysis of these volunteers' experiment data, athreshold and tthreshold are set as 2 g and 2 s, respectively . In order to get g when standing and lying after the fall, sum acceleration a which has magnitude between (1 0.3) g and (1 + 0.3) g will be considered as gbefore and gafter . Considering that the tilt of the ground or the lying posture of the elderly may affect the rotation angle, rotation angle between (90 30) and (90 + 30) will infer that the elderly has fallen . System test contains five kinds of activities of daily living (i.e., walking, jumping, squatting, sitting, and resting) and four kinds of fallings (i.e., forward, backward, leftward, and rightward). Each kind of motion has been repeated 20 times on each volunteer, and the detection results of the proposed algorithm and an acceleration threshold based algorithm are listed in table 1 . The sensitivity and specificity [21, 22] of the proposed system can be got from the test data in table 1 . Test results of acceleration threshold based algorithm show lower sensitivity and specificity at 91.6% and 88.7%, respectively . Figure 9 shows the accelerations in different kinds of fallings which all trigger the fall alarm correctly and the corresponding rotation angles are 91.9, 100.5, 104.7, and 114.1. figure 10 shows acceleration during activity of lying down and resting which has rotation angle of 117.0 and similar waveform to falling, but the peak acceleration is much lower . They all do not have rotation about 90; even some of the peak values are quite high, so the fall alarm has not been triggered . An alarm sms (short message service) containing a map url has been received by the handset as shown in figure 12 when a fall has been detected . Clicking the url will open a map in web browser on which the fall location will be displayed accurately as shown in figure 13 . This paper developed a fall detection system based on a single triaxial accelerometer based wearable device . There is no special requirement of the device's mounting orientation because the algorithm does not claim the axes of accelerometer to be fixed strictly . The system has low power consumed hardware design and highly efficient algorithm which could extend the service time of the wearable device . As normal activity of resting also has similar rotation as falling, it may trigger fall alarm when the body hits ground heavily . So the choice of athreshold is quite important to distinguish falling from heavily lying activity . Sufficient sample number collected from subjects with different age and gender will improve the reliability and robustness of the threshold . Beside these, technologies such as svm and neural network are considerable to seek out a proper classification method based on the features used in this system.
|
One radiologist retrospectively reviewed the medical records of the patients who received tfesi using the conventional approach at our department during a 1-year period, from june 2003 to may 2004 . This involved performing tfesi at the location of the exiting nerve root, regardless of the level of the nerve root compression . For example, tfesi for l5 radiculopathy was performed at the neural foramen of l5-s1 even when the l5 nerve root compression was in the paracentral or subarticular region at the level of the l4 - 5 disc . After a consensus meeting between three radiologists who were unaware of the clinical results after tfesi, we selected those cases treated by conventional tfesi with supra - adjacent nerve root impingement . The inclusion criteria were (a) the presence of lumbar radiculopathy, (b) nerve root compression in the paracentral or subarticular region at the level of the supra - adjacent intervertebral disc (for example, at the l4 - 5 disc level for the l5 nerve root), (c) one level tfesi from l1 to s1, (d) no prior therapeutic tfesi, (e) no prior surgery, and (f) clear identification of the nerve root compression by using a cross - sectional imaging study (either computed tomography or magnetic resonance imaging). Thirteen patients who met all the criteria were included and they were referred to as the conventional tfesi group . However, since june 2004, we have used tfesi with the preganglionic approach at the supra - adjacent intervertebral disc (for example, at the neural foramen of l4 - 5 for a l5 nerve root) if the nerve root compression was at the level of the supra - adjacent intervertebral disc . Using the same inclusion criteria as mentioned above, a total of 20 patients were consecutively enrolled and they were referred to as the preganglionic tfesi group . Ttransforaminal epidural steroid injection using the conventional approach was conducted under biplane fluoroscopic guidance by two radiologists who were very experienced in spinal interventions . All the treatments were performed as outpatient procedures, and written informed consents were obtained from all the patients . With a patient lying in the prone position, the tube was rotated obliquely to ensure injection at the neural foramen . The goal of positioning was to allow a perpendicular needle tract toward the classic injection site underneath the pedicle, in the so - called " safe triangle " (5, 7). The safe triangle was defined by the pedicle superiorly, the lateral border of the vertebral body laterally, and the outer margin of the spinal nerve medially . After disinfecting the skin, local anesthetic was administered by using a 25-gauge needle . Under fluoroscopic guidance, a 12-cm 22-gauge spinal needle was then advanced into the safe triangle . At the same time, a lateral view was obtained to verify that the anterior - posterior position of the needle tip was appropriate . The needle position was checked by biplane fluoroscopy, and this was followed by the injection of about 1 ml of contrast material (omnipaque 300 [iohexol, 300 mg of iodine per milliliter]; amersham health, princeton, nj). The posteroanterior and lateral spot radiographs were obtained to document the distribution of the contrast material . Bupivacaine hydrochloride (0.5 ml, marcaine spinal 0.5% heavy; astrazeneca, westborough, ma) and 40 mg (1 ml) of triamcinolon acetonide suspension (tamcelon; hanall, seoul, korea) were slowly injected . In terms of tfesi with using the preganglionic approach, the goal of positioning the needle tip was medial and inferior to that used in the conventional approach . In our department, we target injections just lateral to the pars interarticularis on the oblique view during the preganglionic approach (fig . A fortnight after tfesi, the patients were followed - up at our outpatient department . This length of follow - up has been proposed in the literature and relates to the duration of the therapeutic effect of corticosteroid (7). To check the effect of tfesi, all the patients were recommended not take any drugs or to participate in any physical therapy for their sciatica before this 2-week follow - up . The level and cause of nerve root compression on the ct or mr imaging and the level of radiculopathy were documented in the medical charts before performing tfesi . After retrospectively reviewing medical records, we classified the cause of radiculopathy as being due to a herniated intervertebral disc (hivd) or it was due to spinal stenosis . The patients' demographic variables were also detailed at the initial clinical evaluation . For statistical analysis, we classified the patients' ages into six age groups; <29-years - old, 30 - 39, 40 - 49, 50 - 59, 60 - 69 and> 70 . The duration of radiculopathy was also treated as a potential predictive variable, and it was classified as acute or subacute, i.e., <6 months or chronic (> 6 months) (8). The treatment outcome was assessed using a 5-point patient satisfaction scale, i.e., 0 (poor), 1 (fair), 2 (good), 3 (very good), and 4 (excellent), and by using a vas (visual assessment scale) that ranged from 0 to 100 . A successful outcome required a patient satisfaction score of 3 (very good) or 4 (excellent), and a reduction on the vas of> 50% two weeks after the tfesi . The patients with a successful outcome were referred to as having received effective treatment and those patients without a successful outcome were referred to as having received ineffective treatment . Logistic regression analysis was performed and the factors included were conventional or preganglionic tfesi, the cause of radiculopathy, the patients' age and gender and the duration of radiculopathy . The mann - whitney u test was also used to evaluate for age differences between the two groups (the conventional and preganglionic groups). Spss, version 10.0 (spss, chicago, il) was used throughout the analysis . One radiologist retrospectively reviewed the medical records of the patients who received tfesi using the conventional approach at our department during a 1-year period, from june 2003 to may 2004 . This involved performing tfesi at the location of the exiting nerve root, regardless of the level of the nerve root compression . For example, tfesi for l5 radiculopathy was performed at the neural foramen of l5-s1 even when the l5 nerve root compression was in the paracentral or subarticular region at the level of the l4 - 5 disc . After a consensus meeting between three radiologists who were unaware of the clinical results after tfesi, we selected those cases treated by conventional tfesi with supra - adjacent nerve root impingement . The inclusion criteria were (a) the presence of lumbar radiculopathy, (b) nerve root compression in the paracentral or subarticular region at the level of the supra - adjacent intervertebral disc (for example, at the l4 - 5 disc level for the l5 nerve root), (c) one level tfesi from l1 to s1, (d) no prior therapeutic tfesi, (e) no prior surgery, and (f) clear identification of the nerve root compression by using a cross - sectional imaging study (either computed tomography or magnetic resonance imaging). Thirteen patients who met all the criteria were included and they were referred to as the conventional tfesi group . However, since june 2004, we have used tfesi with the preganglionic approach at the supra - adjacent intervertebral disc (for example, at the neural foramen of l4 - 5 for a l5 nerve root) if the nerve root compression was at the level of the supra - adjacent intervertebral disc . Using the same inclusion criteria as mentioned above, a total of 20 patients were consecutively enrolled and they were referred to as the preganglionic tfesi group . Ttransforaminal epidural steroid injection using the conventional approach was conducted under biplane fluoroscopic guidance by two radiologists who were very experienced in spinal interventions . All the treatments were performed as outpatient procedures, and written informed consents were obtained from all the patients . With a patient lying in the prone position, the tube was rotated obliquely to ensure injection at the neural foramen . The goal of positioning was to allow a perpendicular needle tract toward the classic injection site underneath the pedicle, in the so - called " safe triangle " (5, 7). The safe triangle was defined by the pedicle superiorly, the lateral border of the vertebral body laterally, and the outer margin of the spinal nerve medially . After disinfecting the skin, local anesthetic was administered by using a 25-gauge needle . Under fluoroscopic guidance, a 12-cm 22-gauge spinal needle was then advanced into the safe triangle . At the same time, a lateral view was obtained to verify that the anterior - posterior position of the needle tip was appropriate . The needle position was checked by biplane fluoroscopy, and this was followed by the injection of about 1 ml of contrast material (omnipaque 300 [iohexol, 300 mg of iodine per milliliter]; amersham health, princeton, nj). The posteroanterior and lateral spot radiographs were obtained to document the distribution of the contrast material . Bupivacaine hydrochloride (0.5 ml, marcaine spinal 0.5% heavy; astrazeneca, westborough, ma) and 40 mg (1 ml) of triamcinolon acetonide suspension (tamcelon; hanall, seoul, korea) were slowly injected . In terms of tfesi with using the preganglionic approach, the goal of positioning the needle tip was medial and inferior to that used in the conventional approach . In our department, we target injections just lateral to the pars interarticularis on the oblique view during the preganglionic approach (fig . A fortnight after tfesi, the patients were followed - up at our outpatient department . This length of follow - up has been proposed in the literature and relates to the duration of the therapeutic effect of corticosteroid (7). To check the effect of tfesi, all the patients were recommended not take any drugs or to participate in any physical therapy for their sciatica before this 2-week follow - up . The level and cause of nerve root compression on the ct or mr imaging and the level of radiculopathy were documented in the medical charts before performing tfesi . After retrospectively reviewing medical records, we classified the cause of radiculopathy as being due to a herniated intervertebral disc (hivd) or it was due to spinal stenosis . The patients' demographic variables were also detailed at the initial clinical evaluation . For statistical analysis, we classified the patients' ages into six age groups; <29-years - old, 30 - 39, 40 - 49, 50 - 59, 60 - 69 and> 70 . The duration of radiculopathy was also treated as a potential predictive variable, and it was classified as acute or subacute, i.e., <6 months or chronic (> 6 months) (8). The effectiveness of tfesi was evaluated two weeks after the procedures . The treatment outcome was assessed using a 5-point patient satisfaction scale, i.e., 0 (poor), 1 (fair), 2 (good), 3 (very good), and 4 (excellent), and by using a vas (visual assessment scale) that ranged from 0 to 100 . A successful outcome required a patient satisfaction score of 3 (very good) or 4 (excellent), and a reduction on the vas of> 50% two weeks after the tfesi . The patients with a successful outcome were referred to as having received effective treatment and those patients without a successful outcome were referred to as having received ineffective treatment . Logistic regression analysis was performed and the factors included were conventional or preganglionic tfesi, the cause of radiculopathy, the patients' age and gender and the duration of radiculopathy . The mann - whitney u test was also used to evaluate for age differences between the two groups (the conventional and preganglionic groups). Spss, version 10.0 (spss, chicago, il) was used throughout the analysis . The study subjects were 22 women and 11 men with a mean age of 55.1 years (age range: 17 - 76, standard deviation [sd]: 14.1). The mean age was 53.9 years (sd: 13.4) in the conventional tfesi group and it was was 55.8 years (sd: 14.8) in the preganglionic tfesi group . Of the 13 patients in the conventional tfesi group, nine showed effective treatment two weeks after tfesi (69.2%), and 18 of the 20 patients (90%) in the preganglionic tfesi group showed effective treatment, and the difference in the two rates of effective treatment was of borderline significance (p = 0.056; odds ratio 10.483). The cause of radiculopathy, the age of the groups, gender and the duration of symptoms were not found to be statistically related to the effectivness of tfesi (p> 0.05). These results are summarized in tables 1, 2 . In the conventional tfesi group, seven patients (53.8%) had spinal stenosis and six patients (46.2%) had hivd, and in the preganglionic tfesi group, 13 patients (65%) had spinal stenosis and seven patients (35%) had hivd . In the conventional tfesi group, the radiculopathy was acute or subacute in eight patients (61.5%) and chronic in five patients (38.5%); in the preganglionic tfesi group, radiculopathy was acute or subacute in six patients (30%) and it was chronic in 14 patients (70%). In the conventional tfesi group, tfesi at l5-s1 was performed in 10 patients and tfesi at l4 - 5 was performed in three patients; in the preganglionic tfesi group, tfesi was performed at l5-s1 in five patients, at l4 - 5 in 14 patients and at l3 - 4 in one patient . Lumbosacral radiculopathy is a common and costly medical disease, and its lifetime prevalence has been estimated to be 40 - 60% (9). Based on the recent concepts of pain generation in the sciatic condition, it's believed that concomitant chemical irritation of the nerve root that's caused by disk material is the decisive factor for the development of severe sciatica, rather than the pain being due to mechanical compression alone (10 - 16). According to this concept, the local application of corticosteroids in the area of the compressed thus, percutaneous injection based therapies, including tfesi, are being used with increasing frequency to treat the radiculopathy resulting from a herniated disc or degenerative lumbar spinal stenosis (17 - 19). In contrast to an interlaminar or a caudal epidural steroid injection, tfesi provides a low volume of concentrated medication to a selected nerve root . Medical journals and texts often incorrectly refer to transforaminal epidural injections as " selective epidural injections ", " selective nerve root blocks ", or " nerve root sleeve injections " . However, the international spinal intervention society (isis), has promoted the used of a nomenclature based on precise anatomic descriptors, and it recommends the term " transforaminal " (5). Gajraj (4) mentioned that to be selective, a nerve root block should be performed extraforaminally and distal to the division of the ventral and dorsal rami; otherwise, the dorsal ramus and its innervated structures would also be anesthetized . Therefore, they suggested that the therapeutic procedure be referred to as a' transforaminal epidural steroid injection' and that the diagnostic procedure should be referred to as a' selective spinal nerve block' or a' selective ventral ramus block .' In the case of tfesi with using the conventional approach, the spinal needle is positioned within the " safe triangle " (bordering the pedicle, the exiting nerve root and the lateral border of the vertebral body), with the bevel placed below the inferior aspect of the pedicle (5, 7). Using this conventional approach, the injectate typically bathes the epidural space around the dorsal root ganglion and then it descends along the distal aspect of the nerve root . Ideally, if there is no stenosis and the needle tip is appropriately positioned, the injectate may spread rostrally to the epidural portion of the preganglionic nerve root as well . However, for most cases of lumbosacral radiculopathy that are secondary to stenosis or a herniated disc, the site of impingement usually lies at the level of the supra - adjacent intervertebral disc, which is rostral to the conventional lumbar tfesi bevel position . In addition, one cannot always guarantee a rostral spread of injectate to the epidural / preganglionic portion of the nerve root . Thus, performing preganglionic tfesi at the supra - adjacent level may be a more effective method to deliver injectate to a target site . For the preganglionic approach, it is important that the injectate distributes itself predominantly in the epidural space at the disc level (more inferior than that for the conventional approach), and that it does not excessively spread along the spinal nerve at the supra - adjacent level, which is not inflamed or compressed . Lew et al . (6) inserted the needle into the inferior and anterior neural foramen for performing preganglionic tfesi, and we use a modification of this method . The landmark we use for needle insertion is just lateral to the pars interarticularis on the oblique view; this is medial and inferior to that used for the conventional approach (fig . First, it is not a controlled, randomized prospective study; thus, it has the limitations of a retrospective study and so a randomized, prospective study is warranted . Third, other factors that probably influenced the therapeutic effect were not included . In conclusion, preganglionic tfesi was found to have a better therapeutic effect on the radiculopathy caused by compression at the supra - adjacent level than did conventional tfesi, and this result had borderline statistical significance.
|
One of the key challenges in the development of novel materials is the ability to tune and control their macroscopic physical and chemical properties on a molecular level by external stimuli . Such a degree of control is challenging but crucial for a wide range of applications ranging from catalysis to pharmacological and medical applications . In photoactive materials light absorbed by chromophores can be converted into directed functionality, typically by means of photoinduced isomerization of nitrogen or carbon containing double bonds and pericylic reactions . Indeed, e z isomerization results in large amplitude changes in structure as well as chemical and physical properties . Molecular motors based on overcrowded alkenes are particularly attractive due to the synthetically tunable properties, such as thermal stability, absorption spectra, etc ., and therefore are readily applied to a wide range of functional systems . However, although the thermally activated step in the unidirectional rotary cycle is well understood and is now largely predictable, the photochemical properties and especially photochemical quantum yields are less well understood . Hence both from a fundamental perspective and in achieving the goal of complete molecular design, gaining insight into the excited - state properties of light driven molecular - sized machines is essential . The overcrowded alkene - based molecular rotary motors are composed of a central carbon carbon double bond (the axle) embedded in an intrinsically chiral environment . The unidirectional rotational cycle starts with a photoinduced e z isomerization around the central c = c bond, generating a metastable isomer p * (figure 1), which relaxes thermally to the stable isomer p, which in the case of a symmetric stator unit is identical to i. this isomer marks half of the rotation cycle and is the starting point for a second photoinduced isomerization step that leads again to a metastable isomer . Thermally activated conformational isomerization of this isomer brings the system back to its initial state . Overall, the rotor part has then performed a complete rotation with respect to the stator unit of the molecular motor . Although the rotation includes both photochemical and thermal steps that involve different parts of the motor, the structural evolution is largely governed by the excited - state properties of the central c = c group, which, in turn, are dictated by the potential energy surfaces of the excited states that are accessed upon electronic excitation . Despite the large number of theoretical and experimental studies that have focused on characterizing this process, there are several key questions outstanding including identification of the main structural coordinates and the role of various electronic states involved in the excited - state dynamics . Time - resolved studies are essential to elucidate these dynamics but have thus far focused on probing the change in the electronic structure after photoexcitation through uv / vis absorption and fluorescence studies . These techniques offer a high time resolution but provide only indirect information as to how the structure evolves spatially over time . In the present contribution we show that this information can be obtained through a combination of picosecond time - resolved vibrational spectroscopy of the electronically excited states together with quantum - mechanical calculations . The setup for the time - resolved infrared measurements has been described in detail previously . Mid - ir probe pulses were generated using an amplified ti: sapphire system (spectra - physics hurricane, 600 j, repetition rate 1 khz) pumping a commercial bbo - based opa (spectra - physics opa-800c), the signal and idler output of which were difference - frequency - mixed in aggas2 . Uv pump pulses (400 nm, 1 j) were generated by doubling part of the output of the ti: sapphire laser . The diameter of the uv pump focus was 180200 m; that of the ir probe focus, 150 m . The sample cell with caf2 windows spaced by 500 m was placed in the ir focus . To avoid accumulation of the thermally unstable conformer p * during the measurements, the pump probe delay time was scanned by mechanically adjusting the beam path of the uv pump . The temporal resolution of 200 fs has been determined from the full width at half - maximum of the pump probe cross - correlation function . The pump pulse was chopped at 500 hz, and transient spectra were obtained by subtracting nonpumped absorption spectra from the pumped absorption spectra, both of which were recorded by spectrally dispersing the probe pulses using an oriel ms260i spectrograph and measuring the frequency - dependent ir intensity using a 2 32 hgcdte detector array (infrared associates). Compound i was available from earlier studies (see ref (44)). In all experiments we investigate a 10 mm solution of compound i in deuterated cyclohexane (aldrich, 99.6 atom% d). For the investigation of the ground - state conformers (including vertical excitation energies and forces acting at the franck condon point) quantum mechanical calculations were performed using the turbomole suite of programs . Geometry optimization and normal - mode analysis were performed by (time - dependent) density functional theory ((td)-dft) using the hybrid functional b3lyp . For the geometry optimization the d3 correction method of grimme et al . The cc - pvdz or aug - cc - pvdz basis sets were employed, respectively . Post - hartree fock calculations were performed on the basis of spin - component scaled second - order mller plesset perturbation theory and the approximate coupled - cluster singles - and - doubles model cc2 . All perturbation method calculations were performed using the resolution of identity (ri) approximation and the efficient ricc2 module implemented in the turbomole package together with the standard auxiliary basis sets . The gaussian09 program package was employed to study the excited - state properties in more detail and in particular to optimize the structure of the dark - state species . Geometry optimization and normal - mode analysis were performed in the framework of td - dft at the b3lyp / cc - pvdz level . The structural evolution from the initial state i to isomer p * (figure 1) was considered first in terms of the spectral properties of the initial state and the first metastable product (p *). The steady - state uv / vis absorption spectra of the two isomers are distinct, reflecting a change in the conjugated system (figure 1a). The ftir spectra of the two isomers (figure 1c) show that the carbon carbon stretch and ring vibrations couple to a large degree as a consequence of the extended system; however, dft calculations enable us to assign the bands in the 15501650 cm range as being mainly associated with modes involving the central c = c double bond (supporting information). The metastable isomer p * shows a shift of these modes to lower frequencies confirming a decrease in bond strength . Comparison of the optimized geometries of the two isomers (i (p *), cc bond length 1.369 (1.377); cc = cc dihedral angle 14.1 (29.5)) evidence the corresponding lower bond character as well . Unidirectional motion of the unidirectional motor starting from the thermally stable conformer (i) via the product of the photoinitiated step (p *) to the thermally stable conformer (p) (optimized geometries on the b3lyp+d / aug - cc - pvdz level): (a) experimental and calculated (light color and dotted line) uv vis spectra of conformer i and p *; (b) molecular orbitals of the initial conformer; (c) experimental and calculated ir spectra (b3lyp+d / aug - cc - pvdz) of the initial state (blue) and final state (red). In both the measured uv / vis absorption and ftir spectra at the photostationary state (pss), i and p * are present in a 25:75 ratio . Time - resolved vibrational spectroscopy was employed to achieve the required temporal resolution as well as structural sensitivity to elucidate the structural evolution that follows photoexcitation with a short uv - pump pulse (center wavelength 400 nm). The resulting structural evolution was followed by time - resolved differential absorption spectra in cyclohexane - d12 with a time resolution of 200 fs (figure 2). The transient ir spectra show, as expected, pronounced differences between the ir absorption spectrum of the molecule in the initial and excited states . A first point of note is that the spectrum does not evolve further after ca . 30 ps, and the difference spectrum corresponds perfectly with the difference spectrum obtained upon continuous wave excitation (figure 1); i.e., the metastable isomer p * has formed fully within the 30 ps after excitation . Ftir and time - resolved infrared spectra of the molecular motor in cyclohexane - d12: (a) ftir spectra of the thermal stable conformer (initial, solvent corrected, top), uv - ump / ir - probe transient infrared spectra (uv = 400 nm) (middle), and difference ftir spectra between the two ground - state conformers of the molecular motor; (b) kinetics of selected bands and corresponding results of the global fit; (c) species associated spectra (sas) of species 1 and calculated ir spectra (top) and sas of the pss (sp3) together with ftir spectra (bottom). Negative bands indicate ground - state bleaching, and positive bands, species created after excitation . The time - resolved ir spectra obtained within the first 30 ps exhibit several remarkable features . The first and most striking is a broad and unstructured absorption over the entire mid - ir range (12003000 cm). This absorption, which decays rapidly, is particularly prominent at early time delays (<5 ps). Individual absorption bands with remarkably high integrated intensities in the 14001600 cm range are superimposed on the broad spectral feature . Notably, these bands are significantly broader than the bleached bands in the transient spectra and bands in the ftir spectra . The solvent response and the dependence of the uv pump intensity (supporting information) confirm that these features are intrinsic to the compound and are not due to solvent or two - photon processes . The width and intensity of the broad excited - state absorption bands excludes that they arise from vibrational transitions . Indeed, the absorbance is closer to that expected for electronic transitions, albeit these typically occur at much higher energies (in the uv / vis range). The initial state of the compound (i) shows an absorption band at 390 nm (figure 1), which is reproduced well by b3lyp / cc - pvdz calculations in the gas phase (403 nm; f = 0.428). The s1 s0 transition has predominantly homo lumo character (figure 1). In contrast to previous assignments, however, we find that this electronic transition is not localized on the stator but involves to a significant extent excitation from the bonding orbital of the central double bond to the antibonding * orbital (figure 1). As a consequence, the double bond character of this bond is reduced as well as the barrier to rotation around this bond . In line with calculations on ethylene and its derivatives, we find a dark state (s2) associated with the homo1 lumo excitation at slightly higher excitation energies that is not directly accessible from the ground state (figure 1, table 1). Because the homo1 orbital is localized on the aromatic stator unit, s2 has a significantly larger dipole moment than s1 (4.3 vs 2.2 d at the scs - cc2/cc - pvdz level). It should be emphasized that the description of the lower - lying electronic states in the compound studied here is thus entirely different from ethylene and its derivatives where, as discussed by salem and others, for torsion angles of around 90 the two low - lying electronic states have either a biradical or zwitterionic character depending on the occupation of the two central 2p - orbitals and require multireference methods for a proper description . In the present study, in contrast, we investigate the dynamics occurring at small torsional angles (vide infra) for which the employed single - reference methods not only have been validated . In addition we employ the results of multireference calculations on smaller motor molecules as reported by liu and morokuma to make a further comparison with our experimental results . For s0 the optimized structure on the b3lyp+d / aug - cc - pvdz level was used to calculate the vertical excitation energies . For vertical excitation they thus strongly suggest that the broad and structureless absorption feature observed in the time - resolved ir spectra is associated with the electronic s1 s2 transition . The presence of two close - lying states also explains why the induced absorption bands have such high intensities . Our calculations show that the energy gap between the two states strongly depends on structural parameters such as the c = c bond length that are involved in the 14001600 cm normal modes . For these modes one therefore expects that their transition moments will be enhanced by vibronic coupling as is indeed observed . The conclusion that the excited - state dynamics of the molecular rotor should be described in a multistate model is further supported by recent multireference calculations on smaller rotor molecules that also find very small energy differences between the s1 and s2 states . The excited - state dynamics were elucidated further using a global analysis of the transient spectra, which shows that the spectra can be described well with two exponential decay terms with time constants of 1.53 0.03 and 12 1 ps . We note that our experiments have a time resolution of 150200 fs and therefore do not allow observation and confirmation of the ultrafast dynamics reported previously in fluorescence - upconversion studies . Species - associated spectra (sas) (supplementary figure 2) were derived by using a two - step sequential kinetic model . The sas of the first species shows an overall background signal with broad and intense features superimposed on it that indicate vibronic coupling . Furthermore, the increase (decrease) of absorbance in the 1550 (1600) cm region indicates a substantial change in bond character of the central double bond (figure 2c). This spectrum was related to the structure of this excited - state species using excited - state geometry optimizations . State without any structural constrains associated with the homo1 lumo excitation leads to a stable minimum that can be reached from the franck condon excited geometry by relatively small structural changes (supplementary figure 4), and an excited - state ir absorption spectrum that is in good agreement with the sas of species 1 (figure 2). It is notable that for a proper comparison with the experimental spectrum, the theoretically predicted stick spectrum needs to be convolved with 20 cm gaussian line shapes, suggesting that in the dark state a wide range of structures is sampled . Our experiments and calculations thus demonstrate that excitation and excited - state decay involve two different electronic states . In earlier studies, time - resolved fluorescence and visible absorption data were interpreted in terms of a decay from a single, isolated electronic state decaying to the ground state after structural relaxation in the excited state . The present data show that the s1 state actually decays to an intermediate, dark electronic state, and from there to the ground state . In the sas of the second species (supplementary figure 2) the broad background is absent, and bands have widths comparable to those in the s0 state . The absence of the broad background indicates that this species is no longer in an electronically excited state but back in the (vibrationally hot) electronic ground state . Indeed, the vibrational activity observed in the 1550 cm region follows closely the ir absorption spectrum of p*. In addition, repopulation of the original state (i) is observed also (i.e. The quantum yield for isomerization is less than unity), and the sas of the second species contains contributions from both vibrationally hot ground - state i and metastable p * isomers . Vibrational cooling of these isomers leads to the sas of the final species, which is in excellent agreement with the steady - state ftir difference spectrum of room - temperature i and p*. The present experimental and theoretical data allow a complete picture of the mechanism by which the molecular rotary motor undergoes isomerization after electronic excitation (figure 3). Photon absorption brings the motor to a bright state from which it decays on an ultrafast time scale and within the time resolution of the present experiments to a different electronically excited dark state . In line with previous calculations on similar systems, our calculations indicate that this is a barrierless process proceeding via a conical intersection . Previously, it was assumed that structural evolution on the homo lumo potential energy surface is responsible for the observed ultrafast decay of the fluorescence, and (following commonly accepted models on photoisomerization of carbon carbon double bonds) that it primarily proceeds along torsional and pyramidalization coordinates . The present study, in contrast, leads to the conclusion that the fluorescence decay is mediated by the passage through the conical intersection of the homo lumo and homo1 lumo potential energy surfaces . Inspection of the structural changes that occur upon geometry relaxation to the minimum on the homo1 lumo potential energy surface show that the central c = c bond length increases from 1.381 to 1.461 and that only relatively small changes occur in the torsional and pyramidalization coordinates . In combination with the forces that act on the molecule at the franck condon excited bright state (supplementary figure 3), this suggests that motion along the c = c stretch coordinate needs to be taken into account as well for understanding the decay of the fluorescence . Proposed multistate dynamics of the photoinduced unidirectional rotation of the molecular motor starting from conformer i to conformer p * (projected into one dimension): dotted arrow, ultrafast process reported in previous work; fast (red arrow) and slow process (blue arrow) observed in the present time - resolved infrared study . (a) calculated energy profile along the torsion coordinate showing how the energies of the electronic states change as the molecules evolves to conformer p*. (b) schematic representation of the proposed model . Hence, it can be concluded that internal conversion to the electronic ground state takes place from the dark state . The decay rate for this process indicates that it is mediated by conical intersections between the two states as has indeed been proposed in previous theoretical studies . These studies concluded, however, as well that to reach these intersections a barrier needs to be overcome that results from the steric repulsion of the methyl group of the rotor unit with the hydrogen of the stator unit . Previous time - resolved fluorescence measurements reported an ultrafast damping mode at 113 cm that was speculated to arise from motion along a coordinate involving inversion / pyramidalization although no direct support could be found for such an assignment . Interestingly, our calculations find in the dark state a mode at 119 cm (b3lyp / cc - pvdz; not scaled, supporting information) that involves motion of the methyl group with respect to the hydrogen of the stator unit . One might therefore wonder to what extent this mode is related to the oscillatory behavior of the fluorescence . Our observed s2 decay constant of 1.5 ps matches the slow component of the overall fluorescence decay (0.91.5 ps). Our calculation of the excitation energies of the bright and dark states along the 119 cm normal mode did not show a conical intersection between the two states, supporting the previous explanation of the oscillations observed in the fluorescence measurements by the movement of wave packets and suggesting a scenario in which a coherent oscillation in the dark s2 state periodically partly repopulates the fluorescent s1 state . However, our experimental methods do not provide the time resolution to confirm this . The photodynamics of a unidirectional molecular motor has been studied by time - resolved ir spectroscopy in which both vibrational and electronic structures are probed . In combination with quantum mechanical calculations, the high structural sensitivity and real - time character of the technique allows us to understand fundamental aspects of the operation mechanism . The results show that conversion of photon energy into directed motion proceeds on the potential energy surfaces of two different electronic states, which is the more important as it implies that the conical intersection between the dark electronically excited state and the ground state determines the efficiency of the motor . To rationally tune the performance of photoinitiated unidirectional rotation thus involves a multicoupled - state optimization of nuclear motion.
|
The patellofemoral joint is one of the most common sources of knee pain in younger people . Maltracking and instability of the patellofemoral joint are responsible for the majority of symptoms and are associated with the development and progression of osteoarthritis1). The position of the patella relative to the trochlea of the femur is not fixed and changes as the knee moves from extension to flexion . Differences in the morphology of the patellofemoral joint have been shown to be associated with altered kinematics and patellofemoral instability29). A variety of measurements have been described to identify abnormalities of the patellofemoral joint . On a lateral radiograph, or a sagittal magnetic resonance imaging (mri) scan, the insall - salvati index10) is measured to assess patella height by comparing the length of the patellar tendon with the length of the patella . The caton - deschamps index11) can also be used to determine patellar height and is calculated by comparing the length of the patellar articular surface with the distance from the postero - inferior border of the patellar and the anterior edge of the tibial plateau . On the axial view, the bisect offset can be used to assess medial or lateral displacement of the patella . Patellar tilt is also assessed on the axial view and is normally 05 relative to a line connecting the posterior femoral condyles . The position of the knee and its weight bearing status have been shown to influence patellofemoral kinematics and measurement of patellofemoral indices1215). Mri is commonly used in the investigation of patellofemoral pain and instability and in many cases is the investigation of choice in preference to plain radiography . Mri provides additional information compared to radiographs, such as the condition of the articular surfaces, integrity of ligamentous stabilising structures (e.g. The medial patellofemoral ligament), and rotational alignment (tibial tuberosity trochlear groove), and facilitates better evaluation of trochlear dysplasia5,1620). Whilst the patellofemoral indices described above were originally designed for radiographic measurements, they have been applied to mri which has been shown to be an excellent imaging modality for evaluating the patellofemoral joint with good correlation with plain radiographs2124). Mri is usually taken with the patient in supine position and the knee in extension1,21). It has been demonstrated that patellofemoral instability typically manifests during the terminal 30 of knee extension with contraction of the quadriceps femoris muscle14). Undergoing an mri scan can be an intimidating experience for patients, particularly those prone to claustrophobia25,26). Such patients are likely to be anxious and tense during the scan and may inadvertently contract their quadriceps . This quadriceps contraction may alter the relationship of the patella to the femur, overestimating the degree of instability that may be present . The objective of our study was to determine the impact of knee position and quadriceps contraction on patellofemoral indices measured on mri . Twenty patients undergoing mri scan of the knee were identified from a pool of referrals to the orthopaedic department at our institution . Patients were selected based on the absence of patellar or patellofemoral symptoms documented in the clinical notes or on the mri request . Inclusion criteria were 2540 years of age, a body mass index less than 30, a clinical diagnosis of non - patellar or patellofemoral pathology . Exclusion criteria were known or suspected patellar or patellofemoral conditions, connective tissue disorders that could cause hyperlaxity, and previous surgery or injury to the knee . Axial and sagittal mri sequences were performed with the knee fully extended and quadriceps contracted; knee fully extended and quadriceps relaxed; knee flexed 30 with quadriceps contracted; and knee flexed 30 with quadriceps relaxed . A triangular wedge was placed under the patient s knee to reproducibly create 30 of flexion . When quadriceps contraction was required, subjects were given a rest period between mri sequences to prevent muscle fatigue . Bisect offset27) and patellar tilt angle28) were measured on axial mri images using the slice showing the widest view of the patella . The insall - salvati index and caton - deschamps index were measured on the sagittal view using the slice showing the widest view of the patella . 1) was determined by drawing a line connecting the posterior femoral condyles and a perpendicular line was then drawn through the deepest point of the trochlea groove to where it intersects the patellar width line . In cases where the trochlea was flattened, the bisect offset is defined as the proportion of the patella lying lateral to the midline as a percentage of the whole patellar width . Patellar tilt was defined as the angle between a line connecting the posterior femoral condyles and the maximum patellar width (fig . The insall - salvati ratio was determined by comparing the length of the patellar tendon with the length of the patella . The caton - deschamps index was defined as the ratio of the distance between the lower edge of the patellar joint surface and the upper edge of the tibial plateau to the length of the patellar articular surface (fig . The student t - test (unpaired) was used to compare the difference between these values in the various states of knee flexion and quadriceps contraction . All 20 patients were assessed with the knee in extension and flexion, with and without quadriceps contraction . The mean values of the patellar tilt, bisect offset, insall - salvati ratio and caton - deschamps index of the patients are detailed in table 1 . The mean patella tilt averaged 9 with the knee flexed and quadriceps in any state . Patella tilt increased but remained within normal limits with the knee extended and quadriceps relaxed . However, when the quadriceps was contracted with the knee in extension, the mean patella tilt was 14.6, the upper limit of the normal range . The mean difference in patella tilt from the flexed, relaxed positon to the extended, contracted position was 5.6 (range, 9.8 to + 25.9), but this did not reach statistical significance (p=0.06). The mean bisect offset angle in the flexed position increased from a normal range of 56% and 57% when the quadriceps were relaxed or contracted, respectively, to an abnormal value of 65% with the knee extended and quadriceps contracted (p=0.012). There were four patients who demonstrated normal patella tilt and bisect offset with the knee flexed and quadriceps relaxed, but abnormally high tilt and bisect offset were observed with the knee extended and quadriceps contracted . The mean values of the caton - deschamps index were within the normal range with knee flexed but were abnormally elevated with the knee extended, both with the quadriceps relaxed and contracted . The difference between the flexed relaxed position and extended contracted position was 0.05 (range, 0.15 to + 0.31), which did not reach statistical significance (p=0.34). The mean values of the insall - salvati ratio were normal in all combinations of knee position and quadriceps contraction . The change in the insall - salvati ratio from the flexed, relaxed state to the extended, contracted state was 0.07 (range, 0.17 to + 0.11), which was not statistically significant (p=0.97). Mri evaluation of the knee forms an integral part of the investigation of young patients with knee pain . The patella begins to engage the trochlea during knee flexion, and patellofemoral instability typically manifests during the terminal 30 of knee extension . In the clinical setting of patellofemoral disorders, mri can provide useful information about the bony morphology of the femur and patella as well as the condition of the articular cartilage . Numerous patellofemoral measurements or indices have been described to quantify abnormalities of the patellofemoral joint . Many of these measurements were originally described on plain radiographs and their use has been extended to mri . They can be of some value when deciding on the most appropriate management for patients with patellofemoral symptoms . Significant differences in these measurements exist between patients with patellofemoral instability and asymptomatic patients3,6). Quadriceps contraction and weight bearing have been shown to alter patellar height and patellofemoral kinematics1215,29,30). For the majority of patients, mri of the knee is performed with the knee extended . Patients undergoing mri scanning of the knee may be anxious and as a result involuntarily contract their quadriceps . This has the potential to lead to inappropriate management decisions or unnecessary surgery . In our study, we aimed to assess the influence of knee position and quadriceps activity on frequently measured patellofemoral indices . In our cohort of patients, none of whom had patellofemoral symptoms, an increase in the measured patellofemoral indices was observed with the knee extended and quadriceps contracted . The mean values of these indices increased above the normally accepted range in some cases with the knee in this position . In the case of the bisect this suggests that the flexed position protects against erroneous or exaggerated patellofemoral measurements caused by inadvertent quadriceps contraction as well as trochlea engagement . Thus, it is important that potential confounders (e.g. Quadriceps contraction and knee extension) are minimised in order to achieve more reliable measurements upon which surgical decision - making is based . We, therefore, recommend, when investigating patients with suspected patellofemoral pathology, mri of the knee should be performed in 30 of flexion to obtain a more accurate view of the patellofemoral joint and avoid the confounding effects of quadriceps contraction . Patellofemoral indices measured on mri are affected by the position of the knee and quadriceps muscle activity . With the knee in extension and the quadriceps contracted, as may occur in an anxious patient, there was a tendency towards abnormal patellofemoral measurements in our cohort of asymptomatic patients . Performing mri of the knee in 30 of flexion helps to reduce the confounding effect of quadriceps contraction and may result in more reliable radiological assessment of the patellofemoral joint.
|
The knowledge of mechanical materials behaviour is of great importance particularly for some innovative engineering applications, which involve a single material, bimaterials, or multiple materials . Some bimaterials are obtained by means of a coating process and consist of coupled layers that may or may not contain filler elements, such as a foaming operation, or may be developed as welded substrates . Usually, at the end of the process, the material is identified as a new single material . The coating procedure developed and studied in this work refers to the hot - dip galvanizing treatment, considered as a better treatment to fight against corrosion . The role of a hot - dip galvanizing treatment consists in the deposition of a protective external layer of metallic zinc obtained by immersing the steel in a zinc bath at a temperature of around 460c . When the material (i.e., steel) is introduced into the zinc bath and then removed, several changes in the chemical composition and in the mechanical structure can occur . These changes produce a new structural arrangement on zinc substrate and are usually revealed by the generation of cracks in the zinc layer . The behaviour of materials may change as a result of various events such as fatigue, fracture, wear, fretting fatigue, creep, hydrogen embrittlement, thermal shock processes, or atmospheric attacks . An important role in these failure processes is played by any discontinuity in the material that can appear during the manufacturing process or during working period, or as a result of inappropriate use . In our case it appears as a consequence of the hot - dip galvanizing treatment applied as described above in association with the action of the mechanical loading . Recently, krishnan and xu focused on failure mechanics of adhesive joints (i.e., considered as bimaterials) using a fringe pattern concentrations technique to describe the bimaterials interface . As analytical model, they used the fracture mechanics approach, while to compute the stress singularity in the bimaterial layer they took into account the stress intensity factor in mode i. the formula used to express this stress intensity factor is (1)ki = rekai, where k is the stress intensity factor in the case of the bimaterial component: (2)k = ytaaiei, where t = p(3s / w) and y, are the calibrating factors that depend on a / w, b / w, respectively, dundurs' parameters . Then a, b, and w represent the length of the possible crack, the thickness, and the length of the specimen . Is a function of dundurs' parameters,, and is presented as (3)=12ln11+, where, dundurs' parameters material, is expressed by (4)=112221211122+2121 in which 1 and 2 denote the material, while and are the shear modulus and poisson's ratio, respectively . The elastic fracture theory is a suitable tool to compute the mechanical behaviour in case of coatings, composites, and welded structures . The bimaterial produced by the reactions that occur during the hot - dip galvanized steel process must have the same conditions on the contact surface as the linear spring - like model . The discontinuity of displacement across the interface is assumed to be linearly proportional to the displacement at the interface of the constituent where the stress source is located . The present authors agree that the two materials that form the bimaterial should be considered as a functionally autonomous subsystem with a different young's modulus and poisson's coefficients . This implies a strain incompatibility between the two solids and the formation of a periodic distribution of tensile and compressive stress in checkerboard patterns under the uniaxial tensile test . A robust approach was proposed by yu et al . In order to formulate analytical solutions through the use of linear spring - like model . According to this theory we can define the type of contact between the surfaces by the fraction of the adherent area, applying the following formula: (5)=aacac, where is used to quantify the extent of bonding at the interface, a is the total area of the interface, and ac is the area covered by paper (see example on figure 2 from). According to the study made by panin et al ., the interface of solid materials covers a sinusoidal surface layer due to a rotation of successive constraints in tensile and compression stress in the structure . This effect is described by the following equation: (6)=aysinxlxt2, where t is the thickness of the coating, x is the distance of crack propagation, y is the stress coefficient . This paper addresses two goals: first of all, to experimentally characterize the layer of zinc applied during the hot - dip galvanization process, in order to obtain necessary information about the uniformity of the zinc layer and the number of cracks and their length, and finally to estimate the behaviour of the cracks located in zinc layer when the mechanical loading is imposed . Secondly, we proposed to corroborate the experimental results with analytical and numerical computations, ascertaining where the crack discontinuities spread while considering the three main possibilities of crack development: arrest at the bimaterial interface, crossing into the second material, in our case steel, and finally creating a deflection between the two materials . In the literature k. m. mrz and z. mrz predicted the behaviour of bi- and multimaterial interfaces according to a simplified approach using the mk - criterion based on the linear elastic fracture mechanics (lefm). In this criterion it is assumed that the crack growth follows the direction of minimum distortion energy density at a distance corresponding to a specified value of dilatation energy . Figure 2 shows a specific case in which the crack is considered to propagate perpendicularly to the interlayer and make a bifurcation at the interface . The decohesion phase may present as one of the four possible scenarios whereby the crack will propagate as follows: (i) the plastically weaker material (wm) to the plastically stronger material (sm), wm - sm, (ii) the plastically weaker material (wm) to the plastically stronger interlayer (si), wm - si, (iii) the plastically stronger material (sm) to the plastically weaker material (wm), sm - wm, and (iv) the plastically stronger material (sm) to the plastically weaker interlayer (wi), sm - wi . In simple terms, the criterion for crack initiation and propagation along the interface could be considered, where the maximum stress, max, is expressed as (7)max=x+y2+x+y22+xy . To solve the problem of deflection at the interface of two materials, hutchinson proposed the following condition: (8)gcgc1<gdgp1, where g = gc represents release energy rate of the interface bimaterial . Studies, related to the problem of cracks running perpendicular to a bimaterial, yields a different expression for the stress intensity factor that is connected to the stress tensor as follows: (9)ij = kr1fij. To determine the propagation energy of the crack running perpendicular to the interface, also called energy release rate, the following equation studied by madani et al . Can be applied: (10)gd=(11)/1+(11)/24cosh2k12+k22gp=1222kp2 . In (8), (10) gd and gp are the strain energy release rate for deflection and penetration; k1 and k2 are the stress intensity factors for the interface crack; kp is the value of stress intensity factor, for a particular case, when the crack from material 1 penetrates into material 2 (see figure 2). Analytical techniques and the green function can be employed to describe the behaviour of bimaterial compounds by calculating numerical solutions of singular integral equations, as was applied by erdogan et al . And used by pruncu et al . And azari et al ., which yield the following expression: (11)ki(a)=211+k1a0g(1)kib=211+k1a0g1 . A more general form of such approach could be structured using an algorithm that describes the numerical procedure for obtaining the different values of the function g(ti) by the following . (2) for k ranging from 1 to n, we need a computing route for xk and f(xk). (3) for every xk and for i variants from 1 to (n 1), we have to calculate the first ti that is a weight function of the jacobi polynomials described as follows: (12)1ng(ti)1tixk+k(xk, ti)=0 withti = cos2i12n, i=1,,nxk = coskn, k=1,,n1 . (4) the computation then yields a matrix relationship expressed as follows:(13)1t1x1+k(x1,t1)1t2x1+k(x1,t2).... 1tnx1+k(x1,tn).............................. 1t1xk+k(xk, t1)1t2xk+k(xk, t2).... 1tnxk+k(xk, tn)gt1gt2 .... gtn = fx1fx2 .... fxk . G are obtained by multiplying the transposed of the matrix by the vector f(xi). One has the following: a0 is half - length of the crack; 1, 2 are shear modulus for materials 1 and 2; c is the distance from the middle of the crack at the interface plane; r, are polar coordinates, k = 3 4 for the plane strain case and k = (3)/(1 +) for the plane stress case, is poisson coefficient, and g is the parameter that expresses the magnitude of the applied load . Another analytical technique, which was employed by chen et al . Using complex potential values, was obtained in the following manner: (14)ki(b)=limr02rx=22k2 + 1a0m=11mmki(a)=22k2 + 1a0m=1m, where a0 is half - length of the crack, m = m/b, m = 0,1, 2,3,, b is the distance between the interface and the crack front, x is the distribution of stress in front of the crack, k = 3 4 for the plane strain case and k = (3 4)(1 +) for the plane stress case, and 2 is shear modulus for the material in which the crack is located . Because of its multiple properties, steel is one of the most versatile materials used in industrial engineering applications . The european standard (en) reveals different types of steel employed in fields such as the automotive industry and aeronautical design . In this work we considered two steel alloys: he360dr and s420mc . Their mechanical characteristics are summarized in table 1 . During the lifetime of service, in contact with the environment this metal may develop problems that could be prevented by applying the above - described process of hot - dip galvanization . The specimens obtained after hot - dip galvanization were submitted in laboratory to fatigue tensile test in order to detect their behaviour under fatigue conditions conforming to real life and to observe the changes that occurred in the metallic zinc layer . The fatigue tests were performed on a servohydraulic testing machine capable of applying axial loads up to 100 kn, using a sinusoidal load wave, with a frequency of 30 hz and a strength ratio r = 0.1 . After the fatigue test the specimens were experimentally analysed by optical microscopy and scanning electron microscopy (sem). During observation with the optical microscope, a sample of length 5328 m was considered . To simplify the management of these optical microscope observations, we divided the sample size into 16 units with a length of about 333 m . The main purpose of this was to analyse (i) the number of cracks per unit of length; (ii) whether the evolution of the number of cracks was constant over all layers applied; (iii) which material was prone to develop longer cracks, and finally if the zinc layer was constant over the whole steel surface . The first result was the average number of cracks per unit of length, as summarized in table 2 . The letters b and h in table 2 indicate the time of immersion in the zinc bath, b being 3 minutes of immersion and h 7 minutes . The numbers 9, 8, 7, and 2 indicate the specimen number analysed . From table 2 we can observe that the average number of cracks per unit of length is about 6/11 for he360dr and 7/8 for s420mc . A first remark proves that the number of cracks increases with the time of immersion . The results are plotted in figure 3 and highlight the number of cracks for all 16 units of length . Figure 3 shows that the number of cracks on the entire length of zinc layer that encloses each unit is overall scattered; however, on the local case of two / three consecutive units, the number of cracks per unit seems to be almost uniformly distributed . A key element for determination of the efficiency of the coating process may be deduced from the evolution of cracks lengths before and after the fatigue tests . According to the observations shown in figure 4, there was a significant change of crack length as a consequence of fatigue test . A gap of about 25 m in crack length before and after cyclic load was found due to the weakened structure of material . This observation was done in a useful sample area (ua) and then in the area where the test had less influence on the behaviour of the piece, marked as the nonuseful area (nua). The uniformity of the zinc layer was considered as another issue that can stimulate the crack behaviour ., the zinc layer deposited over the steel alloy is uniformly distributed, having a value of 5080 m . The particularity of the size of substrate of he360dr h8 materials, that is, the thin thickness, may be explained as a consequence of immersion time . So, because the time of immersion within the bath of zinc was less than the time imposed by our methodology, the thickness of substrate was lower; this means that instead of 7 minutes we found that the real time of immersion was about 5 minutes . The optical measurements confirmed that the thickness deposited over the steel pieces was uniform and show that the zinc layer is composed of several multilayers . The substrates are denominated by gamma (), delta (), zeta (), and zinc eta (), as shown in figure 6 . Figure 6 proves that most of the cracks are located in substrate and may occur along the zinc grain boundaries . Indeed, from our observations these cracks arise in this substrate and then spread toward the steel - zinc interface . However, the analysis indicates a decrease of the crack magnitude near the interface, which means the crack growth is interrupted before it reaches the interface . Observations from scanning electron microscopy (sem) exhibit even more clearly that, during the hot - dip galvanized process (hdg), the quality of the bonded layers may influence the direction of the cracks, if the cracks touch the steel - zinc interface . This troublesome problem produces a sort of debonding area which forms a path for surface deflection of the cracks . The debonding area in steel - zinc adhesive layers is illustrated in figure 7, created by the propagation of cracks at the interface between the zinc and steel and into the zinc substrates zeta () and eta (). For bimaterials, the interface crack problems could be due to the nonhomogeneity of the materials, which develop in the direction parallel to the crack tip . From these preliminary findings we could confirm that during the hdg process the zinc layer is uniformly deposited and the average number of cracks is significant on this layer . It seems that during the fatigue process the cracks get longer and spread toward the bonding interface, arresting at the bimaterial interface . In the worst scenario, numerical computational technique was implemented by abaqus software, in order to corroborate the experimental data with analytical and numerical simulations and to highlight the effects of cracks that develop during the hot - dip galvanizing process . In order to implement the experimental data in the numerical model, besides, this value corresponds with the thickness measured under the s420mc h2 materials (see figure 5), and it allows making the assumption that the crack / cracks imposed in our models will spread only toward the interface steel / zinc . If we consider a smaller thickness, for example, the size of layer measured under he360dr b9 material, and we adopt in the numerical model the critical size of crack detected after the loading test (see figure 4), it will be obvious that the crack will cross all the coating substrate . But this issue is far from our experimental observation, since we had observed that the crack growth is only toward interface steel / zinc . Experimental data were introduced in our numerical model as the thickness size of zinc layer (figure 5), while the contour of zinc layer on the entire material surface is considered homogenous and uniform (figure 5). An initial length of crack and the maximum length of crack (see figure 4) were imposed as constraint in the numerical program . The principles of linear fracture mechanics (lfm) were implemented in the numerical model in order to explain behaviour of crack at the interface steel / zinc that is assuming that all the materials contain a minimum flow that will grow during the mechanical loading . So, considering the crack located in zinc substrate (figure 5) that will develop perpendicular to the applied load, it is possible to denote this state by mode i fracture . It should be noted that in the numerical model a mechanical loading of 500 mpa corresponding to an average of ultimate tensile strength of galvanized materials (see table 1) was imposed . A value of about 30 m was selected as the initial length of the crack / cracks before propagation, in agreement with experimental data (figure 4). However, we know that the crack is bounded by two fronts, a and b. in this model, we assumed that the front of crack b was static and so it could not propagate, whereas the only front of crack a would spread . A basic model composed of two materials, m1 and m2, as shown in figure 8(a), which forms the bimaterial body, was implemented . M2 represents the steel and m1 the zinc layer, delimited by the following values: h1 = 0.08 mm, h2 = 19.84 mm, c = 0.045 mm, w = 15 mm, 2a0 = 0.030 mm, and = 0.5 m and submitted to a mechanical load, = 500 mpa . The applied load in this system will have direct consequence to the crack behaviour and define the presence of stress singularity on both fronts of the crack, tips a and b. the configuration for the crack fronts is shown in figure 8(b). Settlement of the crack propagates performance was evaluated using the stress intensity factor (sif) parameter, derived from the singularity 1/r advanced in front of the crack tip . Since the value of the stress intensity factor (sif) is obtained, we proceed to conclude if the crack crosses into the second material, ends at the bonded interface, or deflects between these two bodies . (a) model with one crack in the bimaterial: in this case one single crack of an initial size of 30 m was considered . Then the length was increased by 3 m in each simulation up to the maximum of 60 m (i.e., close to the experimental analysis shown in figure 4). Figure 9 shows how the stress distribution increases with the length of crack, assuming that the initial crack had the same stress value at both fronts a and b. two - dimensional finite - element meshes are virtually symmetrical near this bottom (crack fronts) and the symmetry showed almost the same value as the stress distribution, for each of the crack fronts, during the simulation . The shape of the stress - strain curve as a function of the crack length is illustrated in figure 10 . The shape of the curve grows wide with the increasing of crack length in front of crack tip a. the effect of stress distribution in front of crack can be converted into basic parameters that show the impact of crack behaviour, that is, the stress concentration factor (scf). Obviously, the stress concentration factor is the ratio of the maximum stress over the nominal stress, denominated kt and expressed as (15)kt=maxnom. While the front of crack b does change, the main role in this research was played only by the front of crack a located near the interface of the bimaterial . Thus, figure 11 shows the effect of scf in the front of crack a. these results were corroborated with the theoretical stress concentration factor (scf) obtained with the online software . The results presented in figure 11 show a good agreement and underline that when the crack reaches the interface, there is a sudden increase in the stress distribution value . This sharp rise in values may result in the creation of a surface called a debonding area, as shown in figures 9(c) and 9(d). Then, by assessing the crack propagation with lfm using (crack) stress intensity factors (sif), k, it is possible to establish where the crack stops . To achieve even better accurate results, a comparison between an analytical model reported by erdogan et al . And the difference between the numerical and analytical results is due to the use of a small number of constants in the analytical model . The results are shown in figure 12, demonstrating the trend of the (crack) stress intensity factors (sif) during applied stress, in front of cracks a and b. from the curves drawn below, it can be seen that the value of the sif increases with the crack length, and the crack propagates up to a length of about 50 m . Then stabilization and even a decline of the sif value the value of sif will increase sharply only if the flow area denoted as well as since the value of the (crack) stress intensity factors (sif) is low for the front of both cracks a and b, it seems that the crack cannot cross into the second material . (b) model with two or more cracks: in the second assumption, a multiple cracks model, namely, with 3 cracks, was implemented using almost the correspondent algorithm but specifying 3 initial cracks with an initial size of 30 m for each crack, and then each crack would increase by 3 m, up to the maximum size of 60 m . Thus, the maximum cracks value is assigned when the cracks reach the steel - zinc interface . In this model with 3 cracks the applied load (500 mpa) was considered as statement from the case of the model with a single crack . The motivation to implement a model with three cracks aims to detect whether the situation changed due to the increased (crack) stress intensity factor (sif) values, as a result of the cumulative energy developed by these 3 cracks . Related work has been reported by song et al . Who declared that the interface crack will propagate if the principal maximum stress at the crack tip exceeds a critical value . Thus, confirming our initial supposition, the results presented in figure 14 show an increase for maximum stress value within front of the cracks . At the same time, the surface denominated debonding area appears more pronounced . The tendency was confirmed from the development of the (crack) stress intensity factors (sif), k values, where the results are reported in figure 15 . The shapes of the curves in figure 15 show a similar trend obtained by the one in the case with one crack except for the fact that crack 2 shows the highest influence of propagation, derived from the cumulated extension efforts from another two cracks . Another thing to note is the gap difference of sif for crack lengths 57 m and 60 m . This difference could be explained by the appearance of the previously mentioned debonding areas (i.e., imposed length for debonding area considered in this research was a maximum of two initial crack lengths, because after this size the peeling processes occur). Although the difference is evident, it does not exceed the critical value of mode i fracture toughness; for example, the value cited by ashby for steel is about 80170 mpa m. consequently, the crack will not cross into the steel material and in the worst case the crack / cracks will form a large bifurcation at the interface between these two materials . This research paper highlights by means of experimental, numerical, and analytical tool the behaviour of a bimaterial zinc / steel interface submitted to mechanical loading . In particular, the case of crack / cracks at the bimaterials interface was considered . The main objectives of this paper were to assess the behaviour of the crack / cracks generated at the end of the hot - dip process and to reveal that the numerical computations are in a good agreement with the experimental outcomes . Optical microscopy and scanning electron microscopy (sem) techniques were involved to evaluate the experimental performance of the bimaterials compound . Postmortem analysis of the fracture surfaces emphasized the uniformity of the zinc layer over the steel surface and provided accurate information related to the average of cracks length (figure 4). In addition, this technique allows quantifying the number of cracks (figure 3) that forms in the zinc layers . In the meantime, this assessment provides patterns about the evolution of crack from incipient phase, where the cracks arise, and how far they spread . In numerical computations, simulations of the model considered were run in two different situations, namely, when the bimaterial contains just one crack or else 3 cracks, in order to prove the agreement between computation and experimental outcomes . Besides, to get even accurate results, the analytical model used by erdogan et al . Was also confronted . The sif were calculated to obtain value of the stress singularity that characterizes the crack evolution in the bonding area of bimaterial, for both crack tip values, that is, the fronts of cracks a and b. the analytical, numerical, and experimental assessments prove that the crack / cracks that arise during the hot - dip galvanized steel process will propagate during the mechanical fatigue test . It was also established that the crack / cracks will stop near the steel - zinc interface at a distance of about 3 m and only in particular cases yield a deflection at the bimaterial interface . To summarize, the results may confirm that cracks reduce the life span of the bimaterial but are not responsible for a direct degradation of the steel . This method is therefore useful for employment in damage models that include the safety factor condition . Finally, a nondestructive method should be employed to detect the behaviour of bimaterials for a better calibration.
|
Epilepsy is a common and serious chronic neurological disease that affects over 50 million people worldwide . Anti - epileptic drugs (aeds) are effective at controlling seizures in many patients, acting through a range of neuronal targets, including ion channels, neurotransmitter release, and receptor mechanisms.1, 2 however, a third of patients with epilepsy fail to achieve seizure freedom, and current aeds do not show disease - modifying properties . Future treatments for epilepsy need to differentiate from currently marketed drugs, for example, by having a novel mechanism(s) of action or providing disease - modifying effects.1, 2 acquired epilepsy is thought to result from disturbances to the expression and function of neurotransmitters and their receptors, ion channels, and signaling components, as well as altered metabolism, neuronal and glial microstructure, neuroinflammation, and other mechanisms.3, 4, 5 it is likely that disease - modifying treatments will need to influence multiple genes within a given pathway or in various independent pathways . Potential gene network control points were recently identified and include master regulators of transcription and neuroinflammation, epigenetic factors, and noncoding rnas . Micrornas (mirnas) are a conserved family of endogenous small noncoding rnas that regulate protein levels in cells by post - transcriptional control of mrna stability and translation.9, 10 this is achieved by sequence - specific binding of the mirna to complementary bases in the mrna target . Since this generally requires only a 7- to 8-nucleotide match, individual mirnas can potentially target large numbers of mrnas . This provides the ability to regulate entire gene networks or multiple biological processes and has been demonstrated in the brain . Microrna-134 (mir-134) was identified as a brain - enriched, neuronally expressed mirna that controls dendrite spine morphogenesis, via repression of lim domain kinase 1 and other targets.14, 15 this is potentially important for disorders of hyperexcitability, since dendritic spines are contact points for excitatory communication and there is evidence that reorganization of dendrites is a feature of experimental and human epilepsy.16, 17 we identified mir-134 among upregulated mirnas profiled in areas of hippocampal damage following status epilepticus induced by intra - amygdala kainic acid (ka) in mice . Expression of mir-134 is also upregulated after neuronal stimulation and seizures in various other in vitro and in vivo models,15, 19, 20, 21, 22 and mir-134 is overexpressed in the resected human neocortex from patients with intractable temporal lobe epilepsy (tle). Silencing mir-134 by intracerebroventricular (i.c.v .) Injection of locked nucleic acid (lna), cholesterol - tagged antagomirs (ant-134) reduced levels of mir-134 for at least a month and rendered mice refractory to the convulsant effects of both ka and pilocarpine.19, 22 consistent with known mir-134 targets, lim domain kinase 1 and levels of other mir-134 targets were higher in ant-134-treated mice after status epilepticus and the dendritic spine volume was increased.19, 22 notably, injection of ant-134 after status epilepticus suppressed the later occurrence of spontaneous recurrent seizures in the intra - amygdala ka model in mice . There is significant interest in developing mirna - based therapies.23, 24 there are also barriers to antisense - based approaches and there has been some disengagement of industry from pursuing such efforts . This is likely to be a problem for any new therapy for epilepsy, particularly one that is not based on traditional small molecule chemistry.1, 2 pre - clinical development of an mir-134-based treatment for epilepsy might be more attractive if additional important questions are answered . Principally, work to date has only tested ant-134 in mouse models of status epilepticus . Proof of seizure - suppressive effects of ant-134 in a non - status epilepticus model or in another species would bridge the gap in evidence and facilitate pre - clinical development of ant-134-based treatment for epilepsy.26, 27 here, we evaluated mir-134 expression in the resected hippocampus from patients with pharmacoresistant tle and we tested ant-134 in three different models . We used the pentylenetetrazol (ptz) model in mice, a popular method for screening putative anticonvulsive effects that triggers seizures via -amino butyric acid (gaba) blockade.26, 28 second, the perforant pathway stimulation (pps) model, a toxin - free model of acquired epilepsy based on nonconvulsive status epilepticus that avoids the confounding influence of exposing the brain to chemoconvulsants, was used in rats . Finally, we used a high - potassium model of epileptiform activity, using ex vivo brain slices from rats pre - treated with ant-134 . Our results establish that targeting mir-134 offers broad anticonvulsant and possibly disease - modifying effects in experimental epilepsy, which may encourage pre - clinical development of ant-134 as a treatment for epilepsy . For this, we analyzed levels of mir-134 in the surgically obtained hippocampus from adults with pharmacoresistant tle and we compared findings to autopsy hippocampal samples from people who died of causes unrelated to neurological disease . These samples were used previously to analyze expression of other genes, and clinical data for both groups are briefly summarized in tables s1 and s2 . There were no between - group differences in patient age, and each group included males and females . We detected higher levels (p = 0.037) of mature mir-134 in the tle specimens compared to autopsy samples (figure 1a). This difference is unlikely to be an artifact of post mortem delay, since mir-134 levels did not decrease in simulated autopsy experiments lasting up to 12 hr . We began by establishing dosing parameters in the mouse ptz model . Generalized tonic - clonic seizures were first reliably elicited at a dose of 60 mg / kg in c57bl/6j mice (figure 1b). A dose of 80 mg / kg elicited generalized tonic - clonic seizures in all mice and with a more consistent and shorter latency than with the 60 mg / kg dose (figure 1b). A dose of 100 mg / kg also produced rapid - onset tonic - clonic seizures in all mice but was associated with high mortality (figure 1b and data not shown). Ordinal logistic regression analysis was used to explore the dose dependence of the ptz - induced convulsions . Ptz dose was significantly associated with racine scores (figure 1c). A dose of 80 mg / kg was selected for further experiments . To obtain molecular evidence for ptz - induced seizure activity in the model, we measured expression of activity - regulated genes in the hippocampus . Transcript levels of fbj osteosarcoma oncogene (fos), a calcium - dependent marker of neuronal activity and activity regulated cytoskeletal - associated protein (arc), another immediate early gene responsive to intense neuronal activity, were strongly increased in the hippocampus 30 min, but not at 4 hr, after ptz - induced seizures (figures 1d and 1e). There was no evidence of irreversible neuronal injury in tissue sections from mice after ptz, as assessed by fluoro - jade b (fjb) and neun (rna binding protein, fox-1 homolog [c. elegans] 3) staining (data not shown). Expression of mir-134 is known to increase in various in vitro and in vivo seizure models.15, 19, 20, 21, 22 we therefore investigated whether ptz - induced convulsions alter mir-134 levels in mice . Taqman mirna assays showed that levels of mature mir-134 were significantly increased in the hippocampus, but not in the cortex, 30 min after ptz - induced generalized tonic - clonic seizures in mice (figure 1f and data not shown). Injection of antagomirs targeting mir-134 (ant-134) in mice.19, 22 previous work has established a dose of these antagomirs that reduces hippocampal mir-134 levels by over 90% by 24 hr after injection . Accordingly, we tested ptz responses 24 hr after injection of ant-134 and compared them to responses in mice that received a scrambled antagomir (scr). In scr mice, delay to onset of first tonic - clonic seizure after ptz injection was similar to that observed before in control mice (figure 2a, and compare to figure 1b). Thus, the control antagomir did not alter the normal response to ptz in the model . The time to first ptz - induced tonic - clonic seizure was significantly longer in mice injected with ant-134 compared to scr - injected animals (figure 2a). The severity of racine - scored ptz - induced seizures was also significantly lower in ant-134- compared to scr - injected mice (figures 2b and 2c). Analysis of electrographically recorded seizure activity determined that electroencephalography (eeg) total power was lower in ant-134 mice compared to the control group after ptz (figure 2d). We next analyzed brain tissue samples from scr- and ant-134-injected mice for evidence of mirna silencing and differences in expression of activity - regulated genes . Analysis of the hippocampus obtained after ptz - induced seizures confirmed that mir-134 expression was lower in ant-134 pre - treated mice compared to scr - treated animals (figure 3a). Ant-134 had no effect on levels of an unrelated mirna (figure 3b). Next, we assessed expression of arc and c - fos as molecular markers of recent neuronal activity to support the clinically scored behavior and eeg differences in ant-134 mice . Quantitative real - time pcr analysis revealed increased c - fos expression in the hippocampus of scr - injected mice after ptz - induced seizures (figure 3c). In contrast, c - fos levels were lower in ant-134-injected mice, consistent with reduced seizure severity (figure 3c). This difference was also apparent in the neocortex from the same animals (figure 3c). Expression of arc was increased in the hippocampus of scr - injected mice that received ptz . Arc levels were not significantly different in ant-134 mice compared to scr - injected animals in the hippocampus and neocortex after ptz - induced seizures (figure 3d). We turned next to the pps model in rats, first investigating effects on mir-134 levels . Taqman mirna assays showed that levels of mature mir-134 were not significantly modified in the hippocampus of rats at two different time points (figure 4a). Next, we assessed the effect of silencing mir-134 before stimulation on seizure severity during status epilepticus . Rats were pre - treated with ant-134 or scr (i.c.v .) 24 hr before the 8-hr stimulation protocol . Analysis of electrographically recorded seizure activity determined that scr - injected rats presented a mean (sem) increase of 1,304.3% 94.9% in eeg total power relative to baseline . This was similar to animals that were stimulated but not receiving the oligonucleotide (data not shown). In rats pre - treated with ant-134, the severity of evoked seizures in the pps model was similar: eeg total power during seizures was a mean (s.e.m) of 1,244.6% 82.7% (percent of baseline). Despite not seeing an acute anticonvulsant effect of ant-134 in the pps model, we were nevertheless interested in whether silencing mir-134 after status epilepticus in the model would alter the emergence of recurrent spontaneous seizures . A key prior finding was that silencing mir-134 after status epilepticus induced by intra - amygdala ka reduced the subsequent occurrence of spontaneous recurrent seizures by over 90% . For these studies, rats underwent 8-hr stimulation of the perforant pathway to induce epilepsy and the i.c.v . Rats were then monitored with video - eeg until a first spontaneous seizure was recorded, typically 1025 days after pps, and they were then followed for a further 8 weeks (figure 4b). Epilepsy developed in all scr - injected rats over the expected course, with the first spontaneous seizures appearing 14 weeks after status epilepticus (figures 4b and 4c). Scr - injected rats averaged 20 spontaneous seizures recorded during the 8-week recording time (figures 4d and 4e). In contrast, no spontaneous seizures were detected over the 8-week period in six of seven rats injected with ant-134 after status epilepticus (figures 4d4f). Epilepsy emerged in only a single rat treated with ant-134 (figures 4d and 4f). The fisher exact test determined that there was a significant difference in epilepsy development between the groups (p = 0.005). In terms of effect size, ant-134 prevented 86% of the risk of epilepsy, with a 95% confidence interval (ci) of 12%98% . An analysis of the duration of spontaneous seizures (electrographically defined) revealed that when spontaneous seizures occurred, they were similar between groups . That is, the average duration of a spontaneous seizure in scr - treated rats was 53.7 14.4 s (n = 20 seizures, from five rats), which was similar to the duration in epileptic rats in the pps model that did not receive an i.c.v . Injection (49.4 15.9, n = 20 seizures). In the ant-134 rat that developed epilepsy, the average duration of a spontaneous seizure was 52.3 16.2 s (from n = 12 seizures). Having observed a disparity between the acute anti - seizure effects of ant-134 pre - treatment in the ptz and pps models, we sought to examine the effect of ant-134 on naive, non - epileptic tissue and whether the effects were due to long range networks or if local circuitry was sufficient to mediate any seizure protection . We injected ant-134 in vivo in rats and subsequently prepared ex vivo brain slices (figure 5a). These slices were then exposed to a 9-mm k seizure challenge, to determine whether ant-134 protects against epilepsy in local circuits of the isolated slice in the absence of epileptogenesis . Onset of activity was delayed in ant-134-treated slices by 176 s relative to the control (figures 5b and 5c). This effect was statistically significant (mann - whitney u test, p = 0.002, = 0.025, power = 0.87). We also compared the power of epileptiform activity and duration of seizure - like events in these data; these effects were not statistically significant (power: t test, p = 0.70; duration: mann - whitney u test, p = 0.067). This finding suggests that ant-134 can confer seizure resistance in naive tissue and thus mediate its effect even in the absence of epileptogenesis . In addition, preservation of the seizure resistance in isolated slices indicates that at least some of the effects of ant-134 are due to local changes in activity . The present study provides important additional evidence of the anticonvulsant and disease - modifying effects of lna - based antagomirs targeting mir-134 in animal models of epilepsy . Our study shows that ant-134 is an anticonvulsant in an acute chemoconvulsant model (ptz in mice) and ant-134 had anti - epileptogenic activity in the perforant pathway stimulation model of epilepsy in rats . Ant-134 also confers resistance to epileptic activity in naive tissue, reflected as a delay to activity onset following a seizure challenge in ex vivo brain slices . We also report that mir-134 levels are elevated in the hippocampus of patients with pharmacoresistant tle . The therapeutic potential of targeting mir-134 in established epilepsy will require additional studies, but our findings may encourage further research or pre - clinical development of this mirna - based treatment for epilepsy . Despite the recent introduction of two additional aeds (perampanel and brivaracetam), new drug development in epilepsy faces significant challenges.1, 2, 32 new targets are required that can treat pharmacoresistant patients or have disease - modifying effects that are not served by current therapies . Mirnas have emerged as potential targets of the future via their influence on neuronal microstructure, gliosis, neuroinflammation, and ion channels.8, 33 silencing mir-134 has produced the most convincing anti - seizure effects to date, reducing status epilepticus in pre - treatment paradigms in the intra - amygdala ka and pilocarpine models and exerting potent long - term effects on spontaneous seizure development.19, 22 this mirna is also an attractive target, since studies show increased levels of mir-134 within the temporal lobe of adult and pediatric patients with intractable epilepsy.19, 20 we report here that mir-134 is also elevated in the hippocampus of adults with pharmacoresistant tle, although there are potential confounders with comparing resected material from patients to autopsy control samples . The present study has answered key questions that could facilitate pre - clinical development by showing that ant-134 has anticonvulsant effects in non - status epilepticus models and is disease modifying in another species . The first important finding was that pre - treatment with ant-134 strongly suppressed seizures in the mouse ptz model . Effects on both clinical behavior, including delaying the time to first convulsive seizure, and electrographic seizure activity were seen . Thus, lowering brain levels of mir-134 can exert anti - excitability effects, and this implies that mir-134 has a role in setting excitability thresholds in the brain . This is thought to be due to regulation of proteins that control dendritic morphology,14, 15 although other targets are known . Ant-134 did not fully prevent seizures in the ptz model; rather, it delayed and minimized their severity, a finding most closely matching the effect of ant-134 in the pilocarpine model of status epilepticus . It may not be possible to fully prevent all seizures using ant-134 in chemoconvulsant models, but further adjustments to antagomir dose or delivery may yield optimal seizure - suppressive effects . Ptz triggers seizures via gabaergic blockade; this differs from the mechanism by which status epilepticus is induced by ka and pilocarpine, which work by promoting glutamatergic and cholinergic transmission, respectively . This suggests that ant-134 may be effective for epilepsies of various etiologies, which, in patients, can vary considerably between trauma, stroke, infection, genetic, and other causes . Our studies also show that ptz - induced convulsions increase brain levels of mir-134, transcription of which is probably mediated by myocyte enhancer factor 2c . We did not observe an increase in mir-134 after perforant pathway stimulation in the rat . This was surprising, although changes to mir-134 levels are not always detected after chemoconvulsive stimuli, and we cannot rule out a technical explanation (e.g., the time points selected or a subfield - specific effect that was masked by the use of the whole hippocampus). Our study included an analysis of the short - term effects of ant-134 on neuronal activity - regulated genes in the ptz model . Expression of genes such as c - fos and arc is a well - established surrogate marker of recent seizure activity, the protein products of which are involved in coordinating synaptic plasticity and adaptation to excessive neuronal stimulation.38, 39 unexpectedly, only levels of c - fos, and not arc, showed the expected reductions in ant-134 mice after ptz seizures . It is known that c - fos induction is calcium dependent, whereas arc expression can be induced via calcium - independent pathways.38, 39 therefore, ant-134 treatment may have reduced seizure severity sufficient to prevent c - fos induction, such as by minimizing n - methyl - d - aspartate (nmda) receptor opening, but enough residual neuronal excitation remained to upregulate arc . These findings provide additional evidence of the scale and nature of seizure suppression by ant-134 and suggest molecular markers that can distinguish effects of mirna manipulations on different components of seizure responses . In the present study, we observed that pre - treatment of rats with ant-134 did not protect against perforant pathway stimulation - induced status epilepticus . While there are examples of anticonvulsants producing effects in some but not all models, these findings suggest that ant-134 may have the most clinical value as an anti - epileptogenic treatment . Previous work showed that injection of ant-134 after status epilepticus in mice suppressed the later occurrence of spontaneous seizures by 90%, evidence of a disease - modifying effect in the intra - amygdala ka model . Here, we found nearly identical anti - epileptogenic effects of ant-134 in a different model in rats . This is the only demonstration, to our knowledge, of any disease - modifying treatment in the pps model in rats . The pps technique induces hippocampal sclerosis and recurrent spontaneous seizures,29, 40 and it provides a means to trigger epilepsy without the bias or other issues associated with chemoconvulsants . Ant-134 was injected shortly after triggering status epilepticus in order to model a reasonably realistic clinical scenario, such as a patient being treated shortly after an initial precipitating injury . Ant-134 had dramatic and potent effects, with the majority of ant-134 rats (six of seven, 86%) never developing spontaneous recurrent seizures . Notably, spontaneous seizures in the study with the intra - amygdala ka model did occur in all ant-134 mice, albeit with dramatically lower seizure frequency . This difference may relate to the extent of hippocampal injury or another aspect of the epileptic phenotype, such as the frequency of spontaneous seizures . Thus, presently we see a possible additional therapeutic action of ant-134, whereby post - treatment is capable of fully preventing epilepsy at least in some models . We cannot, of course, exclude that epilepsy might have developed in some of the ant-134 rats at some point in the future . However, we recorded for 8 weeks beyond the standard latent period . We further corroborated the anti - seizure effect of ant-134 by using an acute seizure challenge with high potassium in otherwise healthy (ex vivo) tissue . Inhibitory neurotransmission is retained in this model (in contrast to ptz) and there is no hippocampal sclerosis (unlike pps), further suggesting that ant-134 can be therapeutic in multiple epileptic syndromes with varying mechanisms . We observed a delay in the onset of epileptiform bursts in brain slices that had been pre - treated with ant-134 . This finding suggests that epileptogenesis is not required for ant-134 to mediate its effects on seizure onset . We did not see any significant changes in the power or duration of epileptiform activity; however, these parameters are highly variable in brain slices, which can obscure potential effects . In addition, we propose that ant-134 can mediate seizure protection in the hippocampus via effects on local circuitry, because long range connections would likely be severed during the slicing process . The anti - epileptogenic actions of ant-134 may be independent of the etiology of the initial precipitating injury, although this will require further testing (e.g., in models of trauma or infection - induced epilepsy). In addition, upregulation of mir-134 is not essential for ant-134 to produce anti - epileptogenic effects, since mir-134 levels were not altered after pps - induced status epilepticus . Thus, epilepsy can be dramatically suppressed in two different in vivo models, and one in vitro, in two different species . This provides strong support for and is an argument for further development of ant-134 for epilepsy treatment or prevention . Antagomirs targeting a liver - expressed mirna have been given to humans and were found to be well tolerated and effective against hepatitis c in clinical trials . There are concerns, obviously, that because ant-134 can alter dendritic spines, it could have effects on cognition . Studies to date have not identified such problems, with natural exploratory behavior and performance in a hippocampus - dependent task found to be normal in mice a few days after i.c.v . Injection of ant-134.19, 22 however, more demanding tests of cognition or learning will need to be performed . Another factor that argues for general safety is that mice and rats have been recorded for at least 2 months after brain injections of ant-134 . Nevertheless, pre - clinical development will necessitate an extensive battery of toxicity and safety testing . Work to date on ant-134 satisfies certain recommendations for testing and evaluating novel therapies for epilepsy, with seizure - suppressive effects demonstrated in five different models and two different species.1, 2, 43, 44 there are, however, additional seizure models that could be used during any future pre - clinical development . This includes kindling, a popular model that has been successful in identifying aeds with novel mechanisms of action . While this is not an essential step before pre - clinical development, sex differences in mirna inhibitor responses may be worth investigating in future studies and sexual dimorphism in mirna expression has been reported, although not for mir-134.46, 47 it will also be of value to understand how ant-134 produces its potent seizure - suppressive effects . The most likely mechanism is upregulation of one or more proteins due to de - repression of a mir-134 target . Previous work has shown that mir-134 is uploaded into the rna - induced silencing complex after seizures, which facilitates targeting of mrnas, and in vitro studies suggest that the neuroprotective effects of ant-134 are due to de - repression of lim domain kinase 1 . Ant-134 treatment also increases dendritic spine volume and changes spine number in the hippocampus,19, 22 which could influence excitability and would also be consistent with a mechanism involving protection of mir-134 targets such as lim domain kinase 1 or pumilio rna - binding family member 2 . Altered spine volume and number is consistent with our observation of a robust local effect of suppressing mir-134 on delaying epileptiform activity, although additional effects on long range connections cannot be ruled out . We must also consider that the acute seizure - suppressive effects and long - term anti - epileptogenesis effects may arise from different mechanisms . Ultimately, in vivo studies will be necessary to determine the anti - seizure mechanism of ant-134 (e.g., by analyzing gene expression networks, quantifying the proteome, and applying techniques to validate antagomir - mirna targeting such as polysome shift assays). What are the next steps for translation or pre - clinical development? An obvious question is whether and how antagomirs could be given to patients . Their large size precludes their passing an intact blood - brain barrier (bbb). Recent work has explored methods to circumvent the bbb, including conjugating antagomirs with brain - penetrating peptides or administering antagomirs via intranasal injection.19, 51 the bbb may also be open after certain epilepsy - precipitating injuries or it can be physically breached, such as through use of ultrasound . Another question is whether ant-134 injection into already epileptic animals could alter the frequency or duration of spontaneous seizures or attendant hippocampal pathology . Success with that approach could provide novel treatment opportunities for the population of drug - resistant patients for whom surgery or other alternatives to aeds are either not possible or not effective currently . In summary, the present study provides important additional validation of the potent seizure - suppressive and possibly disease - modifying effects of ant-134 in two different animal models and one brain slice model . The effectiveness of ant-134 and the potency of seizure suppression suggest a target for drug development in epilepsy that could provide additional effects beyond those provided by any currently marketed drug for epilepsy . This study was approved by the ethics (medical research) committee of beaumont hospital of dublin (no . 05/18) and written informed consent was obtained from all patients . The control (autopsy) hippocampus (n = 12) was obtained from 12 individuals . Patients (n = 12) were referred for surgical resection of the temporal lobe by an epileptologist (n.d .) Following neurological assessment, video - eeg recording, and mri / neuroimaging . Each patient was determined to have medically intractable tle with a history of recurring seizures (table s2). The hippocampus was obtained and a portion of each specimen was frozen in liquid nitrogen and stored at 70c until use . A pathologist (m.a.f .) Assessed the hippocampus as part of the pathologic evaluation, addressed the degree of hippocampal sclerosis, and described other pathologic changes . All animal experiments were performed in accordance with the european communities council directive (2010/63/eu). Procedures in mice were approved by the research ethics committee of the royal college of surgeons in ireland (rec-842), under license from the ireland health products regulatory authority (ae19127/001). Procedures in rats were performed under authorization of the philipps university bioethics committee and were approved by the local regulation authority (regierungsprsidium gieen), or they were performed according to the uk animals (scientific procedures) 1986 act (ppl 70 - 7684) and approved by local ethical review (university college london). Male adult c57bl/6j mice (2025 g) and male sprague - dawley rats (325350 g or 200300 g; all from harlan) were used in all studies . Animals were housed in on - site barrier - controlled facilities having a 12-hr/12-hr light / dark cycle with ad libitum access to food and water . Mice were equipped for eeg recordings under surgical anesthesia (isoflurane; 5% induction, 1%2% maintenance) in a mouse - adapted stereotaxic frame . Body temperature was maintained within the normal physiological range with a feedback - controlled heat pad (harvard apparatus). After a midline scalp incision, partial craniectomies were performed and animals had skull - mounted recording electrodes placed and fixed with dental cement . A second cohort of mice had eeg electrodes and a guide cannula implanted to allow i.c.v . This cannula was placed on the dura mater with the following coordinates from the bregma: anterior - posterior (ap), + 0.3 mm; lateral (l), + 0.9 mm; and ventral (v), 2.0 mm . After recovery from surgery, mice were connected to the lead socket of a swivel commutator, which was connected to a grass twin digital eeg system .]) With different doses of ptz (60, 80, or 100 mg / kg). Lorazepam (8 mg / kg, i.p .) Was administered after the first tonic - clonic seizure to reduce morbidity and mortality . Mice were followed for 30 min or 4 hr after ptz administration for the appearance of seizures by electrographic and behavioral methods . After the observation period, mice were deeply anesthetized (pentobarbital) and transcardially perfused, and their brains were removed for analysis of gene expression or histological assessment . Injection of 0.12 nmol/2 l 3-cholesterol - tagged locked nucleic acid oligonucleotide targeting mir-134 (ant-134) or its respective control, a non - targeting scrambled version of the antagomir (scr; 0.12 nmol/2 l) (exiqon a / s), as previously described.19, 22 twenty - four hours later, mice were connected to an eeg system and a baseline recording was obtained . Next, mice were injected with ptz (80 mg / kg, i.p . ). Lorazepam (8 mg / kg, i.p .) Was administered after the first tonic - clonic seizure to reduce morbidity and mortality . These mice were followed up for 30 min after ptz administration for the appearance of seizures . After this period, mice were deeply anesthetized (pentobarbital overdose) and transcardially perfused (pbs) for further assessments . Under isoflurane (5% induction, 3% maintenance) anesthesia, bipolar stainless - steel stimulating electrodes (nex-200; rhodes medical instruments) were positioned in the angular bundles of the perforant pathway and custom unipolar recording electrodes (crafted from 796000; a - m systems) were lowered into the dorsal dentate gyrus . Electrodes and ground screws were connected to miniature wireless transmitters (ft20; data sciences international) that were implanted subcutaneously on the animal s flank . Plastic connectors (gs09plg; ginder scientific) joined the electrodes with stimulation / recording equipment . The pps protocol utilized a paradigm designed to evoke and maintain hippocampal seizure activity throughout the stimulation, but not convulsive status epilepticus, which consisted of continuous, bilateral 2-hz paired - pulse stimuli, with a 40-ms interpulse interval, plus a 10-s train of 20 hz single - pulse stimuli delivered once per minute, generated by an s88 stimulator (grass instruments). All pulses (0.1-ms duration) were delivered at 2024 v, as this voltage reliably evokes granule cell discharging without tissue - damaging hydrolysis.29, 40 the current associated with these voltages was typically between 15 and 30 a . No samples displayed any signs of hydrolysis (e.g., holes around the stimulating electrodes). As described previously, stimulation for 30 min (on 2 consecutive days) required only isoflurane to terminate seizures . Eight - hour stimulation on the third day did not induce convulsive status epilepticus and, therefore, did not require pharmacological termination . Rats were randomly divided in three cohorts to assess the following: (1) mir-134 expression after pps (24 hr, 4 days, and 14 days); (2) the effect of ant-134 on pps - induced status epilepticus, in which rats were pre - treated with ant-134 or scr (0.36 nmol/6 l, i.c.v . ; exiqon a / s) 24 hr before the 8-hr stimulation; and (3) the effect of ant-134 on epileptogenesis, in which rats were injected with 0.36 nmol/6 l (i.c.v .) Of ant-134 or scr (exiqon a / s) immediately after 8-hr stimulation . Five rats were excluded from this study due to practical issues (e.g., blocked cannula). For statistical purposes, we pooled samples from 24 hr and 4 days after pps as an early time point, while 14-day samples were considered as the late time point . Mouse eeg data were analyzed and quantified using labchart 8 software (ad instruments). Ptz - induced seizures were defined as high - amplitude (> 2 baseline) high - frequency (> 5 hz) polyspike discharges lasting> 5 s. for statistical purposes, we assigned a cut - off time of 1,800 s for those animals that did not present seizures during the observation period . From the eeg recordings, we calculated the delay to first seizure, the total power, and the percentage of total power / spectral bands, as previously described.19, 54 eeg total power was plotted as the percentage of baseline recording (each animal s eeg power post - seizure compared to its own baseline eeg). Clinical behavior was scored using the following adapted racine scale: score 0, no seizures observed; score 1, rhythmic mouth and facial movement; score 2, rhythmic head nodding (bobbing); score 3, forelimb clonus; score 4, rearing and bilateral forelimb clonus; and score 5, rearing and falling (stay fallen on rear side; tonic - clonic seizures). The highest score reached during every 5 min during the 30 min after ptz was recorded . For studies in rats, eeg activity during and after pps was amplified and recorded digitally at 2 khz utilizing a powerlab 16/35 and labchart software versions 7 and 8 (ad instruments). Spontaneous granule cell layer activity was recorded continuously (24 hr / day) and stored digitally and automatically in 3-hr epochs . Each day, we analyzed the preceding 24 hr of recordings, as well as all events with amplitudes exceeding 120% of average baseline . Continuous (24 hour/7 day) video monitoring utilized edimax 7010w infrared cameras . Video files were captured at 1215 frames / sec and were time - stamped for integration with the electrophysiological data using securityspy surveillance software (ben software) and stored digitally . Confirmed seizures were scored according to the racine scale . Rats were anesthetized with isoflurane (5% induction,2% maintenance as appropriate) and mounted in a stereotaxic frame . We injected ant-134 (0.12 nmol) in 1 l te buffer (life technologies) at coordinates relative to the bregma: ap, 0.92 mm; medial - lateral (ml), + 1.3 mm, and dorsal - ventral (dv), 3.3 mm to target the lateral ventricle . To allow the rats to fully recover from the analgesic drugs and to coincide with the maximal anti - epileptic effect seen in vivo sodium pentobarbital and transcardially perfused with ice - cold sucrose artificial cerebrospinal fluid (acsf; in mm: 205 sucrose, 10 glucose, 2.5 kcl, 0.1 cacl2, 5 mgcl2, 26 nahco3, and 1.2 nah2po4.h2o; osmolarity, 295 mosm). The brain was quickly dissected into ice - cold sucrose acsf and transferred to a campden 700 smz slicer (campden instruments). Slices (400 m) were prepared in the horizontal orientation between the bregma at approximately 7.1 and 5.1 mm . For storage, slices were submerged in oxygenated normal acsf (in mm: 125 nacl, 10 glucose, 3 kcl, 1 mgcl2, 2 cacl2, 26 nahco3, and 1.25 nah2po4.h2o; osmolarity, 290 mosm) and allowed to recover at room temperature for at least 60 min prior to recordings . Slice recordings were made using a membrane chamber (scientific systems design), a modified submerged chamber, which improves oxygen supply to the tissue and supports greater epileptiform bursts than conventional submerged recording chambers . Slices were continually perfused with acsf, heated to 32c, at a flow rate of 16 ml / min . For local field potential (lfp) recordings, borosilicate glass recording micropipettes (resistance, 34 m) were placed into hippocampal ca1b stratum pyramidale and epileptiform activity was induced by raising the perfusing kcl concentration to 9 mm . Total rna was isolated from brain samples using trizol (invitrogen), as described previously.19, 54 for mrna qpcr, 1 g total rna was used to generate cdna by reverse transcription using the superscript iii reverse transcriptase enzyme (invitrogen). The pcr amplification was performed for 50 cycles on a thermocycler (applied biosystems). Quantitative real - time pcr was performed using a lightcycler 1.5 (roche diagnostics) in combination with quantitect sybr green pcr kit (qiagen) as per the manufacturer s protocol with 25 m of primer pairs used . Specific primers for each gene assayed were purchased from sigma and sequences used were as follows: actin, beta (actb) (forward [f], ggttggccttagggttcagg; reverse [r], gggtgtgatggtgggaatgg); c - fos (f, cattcagaccacctcgacaa; r, ggaattaacctggtgctgga); and arc (f, agcagcagacctgacatcct; r, gtgatgccctttccagacat). Data were normalized to actb and relative mrna transcript levels were quantified using the ct method . For mirna, 250 ng rna was reverse transcribed using stem - loop specific primers for mmu - mir-134 (applied biosystems) and real - time quantitative pcr was carried out on a 7900ht fast real - time system (applied biosystems) using taqman mirna assays . Expression of rnu19 was used for normalization . A relative fold change in expression of mir-134 was determined using the ct method.19, 56 specific mirna assays were obtained from thermofisher scientific for mir-134 (i d 001186), mir-19a (i d 000395), and rnu19 (i d 001003). Data were normalized to rnu19 and relative mirna expression levels were quantified using the ct method . Statistical analysis was performed using graphpad prism and stata release 14 software, and a p value <0.05 was considered significant . Latencies to tonic - clonic seizures were analyzed by the kruskal - wallis test, followed by the nonparametric dunn multiple comparison test when indicated . Total time spent in seizures, mean amplitude, frequency, total power of eeg recordings, and mrna levels were analyzed by the student t test or one - way anova followed by the bonferroni test, depending on the experimental design . Ex vivo brain slice data were analyzed using the mann - whitney u test . Three comparisons were made from the same data and (significance level) was consequently reduced to 0.025 for these experiments ., d.f.o ., and n.d . Provided human samples and data; c.r.r ., s.s . Wrote the paper and all co - authors contributed to data interpretation, review, and editing of the final paper . The royal college of surgeons in ireland filed for a patent on the inhibition of microrna-134 for the treatment of seizure - related disorders and other neurologic injuries.
|
It is a common discomfort making to the top ten list of complaints in ambulatory medical care, but our understanding of the epidemiology of headache disorders is still incomplete . Most of the recurrent headache cases are due to benign chronic primary headache disorders, such as tension headache and migraine . Less frequently, headache could be due to other underlying conditions such as infections, cerebral hemorrhage and brain lesions [5, 6]. The study of headache epidemiology can address a number of important questions such as variation in the occurrence and severity of headache in the population, and the relationship between headache and other medical disorders . In addition, these studies may provide clues to abortive treatments and preventive strategies for headache . It is well documented among adults that overuse of headache medication may contribute to the development of chronic headache [814]. Epidemiologic studies indicate that chronic headache (> 15 days per month) is common in the adult population with a 25% prevalence rate [1521] and a prevalence of chronic headache associated with medication overuse of about 1% [18, 20, 21]. In general, self - medicating for headache is highly prevalent and self - care is likely to increase in the era of health - care reform [22, 23]. . Chronic and inappropriate use of over - the - counter drugs such as analgesics, particularly nonsteroidal anti - inflammatory drugs (nsaids), can lead to overuse syndromes and drug - induced headache [25, 26]. In the present study, we sought to estimate the association between analgesic use and headache among adults in a large sample of the jordanian population in relation to age, gender and headache frequency . In this study, participants (age range 1885) were approached at their work places, classes or homes ., researchers asked every participant to nominate two other persons until the desired sample size was obtained . The study was ethically approved by the institutional review board (irb) at jordan university of science and technology and was carried out in accordance with the principles described in the declaration of helsinki, including all amendments and revisions . The study was conducted in various regions of jordan during the period from january 2007 to november 2008 . The questionnaire was distributed, in person, by the researchers, and was completed in the presence of the researcher . Each participant was provided with a full explanation of the study and how to complete the questionnaire . Participants were informed that the researcher would be available for any required assistance during scoring of the questionnaire . For the small group of participants who were illiterate, the questionnaire was administered by the researcher in the form of an interview . Data were aggregated into groups and only the authors and the investigator were allowed access to the collected data . The questionnaire gathered information that included demographic data, frequency and type of headache, and its impact on everyday activities, analgesic use, consultation of a doctor or pharmacist on the use, increase or decrease in the frequency of headache after painkiller usage, increase or decrease in painkiller dose and family history of headache . Every person who was 18 years or older was allowed to complete the survey . Retest reliability, 50 subjects were selected randomly; they answered the questionnaire twice with a 1-week interval . Test for each item, correlation coefficients ranged from 0.79 to 0.86, suggesting that the questionnaire was reliable . The data were coded using the statistical package for the social sciences, version 15.0 (spss inc . The data were summarized using frequency tables and means and standard deviation for continuous variables . To estimate the prevalence of headache among adults in jordan, a sample of participants (4,836 participants; mean age 27 0.4 years, and male: female ratio of 59:41) was allowed to complete a self - conducted screening questionnaire . As shown in table 1, about half of the participants (49.2%) were university students and 78.3% were jordanian citizens . Moreover, 70.7% participants were single and 47.4% were smokers.table 1the demographic data of the study samplevariablen (%) gender male2,870 (59.4) female1,966 (40.6)age 1829 years3,572 (73.95) 3039 years506 (10.46) 4049 years402 (8.32) 50 years356 (7.37)education illiterate83 (1.7) elementary school65 (1.3) secondary school213 (4.4) high school610 (12.6) diploma344 (7.1) university student2,378 (49.2) bachelor901 (18.6) masters181 (3.7) ph.d.61 (1.3)nationality jordanian3,787 (78.3) arab (non - jordanian)841 (17.4) foreign208 (4.3)marital status single3,422 (70.8) married1,304 (27.0) divorced55 (1.14) other55 (1.14)monthly income low (<or = 400 jd)257 (5.3) medium (> 400 jd to <or = 1,000 jd)3,831 (79.2) high (> 1,000 jd)748 (15.5)smoking smoker2,294 (47.4) non - smoker2,542 (52.6)1 jd is equivalent to about 1.4 us dollars the demographic data of the study sample 1 jd is equivalent to about 1.4 us dollars of the 4,836 participants, 82.3% complained of headache at least once per year . For both the 1829 and the 3039-year - old groups, the yearly prevalence of headache was found to be the same (82.8%), while it was 79.9 and 81.7% for the 4049 and older than 50-year - old groups, respectively . Among the participants, 17.2% had daily headache attacks, while 25.7% had fewer than daily to weekly headaches, 21.6% had headaches on fewer than weekly up to monthly basis, 17.8% complained of headaches on a fewer than monthly basis and 17.7% of all participants did not experience headache attacks . Moreover, 38.4% of the headache complainers did not know the exact type of headache they were experiencing, 36.9% complained of tension type headache and only 7.7% were diagnosed with migraine headache; 51.6% of complainers thought that headache affected their daily activities . A large number of participants stated that one or more of their family members complained of headache as well (table 2).table 2frequency, type, and family history of headachevariablen (%) headache frequency daily832 (17.2) fewer than daily to weekly1,243 (25.7) fewer than weekly to monthly1,043 (21.6) fewer than monthly to 1 year860 (17.8) no headache858 (17.7)type of headache migraine372 (7.7) tension1,749 (36.1) unknown1,857 (38.4) no headache858 (17.7)headache affects daily activities (if any) yes2,051 (51.6) no1,927 (48.4)other family members complaining from headaches father327 (6.8) mother545 (11.3) brothers or sisters552 (11.4) other relatives558 (11.5) more than one family member860 (17.8) none1,994 (41.1) frequency, type, and family history of headache of the migrainers, 37.7% (n = 140) complained of daily headache, 35.6% (n = 132) had fewer than daily up to weekly headaches, and 18.1 (n = 67) and 8.6% (n = 32) complained of headaches on a fewer than weekly up to monthly basis, and on fewer than monthly basis, respectively . Additionally, about 75% (n = 279) of migrainers thought that migraine adversely affected their daily activities . Concerning tension type headache, 20.3% (n = 348) complained of daily headache, 34.7% (n = 594) had fewer than daily up to weekly headaches, and 24.1% (n = 413) and 20.8 (n = 356) complained of headaches on fewer than weekly up to monthly basis, and fewer than monthly basis, respectively . Moreover, about 53% (n = 907) indicated that tension type headache affected their daily activities . The stratified prevalence for both migraine and tension type headache according to age group and gender are shown in table 3.table 3stratified prevalence of migraine and tension - type headache according to age group and genderheadache typetension - type headachemigrainegendermale n (%) female n (%) male n (%) female n (%) age category (years) 1829652 (31.6)586 (39.0)158 (7.7)97 (6.5) 3039120 (36.1)73 (43.7)34 (10.2)11 (6.7) 404972 (31.7)68 (39.1)17 (7.5)18 (10.3) 50 and above92 (37.3)49 (40.8)28 (11.3)8 (6.7)total936 (32.6)776 (39.5)237 (8.3)134 (6.8) stratified prevalence of migraine and tension - type headache according to age group and gender only 17.3% of participants sought medical care for their headaches . The percentage of participants using analgesics on a weekly basis was 24.5%, less than monthly but more than weekly was 24.8%, monthly usage was 22.5%, and the percentage of participants who never use a analgesics was 14.6% . Participants who used analgesics on the advice of a physician were 15.3%, while those who used analgesics on a pharmacist advice compromised 13.6% . Those who used analgesics based on the experience of a family member or others were 34.8 and 47.4%, respectively (table 4). In addition, 13.1% of participants complained of increased headache severity or frequency on medication use . Results also revealed that 22.0% of participants had increased their analgesic dose and 78.0% did not change their regimen . The most frequently used analgesic among participants was acetaminophen (78.00%), and to a lesser extent ibuprofen (7.49%) and aspirin (5.58%) (table 5).table 4approach to medication use among patients with headachevariablen (%) seeking medical help for headaches yes688 (17.3) no3,290 (82.7)advice on using analgesics physician609 (15.3) pharmacist541 (13.6) family1,383 (34.8) others (friends, co - workers, neighbors, etc. )1,887 (36.3)frequency of analgesics usage daily606 (15.2) fewer than daily to weekly974 (24.5) fewer than weekly to monthly985 (24.8) fewer than monthly to 1 year829 (22.4) no analgesics584 (14.6)increase in headache frequency after analgesic use yes520 (13.1) no3,458 (86.9)increase analgesic dose used over time yes877 (22.0) no3,101 (78.0)some participants have sought the advice of more than one categorytable 5frequency of analgesics use among headache patientsname of the analgesic usedn (%) acetaminophen3,103 (78.0)ibuprofen298 (7.5)aspirin222 (5.6)diclofenac sodium64 (1.6)naproxen25 (0.6)metamizole11 (0.3)mefenamic acid10 (0.3)ergotamine10 (0.3)others137 (3.5)note that some patients used more than one medication approach to medication use among patients with headache some participants have sought the advice of more than one category frequency of analgesics use among headache patients note that some patients used more than one medication in this study, we report for the first time an overall 1-year period prevalence of headache among adults in jordan . A sample (4,836) of participants were requested to complete a self - conducted screening questionnaire . As much as 82.3% of participants reported that they complained of headache at least once per year . This is much higher than the average global prevalence of headache (46%) [27, 28]. Similar percentages were obtained from two studies conducted in other middle eastern countries namely oman and qatar, and from other developing and developed countries [3234]. On the other hand, one study conducted in oman showed a prevalence of headache of about 45%, however, that study was among university medical students and not the general population . In nearby saudi arabia, the prevalence of primary headaches ranged from 8 to 13% [30, 36, 37], which is much lower than that reported in all other studies from the middle east area . The higher prevalence of headache in jordan indicates that it is one of the major health problem . Tension - type headache was found to be the most prevalent among other types of headaches (36.9% compared to 7.7% for migraine). The prevalence of tension - type headache, in this study, falls within the prevalence range previously reported from studies conducted in the middle east area (1139%) [29, 35, 38, 39]. Additionally, the reported prevalence for tension - type headache, in this study, is lower than its global prevalence (about 42%), which seems to be the case for the whole middle east area . Studies on migraine headache from other arab countries reported prevalence that ranged from 10 to 12.2% [29, 39, 40], which is higher than the migraine prevalence in our studied sample . As in the case of tension type headache, both the global migraine prevalence (about 11%), and the migraine prevalence in western europe (about 14%) is higher than that in jordan . Therefore, jordan seems to have lower migraine prevalence than many other parts of the world . A recent study from nearby qatar reported a migraine prevalence of about 8.0%, which is very similar to the prevalence reported in the current study . The effect of headache on everyday activities was obvious in our study where a significant percentage (51.6%) of participants ascertained that headache adversely affected their daily activities . Our results showed that 82.7% of participants did not seek medical attention for their headaches . In agreement with other s findings [29, 39], 75.6% of our population used analgesics and acetaminophen was the most popular (78.0%). The popularity of acetaminophen over other analgesics could be related to its availability as an over - the - counter medication, low price, and because it is known to be safe to the gastrointestinal tract . Previous studies from jordan and surrounding countries reported smoking prevalence of about 2648%, depending on the gender, age and the specific population group studied [4144]. Worldwide, the overall prevalence of smoking among adult males and females was estimated to ranges from 21 to 37% in the high - income countries, and 8.9 to 49% in low to middle income countries . Therefore, the percentage of smokers obtained in this study is comparable to previous studies from the region and to low to middle income countries all over the world . According to data obtained form the jordanian department of statistics, about 38% of jordanian adult population falls into the age range of 1929 year, which is considered a high percentage of young adults . In this study, however, 74% of the studied sample falls within the range of 1829 years, and 47% of them were college students . Therefore, the studied sample appears to be not population based, which is one limitation of the current study . Another limitation is the fact that the sensitivity and specificity of the questionnaire was not tested . In summary, headache is a major health problem in jordan, where 82.3% of participants experienced troublesome headache attacks at least once per year . Analgesic overuse without seeking medical advice is regarded as potential for development of chronic headache . These results indicate the need for public education to ensure safe practices and to make the use and selling of analgesics more stringent.
|
A 55-year - old woman visited the emergency clinic of hanyang university seoul hospital with chest pain that had persisted for one month and had become aggravated two days earlier . Ten years before this admission, the patient had undergone double valve replacement with aortic and mitral mechanical valves due to aortic regurgitation and mitral steno - insufficiency . Echocardiography revealed normal motion and function of the mitral and aortic valve prostheses, and coronary angiography findings were also normal . However, coronary computed tomographic angiography revealed three large lobulated aneurysms with calcified walls bulging from the base of the left ventricle (fig . The leak in the left ventricle was located in the sub - mitral valve prosthesis area . Based on this finding, we diagnosed the patient with a pseudoaneurysm of the left ventricle, and surgical treatment was planned . Arterial cannulation via the left femoral artery and venous cannulation via the left femoral vein and left pulmonary artery were performed . Three communicating aneurysmal sacs were observed in a single plane, identical to that observed in coronary computed tomographic angiography . The neck of the first sac was located at the base of the left ventricle . Under cardiopulmonary bypass and fibrillation, a defect measuring 15 mm in diameter was identified in the sub - mitral left ventricular wall with calcification but with no infection . Closure of the defect was performed with a supple peri - guard pericardium patch with apex processing (synovis, st . The walls of the aneurysmal sacs were closed, and the patient was weaned from cardiopulmonary bypass without difficulty . The vital signs of the patient remained stable, and she was extubated six hours after the operation . Follow - up echocardiography was performed on postoperative day eight, and no abnormal findings, including cardiac wall motion, were noted . No leakage at the closed aneurysmal neck was observed, and there was no evidence of recurrence of the pseudoaneurysm (fig . She has remained disease - free for six years postoperatively, with regular coumadin anticoagulation therapy due to the presence of the prosthetic aortic and mitral valves . A left ventricular (lv) pseudoaneurysm, or false aneurysm, is defined as a contained rupture or perforation of the myocardium . The rupture of the myocardium occurs rarely in clinical practice; it is most often associated with myocardial infarction or cardiac surgery, such as mitral valve replacement (mvr), and is usually fatal [24]. In 1980, cobb et al . Roberts and morrow suggested that inadvertent invasion into the lv free wall is possible during excision of the mitral valve if there is poor visualization of the operating field when using the tips of the scissors . Other causes of complete or incomplete rupture of the lv free wall include an oversized prosthetic valve, excessive extirpation of calcium in the mitral annulus, myocardial erosion caused by the struts of the prosthetic valve, the untethering of the fibrous structures of the left ventricle during resection of mitral leaflets, an increase in lv contractility after aortic cross- clamping, enhanced lv wall stress with the support of inotropic agents, and other mechanical trauma between the free wall and the papillary muscles, such as rubber catheter wedging or metal pump suction during valve replacement . The wall of a false aneurysm comprises the fibrous obliteration of the pericardial sac, resulting from adhesion between the parietal and visceral layer of the pericardium . While a true aneurysm has nonrestrictive continuity with the lv cavity, a pseudoaneurysm has a defect in the myocardial continuity and a well - defined neck, representing a history of lv wall perforation . Thus, such pseudoaneurysms are more likely to undergo rapid enlargement and rupture than true aneurysms . Therefore, surgical correction, including the resection of the aneurysmal sac and patch repair or primary closure of the aneurysmal neck, is indicated and recommended for pseudoaneurysms . In the present case, we diagnosed a lv pseudoaneurysm using coronary computed tomographic angiography . Myocardial infarction was excluded as a cause of the lv pseudoaneurysm because coronary angiography revealed normal findings and cardiac markers were in the normal range, although electrocardiography revealed myocardial ischemia in the inferior wall . The cause of lv pseudoaneurysm in our patient was a late - term complication of mvr . Echocardiography revealed normal function of the mitral valve prosthesis; therefore, mitral reoperation was not indicated . In such patients, if a repeat sternotomy for entering the operative field is considered, it may be difficult to approach the heart due to massive pericardial adhesions, and the possibility of injury or rupture of the pseudoaneurysm during dissection may be higher . A direct approach to the operative field via a left lateral thoracotomy can avoid these complications and preserve the previously implanted prosthetic valves . Further, it has other advantages, such as making it easier to establish cardiopulmonary bypass and obviating the need to cross - clamp the aorta, in contrast to the sternotomy approach . In our operation, a fibrillator was used and the exposure of the operative field was excellent . In the operative field, we found three large lobulated pseudoaneurysms with calcified walls in a line, bulging from the base of the left ventricle . The configuration of the pseudoaneurysms suggested a previous episode of lv rupture, which had developed over time . In patients with lv pseudoaneurysms, there is a well - defined approach to surgical correction . The neck of the pseudoaneurysm is dissected, and the perforated site can be closed by patch repair or primarily . The mortality rate of this surgery is approximately 10% ., we have reported a case of lv pseudoaneurysm that occurred as a late complication after mvr . We performed a left lateral thoracotomy via the fifth intercostal space to approach the operative field directly and successfully repaired the sub - mitral lv pseudoaneurysm using a prosthetic patch . A few cases of lv pseudoaneurysms have been previously reported; however, no case reports have previously been presented of korean patients with an lv pseudoaneurysm following mvr who were treated with an operative technique employing a left lateral thoracotomy.
|
Posterior urethral valve (puv) is the most common cause of congenital bladder outlet obstruction in boys and causes renal failure in 25% to 30% of cases before adolescence . Puv is associated with considerable morbidity, including urinary tract infection (uti), chronic renal failure, urinary incontinence, and even death [1 - 3]. The diagnosis is made on average in 1 in 1,285 fetal ultrasound screenings . As a result of recent prenatal diagnosis, improvements in respiratory support and resuscitation at birth, and adequate management of end - stage renal disease, the mortality rate in patients with puv has significantly decreased in the past four decades . Endoscopic ablation of a puv is the current gold standard of therapy, but approximately 10% to 30% of patients require a second procedure to achieve satisfactory valve ablation [3,6 - 8]. As animal models have proven, even partial outlet obstruction can lead to structural and functional deterioration in the detrusor muscle and bladder if the obstruction is not released soon enough [9 - 11], which indicates the need for close follow - up after valve ablation . Although studies about prognostic factors for outcome of renal function after puv ablation are available [8,12 - 15], to date, the effects of preoperative factors on the rate of residual valves have not been precisely addressed . In this study, therefore, we sought to evaluate any possible relationship between preoperative clinical and imaging findings of patients with puv and remnant leaflets after their valve ablation to identify high - risk patients and achieve purposive follow - up . We evaluated 64 patients with clinical evidence of puvs, confirmed by voiding cystourethrography (vcug), who were admitted between 2008 and 2012 at the shiraz university of medical sciences . Preoperative evaluation included clinical examination, history of uti, serum electrolytes, urinalysis, complete blood count, urine culture, serum creatinine, and radiographic evaluation (vcug / ultrasonography and dimercaptosuccinic acid [dmsa] scan if necessary). Of these patients, 9 did not participate in follow - up sessions and were excluded from our study . The median patient age at the time of diagnosis was 10.0 months (range, 5 days to 120 months). Surgeon preference was to use an 11-fr pediatric resectoscope (karl storz gmbh & co. kg, tuttlingen, germany). When the urethra was too small for this instrument, a 3-fr ureteric catheter with a metal stylet was used . Valves were ablated mainly at the 5, 7, and (in most cases) 12 o'clock positions . The end point of primary ablation was determined by visual assessment of destruction of the valve . A foley catheter was left in place and was removed 24 to 48 hours after valve ablation . We performed cystoscopy in all patients at a follow - up session, at least 3 months after valve ablation (range, 3 - 12 months). Patients were divided into two groups on the basis of observation of obstructive residual leaflets in a second cystoscopy to analyze the possible preoperative factors that were related to obstructive remnant leaflets . Group a had no evidence of obstructive remnant leaflets and in group b a second ablation was done owing to obstructive residual leaflets . We evaluated age at surgery, history of uti, level of serum creatinine and blood urea nitrogen, specific gravity of urine, hemoglobin, presence of scarring in the dmsa scan, vesicoureteral reflux (vur) and grade of reflux, renal parenchymal thickness, echogenicity of kidney, bladder wall thickness, renal cortical thickness, anteroposterior diameter of the renal pelvis, diameter of the distal ureter, and hydroureteronephrosis and side between groups . For statistical analysis, student t - test and mann - whitney test for quantitative numeric data comparison and chi - square test for categorical variables were adopted by using ibm spss ver . 19.0 (ibm co., armonk, ny, usa). Follow - up cystoscopy was performed at least 3 months (range, 3 - 12 months) after primary valve ablation in 55 boys with a 6.75-f pediatric cystoscope (richard wolf gmbh, knittlingen, germany). A total of 37 patients (67.3%) had no significant remnant leaflets (group a), whereas 18 boys (32.7%) required a second ablation as a result of valve remnants . The valve remnants were ablated by use of an 11-f pediatric resectoscope (karl storz gmbh & co. kg) or a 3-fr ureteric catheter with a metal stylet . A pediatric resectoscope was used in 25 boys (67.6%) in group a and in 11 boys (61.1%) in group b, whereas in the other children a 3-fr ureteric catheter was applied . In both groups of patients, no significant statistical relationship was observed between method of ablation (resectoscope versus urethral catheter method) and remnant leaflets (p=0.764). The median ages at the time of ablation for groups a and b were 15 and 7 months, respectively (fig . 1). The mann - whitney test revealed a significant difference between the groups (p=0.017). Other clinical data that we assessed demonstrated no significant differences in children with and without remnant leaflets after valve ablation and are summarized in table 1 . Radiographic characteristics of patients as shown by ultrasonography, dmsa scan, and vcug were collected retrospectively . Sixteen patients had a dmsa scan and scarring was detected in all except one boy, with no significant predictive value for valve remnants (p=1). In vcug, vur and side and grade of reflux significant differences were shown in the presence of vur and grade 4 or 5 reflux (p<0.05). Our review of the ultrasound studies showed that the echogenicity of the renal parenchyma separated into normal echogenicity and hyperechogenicity, and echogenicity was higher in 94.4% of the preoperative ultrasounds of patients with residual leaflets (p=0.000). Data on renal parenchymal thickness, bladder wall thickness, renal cortical thickness (in the sagittal plane over a medullary pyramid, perpendicular to the capsule), hydroureteronephrosis and side of hydroureteronephrosis, anteroposterior diameter of the renal pelvis, and distal ureteral diameter demonstrated no influence on puv ablation outcome in our patients (table 2). Most previous studies have focused on prognostic clinical and imaging factors in relation to the long - term outcome of renal function . To our knowledge, this is the first study to compare preoperative factors regarding the presence of postoperative obstructive leaflets . Although endoscopic primary valve ablation is the preferred initial surgical treatment in most patients with puvs, the absence of obstructive residual valve remnants should be confirmed by careful clinical, radiological, and endoscopic evaluation after surgery . Some investigators suggest vcug to confirm the adequacy of valve ablation, whereas others recommend cystoscopy follow - up in all patients . Both methods have advantages and disadvantages such as transient dysuria, enuresis, hematuria, and toileting anxiety after vcug and the need for general anesthesia in cystoscopy and the more invasive nature of cystoscopy than repeated vcugs . Whatever the method of follow - up, the necessity of post - ablation evaluation cannot be undervalued owing to the high incidence rate of remnant leaflets of 10%-30% in most studies [3,6 - 8], even as high as 51.6% in one case series . To decrease the effect of technical components of the initial resection in the presence of residual valves, all surgeries in our study smeulders et al . Reported that micturating cystourethrography alone is inexact for excluding residual valve tissue (positive and negative predictive value of 56% and 50%, respectively), so we routinely perform cystoscopy in all of our patients . Given that there are no quantitative guidelines for the adequacy of valve ablation, our criterion was no visible obstructive residual valves in follow - up cystoscopy . The slightly higher rate of residual valves in our patients (32.7%) than in most cited studies (10% to 30%) [3,6 - 8] may have been because we applied follow - up cystoscopy in all patients after primary valve ablation, whereas others used follow - up cystoscopy only in cases with abnormal clinical or radiological findings . Even though controversy exists about the role of age (at diagnosis and time of puv surgery), it has been mentioned as one of the predictive factors for renal outcome after valve ablation . We found no published studies that assessed age as a prognostic factor for remnant leaflets, but in our patients, age (at the time of surgery) showed a significant effect on the presence of residual leaflets in follow - up cystoscopy . The cause of this difference may be the narrower urethra in younger children, which limits the surgeon's visibility and complicates the endoscopic maneuver for puv ablation owing to fear of causing stricture . In any event, careful and closer follow - up in younger children seems necessary to achieve better long - term renal outcomes . Besides age at diagnosis, of the other factors that we analyzed, echogenicity of kidney, presence of reflux, and grade of reflux differed significantly between the two groups (p<0.05). Other studies have shown the hyperechogenicity of renal parenchyma as a factor that may help to predict long - time prognosis of renal insufficiency but did not comment on it as a factor affecting the consequences of valve ablation . In our patients, 17 boys (94.4%) with residual leaflets in follow - up cystoscopy showed increased renal echogenicity in comparison with 6 patients (16.2%) in the other group, with a p - value less than 0.05 . In our patients, 33 children showed evidence of vur (16 boys in group a and 17 in group b) and the incidence of grade 4 and 5 reflux was significantly higher in patients with obstructive remnant leaflets (table 2). To exclude the tendency in infants to have more echogenic kidneys separate from renal function, we analyzed this factor in three age groups (under 12, 12 to 48, and over 48 months), which revealed a significant difference in the first two groups (p<0.05). We suppose that this statistical relationship may be due to longer and thicker valves preoperatively that caused more obstruction initially, which was followed by high grades of vur as well as hyperechoic kidney that persisted after the first ablation . The presence of vur and hyperechogenicity of the kidney can affect the long - term prognosis of renal function and should be considered in the management of patients with puv . Method of ablation, renal parenchymal thickness, bladder wall thickness, renal cortical thickness, hydroureteronephrosis, anteroposterior diameter of the renal pelvis and ureter, serum creatinine, and history of uti demonstrated no relationship with residual leaflets in our patients . Considering the lack of studies in this field, it seems that more research is inevitable to facilitate proper screening and the detection of patients with residual leaflets . The need for confirmation of complete resection of puv is undeniable because valve remnants may result in persistent outflow obstruction or renal failure through time and should be detected quickly to minimize the deterioration of kidney or bladder function . The timing of follow - up sessions in most studies is 3 to 6 months after ablation . However, owing to decreases in function and structural deformities in the bladder as a result of partial obstruction, even after as short a period as 2 weeks in animal models [9 - 11], earlier follow - up in the first month after ablation, especially in patients at high risk of residual valves, seems more advantageous . There may be other operative or preoperative factors, in addition to those we evaluated in our study, with the potential to affect the end result of initial valve ablation and residual leaflets . The results of such research can help to provide a better algorithm for management of puvs and achieve purposive follow - up for high - risk patients instead of invasive procedures . Younger age at surgery time, hyperechogenicity of the renal parenchyma, presence of vur, and grade of reflux before surgery in our patients had a significant relationship with residual valves, but more research is needed to confirm these results . More studies may result in enhanced management of patients at high risk of residual valves after puv ablation, because the sooner the obstruction is entirely resolved, the better the long - term outcome.
|
White spot lesions are areas of demineralized enamel that represent an early stage of caries, since they can progress to cavitated lesions if untreated . The demineralization process can be arrested or reversed by noninvasive means, including oral hygiene counselling and/or topical fluoride application [2, 3]. Therefore, early detection of white spot lesions (wsls) is desirable since early preventive treatment can avert the need for future restorative treatment . New technologies such as the diagnodent and quantitative light fluorescence (qlf) devices have been developed for the detection of early carious lesions . These techniques are intended to be adjuncts to clinical decision making and aid in planning preventive treatment . Despite the potential of these methods, the results from these tools are affected by confounding factors in the oral environment, thereby compromising the sensitivity and/or specificity of these techniques . For example with the diagnodent, stain, calculus, plaque, as well as developmental hypomineralization can produce a fluorescence output that results in false - positive readings . A review of the literature evaluating the diagnodent device found that, compared to visual assessment methods, the sensitivity was consistently higher but the specificity was lower, concluding that the increased risk of false - positives limits its clinical usefulness . For qlf, stain, plaque, fluorosis, or any developmental hypocalcification results in false - positives [811]. Composite resins pit and fissure sealants as well as prophy pastes could also lead to false - positive results . Clearly, a new technology is needed that will not be affected by factors in the oral environment . A new optical approach to detect white spot lesions clinically is jointly being developed at the national research council of canada - institute for biodiagnostics, the university of manitoba and dalhousie university, using a combination of optical coherence tomography (oct) and polarized raman spectroscopy (prs). Oct is a nondestructive technique for high - resolution (1020 m) depth imaging that gives information about the morphology and depth of white spot lesions up to 3 mm into enamel . This method is similar to ultrasound technology, but instead of sound waves, light waves are utilized and the imaging is limited to near - surface tissues . Changes in the refractive indices of structures cause light backscattering, creating an image that is different for sound enamel and demineralized enamel . Prs is a noninvasive spectroscopic method that provides details on the biochemistry and molecular structure of white spot lesions . The energy difference between the incoming excitation light and scattered photons is proportional to the vibrational energy of molecules within the sample being studied, known as the raman effect . The caries process results in biochemical and structural changes that can be followed by prs, which uses scattered light to determine differences between the mineral matrix of sound enamel and demineralized enamel . Our previous studies have shown that oct and prs can be used to distinguish sound enamel from white spot lesions (wsls) ex vivo [14, 15, 17]. However, the effects of calculus, hypocalcification, and stain on oct and prs have yet to be established . By combining oct and prs, false - positive results from one technology can potentially be eliminated, thereby increasing the sensitivity and specificity of the new method . Calculus consists of an organic matrix with the inorganic components of dicalcium phosphate dehydrate (dcpd), hydroxyapatite (ha), octacalcium phosphate (ocp), and -tricalcium phosphate (tcp). Raman spectra of human enamel are characterized by a main peak at ~959 cm arising predominantly from the symmetric phosphate groups in carbonated hydroxyapatite, the major mineral component of dental enamel [18, 19]. Clinically, hypocalcification appears visually similar (chalky white) to a wsl and must be differentiated from a wsl since hypocalcification is a developmental defect that does not need to be treated . In hypocalcified enamel, the crystals are arranged normally but there are pores due to larger spaces between enamel rods . Intrinsic stain occurs during tooth development due to alterations in the structure or thickness of enamel or dentin, extrinsic stain accumulates on the acquired pellicle, and internalized stain occurs when extrinsic stain is incorporated into areas of enamel defects after tooth development . The objective of this study was to determine whether calculus, hypocalcification, and stain are confounding factors affecting wsl detection with optical coherence tomography and polarized raman spectroscopy . Postextraction, the teeth were rinsed with water and clinically examined by two clinicians independently . Samples were separated into 5 groups: sound enamel, wsls, calculus, hypocalcification, and stained enamel . Figure 1 is a diagrammatic representation of sample sizes and allocation criteria for the above groups . Since patient histories were not available, it cannot be determined if hypocalcified enamel was caused by excess ingestion of fluoride; therefore, this category is referred to as hypocalcification . Figure 2 is a diagrammatic summary of data collection and analyses with oct and prs . A humphrey's system 2000 optical coherence tomography scanner (zeiss humphrey systems, dublin, ca, usa) operating at 850 nm was used for oct measurements . For all data, the laser was focused to the thinnest line on the tooth surface and the scan length was 2.0 mm . Three scans were collected across the area of interest with the proximal surface of interest oriented perpendicular to the laser beam . Three vertical scans were also taken of sound enamel on the same tooth surface for comparison . Oct images had display resolutions of 500 100 pixels, and transverse resolutions of 1020 m . Figure 3(a) displays a photo of a tooth being scanned with the oct system (laser scan line circled) with the corresponding 2-dimensional depth image of sound enamel (figure 3(b)). Matlab software (the mathworks, natick, ma, usa) was used to plot oct images . A labramhr raman microspectrometer (horiba jobin yvon, edison, nj, usa) the laser excitation was 830 nm and a 10x microscope objective was used (power at the sample was 125 mw) with an acquisition time of 5 seconds and 6 accumulations . On each surface, point measurements were taken with parallel- (p1) and cross- (p2) polarizations at a minimum of three different points . Raman data were analyzed using matlab software to calculate the depolarization ratios (i/i), where i is the area under the raman band from 9251000 cm for cross - polarization (p2), and i is the similar area for parallel - polarization (p1). This wavenumber range was used since it centres at 959 cm (the main peak due to phosphate groups such as those found in apatite). Two - dimensional oct images are shown of sound enamel (figure 3(b)) and a wsl (figure 4(a)). In the sound enamel image, there is intense light backscattering at the tooth - air interface, and no significant signal with depth into the enamel . In contrast, the oct image of a wsl shows significant light backscattering beneath the surface with a triangular shape characteristic of a subsurface lesion as observed on histological sections . The two - dimensional oct image displayed as figure 4(b) shows a deposit of material on the tooth surface that is attributed to calculus . The oct image of hypocalcification in figure 4(c) shows diffuse light back - scattering and a more irregular subsurface pattern of scattering across the entire region scanned compared to sound enamel . The light back - scattering of hypocalcified regions is also more irregular than wsls, which have a characteristic triangular shape . The oct image of stained enamel in figure 4(d) demonstrates increased light backscattering when compared to sound enamel, but again there is no triangular - shaped subsurface light back - scattering as observed with wsls . Average raman depolarization ratios () from the various groups are depicted in a box - and - whisker plot (figure 5). In order to determine whether the mean depolarization ratio values of the various groups were statistically significant from one another, a one - way analysis of variance (anova) followed by unequal n hsd post - hoc comparisons (statistica) was performed (table 1). It was determined that the mean values were statistically significant in all cases at p <.05 except for three cases . Sound enamel was not statistically significant from hypocalcified enamel, carious enamel was not statistically significant from stained enamel, and lastly stained enamel was not statistically significant from hypocalcified enamel . In raman spectra acquired from areas of stain (figure 6), there is a large background sloping fluorescence that is not observed in spectra from areas of sound enamel or wsls without stain where these spectra have a flat background . The development of new technologies for wsl assessment requires that these devices undergo clinical validation prior to becoming an accepted clinical method . In addition to demonstrating the performance of these methods for providing high sensitivity for wsl detection, high specificity is also desirable . Optical coherence tomography and polarized raman spectroscopy are methods that potentially can address the need for a technology with high sensitivity and high specificity . To date there are no studies outside our research group that investigate a combination of oct and prs to detect wsls, and in particular the effects of the calculus, stain, or hypocalcification on the utility of these two technologies . Oct imaging allows differentiation of sound from demineralized enamel on the basis of the characteristic triangular shape of the back - scattered signal beneath the tooth surface in images of wsls . This subsurface scattering pattern is believed to be due to wsls having porous enamel matrices, allowing incident light to travel further into the enamel and causing more scattering to occur, which is detected by the oct system . When calculus is present, it appears clearly as a deposit in the two - dimensional oct image . Similar to conventional caries assessment methods, scaling of calculus is recommended before an assessment is made using oct and prs . Oct can possibly be used to alert the clinician when calculus is still present in the region of interest and that further scaling is necessary . Oct images of hypocalcification can be differentiated from wsls, since the light back - scattering found with hypocalcification is more irregular than wsls and lacks the characteristic triangular shape . To some extent, hypocalcification can be differentiated from sound enamel with oct since hypocalcification has a more irregular pattern of scattering at the surface and subsurface compared to sound enamel . Although areas of stain are not easily distinguishable from hypocalcified enamel or sound enamel with oct, they can be readily differentiated from wsls because areas of stain lack the subsurface triangular - shaped back - scattering pattern characteristic of wsls . Further image analysis is required to nonsubjectively distinguish sound enamel from stained and hypocalcified enamel . Statistical analysis revealed that mean raman depolarization ratios were statistically significant in all cases at p <.05 except for three cases: (a) sound enamel compared to hypocalcified enamel, (b) carious enamel compared to stained enamel, and (c) stained enamel from hypocalcified enamel . Since hypocalcified enamel can be mistaken for wsls upon visual clinical examination, it is reassuring that the raman depolarization values from hypocalcified enamel are distinct from caries, thereby increasing the specificity of the method . Based on the analysis focusing on the depolarization ratio of the 959 cm peak, hypocalcified enamel could not be distinguished from sound enamel . This observation indicates that, fundamentally, hypocalcified enamel is like healthy sound enamel and not in need of treatment . In order to make this separation, further studies are needed which include examining the peak positions and peak width of the phosphate hydroxyapatite peak, which have been shown to be affected by the mineral crystallinity . Furthermore, other peaks could be surveyed to look for peaks characteristic of specialized forms of hypocalcification such as fluorosis . The analyses indicate that stain complicates the use of prs for discriminating stained sound enamel from carious enamel . In reviewing the raman spectra acquired from areas of stain, it is observed that stained sound enamel spectra show a large background fluorescence that is not found in spectra from areas of sound enamel or wsls without stain . In these preliminary analyses, a straight - line background in the region of the peak was simply subtracted for calculating the areas under the peak . Clearly, this initial approach is not enough as the curved background confounds this calculation . Further studies are consequently required using various algorithms to robustly fit the fluorescence background for elimination . In addition, there are various instrument - based methods proposed to suppress the background fluorescence in raman spectra . With fluorescence - based devices (diagnodent, qlf), stain chromophores from any source with prs, the fundamental basis of the method is the phosphate moieties specific to the dominant hydroxyapatite component from the mineral matrix . This peak itself is not due to staining and provides information on mineralization states as required for a method to detect demineralization in caries development . Therefore, with improved methods for fluorescence background subtraction / suppression, it is anticipated that staining will no longer confound prs analyses . The statistical analyses also indicated that, based on the raman depolarization ratio, stained sound enamel cannot be distinguished from hypocalcified enamel . This is also not surprising since both groups are overall noncarious intact enamel with one group containing extrinsic staining . The underlying biochemistry of the enamel matrix is largely similar in both cases as revealed by the raman spectra . Subsequent analyses such as those described above for examining spectra of hypocalcified enamel could provide insights for discriminating these two groups . This result suggests that, like regions of demineralization, the apatite in areas of calculus has a disordered crystal structure and orientation as shown by higher depolarization ratio values . Calculus is easily observed on the oct image, and therefore oct will be the first technology used with the fibre optic probe to screen for wsls and to determine whether prs analysis of the lesion is necessary . If calculus is detected on the oct image, the area will be scaled before the prs method is applied to determine the raman depolarization ratio . By combining oct and prs technologies, it is possible to rule out false - positive readings that might occur from using raman depolarization ratios alone . Furthermore, according to the box- and whisker- plot (figure 4), setting a depolarization ratio threshold of ~0.18 can help discriminate carious enamel from enamel with a calculus deposit . It is important to note that this study was limited to extracted human teeth . In the oral environment, there will be a combination of many possible confounding factors present, and an additive effect may result in the oral cavity that was not observed when testing the possible confounding factors separately . These issues will be addressed in our subsequent studies as we transition to using fibre - optic - based devices for in vivo measurements with patient volunteers . In conclusion, calculus and hypocalcification stain does not influence wsl detection with oct . With improved analysis methods, the current limitations with prs analysis in the presence of stain the combination of oct and prs technologies can decrease the risk of false - positive reading and increase the potential for the detection of wsls with high sensitivity and specificity . This initial study has pointed out limitations that should be taken into consideration when using these methods and highlighted further analyses that need to be undertaken to better understand the effects of calculus, hypocalcification, and stain on oct and prs technologies.
|
Hematoxylin and eosin - stained slides and formalin fixed paraffin embedded blocks of eight cases of hca were retrieved from the archives of the department of pathology, korea university medical center and seoul national university hospital . The hematoxylin and eosin slides were reviewed, and immunohistochemical stains were performed on the formalin fixed paraffin embedded blocks as followed . Hematoxylin and eosin - stained slides of each case were reviewed independently by two authors (h.k . The histological characteristics of the tumors were evaluated with emphasis on steatosis, sinusoidal dilatation, inflammatory infiltrate, cytological atypia, acinar growth pattern, telangiectasia, and peliosis . Histological parameters were recorded as negative if less than 10% of the tumor showed the corresponding morphology . Immunohistochemical stainings was performed using the following antibodies: l - fabp (1:50, rabbit polyclonal) from abcam (cambridge, ma, usa); -catenin (1:50, mouse monoclonal), saa (1:50, mouse monoclonal), and glutamine synthetase (gs; 1:200, mouse monoclonal) from bd biosciences (san diego, ca, usa); cd3 (1:100, mouse monoclonal), cd20 (1:100, mouse monoclonal), p53 (1:50, mouse monoclonal) and ki-67 (1:50, mouse monoclonal) from dako (carpentaria, ca, usa); and glypican3 (1:50, mouse monoclonal) from cell marque (rocklin, ca, usa). Cytoplasmic staining of normal hepatic parenchyma served as a positive control for l - fabp immunostaining . Focal cytoplasmic staining in the perivenular area of normal hepatic parenchyma served as a positive control for gs immunostaining . Diffuse cytoplasmic granular staining with or without membranous staining was recorded as a positive saa immunostaining result . The recent hca classification system proposed by the bordeaux group was used.8 the histologic and immunohistochemical characteristics for each subtype are described below . Each case was categorized based on combined clinical, histologic, and immunohistochemical parameters . The histologic characteristics of h - hca are marked steatosis and an absence of cytological abnormalities and inflammatory infiltrate.6,7,13 this subtype shows negative staining for l - fabp because hnf1 positively regulates fabp1 in normal liver tissue . Diffuse or focal cytoplasmic staining was interpreted as a positive result for l - fabp immunostaining . The presence of steatosis and negative l - fabp immunostaining were indicators of h - hca . The histological characteristics of -hcas are nuclear atypia, an acinar (pseudoglandular) growth pattern, and lack of steatosis.6 -catenin and gs immunostaining was used to detect -hcas.12,13 diffuse or focal cytoplasmic gs staining was interpreted as a positive result . Diffuse or focal nuclear -catenin immunostaining was interpreted as a positive result, whereas cytoplasmic -catenin immunostaining was recorded as aberrant expression . Characteristic -hca histologic characteristics and positive gs and/or -catenin immunostaining results were indicators of -hca . The histologic characteristics of i - hca are presence of inflammatory infiltrate, marked sinusoidal dilatation, and thick - walled arteries.8 steatosis may be present in patients with i - hca but is not as extensive as that in patients with h - hca.8 diffuse or focal cytoplasmic immunostaining for saa was interpreted as a positive result . Hcas without genetic changes in hnf1 or -catenin and without protein expression of the previously mentioned markers are categorized into this group.8 hcas with complete or near - complete necrosis can also be classified in this group.13 hematoxylin and eosin - stained slides of each case were reviewed independently by two authors (h.k . The histological characteristics of the tumors were evaluated with emphasis on steatosis, sinusoidal dilatation, inflammatory infiltrate, cytological atypia, acinar growth pattern, telangiectasia, and peliosis . The percentage of steatotic area was recorded . Histological parameters were recorded as negative if less than 10% of the tumor showed the corresponding morphology . Immunohistochemical stainings was performed using the following antibodies: l - fabp (1:50, rabbit polyclonal) from abcam (cambridge, ma, usa); -catenin (1:50, mouse monoclonal), saa (1:50, mouse monoclonal), and glutamine synthetase (gs; 1:200, mouse monoclonal) from bd biosciences (san diego, ca, usa); cd3 (1:100, mouse monoclonal), cd20 (1:100, mouse monoclonal), p53 (1:50, mouse monoclonal) and ki-67 (1:50, mouse monoclonal) from dako (carpentaria, ca, usa); and glypican3 (1:50, mouse monoclonal) from cell marque (rocklin, ca, usa). Cytoplasmic staining of normal hepatic parenchyma served as a positive control for l - fabp immunostaining . Focal cytoplasmic staining in the perivenular area of normal hepatic parenchyma served as a positive control for gs immunostaining . Diffuse cytoplasmic granular staining with or without membranous staining was recorded as a positive saa immunostaining result . The recent hca classification system proposed by the bordeaux group was used.8 the histologic and immunohistochemical characteristics for each subtype are described below . The histologic characteristics of h - hca are marked steatosis and an absence of cytological abnormalities and inflammatory infiltrate.6,7,13 this subtype shows negative staining for l - fabp because hnf1 positively regulates fabp1 in normal liver tissue . Diffuse or focal cytoplasmic staining was interpreted as a positive result for l - fabp immunostaining . The presence of steatosis and negative l - fabp immunostaining were indicators of h - hca . The histological characteristics of -hcas are nuclear atypia, an acinar (pseudoglandular) growth pattern, and lack of steatosis.6 -catenin and gs immunostaining was used to detect -hcas.12,13 diffuse or focal cytoplasmic gs staining was interpreted as a positive result . Diffuse or focal nuclear -catenin immunostaining was interpreted as a positive result, whereas cytoplasmic -catenin immunostaining was recorded as aberrant expression . Characteristic -hca histologic characteristics and positive gs and/or -catenin immunostaining results were indicators of -hca . The histologic characteristics of i - hca are presence of inflammatory infiltrate, marked sinusoidal dilatation, and thick - walled arteries.8 steatosis may be present in patients with i - hca but is not as extensive as that in patients with h - hca.8 diffuse or focal cytoplasmic immunostaining for saa was interpreted as a positive result . Hcas without genetic changes in hnf1 or -catenin and without protein expression of the previously mentioned markers are categorized into this group.8 hcas with complete or near - complete necrosis can also be classified in this group.13 the histologic characteristics of h - hca are marked steatosis and an absence of cytological abnormalities and inflammatory infiltrate.6,7,13 this subtype shows negative staining for l - fabp because hnf1 positively regulates fabp1 in normal liver tissue . Diffuse or focal cytoplasmic staining was interpreted as a positive result for l - fabp immunostaining . The presence of steatosis and negative l - fabp immunostaining were indicators of h - hca . The histological characteristics of -hcas are nuclear atypia, an acinar (pseudoglandular) growth pattern, and lack of steatosis.6 -catenin and gs immunostaining was used to detect -hcas.12,13 diffuse or focal cytoplasmic gs staining was interpreted as a positive result . Diffuse or focal nuclear -catenin immunostaining was interpreted as a positive result, whereas cytoplasmic -catenin immunostaining was recorded as aberrant expression . Characteristic -hca histologic characteristics and positive gs and/or -catenin immunostaining results were indicators of -hca . The histologic characteristics of i - hca are presence of inflammatory infiltrate, marked sinusoidal dilatation, and thick - walled arteries.8 steatosis may be present in patients with i - hca but is not as extensive as that in patients with h - hca.8 diffuse or focal cytoplasmic immunostaining for saa was interpreted as a positive result . Hcas without genetic changes in hnf1 or -catenin and without protein expression of the previously mentioned markers are categorized into this group.8 hcas with complete or near - complete necrosis can also be classified in this group.13 there were three cases of h - hca, four cases of i - hca, and one cases of -hca . Morphologic findings (table 2) and results of immunohistochemical staining (table 3) were analyzed for each case . This was confirmed by negativity for glypican 3 and p53 immunostaining and a ki-67 index <1% in all eight cases . Three cases (a, b, and c) were classified as h - hca . Morphologically, cases a and b revealed marked steatosis of 30 - 40% and 20%, respectively, and did not show most of the characteristic histologic features of the other subtypes, such as sinusoidal dilatation, inflammatory infiltrate, cytological atypia, acinar pattern, thick - walled arteries, or peliosis (table 2). Case c did not show steatosis but presented with thick - walled arteries and cytological atypia . . There was faint l - fabp staining in the tumoral area, but it was interpreted as negative because the staining intensity was very weak and identical to the non - specific staining of blood vessels . Cases a (fig . 1) and b were in accordance with the known characters of h - hca, but case c was not fully concordant and shared some characteristics with i - hca . Four cases (d, e, f, and g) were categorized as i - hca . Three were male and one was female . Although these three cases had a negative history of alcohol consumption, cases d and g had high bmis (27.8 kg / m and 25.9 kg / m, respectively). All three cases had morphological characteristics typical of i - hca, including marked sinusoidal dilation, presence of inflammatory infiltrates, and thick - walled arteries (table 2). In all four cases l - fabp immunostaining was negative and saa immunostaining was positive (table 3). Glutamine synthetase immunostaining, should be negative in i - hca, was positive in cases e and f. cases d (fig . Morphologic analysis showed lack of steatosis and inflammatory infiltrate, but the presence of an acinar pattern with cytological atypia (table 2, fig . Satining the tumor cells were positive for l - fabp and glutamine synthetase (fig . However, -catenin immunostaining showed an aberrant pattern of diffuse cytoplasmic staining and was interpreted as negative because there was no nuclear staining (fig . This case was classified as -hca because all morphologic and immunohistochemical findings were in agreement with known characteristics of -hca except for the -catenin immunostaining result . All eight cases were determined to belong to the above subtypes therefore none were categorized as an unclassified hca . Three cases (a, b, and c) were classified as h - hca . Morphologically, cases a and b revealed marked steatosis of 30 - 40% and 20%, respectively, and did not show most of the characteristic histologic features of the other subtypes, such as sinusoidal dilatation, inflammatory infiltrate, cytological atypia, acinar pattern, thick - walled arteries, or peliosis (table 2). Case c did not show steatosis but presented with thick - walled arteries and cytological atypia . . There was faint l - fabp staining in the tumoral area, but it was interpreted as negative because the staining intensity was very weak and identical to the non - specific staining of blood vessels . Based on these findings, these three cases were classified as h - hca . Cases a (fig . 1) and b were in accordance with the known characters of h - hca, but case c was not fully concordant and shared some characteristics with i - hca . Four cases (d, e, f, and g) were categorized as i - hca . Three were male and one was female . Although these three cases had a negative history of alcohol consumption, cases d and g had high bmis (27.8 kg / m and 25.9 kg / m, respectively). All three cases had morphological characteristics typical of i - hca, including marked sinusoidal dilation, presence of inflammatory infiltrates, and thick - walled arteries (table 2). In all four cases l - fabp immunostaining was negative and saa immunostaining was positive (table 3). Glutamine synthetase immunostaining, should be negative in i - hca, was positive in cases e and f. cases d (fig . Morphologic analysis showed lack of steatosis and inflammatory infiltrate, but the presence of an acinar pattern with cytological atypia (table 2, fig . Satining the tumor cells were positive for l - fabp and glutamine synthetase (fig . However, -catenin immunostaining showed an aberrant pattern of diffuse cytoplasmic staining and was interpreted as negative because there was no nuclear staining (fig . This case was classified as -hca because all morphologic and immunohistochemical findings were in agreement with known characteristics of -hca except for the -catenin immunostaining result . All eight cases were determined to belong to the above subtypes therefore none were categorized as an unclassified hca . This is the largest korean hca series review of the past several decades and the first to apply the new subtype classification . The incidence of hca in korea is very low and only a few cases of hca have been reported in korea during the past 25 years.19 the recent hca classification was established based on previous studies of genetic and phenotypic characteristics of hca and hepatic nodular hyperplasia.9,10,15,17,18,20 pathologically, the subtype classification enables an accurate diagnosis of this rare entity even with a small biopsy specimen.8,21 l - fabp immunohistochemistry is especially helpful in the identification of h - hca because hnf1 positively regulates fabp1 in normal liver tissue . Mutation in the hnf1 gene causes steatosis,22 therefore most cases of h - hca also show marked steatosis.7,11 a correlation study between genotype and phenotype of each subtype revealed a strong association between h - hca and the presence of steatosis, the absence of cytological atypia, and absence of inflammatory infiltrate.6 however, one of our l - fabp - negative cases was not consistent with the description in the new classificat ion system because it did not have steatosis but did have cytological atypia . Although a lack of steatosis in an l - fabp - negative case is unusual, similar l - fabp - negative cases without steatosis can be found in other reports.6,23 according to zucman - rossi et al.,6 fewer than 7% of hnf1-mutated adenomas show no or <10% steatosis and fewer than 2% present with cytological atypia . Four cases were categorized as i - hca, and cases showed consistent i - hca findings including positive saa and l - fabp immunostaining in addition to an inflammatory infiltrate . Atypia in i - hca does not seem to be uncommon, and occurred at a rate of approximately 50% in one previous report.6 the bordeaux group pointed out the presence of cases with overlapping features of i - hca and -hca.13 i - hcas are have been reported to present with a lower than moderate level of steatosis in 94% of cases.6 in our study, two of the four i - hcas presented with 5% steatosis while the remaining three showed none . Case h was categorized as -hca because of cytological atypia, an acinar growth pattern, and positive l - fabp staininng . Interpretation of -catenin immunostaining in hca seems to be a common problem; thus, the bordeaux group reported that they rely more on glutamine synthetase immunostaining as a surrogate marker for detecting -hca than on -catenin immunostaining because of the focal distribution or absence of -catenin positive cells.11 in one japanese report, the authors also recognized a certain case as -hca even if the tumors expressed only gs.24 the discordance between -catenin mutation status and protein expression in hcas is not as striking as that reported in studies of other tumors.25,26 glutamine synthetase, a surrogate marker for -catenin, showed inconsistent results in our series . Although positive glutamine synthetase staining is supposed to be characteristics of -hcas, four of our seven cases with non--hca subtypes showed a positive result . Similar findings of inconsistent gs staining results are discussed in a review of hca cases from scotland.27 in addition to these difficulties with immunohistochemistry, -hca can be difficult or impossible to be distinguished from well differentiated hcc because of the cytological atypia and acinar growth pattern.8 if used alone, none of the histological or immunohistochemical parameters included in the subtype classification seem to be able to properly categorize a particular tumor subtype . As summarized in a table created by the bordeaux group, a small number of cases from each subtype share histological features with other subtypes.6 furthermore, immunohistochemistry can give inconsistent results in certain cases . However, l - fabp or saa staining alone seemed to be sufficient for discriminating between h - hca and inflammatory hca, respectively . The opinion that there is no single histologic or immunohistochemical parameter sufficient for classification of any subtype has been expressed in a previous report.27 in our cases presenting with hnf1-mutated and inflammatory hca, most, but not all, had intratumoral hemorrhage . Moreover, female predominance is typically observed in hca cases, but 50% of the patients in our series, were male . A similar relatively high proportion of males was observed in a japanese study of hca.24 the authors assumed that this was a characteristic of japanese hca cases . When combined with our result, it seems likely that the relatively high proportion of males might be the result of genetic and environmental actors associated with an asian population . Overall, our results both support and contradict other reports on hca . In conclusion, the hca subtype classification based on genetic and phenotypic characteristics provides new insight into the pathological and radiological diagnosis and clinical management of these tumors . The diagnostic and clinical implications of the new classification scheme may need to be validated by other studies.
|
Microglia account for approximately 10% of the adult brain cell population and represent the first and main form of immune defense in the central nervous system (cns; lawson et al . Microglia become activated and they can be identified and distinguished from their resting phenotype based on a combination of morphological and immunophenotypic changes (dheen et al ., 2007; ransohoff and perry, 2009). Microglia initiate immune responses by enhancing the expression of toll - like receptors (tlr) and a wide range of pro - inflammatory mediators such as tumor necrosis factor - alpha (tnf), interleukin (il)-1 and il-6 for the removal of the cns threat (suzumura et al ., 1996; microglia may also fulfill a neuroprotective role via the release of neurotrophic factors and promotion of neurogenesis for the restoration of normal physiology (stadelmann et al ., 2002). Hence, the acute inflammatory response is generally beneficial, as it tends to minimize injury and promotes tissue repair . However, chronic neuroinflammation is closely related to various neurodegenerative disorders such as parkinson s disease (pd), huntington s disease (hd), dementias, and multiple sclerosis (ms), although the consequences of sustained microglial activation in these diseases is unclear . Activated microglia upregulate expression of the 18-kda translocator protein (tspo; chen and guilarte, 2008; cosenza - nashat et al . Tspo are found in abundance throughout the body in peripheral organs (i.e., liver and adrenals), and hematogenous cells, but are present at very low levels in the normal healthy cns (banati, 2002). Functionally, tspo has several biological functions including the control of cholesterol transport and neurosteroid synthesis (papadopoulos et al ., 2006), and may also be involved in the release of pro - inflammatory cytokines during inflammation (choi et al ., 2002; wilms et al ., enhanced tspo expression can be detected in vivo by using positron emission tomography (pet) imaging with the selective tspo radioligand c - pk11195 (benavides et al ., 1993; banati et al ., 1999), with evidence that increases in c - pk11195 binding potential (bpnd) correspond to activation of microglia (stephenson et al ., 1995; conway et al . Although tspo is also expressed by reactive astrocytes, a c - pk11195 pet study of patients with hippocampal sclerosis, a condition histopathologically characterized by marked astrogliosis, did not yield results that were significantly different to healthy normal controls (banati et al . This is consistent with the view that reactive astrocytes, in vivo, do not significantly contribute to the c - pk11195 signal . Therefore, in the absence of invading blood borne cells or severe focal leakage of blood - brain barrier, the increased pk11195 binding is likely to indicate the transition of microglia from a resting to an activated state, and is due to an increase in the number, rather than the affinity, of tspo (banati et al ., 2000). Hence, the measurement of tspo uptake using pet provides an in vivo tool to monitor progression and severity of neuroinflammation and is a useful indicator of active cns disease . This article aims to review the use of pet imaging to promote the understanding of activated microglia in neurodegenerative disease . Parkinson s disease is the second most common neurodegenerative disorder of the elderly and is associated with the motor symptoms of tremor, bradykinesia, and rigidity . It is characterized by the extended loss of dopaminergic neurons in the substantia nigra pars compacta, resulting in a deficiency of dopamine in the striatum (braak et al ., 2006), and the presence of alpha - synuclein (-synuclein)-containing lewy bodies . Pd is the most common of a group of parkinsonian movement disorders that also includes multiple system atrophy (msa), corticobasal degeneration (cbd), and progressive supranuclear palsy (psp). The presence of activated microglia close to dopaminergic neurons in post - mortem pd patient brains (mcgeer et al ., 1988a; mogi et al ., 1994; langston et al ., 1999; imamura et al ., 2003), and pd animal models (czlonkowska et al ., 1996; kim et al ., 2009) suggests a close relationship between neurodegeneration and neuroinflammation in pd . Numerous investigations have proposed a deleterious role of microglial activation in pd based on the vulnerability of dopaminergic neurons to various microglia - derived pro - inflammatory cytokines (ferrari et al ., 2006; stone et al ., 2009; de lella ezcurra et al ., 2010), while -synuclein can directly induce activation of microglia (zhang et al ., 2005). However, it seems that the plasticity of microglia must be considered with regards to their contribution in pd, and their role; whether beneficial or detrimental, it may depend on the stimuli present and the stage of disease (li et al ., 2007; michelucci et al ., 2009; sanchez - guajardo et al ., further clues regarding the role of activated microglia has also come from in vivo pet imaging studies (table 1). Significant microglial activation, as reflected by an increase in c - pk11195 bpnd was reported in the midbrain and putamen of pd patients when compared to controls, and was found to correlate positively with the motor severity of parkinsonism (ouchi et al ., 2005; bartels et al ., 2010 these findings suggest that activated microglia has a pathogenic importance in the disease and indicate that the early introduction of a neuroprotective drug to suppress microglial activation could be favorable in pd . Additionally, pd patients exhibited significantly increased c - pk11195 bpnd in the basal ganglia, pons, and frontal and temporal cortical regions (gerhard et al ., 2006a). In this study, the increased microglial activation remained unchanged for 2 years, while the patients deteriorated clinically during this period . Hence, it is likely that microglia are activated early in pd, where they remain activated for longer periods and possibly drive progression of the disease (gerhard et al ., 2006a). Bpnd, binding potential; cbd, corticobasal degeneration; msa, multiple system atrophy; nc, normal control; pd, parkinson s disease; psp, progressive supranuclear palsy . Multiple system atrophy is a sporadic neurodegenerative disorder involving a progressive akinetic - rigid syndrome, autonomic failure, and cerebellar dysfunction . It is associated by the appearance of abnormal glial cytoplasmic inclusions (gci) containing (-synuclein aggregates and neuronal loss within the nigrostriatal and olivopontocerebellar regions (lantos and papp, 1994). The presence of activated microglia is also a prominent feature of msa (schwarz et al ., 1998). In an in vivo pet study of msa patients, significant c - pk11195 bpnd was observed in the putamen, pallidum, pons, substantia nigra pars compacta, and dorsolateral prefrontal cortex, reflecting the known distribution of neuropathological changes in msa (gerhard et al ., 2003). Although the role of microglia in msa is inconclusive, microglial activation localization correlated significantly with the locations of gcis in specific neuroanatomical systems affected in msa (ishizawa et al ., 2004). A correlation between extent of microglial activation and dopaminergic neurodegeneration has also been reported (stefanova et al ., 2007). Progressive supranuclear palsy is an adult - onset progressive neurodegenerative disease of unknown cause, characterized by pd - like symptoms such as postural instability and bradykinesia . The pathological hallmark of the disease is neurofibrillary tangles consisting of hyperphosphorylated tau, accompanied by neuronal loss in the thalamus, basal ganglia, and specific brainstem regions (hauw et al . Several early studies including immunohistochemical investigations have confirmed the possible involvement of activated microglia in psp (kida et al ., 1992; komori et al ., 1998; ishizawa et al ., 2000; ishizawa and dickson, 2001). C - pk11195 pet have also reported significant levels of activated microglia in brain regions known to be affected by the disease process such as the midbrain, cerebellum, pons, frontal lobe, and basal ganglia (gerhard et al ., 2006b). Although these results were unable to support a direct causal contribution to neurodegeneration in psp, they are at least suggestive of a role of microglia in the disease . Corticobasal degeneration is a neurodegenerative disorder that affects both cortical and basal ganglial regions, with considerable clinical heterogeneity between patients . Typically, cbd features an asymmetric hypokinetic - rigid syndrome, coupled with alien limb phenomenon and cortical sensory impairment that is unresponsive to dopaminergic therapy (rebeiz et al ., 1968; gibb et al ., 1989 information on the association of activated microglia in cbd is limited, and mainly coming from immunohistochemical - based assessments (armstrong et al ., 2000; ishizawa and dickson, 2001). However, more recent in vivo pet investigations have attempted to quantify microglial activation in cbd patients . Increased c - pk11195 bpnd was observed in regions such as the caudate nucleus, putamen, substantia nigra pars compacta, pons, and pre- and post central gyrus (gerhard et al . 2004) that correspond to the expected neuropathological changes seen in cbd (ishizawa and dickson, 2001; dickson et al ., 2002). Huntington s disease is an autosomal, dominant inherited progressive neurodegenerative disorder associated with motor, cognitive, and psychiatric symptoms . It is caused by an abnormal polyglutamine - repeat expansion on the it15 gene that codes huntingtin, and involves the progressive loss of medium spiny dopaminergic receptor - bearing striatal gaba - ergic neurons (vonsattel and difiglia, 1998). Although the role of chronic neuroinflammation in the hd pathogenesis is not fully understood, post - mortem assessments have reported high levels of activated microglia close to degenerating neurons (mcgeer et al . Upregulated inflammatory cytokines have also been detected in the striatum and plasma, indicative of an inflammatory component in hd (dalrymple et al ., 2007; imaging studies using c - pk11195 pet have found increased microglial activation in both premanifest hd gene carriers and manifest hd patients when compared to healthy controls (table 2; pavese et al ., 2006; tai et al ., 2007; politis et al ., 2008, 2011). In premanifest hd patients, significant increases in c - pk11195 bpnd in the striatum and hypothalamus was reported, which correlated inversely with neuronal dysfunction as measured by c - raclopride; a marker of dopaminergic d2/d3 receptor availability (tai et al ., 2007; politis et al ., 2008). Interestingly, microglial activation in the striatum, and regions related to cognitive function has been shown to predict the 5-year disease clinical onset in premanifest hd patients (tai et al . These results imply that microglial activation is an early event in the hd disease course, with a possible pathogenic involvement that is associated with a subclinical progression of the disease . Bpnd, binding potential; hd, huntington s disease; nc, normal control . In manifest hd patients, significant c - pk11195 bpnd in the striatum, hypothalamus, and various cortical regions was found, that correlated with greater disease burden and higher motor disability (pavese et al . The cortical microglial activation is likely to indicate the involvement of cortical neurons in hd, a well - recognized phenomenon as the disease progresses . Collectively, these findings are consistent with the post - mortem studies (messmer and reynolds, 1998; sapp et al ., 2001) and suggest a detrimental microglial contribution to the ongoing neuronal degeneration in hd . Dementias are a group of disorders that are expected to affect more than 100 million people by 2050 raising remarkable financial costs for healthcare (wimo et al ., 2003). Ad is the most common cause of dementia and is the most common neurological disorder of the elderly . Ad is characterized by the presence of amyloid plaques, neurofibrillary tangles, and activated microglia (for review, see hardy and selkoe, 2002). There is a plethora of evidence from post - mortem human ad studies (mcgeer et al ., 1988a; venneti et al ., 2009) and animal models (frautschy et al ., 1998; stalder et al, 1999; leung et al ., 2011) reporting a high accumulation of activated microglia in close proximity with the amyloid plaques, and upregulated levels of pro - inflammatory cytokines (akiyama et al ., 2000; eikelenboom et al ., positron emission tomography enables a broad range of functional processes to assess the ad brain in vivo (table 3). C - pk11195 has been used to demonstrate increased levels of activated microglia in both ad animal models (venneti et al ., 2009) and ad patients (cagnin et al ., 2001; edison et al ., 2008; yokokura et al ., 2011). In ad patients, significant c - pk11195 bpnd was consistently observed in the temporal, parietal, and occipital cortices, regions known to be affected by ad pathology (cagnin et al ., 2001; the increased activated microglia also inversely correlated with the patient mini - mental state examination (mmse) scores, which is compatible with a role of microglia in neuronal damage (edison et al ., 2008). Interestingly, elevated levels of activated microglia were also detected in patients with amnestic mild cognitive impairment (mci; okello et al ., 2009a), although this was not observed in another study assessing mci patients (wiley et al . Mci could represent an early precursor stage of ad, since it was found that mci patients with increased amyloid load were significantly more likely to clinically convert to ad within 3 years (okello et al ., 2009b). Therefore, microglial activation could be an early event in the ad pathogenesis that begins at the mci stage . Ad, alzheimer s disease; bpnd, binding potential; ftld, frontotemporal lobar degeneration; mci, mild cognitive impairment; mmse, mini - mental state examination; nc, normal controls . Despite the evidence suggestive of a pathogenic role of activated microglia in ad, it is hypothesized that the accumulation of amyloid plaques is actually due to a failure in microglial clearance mechanisms that would normally remove the protein (bornemann et al ., 2001; this indicates a beneficial, rather than detrimental role of microglia in ad . Notwithstanding the abundance of activated microglia close to senile plaques, they maybe inefficient in the clearance of amyloid, hence, resulting in aggregate formation (bolmont et al ., 2008). It has been shown that in the presence of pro - inflammatory cytokines, phagocytic functions of microglia are compromised (koenigsknecht - talboo and landreth, 2005). Therefore, microglia may confer a dichotomous role in ad, where early microglial activation is possibly neuroprotective involving the removal of amyloid . However, chronic neuroinflammation may downregulate amyloid clearance mechanisms, thus, promoting aggregation and progression of disease . Frontotemporal lobar degeneration (ftld) which includes frontotemporal dementia is the name given to a group of pathologically, clinically, and genetically heterogeneous disorders involving focal atrophy of the frontal and temporal lobes, while unlike ad, with sparing of the parietal and occipital regions (neary et al ., 1998). Another important dissimilarity between ad and ftld pathology is the absence of amyloid plaque formation (paulus et al ., 1993; rather, the key histopathological features of ftld, depending on subtype, includes tau deposition (including pick bodies) and ubiquitin - positive, tau - negative inclusions (munoz et al ., 2003; uchihara et al ., 2003). In vivo pet imaging of ftld patients detected enhanced microglial activation in the expected frontotemporal regions (cagnin et al ., 2004). In the same study, significant c - pk11195 bpnd in the bilateral putamen is also consistent with previous neuropathological data showing the involvement of the basal ganglia in ftld (mirra and hyman, 2002). These observations indicate the presence of an active microglial response that reflects progressive neuronal degeneration . Importantly, the detection of increased microglial activation in affected regions in ftld suggests that microglial responses occur independently of amyloid deposition, and that neuronal loss alone is enough to induce activation (cagnin et al ., 2004). Multiple sclerosis is a disease characterized pathologically by inflammatory demyelination and axonal transection, and is the most common cause of non - traumatic disability in young adults (compston and coles, 2008). The involvement of activated microglia has long been proposed in ms (benveniste, 1997). Post - mortem investigations have detected activated microglia in the cortical gm of ms patients (de groot et al . 2002), while histopathological studies have implicated microglia in lesion pathogenesis (for review, see lassmann, 2008). An observed correlation between neuronal loss and microglial activation was reported in animal experimental ms (rasmussen et al ., 2007). Significant levels of activated microglia was also found in ms patients, especially in the progressive forms of disease that are associated with neurodegeneration (kutzelnigg et al ., 2005; magliozzi et al ., 2010), and selective ablation of parenchymal microglia was able to prevent demyelination and axonal damage (heppner et al ., 2005). Pathological aspects of ms such as neuroinflammation, demyelination, and neurodegeneration may be explored in vivo with pet (for review, see kiferle et al ., 2011). Pet with c - pk11195 and other tracers has demonstrated inflammatory processes with microglial involvement in ms (figure 1; table 4). In animal experimental ms and human post - mortem brains it has been shown that c - pk11195 uptake corresponds to the distribution pattern of activated microglia (banati et al ., 2000). It has also been demonstrated that there is increased c - pk11195 bpnd in areas of focal pathology identified by t1- and t2-weighted mri (vowinckel et al ., 1997; banati et al ., 2000) and in gadolinium - enhanced t1-weighted mri (debruyne et al ., 2003). Increased c - pk11195 bpnd was observed in normal - appearing gray and white anatomical structures (banati et al . This is in line with the hypothesis that inflammatory processes initiated by microglia early in ms may constitute the real burden of disease, associated with invisible microglia - mediated damage that occur independently of relapses (kesselring, 1990; confavreux et al ., 2000). A positive correlation has been suggested between ligand uptake and disease duration, disability, and brain atrophy (banati et al ., 2000; however, recent data from our group found a significant association between high c - pk11195 bpnd in the cortical gray matter and disability in patients with secondary progressive ms, and with higher c - pk11195 bpnd in the secondary progressive group than the relapse - remitting ms group (politis et al . Enhanced microglial activation in ms has also been detected using the more recently developed tspo tracers c - vinpocetine and c - pbr28 (vas et al ., 2008; oh et al ., 2011). Positron emission tomography images showing increased c - pk11195 bpnd in a multiple sclerosis patient (a) when compared to a healthy normal control (b). Color bar represents intensity of c - pk11195 tracer binding (bpnd). Bpnd, binding potential; gm, gray matter; mri, magnetic resonance image; ms, multiple sclerosis; nawm, normal - appearing white matter; nc, normal control; pp, primary progressive multiple sclerosis; rr, relapse - remitting multiple sclerosis; sp, secondary progressive multiple sclerosis . Microglial activation may contribute to the mechanism of axonal injury via the release of soluble factors that may either directly or indirectly cause neuronal dysfunction (peterson et al ., 2001; barnett and prineas, 2004; dutta and trapp, 2006; zipp et al ., 2006; dal bianco et al ., 2008; lassmann, 2008; magliozzi et al ., 2010), however, activated microglia may also exert protective functions with ms through the release of neurotrophic factors (stadelmann et al ., 2002; napoli and neumann, 2009), and triggering of remyelination mechanisms (li et al ., 2005; setzu et al ., c - pk11195 was the first tracer to be consistently used for the study of activated microglia and neuroinflammation in vivo . However, limitations associated with the application of c - pk11195 include a high level of non - specific binding (petit - tabou et al ., 1991), and a poor signal to noise ratio, which complicates its quantification (boutin et al ., 2007). This has prompted the search for novel pet tracers (termed, second generation radioligands) with improved capacities to quantify tspo expression . Radioligands such as c - pbr28, c - daa1106, f - fedaa1106, and f - pbr111 have recently been developed to image tspo in vivo (gulys et al ., 2002; ikoma et al ., 2007;, 2011; for a review, see chauveau et al ., 2008). Published data using the second generation ligands c - daa1106 (ikoma et al ., 2007) and f - fedaa1106 (fujimura et al ., 2006) in humans were promising, with both tracers showing significantly higher cerebral uptake than c - pk11195 . Furthermore, increased c - daa1106 binding was reported in ad patients (yasuno et al ., 2008) that were similar to the previous studies that used c - pk11195 (cagnin et al ., 2001). The only published study using the second generation radioligand c - pbr28 found areas of focal increases in radiotracer binding in the brain of ms patients (oh et al ., 2011) interestingly, the increased focal c - pbr28 binding preceded the development of some gadolinium - enhancing lesions . Brain parenchymal c - pbr28 binding in ms patients was positively correlated with the duration of the disease, however it was not significantly higher than that of healthy volunteers . Interpretation of these results is limited by the lack of characterization of the binding affinity pattern, which might have significantly affected the comparison between subjects . It has been recently demonstrated that there are three different affinity patterns for second generation tspo ligands in healthy volunteers as well as patients with ms, which was evident with all the ligands tested (c - pbr28; c - pbr06; f - pbr111; owen et al ., 2010). This presents a methodological problem, as differences in pet signal across subjects cannot be safely interpreted as differences in target density, but may reflect differences in the affinity pattern . A possible approach to solve this problem is based on the use of peripheral binding affinity, which can be characterized to classify subjects into one of the groups, as differences in affinity status between individuals have been shown to be present on peripheral cells as well (owen et al . Interestingly, the difference in binding patterns observed with second generation radioligands was not observed with c - pk11195 . Also, in vitro autoradiography data using c - pk11195 suggest a receptor density (bmax) significantly higher than that found using second generation ligands . It could be speculated that c - pk11195 and newer ligands bind to distinct sites within the tspo molecule . Although, data obtained from first generation studies have been promising and suggested that c - pk11195 could be useful to image acute inflammatory lesions and microglial activation in ms, a conclusive demonstration of the potential of tspo imaging for the application as disease biomarker, indicative of microglial activation in ms, is still lacking . Furthermore, despite second generation ligands constituting a potential improvement relative to c - pk11195 at least from a methodological point of view, a clear advantage in their clinical application as disease biomarkers has not been demonstrated yet . For these reasons, we aim to characterize a second generation tspo pet radioligand in vivo in humans, and to evaluate its application as a disease biomarker in ms . Among second generation tspo tracers, f - pbr111 presents different advantages, as there is low difference in its affinity for tspo between high, medium, low affinity binders . Also, it could be potentially used in clinical applications as it is labeled with fluorine-18 . Promising preclinical data, and ongoing studies in neurological patients, suggest it could be a good choice amongst second generation tspo ligands to progress into studies in ms patients . Inflammation coupled with the presence of activated microglia seems to be a common feature of a wide range of cns diseases . However, despite a large number of research studies, the exact role of microglia in chronic neurodegenerative diseases remains uncertain . In line with the high plasticity of microglia that allows them to perform numerous cns functions, microglia are likely to play a dichromatic role in disease, depending on signals present in their microenvironment and the duration of activation . While early microglial activation could represents a beneficial response (i.e., removal of cns threat, promoting tissue repair and removal of misfolded protein), chronic exposure could induces detrimental effects by promoting neuronal death (i.e., through the sustained release of neurotoxic factors), thus, contributing to progression of disease . Pet imaging with the use of tspo radioligands provides a valuable tool that allows us to track the progression and severity of neuroinflammation in the living brain, and is a useful indicator of active cns disease . Therefore, the early detection of microglia using pet could offer opportunities for pharmacological interventions to limit the potential disruptive effects of chronic microglial activation . Furthermore, with the development of newer tspo tracers, the potential for pet imaging research to promote our understanding of activated microglia in cns disease can only increase . The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
|
Rheumatoid arthritis (ra) is a chronic systemic inflammatory disease affecting predominantly joints, synovial membranes, articular cartilages, and subchondral bones . Disease progression is attributed to increases in reactive oxygen species (ros) and oxidative stress (os) in the lesion sites . Proinflammatory cytokines, such as tumor necrosis factor- (tnf-), interleukin-1 (il-1), and il-6, regulate the inflammatory and immune responses and play a pivotal role in the disease . Overproduction of nitric oxide (no), as a result of induction of inducible nitric oxide synthase (inos) due to enhanced production of these cytokines, is associated with persistent inflammation and tissue destruction in experimental arthritis models, including rheumatoid arthritis [4, 5]. A number of inflammation stimuli, including tnf-, il-1, il-6, or ros, can activate proinflammatory pathways involved in ra pathogenesis, concerning predominantly nuclear factor-b (nf-b), mitogen activated protein kinases (mapks), or janus kinases / signal transducers and activators of transcription (jak / stat1/3) [68]. This results in translocation of relevant downstream transcription factors from the cytoplasm to the nucleus, where they activate messenger rna (mrna) expression of target genes, including il-1, tnf-, inos, and 12/15-lipoxygenase (lox), leading to overproduction of corresponding proteins . Cytokines released into the synovium reach also the systemic circulation and act in other tissues and organs such as lungs, vascular tissue, liver, and heart . Several recent investigations reported damage of vital organs with various degrees of impairment, considered to be secondary complications of ra and a major predictor of mortality in ra patients . Increasing evidence is pointing to the critical role of the liver in modulating the immune response in autoimmune and chronic inflammatory diseases including ra [5, 11, 12]. The hepatic biochemical and immunological alterations are associated with and influenced by changes in the oxidative state of liver cells . Adjuvant - induced arthritis (aa) in rats not only is an experimental model of polyarthritis but also induces pathological changes in a variety of other tissues, including the liver and spleen . It is a useful tool to study immunopathologic processes, autoimmune chronic inflammation, and inflammatory cachexia in rodents . In addition, at the molecular level, mrna profiling suggests that this model is also similar to human ra, particularly in tissue gene expression and in the activation of regulatory pathways [11, 14]. Numerous studies reported natural polyphenols as potential therapeutic agents of diseases caused by os and inflammation [1517]. N - feruloylserotonin (n - f-5ht, n - feruloyl-5-hydroxy - tryptamine) is a conjugated serotonin, a member of the indole hydroxycinnamic acid amides, with serotonin (5-ht) and ferulic acid (fa) as representative components of its structure . Hydroxycinnamic acid amides of serotonin, synthesized by serotonin n - hydroxycinnamoyltransferase, are present in several vegetables and wild - growing plants whose seeds are used in herbal medicine in eastern countries [1820]. In cell - based studies, under short - term high - glucose conditions, n - f-5ht exerted an inhibitory effect on overproduction of mitochondrial superoxide by acting as scavenger of superoxide . N - f-5ht attenuated the upregulation of mrna and proteins of ros - dependent adhesion (vascular cell adhesion protein-1 (vcam-1)) and migration factors (monocyte chemoattractant protein-1 (mcp-1)), crucial in early atherosclerosis lesions in human aortic endothelial cells, and inhibited the activation of transcription factor nf-b . Furthermore, n - f-5ht showed a protective effect on ros - related neuronal damage by decreasing the activity of proapoptotic caspase-3 . N - f-5ht isomers isolated from seeds of leuzea carthamoides were shown to inhibit protein kinase c / ii activation and decrease the oxidative burst of human whole blood and isolated neutrophils in vitro . N - f-5ht was also found to have a protective effect against ldl oxidation and atherogenesis in experimental animals and in human studies [2426]. Methotrexate (mtx), used as a standard drug in our study, represents the most frequently used pharmacotherapy of ra in clinical practice . Its administration is, however, limited due to its toxic side effects [27, 28]. Yet application of a combination therapy of mtx with other potential immunomodulators, synthetic drugs or natural substances [3032], might elevate the therapeutic efficacy: decrease the dose of mtx and thus its side effects . In our previous study, we showed that administration of n - f-5ht to mtx - treated arthritic rats lowered the dose of mtx for the required sustained antirheumatic impact . In this study, we focused on the therapeutic impact of n - f-5ht and mtx administered in monotherapy and on details of the inflammatory state in the arthritic rat liver with the aim to elucidate the molecular mechanisms of their effect . One of the possible clarifying approaches is to study the mrna expression of key proinflammatory markers (il-1, tnf-, and inos) in the liver of treated and untreated arthritic rats . Further, it is of particular interest to expand our knowledge on the effect of n - f-5ht and mtx in the aa model, which in turn should allow extrapolations of these results to ra patients . To this aim we evaluated also conventional arthritic parameters (hpv, arthritic score, body weight change, and weight of the liver) along with changes in plasmatic levels of il-1 and crp and the activity of 12/15-lox in the liver . Adult male lewis rats weighing 160180 g were obtained from charles river wiga, germany . The experimental protocol was approved by the ethics committee of the institute of experimental pharmacology and toxicology and by the slovak state veterinary and food administration in accordance with the european convention for the protection of vertebrate animals used for experimental and other scientific purposes and was in line with slovak legislation . To induce a rat model of adjuvant arthritis (aa), rats were intradermally injected with a suspension of heat - inactivated mycobacterium butyricum in incomplete freund's adjuvant (difco laboratories, detroit, mi, usa). The third group comprised adjuvant arthritis rats treated with methotrexate (methotrexat ebewe sol inj 20 mg/2.0 ml) in oral dose of 0.4 mg / kg twice a week (aa - mtx). The fourth group comprised adjuvant arthritis rats treated with n - feruloylserotonin dissolved in suspension of methylcellulose tween 80 at a dose of 3 mg / kg / day orally (aa - n - f-5ht). Drugs were administered orally by gastric gavage from day 0 (the day of treatment) to day 28 of the study . Blood for plasma preparation was taken by retroorbital puncture on day 14 and by cardiac puncture on day 28 under deep ketamine / xylazine anesthesia . After the animals had been sacrificed under deep ketamine / xylazine anesthesia, tissues for liver and spleen homogenate preparation were taken at the end of the experiment (day 28). Blood in heparinized tubes for plasma preparation was centrifuged at 3000 rpm for 15 minutes at 4c . Fraction of four isomers of n - f-5ht (table 1) was isolated from the seeds of leuzea carthamoides (wild) dc by solvent extraction . This was then followed by column chromatography on silica gel and hplc separations under conditions previously reported [35, 36]. The hind paw volume (hpv) was recorded on days 14, 21, and 28 with the use of an electronic water plethysmometer (ugo basile, comerio, varese, italy). Calculation of the increase in hind paw volume in ml assessed the intensity of the edema . The arthritic score was measured as the total score of hpv (ml, max . Points 5) + diameter of scab in the site of mb application, measured in parallel to the spinal column (mm, max . Body weight change (bwc; g) was measured on days 1, 14, 21, and 28 . Bwc was calculated as the difference of the body mass measured on days 14, 21, and 28 to the body weight measured at the beginning of the experiment (day 1). For the determination of rat crp concentration in plasma (g / ml), the elisa kit from immunology consultant laboratories, inc . The reaction of secondary biotin - conjugated anti - rat crp antibody was evaluated by streptavidin - hrp . The tetramethylbenzidine reaction with hrp bound to immune complex was measured at 450 nm (microplate reader, labsystems multiskan rc). For the determination of il-1 concentration in plasma, the elisa kit from r&d systems quantikine was used . Rat cytokine present in the samples binds to anti - rat cytokine antibodies absorbed in the microwells . The reaction of secondary biotin - conjugated anti - rat cytokine antibody is evaluated by hrp . The tetramethylbenzidine reaction with hrp bound to immune complex was measured at 490 nm in comparison with the reference wavelength of 620 nm (microplate reader mrx ii). Concentration of proteins in liver homogenates was determined by using the bradford method and expressed in mg / ml of enzyme preparation (cytosolic fraction from rat lung and liver tissues). Linoleic acid (99%, sigma - aldrich, usa) was used as a substrate prepared in solubilized state as described in the concentration of 0.2143 100.7143 10 m. the assay of lox was monitored for 60 seconds as an increase in the absorbance at 234 nm, reflecting the formation of hydroperoxylinoleic acid . For the lox activity assay, an uv / vis spectrometer perkin - elmer lambda 35 (usa) was used . The reaction medium contained a 50 mm tris - hcl buffer (ph 7.0), 2.5 l of the enzyme, and solubilized linoleic acid . Total rna was isolated from the rat liver and spleen using rnazol rt (sigma - aldrich) and converted into complementary dna (cdna) using the primescript rt reagent kit (takara) following the protocols of the manufacturers . Amplification and detection of cdna of reference and target genes were performed on a 7300 real - time pcr system (applied biosystems) using hot firepol evagreen qpcr mix plus (rox) (solis biodyne). Relative mrna expressions of il-1, tnf-, and inos were analyzed using the ct value method . The sequences of the primers were designed and checked using primer3 and oligo analyzer 1.0.3 (table 2). Mean and sem values were calculated for each parameter in each group (810 animals in each experimental group). Statistically significant differences among treated, untreated, and control groups were tested using parametric analysis of variance (anova). Post hoc tests (tukey - kramer (anova)) were applied in situations where differences among groups were significant at the level of significance = 0.05 . After post hoc testing, the following significance levels were specified: extremely significant (p <0.001), highly significant (p <0.01), significant (p <0.05), and not significant (p> 0.05). Antioxidant properties of polyphenols including n - f-5ht have been reported [21, 40, 41]. Nevertheless, the n - f-5ht impact on chronic inflammatory and os - inducing arthritis, which could widen the possibilities of the ra therapy, remains to be elucidated . In our previous study in the model of aa, n - f-5ht in the dosage of 15 mg / kg markedly potentiated the therapeutic effect of low - dose (nontherapeutic dose) mtx (0.3 mg / kg) on arthritic (hind paw volume and arthritic score) and inflammatory parameters (il-17, mcp-1, and crp), yet it resulted in insignificant effect in monotherapy . As data about the optimal n - f-5ht dose in the rat model are scarce, we decided to study two doses of n - f-5ht: (i) when 15 mg / kg exceeded the physiologically acceptable concentration, we used 3 mg / kg, and (ii) when 15 mg / kg was too low to reach the maximal effect, we used 30 mg / kg . Unexpectedly, contrary to the lower dose of n - f-5ht, the higher dose exhibited minor effect on the parameters examined and/or these varied strongly among the animals . For this reason, this report shows only the data evaluating the lower dose of n - f-5ht . In this study, we used the therapeutic dose of mtx (0.4 mg / kg) with the intention to compare each mechanism of action of mtx and n - f-5ht, both evaluated in monotherapy . The significant rise in arthritic parameters, arthritic score, and hpv confirmed the arthritis in our model in rats . The arthritic score showed an increase in the untreated arthritic group compared to the control group on all days monitored (aa versus co, day 14, p <0.01; day 21 and day 28, p <0.001; table 3). At the end of the experiment, the arthritic score was almost doubled in the aa group compared to controls . A trend toward reduction was observed after administration of n - f-5ht to aa animals on day 28, but the effect was not statistically significant . The treatment with mtx significantly reduced the arthritic score on observation days 21 and 28, compared to the untreated arthritic group, proving the therapeutic potential of the applied dose of mtx (aa - mtx versus aa, day 21, p <0.05; day 28, p <0.01; table 3). Similarly, the change in hpv showed an increase in the untreated arthritic group compared to the control group on days 21 and 28 (aa versus co, day 21, p <0.01; day 28, p <0.05; table 3). The administration of n - f-5ht induced no modification of hpv of the arthritic animals on any day monitored . Mtx therapy significantly reduced the observed swelling on days 21 and 28 compared to the untreated arthritic group (aa - mtx versus aa, day 21 and day 28, p <0.001; table 3). The muscle wasting condition due to high catabolic activity, known as rheumatoid cachexia, occurring in approximately two - thirds of all patients with ra, is mediated by tnf- and il-1 in ra . Papers published over the past years confirmed that oxidative metabolism was considerably enhanced in the liver of adjuvant - induced arthritis in rats [4346]. Rats used in this study revealed signs of cachexia (table 3). A significant decrease in body weight change (bwc) the bwc of the arthritic rats was 56% on day 14, 19% on day 21, and 27% on day 28 (aa versus co, days 14, 21, and 28, p <0.001; table 3) of the bwc of healthy controls . N - f-5ht treatment led to a significant increase of bwc on day 28 (aa - n - f-5ht versus aa, p <0.05; table 3). The administration of n - f-5ht in arthritic animals did not change these parameters on any of the days observed . The liver weights were significantly lower (aa - mtx versus aa, p <0.05; table 3) only in the group of rats treated with mtx . The reduced weight of the liver in mtx - treated rats was assumed to be the result of inhibition of the pathway of de novo dna synthesis by mtx [47, 48]. In summary, the statistical significance of 3 mg / kg of n - f-5ht treatment was determined only for bwc . The arthritic score revealed a trend toward the positive effect increasing with time, indicating a late onset of n - f-5ht action (table 3). As expected, significant differences were found in the arthritic score and hpv in the arthritic animals treated with the therapeutic dose of 0.4 mg / kg mtx compared to those treated with the low dose of 0.3 mg / kg mtx . Il-1, a prototypic proinflammatory cytokine, is a major mediator of the inflammatory cascade in ra, which is involved in the mechanisms leading to progressive joint destruction . In the model of aa, the early phases of the disease seem to be characterized by a systemic increase of il-1 . The plasmatic level of il-1, a protein of multiorgan origin, was significantly increased in arthritic animals compared to the control group in the early phase of aa, on day 14 (aa versus co, p <0.001; figure 1(a)), ascertaining the presence of inflammation . Administration of mtx did not lead to a significant change of plasmatic il-1 concentration; only a trend toward reduction was observed on day 14 . It is noteworthy that n - f-5ht treatment resulted in a significant decrease of il-1 level in plasma (aa - n - f-5ht versus aa, p <0.05; figure 1(a)). This result is interesting, as this molecule was reported to be relevant in driving the transition from the acute phase to the chronic irreversible phase of the disease and it has been suggested that it could be the target of early intervention to stop the course toward the chronic form of the disease . The blocking il-1 protects bone and cartilage from progressive destruction in ra and its inhibition could be effective in the treatment of this disease . Activation of t and b cells, macrophages, and inflammatory mediators tnf-, il-1, and il-6 aggravates the oxidative damage of the vital organs in rheumatoid arthritis, such as the liver . The liver, in turn, influences the systemic inflammation via producing inflammatory cytokines and mediators such as tnf-, il-1, il-6, no, crp, and lox . Il-6, il-1, and tnf- promote the synthesis of crp in hepatocytes via stat3 [51, 52] and nf-b pathways . The level of the systemic inflammatory parameter crp in plasma, resulting from liver synthesis, was increased significantly in the group of arthritic animals compared with control animals in the chronic phase of the disease on experimental day 28 (aa versus co, p <0.001; figure 1(b)). Administration of n - f-5ht and mtx significantly reduced the plasmatic levels of crp on day 28 compared to the untreated group of arthritic animals (aa - n - f-5ht versus aa, p <0.05; aa - mtx versus aa, p <0.05; figure 1(b)). Interaction of crp with fc - gamma receptors (fcr) fcri and fcriia is known to promote the production of proinflammatory cytokines, resulting in the amplification loop of inflammatory reaction . These processes are initiated through the induction of the receptor activator of nuclear factor-b ligand (rankl) protein and direct stimulation of osteoclastogenesis, causing a loop between inflammation and bone destruction in ra . Crp enhances both the proinflammatory response and bone destruction . In the treatment of ra, a lowered crp level thus not only is a significant parameter in terms of disease progression elimination but also has a direct impact on decreasing the degree of bone destruction . Alterations in the oxidative state lead to the activation of nf-b and nf-b - dependent genes, such as lox . The enzyme 5-lox catalyzes the conversion of arachidonic acid to leukotrienes, whose production has been associated with inflammation in arthritis . Suppression of 5-lox expression ameliorates clinical parameters in ra and aa [56, 57]. Increased levels of nf-b in the lung and liver as well as increased activity of lox in the lung highlight the importance of extra - articular manifestations of aa . In our experiment, liver 12/15 lox activity increased in arthritic animals in comparison to healthy animals (aa versus co, p <0.001; figure 1(c)). The effect of n - f-5ht on the activity of 12/15-lox in liver homogenate was comparable with that of mtx . After administration of mtx or n - f-5ht, a significant decrease to control levels was assessed in the liver of the aa group (aa - n - f-5ht versus aa, p <0.001; aa - mtx versus aa, p <0.001; figure 1(c)). Thus the anti - inflammatory effect of n - f-5ht in aa was supported by the ability of the molecule to inhibit 12/15-lox activity . Similar to this result, recent observations also reported that several other flavonoids may act as lox inhibitors . In aa, the gene expression levels of tnf- and inos produced in the liver were reported to increase [60, 61]. Also, in our study, the levels of tnf- and inos mrna expressions were significantly increased in arthritic animals (both p <0.001, aa versus co; figures 2(a) and 2(b)). It was proposed that these modifications in the liver of arthritic rats not only were a consequence of the metabolic alterations caused by the disease, especially the increased oxidative metabolism, but also depended on increased inflammatory parameters in the liver . The same agents that increase oxidative metabolism, tnf-, il-1, il-6, and others, are responsible for increasing the activity of inos in several tissues . An increase of inos activity as a consequence of elevated inos mrna expression was considered to play a dominant role in the pathogenesis of ra . No generation by inos induced in chondrocytes in the initial stage of aa may play a key role in triggering the subsequent events in arthritis . In general, the use of nos inhibitors has been shown to exert beneficial effects in experimentally induced arthritis . However, which types of cells expressing inos are associated with the induction or progression of adjuvant - induced arthritis via no generation remains uncertain . Mrna expression of inos in rat liver was reduced following mtx (aa - mtx versus aa, p <0.001; figure 2(a)) and n - f-5ht treatment (aa - n - f-5ht versus aa, p <0.01; figure 2(a)). The effect of mtx treatment on tnf- protein and mrna expression differs among studies, depending on the conditions of the given study, concerning gender of patients, type of cell line, duration of treatment, mtx dose, and so forth . In our study in the rat aa model, administration of mtx attenuated significantly the mrna expression of tnf- (aa - mtx versus aa, p <0.01; figure 2(b)). In many patients, however, mtx treatment does not result in lower tnf- plasma concentration . When mtx fails to produce an adequate response, newer therapies are used in combination with mtx . Blocking tnf- with anti - tnf- monoclonal antibodies significantly decreased the signs and symptoms of ra compared to placebo in ra patients with active disease receiving mtx [65, 66]. Thus, the n - f-5ht - driven significant reduction of tnf- mrna expression (a - n - f-5ht versus aa, p <0.01; figure 2(b)) suggests an intriguing effect on ra treatment, calling for deeper investigation . Increase of mrna expression was observed for il-1 in the liver of arthritic animals (aa versus co, p <0.001; figure 3(a)) as expected . Administration of mtx did not lead to significant attenuation of il-1 transcription in the liver . This is in concert with previous studies of mtx function in different types of cells (e.g., human peripheral blood mononuclear cells and murine peritoneal and splenic cells) [67, 68]. On the other hand, mtx exhibits another mechanism of il-1 function inhibition, which involves blocking the binding of il-1 to il-1 receptor in the membrane of peripheral blood cells (monocytes, lymphocytes, and granulocytes). Contrary to mtx, treatment with n - f-5ht led to a substantial inhibition of il-1 gene expression (aa - n - f-5ht versus aa, p <0.01; figure 3(a)). Further, we examined il-1 mrna expression in the main immunocompetent organ, in the rat arthritic spleen, which has not been studied previously in terms of the aa model, related to il-1 expression . We observed il-1 mrna expression activation comparable to that in the liver (aa versus co, p <0.001; figure 3(b)). Interestingly, both mtx and n - f-5ht exhibited a significant and remarkably stronger inhibition of il-1 mrna expression in comparison to that in the liver (aa - mtx versus aa, p <0.01; aa - n - f-5ht versus aa, p <0.001; figure 3(b)). In the spleen of n - f-5ht treated rats, the relative mrna expression decreased even to control level . Besides other events, mtx treatment leads to suppression of nf-b, a heterodimer consisting of two subunits p65 and p50, one of the most prominent inflammatory transcription factors activated in ra . This was confirmed in our previous work, along with the finding that also n - f-5ht (15 mg / kg) suppressed the activation of nf-b (p65) in the arthritic rat liver [21, 33]. Interestingly, combination therapy (mtx + n - f-5ht) potentiated the effect of a single drug, suggesting different mechanisms leading to nf-b inhibition . Mtx driven reduction of cytokine transcription was attributed to abrogation of ib kinase activation and thereby suppression of ib (nf-b inhibitor) phosphorylation and degradation, resulting in retaining the inactive nf-b form in cytoplasm . However, the contribution of n - f-5ht to nf-b pathway suppression needs to be further investigated . Studies of the proposed pathways involved in the transcription of tnf-, il-1, and inos in ra could help evaluate the mechanism of action of these drugs [68, 71, 72]. The gene expression of inos is mostly under the control of synergistically activating nf-b (il-1 and tnf- stimulated) and stat1 (ifn- stimulated) key proinflammatory signals in the liver . In contrast to inos, tnf- does not contain the stat binding element in its promoter region . The inhibition of tnf- and inos transcription observed in our study might be mostly attributed to the suppressed nf-b pathway for both mtx and n - f-5ht [33, 64, 70]. However, the contribution of ap-1 to tnf- and stat1 for inos cannot be excluded . Mtx - dependent suppression of nf-b was reported [33, 70, 73, 74], but in other cases mtx was not found to be effective in the attenuation of arthritic - increased mrna expression of il-1 [68, 75]. Taking into account our results, where mtx treatment did not lead to inhibition of il-1 mrna expression in the arthritic liver in contrast to the significant n - f-5ht impact, yet treatment of both mtx and n - f-5ht decreased the presumably nf-b - dependent lox activity and inos and tnf- transcription to a similar extent, the involvement of n - f-5ht in another pathway for transcription regulation of this cytokine in the arthritic liver should be considered . After analysis of the reported pathways involved in the regulation of il-1 mrna expression, we hypothesized that tnf--driven ap-1 transcription factor activation or jak / stat3 pathway activated via il-6 or ifn- might play a role ([7, 8, 71, 72, 76, 77], figure s1 in supplementary material available online at http://dx.doi.org/10.1155/2016/7509653). Papers reporting involvement of other polyphenols in anti - inflammatory regulation, for example, resveratrol, claim that these compounds exhibit their anti - inflammatory effect through suppression of nf-b and jak / stat signaling pathways [78, 79]. The enhanced influence of mtx and n - f-5ht on il-1 transcription in the spleen in comparison to the liver may be the consequence of different predominance of inflammatory pathways in this organ, presumably with a stronger nf-b contribution . Details about the relevance of these pathways and the role of n - f-5ht in the transcription regulation of il-1, inos, and tnf- in the liver and other organs in ra are to be further elucidated . The present study contributed additional evidence about the beneficial effect and mechanism of action of n - f-5ht and of mtx on a systemic inflammatory process in the liver and its association with the pathogenesis of adjuvant arthritis . N - f-5ht treatment led to amelioration of inflammatory parameters tested (plasmatic crp and il-1 protein levels, liver lox activity, and liver and spleen cytokine expression). However, this did not result in a significant change of hpv, although a trend of improvement of the arthritic score was observed after 28 days . A synergistic effect of tnf- and il-1 was shown to influence the balance between protein degradation and protein synthesis causing among others an increase in resting energy expenditure and net efflux of amino acids from muscle to liver . The significant increase of bwc in n - f-5ht treated rats, probably sign of the partial improvement of rheumatoid cachexia, might be the result of lowered mrna expression of tnf- and il-1 determined in the arthritic liver . Moreover, taking into account the reported association of weight loss with the il-1 production by splenic cells, the n - f-5ht mediated attenuation of increased il-1 mrna expression in the arthritic spleen might contribute to this complex process . The contribution of the affected expression of tnf- and il-1 originating from other organs cannot be excluded and is to be further elucidated . Unexpectedly, chronic daily treatment with a high concentration of n - f-5ht (30 mg / kg) exhibited either a minor effect on the parameters examined and/or a strong variation among the animals (not shown) and that in contrast to a much lower concentration (3 mg / kg). Since n - f-5ht possesses a serotonin (5-hydroxytryptamine, 5-ht) moiety, the question if there might be some interplay between effects of these two molecules on ra pathogenesis is to be raised . Since n - f-5ht inhibited the increase of cytosolic free ca concentration in rat vascular smooth muscle cells induced by serotonin mediated by 5-ht2 receptors, it was hypothesized that at a sufficient concentration n - f-5ht may act as a competitive antagonist, which displaces serotonin from its binding site . Intake of a high concentration of a 5-ht2 receptor antagonist may lead to a variety of effects: it may influence the receptor density, even enhance the effect of serotonin, or lead to desensitization and with time to receptor resistance (through inhibitory feedback due to binding - induced enhanced production of serotonin). Interestingly, serotonin is known not only as a neurotransmitter . Increasing but contradictory reports associate serotonin with immunoinflammatory pathways in the periphery . Serotonin, via its 5-ht2a, 5-ht2b, and 5-ht3 receptors, has been implicated to have both proinflammatory and anti - inflammatory roles in a number of studies of rheumatoid arthritis [8488]. The reported effects of 5-ht receptor antagonist on macrophage - like synovial cells encourage the interest to study the effect of n - f-5ht from this point of view . To confirm this hypothesis, a precise characterization of interaction between n - f-5ht and 5-ht receptors is to be done . On comparing the effects of the two drugs, administration of mtx (0.4 mg / kg) or n - f-5ht (3 mg / kg) was found to lead to a decrease of the main plasma marker of systemic inflammation crp, the liver origin protein, and to inhibition of proinflammatory lox in the liver . The impact of mtx and n - f-5ht on mrna expression of tnf-, il-1, and inos in the liver and on the level of crp in plasma was mentioned at the conference . Mtx and n - f-5ht reduced the arthritis - increased transcription of tnf- and inos in the liver to a comparable extent . We suppose that the inhibition of tnf- and inos transcription might be mostly attributed to the suppressed nf-b pathway for the two drugs [21, 33, 70]. As previously reported [67, 68] and also proven by our study, mtx was not able to diminish the arthritic - induced il-1 mrna transcription in the liver . This handicap might be compensated by coadministration of n - f-5ht, since this drug was shown to lower the level of proinflammatory cytokine il-1 in plasma in the acute phase of aa and to attenuate significantly the elevation of il-1 mrna expression in the arthritic rat liver and spleen in the chronic phase . Detailed studies are required to confirm the hypothesis that n - f-5ht might function through potentially different mechanisms of inhibition of the inflammatory pathway nf-b and not through mtx, as well as the possibility of an additional pathway influencing il-1 transcription under control of n - f-5ht but not mtx . The confirmation would support n - f-5ht as a promising agent for the treatment of ra in combination therapy with mtx . The positive effect was shown in our previous study, where n - f-5ht markedly potentiated the therapeutic effect of low - dose mtx . As the therapeutic dose of mtx was used in this study and the purpose of combination study is to lower the mtx dose to decrease the side effects of this drug, the effect of combination therapy was not included . Oral daily intake of n - f-5ht could overcome the inconvenient administration and high costs of biological therapy using il-1 monoclonal antibody, which was shown in clinical trials to be superior to placebo in combination with mtx in reducing signs, symptoms, and radiographic progression in patients with advanced ra [91, 92]. Future studies of n - f-5ht mechanisms of action should shed more light on the immunomodulatory function of this natural polyphenol . It is to be expected that n - f-5ht is able to positively affect the activity of other markers of inflammation and oxidative stress not only in the liver and spleen but also in other organs (lung, brain, etc . ), a hypothesis to be tested by future work . However, to establish the optimal dosing in light of the effects achieved is of primary importance.
|
Although studies on the effects of children s use of computers are still undetermined, some initial studies showed positive and negative effects in this regard . Children commonly use computers for playing games, completing school assignments, sending / receiving e - mails, and connecting to the internet . This may sometimes interfere with other activities such as homework or normal social interchange (1). Studies showed that internet addiction positively correlated with depression, novelty seeking, harm avoidance, and reward dependence . On the other hand, internet addiction negatively correlated with persistence, self - directness, cooperativeness, and self - transcendence . In several studies it was demonstrated that significant factors affecting internet addiction were depression, gender, novelty seeking, and self - transcendence (2, 3). Computer game addiction is excessive or compulsive use of the internet, computer, and video games that may interfere with daily life . It is not clear whether internet and video game playing meets the diagnostic criteria of diagnostic and statistical manual of mental disorders, 4 edition (dsm - iv) (4). Previous studies about internet addiction have investigated several associated psychological variables such as shyness, loneliness, self - consciousness, anxiety, depression, and interpersonal relations (5). Some studies revealed a significant association between internet addiction and depressive symptoms in adolescents and high school students . Many investigations suggest the necessity of the evaluation of the potential underlying depression in the treatment of internet - addicted adolescents (6). Moreover, the level of internet addiction correlated positively with the level of depression and suicidal ideation among high school students . Based upon several studies, there were significant positive correlations among internet addiction, depression, and suicidal ideation in adolescents (7). Kim et al . Showed that the levels of depression and suicide ideation were highest in the internet - addicts group than other students . They advised future studies to investigate the direct relationship between psychological health problems and internet dependency (8). In this study we tried to investigate the prevalence of internet, computer games, and dvd and video addiction among high school students in southern iran, shiraz, and its relation to depression and anxiety during the years 2008 and 2009 and in a cross - sectional study 1020 high school students (males and females) were selected randomly by area and cluster sampling from different areas of shiraz in southern iran . An informed consent was received from each participant and they were assured of the confidentiality of the data . The students were given a full explanation of the reasons for the implementation of the study and were informed that their responses would be confidential . They were asked to express their personal comments and recommendations at the end of the interview . Special attention was paid to ensure that the students clearly understand the instructions of the interview . In addition, they were asked not to say their name or student number in order to encourage them to provide more open and honest answers . Demographic data (age, sex, and economic status according to income of the family), duration of internet usage, computer games playing, tv and satellite watching, dvd and video cd usage, and the reasons of the usages were asked at the interviews . The students were interviewed for addiction, generalized anxiety disorder, and major depressive disorder according to the dsm - iv criteria . Mild depression: decreased mood, presence of anxiety symptoms, and increased symptoms in the afternoon, without suicidal idea . Moderate depression: decreased activity, depressed mood, agitation, decreased energy, and decreased concentration, sense of guilt, hypochondriacs, sleep disturbance, depersonalization symptoms, decreased appetite, and decreased sexual activities . Dependent: dysfunctional, and withdrawal symptoms (restlessness, anxiety, decreased concentration, insomnia, irritability, fatigue, and craving) after discontinuing . The obtained data were analyzed using descriptive indices and the analytic methods of the chi - squared and pearson regression . The data were analyzed with statistical package for social sciences (spss) for windows15.0 (chicago, il . 277 students (27.2%) were in the first year of high school, 242 (23.7%) were students of the second year, and 501 (49.1%) were in the third year of high school . 140 students (13.7%) had low economic status (defined as family monthly income of less than 3000000 rials income), 807 (79.1%) had moderate economic status (3000000 - 1000000 rials income per month), and 62 (6.1%) had high economic status (more than 10,000,000 rials income per month). Table 1 shows the prevalence of depression and anxiety among students according to sex, economic state, and internet, computer, or dvd usage, and history of medical disease . 13 students (1.3%) were computer games abusers, and 634 students (85%) reported playing computer games for amusement . 215 (21.1%) of student did not use dvd or video cd . 1 student (0.1%) was dvd or video cd abuser, and 576 students (77.7%) reported using dvd or video cd for amusement . 22 (2.2%) students did not watch tv or satellite, 4 students were abusers, and 190 (18.6%) students were dependent to tv or satellite . 455 (53.6%) students reported watching tv or satellite for film and football, and 306 (36.2%) for amusement . 94 students (9.2%) had medical problems, and 71 (7%) used some medications regularly . Prevalence of anxiety and depression were significantly higher in females (p <0.05). The prevalence of anxiety and depression was significantly lower in students of the third year compared to other grades (p <0.05). The prevalence of anxiety was significantly higher in students with lower family monthly income status (p <0.05). The prevalence of depression was significantly higher in students with lower economic status (p <0.05). The prevalence of depression was significantly higher in students who were internet abusers or dependents (p <0.05), but we did not detect a significant relation between anxiety and internet usage . The prevalence of anxiety was significantly higher in the students who used the internet for chatting, amusement (such as downloading music, films, and pictures), and reading the news compared to the students who used the internet for other reasons (p <0.05). There was no significant correlation between depression and reason of internet use among the students . The prevalence of anxiety and depression were significantly higher in students who were computer games abusers or dependents (p <0.05). The prevalence of anxiety and depression did not show a relationship with the reason of playing computer games . The prevalence of anxiety was significantly higher in students who were dvd or video cd dependents(p <0.05). The prevalence of depression did not relate to the level of dvd or video cd use . Students who used dvd or video cd for resting had higher levels of anxiety and depression (p <0.05). The prevalence of depression and anxiety did not relate to the usage of tv or satellite (p <0.05). Students who watched tv or satellite for film, football, and music had lower levels of anxiety (p <0.05). Students who watched tv or satellite for film and football had lower levels of depression (p <0.05). The students who used some medications regularly or had medical problems had higher rates of depression and anxiety (p <0.05). The problem of excessive computer and internet usage is increasing more rapidly and it can occur together with other kinds of addiction . The causes of internet addiction do not have only habitual bases, but also demographic and socioeconomic aspects . The behaviors related to internet addiction may be a symptom of depressive disorders in adolescents (9 - 11). Prevalence of depression and anxiety among students according to sex, economic state, and internet, computer, or dvd usage, and history of medical disease batthyany et al . Reported excessive computer playing and internet usage corresponding to addictive behaviors were found in 12.3% of the adolescents in austria (12). . Showed the rate of internet addiction in the high school students to be about 7% which was more prevalent among males (13). Hur in study on korean adolescents reported significant correlations among internet addiction, depression, and suicidal ideation (14). Ha et al . Found that almost one third of subjects in their study diagnosed as internet addicts had a significant level of depressive symptoms that required psychiatric intervention (15). These users use the internet to such an extent that it interferes with their academic studies and they are very much preoccupied with it . It is still very much a matter of debate whether internet addiction is a distinct disorder or a behavioral problem secondary to another disorder . Suggested that internet communication with people can alleviate depression, at least among socially isolated and moderately depressed populations such as college students (11). They added that the behaviors related to internet addiction may be a symptom of depressive disorders in adolescents . Educationists and parents should try to understand the root causes of any isolation in the youth . It is alarming that excessive internet users are more likely to report having felt sad or depressed most of the days in the past year . They opined that the possible co - morbidity of major depressive disorder among internet - dependent adolescents could be explained by the internalizing tendency of the adolescents . Internalized depressive adolescents can escape from the reality or problems of the real world by losing themselves in the cyber world . Purposeful activities on the internet, which are focused, for example on academics - related research or discussing a project online, can be completed in relatively shorter periods of time through good planning . However, use of the internet for entertainment may not have a time limit and some activities like multi - player games can be highly compulsive . Parental rules in such situations can set the limit, and thereby reduce excessive use and limit negative outcomes . The rate of internet, computer games, and dvd addiction in our study were significantly lower than reports from other parts of the world . The prevalence of anxiety was significantly higher in students who did not use the internet . These abnormal results may be due to lower economic states among the students who did not use the internet . The prevalence of anxiety was significantly higher in the students who used internet for chat, amusement, and news . Similar to other studies, the prevalence of anxiety and depression was significantly higher in students who were computer game abusers or dependents, although it did not have any relation with the reason of playing of the computer games . For example, ha et al . Reported that one third of subjects in their study diagnosed as internet addicts had a significant level of depressive symptoms that required psychiatric intervention (15). While internet addiction is a new phenomenon, it has already become a subject of numerous studies . On the other hand, it is a very complicated problem and it is difficult to state whether it is more accurate to treat the problem totally as an addiction or not (15 - 17). In summary, it can be concluded that the results presented in this study are for the most part in accordance with those of other authors and other studies on this subject . Some differences could be the result of different conditions, instruments, and differences in the number and structure of the studied group . Ja conceived and designed the evaluation and helped to draft the manuscript and its revision and re - evaluated the clinical data . Aa participated in the evaluation and collection of the clinical data, and helped to draft the manuscript . Agh participated in conceiving and designing the evaluation and helped to draft the manuscript and re - evaluated the clinical data . Mkh, zkh, and zgh participated in the evaluation and collected the clinical data . Declaration of interest: none . Citation: ahmadi j, amiri a, ghanizadeh a, khademalhosseini m, khademalhosseini z, gholami z, et al . Prevalence of addiction to the internet, computer games, dvd and video and its relationship to anxiety and depression in a sample of iranian high school students.
|
, it must develop tolerance to paternal antigens to avoid a lethal immunologic attack against the fetus . On the other hand, it must preserve the ability to fight infections from a multitude of commensal and environmental pathogens . Disruption of this balance can have devastating consequences, including preterm labor and death of the fetus and/or mother . The normal maternal immune response to pregnancy is increasingly recognized as a dynamic process, with changes in the maternal pro / anti - inflammatory profile occurring at different stages of gestation [13]. Despite this recognition, a complete, longitudinal immunologic profile of normal such analyses are critical for understanding the response to specific infectious and immunologic diseases that show disproportionately negative outcomes during pregnancy, such as influenza and ulcerative colitis . One approach to such immune profiling is through the use of multiplex cytokine arrays, allowing for simultaneous quantification of many proteins with a very small amount of plasma or serum . Others have used multiplex arrays to study the maternal cytokine milieu, but the studies have been predominantly limited time point cross - sectional [68] or case - control [911] in design . The results of some longitudinal studies have been published in recent years, although results have been based on relatively few time points (5 or fewer) [13]. In this study, we applied the multiplex array approach to evaluate the changes in 42 cytokines in rich detail during pregnancy . The samples are from a cohort of 16 pregnant women, with each subject sampled a median of 18 times . Because this represents a significant increase in the number of tests per subject compared to previous studies, we also describe a strategy addressing within - subject correlation with repeated measurements using unconditional growth modeling . With this approach, we have been able to detail the typical longitudinal variation of serum cytokines throughout pregnancy in this cohort of women . Each participant had a serum sample collected and cryopreserved biweekly from study enrollment during the first trimester (average of 9.7 weeks' gestation for first samples) until 34 weeks' gestation, then weekly from 34 weeks until delivery . As a result of this repeated sampling, a median of 18 samples per participant were obtained longitudinally throughout pregnancy . Samples were collected under a protocol approved by the mayo clinic institutional review board (irb) that accrued participants from 1987 to 1988 . Information regarding date of the blood draw, date of delivery, outcome of the delivery, and any major complications that the woman experienced during pregnancy (hypertensive disorders, preterm labor, and infections) was available and helped identify appropriate participants to include . Only women who carried their pregnancies to term and experienced no pregnancy complications were included in this study . We only used samples from subjects who had specimens obtained throughout the entire course of pregnancy and whose complete, longitudinally collected specimens appeared intact and nondesiccated . Most cytokines are stable in storage at 80 degrees c for up to 2 years, but stability beyond that time is not well known . Therefore, before proceeding with studies on the samples of interest, we first tested protein levels of a small number of individually stored serum aliquots from other subjects archived on this protocol . Since we found detectable levels of cytokines in the pregnant serum samples that were within range of control samples, we proceeded with the entire study involving a cohort of 16 healthy, primigravid women who completed a term pregnancy without any significant complications . Samples were assayed when freshly thawed to avoid freeze - thaw cycles, which are known to degrade cytokines . Contemporary plasma samples from 11 nonpregnant control subjects were collected under a separate irb - approved protocol for collection of biospecimens from healthy individuals within the same health system in 2010 and similarly assessed on the same 96-well plates for comparison and as a quality control measure . For contemporary nonpregnant control samples, peripheral venous blood was drawn into heparinized vacutainer tubes that were processed and separated into plasma and peripheral blood mononuclear cells (pbmcs) following gradient centrifugation using ficoll - paque (ge healthcare, uppsala, sweden). Plasma was collected and immediately frozen at 80c in 1 ml aliquots until use . Protein levels for 42 cytokines, chemokines, and growth factors (table 1) were measured using the milliplex map human cytokine / chemokine kit (millipore, billerica, ma, usa) per manufacturer's instructions . To minimize the potential for interassay variability, each subject had all of their longitudinal specimens analyzed on the same plate . Protein concentrations were determined using a linear regression standard curve from each plate generated using the high pmt concentrations with sensitivity from 3.2 to 2,000 pg / ml . All samples were tested in duplicate with the mean value of the measurements used for statistical analyses . Comparison of baseline (first trimester) and end of pregnancy levels of cytokines / growth factors was carried out between the 16 primigravid subjects and the 11 nonpregnant control subjects using the kruskal - wallis tests . There were extremes of values that fell outside of the limits of the multiplex array . For cytokines below the limit of detection (ld), we assigned a value that was half the lowest detectable value for the assay as previously described . Analytes above the detectable range were assigned a threshold concentration . To obtain a visual representation of overall patterns in the highly dimensional raw data as an additional multivariate technique to identify patterns within the data, principle components analysis (pca) was also completed on the raw values obtained from the multiplex array . To assess the within - subject correlation, we determined change of cytokines and growth factors from a baseline time point the values obtained from the participants' first blood draw in the first trimester by taking the log of 1 plus fold change from the baseline value: log(1 + x), where x = (cytokine concentration of the sample of interest / cytokine concentration of the baseline sample) to analyze trends over time . First, we graphically assessed the growth trajectory for the 42 cytokines using smoothing splines . We then fit unconditional mean models (umm) for the 42 cytokines in order to estimate the variance components: the within - subject variance () and the between - subject variance (0). Estimating the two variance components helps to determine whether there is sufficient variation to warrant further analysis and enabled computations of the intraclass correlation coefficient,, which describes the proportion of the total outcome variation that lies between subjects . Next, we fit unconditional growth models (ugm), which allowed random slope but not random intercept because the starting value of all patients was the same (baseline value = 0.3) due to normalization to each individual's baseline value . As both gestational age in weeks and trimester can be used as the time covariate for growth curve models, and as the trimester can be treated as either a continuous or a categorical variable (depending on whether we assume linear relationship between trimester and outcome variables), six different models were fitted for each cytokines as follows: (1) model with only the gestational age in weeks as the time covariate, (2) model with only the trimester (continuous) as the time covariate, (3) model with only the trimester (categorical) as the time covariate, where the variance - covariance pattern was assumed to be autoregressive, (4) model with both gestational age in weeks and continuous trimester as covariates, allowing random slope for gestational time in weeks, (5) model with both gestational age in weeks and continuous trimester as a covariate, allowing random slope for trimester, and (6) model with both gestational age in weeks and continuous trimester as a covariate, allowing random slopes for both gestational age in weeks and trimester . We then compared the six models and the unconditional mean model for each of the cytokines based on logic and statistical fitness, using akaike information criteria (aic). Because of the exploratory nature of this study, there was no correction for multiple comparisons . The multiplex was designed to assess 42 factors, but the limits of detection were exceeded with three factors, and there were 5 cytokines that fell below the limit of detection in> 50% of the samples . Pdgf - aa, pdgf - ab / bb, and rantes had cytokine levels above detection limits of the assay in 9.9%, 11.2%, and 34.9% of the samples, respectively (table s1; see supplementary material available online at http://dx.doi.org/10.1155/2015/952571). Il-2, il-3, il-4, il-13, and tnf had> 50% of the samples below the detection limit (table s1). Differences in cytokine profiles between baseline (first trimester) pregnancy samples and nonpregnant control samples could be identified by pca (figure 1). Specifically, we identified significantly higher levels of gro, tgf, egf, pdgf - aa, and pdgf - ab / bb and significantly lower levels of scd40l, ip-10, il-6, il-17, il-13, and mcp-1 in the baseline pregnancy samples (table 1). When all longitudinal samples were included in a pca, no difference next, we evaluated whether those differences apparent in early gestation were also present at the end of pregnancy . When comparing the final independent samples obtained at the end of pregnancy to the healthy control samples, the following remained significantly elevated in pregnant women: egf (330.6 versus 24.8 pg / ml, p = 0.0013), gro (1,153.6 versus 341.6 pg / ml, p <0.001), sil-2ra (17.9 pg / ml versus lld, p = 0.02), and tgf (15.8 versus 1.8 pg / ml, p = 0.0006) meanwhile, only eotaxin was lower in women at the end of pregnancy compared to normal controls (33.4 versus 330.0 pg / ml, p <0.001). To begin to assess within - subject variation, we clustered the raw data (figure 2), where the issue of correlation within subjects becomes visually apparent . Empirical growth plots demonstrated that the within - subject variation differs among different women (figures 3 and 4 show a representative example using il-15, and the remainder of the plots can be viewed in supplementary figures). For example, patient o displays very large variation in the majority of the cytokines tested, whereas patients b, c, f, and g have comparatively steady levels for most cytokines . Also, high variability in one cytokine does not imply high variability in other cytokines for the individual women . High interclass correlation (0.7) was observed for scd40l, rantes, il-10, tnf, il-7, and gm - csf (table s2). This means that the majority of the variability in these cytokines is attributed to variance between subjects . The interclass correlations were comparatively low (<0.3) for il-3, il-4, mcp-3, and ip-10, suggesting more variation within subjects for these cytokines . The final model for mdc (table 2) was ugm with gw, with a decreasing trajectory . The estimated variance for the random slope is 0.000001632, suggesting that the variability of slope among patients is quite small . On the other hand, the average scatter of an individual's outcome around her own trajectory is larger (the estimated variance is 0.000937, p <0.0001), suggesting that there might be some other important covariates that are not included in the model . However, including gestational age in weeks as a covariate does substantially improve the fit of the model . When comparing the estimated within - subject variance of the ugm with that from the umm, we found that the linear gestational age in weeks helps to explain 34% of the within - subject variation in mdc . The estimated fixed effect suggests that mdc decreases over time (the estimated slope is 0.00163, with p 0.0001, suggesting that the slope is significantly lesser than 0, figure s2). Eight other cytokines demonstrated statistical significance, although with increasing trajectories, with ugm and gw as a covariate: il-1, il-6, il-8, il-12p70, il-13, il-15, ip-10, and flt3-ligand (table 2). Six cytokines showed association with trimester as a linear variable: il-1ra, il-3, il-9, il-12p40, ifn2, and scd40l (table 3). Il-1ra showed the greatest percent explanation by inclusion of linear trimester in the model . When comparing the estimated within - subject variance of the umm with that from the ugm, we found that the linear trimester helps to explain 27% of the within - subject variation in il-1ra . Seven other cytokines showed significant associations with trimester as a categorical variable: il-4, ifn, g - csf, tgf-, tnf-, sil-2ra, and mip-1 (table 4). The final model for both egf and vegf was umm with intercept only, leading to the conclusion that both egf and vegf do not change over time . Time - dependent ugm models were identified but did not meet statistical significance for the following cytokines: il-2, il-5, pdgf - aa, pdgf - ab, mip-1, gro, mcp-1, mcp-3, rantes, il-17, il-7, eotaxin, fgf-2, il-10, tnf, il-1ra2, fracktalkine, and gm - csf . Therefore, approximately 50% of cytokines measured by multiplex array did not show any association with gestational week or trimester . Our results suggest that the third trimester of pregnancy is characterized by an increasingly inflammatory (e.g., il-1, il-6, il-12, il-15, ip-10, and scd40 ligand) as well as counterregulatory (e.g., il-1ra and flt3-ligand) milieu compared to earlier stages of pregnancy . Our superimposed growth curves of il-15 (figure 4) and il-1 (figure s3), the cytokines with the strongest association with gestational week as a linear covariate, suggest that this change begins at approximately week 20 and peaks just after week 30 . This is consistent with other reports of systemic immune activation as well as counterregulation in the latter part of pregnancy [3, 1719]. Increasing il-1 and il-15 may predominantly be related to production from placental tissues [20, 21] or mononuclear phagocytes [22, 23] in late gestation . The precise immunologic mechanisms responsible for this shift cannot be determined by our study, but if the source of these cytokines is predominantly the innate immune system, one potential stimulus to these cytokines' secretion is cell - free fetal dna . A recently proposed model links rising circulating levels of fetal dna to maternal innate immune activation via toll - like receptor- (tlr-) 9 on neutrophils and macrophages, leading to increasing inflammatory cytokine release, that may result in an immune cascade ultimately leading to parturition . A novel finding of this study is the decline in mdc levels throughout pregnancy (figure 5). Mdc is chemoattractant for immature dendritic cells and type 2-biased t cells, and it is possible that decreasing mdc levels may reflect a gradual shift away from a self - amplifying type 2 immune response as pregnancy progresses . Il-9 is cytokine that has been recognized for decades but only recently had its cell of origin identified: the innate lymphoid cell (ilc). The role of il-9, which has historically been categorized as a th2 cytokine prior to the recognition of ilc, is currently unknown in normal pregnancy . Because only serum was available for analysis, we cannot confirm the cellular source of the changes observed with this cohort . Nonetheless, increasing transcription levels of several innate immune components, including cd14, multiple tlr genes, and il-1b, have been observed in peripheral blood leukocytes of women in the third trimester, suggesting that the changes in concentrations of the cytokines identified in our study could plausibly be due to changes in peripheral blood cellular composition . Further studies will be necessary to determine whether placental tissues, circulating leukocytes, stromal cells, or other sources also contribute to the changes reflected in our results . Although these results show statistical significance, it is also noteworthy that the slopes of the variance were all fairly small for each of the analytes and that gestational week did not explain any more than 40% of the variation observed in any of the cytokines . Pregnancy clearly alters the maternal immune milieu, but the changes from baseline in the setting of normal pregnancy are subtle and more variable in some women than in others . What clinical factors contribute to this variation observed between women in the setting of a normal first pregnancy is not entirely known . Blood draws and resulting data were relatively sparse in the first trimester due to women not returning as frequently for study blood draws, even though they were scheduled per protocol, relative to the second and third trimesters . It is also important to note that many analytes were not detectable in samples; therefore, it is possible that a different method besides multiplex array on serum or plasma, for example, elisa for individual cytokines / growth factors, may be more sensitive to detect change over time . Previous longitudinal studies of maternal cytokines during pregnancy have shown some concordance with our results . Investigated the change of maternal plasma cytokines from early to midgestation in a large cohort (approximately 1,000 patients) and found that il-12 and ifn levels increased, while il-2 and gm - csf levels decreased as pregnancy progressed . Our results confirmed increasing il-12 levels, as well as an increase of ifn in the third trimester compared to the first . However, kraus et al . Published maternal multiplex elisa results from 50 women tested at each trimester as well as postpartum and showed that ifn levels decreased throughout gestation . Denney et al . Also found that basal levels of ifn decreased throughout gestation, as did levels of tnf, il-1, and il-6 in serum samples of 45 healthy pregnant women collected during each trimester . Another recent study demonstrated decreasing il-1 levels throughout gestation . While our study did not confirm any time - dependent change of tnf, we instead observed increases in il-1 and il-6 throughout pregnancy, in contrast to these studies . Clearly, individual heterogeneity exists, and our smaller sample size may account for some of these differences with prior studies . Although not the original focus of this study, we also identified several differences in cytokine / growth factor milieu when comparing pregnant women to healthy controls . Notably, the first trimester of pregnancy was characterized by an increase in several growth factors (gro, egf, tgf, and pdgf) and a relative decrease in inflammatory markers (scd40l, il-6, il-17, ip-10, eotaxin, and mcp-1). Eotaxin, a potent chemoattractant for eosinophils during allergic reactions, has been similarly described to be suppressed during pregnancy by kraus et al . . Overall, the tolerance induction required for successful pregnancy at the level of the fetomaternal interface may also be observed in a relatively tolerogenic, growth factor - rich maternal systemic environment . The difference in sample source when comparing the archived samples from healthy pregnant women (serum) and normal controls (plasma) may contribute to these findings . For example, eotaxin, pdgf, egf, vegf, and soluble cd40 ligand have previously been shown to be significantly different in serum postclotting as compared to plasma samples . Because of this potential source of variation in comparing our historical to contemporary samples, our results will require validation with similarly processed samples of the same source . However, egf levels have been reported to be approximately 65 pg / ml in serum of healthy individuals, well below our median 489.4 pg / ml in our samples obtained from pregnant subjects, suggesting that our results may hold true despite differences in sample source . Similarly, serum levels of cd40l have been shown to be 830-fold higher in serum as compared to plasma, suggesting again that the very low levels identified in the serum of our cohort of pregnant women may indeed be reflective of the pregnancy state . Our study is unique in that the longitudinal samples were obtained frequently throughout the course of pregnancy . Because of this, our study has the potential to more richly describe individual maternal immune variation over time . However, our study is limited by the relatively small sample size, the lack of pre- or postpartum samples, and potentially the age of the specimens . To address these limitations, we have recently conducted a larger longitudinal study of maternal immune changes during pregnancy, with peripheral blood samples obtained monthly throughout gestation as well as 6 weeks postpartum . Tolerance at the fetomaternal interface is complex and technically challenging to study in humans longitudinally . As a result, many recent studies have sought to understand how pregnancy changes maternal systemic immunity . The possibility exists of maternal peripheral blood not completely or accurately reflecting the local changes within decidual tissues . An example of such a discrepancy in our study is that of ip-10, which was low in first - trimester pregnancy compared to healthy controls in this cohort . Ip-10 is secreted by decidual natural killer cells and is key to trophoblast migration and thus has previously been shown to be elevated during pregnancy [31, 32]. On the other hand, the decidual t cell compartment at parturition has recently been shown to closely reflect that of peripheral blood, suggesting that for some components of the immune system the maternal peripheral blood is reasonable to study . Furthermore, sampling maternal peripheral blood is much more feasible to perform longitudinally as compared to more invasive means and may still lend insight into the maternal adaptation to pregnancy . Successful pregnancy has previously been described as predominantly a type 2 immune response - biased phenomenon [3436]. In light of the collective evidence, it seems that the description of pregnancy in terms of type 2 immune responses may be oversimplified, both in the overall description of key cytokines / growth factors as well as in the temporal dynamics, and it is in need of further refinement.
|
Sarcoidosis - related granulomatous reaction of the immune system could be attributed to environmental factors . However, data supporting this hypothesis remain controversial . Clinical features of this disease include the following nonspecific symptoms: cough, dyspnea, erythema nodosum, febrile arthritis, uveitis, and parotitis sarcoidosis commonly targets hilar and mediastinal lymph nodes, which are found in more than 90% of the patients . The diagnosis is established on the basis of compatible clinical and radiological findings and supported by histological evidence in one or more organs of noncaseating epithelioid cell granulomas in the absence of organisms or particles . The correlation between sarcoidosis and malignancy remains unclear, despite that this topic has been increasingly investigated . In this article, we report a case of non - luminal her-2/neu - positive breast cancer in a patient without history of sarcoidosis and initially suspected to have metastatic disease . A 52-year - old woman was presented to our hospital . She noted a lump in her left breast during self - examination . Palpation revealed a nodular lump of tight, elastic consistency in the upper inner quadrant of the left breast . Mammography scan demonstrated a 19 mm 18 mm mass on the border of the inner quadrants on the left breast (figure 1). Ultrasound examination revealed enlarged lymph nodes in the left axilla (10 mm in diameter), left supraclavicular lymph node (18 mm 10 mm), and multiple right enlarged supraclavicular lymph nodes, with a maximum size of 16 mm 7 mm . Plain chest x - rays showed no abnormal findings (figure 2). The suspected diagnosis was breast cancer at t 1n 3 cm 0 . Excisional biopsy of the left supraclavicular lymph node was performed to verify the diagnosis and differentiate the nature of the lesion . Histological examination of the obtained material revealed no cancer but multiple epithelioid cell granulomas . Based on these results, lumpectomy with urgent histology of resection margins urgent histodiagnosis revealed clear margins and demonstrated a lump in the breast, which was identified as infiltrative carcinoma . Routine histological examination revealed infiltrative, moderately differentiated (g 2) breast carcinoma with microcalcifications (figure 3). Noncaseating epithelioid cell granulomas of sarcoidosis without tumor growth were found in 6 of 15 lymph nodes (figure 4). The molecular type of breast cancer was identified as non - luminal her-2/neu - positive through immunohistochemistry . Therefore, the post - operative diagnosis of the patient was left breast cancer (t 1n 0 m 0), with sarcoidosis of left axillary and right supraclavicular lymph nodes . At the time of writing this article, the patient had been undergoing radiation therapy and directed to immunologist for sarcoidosis management and follow - up . Mammography scan demonstrating a 19 mm 18 mm mass on the border of the inner quadrants of the left breast (white arrow). (a) craniocaudal . (b) mediolateral oblique view . Plain chest x - ray revealed no abnormal findings . Infiltrative moderately differentiated (g 2) breast carcinoma with microcalcifications (h&e staining, 200). Lymph nodes with noncaseating epithelioid cell granulomas of sarcoidosis without tumor growth (h&e staining, 200). The correlation between sarcoidosis and carcinogenesis remains unproven, although such relation has been described in numerous studies . Brincker and wilbek first found this link in their study on 2544 sarcoidosis cases; the incidence rates of lymphomas and lung cancer were 11 and 3 fold higher, respectively, in patients with sarcoidosis than those in the population . Reported 21 cases of sarcoidosis developing after primary malignancies, including 10 cases after breast cancer . Blank et al . Defined breast cancer, cervical cancer, and b - cell lymphoma as the most common malignancies in patients with sarcoidosis . Positron emission tomography (fdg - pet / ct scan) is one of the most advanced and precise diagnostic tools for such diseases . However, the application of this method in the assessment of regional and distant metastasis spread is limited . In cases of simultaneous sarcoidosis and malignancies, the functions of fdg - pet / identified that the maximal standardized uptake value (suv) in patients with maligna- ncies is significantly higher than in patients with benign diseases . Nevertheless, in patients with granulomatous process, the maximal suv is similar to that in patients with malignant diseases . Therefore, fdg - pet / ct scan may only be an additional diagnostic tool used to assess the extent of disease spread without differentiation between malignant and granulomatous disorders; this tool could also create diagnos- tic difficulties and misunderstandings in patients with such simultaneous comorbidities 9, 10 . This study reports a case of non - luminal her-2/neu - positive breast cancer in a patient presenting non - caseating epithelioid cell granulomas of sarcoidosis after treatment and initially suspected to have metastatic disease . A very recent retrospective study described the clinical biological and radiological characteristics of 12 patients presenting sarcoidosis associated with solid tumor; sarcoidosis frequently affects patients with breast cancer (32.3%) and thus must be considered in the differential diagnosis of the disease . In the current study, a review of literature is also presented and included 61 other patients showing similar association between cancer and sarcoidosis . This case report emphasizes the importance of differential diagnosis of lymph node involvement in cancer patients . Diagnosis of sarcoidosis denied that the presence of metastasis could lead to changes in the post - operative management of the patient . Although several epidemiological studies reported the association between cancer and sarcoidosis, further studies, including case reports, may represent an opportunity to obtain additional biological and clinical information to clarify the mechanisms underlying the association of cancer and sarcoidosis . Furthermore, the present case report highlights the importance of histological determination in lymph nodes for distinguishing metastasis from sarcoidosis.
|
This retrospective observational study was approved by the western institutional review board (olympia, washington, usa). It complied with the health insurance portability and accountability act of 1996 and followed the tenets of the declaration of helsinki . Informed consent was obtained from the subjects after explanation of the nature and possible consequences of the study . Patients with ga were identified from the tertiary practice of retinal specialists (kbf, js, and ly) if they exhibited plateau signatures in at least one eye (study eye) on oct imaging and if they also had at least 3 years' follow - up with consecutive eye - tracked spectral - domain (sd)-oct scans taken at least every 6 months . Eyes with macular neovascularization, other retinal pathology, or media opacity preventing adequate imaging were excluded . Medical records and multimodal imaging, including color fundus photography (cfp), red - free photography (rf), fundus autofluorescence (faf), near - infrared reflectance scanning laser ophthalmoscopy (nir), and sd - oct was performed on all the patients . Cfp and rf were performed with a trc-50ix flood - illuminated fundus camera (topcon medical systems, oakland, nj, usa). Faf was performed with either the spectralis hra + oct (heidelberg engineering, heidelberg, germany) or the topcon trc-50ix fundus camera . Oct scans taken before the acquisition of eye - tracked spectralis scans were assessed qualitatively but not included in the quantitative analysis . The sd - oct protocol used in all eyes comprised 20 horizontal raster line scans over the area of interest, ranging from 19 to 49 b - scans per eye, with each scan spaced 115 to 250 m apart, and automatic real - time averaging set between 4 and 23 . To study the origin and progression of plateaus, the most recent sd - oct with this signature was identified . Then, serial eye - tracked b - scans of the region of interest were tracked back to baseline . In cases in which the scanning protocol varied during the course of follow - up, the b - scan closest to the area of interest was matched manually and extracted for analysis . These extracted sd - oct images were then stacked, aligned, and saved as a video file using the fiji distribution (fiji is just image j, http://fiji.sc; in the public domain) for the qualitative analysis of the progression of the lesion (see supplementary video). At each time point, the plateau appearance on sd - oct was correlated to the appearance in cfp, nir, and faf . Three patients had en face oct and oct angiography (octa) imaging with 3 3-mm macular cubes (rtvue xr avanti; optovue, fremont, ca, usa). The review software (revue, version 2015.1.0.90; optovue, fremont, ca, usa) displays flow signals superimposed in red on a cross - sectional structural sd - oct image . In a healthy eye, the fourth outer retinal hyperreflective band includes the rpe and brm . In a ped, by definition in the course of this separation, either a basal lamina (bl) of 0.15-m thickness or a blamd of variable thickness adheres to the rpe and not to the brm . Therefore, we call the hyperreflective band that anteriorly delimits a ped the rpe - bl complex . The definition of a plateau was a distinct oct signature where a mound - like structure with a flattened apex and a wide base was observed within an area of ga after complete loss of the overlying rpe . To determine the volume of the drusenoid ped and ensuing plateau (fig . 2), the cavalieri principle of stereology was applied to sd - oct volumetric data acquired at each visit, as follows . (1) each b - scan in the volume was scaled to a 1:1 pixel aspect ratio . The caliper function within the heidelberg eye explorer software (version 6.3.4.0; heidelberg engineering) was used to measure the area between the outer boundary of rpe+bl and the inner boundary of brm . (2) the volume between two consecutive oct slices (hereafter called a segment) was then determined using the following formula: \}\begin{document}$$d\left ({\left ({a\_x + a\_\left ({x + 1} \right)} \right)/2} \right),$$\end{document}where d is the distance between consecutive slices in m, a is the area between the rpe+bl and brm in m, and x is the oct slice number . (3) total ped volume was calculated by summing the volumes of individual segments . The number of segments in the oct volume was (n 1), where n is the total number of slices that spanned the ped . Graphical plots of ped volume with respect to time were generated using interval data . Origin and evolution of a plateau, as revealed by nir (a) and oct (b) images . Green arrows on nir images show the levels of corresponding oct cross - sectional images . Baseline images show several elevations of the rpe with largely hyporeflective interiors . At 3 years after baseline, punctate hyperreflectivity (red arrowhead), progressive loss of the onl has caused the opl (yellow arrows) to approach the surface of the ped . Also at 4 years, a mons hyperreflective wedge (blue arrowheads) appears at the ga border . At 5 years, the downwardly deflected opl is seen to move progressively toward the edge of the plateau following the advancing border of ga . Formation of the plateau at 5 years was characterized by the loss of the overlying rpe causing marked thinning of the hyperreflective rpe - basal lamina complex now reduced to just blamd, compared with at 4 years . At 7 years the institutional review board at university of alabama at birmingham (uab) approved the laboratory study, which complied with the health insurance portability and accountability act and adhered to the tenets of the declaration of helsinki . Amd eyes were identified through an ex vivo imaging screen of eyes accessioned for research purposes from nondiabetic white donors to the alabama eye bank during the period 1996 to 2012 . Median death - to - preservation time was 3:49 hours (range, 0:4011:40 hours). Eyes were preserved by immersion in 1% paraformaldehyde and 2.5% glutaraldehyde in 0.1 m phosphate buffer following anterior segment excision . After vitreous removal, maculas were photographed in color on a stereomicroscope (smz - u; nikon, melville, ny, usa). When prepared for histology (20112013) and uploaded to the project macula web site (http://projectmacula.cis.uab.edu, in the public domain), eyes underwent additional multimodal ex vivo imaging . From each globe, an 8-mm - diameter full - thickness tissue punch containing the fovea and temporal portion of the optic nerve head was held in a tissue holder mounted on a spectralis, as described . A 30 20 sd - oct volume (143 scans, 30-m spacing, automated real - time averaging [art] = 25) was captured along with red - free and near - infrared reflectance scanning laser ophthalmoscopic images . Tissue punches were postfixed by osmium tannic acid paraphenylenediamine to accentuate extracellular lipid and embedded in epoxy resin (polybed 812; polysciences, warrington, pa, usa). Sub - micrometer - thick (0.8 m) sections at 25- to 30-m intervals were stained with 1% toluidine blue for polychromaticity, scanned with a 40 objective, and reviewed and photodocumented with a 60 oil - immersion objective (numerical aperture = 1.4) and digital camera (xc10; olympus, center valley, pa, usa). Images were adjusted for exposure, contrast, and sharpness (photoshop cs6, adobe, san jose, ca, usa). Patients with ga were identified from the tertiary practice of retinal specialists (kbf, js, and ly) if they exhibited plateau signatures in at least one eye (study eye) on oct imaging and if they also had at least 3 years' follow - up with consecutive eye - tracked spectral - domain (sd)-oct scans taken at least every 6 months . Eyes with macular neovascularization, other retinal pathology, or media opacity preventing adequate imaging were excluded . Medical records and multimodal imaging, including color fundus photography (cfp), red - free photography (rf), fundus autofluorescence (faf), near - infrared reflectance scanning laser ophthalmoscopy (nir), and sd - oct was performed on all the patients . Cfp and rf were performed with a trc-50ix flood - illuminated fundus camera (topcon medical systems, oakland, nj, usa). Faf was performed with either the spectralis hra + oct (heidelberg engineering, heidelberg, germany) or the topcon trc-50ix fundus camera . Oct scans taken before the acquisition of eye - tracked spectralis scans were assessed qualitatively but not included in the quantitative analysis . The sd - oct protocol used in all eyes comprised 20 horizontal raster line scans over the area of interest, ranging from 19 to 49 b - scans per eye, with each scan spaced 115 to 250 m apart, and automatic real - time averaging set between 4 and 23 . To study the origin and progression of plateaus, the most recent sd - oct with this signature was identified . Then, serial eye - tracked b - scans of the region of interest were tracked back to baseline . In cases in which the scanning protocol varied during the course of follow - up, the b - scan closest to the area of interest was matched manually and extracted for analysis . These extracted sd - oct images were then stacked, aligned, and saved as a video file using the fiji distribution (fiji is just image j, http://fiji.sc; in the public domain) for the qualitative analysis of the progression of the lesion (see supplementary video). At each time point, the plateau appearance on sd - oct was correlated to the appearance in cfp, nir, and faf . Three patients had en face oct and oct angiography (octa) imaging with 3 3-mm macular cubes (rtvue xr avanti; optovue, fremont, ca, usa). The review software (revue, version 2015.1.0.90; optovue, fremont, ca, usa) displays flow signals superimposed in red on a cross - sectional structural sd - oct image in a healthy eye, the fourth outer retinal hyperreflective band includes the rpe and brm . In a ped, by definition, the rpe is separated from the brm . In the course of this separation, either a basal lamina (bl) of 0.15-m thickness or a blamd of variable thickness adheres to the rpe and not to the brm . Therefore, we call the hyperreflective band that anteriorly delimits a ped the rpe - bl complex . The definition of a plateau was a distinct oct signature where a mound - like structure with a flattened apex and a wide base was observed within an area of ga after complete loss of the overlying rpe . 2), the cavalieri principle of stereology was applied to sd - oct volumetric data acquired at each visit, as follows . (1) each b - scan in the volume was scaled to a 1:1 pixel aspect ratio . The caliper function within the heidelberg eye explorer software (version 6.3.4.0; heidelberg engineering) was used to measure the area between the outer boundary of rpe+bl and the inner boundary of brm . (2) the volume between two consecutive oct slices (hereafter called a segment) was then determined using the following formula: \}\begin{document}$$d\left ({\left ({a\_x + a\_\left ({x + 1} \right)} \right)/2} \right),$$\end{document}where d is the distance between consecutive slices in m, a is the area between the rpe+bl and brm in m, and x is the oct slice number . (3) total ped volume was calculated by summing the volumes of individual segments . The number of segments in the oct volume was (n 1), where n is the total number of slices that spanned the ped . Graphical plots of ped volume with respect to time were generated using interval data . Origin and evolution of a plateau, as revealed by nir (a) and oct (b) images . Green arrows on nir images show the levels of corresponding oct cross - sectional images . Baseline images show several elevations of the rpe with largely hyporeflective interiors . At 3 years after baseline, punctate hyperreflectivity (red arrowhead), progressive loss of the onl has caused the opl (yellow arrows) to approach the surface of the ped . Also at 4 years, a mons hyperreflective wedge (blue arrowheads) appears at the ga border . At 5 years, the downwardly deflected opl is seen to move progressively toward the edge of the plateau following the advancing border of ga . Formation of the plateau at 5 years was characterized by the loss of the overlying rpe causing marked thinning of the hyperreflective rpe - basal lamina complex now reduced to just blamd, compared with at 4 years . At 7 years, a closed ort (pink arrowhead) is present adjacent to the plateau . The institutional review board at university of alabama at birmingham (uab) approved the laboratory study, which complied with the health insurance portability and accountability act and adhered to the tenets of the declaration of helsinki . Amd eyes were identified through an ex vivo imaging screen of eyes accessioned for research purposes from nondiabetic white donors to the alabama eye bank during the period 1996 to 2012 . Median death - to - preservation time was 3:49 hours (range, 0:4011:40 hours). Eyes were preserved by immersion in 1% paraformaldehyde and 2.5% glutaraldehyde in 0.1 m phosphate buffer following anterior segment excision . After vitreous removal, maculas were photographed in color on a stereomicroscope (smz - u; nikon, melville, ny, usa). When prepared for histology (20112013) and uploaded to the project macula web site (http://projectmacula.cis.uab.edu, in the public domain), eyes underwent additional multimodal ex vivo imaging . From each globe, an 8-mm - diameter full - thickness tissue punch containing the fovea and temporal portion of the optic nerve head was held in a tissue holder mounted on a spectralis, as described . A 30 20 sd - oct volume (143 scans, 30-m spacing, automated real - time averaging [art] = 25) was captured along with red - free and near - infrared reflectance scanning laser ophthalmoscopic images . Tissue punches were postfixed by osmium tannic acid paraphenylenediamine to accentuate extracellular lipid and embedded in epoxy resin (polybed 812; polysciences, warrington, pa, usa). Sub - micrometer - thick (0.8 m) sections at 25- to 30-m intervals were stained with 1% toluidine blue for polychromaticity, scanned with a 40 objective, and reviewed and photodocumented with a 60 oil - immersion objective (numerical aperture = 1.4) and digital camera (xc10; olympus, center valley, pa, usa). Images were adjusted for exposure, contrast, and sharpness (photoshop cs6, adobe, san jose, ca, usa). Plateau signatures were observed in eight eyes of seven patients, of whom six were female . Mean age was 75 years (range, 6089) and mean follow - up period was 7.7 years (range, 3.711.6). Baseline visual acuity (va) was logmar 0.42 (snellen equivalent 20/52) (range, 0.181). Final va was logmar 1.16 (snellen equivalent 20/289) (range, 0.182.3). In two eyes, ga spared the fovea throughout the entire course of the follow - up . At baseline, the presence of a drusenoid ped with homogeneous hyperreflective contents and an intact overlying rpe was noted in six eyes (75%; figs . 2, 3). One eye (patient 5, left eye) had an extremely large ped measuring 2.24 mm with mostly hyporeflective contents and an overlying vitelliform lesion . In another eye (patient 4, left eye), the plateau was already present at baseline . Pigmentary changes noted on cfp were also found on nir, rf, and faf in six eyes, and these corresponded to intraretinal hyperreflective foci on oct (fig . 3). Overlying the ped surface, the ellipsoid zone and outer nuclear layer (onl) were thin, with the opl nearly apposed to the surface of the ped . B) at baseline and follow - up (a, 4 years; b, 7 years). (a) at baseline, patient 3 has a drusenoid ped with overlying pigment hyperplasia and hyperautofluorescent vitelliform material . The oct b - scan shows intraretinal hyperreflective foci (red arrowhead) and loss of outer retinal bands over the apex of the ped . Four years later, a region of hypoautofluorescent ga contains a plateau that cannot be appreciated in the cfp, nir, rf, or faf . The oct b - scan shows a plateau with a shape similar to the baseline ped . The downwardly deflecting opl (yellow arrow) has moved laterally as it follows the border of the advancing ga . There was marked attenuation and decreased reflectivity of the rpe - bl band . (b) at baseline, patient 6 has a drusenoid ped with overlying pigment hyperplasia that is located inferior to an area of ga . Bottom row: seven years later, the ga has markedly enlarged, and the ped is no longer visible on cfp, nir, rf, or faf . The oct b - scan shows that following progressive loss of the onl, the opl (yellow arrow) appears draped over a plateau with a shape similar to the baseline ped . Hyporeflective areas (blue arrowhead) are visible within the plateau interior . During follow - up, onl thinning resulted in the opl approximating the surface of the ped in all cases in which the ped was present at baseline (figs . 2, 3). As ga progressed, this point of approximation moved toward the edges of the ped base, following the advancing border of ga (supplementary video). In all eyes, there was also progressive thinning of the hyperreflective rpe - bl complex and diminution of its reflectivity, beginning at the apex of the ped and advancing toward its edges . After rpe loss occurred over the entire ped surface, the plateau (i.e., a thin hyperreflective inner surface and an interior of heterogeneous and overall reduced reflectivity) appeared . The plateau surface was highly reflective on both cross - sectional and en face oct (fig . 4, en face oct surface) and showed the presence of focal defects (fig . 4, blue arrows) that were usually accompanied by smaller hyperreflective foci seen beneath the hyperreflective border . These hyperreflective foci also could be observed within the area of ga as hyperautofluorescent foci on faf and hyperreflective foci on en face oct (fig . 4, green arrows). Accordingly, on en face oct, plateau contents were seen as honeycomb - like structures with hyporeflective spaces interspersed with hyperreflective foci (fig . 4, green arrows) increased in abundance within the plateau interior during follow - up in all eyes as seen on cross - sectional and en face oct (figs . 2, 3, 4). On both cross - sectional and en face octa, no abnormal flow signals were noted within plateaus (fig . (a) a plateau located within the area of ga features internal hyporeflective areas on cross - sectional oct (blue arrowhead), which appear to be organized in a honeycomb - like pattern on en face oct (blue arrowhead). On cross - sectional oct, octa, and on oct surface (an en face oct slab at the level of the rpe - bl atop the plateau), the plateau interior is bounded by a distinct hyperreflective band that continues as a thick and highly reflective rpe band . This hyperreflective surface shows transient hyporeflective defects (yellow arrows) during the evolution of these lesions . An en face oct image of the plateau surface allows better appreciation of the focal defects (yellow arrow). (b) a plateau located within the area of ga features internal hyporeflective areas on cross - sectional oct (blue arrowhead), which appear to be organized in a honeycomb - like pattern on en face oct (blue arrowhead). On cross - sectional oct and octa, a distinct hyperreflective surface surrounds the plateau interior and focal defects (yellow arrows) can be seen in some areas . An en face oct taken at the plateau surface allows better appreciation of focal defects in this hyperreflective layer (en face octa: surface yellow arrow). Deep to these focal defects are hyperreflective features (faf and en face oct: green arrowheads) that are also seen on faf as punctate hyperfluorescence within the confluent area of hypoautofluorescence . A single plateau was seen in all eyes except for one (patient 2) that had two separate plateaus (fig . Patient 6 had one plateau in each eye . In the seven eyes with a baseline ped, the thinning of the hyperreflective band over the ped surface after rpe loss (at which point we consider the plateau to be formed) was preceded by a sharp decrease in ped volume (fig . Subsequently, the volume of the residual plateau appeared very stable over time (fig . The point at which the plateaus form (complete loss of rpe from the hyperreflective rpe - bl complex over the ped) is shown by the dotted line . Patient 2 has two separate peds that evolve to two separate plateaus (a, b). Patient 6 has a plateau in both the right eye (r) and the left eye (l). Only patients with an intact hyperreflective rpe - bl complex baseline were included in this analysis . When the plateau signature is first observed (black dotted line), a decrease in the volume that stabilizes on further follow - up . Figure 6 shows histology of a donor eye with ga, for which local relationships and cellular processes in the interior of outer retinal corrugations were particularly clear yet also representative of other ga eyes available for review . Atrophy spared the fovea in this eye, as seen with ex vivo cfp and 488-nm autofluorescence, and small reflective puncta in the atrophic area were apparent on nir (figs . 6e), blamd was seen as discontinuous, being present at three separate locations . Pigmented cells were of the subducted phenotype, that is, rpe - originated cells located external to blamd, in contact with brm . For reference, in the henle fiber layer of a normal eye, obliquely oriented mller cell processes are parallel to, and interleaved with, inner fibers of cone and rod photoreceptors . In the presence of severe photoreceptor degeneration, including ort in this ga eye, the trajectories of gliotic mller cell processes were oriented in many directions, as indicated by arrows in figure 6e . In one instance, processes seemed to enter an outer retinal corrugation horizontally through an opening in the blamd and sweep the subducted cells off brm (fig . 6d). Persistent bl deposit and mller cell processes in ga in a 95-year - old white man . Cfp (top row left) shows a large area of atrophy of rpe extending to the optic nerve head but sparing the fovea . Green arrowheads approximate the level of the histologic section shown in the top far right and bottom . (b) ex vivo 488-nm autofluorescence shows loss of signal in the atrophic area . (c) ex vivo nir imaging shows small and highly reflective puncta in the atrophic area . Detailed (d) and panoramic (e) views of the atrophic area in histology . Nfl, nerve fiber layer; gcl, ganglion cell layer; ipl, inner plexiform layer; dr, calcified druse . (d) processes from mller cells under a corrugation of persistent blamd in the atrophic area . This corrugation overlies subducted cells of rpe origin (teal arrowheads), which contain nuclei, spindle - shaped melanosomes, and lipofuscin, and are located external to blamd, on brm . Mller cell processes appear to enter the corrugation horizontally from the left (yellow arrow) and sweep the pigmented cells away . (e) blamd is discontinuous and present at three separate locations (red arrows). In the normal henle fiber layer, mller cell processes are obliquely oriented (outer - center to inner - periphery), and they are parallel to, and interleaved with, inner fibers of cone and rod photoreceptors . In the presence of severe photoreceptor degeneration, the trajectories of gliotic mller cell processes and remaining photoreceptors are oriented in many directions (yellow arrows). Plateau signatures were observed in eight eyes of seven patients, of whom six were female . Mean age was 75 years (range, 6089) and mean follow - up period was 7.7 years (range, 3.711.6). Baseline visual acuity (va) was logmar 0.42 (snellen equivalent 20/52) (range, 0.181). Final va was logmar 1.16 (snellen equivalent 20/289) (range, 0.182.3). In two eyes, at baseline, the presence of a drusenoid ped with homogeneous hyperreflective contents and an intact overlying rpe was noted in six eyes (75%; figs . 2, 3). One eye (patient 5, left eye) had an extremely large ped measuring 2.24 mm with mostly hyporeflective contents and an overlying vitelliform lesion . In another eye (patient 4, left eye), the plateau was already present at baseline . Pigmentary changes noted on cfp were also found on nir, rf, and faf in six eyes, and these corresponded to intraretinal hyperreflective foci on oct (fig . 3). Overlying the ped surface, the ellipsoid zone and outer nuclear layer (onl) were thin, with the opl nearly apposed to the surface of the ped . Multimodal imaging of two patients (a, b) at baseline and follow - up (a, 4 years; b, 7 years). (a) at baseline, patient 3 has a drusenoid ped with overlying pigment hyperplasia and hyperautofluorescent vitelliform material . The oct b - scan shows intraretinal hyperreflective foci (red arrowhead) and loss of outer retinal bands over the apex of the ped . Four years later, a region of hypoautofluorescent ga contains a plateau that cannot be appreciated in the cfp, nir, rf, or faf . The oct b - scan shows a plateau with a shape similar to the baseline ped . The downwardly deflecting opl (yellow arrow) has moved laterally as it follows the border of the advancing ga . There was marked attenuation and decreased reflectivity of the rpe - bl band . (b) at baseline, patient 6 has a drusenoid ped with overlying pigment hyperplasia that is located inferior to an area of ga . Bottom row: seven years later, the ga has markedly enlarged, and the ped is no longer visible on cfp, nir, rf, or faf . The oct b - scan shows that following progressive loss of the onl, the opl (yellow arrow) appears draped over a plateau with a shape similar to the baseline ped . During follow - up, onl thinning resulted in the opl approximating the surface of the ped in all cases in which the ped was present at baseline (figs . 2, 3). As ga progressed, this point of approximation moved toward the edges of the ped base, following the advancing border of ga (supplementary video). In all eyes, there was also progressive thinning of the hyperreflective rpe - bl complex and diminution of its reflectivity, beginning at the apex of the ped and advancing toward its edges . After rpe loss occurred over the entire ped surface, the plateau (i.e., a thin hyperreflective inner surface and an interior of heterogeneous and overall reduced reflectivity) appeared . The plateau surface was highly reflective on both cross - sectional and en face oct (fig . 4, en face oct surface) and showed the presence of focal defects (fig . 4, yellow arrows). On cross - sectional oct, the inner contents of the plateau consisted of round, hyporeflective areas (fig . 4, blue arrows) that were usually accompanied by smaller hyperreflective foci seen beneath the hyperreflective border . These hyperreflective foci also could be observed within the area of ga as hyperautofluorescent foci on faf and hyperreflective foci on en face oct (fig . 4, green arrows). Accordingly, on en face oct, plateau contents were seen as honeycomb - like structures with hyporeflective spaces interspersed with hyperreflective foci (fig . 4, green arrows) increased in abundance within the plateau interior during follow - up in all eyes as seen on cross - sectional and en face oct (figs . 2, 3, 4). On both cross - sectional and en face octa, no abnormal flow signals were noted within plateaus (fig . (a) a plateau located within the area of ga features internal hyporeflective areas on cross - sectional oct (blue arrowhead), which appear to be organized in a honeycomb - like pattern on en face oct (blue arrowhead). On cross - sectional oct, octa, and on oct surface (an en face oct slab at the level of the rpe - bl atop the plateau), the plateau interior is bounded by a distinct hyperreflective band that continues as a thick and highly reflective rpe band . This hyperreflective surface shows transient hyporeflective defects (yellow arrows) during the evolution of these lesions . An en face oct image of the plateau surface allows better appreciation of the focal defects (yellow arrow). (b) a plateau located within the area of ga features internal hyporeflective areas on cross - sectional oct (blue arrowhead), which appear to be organized in a honeycomb - like pattern on en face oct (blue arrowhead). On cross - sectional oct and octa, a distinct hyperreflective surface surrounds the plateau interior and focal defects (yellow arrows) can be seen in some areas . An en face oct taken at the plateau surface allows better appreciation of focal defects in this hyperreflective layer (en face octa: surface yellow arrow). Deep to these focal defects are hyperreflective features (faf and en face oct: green arrowheads) that are also seen on faf as punctate hyperfluorescence within the confluent area of hypoautofluorescence . In seven of eight eyes, the plateau was located in the macula . In one eye, a single plateau was seen in all eyes except for one (patient 2) that had two separate plateaus (fig . Patient 6 had one plateau in each eye . In the seven eyes with a baseline ped, the thinning of the hyperreflective band over the ped surface after rpe loss (at which point we consider the plateau to be formed) was preceded by a sharp decrease in ped volume (fig . Subsequently, the volume of the residual plateau appeared very stable over time (fig . The point at which the plateaus form (complete loss of rpe from the hyperreflective rpe - bl complex over the ped) is shown by the dotted line . Patient 2 has two separate peds that evolve to two separate plateaus (a, b). Patient 6 has a plateau in both the right eye (r) and the left eye (l). Only patients with an intact hyperreflective rpe - bl complex baseline were included in this analysis . When the plateau signature is first observed (black dotted line), a decrease in the volume that stabilizes on further follow - up . Figure 6 shows histology of a donor eye with ga, for which local relationships and cellular processes in the interior of outer retinal corrugations were particularly clear yet also representative of other ga eyes available for review . Atrophy spared the fovea in this eye, as seen with ex vivo cfp and 488-nm autofluorescence, and small reflective puncta in the atrophic area were apparent on nir (figs . 6e), blamd was seen as discontinuous, being present at three separate locations . Pigmented cells were of the subducted phenotype, that is, rpe - originated cells located external to blamd, in contact with brm . For reference, in the henle fiber layer of a normal eye, obliquely oriented mller cell processes are parallel to, and interleaved with, inner fibers of cone and rod photoreceptors . In the presence of severe photoreceptor degeneration, including ort in this ga eye, the trajectories of gliotic mller cell processes were oriented in many directions, as indicated by arrows in figure 6e . In one instance, processes seemed to enter an outer retinal corrugation horizontally through an opening in the blamd and sweep the subducted cells off brm (fig . 6d). Persistent bl deposit and mller cell processes in ga in a 95-year - old white man . (a c) ex vivo imaging of postmortem fundus . (a) cfp (top row left) shows a large area of atrophy of rpe extending to the optic nerve head but sparing the fovea . Green arrowheads approximate the level of the histologic section shown in the top far right and bottom . (b) ex vivo 488-nm autofluorescence shows loss of signal in the atrophic area . (c) ex vivo nir imaging shows small and highly reflective puncta in the atrophic area . Detailed (d) and panoramic (e) views of the atrophic area in histology . Nfl, nerve fiber layer; gcl, ganglion cell layer; ipl, inner plexiform layer; dr, calcified druse . (d) processes from mller cells under a corrugation of persistent blamd in the atrophic area . This corrugation overlies subducted cells of rpe origin (teal arrowheads), which contain nuclei, spindle - shaped melanosomes, and lipofuscin, and are located external to blamd, on brm . Mller cell processes appear to enter the corrugation horizontally from the left (yellow arrow) and sweep the pigmented cells away . (e) blamd is discontinuous and present at three separate locations (red arrows). In the normal henle fiber layer, mller cell processes are obliquely oriented (outer - center to inner - periphery), and they are parallel to, and interleaved with, inner fibers of cone and rod photoreceptors . In the presence of severe photoreceptor degeneration, the trajectories of gliotic mller cell processes and remaining photoreceptors are oriented in many directions (yellow arrows). Through a retrospective review of amd patients with long - term serial eye - tracked sd - oct, we identified a series of eyes in which drusenoid peds progressed into plateau signatures within areas of ga . Plateaus were seen on oct to contain heterogeneous reflectivity enclosed by a thin overlying hyperreflective surface . A focal defect in the hyperreflective surface, in addition to intraretinal and sub - rpe hyperreflective dots, was observed during the evolution of ped into plateau signatures . Opl subsidence was noted to begin at the surface of the ped and progress toward the edge following the areas of expanding atrophy . There was a gradual increase in volume due to an increase in hyporeflective contents initially, followed by complete loss of the rpe and a sharp decrease in ped volume, at which time the plateau was considered to have formed . The study of drusen life cycles and ped evolution are important to improve our understanding of the pathogenesis of amd . Understanding the origins and evolution of various oct findings and correlating these findings to histology enable the in vivo study of microscopic cellular changes occurring in these eyes with progressive ga . The development of ga has been previously reported to occur in 19% of eyes with drusenoid peds and to be associated with specific features such as subsidence of the opl and inner nuclear layer and the development of a hyporeflective wedge - shaped band within the henle fiber layer described by mons et al . The appearance of plateaus should be distinguished from other signatures previously described in ga, such as ort, ghost drusen, hyperreflective crown - like structures, hps, and refractile drusen (figs . 1, 2). Plateau boundaries are difficult to distinguish from the surrounding atrophy using cfp, nir, rf, and faf (figs . 1, 3, 4, 6). Previous studies have reported focal areas of hyperautofluorescence within ga, and in our study these correlated with hyperreflective foci seen on en face oct (fig . The presence of many pigmented cells of apparent rpe origin within atrophic areas is now well - documented (fig . 6), and such cells could give rise to both autofluorescence and oct hyperreflectivity signals . Plateaus do not contain the highly refractile material as seen on cfp and nir in eyes with spherules in calcifying drusen . 1) have a similar overlying thin hyperreflective layer consistent with an overlying blamd drape, as previously observed in oct and in histology (fig . Our current data support a previous study that suggested that plateaus occur at a low frequency in eyes with ga (7.5%). The plateau is a signature of a residual structure seen on oct once the rpe has progressed into complete atrophy . In our study, after plateau formation as defined by loss of the overlying rpe layer exposing the underlying blamd that then persists, minimal changes in plateau volume were observed on subsequent follow - up, as previously seen . In all eyes of our series, a drusenoid ped was noted to precede the appearance of the plateau . In a prior description, plateaus were thought to evolve in the outer retina and the hyperreflective line that is likely persistent blamd was attributed to the opl . In contrast, serial eye - tracked oct imaging in our cases shows that changes occurred in the sub - rpe compartment, defined in atrophic eyes as the space external to persistent blamd . During development of a plateau, its thin hyperreflective surface, having emerged after rpe atrophy, is readily distinguishable from the overlying subsiding opl (figs . 1, 2). Plateaus are one route from drusenoid ped to atrophy, and they can be contrasted with a route via ped growth and collapse, which we recently described . Growth and collapse of large ped appear to be on a continuum with similar changes described for smaller drusen . Why a ped in any one eye proceeds to a plateau or to collapse is not known at present . Our detailed description of plateaus will facilitate mechanistic thinking and guide the design of future studies with more patients to investigate associated risk factors that may have prognostic value . Evolution of a plateau entails at least four processes that are discernible at the histologic level and also in sd - oct . In approximately chronologic order, the sequence of the evolution is as follows: loss of rpe, persistence of blamd, followed by concurrent clearing of druse contents and occupation of druse space by cellular processes . The loss of rpe is the point at which a drusenoid ped becomes a plateau, and it is marked by a thick, roughened, and highly hyperreflective band becoming thinner, smoother, and moderately hyperreflective . Hyperreflective foci over ped destined for plateaus were noted in our series, suggestive of anterior rpe migration, as also seen over ped destined for collapse . The development of ga is hypothesized to proceed via two main pathways of rpe fate, including migration of fully pigmented and nucleated rpe into the retina (called sloughed and intraretinal) and shedding of non - nucleated granule aggregates, possibly apoptotic remnants, into underlying blamd . Our previous studies correlated intraretinal hyperreflective foci seen on in vivo and ex vivo oct with anteriorly migrating rpe cells . Thus, we have good reason to suspect that the spherical hyperreflective intraretinal foci directly internal to the plateaus are also migrating rpe cells . The thin, moderately hyperreflective band draped over plateaus blamd is a stereotypically structured thick layer of basement membrane material that was initially used by sarks et al . To stage amd eyes and a basement membrane is a defining feature of an epithelium, as is the rpe . It is crossed by lipoprotein particles en route to brm and choriocapillaris for apparent egress to the systemic circulation . When blamd is thick enough to be visible, it is observable as a hyporeflective layer . After the rpe atrophies and can no longer cast a shadow, blamd emerges as a moderately hyperreflective line of overall horizontal orientation that is sometimes corrugated . Outer retinal corrugations were proposed to be contraction folds of persistent blamd created by loss of neovascular tissue or drusen / basal linear deposit previously located in the sub - rpe space . Here we extend this model to large drusenoid ped, on the grounds that corrugations and plateaus represent a continuum of oct signatures involving persistent blamd . Further, we propose on the basis of prior pathology literature a possible mechanism for how sub - rpe material may be cleared and the shape of persistent blamd established . Our clinical series showed that most of the peds that evolved into plateaus were drusenoid, and druse contents (e.g., lipids, proteins, and minerals) appear to be removed, replaced, or both, over time . The cells and secreted factors (e.g., metalloproteinases, lipases) responsible for druse removal are not established . Mller cells are candidates, because previous studies have shown that mller cell processes may protrude into the sub - rpe space, extend over brm, and break up persistent blamd . Gliosis indicated by intense glial fibrillary acidic protein immunoreactivity is prominent in areas of severe photoreceptor loss and rpe atrophy, and mller cells remain when all photoreceptors have died . In our exemplar histologic case, we hypothesize that plateau and corrugation formation requires extension of mller cell processes through defects in the rpe / blamd complex (figs . 4, 6) that occur during the life cycle of drusenoid peds . We further hypothesize that increasing hyporeflectivity observed within the sub - rpe space during the progression of drusenoid peds represents a change in composition of the sub - rpe material that encourages the entry of these processes . The strength of this research is the long follow - up period for our patient cohort, with serial eye - tracked sd - oct imaging for up to 7 years and notably dating back to before the development of ga in all but one eye . Another strength is the availability of up to nine separate imaging technologies, each specifically highlighting different tissue features in any one case and the availability of one illustrative histology case . Limitations include the small number of eyes and the absence of direct correlation of in vivo imaging to postmortem histology; hence, although our hypothesis of mller cells involvement in plateau formation is credible and testable, whether these cellular activities are directly visible in oct is currently unknown . Our technique of volume measurement may be subject to variations according to oct b - scan density between patients, but for our purpose of studying progression on a per - patient basis, this limitation was acceptable . To minimize inconsistencies, all patients in our study had eye - tracked scans at each follow - up visit with similar density scan patterns available for analysis . Our study adds value to existing literature on ped by suggesting a role of mller cell gliosis, elongation, and elaboration in the pathogenesis of amd, which should be further explored in future studies . It is important for clinicians to be aware of plateaus and to distinguish them from oct findings related to neovascular amd, such as vascularized peds or signs of exudation, as octa imaging of three eyes in our study showed no evidence of neovascular flow within plateaus (fig . Plateau structures should not be confused with areas of subretinal fluid and treatment is not indicated for this finding . Finally, the distinctive reflectivity of persistent blamd in outer retinal corrugations, and, now, plateaus, provides strong motivation for renaming the fourth outer retinal hyperreflective band of normal eyes, which is currently called the rpe - brm complex, to the rpe - blam - brm complex (abbreviated as rbb) to accommodate the appearance of ped and persistent blamd in eyes with amd.
|
Endocarditis of the right side of the heart is uncommon by virtue of the low hemodynamic pressure and lack of isolated or significant right - sided valvular deformities . The valves fall prey to an infective process in settings of congenital heart disease or endothelial injury . Pulmonary arterial endarteritis is a rare event, even in patients with congenital heart disease (chd). Further, a combination of pulmonary endarteritis with a systemic suppuration in chd invites greater attention . A 4-year - old male child, born from a non - consanguineous marriage, was admitted with the history of fever and progressive right - sided weakness for 1 week and cyanosis noted since 6 months of age . The patient's mother had noted dyspnea on feeding since 1 year of age . On admission, the patient had dyspnea on exertion (grade iii / iv, ats grading). The cardiac apex was at left 5 intercostal space, 3 cm outside the mid - clavicular line . An ejection systolic murmur (grade iii / vi) was audible in the pulmonary area . A right - sided complete hemiparesis with extensor plantar was noted . An ecg revealed right atrial enlargement, extreme right axis, and poor progression of r wave . Chest x - ray revealed cardiomegaly with reduced pulmonary vascular markings [figure 1]. A full - segmental echocardiography revealed a single ventricle of the double - inlet left ventricle type [figure 2]. A rudimentary right ventricle was connected to the main ventricle by a non - restrictive foramen . The aorta arising from the rudimentary chamber and pulmonary artery from the main chamber [figure 3]. A 7 mm 5 mm fixed structure on the wall of the main pulmonary artery with erratic movement, indicative of a vegetation, suggested pulmonary endarteritis [figure 4a and b]. A small osteum - secundum atrial septal defect was present, but patent ductus arteriosus was not present . Ct scan of the brain revealed bilateral multiple cerebral abscesses [figure 5], with the largest one present superficially in the left parietal region . Chest x - ray showing cardiomegaly with decreased pulmonary flow echocardiography (subcostal anatomically corrected view) showing both mitral and tricuspid valves opening into a single ventricle of lv morphology . A rudimentary rv type of ventricle is also visualized echocardiography (subcostal anatomically corrected view) showing aorta arising from a rudimentary right ventricle which is connected to the left ventricle through a nonrestrictive foramen (a) and (b) shows the pulmonary vegetation suggesting pulmonary endarteritis ct scan of the brain showing bilateral cerebral abscesses the child was started on parenteral ceftriaxone 80 mg/ kg / day (plus, gentamicin 3 mg / kg / day for 2 weeks) for the endarteritis and was continued for 6 weeks for optimal treatment of the cerebral abscess . An attempted drainage of the largest cerebral abscess resulted in some improvement of the hemiparesis . The patient became afebrile in 2 weeks and was able to walk after 4 weeks of therapy . Repeat echo before discharge showed substantive decrease in size of the pulmonary artery vegetation and cardiac symptoms . The patient has been referred to the cardiac surgery department for corrective surgery for single ventricle . The risk of infective endocarditis is considerably increased in children with congenital heart disease, and the disease can occur with almost any lesion, more so with cyanotic congenital heart disease (cchd). Right - sided infective endocarditis is rare by virtue of the low hemodynamic pressure and lack of isolated or significant right - sided valvar deformities . In adults, right - sided infective endocarditis usually follows prolonged intravenous catheterization or intravenous drug - abuse, affecting the tricuspid valve alone or in combination with the pulmonary valve . A similar valvar involvement also occurs in infants and in children, but here congenital cardiac anomalies with their accompanying interventions are important pre - disposing factors . Pulmonary endarteritis as an entity of right - sided endocarditis is rare, even in patients of congenital heart disease . Most of the reported pulmonary endarteritis cases have been associated with a patent ductus arteriosus (pda). There are less than 30 reported cases of pulmonary endarteritis associated with pda in the adult, and overall incidence has dramatically decreased over the last 30 years . Bilge et al ., in their case report of pulmonary endarteritis in pda, underlines the importance of echocardiography in not only making this rare diagnosis but also as an effective means of following up such a case . Apart from pda, a single report exists of pulmonary endarteritis occurring after anatomical correction of complete transposition of the great arteries . To the best of our knowledge and available resources, our case report of pulmonary endarteritis in a child of single ventricle is probably the first such so far . The onset of pulmonary endarteritis and the formation of vegetation can be explained by several factors, including an obstacle of a valve or bloodstream jet and venturi effect, the formation of a platelet fibrin thrombus, transient bacteremia, and adhesion factor for infection . In the present case, an untreated infection in the child could have led to multiple episodes of bacteremia . The presence of multiple, bilateral cerebral abscesses is a corroborative evidence to the bacteremia . The pulmonary artery in this case arose from the main ventricle (morphological double - inlet lv) and was hypoplastic . Turbulent blood flow distal to the stenotic lesion may increase the risk of developing infective endarteritis in an already hypoplastic pulmonary artery . The intima is also damaged in these areas, predisposing to formation of platelet fibrin thrombus, and thus making the region more susceptible to colonization by pathogens . Congenital heart disease (chd) has a reported incidence of 9596/million live births (0.95%), out of which 14.5% (1391/million live births) have cyanotic congenital heart disease (cchd). Single ventricle (106/million live births) accounts for 7.6% of cchds and 1.1% of all chds . Meticulous full - segmental echocardiographic approach is required to diagnose and delineate the specific type of single ventricle . Single ventricle is a complex cchd and is considered a high risk condition for an infective endocarditis . Trans - thoracic echocardiography (tte) is more sensitive in the pediatric population than in the adult population for detection of vegetation . Tte is more likely to identify vegetations in children with normal anatomy or isolated valvular pathology than in those with complex cchd . The importance of a carefully - performed tte or trans - esophageal echocardiography is, therefore, essential in a complex cchd like single ventricle states . Cyanotic heart disease accounts for 12.8%-69.4% of all cases of brain abscesses, with the incidence being higher in children . The incidence of brain abscess in patients with cyanotic heart disease has been reported to range between 5 and 18.7% . In our case, bacteremia from an unknown source could have bypassed the pulmonary circulation by entering the double - inlet lv (the dominant ventricle) and moved through the aorta and seeded in the brain . Patients with cyanotic heart disease could have low - perfusion areas in the brain due to chronic severe hypoxemia and metabolic acidosis as well as increased viscosity of blood due to secondary polycythemia . These low - perfusion areas commonly occur in the junction of gray and white matter, and they are prone to seeding by microorganisms that may be present in the bloodstream . The advent of ct scans and their use in the management of these abscesses has resulted in a fourfold decrease in the mortality rate in patients with brain abscesses, secondary to cyanotic heart disease - from 40%-60% in the pre - ct era to ~10% . The threshold for ct scans in a cchd should be low, and regular ct scans should be obtained to monitor the size of the abscess . In conclusion, this case report aims to highlight the considerable and varied morbidity associated with cyanotic congenital heart diseases (cchd). The presence of a relatively common infectious complication (cerebral abscesses) and a rare infectious complication (pulmonary endarteritis) in the same child with a cchd (single ventricle) validates the need for a heightened clinical awareness and a prompt and meticulous investigational approach for diagnosis and therapy in this group of patients.
|
Most commonly affects people of african descent . In nigeria, sickle cell anaemia affects about 1 - 3% of the nigerian population . Individuals who have only one copy of the mutation are said to have sickle cell trait.12 these people are usually healthy but can transmit the disease to their children.3 sickle cell anaemia is characterised by acute episodes of pain (in the abdomen, chest or joints) and exhibits a range of severity.45 sickle cell disease is a condition which alters the shape of the red blood cells from round to sickle shape, causing them to block small blood vessels and interfere with normal blood flow . Children affected with sickle cell disease experience chronic episodes of pain and an increased susceptibility to potentially life - threatening conditions, including bacterial infections and organ failure . At the present time, there is no cure for sickle cell anaemia . Although there are some altering therapies such as hydroxyurea and hematopoietic cell transplantation for the management of sickle cell disease, but these can have serious side effects and are very risky the average life expectancy for people with sickle cell anaemia is less than 50 years . The first deoxyribonucleic acid (dna) diagnostic procedure for prenatal purposes was reported more than thirty years ago.6 subsequently, it was recognised that the mutation itself affected the cleavage site of a restriction enzyme, ddei, that could recognize the dna sequence of ctnag (n = a, t, c, or g). While dna from a normal allele (ctgag) would be digested by the enzyme, dna from an affected allele in which a is substituted by t (ctgtg) would not.78 the resulting differences between dna fragment sizes can then be recognised by electrophoresis, thus forming the basis for diagnosis . With the advent of polymerase chain reaction (pcr), rapid dna analysis methods have become available, and these techniques are now widely used for prenatal diagnosis.910111213 pre - implantation genetic diagnosis (pgd) is a procedure that has emerged against the backdrop of in vitro fertilisation (ivf) technology . In nigeria, this process of ivf was first introduced by ashiru et al.14 following their pioneering work, we were able to advance this technique for patients with infertility,1516 and now for patients with advanced maternal age and sickle cell disorders with the use of pgd . With pgd, the genetic status of an embryo can be determined before transfer into the uterus after ivf, thus almost completely eliminating the risks of bearing a child with the disease17(pgd is not 100% accurate). The most common form of pgd involves the extraction of one or two cells from the pre - implantation embryo, often around the 8-cell stage . Couples at risk for the transmission of genetic diseases can now choose ivf and pgd to avoid the problem of selective abortion that is associated with pre - natal diagnosis during pregnancy . The patient was a 29-year - old woman and spouse with heterozygous genotype (as). Couple already have a 2-year - old child who is affected with sickle cell anaemia . Prior to ovarian stimulation, hysterosonogram (hsn) was done which revealed normal uterine cavity . The protocol was also approved by the research and ethics committee of the centre . Following 3 weeks of oral contraceptive use, the patient was down - regulated using a gnrhanalog (leuprolide). Super ovulation was achieved with the use of recombinant follicle stimulating hormone (fsh). When three or more leading follicles measured> 18 mm in diameter, the patient was triggered with human chorionic gonadotropin (hcg) 5000 iu . The surrounding cumulus and corona cells were then removed and the nuclear maturity of the oocytes was assessed under an inverted microscope . Only metaphase ii oocytes were injected with morphologically normal motile spermatozoa . Further culture of injected oocytes was done in 20 l microdrops of culture medium under lightweight paraffin oil . Fertilisation was confirmed after 16 - 18 hours by the observation of two distinct pronuclei (2pn). Oocytes with 2pn were assessed on day 2 after injection for embryonic development . On day 3, a single blastomere was biopsied for embryos at 6 - 8 cell stage with less than 50% fragmentation [figures 1 and 2]. Blastomere showing nucleus fifteen biopsied cells were sent for genetic screening and analysed using pgd / pcr technique [figure 3]. Results provided after 48 hours showed that 5 (33%) of the biopsied cells were of genotypes unaffected by sickle cell anemia; of these, three were heterozygous carriers of hb s (as) and two were homozygous for hba (aa). Three unaffected embryos (two heterozygous normal and one homozygous) were transferred on day 5 at blastocyst stage . Endometrial lining was prepared for fet using increasing doses of estradiolvalerate from 2 mg daily up to 8 mg with weekly monitoring of the endometrium . Two vitrified normal embryos (one hbas and one hbaa) were thawed both at hatched blastocyst stage and transferred [figure 4]. The advent of ivf as a treatment for infertility has created the opportunity to study the chromosomal constitution of surplus human pre - implantation embryos . Cultured human pre - implantation embryos have been used to develop methods which allow pgd analyses by pcr on biopsied blastomeres from an embryo.18 beta - thalassaemia and sickle cell anaemia are -globin chain quantitative and structural disorders that lead to anaemia syndromes . Until recently, the only alternative for couples with a high genetic risk was to undergo prenatal diagnosis followed by termination of an affected pregnancy . The pgd of -thalassaemia and sickle cell anaemia is an alternative that avoids therapeutic abortion by diagnosing embryos for -globin defects before implantation into the mother's womb.19 on a world - wide scale, pgd for -thalassaemia and/or sickle cell anaemia has already been applied on single blastomeres20 and on the first and second polar bodies.21 the molecular strategies used were dna amplification followed by genetic diagnosis by denaturing gradient gel electrophoresis analysis,20 restriction enzyme digestion, the creation of a new restriction enzyme recognition sequence involving the ivs1 nt 110 mutation2122 and the use of fluorescence pcr.22 in the present study, pgd was applied clinically for sickle cell anaemia on a fertile carrier couple with previous experiences of therapeutic abortion for affected foetuses, and a sickle cell disease child . Despite the fact that sickle cell anaemia is one of the most common genetic disorders and detailed genetic information is available,23 unaffected pregnancies following pgd for sickle cell anaemia previously have not been reported . Lack of previous success in this area presumably is due to the length of time and effort required to overcome technical difficulties inherent in these procedures, as well as lack of available research funding.17 our results demonstrate that sickle cell anaemia can be detected in single cells by pcr and restriction enzyme analysis and that unaffected pregnancies can be established by the transfer of embryos of known genetic makeup that have undergone biopsy . In total, one pgd cycle with a frozen embryo transfer cycle were carried out . The goal of pgd is to reduce the risk of having children born with genetic diseases from a priori risk of 25% to a value significantly less . Patients undergoing pgd should be advised that if a pregnancy does occur from this treatment, they should consider undergoing chorionic villi sampling (cvs) or amniocentesis to confirm these micro - genomic results . In summary, this is the first unaffected pregnancy and delivery after successful pgd for sickle cell anaemia . Our results demonstrate that pgd for the detection of sickle cell anaemia is a powerful diagnostic tool for carrier couples who desire a healthy child but wish to avoid the difficult decision of whether to abort an affected foetus . The procedure, successfully used in this case, may also be applied to other monogenic disorders and further supports the notion that pgd is destined to be an integral aspect of assisted reproductive technology . Given the current methods and relatively high cost of the procedure, it is unlikely that pgd will totally replace prenatal testing . However, it is conceivable that with further refinements, pgd will certainly become an invaluable and powerful diagnostic modality.
|
Pulse rate, also called heart rate, is the number of heartbeats per unit of time, commonly used as beats per minute (bpm). Pulse rate is varied in accordance with the body's need for oxygen changes, such as during exercise or sleep . Since various health - related phenotypes are closely correlated with pulse rate [1 - 3], measuring pulse rate is commonly used for diagnosing and accessing medical conditions . Pulse rate is known to be positively correlated with triglycerides and negatively correlated with high - density lipoprotein cholesterol . Metabolic syndrome is associated with poor exercise capacity and poor heart rate recovery in patients who have coronary disease . Moreover, high pulse rate is negatively correlated with lifespan in mammals, including humans . Despite the importance of pulse rate as a risk factor for various diseases, however, few genes are known to be associated with pulse rate, and the underlying mechanism for pulse rate remains unraveled . We previously reported pulse rate - associated loci from the korea association resource (kare) genomewide association study (gwas), comprising 8,842 samples in the korean population . In this study, we extended the previous study and reexamined the relevance of pulse rate - associated single - nucleotide polymorphisms (snps) from an additional gwas of 3,703 korean samples . In the discovery stage, the association results for pulse rate were obtained from the kare study . Subjects for the replication stage were recruited from the health examinee cohorts, called hexa - shared cohorts . The standardized examinations that were applied in this survey included 4,302 participants aged 40 to 70 years . Pulse rate of kare was measured 3 times while the participant was lying down, and the average value was used for the analysis (before the first measurement, participants rested for 5 min, and 3 measurements were taken at least 30 s apart). In hexa - shared cohorts, the first measurement of the participants, who rested for 5 min, the methods for genotyping and quality control for the kare gwas have been described elsewhere . For the hexa gwas, genomic dna was extracted from 4,302 participants from an urban cohort and genotyped with affymetrix genome - wide human snp array 6.0 (affymetrix, inc ., santa clara, ca, usa). From 4,302 genotyped samples, we excluded samples with a low call rate (95%, n = 443), high heterozygosity (n = 25), outliers (n = 26), and gender inconsistencies (n = 8), and those obtained from individuals who had developed any kind of cancer (n = 61) were excluded from subsequent analyses, along with related or identical individuals whose computed average pairwise identity - by - state value was higher than that estimated from cryptic first - degree relatives of samples (n = 33). Snp markers with a high missing genotype rate (> 5%), minor allele frequency (maf) (<0.01), and significant deviation from hardy - weinberg equilibrium (p <1 10) were excluded, leaving a total of 627,659 markers to be examined in 3,703 individuals . Association analyses were performed using plink (http://pngu.mgh.harvared.edu/~purcell/plink/), sas version 9.2 (sas institute inc ., cary, nc, usa), and r statistics package (version 2.7.1) (http://r-project.org/). The snp association for pulse rate was tested by linear regression analysis with an additive model, adjusting for age, sex, and recruitment area . The kare gwas and replication gwas were combined by an inverse - variance meta - analysis method, assuming fixed effects, with cochran's q test used to assess between - study heterogeneity . Meta - analysis calculations were performed using metal (http://www.sph.umich.edu/csg/abecasis/metal) in the r program (version 2.7.1). In the discovery stage, the association results for pulse rate were obtained from the kare study . Subjects for the replication stage were recruited from the health examinee cohorts, called hexa - shared cohorts . The standardized examinations that were applied in this survey included 4,302 participants aged 40 to 70 years . Pulse rate of kare was measured 3 times while the participant was lying down, and the average value was used for the analysis (before the first measurement, participants rested for 5 min, and 3 measurements were taken at least 30 s apart). In hexa - shared cohorts, the first measurement of the participants, who rested for 5 min, was used . The methods for genotyping and quality control for the kare gwas have been described elsewhere . For the hexa gwas, genomic dna was extracted from 4,302 participants from an urban cohort and genotyped with affymetrix genome - wide human snp array 6.0 (affymetrix, inc .,, we excluded samples with a low call rate (95%, n = 443), high heterozygosity (n = 25), outliers (n = 26), and gender inconsistencies (n = 8), and those obtained from individuals who had developed any kind of cancer (n = 61) were excluded from subsequent analyses, along with related or identical individuals whose computed average pairwise identity - by - state value was higher than that estimated from cryptic first - degree relatives of samples (n = 33). Snp markers with a high missing genotype rate (> 5%), minor allele frequency (maf) (<0.01), and significant deviation from hardy - weinberg equilibrium (p <1 10) were excluded, leaving a total of 627,659 markers to be examined in 3,703 individuals . Association analyses were performed using plink (http://pngu.mgh.harvared.edu/~purcell/plink/), sas version 9.2 (sas institute inc ., cary, nc, usa), and r statistics package (version 2.7.1) (http://r-project.org/). The snp association for pulse rate was tested by linear regression analysis with an additive model, adjusting for age, sex, and recruitment area . The kare gwas and replication gwas were combined by an inverse - variance meta - analysis method, assuming fixed effects, with cochran's q test used to assess between - study heterogeneity . Meta - analysis calculations were performed using metal (http://www.sph.umich.edu/csg/abecasis/metal) in the r program (version 2.7.1). The discovery gwas for pulse rate included 352,225 snps profiled with affymetrix genome - wide human snp array 5.0 in 8,842 individuals from the ansung and ansan cohorts as described previously . Characteristics of the study, including age, sex, and trait summaries, are presented in table 1 . The association analysis identified several genomic locations as potentially associated with pulse rate . Unlike the previous gwas, we did not apply a threshold with a p <0.01 in both ansung and ansan cohort in addition to a combined p <1 10 for the snp selection for the replication study so that we could include more promising snps for their association with pulse rate . We observed 61 significant snps by applying only a threshold with a combined p <1 10 . After excluding snps by cluster plot inspection and removing singletons, 3 independent snps (that is, with pairwise linkage disequilibrium statistics r <0.2 and maf 0.05 within a 500-kb window of the genomic region) were finally chosen to validate in the independent population - i.e., the hexa cohort, comprising 3,703 individuals . In the replication study, all 3 snps were confirmed for their association with pulse rate at a p <0.05 (table 2). The first pulse rate signal located to 1q32.2a (rs12731740, maf = 0.103, poverall = 2.20 10). Three genes, such as cd46, clorf132, and cd34, appear near this locus . The physiological relevance of the 3 genes in relation to pulse rate is not clear [8, 9]. Thus, fine mapping surrounding this locus by targeted resequencing is highly recommended to discover the causal variants for pulse rate . The second pulse rate snp is rs12110693 (maf = 0.494, poverall = 1.10 10) on 6q22.31c . The only gene located near this snp is loc644502, which has no known function . The third locus associated with pulse rate is at 6q22.31c (rs2892767, maf = 0.261, poverall = 2.50 10). This locus is near gja1 (gap junction protein, alpha 1, 43 kda), which is a member of the connexin gene family . The protein encoded by gja1 is a component of gap junctions, which are intercellular channels that provide a route for the diffusion of low - molecular - weight materials from cell to cell . In this study, we performed a genomewide scan for pulse rate and identified 3 loci accounting for the variation in pulse rate . Two of 3 loci were previously reported and replicated once again in an independent hexa - shared cohort . The other one (rs2892767) near gja1 was previously implicated for its association with pulse rate but was not chosen for the replication study, since the snp did not meet the selection criteria in the discovery stage . In the present study, snp rs2892767 near gja1 was taken forward to the replication study using the independent dataset from the hexa - shared cohort and was nicely confirmed for its association with pulse rate . Two snps, rs2892767 near gja1 and rs12110693 near loc644502, are 408 kb apart from each other and are located in a separate ld, indicating that both are independent snps . We performed multiple linear regression analyses, conditioning the snps to each other to find a significantly stronger proxy for pulse rate . However, no dramatic decrease in statistical significance was observed, and no interaction was found between rs2892767 and rs12110693 (table 3). Gap junctions are thought to have a crucial role in the synchronized contraction of the heart and in embryonic development . It is also known that gap junctions, clusters of cell - to - cell channels composed of connexins, mediate the orderly spread of electrical excitation throughout the heart . The gja1-encoding protein has been reported to be involved in the development and function of the heart by allowing direct cell - to - cell exchange of molecules, which mediate multiple signaling events . Cho et al . Previously reported the same locus near gja1 to be responsible for pulse rate without evidence of replication . In the present study as indicated from the functional role of gja1, it is a strong candidate gene for pulse rate . Thus, further efforts, such as fine mapping or imputation based on large - scale sequencing data near rs2892767 on 6q22.31, would reveal the causal variant of this locus . In addition, functional studies for gja1 would be worthwhile to facilitate a full understanding of its biological role in pulse rate . Our study was relatively underpowered to discover additional novel loci and demonstrated that large - scale genomewide meta - analysis comprising hundreds of thousands samples is required for understanding the missing heritability of pulse rate.
|
This complication usually occurs during abdominal aortic surgery and is an unusual complication following live donor nephrectomy . Live kidney donors are healthy individuals who willingly undergo major surgery to improve the well - being of another individual . Therefore, it is of utmost importance to minimize the risks of this procedure and thus maximize donor safety . A 39-year - old mediterranean female with a bmi of 26, underwent an elective, living - related, transperitoneal left - sided totally robot - assisted donor nephrectomy using the da vinci surgical system . Donor nephrectomy was performed by a transplant surgeon and assisted by a second transplant surgeon, as described elsewhere [2, 3]. Briefly, the procedure was performed with the da vinci surgical system s using three arms with a fenestrated bipolar forceps (endowrist bipolar cautery instrument; intuitive surgical, sunnydale, usa) in arm 1, a monopolar cautery hook (endowrist monopolar cautery instrument; intuitive surgical, sunnydale, usa) to dissect structures in arm 2 and the camera (3d vision system 12 mm 30 endoscope; intuitive surgical, sunnydale, usa) in arm 3 . After full exposure of the kidney and vascular structures, a pfannenstiel incision was made and an endo - bag (endocatch; us surgical, norwalk, usa) was introduced into the abdomen . Subsequently, the ureter was clipped and divided with scissors, and the renal artery and the vein were transected using an endoscopic stapler (endogia; us surgical, norwalk, usa). The kidney was then placed in the endobag and extracted through the pfannenstiel incision . Before removing all trocars, the renal bed and vascular stumps were inspected using the da vinci, and intra - abdominal hemostasis was performed with the fenestrated bipolar forceps . The operation field was found to be dry after which all incisions were closed intracutaneously . Postoperatively, the patient was placed on dipidolor patient - controlled analgesia combined with paracetamol . During the postoperative recovery she was discharged at postoperative day 3 with a normal appetite and no wound problems . On postoperative day 11, she visited the outpatient clinic for a follow - up visit and the nausea was completely gone . However, she noted abdominal pain located on the right side near the iliac crest and reported two episodes of hematuria . Laboratory results showed a decreased c - reactive protein (crp) level and normal leukocyte count . On postoperative day 19, the patient noted bright red fluid leakage from the pfannenstiel incision without any further symptoms and contacted the nurse practioner . It was decided that she would visit the outpatient clinic if the leakage would worsen or other complaints would emerge . On postoperative day 29, the patient visited the outpatient clinic for her scheduled 1-month postoperative follow - up visit . She still experienced pain in her abdomen which was mildly controlled with anti - analgesia . The pain progressed when she laid on her right or left side and, at night, her abdomen was more distended than usual . On physical examination, she had a distended abdomen, with tenderness on palpation on the right and the left side, and below the umbilicus, with a shifting dullness on percussion during movement . An abdominal ultrasonography showed intraperitoneal fluid in all four quadrants of the abdomen and a diagnostic paracentesis demonstrated yellow fluid with a lipid aspect, suspected of being chylous ascites and confirmed by biochemical analysis showing positive triglycerides of 57.98 mmol / l . She was admitted to the hospital for drainage and a medium - chain triglyceride - based diet was started . On day 4 the medium - chain triglyceride - based diet was continued for a total of 4 weeks after which a second abdominal ultrasonography was done, which showed no fluid in the abdomen . In this case report, we describe the first reported complication of chylous ascites after total robot - assisted donor nephrectomy . This complication is more common in major oncological surgical procedures, where lymph nodes are often resected . Therefore, from an oncological point of view these patients often casually accept this complication . Nevertheless, healthy live kidney donors are different from patients who undergo extensive dissection damaging lymphatic vessels necessitating postoperative treatment . In over three decades,> 1500 live donor nephrectomies have been performed at our centre and never before have we encountered a case of postoperative chylous ascites after a donor nephrectomy . A review of the literature resulted in a total of 56 reported cases of chylous ascites after donor nephrectomy (supplement 1). A huge contrast has been compared with the thousands of live donor nephrectomies that have been published over the years . The occurrence of chylous ascites is low and the expectation is that this is an underestimation . There is no clear treatment pathway; however, a median chain triglyceride diet combined with a therapeutic drain or octreotide seems to be the first step . We could not identify any other reported cases of chylous ascites after robot - assisted donor nephrectomy [2, 47]. During a robot - assisted donor nephrectomy, it is not necessary to dissect the lymfatic tissues around the aorta and the origo of the real artery . Larger lymphatics around the renal vessels are either clipped or sealed by modern energy devices . In our case, a fenestrated bipolar forceps and a monopolar cautery hook were used for dissection and sealing . However, with monopolar energy, although control the lymphatics for a short time, necrosis can occur later on leading to leakage of large amount of chyle . The complication is often diagnosed after a few weeks, causing a delay in treatment . Fortunately, the complication can be successfully treated with conservative measures within a few weeks as demonstrated in this case.
|
Obesity is a worldwide phenomenon, with an incidence increasing in parallel with obesity - associated diseases such as insulin resistance, type 2 diabetes mellitus, and hypertension . The combination of obesity and hypertension places patients at a higher risk of hypertensive end - organ damage and vascular events [2, 3]. Blood pressure (bp) is subject to diurnal variation, and studies using ambulatory bp monitoring (abpm) have demonstrated the clinical significance of disturbances in the diurnal bp profile and have associated nondipping with a progression in end - organ damage [4, 5]. Moreover, a nondipping pattern of bp has been reported to occur in several conditions that are frequently associated with obesity . Although body mass index (bmi) is associated with the severity of ambulatory hypertension and an increase in daytime bp, bmi does not reflect body fat distribution . Epicardial adipose tissue is related to visceral fat, rather than total adiposity, and shares microcirculation with myocardial tissue and coronary vessels [6, 7]. Because elevated bp is associated with ectopic fat accumulation in the intrathoracic and epicardial areas, a possibility of association of epicardial adipose tissue with hypertension as well as diurnal bp patterns [10, 11] has been found in some recent studies [8, 9]. Epidemiological studies have found that epicardial fat is two to three times more common among females than males and that excessive body weight increases the risk of diabetes mellitus (dm) and cardiovascular diseases approximately one - and - a - half to two times higher in women than it does in men . Furthermore, a higher prevalence of hypertension among overweight adults is found in women than in men, which may indicate different susceptibilities based on gender . Given these facts, we aimed to investigate the influence of obesity on the association between epicardial fat thickness (eft) and circadian bp changes in patients with recently diagnosed essential hypertension (eh), with a gender subgroup analysis . This cross - sectional observational single - center cohort study included patients who underwent 24 h abpm and echocardiography between january 2008 and october 2013 . Demographic characteristics recorded at the first visit included age, sex, height, weight, medication, smoking history, and other diseases . Blood was drawn for measurement of total serum cholesterol, triglycerides, high - density lipoprotein (hdl) and low - density lipoprotein (ldl) cholesterol, blood glucose, creatinine, uric acid, and high sensitivity c - reactive protein (hs - crp). Body mass index (bmi) was calculated as the ratio of dry weight in kilograms to height squared (in square meters). A total of 441 consecutive patients, who underwent office bp measurements, 24-hour abpm, and laboratory measurements for cardiovascular risk factors and echocardiography, were analyzed . Following the recommendations of the european society of hypertension, a normotensive state was defined as a mean daytime ambulatory systolic and diastolic bp <135/85 mmhg by abpm, associated with true ht was assigned if the average daytime bp was higher than 135/85 mmhg and the average nighttime bp was above 120/75 mmhg . Obesity was defined as a bmi above 25 kg / m, as per the korean society for the study of obesity . The patients with the following diseases were excluded from the study: secondary hypertension, significant liver disease, neurologic disorder, malignant disease, valvular heart disease, heart failure, and history of acute coronary syndrome, myocardial infarction, coronary revascularization procedure, carotid revascularization procedure, ischemic leg ulcer, peripheral revascularization, or amputation . Because the presence of type 2 dm is known to be associated with increased eft regardless of obesity [6, 7], we also excluded overt type 2 dm from the analysis to avoid its possible confounding impact on the association between eft and circadian bp variability in our hypertensive patients with or without obesity . Office bp measurements were performed using an automated device (easy x 800 (r / l), jawon medical, seoul, korea). Measurements were taken after patients had rested for 10 min in a sitting position, with the arm comfortably placed at the heart level . Each set of two measurements was averaged to give the office systolic and diastolic bp . Abpm was performed on each patient's nondominant arm using an automatically oscillometric device (tonoport v, par medizintechnik, berlin, germany) on a normal working day . All subjects were instructed to rest or sleep between 10:00 pm and 7:00 am (nighttime) and to continue their usual activities between 7:00 am and 10:00 pm (daytime). The accuracy of the device was checked against the standard auscultatory method to ensure that the difference in bp measurements between methods did not exceed 5 mmhg . The device was set to obtain bp readings at 20 min intervals during the day (7:00 am10:00 pm) and at 40 min intervals during the night (10:00 pm7:00 am). Each abpm dataset was first automatically scanned to remove artifactual readings according to preselected editing criteria . Data were edited by omitting all readings of zero, all heart rate readings <20 or> 200, diastolic bp readings> 150 and <40 mmhg, systolic bp readings> 240 and <70 mmhg, and all readings where the difference between systolic and diastolic bps was less than 10 mmhg . The following abpm parameters were evaluated: average ambulatory 24-hour systolic and diastolic bp levels, average ambulatory daytime systolic and diastolic bp levels, average ambulatory nighttime systolic and diastolic bp levels, and mean ambulatory 24-hour, daytime, and nighttime bps . Additionally, for both sbp and dbp, the magnitude of the nocturnal decline in bp (nocturnal decline) was calculated as follows: daytime average bp minus nighttime average; the percentage change in bp from day to night (% day night bp) was calculated as (daytime bp nighttime bp) 100/daytime bp . With this latter data, a normal dipper pattern was diagnosed when the reduction in the average sbp and dbp during the nighttime was 10% of the average daytime values . The nocturnal bp status was also assessed and expressed as either nocturnal normotension or hypertension, with nocturnal hypertension defined as a nighttime bp of 120/70 mmhg . Standard two - dimensional (d) and strain echocardiography were performed on all subjects while lying in the left lateral decubitus position using a 3.5 mhz transducer (philips ie33, philips medical systems, bothell, wa, usa), and the echocardiography examiners were blinded to patient information . Measurements of the thickness of interventricular septum and posterior wall, the diameter of the lv cavity, and the lv mass index (lvmi) were performed according to american society of echocardiography criteria . Pulsed wave doppler of the transmitral lv inflow was performed in an apical 4-chamber view with the sample volume placed at the level of the mitral valve tips, and the following measurements of global lv diastolic function were determined: peak early (e) and late (a) diastolic mitral flow velocity, and their ratio, e / a; early (ea) diastolic mitral annular velocity; deceleration time of the e wave; and lv isovolumetric relaxation time (ivrt). Echocardiographic assessments of the eft were measured perpendicularly from the free wall of the right ventricle at end - systole in three cardiac cycles according to the method previously described by iacobellis et al . Epicardial fat was described as the echo - free space between the outer wall of the myocardium and the visceral layer of the pericardium . The maximum eft was also measured from the point on the free wall of the right ventricle along the midline of the ultrasound beam perpendicular to the aortic annulus as the anatomic landmark (figure 1(b)) and from the apical 4-chamber view focused on the right ventricle (figure 1(c)), because one of the critical issues in eft measurement is the inconsistency in the measurement location, and mean eft was averaged from the parasternal long axis, parasternal short axis, and apical 4-chamber view images . The offline measurement of eft was performed by two cardiologists (ik shim and ki cho) who were unaware of the clinical data . Statistical analyses were performed with the commercially available computer program spss 18.0 for windows (spss inc . Values are expressed as mean standard deviation or as a percentage (%). Parameter differences among the 3 groups were evaluated using the one - way anova test for normally distributed variables and the kruskal - wallis test for non - normally distributed variables . Values are expressed as means (standard deviation) if numerical variables or as the number of subjects and their percentages (%), if categorical . Pearson correlations analysis was performed to determine factors that potentially influenced bp and hr variability . Multivariate logistic regression models for bp variability were built to determine which variables were independently associated with this status . A total of 441 patients with eh (male / female, 236/205; mean age, 50.7 13.8) and 83 normotensive normal weight patients (controls, male / female, 42/41; mean age, 51.0 13.3) were analyzed, and their clinical features and ambulatory blood pressure parameters according to gender are given in table 1 (male) and table 2 (female). Circadian bp profile and bp variability assessed by 24-hour mean bps variation were increased in hypertensive patients, especially in hypertensive obese patients, without gender difference (all p's <0.05). Moreover, the proportion of patients with a nondipping pattern was the highest among the hypertensive obese patients . Although there were no significant differences in hr variability among the groups, hypertensive obese patients had higher daytime and 24-hour mean hr and male hypertensive obese patients also had higher nighttime hr than control patients (all p's <0.05). Although total cholesterol levels were higher in hypertensive obese patients of both genders than in the controls, male hypertensive obese patients had higher triglycerides and female hypertensive obese patients had lower hdl cholesterol than controls (all p's <0.05). Although there was no significant difference in systolic function, hypertensive patients showed significantly increased wall thickness and enlarged left atrial diameter, which were more prominent among hypertensive obese patients, without gender difference (tables 3 and 4). Interestingly, eft was higher in female than in male patients (7.0 2.5 versus 5.9 2.2 mm, p <0.001). Among women, eft was highest in the obese eh group (7.5 2.6 mm) whereas that of the control was 6.4 2.8 mm and that of the nonobese eh group was 6.7 2.8 mm; however, eft did not vary significantly among males (5.9 1.9 versus 6.0 2.7 versus 5.9 2.4 mm, resp ., p = 0.937). When we compared the 24-hour abmp parameters and eft between male and female patients, female patients had significantly higher eft (7.0 2.6 versus 5.9 2.2 mm, p <0.001) and a greater daytime bp variation (15.1 4.72 versus 13.6 4.45 mmhg, p <0.001) than male subjects; males had higher 24-hour mean bp (138.8 14.7 versus 137.3 15.3 mmhg, p = 0.043) and hr variability (15.6 7.45 versus 14.3 6.02, p = 0.023) than female subjects (table 5). Variable circadian bp profiles and la size were significantly related to bmi in both females and males (all p's <0.05, figures 2(a) and 2(b), table 6). However, eft was significantly correlated with 24-hour mean bp (both day and night) as well as variability (mainly night) only in female patients (figure 2(c)). When we investigated the association of quotient of eft / bmi with bp values, eft / bmi showed positive correlation with 24-hour systolic bp (r = 0.172; p = 0.009), 24-hour mean bp (r = 0.134; p = 0.041), day systolic bp (r = 0.150; p = 0.022), day systolic bp variation (r = 0.133; p = 0.043), night systolic bp (r = 0.217; p = 0.001), night systolic bp variation (r = 0.181; p = 0.006), night diastolic bp (r = 0.132; p = 0.047), and night diastolic bp variation (r = 0.179; p = 0.007). However, no correlation was shown between eft / bmi and 24-hour abpm parameters in male . Multivariate logistic regression analysis demonstrated that the 24-hour mean bp variability was associated with sbp (standardized coefficient = 0.199; p = 0.018) and eft (standardized coefficient = 0.175; p = 0.016) in female patients, but not in male ones (table 7). When we performed binary logistic regression analysis to identify the independent determinants of nocturnal nondipping bp pattern, eft was independent contributor to the nondipping pattern only in female (odds ratio 7.034, 95% confidence interval 2.258 to 21.909, p = 0.001) (table 8). The most relevant information obtained from this study is that relationships among eft, obesity, and circadian bp variability are affected by gender in different manners . Although circadian bp profile and bp variability were increased in hypertensive obese patients without gender differences, female patients had significantly higher eft and greater daytime bp variability than male subjects . Bp variability was associated with sbp and eft only in female patients; therefore, eft may be a more valuable parameter in the evaluation of bp severity and obesity in women than in men . Bmi is known to be associated with the severity of ambulatory hypertension and increased daytime bp . In the present study, we investigated the relationship between the parameters derived from 24-hour abpm (24-hour sbp and dbp, and bp variability) in nondiabetic hypertensive patients with or without obesity . In general, bmi is correlated with bp level, and individuals with abdominal obesity have increased bp levels or are at risk for hypertension [3, 5]. The mechanism behind obesity - related bp elevation has not been fully established . Obesity may induce autonomic dysfunction secondary to the elevation of plasma insulin concentration, because hyperinsulinemia has been associated with sympathetic activation [18, 19] and marked increases in hr . Vice versa, sympathetic hyperactivity is also an independent contributor to the insulin resistance associated with obesity [21, 22]. Thus, it is possible that mean arterial pressure and nighttime hr might remain at daytime levels as a consequence of sustained elevation of plasma insulin concentration . Our hypertensive obese patients had higher proportions of nondipping patterns and higher daytime and 24-hour mean hr; moreover, male hypertensive obese patients also had higher nighttime hr than the controls . These findings are similar to the report of antic et al ., who showed that the normal dipping pattern of bp and hr is rapidly lost following a switch to a high fat diet, without affecting daytime values . Moreover, obesity suppresses nighttime parasympathetic activity and increases nighttime hr values . Because diurnal variations in mean arterial pressure and hr appear to be autonomically mediated, the loss of nocturnal dipping of mean arterial pressure and hr in our obese patients must represent an underlying change in autonomic function . Since the nighttime mean bp was altered in obese patients, the presence of hypertension in obese patients might be missed by office bp measurements that were made only during the daytime . Thus, our results emphasize the importance of continuous 24-hour monitoring of cardiovascular variables, especially in obese patients . Regarding gender differences, obese females showed a higher tendency towards bp variability than obese males . One interesting finding was that females showed a significant relationship between increased eft, obesity, and bp variability, but this was not the case in males . Still yet, there is no consensus in the literature on the impact of gender on the amount of epicardial fat . Iacobellis et al . Showed bigger size of eft in males than in females, and our result showed the greater values of eft in females . Recent study by akilli et al . Showed larger eft in females than in males . Thus, these findings may indicate different gender susceptibilities related to obesity and the regional differences in fat distribution, especially eft distribution . Several studies have reported gender differences regarding the effects of obesity and change in body weight on bp [13, 26] and cardiovascular outcome [12, 27]. It has been reported that obese women have a higher relative risk of diabetes and heart failure with increasing abdominal circumference than men and that obesity has an association with diastolic dysfunction and lvmi only in women . From these results, women can be considered to be more susceptible to cardiovascular adverse effects related to obesity . In our study, accentuated bp variability in obese hypertensive women may have indicated a role in cardiovascular vulnerability . However, the exact explanation for these gender differences is still unclear . One possible mechanism is that such gender differences result from abrupt hormonal and body fat composition changes after menopause . Thus, obese females have a greater amount of visceral adipose tissue which may lead to insulin resistance . Insulin resistance and changes in the autonomic nervous system as a result of redistribution of body fat may have an impact on the cardiovascular system in obese women . Excess fat has traditionally been understood to be found in intra - abdominal organs such as the liver and in subcutaneous tissue . Recently, however, epicardial adipose tissue has been found to reflect visceral adiposity and has been proposed as a new cardiometabolic risk factor . Increased plasma fatty acid levels may stimulate the cardiac autonomic nervous system activity through an increase in plasma catecholamine concentrations, which may be related to impaired diurnal bp patterns . Several reports have found a relationship between bp pattern and eft [10, 31], and echocardiographically assessed elevated eft was independently associated with impaired diurnal blood pressure profiles in hypertensive individuals . Also, increased eft has been reported to be associated with diastolic dysfunction and la dilatation due to local or systemic effects in untreated hypertensive patients . In our results, variable circadian bp profiles and la size were significantly related tobmi in both males and females, but eft was significantly correlated with la diameter and 24-hour mean bp with variability as well as nocturnal nondipping bp pattern, only in female patients . The present study suggests that there would be a sex - dependent regulation of bp associated with epicardial adipose tissue, and a recent study demonstrated a sex - dependent regulation of diet - induced lvh associated with sexual dimorphic expression of adipocytokines in epicardial adipose tissue . Although our patient sample seems sufficiently large compared to other studies in the literature, in this cross - sectional study we observed predictive factors and outcome variables simultaneously and had no follow - up data ., although we suggested that the hyperinsulinemia would be the possible main cause of elevated nighttime hr levels, we did not measure the plasma insulin levels . Because both pre- and postmenopausal women were included in the study, we cannot assume the impact of estrogen on epicardial fat . Finally, all participants were korean, and we thus cannot generalize our results to populations of other ethnic groups . In conclusion, the relationship among eft, obesity, and circadian bp variability was affected by gender in different manners . Eft may be a more valuable parameter in the evaluation of bp severity and obesity in women than in men.
|
During the past 2 decades, laparoscopic surgery has gained worldwide popularity resulting from its well - known characteristics of less postoperative pain, fewer complications, earlier discharge, and better cosmesis . Smaller skin incisions in laparoscopic surgery were related to fewer unwanted side effects, including less postoperative pain . However, in recent studies comparing conventional and single - incision laparoscopic surgical procedures, the postoperative pain scores were not different . Keyless abdominal rope - lifting surgery (kars) is a novel, gasless (isobaric), single - incision laparoscopic surgical technique used in various gynecologic operations and cholecystectomies . Besides being a single - incision laparoscopic technique, kars does not require carbon dioxide (co2) use to inflate the abdominal wall and the intra - abdominal pressure is not elevated during the operation . In addition, postoperative shoulder pain seems to be more frequently observed after laparoscopic surgical procedures in which the intra - abdominal pressure is elevated to between 12 and 18 mm hg by use of co2 . In this study we aimed to compare the postoperative pain levels for kars and conventional multiport laparoscopy performed for adnexal cysts . Although kars has been performed in our institute since the first half of 2010, the study included benign ovarian cysts operated on between november 2011 and june 2013 . Beginning in november 2011, intraoperative and postoperative pain management for all operations performed in our unit was standardized; thus the uniform management approach allowed us to collect and analyze the data from different surgical techniques . The study was approved by the local institutional ethical committee of kafkas university school of medicine . The included women had cystic masses including simple cysts with or without septation, endometriomas, and benign cystic teratomas . Most of the participants complained of groin pain, menstrual bleeding disorders, dysmenorrhea, and infertility . Emergency cases including patients with hemodynamic instability, severe abdominal pain, and inaccurate preoperative diagnoses were excluded . Malignant cysts were excluded based on the patient's history, clinical findings, ultrasonography and magnetic resonance imaging, and levels of cancer antigen 125, alpha fetoprotein, carcinoembryonic antigen, and cancer antigen 199 . Women who were diagnosed with an adnexal cyst and in whom a laparoscopic operation was indicated were invited to choose one of the operative techniques . Because kars was performed only in our center, we could not design a randomized trial . Thus the groups of this cross - sectional prospective clinical study were formed according to the women's choice as the kars or conventional co2 laparoscopy groups . Initial visual analog scale (vas) scores of 5.7 1.42 and 6.3 1.42 in patients undergoing kars and conventional laparoscopy, respectively, indicated that we needed at least 30 operations in each group to perform a study with a statistical power of 80% at an level of .05 . The demographic and physical characteristics of the participating patients included their age, gravidity, parity, height, weight, and body mass index, as well as the number of abortions, ectopic pregnancies, and offspring . Oral intake was prohibited starting at 11 pm, and a 135-ml solution containing 19 g of sodium dihydrogen phosphate and 7 g of disodium hydrogen phosphate was administered rectally at 6 am on the operation day . We used the operative laparoscopy study group's classification system for staging intra - abdominal adhesions: 0, none; 1, filmy and avascular; 2, dense and vascular; and 3, binding and cohesive . The abdominal access time in kars patients included the time needed for the construction of the pathway into the abdominal cavity and the placement of the lifting ropes . In conventional laparoscopy patients, the abdominal access time included the time needed for the creation of the co2 pneumoperitoneum at 14 mm hg of pressure and the insertion of the 3 intra - abdominal access ports . All included patients were considered class 1 or 2 according to the american society of anesthesiologists classification and received a standard anesthetic management regimen during the operations . We used propofol, 1.5 to 2.5 mg / kg, to induce anesthesia and facilitated intubation with rocuronium, 0.4 to 0.6 mg / kg . Oxygen was supplemented before and after the intubation at rates of 100% and 50% (mixed with the operating theater's air), respectively . We used 2% sevoflurane and 50 g of fentanyl for anesthesia maintenance . To replace the fluid deficit, we used sodium chloride or ringer lactate solution at 10 ml / kg on intravenous insertion at 2 ml / kg per hour . Unexpected bleeding was managed by use of additional crystalloid solution at 3 ml / kg per hour . Atropine, 1 to 1.2 mg intravenously, was used to reverse the neuromuscular blockade . The postoperative pain management and vas pain score recordings were initiated in the obstetrics and gynecology service . All patients, regardless of initial vas pain score, received 50 mg of meperidine intramuscularly at the beginning of the postoperative period and 75 mg of diclofenac sodium during the second postoperative hour . Vas pain scores were recorded at the beginning and second, fourth, and 24th hours of the postoperative period . Beginning from the fourth postoperative hour, patients with vas pain scores of> 4 points received an additional dose of meperidine, 25 mg intramuscularly . Kars has common features of conventional laparoscopy and laparotomy . During the creation of the abdominal access pathway, the umbilical fold is lifted with 2 clamps bilaterally and a third clamp at the center of the umbilicus . Depending on the need for multiple instrument use or the depth and thickness of the subcutaneous tissue, the length of the incision may be adjusted smaller or larger . After the skin incision, the subcutaneous tissue is dissected bluntly with the tip of a fine instrument until the underlying fascia is reached . The opening is bluntly widened with the moderate stretching force of 2 fine retractors . At this stage, the surgeon can examine the intra - abdominal viscera by using his or her index or little finger to identify possible adhesions . The fascia at the entry site is lifted by 2 stitches placed at the lower and upper borders at the 6- and 12-o'clock positions (figure 1) to guide the rest of the process . While the 2 stitches elevate the entry site, the intra - abdominal viscera is observed for possible injuries and adhesions by use of the introduced telescope . The lower and upper borders of the fascia underlying the umbilical incision are sutured at the 6- and 12-o'clock positions . The veress needle is unloaded from its cannula, and one tip of a no . The loaded cannula is introduced into the elevated entry site under direct or telescopic vision . The tip of the cannula is inserted toward the abdominal wall, 1 to 2 cm below the entry, under direct eye vision, and the tip is slid just above the peritoneum . It is turned to the right 6 to 7 cm to avoid injury to the epigastric vessels, and the abdominal wall is pierced from the inside toward the outside at approximately 5 cm below the umbilical entry . During this procedure, the tip of the veress cannula should always be maintained in an upward direction to avoid an accidental bowel injury . The tip of the suture is unloaded from the cannula outside the abdominal wall, and the unloaded cannula is withdrawn back from the entry . The other tip of the suture is loaded into the cannula, and the same steps are repeated . However, this time, the tip of the cannula is taken outside the abdominal cavity, 5 cm below the first tip then, an assistant elevates the abdominal wall, and the surgeon ties the sutures over the prepared sterile retractor located between the pubis and umbilicus (figure 3). The entry - site sutures are stretched during introduction of the telescope into the abdominal cavity to prevent staining of the optic of the telescope . The laparoscopic hand instruments are used through the same single incision (figure 3). There is no need to use trocars (keyless) to prevent gas leakage, and any surgical instrument (a laparoscopic hand instrument or a conventional surgical hand instrument) that can pass through the incision can be used . If the intra - abdominal operative space is not adequate to perform the operation, additional lifting sutures can be placed at the sites at which further elevations are required . Lifting of a particular area (eg, protrusion of the peritoneal folds or adipose tissue into the operative field, particularly in overweight patients) can be managed by a suture just penetrating the skin and tied to the same retractor . If the operation is limited to the pelvis, the retractor used does not limit the surgeon's motions . However, if an additional operation is anticipated at the upper side of the abdominal cavity, the placement of the retractor should be changed . The fascial layer is closed with continuous unlocked sutures while the lifting sutures assist the elevation of the fascial layer . 3 - 0 or 4 - 0 intracutaneous absorbable sutures and hidden into the umbilical fold . One month after the operation, the umbilical incision and the scars of the veress cannula are nearly indemonstrable (figure 4). The umbilical incision and the scars of the veress cannula are nearly indemonstrable 1 month after surgery . Co2 laparoscopy is performed with the use of a 10-mm port (infraumbilical port for the telescope) and two 5-mm ports (lateral ports for the hand instruments) placed after the creation of co2 pneumoperitoneum using the veress needle . At the end of the surgical procedures, all fascial - layer incisions of the 10-mm ports are sutured before the placement of skin sutures; however, only the skin incisions of 5-mm ports are closed with no . 3 - 0 or 4 statistical analysis was performed with spss software, version 16.0 (spss, chicago, illinois). The distribution of variables was studied by use of kurtosis, skewness, and shapiro - wilk tests . Normally distributed variables of the 2 groups were compared by use of the student t test, and non normally distributed variables were compared by use of the mann - whitney u test . The test was used to assess the probability of existence of shoulder pain in the 2 groups . A logistic regression model was created to study the confounding factors that influenced the perception of shoulder pain . The hosmer - lemeshow test showed that the model fit (= 13 762, p = .88, n = 77). Kars has common features of conventional laparoscopy and laparotomy . During the creation of the abdominal access pathway, the umbilical fold is lifted with 2 clamps bilaterally and a third clamp at the center of the umbilicus . Depending on the need for multiple instrument use or the depth and thickness of the subcutaneous tissue, the length of the incision may be adjusted smaller or larger . After the skin incision, the subcutaneous tissue is dissected bluntly with the tip of a fine instrument until the underlying fascia is reached . The opening is bluntly widened with the moderate stretching force of 2 fine retractors . At this stage, the surgeon can examine the intra - abdominal viscera by using his or her index or little finger to identify possible adhesions . The fascia at the entry site is lifted by 2 stitches placed at the lower and upper borders at the 6- and 12-o'clock positions (figure 1) to guide the rest of the process . While the 2 stitches elevate the entry site, the intra - abdominal viscera is observed for possible injuries and adhesions by use of the introduced telescope . The lower and upper borders of the fascia underlying the umbilical incision are sutured at the 6- and 12-o'clock positions . The veress needle is unloaded from its cannula, and one tip of a no . The loaded cannula is introduced into the elevated entry site under direct or telescopic vision . The tip of the cannula is inserted toward the abdominal wall, 1 to 2 cm below the entry, under direct eye vision, and the tip is slid just above the peritoneum . It is turned to the right 6 to 7 cm to avoid injury to the epigastric vessels, and the abdominal wall is pierced from the inside toward the outside at approximately 5 cm below the umbilical entry . During this procedure, the tip of the veress cannula should always be maintained in an upward direction to avoid an accidental bowel injury . The tip of the suture is unloaded from the cannula outside the abdominal wall, and the unloaded cannula is withdrawn back from the entry . The other tip of the suture is loaded into the cannula, and the same steps are repeated . However, this time, the tip of the cannula is taken outside the abdominal cavity, 5 cm below the first tip . Then, an assistant elevates the abdominal wall, and the surgeon ties the sutures over the prepared sterile retractor located between the pubis and umbilicus (figure 3). The entry - site sutures are stretched during introduction of the telescope into the abdominal cavity to prevent staining of the optic of the telescope . The laparoscopic hand instruments are used through the same single incision (figure 3). There is no need to use trocars (keyless) to prevent gas leakage, and any surgical instrument (a laparoscopic hand instrument or a conventional surgical hand instrument) that can pass through the incision can be used . If the intra - abdominal operative space is not adequate to perform the operation, additional lifting sutures can be placed at the sites at which further elevations are required . Lifting of a particular area (eg, protrusion of the peritoneal folds or adipose tissue into the operative field, particularly in overweight patients) can be managed by a suture just penetrating the skin and tied to the same retractor . If the operation is limited to the pelvis, the retractor used does not limit the surgeon's motions . However, if an additional operation is anticipated at the upper side of the abdominal cavity, the placement of the retractor should be changed . The fascial layer is closed with continuous unlocked sutures while the lifting sutures assist the elevation of the fascial layer . 3 - 0 or 4 - 0 intracutaneous absorbable sutures and hidden into the umbilical fold . One month after the operation, the umbilical incision and the scars of the veress cannula are nearly indemonstrable (figure 4). The umbilical incision and the scars of the veress cannula are nearly indemonstrable 1 month after surgery . Kars has common features of conventional laparoscopy and laparotomy . During the creation of the abdominal access pathway, the umbilical fold is lifted with 2 clamps bilaterally and a third clamp at the center of the umbilicus . Depending on the need for multiple instrument use or the depth and thickness of the subcutaneous tissue, the length of the incision may be adjusted smaller or larger . After the skin incision, the subcutaneous tissue is dissected bluntly with the tip of a fine instrument until the underlying fascia is reached . The opening is bluntly widened with the moderate stretching force of 2 fine retractors . At this stage, the surgeon can examine the intra - abdominal viscera by using his or her index or little finger to identify possible adhesions . The fascia at the entry site is lifted by 2 stitches placed at the lower and upper borders at the 6- and 12-o'clock positions (figure 1) to guide the rest of the process . While the 2 stitches elevate the entry site, the intra - abdominal viscera is observed for possible injuries and adhesions by use of the introduced telescope . The lower and upper borders of the fascia underlying the umbilical incision are sutured at the 6- and 12-o'clock positions . The veress needle is unloaded from its cannula, and one tip of a no . The loaded cannula is introduced into the elevated entry site under direct or telescopic vision . The tip of the cannula is inserted toward the abdominal wall, 1 to 2 cm below the entry, under direct eye vision, and the tip is slid just above the peritoneum . It is turned to the right 6 to 7 cm to avoid injury to the epigastric vessels, and the abdominal wall is pierced from the inside toward the outside at approximately 5 cm below the umbilical entry . During this procedure, the tip of the veress cannula should always be maintained in an upward direction to avoid an accidental bowel injury . The tip of the suture is unloaded from the cannula outside the abdominal wall, and the unloaded cannula is withdrawn back from the entry . The other tip of the suture is loaded into the cannula, and the same steps are repeated . However, this time, the tip of the cannula is taken outside the abdominal cavity, 5 cm below the first tip . Then, an assistant elevates the abdominal wall, and the surgeon ties the sutures over the prepared sterile retractor located between the pubis and umbilicus (figure 3). The entry - site sutures are stretched during introduction of the telescope into the abdominal cavity to prevent staining of the optic of the telescope . The laparoscopic hand instruments are used through the same single incision (figure 3). There is no need to use trocars (keyless) to prevent gas leakage, and any surgical instrument (a laparoscopic hand instrument or a conventional surgical hand instrument) that can pass through the incision can be used . If the intra - abdominal operative space is not adequate to perform the operation, additional lifting sutures can be placed at the sites at which further elevations are required . Lifting of a particular area (eg, protrusion of the peritoneal folds or adipose tissue into the operative field, particularly in overweight patients) can be managed by a suture just penetrating the skin and tied to the same retractor . If the operation is limited to the pelvis, the retractor used does not limit the surgeon's motions . However, if an additional operation is anticipated at the upper side of the abdominal cavity, the placement of the retractor should be changed . The fascial layer is closed with continuous unlocked sutures while the lifting sutures assist the elevation of the fascial layer . 3 - 0 or 4 - 0 intracutaneous absorbable sutures and hidden into the umbilical fold . One month after the operation, the umbilical incision and the scars of the veress cannula are nearly indemonstrable (figure 4). The umbilical incision and the scars of the veress cannula are nearly indemonstrable 1 month after surgery . Co2 laparoscopy is performed with the use of a 10-mm port (infraumbilical port for the telescope) and two 5-mm ports (lateral ports for the hand instruments) placed after the creation of co2 pneumoperitoneum using the veress needle . At the end of the surgical procedures, all fascial - layer incisions of the 10-mm ports are sutured before the placement of skin sutures; however, only the skin incisions of 5-mm ports are closed with no . 3 - 0 or 4 - 0 intracutaneous absorbable sutures . Statistical analysis was performed with spss software, version 16.0 (spss, chicago, illinois). The distribution of variables was studied by use of kurtosis, skewness, and shapiro - wilk tests . Normally distributed variables of the 2 groups were compared by use of the student t test, and non normally distributed variables were compared by use of the mann - whitney u test . The test was used to assess the probability of existence of shoulder pain in the 2 groups . A logistic regression model was created to study the confounding factors that influenced the perception of shoulder pain . The hosmer - lemeshow test showed that the model fit (= 13 762, p = .88, n = 77). During a 20-month period, 77 women with benign ovarian cysts were operated on by kars (n = 32) or conventional co2 laparoscopy (n = 45). The demographic data, physical characteristics, and preoperative findings of the participating women were summarized in table 1 . The demographic findings, surgical histories, and preoperative hematologic statuses of the groups did not differ significantly (p>.05). Demographic data, physical characteristics, and preoperative findings of participating women in both groups data are presented as mean standard deviation unless otherwise indicated . Conventional multiport laparoscopy performed after creation of pneumoperitoneum . Student t test (used for normal distribution). Mann - whitney test (used for non - normal distribution). Minor bleeding and unintended cyst ruptures were the only observed intraoperative complications . In none of the cases was a blood transfusion or postoperative intensive care admission needed . We did not need to convert to conventional laparoscopy or laparotomy in the kars group or to laparotomy or mini - laparotomy in the conventional laparoscopy group . Simple oral analgesic use after the 24th hour of the postoperative period was adequate for postoperative pain relief in both groups . Most of the intraoperative and postoperative findings were similar in the 2 groups (p>.05); however, the abdominal cavity access and total operative times in the kars group were significantly longer than those in the conventional laparoscopy group (p <.05). Intraoperative and postoperative findings according to operative technique data are presented as mean standard deviation unless otherwise indicated . The vas pain scores at the beginning and second, fourth, and 24th hours of the postoperative period were significantly lower in the kars group (p <.05), although the differences in mean vas scores never exceeded 1 point . In addition, the women in the kars group needed less additional analgesia in comparison with those in the conventional laparoscopy group (p <.05). Moreover, a higher number and percentage of the patients in the conventional co2 laparoscopy group had shoulder pain (p <.05). Postoperative pain scores and additional analgesic requirements according to operative techniques data are presented as mean standard deviation unless otherwise indicated . Conventional multiport laparoscopy performed after creation of pneumoperitoneum . Student t test (used for normal distribution). Mann - whitney test (used for non - normal distribution). The test analyzing shoulder pain showed that postoperative shoulder pain was significantly less frequent in the kars group (= 5.304, p = .021, n = 77). Logistic regression for postoperative shoulder pain predicted that shoulder pain was affected only by the operation type and duration (table 4). Although the operation duration was longer in the kars group, the frequency of shoulder pain was higher in the conventional laparoscopy group . The total operative time correlated positively with the abdominal access and rope - lifting process time, weight and body mass index of the women, adhesion score, cyst diameter, cyst rupture rate, length of hospital stay, and shoulder pain frequency (p <.05). In the conventional laparoscopy group, the total operative time correlated positively with the abdominal access time, weight and body mass index of the women, adhesion score, cyst diameter, cyst rupture rate, length of hospital stay, and shoulder pain frequency (p <.05). In comparison with conventional co2 laparoscopy, kars performed to treat benign ovarian cysts causes less postoperative abdominal and shoulder pain ., our study is the first comparing the postoperative pain scores and additional analgesic requirements of a gasless single - incision laparoscopic technique with conventional multiport co2 laparoscopy . Postoperative pain scores during single - incision and conventional multiport co2 laparoscopic surgical procedures were compared previously; however, the abdominal viscera was inflated by using co2 in all these studies . In our study all the operations for ovarian cysts were performed by the same surgical team under the same operating theater conditions . Although the study included a control group, the participants determined which operative technique they would undergo; thus the study lacks the power of randomization . The vas pain scores measured pain severity at the beginning and second, fourth, and 24th hours of the postoperative period; however, the pain scores between the fourth and 24th hours were missing . Postoperative shoulder pain was evaluated by its presence or absence; however, its severity was not evaluated . Pain sensation is subjective and may even differ for the same individual under different conditions . It develops motivations to avoid damaging conditions, to be cautious about the damaged tissue, and to prevent future conditions related to pain . From this point of view, we did not gather information about the past pain experiences of the patients . Although the frequencies of previous operations were similar in both groups, we cannot truly argue that the pain sensation, perception, and definition of the participants were similar . Gynecologic operations including myomectomy, hysterectomy, ovarian cyst resection, colposuspension, and radical hysterectomy were performed by various surgeons . However, most of the published articles dealt with the feasibility, complications, operative times, and cosmesis of the procedures . In addition, although the previous surgical techniques consisted of gasless laparoscopic procedures, they had multiple abdominal entry sites . Gargiulo and nezhat published an article describing the details of 3 new minimally invasive surgical approaches, including single - incision laparoscopic surgery . Single - incision laparoscopic surgery seemed to yield more intraoperative complications because of the poor visualization and difficulty in maintaining pneumoperitoneum . Gargiulo and nezhat concluded that the improved postoperative pain with single - incision laparoscopic surgical procedures was not proven in comparison with the conventional multiport co2 laparoscopies . Similarly, murji et al conducted a meta - analysis of randomized controlled trials and high - quality observational studies with> 2000 patients and failed to ascertain the impact of single - incision laparoscopy surgery on postoperative pain because of the paucity of data and lack of uniform collection . However, both articles reviewed the results of studies including surgical procedures performed under elevated intra - abdominal pressure created by the insufflation of co2 . In our study in addition, postoperative shoulder pain experienced more frequently after co2 laparoscopies may increase the severity of perceived pain . Thus the gasless (isobaric) nature of our technique may be an explanation for the contradiction with the findings of the previous publications . Recently, gerbershagen et al studied postoperative pain scores on the first postoperative day in 70 764 german patients . Surprisingly, they found that patients had reported high pain scores after many minor surgical procedures, and contrary to this finding, many major abdominal surgical procedures had caused comparatively less pain because of sufficient epidural analgesia . In our study we used a standardized pain management protocol in both groups; thus our results suggest that the single - incision gasless laparoscopic technique yielded better pain scores than conventional co2 laparoscopy . In addition, at the 24th hour of the postoperative period, 59.3% of the women in the kars group and 35.5% of the women in the conventional multiport co2 laparoscopy group had vas pain scores of 0 points . Moreover, none of the scores in either group were> 4 points . Previous studies comparing the postoperative pain scores after single - incision and conventional laparoscopies mostly included cholecystectomies and showed similar pain scores for the same surgical procedures . In the prospective, randomized, multicenter trial conducted by marks et al, the postoperative pain scores did not differ between single - incision and multiport laparoscopies . However, a substantial increase in the incidence of hernia with cholecystectomies performed by single - incision laparoscopic surgery was found . In their study the closure techniques for the access sites were not briefly defined, and one of the centers unavoidably lost more than one third of its patients to follow - up . In addition, there were contradictory findings in other publications dealing with postoperative hernia formation after single - incision laparoscopies . Moreover, all of the included operations had been performed after the creation of pneumoperitoneum by using co2 . Better pain scores after kars may be the result of the avoidance of co2 pneumoperitoneum . Although single - incision laparoscopic surgery was found to be feasible, safe, and reproducible in gynecology patients with benign and cancerous diseases, only a few articles suggested better postoperative pain scores, and some of them were case reports or pilot studies . In 2011 fagotti et al published their randomized controlled trial comparing postoperative pain after conventional laparoscopy and laparoendoscopic single - site surgery (less) for benign adnexal disease . They concluded that less was more advantageous than conventional multiport laparoscopy in terms of postoperative pain and the need for rescue analgesia . Although we had similar postoperative findings in terms of pain, the need for rescue analgesics, and length of hospital stay, we also had different findings . The women included in the previous study had a higher median age (49 years in the less group and 42 years in the conventional laparoscopy group) than the women in our study (33.5 years in the kars group and 38 years in the conventional laparoscopy group). The median body mass index, major cyst diameter, and previous abdominal operation rate and the mean operative time in both groups in our study were higher than the values in both groups in the previous study . Whereas fagotti et al showed a lower bleeding rate in the less group, we observed similar bleeding rates in the kars and conventional multiport laparoscopy groups . In comparison with conventional multiport laparoscopy, fagotti et al showed significantly lower pain scores in the less group at the second and fourth postoperative hours; however, we showed lower pain scores in the kars group initially postoperatively and at the second, fourth, and 24th hours of the postoperative period . In addition, we showed significantly less postoperative shoulder pain in the kars group, which may result from the gasless nature of kars . In 2011 prasad et al published their study comparing the postoperative pain scores after single - incision and conventional laparoscopic cholecystectomies . They observed similar pain scores in both groups and noticed that pain scores decreased after the operative times decreased in the single - incision group . Although the decreased pain scores were also lower than the pain scores in the conventional laparoscopy group, the difference was not significant . In our study, although the kars group had significantly longer operative times (by a mean of 16 minutes), the postoperative pain scores and additional analgesic requirements were significantly lower . Our results suggest that kars yields better pain scores than conventional multiport co2 laparoscopy and that fewer additional analgesics are required after kars . However, one should note that our study included the results of surgical procedures performed for ovarian cysts . To increase the level of evidence, randomized prospective studies including various operations are needed . In addition, the gasless single - incision technique should be compared with single - incision laparoscopic surgical procedures using co2 to create pneumoperitoneum . In comparison with conventional co2 laparoscopy, kars performed to treat benign ovarian cysts causes less postoperative abdominal and shoulder pain . To our knowledge, our study is the first comparing the postoperative pain scores and additional analgesic requirements of a gasless single - incision laparoscopic technique with conventional multiport co2 laparoscopy . Postoperative pain scores during single - incision and conventional multiport co2 laparoscopic surgical procedures were compared previously; however, the abdominal viscera was inflated by using co2 in all these studies . In our study all the operations for ovarian cysts were performed by the same surgical team under the same operating theater conditions . Although the study included a control group, the participants determined which operative technique they would undergo; thus the study lacks the power of randomization . The vas pain scores measured pain severity at the beginning and second, fourth, and 24th hours of the postoperative period; however, the pain scores between the fourth and 24th hours were missing . Postoperative shoulder pain was evaluated by its presence or absence; however, its severity was not evaluated . Pain sensation is subjective and may even differ for the same individual under different conditions . It develops motivations to avoid damaging conditions, to be cautious about the damaged tissue, and to prevent future conditions related to pain . From this point of view, we did not gather information about the past pain experiences of the patients . Although the frequencies of previous operations were similar in both groups, we cannot truly argue that the pain sensation, perception, and definition of the participants were similar . Gynecologic operations including myomectomy, hysterectomy, ovarian cyst resection, colposuspension, and radical hysterectomy were performed by various surgeons . However, most of the published articles dealt with the feasibility, complications, operative times, and cosmesis of the procedures . In addition, although the previous surgical techniques consisted of gasless laparoscopic procedures, they had multiple abdominal entry sites . Gargiulo and nezhat published an article describing the details of 3 new minimally invasive surgical approaches, including single - incision laparoscopic surgery . Single - incision laparoscopic surgery seemed to yield more intraoperative complications because of the poor visualization and difficulty in maintaining pneumoperitoneum . Gargiulo and nezhat concluded that the improved postoperative pain with single - incision laparoscopic surgical procedures was not proven in comparison with the conventional multiport co2 laparoscopies . Similarly, murji et al conducted a meta - analysis of randomized controlled trials and high - quality observational studies with> 2000 patients and failed to ascertain the impact of single - incision laparoscopy surgery on postoperative pain because of the paucity of data and lack of uniform collection . However, both articles reviewed the results of studies including surgical procedures performed under elevated intra - abdominal pressure created by the insufflation of co2 . In our study in addition, postoperative shoulder pain experienced more frequently after co2 laparoscopies may increase the severity of perceived pain . Thus the gasless (isobaric) nature of our technique may be an explanation for the contradiction with the findings of the previous publications . Recently, gerbershagen et al studied postoperative pain scores on the first postoperative day in 70 764 german patients . Surprisingly, they found that patients had reported high pain scores after many minor surgical procedures, and contrary to this finding, many major abdominal surgical procedures had caused comparatively less pain because of sufficient epidural analgesia . In our study we used a standardized pain management protocol in both groups; thus our results suggest that the single - incision gasless laparoscopic technique yielded better pain scores than conventional co2 laparoscopy . In addition, at the 24th hour of the postoperative period, 59.3% of the women in the kars group and 35.5% of the women in the conventional multiport co2 laparoscopy group had vas pain scores of 0 points . Moreover, none of the scores in either group were> 4 points . Previous studies comparing the postoperative pain scores after single - incision and conventional laparoscopies mostly included cholecystectomies and showed similar pain scores for the same surgical procedures . In the prospective, randomized, multicenter trial conducted by marks et al, the postoperative pain scores did not differ between single - incision and multiport laparoscopies . However, a substantial increase in the incidence of hernia with cholecystectomies performed by single - incision laparoscopic surgery was found . In their study the closure techniques for the access sites were not briefly defined, and one of the centers unavoidably lost more than one third of its patients to follow - up . In addition, there were contradictory findings in other publications dealing with postoperative hernia formation after single - incision laparoscopies . Moreover, all of the included operations had been performed after the creation of pneumoperitoneum by using co2 . Better pain scores after kars may be the result of the avoidance of co2 pneumoperitoneum . Although single - incision laparoscopic surgery was found to be feasible, safe, and reproducible in gynecology patients with benign and cancerous diseases, only a few articles suggested better postoperative pain scores, and some of them were case reports or pilot studies . In 2011 fagotti et al published their randomized controlled trial comparing postoperative pain after conventional laparoscopy and laparoendoscopic single - site surgery (less) for benign adnexal disease . They concluded that less was more advantageous than conventional multiport laparoscopy in terms of postoperative pain and the need for rescue analgesia . Although we had similar postoperative findings in terms of pain, the need for rescue analgesics, and length of hospital stay, we also had different findings . The women included in the previous study had a higher median age (49 years in the less group and 42 years in the conventional laparoscopy group) than the women in our study (33.5 years in the kars group and 38 years in the conventional laparoscopy group). The median body mass index, major cyst diameter, and previous abdominal operation rate and the mean operative time in both groups in our study were higher than the values in both groups in the previous study . Whereas fagotti et al showed a lower bleeding rate in the less group, we observed similar bleeding rates in the kars and conventional multiport laparoscopy groups . In comparison with conventional multiport laparoscopy, fagotti et al showed significantly lower pain scores in the less group at the second and fourth postoperative hours; however, we showed lower pain scores in the kars group initially postoperatively and at the second, fourth, and 24th hours of the postoperative period . In addition, we showed significantly less postoperative shoulder pain in the kars group, which may result from the gasless nature of kars . In 2011 prasad et al published their study comparing the postoperative pain scores after single - incision and conventional laparoscopic cholecystectomies . They observed similar pain scores in both groups and noticed that pain scores decreased after the operative times decreased in the single - incision group . Although the decreased pain scores were also lower than the pain scores in the conventional laparoscopy group, the difference was not significant . In our study, although the kars group had significantly longer operative times (by a mean of 16 minutes), the postoperative pain scores and additional analgesic requirements were significantly lower . Our results suggest that kars yields better pain scores than conventional multiport co2 laparoscopy and that fewer additional analgesics are required after kars . However, one should note that our study included the results of surgical procedures performed for ovarian cysts . To increase the level of evidence, randomized prospective studies including various operations are needed . In addition, the gasless single - incision technique should be compared with single - incision laparoscopic surgical procedures using co2 to create pneumoperitoneum . Kars seems to cause less postoperative pain during the management of benign ovarian cysts in comparison with conventional multiport co2 laparoscopy.
|
Pancreatitis, the commonest adverse event following endoscopic retrograde cholangiopancreatography (ercp), has been found to occur at widely varying rates, in 1% to 15.1% of pateints.14 post - ercp pancreatitis (pep) has been found at lower rates in recent studies because noninvasive methods, such as magnetic resonance cholangiopancreatography (mrcp) and endoscopic ultrasonography (eus), have superseded diagnostic ercp.5 despite improvement of our knowledge, equipment, and methods for ercp, complications are still a significant hazard with this procedure . Pep is the most common severe complication.1,6,7 numerous studies have looked at risk factors for pep,14,616 with varied results, possibly because of different study designs, different candidate predictor variables, and differences between settings . Precise identification of risk factors is of great importance for recognition of high - risk cases in which ercp should be avoided if possible or protective modalities should be considered to minimize patients risk of morbidity and mortality . We know that inflammatory biomarkers are useful at 2448 hours post procedure in predicting pep, and a few studies have evaluated pre - procedure inflammatory markers, especially c - reactive protein (crp) elevation, as predictors of pep.1723 none of the previous studies has focused on pre - ercp erythrocyte sedimentation rate (esr) as a potential risk factor for pep . Despite the importance of identifying risk factors for pep, the present study examined prospectively the potential patient- and procedure - related risk factors, including esr, for pep in iranian population . During a four - year period (20082012), 780 patients who underwent ercp in a tertiary care hospital were analyzed in this prospective study . The patients were referred to this center from different parts of iran, which enhances the ability to generalize the findings for the iranian population . All patients gave their written informed consent to participate in this research before the ercp procedure, and the study protocol was approved by the ethics committee of the research center for gastroenterology and liver diseases, shahid beheshti university of medical sciences . Indications for ercp were determined by participating endoscopists before the procedure, on the basis of generally accepted diagnostic indications for ercp.5 laboratory evaluations, including those of alkaline phosphatase (alp), alanine transaminase (alt), aspartate aminotransferase (ast), bilirubin, and serum amylase, were performed on the first day of hospitalization, and the results were used as pre - ercp laboratory parameters . Patients in acceptable condition were discharged one to two days after ercp; otherwise, they received longer inpatient care based on the severity of their complications and illness . All the patients had a follow - up visit two weeks after discharge from hospital . Patient- and procedure - related data, including demographics, characteristics, clinical information and technical details, and findings from ercp procedures were recorded prospectively on a detailed data sheet . Exclusion criteria were a history of biliary sphincterotomy or pre - cut sphincterotomy, pre - procedure active pancreatitis, pregnancy, mental disability, and refusal to participate . Ercp procedures were performed by a total of eight expert endoscopists, almost always with a trainee performing at least part of the procedure . During the procedures, patients were under conscious sedation using a combination of intravenous lidocaine, midazolam, and propofol . Successful cannulation was defined as free and deep instrumentation of the biliary tree, and a cannulation attempt was defined as sustained contact with the cannulating device and the papilla for at least five seconds.17 difficult biliary cannulation was defined as the failure of biliary access despite 10 minutes of attempted biliary cannulation or more than five attempted unintentional pancreatic cannulations.18 any complications taking place during or following the procedure were also entered into the records . Pep was diagnosed according to the generally accepted criteria defined by cotton et al,6 ie, presence of upper abdominal pain 24 hours after an ercp procedure and a serum amylase level more than three times the upper limit of normal . Results were expressed as the mean standard deviation (sd) for quantitative variables and percentages for categorical variables . Multiple linear regression analysis was used to develop an optimal model for predicting pep with the presence of confounders . The performance of the model was assessed with the hosmer lemeshow goodness - of - fit test . All the statistical analyses were performed using spss version 16.0 (spss inc .) For windows . Between 2008 and 2012, 780 patients (male: female ratio 393:387, mean age 57.5 years) underwent diagnostic and therapeutic ercp with the primary diagnosis of hepatobiliary disorders . Of these 780 ercps, 105 procedures (13.5%) were carried out in patients with invasive cancers (pancreatic ductal adenocarcinoma, biliary carcinoma, metastastic tumor with biliary obstruction, hepatocellular carcinoma, ampullary carcinoma) because of obstruction and 675 (86.5%) were performed in patients with benign diseases, which included 313 procedures (40.1%) to remove bile duct stones and 362 (46.4%) for benign biliary stricture . The patients included 393 men (50.4%), and 448 (57.5%) were more than 65 years old . Previous cholecystectomy had been performed in 36.3% of patients and 9.0% had undergone previous ercp . A total of 80 patients had history of biliary stone diagnosed by a similar procedure . Also, history of confirmed pancreatitis and hepatitis was observed in 27 (3.5%) and 10 (1.3%) patients, respectively (table 1). Regarding laboratory parameters (table 2), serum amylase was found to be elevated to more than 200 units / l in 102 patients (13.7%) three hours after ercp and more than 800 units / l in 60 patients (7.7%). In all, 446 (70%) participants underwent wire - guided cannulation and others (30%) underwent sphincterotome biliary cannulation using contrast injection as the conventional method . Successful biliary cannulation was technically achieved in 82.5% of all patients at ercp, although in 13.0% of them, cannulation failed . Regarding pathologic changes in papilla, tumoral features and ulcerative changes were found in 3.3% and 0.6% of patients . Of the 780 patients who underwent diagnostic or therapeutic ercp, pancreatitis developed in 26 patients (3.3%). Significant bleeding occurred in two patients; the only predictor in multivariable analysis was biliary sphincterotomy . We diagnosed cholangitis (using the criteria of transient worsening of clinical states and liver function tests consistent with cholangitis) in four subjects, all of whom had common bile duct (cbd) stones with biliary stent placement . Table 3 shows the frequency of pep and raised esr according to indication for ercp . In the multivariable risk model for predicting pep (table 4), significant risk factors with adjusted odds ratios (ors) were age <65 years (or = 10.647, p = 0.023) and esr> 30 (or = 6.414, p <0.001). Female gender, history of recurrent pancreatitis, pre - ercp hyperamylasemia, and difficult or failed cannulation could not predict pep . Regarding the cannulation techniques, there was no difference in the incidence of pep between guide wire - assisted ercp or conventional contrast - assisted cannulation . We have identified two risk factors for the development of pep: age <65 years and esr> 30 . Several studies have focused on younger age as an independent predictor of pep.14,617 so in younger individuals, it is important to perform ercp only when the indication is very strong and there is no other noninvasive substitute for ercp . Another risk factor for the development of pep in our study was increased esr level before ercp (esr> 30). We found that raised esr> 30 mm / hour is a significant factor that independently predicts increased risk of pep . Although some studies have evaluated the level of post - ercp inflammatory markers, especially post - procedure crp elevation, as predictors of development of pep,1923 it seems that none of the previous studies have focused on pre - ercp esr level as a potential risk factor for pep . However, the findings of previous studies suggest that inflammatory biomarkers are helpful at 2448 hours post - procedure, so they are not early predictors . Although it seems that our study is the first study to evaluate pre - ercp esr level as a risk factor for developing pep, many other studies have evaluated the role of pharmacologic agents in reducing the incidence or severity of pep.2,10,2227 several agents, most of which have an anti - inflammatory effect, have been tested in clinical trials . In terms of attenuating the inflammatory response, the most promising results have been with non - steroidal anti - inflammatory drugs (nsaids), and some standard guidelines recommend the routine use of nsaids to prevent pep.28 most of these studies are experimental clinical trials, but it is possible that the main beneficial effect of these drugs is limiting systemic inflammatory response and lowering the level of esr as a potential risk factor for pep . This study could be a guide for future clinical trials on rectal nsaids for the prevention of pep; the effect of these drugs in prevention of pancreatitis, with attention to the level of esr before ercp, should be evaluated . Other risk factors such as female gender, younger age, sphincter of oddi dysfunction, cannulation difficulty, prolonged procedure time, and repeated injection to the pancreatic duct were not assessed because ercp procedures were done by an expert and because of the absence of manometry . Also, other factors such as pre - ercp bacterial infections might increase esr level . Some studies on both human and animal models, performed to evaluate the potential role of antibiotics in preventing pep, found reduced rates of pep in patients receiving antibiotic prophylaxis prior to ercp when compared to placebo.26 however, most studies did not find any role for infections in pep, except in cases of severe pancreatitis with necrosis . The main limitation of this study was the absence of combined evaluation of crp and esr before ercp . Esr will be raised in almost all patients with any systemic inflammation, so our study is also limited because patients with systemic inflammation were not excluded . To date, many risk factors for pep have been reported from high - volume centers . These have included female gender, younger age, sphincter of oddi dysfunction, cannulation difficulty, prolonged procedure time, and repeated injection to the pancreatic duct . Not all of these factors were analyzed in our study, and our results were not fully consistent with the previous results . Performing ercp may be safer in the elderly and in patients with low levels of serum esr because they may be less at risk of pep . Using pre - ercp anti - inflammatory pharmacologic agents like nsaids might be beneficial, by lowering esr level and reducing related risk of pep.
|
Sole aim and the prerequisite for dentistry is an effective pain control during dental procedures . To achieve this goal local anesthesia is being used since long . In 1943, lofgren synthesized the first modern anaesthesia.1 it is lidocaine, which was an amide derivative of diethyl amino acetic acid . It is because of the high density and the firm adherence of palatal mucosa to the underlying bone . Twenty - five years after lidocaine, articaine was first synthesized by muschaneau in 1969 . It has a thiophene ring in its molecule instead of usual benzene ring.2,3 this is most commonly used in germany . Commercially articaine for dental use is available in 4% solution with epinephrine 1:200000 or 1:100000 . It also contains maximum 0.6 mg na - sulfite in 1.0 ml and sodium chloride . Once injected, absorption starts from the site of injection into the vascular compartment.1 the unbound local anesthetic is distributed throughout all the body tissue . Due to the presence of thiophene ring, it is inactivated in the liver as well as by hydrolyzation in the tissue and blood . The aim of the study was to evaluate and compare the efficacy of 4% articaine hydrochloride and 2% lignocaine hydrochloride for the orthodontic extraction . The study was carried out on 50 patients at outpatient department of oral and maxillofacial surgery who needed bilateral maxillary premolar extractions for orthodontic purpose . Patients included in this study were in the age group of 15 - 25 years, both genders and systemically healthy . Bleeding disorders, hypertensive, diabetic, pregnant, allergic to local anesthetics, reluctant and medically compromised patients were excluded from the study . All the patients were explained about visual analog scale (vas) before injecting local anesthesia . Experimental sites (group 1) were injected with 0.5 - 1 ml of 4% articaine hcl containing 1:100000 adrenaline, incrementally in the buccal vestibule . No palatal anesthesia was injected, but the desired anesthetic effect was achieved with the above . On the other hand, control sites (group 2) were injected with 0.8 - 1 ml of 2% lignocaine hcl containing 1:100000 adrenaline, incrementally in the buccal vestibule . When the objective symptoms were checked, it was found that palatal anesthesia was absent hence additional 0.5 ml was injected to obtain a desired result . After assessing the signs and symptoms of obtaining complete anesthesia all the parameters, i.e., drug volume, time of onset, duration of anesthesia and pain rating were recorded for entire patients . The mean administered volume of articaine and lignocaine were 0.779 0.1305 and 1.337 0.2369 respectively . It should be noted that the articaine volume administered was almost half of the lignocaine (table 1). The mean onset time of lignocaine anesthesia was 1.337 0.2369, whereas in articaine group the mean time was 1.012 0.2058 min . This indicates that onset time of articaine was significantly less than lidocaine (p <0.0005) (table 2). Pain rating showed that there was no significant difference in pain score in articaine palatal and buccal group (p> 0.8892), whereas a significant difference was noted in lignocaine palatal and buccal group (tables 3 and 4). Duration of pain in group 1 was 69.08 18.247 and 55.66 6.414 in group 2 patients . Duration of anesthesia is articaine group is more than the lignocaine group . In the entire study, it goes biotransformation in both liver and plasma and hence gets cleared much quickly . Recent studies have shown that articaine carries lot of advantages over other anesthetic agents.4 in this study, we observed that the palatal infiltration was required in approximately 98% of cases when lignocaine was used, whereas in articaine group palatal anesthesia was never required . Thiophene ring in its molecular structure, which makes it more lipophilic and this accounts for its diffusion properties across all the tissues.5 articaine is metabolized in the liver, tissues and blood and hence it is cleared out very fast from the body . This is the only anesthetic agent, which is inactivated from our body in two ways . Zlkowska et al . Has reported that like all other anesthetic agents articaine is safe in epileptic patients.6 this study showed no adverse effects and no complications . This study is in accordance with study by malamed et al . Suggesting 4% articaine with 1:100000 adrenaline is safe and have a low risk of toxicity.2 statistical analysis in this study showed no significant difference in extraction pain on vas for test and control sites . This inference relates to the study done by fan et al.7 oertel et al.8 uckan et al.9 and evans et al.10 when articaine is injected the local concentration of active drug is nearly twice of that obtained with lignocaine . Oertel et al . In his study showed this by determining the concentration of 4% articaine and 2% lidocaine in alveolar blood using high - performance liquid chromatography.11,12 thiophene derivative articaine blocks ionic channels at lower concentration than benzene derivative lidocaine.13 potocnik et al . In vitro study on rat surap nerve concluded that 2% and 4% of articaine is more effective than 2% and 4% of lidocaine in depressing compound action potential of the a fibres.14 - 16 this efficacy and safety factors are observed in this study too . It is a well - known fact that palatal anesthesia is a very painful experience even though surface anesthesia is used . Hence, if articaine is used, patients can be relieved from the painful palatal anesthesia without compromising with safety and efficacy . Certain added advantages like shorter time of onset, longer duration of action and greater diffusion property makes it an ideal anesthetic agent to be used in dentistry.
|
The ras association domain family (rassf) consists of 10 members: rassf1 - 10 . Importantly, all isoforms contain a ras association (ra) domain either in their c - terminal (rassf1 - 6) or n - terminal (rassf7 - 10) regions . To date, no known catalytic activity has been described for this family, and the general consensus supposes that rassf proteins function as scaffolds to localize signaling in the cell . Rassf1 isoform a (rassf1a) is the most characterized member of the rassf family . The rassf1 gene encodes multiple splice variants, including the two predominant isoforms, rassf1a and c. the rassf1a isoform is the longest variant of the rassf1 gene . Structurally, rassf1a is a product of exons 1, 2/, 3, 4, 5, and 6, while rassf1c consists of exons 2, 3, 4, 5, and 6 . Both isoforms contain a c - terminal ra domain; however, rassf1a has an additional c1 domain that is not present in rassf1c . This short arm of chromosome 3 is known to exhibit loss of heterozygosity in many tumor models and is thought to harbor tumor suppressor genes . As the literature has shown, rassf1a fits this description . The rassf1a promoter contains a cpg island that shows a high frequency of hypermethylation in tumors, thereby silencing rassf1a expression in many human cancers including lung, breast, ovarian, renal, and bladder [47]. Rassf1a expression is also lost in numerous cancer cell lines, while rassf1c expression is seemingly unaffected . Interestingly, recent work suggests that rassf1c may actually promote tumor progression [8, 9], further distinguishing these two splice variants . All rassf proteins have an ra domain, which is thought to necessitate their binding to activated, gtp - bound ras proteins . While rassf5 (nore1) is thought to bind ras directly, whether rassf1a is able to associate with ras is less clear . It has been shown that rassf1a binds k - ras in vitro, and an interaction between ectopically expressed rassf1a and activated k - ras has been observed in hek293 cells [11, 12]. However, other work has found that this interaction only occurs in the presence of nore1, arguing for an indirect association . Importantly, to our knowledge, there are no reports demonstrating the interaction of endogenous rassf1a and ras proteins . It has been implicated in the negative regulation of cell cycle progression, cell proliferation, and cell survival . Rassf1a has been shown to localize to microtubules of proliferating cells, increasing microtubule stability and inhibiting cell division [14, 15]. This may be mediated through direct binding or though interaction with microtubule - associated proteins such as c19orf5 . Rassf1a has also been shown to inhibit proliferation by inhibiting the accumulation of cyclin d1 and arresting cell division [17, 18]. Rassf1a also promotes apoptosis, which can reportedly occur through multiple mechanisms and is likely cell - type dependent . One mechanism that mediates the apoptotic function of rassf1a involves protein interaction with modulator of apoptosis-1 (moap-1 or map-1). Moap-1 is normally sequestered in an inactive form in healthy cells . Upon death receptor stimulation, rassf1a binds moap-1, causing its activation and subsequent association with bax, which leads to apoptosis . Previous work has also demonstrated enhancement of rassf1a / mst - mediated cell death by the scaffold cnk1 . Rassf1a can also elicit inhibitory effects on growth and survival through engagement of the hippo pathway . The hippo signaling pathway is a highly conserved kinase cascade that was originally discovered in drosophila and has been shown to be a critical regulator of cell proliferation, survival, and organ growth . Three members of this pathway, drassf, salvador and hippo, contain the sarah (salvador - rassf - hippo) domain, which is conserved in its mammalian counterparts rassf1 - 6, ww45, and mst1/2, respectively . While the drosophila ortholog drassf is known to antagonize hippo activation in the fly, it has been demonstrated that rassf1a promotes phosphorylation and activation of mst 1/2 by inhibiting the phosphatase pp2a in mammalian systems [29, 30]. The biological relevance of rassf1a - mediated activation of hippo signaling has also been investigated . Reported a rassf1a - mst2-yap - p73-puma signaling axis that promotes apoptosis in mammalian cells . Hippo signaling is also important for maintaining intestinal homeostasis and tissue regeneration in response to injury . Mouse models with conditional disruption of either mst1/2 or sav1 in the intestinal epithelium displayed hyperactivation of yes - associated protein (yap), increased intestinal stem cell (isc) proliferation, and increased polyp formation following dextran sodium sulfate (dss) treatment [32, 33]. Similarly, loss - of - function mutations of hippo components in the fly midgut caused increased isc proliferation . These findings suggest that perhaps hippo signaling serves a more global role in regulating organ integrity, structure, and response to injury, and that perturbation of this pathway can lead to aberrant growth and dysfunction . In 2005, two independent groups generated and published findings regarding the systemic deletion of the rassf1a gene variant in mice [35, 36]. Both described similar phenotypes involving the spontaneous generation of tumors, particularly in aged mice, thus further supporting the notion that rassf1a is a bona fide tumor suppressor [35, 36]. Not surprisingly, nearly all studies involving rassf1a to date are related to cancer biology with few reports related to the cardiovascular field . Rassf1a is ubiquitously expressed and has been detected in heart tissue [3, 37, 38]. Initial investigation into the role of rassf1 gene products in a cardiac context came from the neyses laboratory . Their findings demonstrated that both rassf1a and rassf1c could associate with the sarcolemmal calcium pump, pmca4b, in neonatal rat cardiac myocytes . This interaction was shown to mediate the inhibition of erk, and subsequent elk transcription and suggested the possibility that rassf1a could modulate cardiac myocyte growth . Five years later, the same group demonstrated that rassf1a does in fact negatively regulate cardiac hypertrophy in vivo using rassf1a mice . Although these mice have increased susceptibility to spontaneous tumorigenesis, no apparent cardiovascular phenotype was observed under basal conditions, that is, no differences in heart size, morphology, or function compared to wt . However, when rassf1a mice were challenged with pressure overload, they responded with an exaggerated hypertrophic response, evidenced by significantly greater increases in heart weight / body weight and hypertrophic gene expression (anp, bnp, -mhc). Cardiac myocytes of rassf1a mice were significantly larger, which explains the augmented heart growth . Chamber dilation of rassf1a mouse hearts was observed by echocardiography, consistent with eccentric hypertrophic remodeling . Hemodynamic analysis of wt and rassf1a mice showed a rightward shift in pv loops following pressure overload in rassf1a hearts, yet dp / dtmax, dp / dtmin, and fractional shortening were not altered in rassf1a mice compared to wt . To examine rassf1a function in cardiac myocytes, oceandy et al . Utilized a neonatal rat cardiac myocyte (nrcm) culture and the forced expression of rassf1a through adenoviral gene transfer . Increased rassf1a expression inhibited phenylephrine-(pe-) induced cardiac myocyte growth and suppressed raf-1 and erk1/2 activation by pe treatment . Conversely, both raf-1 and erk1/2 phosphorylation were increased in rassf1a hearts following pressure overload, suggesting negative regulation of mapk signaling by rassf1a . Deletion mutants of rassf1a revealed an important function of the n - terminus of rassf1a that disrupts the binding of active ras and raf-1, thus preventing erk activation and cardiac myocyte growth . To better understand the function of rassf1a in cardiac myocytes in vivo, we crossed genetically altered mice harboring a floxed rassf1a allele with mice harboring the cre recombinase transgene driven by the -mhc promoter . This strategy disrupted endogenous rassf1a gene expression and ensured cardiac myocyte specificity [38, 40]. Similar to the rassf1a mice, rassf1a - cre mice had no obvious baseline cardiac phenotype . Although we also found exaggerated heart growth in the rassf1a mice in response to pressure overload, the rassf1a - cre mice unexpectedly had attenuated hypertrophy, that is, smaller hearts and cardiac myocytes, compared to rassf1a and -mhc - cre controls . Furthermore, rassf1a - cre mice had significantly less fibrosis and myocyte apoptosis, and better cardiac function following pressure overload . This was in stark contrast to the rassf1a mice, which presented significantly more fibrosis and a decline in cardiac function comparable to the levels found in wt mice . As an alternative approach we also generated two different cardiac - specific transgenic mouse lines: the first expressing wild - type rassf1a and the second expressing a rassf1a sarah domain point mutant (l308p) that renders it unable to bind mst1 . Interestingly, we found that increased rassf1a expression in the heart caused increases in mst1 activation, cardiac myocyte apoptosis, and fibrosis, and led to worsened function following pressure overload . Conversely, rassf1a l308p tg mice had significant reductions in mst1 activation, apoptosis and fibrosis, while cardiac function was preserved after stress . These opposing phenotypes strongly implicate mst1 as a critical effector of rassf1a - mediated myocardial dysfunction . In cultured nrcms, increased rassf1a expression elicited activation of mst1 and caused mst1-mediated apoptosis . However, in primary rat cardiac fibroblasts, rassf1a had a more pronounced effect on inhibition of cell proliferation rather than survival . Additionally, rassf1a depletion led to an upregulation of nf-b - dependent tnf- expression and secretion in cardiac fibroblasts, while no change in il-1, il-6, or tgf-1 was observed . Through conditioned medium transfer experiments, we demonstrated that tnf- secretion from fibroblasts promotes cardiac myocyte growth . Furthermore, treatment of rassf1a mice with a neutralizing antibody against tnf- was able to rescue the augmented heart growth and fibrosis observed following pressure overload . These data strongly implicated tnf- as a critical paracrine factor influencing the cardiac myocyte growth response to stress in vivo . This work also demonstrated the cell - type specificity of rassf1a signaling in the heart and highlighted a novel signaling pathway downstream of rassf1a / mst1 that mediates a paracrine effect in vivo (see figure 1). This mechanism involving multiple cell types, and paracrine signaling among them is rather unique and contrasts with more established signaling paradigms of cardiac hypertrophy including calcineurin / nfat, hdac / mef2 and mek / erk pathways, which have been elucidated in the cardiac myocyte . Using genetically altered mouse models we showed that increased expression of mst1, and subsequent activation of the hippo pathway, caused increased apoptosis, dilated cardiomyopathy, and premature death . Interestingly, expression of mst1 also attenuated cardiac myocyte hypertrophy thereby impairing the heart's ability to appropriately respond to stress . In contrast, expression of a kinase - inactive mst1 mutant (dn - mst1) prevented cell death and protected the heart from insult . Lats1/2 kinases (mammalian homologs of warts) are targets of mst1/2 that can phosphorylate and inactivate yap, thereby inhibiting yap - mediated gene transcription . Similar to our findings related to mst1, we demonstrated that transgenic expression of lats2 in the heart led to inhibited growth and worsened function . Conversely, kinase - inactive lats2 (dn - lats2) transgenic mice had larger hearts both at baseline and following pressure overload and displayed attenuated cardiac myocyte apoptosis in response to stress . Taken together, these results provide further evidence that activation of hippo signaling, via increased mst1 or lats2 expression, inhibits cardiac myocyte growth and promotes apoptosis in the adult heart . Furthermore, selective inhibition of hippo signaling in the cardiac myocyte (dn - mst1 or dn - lats2 tg) confers protection against insult, similar to what we observed in the cardiac myocyte - specific rassf1a deleted mice . However, the hypertrophic response in these two models was opposite, which may result from a hippo - independent pathway(s) downstream of rassf1a . It should be pointed out that studies of adult mouse models using cardiac myocyte - restricted deletion of mst1/2, lats1/2 or yap have not been published . Findings from these models should be helpful in further elucidating the role of hippo signaling components in the adult murine heart . Recent work from the martin laboratory demonstrated the importance of mammalian hippo signaling during cardiac development and cardiac myocyte proliferation . Conditional deletion of salvador (sav1) in the embryonic heart, driven by nkx2.5-cre expression, caused increased myocyte proliferation and cardiac enlargement and was mediated by hyperactivation of yap and subsequent wnt/-catenin - regulated gene expression . In a similar vein, direct targeting of yap expression in the developing mouse heart further demonstrated its role in governing both myocyte proliferation and heart growth . Interestingly, both reports described an interaction between yap and wnt signaling, highlighting additional hippo signaling crosstalk in the heart . Fueled by the initial reports described herein, investigation into the role of rassf1a in cardiovascular biology has begun to accelerate . Yet many questions remain outstanding . Among them, what are the upstream inputs that regulate rassf1a function? What is the mechanism responsible for rassf1a cell - type - specific what are the molecular constituents of the rassf1a complex? Does rassf1a have additional mst1-independent functions in the heart, as has been demonstrated in tumor cell lines? Recent work identified activated k - ras as a promoter of rassf1a signaling in colorectal cancer cells . This finding begs the question of whether k - ras or additional ras isoforms regulate rassf1a in other systems and cell types . Based on our findings in rassf1a - deleted mice, we speculate that the difference in proliferative capacity between cardiac myocytes and fibroblasts may explain the distinct effects of rassf1a signaling in the heart . There may also be differences in the expression or localization of signaling components, thereby modulating their ability to effectively signal in certain cell types . Exposure to diverse signals and cues in the extracellular milieu may also contribute to varied outcomes downstream rassf1a . As we continue to elucidate the role of rassf1a and hippo signaling in the heart our work has shed light on the importance of cell type specificity rassf1a in determining pathological outcomes . We also defined a paracrine mechanism functioning downstream of rassf1a in response to cardiac stress . It is likely that additional complexities remain to be uncovered and will ultimately influence possible interventions to manipulate rassf1a and treat heart disease . Rassf1a signaling is diverse and our knowledge regarding rassf1a function is rapidly expanding . Given that a bridge from cancer to cardiovascular biology is in place, it is likely that as additional rassf1a mechanisms of action are discovered, its impact on cardiac biology will continue to grow.
|
It is one of the most commonly used medicines in the treatment of rheumatoid arthritis or psoriatic arthritis . We report the case of an adult woman with psoriatic arthritis who developed acute severe hepatitis following long - term treatment with mtx . The periodic biological monitoring of liver enzymes: alanine aminotransferase (alat), aspartate aminotransferase (asat), gamma - glutamyl transpeptidase (gamma - gt) performed every 6 months did not reveal any abnormalities . Mtx was stopped in the year 2005 due to remission of the disease . In 2009, it was reintroduced at a dose of 15 mg / week due to decompensation of the disease . Monitoring of liver enzymes performed every 6 months showed an elevation <2 times the normal levels on average of asat and alat since 2010 . Assessing the risk - benefit ratio and given the severe decompensation of the disease, mtx was continued . In may 2013, patient presented with jaundice following the development of asthenia and weight loss . Laboratory investigation showed the following results: prothrombin time (71%), asat 580 u / l, alat 620 u / l, serum gamma - gt 146 iu / l, serum alkaline phosphatase 170 iu / l and total serum bilirubin 12 mg / dl . Antimitochondrial antibodies (titer> 1/40) and antinuclear antibodies (titer of 1/640) were detected in serum . Routine laboratory investigations for infection with hepatitis a, b, and c viruses and serology for cytomegalovirus and epstein - barr virus were negative . Methotrexate was stopped, and therapy with oral methylprednisolone (80 mg / day) was initiated . A significant improvement in the following parameters was observed a week later: prothrombin time (88%), asat 270 u / l, alat 340 u / l, s. gamma - gt 122 iu / l, and s. alkaline phosphatase 173 iu / l . After 4 months, all laboratory parameters had normalized, and serum was negative for antimitochondrial and antinuclear antibodies . Patients taking mtx are more likely to discontinue therapy because of adverse drug effects rather than because of lack of efficacy . Adverse effects of mtx are, usually, mild and self - limiting, but may include serious adverse drug reactions such as hematopoietic suppression, pulmonary, and hepatotoxicity . Hepatic fibrosis is a usual adverse reaction reported with long - term use of mtx therapy in psoriatic patients . Causality assessment of the adverse drug event (ade) was carried out using who - umc criteria, naranjo's scale, and roussel uclaf causality assessment method (rucam) scale . In this case, patient improved on withdrawal of the drug, and there were no other confounding factors that could have caused this adverse effect . Hence, the ade was probably caused by mtx (who - umc criteria: probable; naranjo's score: 7, probable; and rucam scale: 5). In addition, sufficient and continuous exposure to the drug, lack of previous evidence of autoimmune disease and complete resolution of the condition within 4 months of discontinuation of the suspected drug confirmed the diagnostic criteria of drug - induced autoimmunity . The first case of autoimmune hepatitis associated with mtx was described in 2011 in a 57-year - old man after 11 years of treatment with mtx . A complete normalization of laboratory parameters was obtained 5 months after stopping this drug . To the best of our knowledge, it, usually, occurs at higher doses and also positively correlates with the cumulative dose of drugs . Other risk factors for the development of elevated liver enzymes and changes in liver biopsy include obesity, higher alcohol intake prior to commencement of mtx and persistent hepatitis b or c infection . In the present case, appearance of autoantibodies and transitory autoimmune disease associated with infliximab in a patient with psoriatic arthritis has also been documented and the preexistent serological signs of autoimmunity are believed to be a risk factor for the development of similar autoimmune reactions . This report confirms the need to monitor liver enzymes carefully in patients with psoriatic arthritis using long - term treatment with mtx . Clinicians must collaborate with the pharmacovigilance center to detect and notify serious adverse effects of mtx . Further research is needed to identify the exact mechanism and establish, if possible, primary means of prevention of this serious adverse effect.
|
Mirizzi syndrome is a rare complication of cholecystolithiasis characterized by jaundice due to compression of the common hepatic duct . The diagnosis may not be immediately apparent, and management is controversial with open surgery still recommended by some authors . A case is detailed herein of a 67-year - old man who presented with abdominal pain, fever, and jaundice . A dilated bile duct was found on ultrasound, but the gallbladder could not be seen . The diagnosis of mirizzi syndrome was made at ercp, and a stent was placed through the papilla . Laparoscopic retrograde (fundus first) cholecystectomy was carried out utilizing a laparoscopic liver retractor . In this particular case, it was not possible at ercp to get a guidewire and stent past the obstruction . A stent was left through the papilla, below the obstruction and this allowed primary duct closure during surgery . Acute mirizzi syndrome should be suspected when a patient presents with acute cholecystitis and jaundice with dilated intrahepatic ducts on ultrasound . Ercp is useful to confirm the diagnosis and allows stenting to alleviate the jaundice and facilitate the subsequent operation . Laparoscopic ultrasound is useful to locate the impacted stone and to partially replicate the touch of the surgeon's hand, which is not available in laparoscopic surgery . Mirizzi syndrome (ms) is biliary obstruction from compression of the common hepatic duct (chd) by a gallstone impacted in the cystic duct . Mcsherry classified the syndrome into 2 groups: type i where extrinsic compression of the bile duct occurs and type ii where erosion occurs of the wall of the chd by the stone with formation of a cholecysto - choledochal fistula . Csendes further subdivided type ii depending on the size of the fistula and the degree of destruction of the wall of the chd . The syndrome was initially described in 1948 by pablo luis mirizzi, professor of surgery in cordoba, argentina, and he erroneously postulated that the extrinsic pressure and inflammation induced spasm of the chd . Precise diagnosis may be difficult initially because the condition may be confused with choledocholithiasis and cholangitis . The classical ultrasound findings are of a contracted gallbladder, dilated intrahepatic ducts, and a normal common bile duct (cbd). Although a rare condition, many controversial aspects still surround the definition and management of ms . To illustrate the true ms and the value of a combination of endoscopic retrograde cholangiopancreatography (ercp) and laparoscopic surgery, a case a 67-year - old man was admitted to the emergency department with a 3-day history of gradually worsening upper abdominal pain associated initially with vomiting and anorexia . The patient had a history of hypertension and polymyalgia rheumatica . He was noted to be jaundiced with a temperature of 38 celsius and right upper quadrant tenderness and guarding . His liver function tests were markedly deranged with bilirubin 106 mol / l [range, 3 to 22], alkaline phosphatase 159 iu / l (range, 20 to 110), and alanine transaminase 770 iu / l (range, 5 to 65). This showed dilated intrahepatic ducts with the cbd reported as also being dilated and measuring 9 mm in diameter . Subsequent imaging showed that the ultrasound had actually detected a dilated chd as the cbd was not dilated . At ercp, contrast filled a nondilated cbd up to an obstruction due to a stone (figure 1). Attempts were made to pass a guidewire beyond the obstruction up into the chd and intrahepatic ducts but without success . The guidewire kept going into the gallbladder, and it became apparent that there was an ms with the obstructing stone in the cystic duct causing compression of the chd (figure 2). After the guidewire had been manipulated for a time, some pus came out of the papilla signifying a gallbladder empyema . A 10 french straight plastic stent was placed through the papilla without papillotomy with its proximal tip lying below the obstruction and, as expected, no bile or intrahepatic contrast drained . The stone is impacted in the cystic duct, which is anterior and parallel to the common hepatic duct . Note the narrow common bile duct and the dilatation of the common hepatic and intrahepatic ducts . A computed tomogram (ct) scan was done and showed a contracted gallbladder with a calcified stone causing biliary obstruction (figure 3). At laparoscopic cholecystectomy, an acutely inflamed a liver retractor was used to elevate the liver and maintain exposure of the bile duct (diamond - flex, cardinal health, snowden - dencer mis products, tucker, ga, usa) (figure 4). It was possible to feel the stone via a grasper, and its position was definitely confirmed by laparoscopic ultrasound (figure 5). The duct was incised to release the impacted stone with a single - use cbd blade (espiner medical ltd . The cbd was examined with a 5-mm flexible choledochoscope showing that the duct was clear distally with the stent in place (figure 7). It was not possible to retroflex the choledochoscope to examine the common hepatic or intrahepatic ducts . The gallbladder was excised, the opening in the cystic duct sutured with continuous 40 vicryl (ethicon inc ., somerville, nj, usa) and a 20 french nonsuction tube drain placed in the subhepatic space near the bile duct . The stent was removed at ercp 6 weeks later and a check cholangiogram showed a normal bile duct with no filling of any residual cystic duct and no stricture . During 18 months of follow - up, no delayed sequelae have occurred . Computed tomograpic scan showing a calcified stone causing bile duct obstruction with the proximal end of the stent just below the stone . Residual contrast from the ercp is present in the gallbladder (somatom volume zoom, 4 slice, siemens ag, erlangen, germany). The gallbladder (gb) has been dissected from the liver retrograde, and the liver retractor is in place . The arrow points to surgicel (ethicon, somerville, nj, usa) in the gallbladder bed of the liver . Laparoscopic ultrasound image showing the impacted stone (arrow) in a thickwalled duct (aloka inc . Choledochoscopy using a 5-mm scope showing a clear bile duct with the stent visible (insert). Ms is a rare cause of jaundice due to extrinsic compression of the chd and is present in approximately 0.35% of cholecystectomies . Many series report much higher rates; however, this may represent differing views on what constitutes a case of ms . Kwon and inui recently reported a prevalence of 1.2%, but only a third of their patients were jaundiced, and despite this the majority still underwent open surgery . Similarly, planned open operation for mirizzi syndrome is accepted and, in fact, is still advocated by many . Many surgeons do not view conversion as detrimental and therefore do not persist laparoscopically when cholecystectomy is difficult . Conversion or an open operation allows the use of proprioception or the touch of the surgeon's hand and is generally accepted as a way to improve the safety of any operation, especially one in which severe inflammation is present . To replicate this, however, open surgery is associated with significant short- and long - term morbidity, and a difficult operation is not necessarily easier or safer when performed open . A degree of tactility is possible via instruments although not by currently available robotic systems, and laparoscopic ultrasound is very useful in stone disease . It is generally accepted that an increased risk of bile duct injury exists during surgery for ms, and laparoscopic surgery may increase this risk . Operative cholangiography is advocated to improve the safety of cholecystectomy, but an accurate transcystic cholangiogram will not be possible in ms . A standard technique in open surgery for the difficult laparoscopic cholecystectomy was the fundus - first approach . This can be replicated in laparoscopic surgery by the use of a liver retractor and means that exposure does not rely on traction on the fundus of the gallbladder . In ms, the gallbladder is often fibrosed and contracted so that fundic traction gives relatively poor exposure of the hepatobiliary triangle . Also once the gallbladder is freed from the liver, the obliterated calot's triangle can be more easily evaluated . The magnified view combined with modern instrumentation ercp may provide definitive treatment for ms; however, the impacted stone can create real difficulties . More often, ercp is used to make the diagnosis and insert a stent to alleviate the jaundice and allow planning of an elective operation . If ercp is to be used as definitive treatment, sophisticated techniques may be needed for these cases, including the use of a mother and baby scope and electrohydraulic or laser lithotripsy . In the case described herein, i could have tried to break up the stone with an over the wire mechanical lithotripter, although engaging the stone in the basket may have been difficult . Alternatively, a mother and baby scope and contact lithotripsy (laser or electrohydraulic) could have been tried but would not have been possible in my opinion because the actual cbd was not dilated and may not have taken the 5-mm baby scope . Because i was planning to remove the gallbladder anyway, i preferred to leave the choledochal sphincter intact to avoid longer term risk of choledocholithiasis from a colonized biliary tract and papillary stenosis . In this case, i could not stent the obstruction from below but a percutaneous transhepatic approach could have been used . This would have been relatively straightforward as the hepatic ducts were dilated and might have been a useful strategy if this patient had been unfit for surgery . There is purportedly a 5 times higher rate of gallbladder malignancy in mirizzi sydrome compared with that in uncomplicated gallstone disease . Prasad et al found 5.3% of patients with ms had gallbladder cancer compared with 1% in non - ms cases, and most were diagnosed on histology after cholecystectomy . If the patient is fit for surgery, the optimal management of ms should include cholecystectomy . The technique described leaves the choledochal sphincter intact and does not require intraoperative antegrade stenting or use of t - tubes . In ms as described herein, it would not have been easy to insert these tubes properly as the opening is into the cystic duct rather than the bile duct proper . The preoperative endoscopically placed transpapillary stent temporarily overcame the outflow resistance of the sphincter and allowed safe primary duct closure although periductal drainage was needed . In ms, even if an operation is planned, preoperative ercp and stenting should be considered because this approach should simplify and improve the safety of the operation . In addition, the fitness of the patient for surgery and the complexity of the pathology are important for planning the therapeutic approach . In my opinion, ms should ideally be treated by a combination of ercp and stenting with laparosocopic stenting overcomes the resistance of the choledochal sphincter, and even if accurate closure of the opening in a friable and inflamed duct is not possible, it should avoid the development of a significant biliary fistula . Careful planning combined with modern equipment should allow most cases to be managed without t - tubes, destruction of the choledochal sphincter, or open surgery.
|
Dirofilaria immitis (the canine heartworm) is a filarial nematode naturally hosted by dogs, cats, foxes, muskrat, raccoons, and bears . Adult worms live in the right heart of these animals and produce a debilitating disease . This filarial nematode is transmited by mosquitoes . When an infected mosquito takes blood from a human, the larvae of d. immitis invade and develop for a time in cutaneous tissues, migrate to the right heart ventricle where they eventually die . The fragments of worms may reach the pulmonary arteries and lodge in a small caliber vessel to cause infarction or embolism events . Patients with pulmonary dirofilariasis are usually asymptomatic; however, occurrence of cough, chest pain, hemoptysis, and wheezing has been described in some patients . Eosinophilia, commonly relevant in parasite infections, are present only in 15% of patients with pulmonary dirofilariasis . Usually, a non - calcified, peripheral coin lesion or nodule is seen in chest x - ray or computed tomography (ct). Pathologically, spherical subpleural infarct with a central thrombosed artery containing the parasite in stage of degeneration is most commonly seen [4 - 6]. In the republic of korea (= korea), the first case of human pulmonary dirofilariasis was reported in 2000 . In this report a 48-year - old male was referred to seoul national university hospital after a routine check - up at a local hospital due to abnormal findings seen in chest ct . He was an ex - smoker (quit 10 years ago) and was a social drinker . He had a pet dog, but the dog died 3 years ago from unidentified parasite infection . Complete blood cell count showed a white blood cell count of 6.8610/l (normal: 4.0 - 10.010/l), a hemoglobin concentration of 14.5 g / dl (normal: 14 - 18 g / dl), and a platelet count 26710/l (normal: 130 - 45010/l). The differential count showed neutrophils at 36.1%, lymphocytes at 51.2%, and eosinophils at 1.5% . The c - reactive protein level was 0.02 mg / dl (normal: 0.5 mg / dl). Serum sodium, potassium, creatinine, magnesium, calcium, and liver function test were all within normal limits . The spirometry was normal; fvc 4.95l (105% of predicted), fev1 3.77l (107% of predicted), and fev1/fvc (76%). The chest ct showed a 1.21.0 cm sized subpleural solitary pulmonary nodule at the right lower lobe . Although it looked as a benign inflammatory nodule such as cryptococcal infection, malignancy could not be excluded (fig . On positron emission tomography (pet) image, the small subpleural nodule at the right lower lobe showed minimal increased fludeoxyglucose (fdg) uptake (standardized uptake value [suv] 1.25) (fig . At first we considered a percutaneous needle biopsy for diagnosis, but biopsy was considered not technically feasible due to the location of the nodule . Macroscopic examination of the resected mass revealed a gray, firm, and well - demarcated tumor, measuring 1.21.00.7 cm, with slight pleural indentation and central necrosis, located in the right lower lobe of the lung . Microscopically, chronic granulomatous inflammation which was composed of coagulation necrosis with rim of fibrous tissues and granulations was recognized . In the center of the necrotic nodules, the parasite was a nematode larva and had prominent internal cuticular ridges and thick cuticle, a well - developed muscle layer, an intestinal tube, and uterine tubules . The diameter of the worm was approximately 240 m . Based on these morphologic features, after surgical resection, the patient was discharged without any complications and is being followed up in healthy conditions . Human pulmonary dirofilariasis was first reported in 1887, when de magalhes documented the discovery of a single male and a single female filarial worm in the left ventricle of a boy from rio de janeiro, brazil . In 1961, dashiell reported the first case involving the lung . Usually d. immitis invades the lungs in human cases, but reports of human dirofilariasis involving other organs like the subconjunctiva, liver, and subcutaneous sites are also available . Another case of dirofilariasis in the liver reported in korea was actually a misdiagnosis of hepatic capillariasis . The chest ct images and pathologic findings of our case were similar to the first korean dirofilariasis case . However, our case is the first to show additional pet imaging . In our case, pet - ct was performed for differential diagnosis of malignancy, and the pet - ct showed a small subpleural nodule at the right lower lobe with minimal increased fdg uptake (suv 1.25). In the life cycle of d. immitis, the dog is the principal host, though other suitable hosts include cats, wolves, coyotes, and foxes . Are the normal vector - intermediate host, but more than 60 species of mosquitoes in 6 genera are capable of propagating the development of d. immitis . In the usual life cycle, the sexually mature female worm resides in the dog's right ventricle and sheds thousands of microfilariae into the blood stream . When a mosquito bites the dog, it ingests the microfilariae . Over the next 10 to 16 days, human are the " dead - end host " since larvae cannot develop into adults in humans . In our case, human pulmonary dirofilariasis is usually discovered during routine health examinations because it does not cause notable symptoms . It is seen as a well - circumscribed, non - calcified, peripheral coin lesion or nodule . Usually, the pulmonary lesion is a spherical nodule that upon gross examination appears as a well - circumscribed, spherical, grayish - yellow nodule 1 to 3 cm in diameter, surrounded by normal lung parenchyma . On microscopic examinations, there is a central core of necrosis surrounded by a granulomatous zone of tissues . In our case, the nodule was chronic granulomatous inflammation composed of coagulation necrosis with rim of fibrous tissues and granulations . Dirofilaria infections can be diagnosed on the basis of worm morphology, such as the thick multilayer cuticle with lateral internal ridges, large lateral cords, and coelomyarian musculature . In cross sections, d. immitis measures 100 - 300 m in diameter and possesses a multilayered curicle with a thickness of 10 - 25 m . The present case showed worm structures such as prominent internal cuticular ridges, no external cuticular ridges, thick cuticle, well - developed muscle layer, and presence of an intestinal tube . The diameter of the worm was 240 m, which was compatible with a d. immitis immature female worm.
|
The maxillary posterior area contains cancellous bones with low bone density and thin cortical bones, the quantity and quality of which are lower than those of the mandibular bone . This is due to the small implant - to - bone contact area and the inferior bone quality.123 moreover, the severe bone loss caused by sinus pneumatization or chronic periodontitis, which leads to a reduction in the height of the remaining residual ridge, can further increase the implant failure rate.4 in addition, the occlusal load in the posterior area is 3 - 5 times higher than that in the anterior area.5 to address these problems, various bone graft techniques to augment the insufficient bone volume and thereby ensure the success of maxillary posterior implants have been proposed.6 such surgical methods have been accepted as clinically meaningful procedures . However, these procedures have a number of disadvantages, such as the invasiveness of the surgery, high cost, and long treatment duration after bone graft and implant installation.6 in addition, because bone resorption occurs after a bone graft, the increase in vertical height is unpredictable . Microscopic studies by wallace et al.7 suggested that it was difficult to obtain bones with optimal strength from a bone graft . Rosen et al.8 asserted that the success rate of the implant placement after the bone graft depended on the residual ridge height . This was supported by aka et al.9 who showed that stress applied on the implant was concentrated on the upper part of the implant and that, hence, the stress was not transferred to the grafted bone . Given the above facts and the disadvantages, success rate of bone grafting in a severely atrophied maxilla is not very promising . Studies have reported that this method may allow new bone formation without the need for bone graft.1011 however, winter et al.12 stated that the amount of new bone generated by sinus augmentation alone was insufficient and the results were not satisfactory considering the complexity of the technique . This approach offers many advantages, which include a shorter treatment time, less cost, fewer complications in patients, and minimal surgical invasiveness . Since the introduction of short implant for installation in atrophied residual ridge,13 many previous studies have defined a short implant as measuring 7 mm or less.141516 although short implants have been reported to have a lower survival rate than standard implants due to the small bone - contact area,1415 their survival rates have increased gradually with advancements in surface treatment technologies.16 as a finite element analysis (fea) shows that stress transfer at the implant - bone interface is limited to the upper 2 - 3 mm, the long implant is thought to be biomechanically unnecessary.917 therefore, a short implant may be used for achieving primary implant stability in the case of unfavorable bone quantity and may be used as an alternative for surgical approaches such as bone graft or sinus augmentation . Replacement of a missing molar with a single implant may cause various mechanical failures such as screw loosening, screw fracture, and implant fracture.1819 in a severely atrophied maxillary posterior area, using a single wide implant or splinting multiple implants is a way to overcome the unfavorable crown / root ratio of short implants.202122 two - implant - supported maxillary molars with implants installed in buccal and palatal positions were suggested by balshi and wolfinger.23 the 2 short implants (2si, fig . 1) technique can be used to reconstruct a multi - rooted molar by installing 2 short narrow implants without the need for an additional surgical approach . The 2si approach is a minimally invasive procedure that solely utilizes residual bones to overcome unfavorable bone quantity and quality in the maxillary posterior area . It can yield stable treatment results while minimizing the need for additional procedures and reducing the cost and treatment time . A 5-year clinical study demonstrated the clinical success of 2sis.24 the purpose of this study was to compare the stress distribution of various types of 2sis that were installed and restored in severely atrophied maxillary molar sites . An internal connection implant with an 11-degree taper interface was used (gs, osstem, seoul, korea). Internal connection implants (length, 7.0 mm) with narrow platform (np 3.5 mm), regular platform (rp 4.0 mm), and wide platform (wp 5.0 mm) were modeled . Three - dimensional image data of the human maxillary first molar from ct images were transformed into fea meshes and the connecting area between the crown and implant was smoothened . A gold crown on the abutment (rigid, osstem, seoul, korea) was connected with the implant . Abutment for each implant diameter was connected, and the occlusal surface area of the definitive prosthesis was constructed to have the same shape . An implant was designed to be installed on the missing maxillary first molar area on the maxilla with a pneumatized sinus, 0.5 mm cortical bone on top and bottom, and 3 mm cancellous bone (fig . 2). For the boundary conditions, bottom and mesio - distal parts of the maxillary bone the mechanical properties of the bone, gold, and titanium were set as previously described (table 1).2526 the implant bone interface was constructed with 100% contact for complete stress transfer to the surrounding bone . They were broadly categorized into 3 groups of 2si and 4 groups of single implants . The 2si groups were categorized into 1) np oblique (two narrow implants were obliquely installed), 2) np vertical (two narrow implants were installed in palatal residual bone due to the resorption of buccal bone), and 3) np horizontal (two narrow implants were installed in distal residual bone due to the mesial bone resorption). Single implant installation groups were set to 1) rp - cantilever (a rp implant was installed in stepped bone due to resorption of the mesial bone), 2) wp - cantilever (a wp implant was installed in stepped bone due to resorption of the mesial bone), 3) rp - center (a rp implant was installed in a flat bone), and 4) wp - center (a wp implant was installed in a flat bone). Meshing and pre - processing were performed using hyper - mesh 10.0 (altair engineering inc ., troy, mi, usa) and visual crash for pam version 10.5 (esi group, paris, france). The average occlusal force, a 250 n static axial load, was applied to the center of the occlusal surface (axial loading). To simulate an oblique loading condition, a 250 n oblique load with a 45 angulation from the implant axis was applied on the center of the buccal cusp (oblique loading). The von mises stress was measured in the interface of implant - bone, implant / abutment complex, and at the bone of the peri - implant area in all models . To assess the stress distribution the processing and post - processing procedures were performed using pam - medysa v2014 (esi group, paris, france) and hyper - view v10.0 (altair engineering inc ., troy, mi, usa). Analyses of stress distribution in the implant - bone interface of an implant in the buccal side (np-1) showed an evenly distributed stress pattern in the np - horizontal and np - oblique groups, whereas the np - vertical group exhibited a relatively high stress pattern in the top and center areas of the interface (fig . Similar stress distribution was observed in the np - horizontal and np - oblique groups, while a different stress pattern was observed in the np - vertical group (fig . Stress distribution at the bone of the peri - implant area showed a different pattern to that observed in the interface . The np - horizontal and np - vertical groups showed a large stress concentration in stepped areas between different bone levels, while an even stress distribution was observed in the np - oblique group with flat bone level (fig . Few differences in stress distribution of the implant / abutment complex were observed in each group and all stress was concentrated on the interface between the abutment and inner surface of implant (fig . 4d). When oblique loading was applied, similar stress distribution was observed at the bone - implant interface of the buccal (np-1) and palatal (np-2) implants in the np - horizontal and np - oblique groups (fig . Although the np - vertical group showed slightly higher stress concentration, the difference was not as evident as with axial loading (fig . An evenly distributed stress pattern at the peri - implant bone was noticed in the np - oblique group compared with the np - vertical or np - horizontal groups (fig . The stress distribution of the implant / abutment complex showed virtually no difference in each group, and the amount and location of stress concentrations were similar to those in axial loading (fig . When axial loading was applied, the wp implant showed lower and evenly distributed stress at the implant - bone interface than the rp implant (fig . 6a). However, the stress difference was not large between the center and cantilever positions . As for the stress on the peri - implant bone, a more even stress distribution was observed in the center position implant than in the cantilever position implant . Lower stress was observed in the wp implant than in the rp implant (fig . Stress patterns at the implant / abutment complex of single implants were similar to that of the 2si groups (fig . When oblique loading was applied, the largest von mises stress was observed in the rp implant . The wp implant showed a relatively even stress distribution pattern and had a similar level of von mises stress to that of 2si groups (fig . The stress distribution on the peri - implant bones was similar to that in axial loading but the level of stress was higher . Stress exerted on the implant / abutment complex was very large; a high amount of stress was placed on the abutment and implant in both rp and wp implants . Additionally, larger and wider stress distribution was observed in the implant / abutment contact area on the opposite side of the loading point (fig . The stress distribution at the implant - bone interface was compared by categorizing the bone levels into two (flat and stepped). When axial loading was applied, higher von mises stress was observed on the implant - bone interface in the rp implant than in the wp implant or 2si implants . The highest stress was concentrated on the region with discontinuity between the different bone levels (stepped area) (fig . The 2si groups showed the lowest von mises stress compared with the rp and wp implants . The area between the implants showed lower stress distribution than the outer side of the implant in 2si group . The 2sis showed the most even stress distribution and rp implant showed the largest stress pattern on the peri - implant bones (fig . When applying oblique loading, the largest stress pattern was noted at the buccal side . Higher stress was observed in the rp implant than in the wp implant or 2 np implants (fig . Stress distribution of the peri - implant bones was relatively small and even in the 2si groups . A high level of stress was concentrated in the stepped area of the bone (fig . Differences in stress distribution based on implant diameter, number, or position could be observed, but no differences related to types of bone levels were observed (flat bone vs. stepped bone) (fig . To identify the biomechanical effectiveness of 2sis, various bone levels and bone morphologies were assumed and implants were positioned on the basis of the bone condition . The residual maxillary bone bed was designed with a total length of 4.0 mm and 0.5 mm of cortical bone on the top and bottom for bicortical engagement . Hence, when load was applied on the implant prosthesis, a large stress concentration was observed in certain regions on the bottom cortical bone located on the maxillary sinus side, unlike the result in another fea study.9 similarly, in clinical situations, stress may be concentrated on the bottom cortical bone as well as on the top portion in the case of severely atrophied bone . In this study, the von mises stress distribution on the bone away from the implant - bone interface was also considered . This is because it was difficult to estimate the effect of stress distribution solely based on the stress pattern at the localized implant - bone interface in case of a severely atrophied bone . In addition, stress on the implant - abutment complex was analyzed to estimate the risk of fracture in a narrow implant . The single rp implant group showed the highest level of stress at the implant - bone interface . As the diameter of implant used for restoring the maxillary molar is larger in wp, stress is more evenly distributed and general stress amount (in mpa) tends to be lower . However, two np implants exhibited more favorable stress distribution than a single wide implant; this confirms the biomechanical advantage of 2sis . In the 2si groups, the level of stress was not much different between palatal and buccal positioned implants . Meanwhile, np - vertical, which is a buccal - only or palatal - only positioned condition, exhibited a higher level of stress in the form of a bending moment when axial loading was applied . However, under oblique loading, a similar level of stress was exhibited by the three implant positions (np - oblique, np - horizontal, and np - vertical). These trends arose because oblique loading induced lopsided loading on the buccal or palatal sides . Therefore, the bending moment could be generated in a variously positioned implant, whose diameter is smaller than the roots of a natural tooth . The stress distributions in the center and cantilever positions of the rp and wp implants did not show a large difference . It may be because adjacent teeth were not modeled and both axial and oblique loading were applied on the mesio - distal center . These results are consistent with previous studies, which showed that the buccal cantilever was the most unfavorable and the mesio - distal cantilever was unfavorable only in terms of oral hygiene.2728 stress distribution of the peri - implant bone showed similar trends, where von mises stress was lower in implants of 2si groups than in rp or wp implants . This may be explained by the contact area between the implant and bone tissue, as placing multiple np implants is an effective way to increase the contact area . Since installation of a wp implant is difficult in atrophied bones, 2sis can provide better initial osseointegration and its subsequent maintenance with effective stress distribution . Stress on the implant / abutment complex was lower than that in the implant - bone interface or peri - implant bones . The stress was concentrated on the contacting surface of abutment and the inner part of implant when oblique loading was applied on rp or wp implants . Clinically, fractures are common in the geometric discontinuity between the upper conical part and the lower hex part of the abutment in internal conical connection implants.29 moreover, multiple implants can be advantageous since single molar implants exhibit occasional mechanical failures such as screw loosening, screw fracture, and implant fracture,28 and the oblique loading generated even in physiologic mastication can be detrimental to single maxillary implants . In a previous clinical study on 2sis, none of the np implants using the 2si method was fractured.24 the trend of the presence of higher von mises stress around rp implant than around wp or np implants did not differ by the bone levels . Prominently, the highest level of stress was exhibited on the stepped area of the bones . This can be viewed as a limitation of the fea study; stress concentration on the discontinuous area of features is unavoidable in the interpretation of the fea . In clinical situations, however, these phenomena are not likely to occur as bone loss occurs continuously . In preliminary modeling, however, real bone images can distort the result when comparing the effect of implant diameter and number . Therefore, over - interpretation of the importance of stress concentration at the discontinuous region should be avoided . As an alternative to bone graft on a severely atrophied maxillary posterior area, single wide implant or splinting of multiple implants can be performed.2123 the results from the this study showed that, multiple implants, even with a short length and narrow diameter, offer a favorable implant - bone interface, peri - implant bone, and implant - abutment complex . The use of 2sis, which place np implants in the most dense bone area in the buccal and palatal sides and utilize residual bones per se without surgical difficulties, is a procedure allowing enhanced osseointegration and favorable stress distribution . However, 2si could not be used in the case with narrow mesio - distal space . The results from the fea study can be the consequence of restricted stress transfer within the 2 - 3 mm of the top of the bone.9 further, as adjacent teeth were not predetermined, the replication was not identical to the actual situation . Moreover, clinical efficacy cannot be validated solely by a biomechanical study, as only a relative comparison is possible . However, this study is important in that it supports the findings of the clinical study that showed favorable clinical success rates of 180 2sis.24 the stress distributions based on various bone levels and implant installation conditions in a severely atrophied maxillary posterior area were analyzed . When axial loading or oblique loading was applied, the highest level of stress was observed on the implant - bone interface and peri - implant bones in a single rp implant and the lowest stress distribution was exhibited in 2si conditions . The highest level of stress was concentrated on the implant / abutment - contacting surface of the single wide implant and the lowest level of stress was on the implant / abutment complex of 2sis.
|
Hydatid disease (echionococcosis; hydatidosis) is a parasitic disease, endemic in many sheep raising countries (australia, south america, mediterranean countries, russia, middle east, and central asia). Adult cestodes of echinococcus granulosus inhabit the small intestine of a definitive host (dogs, foxes, and wolves) and produce infective eggs . Through the feces, either cestode segments or free eggs these are ungulates (sheep, goats, pigs, and horses) but in some cases accidental ingestion of eggs, usually shed by dogs, could lead to human cystic echinococcosis (ce). Contaminated food, water, or hand - to - mouth transmission are usual modes of infection in humans [2 - 4]. So far, once ingested by the intermediate host, in its intestinal tract, parasite eggs transform into the oncosphere . Oncospheres penetrate the intestinal wall, enters the portal vein, and reaches the liver where they usually are trapped and become the hydatid cyst . Liver involvement has been described as the most common location of ce, varying from 59% to 78% of all cases [1,5 - 8]. Some larvae pass the liver and reach the lungs where they develop into pulmonary hydatidosis . Lung involvement is present in 15 - 27% of all cases [1,5 - 8]. Not so often, larvae may pass these filters and form cysts in the brain, skeletal muscles, bones, kidneys, spleen, or other tissues . Theoretically, they can occur at any site except the teeth, nails, and hairs . Epidemiological studies have been conducted in some countries, while in serbia, montenegro, bih, and albania no information is available about the precise incidence in humans . The aim of this retrospective study was to investigate the skeletal manifestations of hydatid disease in serbia, it's demographic distribution, site involvement, complications, and bone tissue comorbidities . The study was conducted by reviewing the medical database of institute for pathology (faculty of medicine in belgrade) which is a reference institution in serbia for bone pathology . Materials in the study comprised all the cases with histologically verified bone hydatidosis during the period between 1971 and 2010 in the territory of serbia . Data obtained from medical records included the age at the moment of diagnosis, sex, localization of hydatid cyst, copresence of hydatid cyst in localizations other than the bone tissue, presence of skeletal complications, bone comorbidities, and diagnosis based on radiographies . In order to standardize the data, the radiological assessment was made on standard radiography, having in mind the length of the study period and diagnostic procedures available for that time . Changes in the bone structure were classified as tumefaction (sharply or unshapely demarcated area of altered bone structure), cysts (sharply demarcated lytic bone lesion with geographical borders), or fractures (in cases where fracture line occured). In some patients, altered bone structure was able to be classified as cyst or tumefaction preceding the pathological fracture, while in other cases, no alteration of the bone structure was radiologically visible aside of the fracture line . The age of the patients at the time of diagnosis was from 7 to 77 years . The mean age of all patients was 40.918.8 years . In order to explore the age distribution of ce, we grouped patients into 5 age categories: i (1 - 18 years), ii (19 - 36 years), iii (37 - 54 years), iv (55 - 73 years), and v (> 73 years). In group the mean age of adult patients (more than 18 years old) was 44.716.6 years . A total of 24 male patients presented 58.5% of all cases, while 17 female patients presented 41.5% . The spine was the most commonly involved site with the predominance of the thoracic segment . Analysis of standard radiographies revealed that fracture was by far the predominant radiological diagnosis, followed by tumefaction and cyst (table 2). Pain was the symptom in 41.5% of patients, while some patients demonstrated complications such as paraplegia (22.0%), pathologic fracture (48.8%), and scoliosis (9.8%). The pathological fracture was most frequently found in the spine (75.0%) followed by the femur (20.0%) and tibia (5.0%). However in addition to the bone involvement, 2 patients demonstrated extraskeletal hydatid cysts: 1 in the liver and 1 in the lungs . Bone tissue comorbidities refer to bone tuberculosis in a patient with spinal hydatid disease (2.4%) and to presence of fistula detected in 2 patients (4.9%), 1 with spinal and 1 with pelvic hydatidosis . Serbia is recognized as an endemic country for ce, but so far, no epidemiological study has been conducted . Since echionococcosis is subjected to an obligatory disease for reporting, the data on the number of reported patients were available through the annual report on infectious diseases on the territory of republic of serbia published by serbian institute for public health, serbia . In the study period, a total of 727 patients with ce the frequency was relatively high compared to the reports from other endemic countries, being 0.5 - 4.0% . This frequency can be explained at least partially by a larger total number of patients due to careless reporting of echionococcosis by physicians, which was even noted in the official annual reports from 1978 to 1989 of serbian institute for public health, serbia . Studies in other endemic countries showed that the prevalence of ce increases with age, resulting that the most of the patients belong to the adult population . The mean age at the moment of diagnosis, including all localizations, was from 33 to 52 years [13 - 18]. In our study, the mean age of the patients with skeletal manifestation of ce was 40.918.8 years, but among the adults the mean age was 44.716.6 . Higher frequency in aged people could be due to the fact that older people have more chances to be infected with e. granulosus during life, and also, the clinical signs of ce are more probable to appear later in life, as the disease progresses . As it was reported in previous studies [15,19 - 21], no significant difference between sex was found . In our study, 12.2% of patients were under 18 years, with the mean age being 13.04.2 years . It was consistent with the results of a previous report on the frequency of echinococcosis among children in serbia . Although boys to girls ratio was 1.5:1.0, no significant difference in the positive rate between sex was found . Some other studies reported slight predominance of boys, which could probably be explained by their outdoor playing, closer contact with animals, and low level of personal hygiene, compared to girls . Symptoms associated with bone ce are not specific and often missing, making the diagnosis difficult and sometimes overlooked . Our results showed that 19.5% of patients did not report any symptoms and did not develop any complications . These asymptomatic patients are not surprising in consideration that hydatid disease is anywhere in the body and often discovered as an incidental finding . Radiological diagnosis of osseous hydatid disease is also difficult because of non - specific findings . Radiography usually reveals single or multiple osteolytic lesions and in some cases shows cortical thinning, osteosclerosis (fig . Intraosseous foci of hydatid disease predominate in spongious bone tissues and consist of small, separate, and thin - walled cysts . While these cysts expand, they destroy the surrounding trabeculae and can reach a considerable size . Due to cyst enlargement and consequent cortical thinning, pathological fractures may occur . In the case of connective tissue proliferation and bone sclerosis, presentation of ce can be unclear, consisting of mixed radiological signs (table 2). Therefore, preoperative diagnosis of skeletal hydatid disease is difficult, and conclusive diagnosis is often made intraoperatively and by histological verification [26 - 28]. Histological examination of the cyst wall usually reveals an outer chitinous (or fibrous laminar) and an inner germinal layer, surrounded by either granulation tissue or fibrous capsule (fig . Osseous ce is almost invariably related to primary infection and is not the result of extension from neighboring soft tissue lesions . However, some authors report that around 30 - 45% of bone hydatidosis is co - present with the hydatid cysts in other localizations . We have reported just in 4.9% of cases the presence of hydatid disease in the liver or lungs; however, there is no statement in our database about the radiological surveys for the possible diagnoses of hepatic or pulmonary hydatidosis . Therefore, it is impossible to exclude the presence of secondary cysts without a whole body scan . In patients with bone ce, spine is the most commonly affected site with the frequency of appearance 35 - 50% [24,29, 33 - 36]. Our findings (table 1) are in concordance with the ones reported by other authors, with the exception of the cervical region . It is considered to be relatively silent, slowly progressive disease with a latent period of many years . Early symptoms appear when the small cyst expands and produces significant mechanical compression on surrounding vital structures . At this stage, intermittent pain can be present as a symptom . As the disease progresses and the cyst enlarges, patient starts suffering from persistent backache, gradually leading to severe neurologic deficit and varying degrees of weakness of limbs . Pain was present in 50% of patients with spinal hydatidosis in our study (table 3) with the frequency of appearance similar to the ones reported by other authors . Paraplegia is the most serious complication of vertebral hydatidosis appearing in up to 75% of patients with spinal ec . This compressive effect of spinal ce was present in 37.5% of patients in our study (table 3). Paraplegia is a neurological complication, occurring as a result of invasive intradural and extradural growth of the cyst . Cysts invade the spinal canal either by direct compression or by ischemic changes in the spinal cord . Radicular pain usually precedes paraparesis by few weeks, progressing rapidly to paraplegia in the thoracic spine, but slowly in the lumbar spine . Our results show that, in some patients, paraplegia can be developed as a compressive effect not just of the cyst, but of the spinal pathological fracture that ce can lead to, as well . All these data indicate that once formed in the spinal column, hydatid cyst is likely to result in paraplegia during the progression of the disease . In long - term hydatidosis, apart from pain and paraplegia, some cases can result in secondary infections and fistula formation . . Their presence can resolve the disease in the term of surgical treatment, while bacterial superinfection can lead to sterilization of the parasite, limiting the bone destruction . Interestingly, in our study, 1 male patient was reported with bone ce and tuberculosis super - infection . Despite ce shows the spinal tropism causing severe complications, the therapy of spinal ce is still poor . They are applied in order to retard the recurrences and control the disease but radical surgery is still the keystone . Data from the literature reported that the recurrence rate of bone ce, even after several operations, varied from 30% to 100% . Moreover, the mortality rate of spinal ce is unacceptably high, varying 14 - 58% . When ce is affecting long bones, it is generally the metaphyseal region, extending later to the diaphyses and nearby bones . The incidence of long bone involvement in our study (table 1) was similar to the results reported by other authors . Therapy is surgical resection, performed if lesion is segmental, otherwise, amputation or disarticulation are the only solutions . Our results (table 1) did not differ from the ones obtained by other authors . It's progression is infiltrating and diffuse and may lead to pain, swelling, and stiffness of the hip joint . This disease is hematogenously seeded along the trabeculae and through the medullar canal, leading to extensive bone lesions . Our results reported that these lesions were mostly complicated with pathological fracture (48.8% of all cases). Our results reported primary involvement of the spine (75%), with the predominance of lumbar over thoracic segment . In patients with bone ce, bone tissue destruction develops through 3 mechanisms; as the consequence of the cystic lesion expansion and its compression on surrounding tissues, ischemic processes through compression and obstruction of nutrient vessels, and cellular processes like osteoclast proliferation around the compressed bone tissue . In the absence of pericyst formation, the wall of the cyst is thin and cannot overcome the rigid bone nature . Therefore, the cyst cannot assume it typical, spherical shape, and it enlarges irregularly along the path of least resistance . In patients with skeletal ce, bone destruction lead to its thinning, extension into soft tissues and, as the worse case, can lead to fracture . Therefore, some authors suggest that all the pathological fractures in endemic countries should be considered as a possible case of ce.
|
Workers' health may be protected by his / her own preventive behavior, despite numerous health hazards in the workplace . However, worker behavior is constrained by various workplace pressures such as working conditions, including what is considered to be accepted working behavior and overall morale of the working group . Based on the employment contract, every employer has a certain amount of control / power and the expectation that workers will follow work - related requests . This may lead to adverse health effects in workers; therefore, the government has implemented regulations to protect worker health, such as the occupational safety and health (osh) act . Adverse health effects induced by unexpected incidents may present as occupational injuries, but occupational diseases can appear due to long term continuous exposure to harmful chemicals, dust, noise, etc . To prevent occupational diseases, it is important to manage worker health via health monitoring for early detection of abnormal conditions . It is very important for worker health management to monitor the level of worker exposure to hazards in the workplace; for example, health check - ups including absorption of hazard materials, so called' biological monitoring' . Noise levels in the workplace should also be measured in order to prevent worker's hearing loss . If a worker is exposed to high levels of noise, he / she should be transferred to another work area without noise or provided with proper personal protective equipment (ppe) such as earplugs, etc . As above, information needed for workers' health management can be classified into three categories according to 3 questions: 1) what is the exact nature of the occupational hazards? 3) what health problems are induced by these hazards? These questions should be answered in order to manage workers' health effectively and efficiently . Health management for workers is accomplished by two different strategies: 1) focusing on reduction of exposure to hazard factors in the workplace based on risk assessment using exposure information; 2) the provision of health care services and compensation for workers with adverse health effects . Recently, psychosocial factors such as work - related stressors have been included as hazard factors in the workplace, and health promotion activities have become an important component of worker health management before symptoms and signs of occupational diseases manifest . In this article, we reviewed the various kinds of surveillance systems for occupational diseases in korea and resultant data, and suggest reformation of the workers' health management system . The workers' compensation insurance system is one of the old systems and ensures a worker's life and his / her family is secure after work - related accident . Workers' compensation insurance has been continuously developing since 1960; in particular, its coverage has expanded from large - sized companies to small businesses . Now it is mandatory for all employees to be covered by workers' compensation insurance . During the early period of workers' compensation insurance, only traditional occupational diseases requiring the recuperation of 11 or more days were compensated, but now work - related diseases such as musculoskeletal disorder, cerebrovascular attack and cardiovascular attack requiring the recuperation of 4 or more days, may also be compensated . Industrial accident is defined in the industrial accident compensation insurance act, and occupational diseases are included as industrial accidents . Occupational injuries and illnesses can be covered by workers' compensation insurance as social insurance managed by the korea workers' compensation and welfare service (comwel), supervised and funded by the ministry of employment and labor (moel) korea government . Work relatedness refers to work or the working environment causing occupational injuries and illnesses or occupational injuries and illness happening during work . Data on occupational diseases compensated as industrial accidents are collected and analyzed by the korea occupational safety and health agency (kosha). The osh act the proportion of reported cases is very small (under 1% of total occupational diseases). Kosha collects compensated cases from comwel and reported cases from the moel, and produces official statistics on all occupational diseases . Until now, some workers have been excluded from workers' compensation insurance: self - employed, unpaid family workerscivil servants, teachers, soldiersagriculture, hunting, fishery, and forestry workplaces with less than 5 workers self - employed, unpaid family workers civil servants, teachers, soldiers agriculture, hunting, fishery, and forestry workplaces with less than 5 workers civil servants, as government employees, teachers and soldiers are covered by other insurance systems, while there is no compensation system for self - employed and unpaid family workers and workers of small companies in agriculture, hunting, fishery and forestry . Since 2000, the number of occupational diseases has increased continuously from 4,051 in 2000 to 11,472 in 2007 . However, after 2007 occupational disease cases decreased . In particular, occupational diseases accounted for 8,721 cases in 2009, representing a decrease of 1,013 persons (10.4%) compared to the previous year's 9,734 persons in 2008 (1) (fig . The number of non - fatal work - related diseases stood at 6,626 in 2009, representing a decrease of 944 (12.5%) compared to the previous year's 7,570 persons . The increasing trend in the number of pneumoconiosis cases reversed to a decreasing trend in 2005 . Non - fatal work - related diseases increased continuously until 2007, but recently statistics have shown decreasing trend . Specifically, brain and heart disease frequency have decreased since 2004 (1) (table 1). The number of fatal occupational diseases increased until 2003, but has since shifted to a decreasing trend . There is also a steadily increasing trend in fatal pneumoconiosis, while brain and heart disease cases have decreased . Yearly trends in size of occupational diseases as industrial accidents in korea may be reflected by changes in institutions of industrial accident compensation . In particular, brain and heart disease and musculoskeletal disorders have increased since the 1990s and 2000s, respectively . Recently, these work - related diseases were the most of compensated cases except for coal worker's pneumoconiosis (table 1, 2). Another method of investigation of the magnitude and profile of occupational diseases is the national survey method; however, this method is less developed . Since 1998, there were three kinds of nationwide surveys: first, is the national workers' health interview survey; second, is the national survey on workplace safety and health management; and third, is the working conditions survey (wcs). The first one was done only one time in 1998 for workers in manufacturing sectors . The second one was done a total of 5 times between 2000 and 2008, and the sixth survey was done in 2009 . The third one was conducted in 2006 and focused on psychosocial factors of workers' health in the workplace . The working conditions survey is using the same questionnaire as the fifth survey of the european founplace wcs in order to compare korea and the eu . Every survey has included some questions about worker's experiences of occupational disease . According to the wcs, the magnitude of occupational diseases experienced as symptoms and signs is detailed hereafter: among the various symptoms and signs, the highest prevalence rate is that of musculoskeletal disorders (18.1%); the second most frequent is that of stress (17.9%); back pain is the third (16.8%); and overall fatigue is the fourth (16.7%). The prevalence rate of stress is the highest one among male workers, but musculoskeletal disorders are the highest among female workers (2) (table 3). Workers' compensation insurance has been continuously developing since 1960; in particular, its coverage has expanded from large - sized companies to small businesses . Now it is mandatory for all employees to be covered by workers' compensation insurance . During the early period of workers' compensation insurance, only traditional occupational diseases requiring the recuperation of 11 or more days were compensated, but now work - related diseases such as musculoskeletal disorder, cerebrovascular attack and cardiovascular attack requiring the recuperation of 4 or more days, may also be compensated . Industrial accident is defined in the industrial accident compensation insurance act, and occupational diseases are included as industrial accidents . Occupational injuries and illnesses can be covered by workers' compensation insurance as social insurance managed by the korea workers' compensation and welfare service (comwel), supervised and funded by the ministry of employment and labor (moel) korea government . Work relatedness refers to work or the working environment causing occupational injuries and illnesses or occupational injuries and illness happening during work . Data on occupational diseases compensated as industrial accidents are collected and analyzed by the korea occupational safety and health agency (kosha). The osh act the proportion of reported cases is very small (under 1% of total occupational diseases). Kosha collects compensated cases from comwel and reported cases from the moel, and produces official statistics on all occupational diseases . Until now, some workers have been excluded from workers' compensation insurance: self - employed, unpaid family workerscivil servants, teachers, soldiersagriculture, hunting, fishery, and forestry workplaces with less than 5 workers self - employed, unpaid family workers civil servants, teachers, soldiers agriculture, hunting, fishery, and forestry workplaces with less than 5 workers civil servants, as government employees, teachers and soldiers are covered by other insurance systems, while there is no compensation system for self - employed and unpaid family workers and workers of small companies in agriculture, hunting, fishery and forestry . Since 2000, the number of occupational diseases has increased continuously from 4,051 in 2000 to 11,472 in 2007 . However, after 2007 occupational disease cases decreased . In particular, occupational diseases accounted for 8,721 cases in 2009, representing a decrease of 1,013 persons (10.4%) compared to the previous year's 9,734 persons in 2008 (1) (fig . The number of non - fatal work - related diseases stood at 6,626 in 2009, representing a decrease of 944 (12.5%) compared to the previous year's 7,570 persons . The increasing trend in the number of pneumoconiosis cases reversed to a decreasing trend in 2005 . Non - fatal work - related diseases increased continuously until 2007, but recently statistics have shown decreasing trend . Specifically, brain and heart disease frequency have decreased since 2004 (1) (table 1). The number of fatal occupational diseases increased until 2003, but has since shifted to a decreasing trend . There is also a steadily increasing trend in fatal pneumoconiosis, while brain and heart disease cases have decreased . Yearly trends in size of occupational diseases as industrial accidents in korea may be reflected by changes in institutions of industrial accident compensation . In particular, brain and heart disease and musculoskeletal disorders recently, these work - related diseases were the most of compensated cases except for coal worker's pneumoconiosis (table 1, 2). Another method of investigation of the magnitude and profile of occupational diseases is the national survey method; however, this method is less developed . Since 1998, there were three kinds of nationwide surveys: first, is the national workers' health interview survey; second, is the national survey on workplace safety and health management; and third, is the working conditions survey (wcs). The first one was done only one time in 1998 for workers in manufacturing sectors . The second one was done a total of 5 times between 2000 and 2008, and the sixth survey was done in 2009 . The third one was conducted in 2006 and focused on psychosocial factors of workers' health in the workplace . The working conditions survey is using the same questionnaire as the fifth survey of the european founplace wcs in order to compare korea and the eu . According to the wcs, the magnitude of occupational diseases experienced as symptoms and signs is detailed hereafter: among the various symptoms and signs, the highest prevalence rate is that of musculoskeletal disorders (18.1%); the second most frequent is that of stress (17.9%); back pain is the third (16.8%); and overall fatigue is the fourth (16.7%). The prevalence rate of stress is the highest one among male workers, but musculoskeletal disorders are the highest among female workers (2) (table 3). These institutions are examine workers by the request of employers based on the osh act mandatorily . For example, health examinations are regulated by government in order to protect worker health through early detection of occupational diseases . Health examinations for worker health protection are classified into two different types: special health examination and general health examination . The special health examinations are comprised of health screening tests for early detection of selective occupational diseases in workers exposed to specific hazard factors such as noise, dust, organic solvent, etc . The general health examination is a mass screening test for finding health problems including occupational diseases of workers without exposure to hazard factors . The health examination is focused on early detection of occupational diseases, and its results are used as information for workplace management in order to protect worker health . Cases diagnosed as' suspicious cases of occupational disease' are recommended to be transferred to non - hazardous workplaces . Some of them may be compensated based on diagnosis of occupational diseases through the workers' compensation insurance system . Detection rate of' suspicious cases of occupational diseases' in the special health examination was 0.46% in 2008, an increase from 2006 . The detection rate of' cases observed for occupational disease' was 12.85% in 2008 with an increasing trend . The health examination is defined as a screening test for occupational diseases, so there is no confirmatory diagnosis in the health examination process .' Cases to be observed for occupational diseases' are the result of an examination showing marginal figures for' suspicious cases for occupational diseases' . Based on results from the health examination, suspicious cases will be recommended to undergo medical treatment, change jobs or tasks for reduction of exposure to hazard workplace, etc . Cases to be observed are not in need of any immediate intervention; however, these cases may be also recommended similar treatment, such as wearing personal protective equipment (ppe), changing jobs or tasks, etc . Among suspicious cases and cases to be observed detected by the special health examination, hearing loss due to noise was the most prevalent (3) (table 4). Detection rate of' suspicious cases of occupational diseases' during the general health examination was 0.001% in 2008, and has been very steady since 2004 . In contrast, the detection rate of' suspicious cases of general diseases' has shown fluctuations between 4 and 5% in the last ten years (3) (table 5). Health examinations are very effective in finding asymptomatic chronic diseases, such as pneumoconiosis, hearing loss and some poisonings . However, it can barely detect symptomatic diseases with no signs, like asthma, and easily curable diseases like dermatitis because of the characteristics of the periodic screening test . Therefore, statistics from the health examination include mostly pneumoconiosis and noise - induced hearing loss (4) (table 4). The working environment measurement institution, regulated by the osh act, is in charge of assessing and, ultimately, reducing the level of worker exposure to hazard factors in the workplace . Every employer should do working environment measurement in order to identify hazard factors in the workplace and the level of worker exposure to these factors . The special health examination is based on working environment measurement, such as selection of the examinee . If the level of worker exposure is higher than the occupational exposure level in korea, the employer should immediately act to reduce it . The magnitude of occupational diseases and associated fatality rate in korea have gradually increased since 2007 . The trend in fatality rate can be reflected by the trend in fatal pneumoconiosis and brain and heart disease, as these two categories of occupational diseases predominate total occupational diseases . Most pneumoconiosis cases were coal workers' pneumoconiosis; however, nowadays most coal mines have closed due to restructuring of the energy production system in korea . Other dominant fatal occupational diseases, such as brain and heart diseases, will also decrease because general health programs have focused on prevention of hypertension, one of the most important causal factors of brain and heart diseases in workers . In the general population, the morbidity rate of brain and heart diseases has shown a recent downward trend . One is the causal factors of occupational diseases for prevention, and the other is affected workers of occupational diseases in order to rehabilitate them through recovery of the labor force . Occupational diseases are induced by worker exposure to various hazard factors in the workplace, such as physical, chemical, biological and psychosocial factors . Workers with abnormal conditions can detect acute occupational diseases through self - diagnosis just after exposure to high levels of hazard factors, such as lead, mercury, etc . However, it is not so easy to identify abnormal conditions of chronic occupational diseases, such as asbestos - induced diseases . Furthermore, exposure to low levels of hazard factors may have long - term cumulative effects on worker health (fig . If there is no evidence of work - relatedness, no ill - health can be confirmed as an occupational disease . Work - relatedness may be classified into two different types: direct and indirect causality . First, based on direct causality between work or work environment and ill - health, it is easy to determine work - relatedness, but it is very difficult to evaluate indirect work - relatedness . The same condition diagnosed as occupational disease by a physician can also be categorized as non - work - related because a particular hazard factor cannot be detected in the working history . Final determination of work - related illness or death in any individual case requires detailed occupational and non - occupational information (5). In the united states, there exists occupational health surveillance, such as death certificates, hospital discharge data, physician reports, laboratory reports, workers' compensation reports, national surveys, employer surveillance programs and occupational health clinics (5). Since 1998, there were some suggestions for the introduction of a surveillance system for occupational diseases in korea because worker health examinations and work environment measurements had limitations for management of occupational diseases (6, 7). The magnitude of occupational diseases in korea is assessed mainly by the workers' compensation system . Statistics might exclude unclaimed occupational diseases and those of workers from the public sector and workers who are not covered by compensation insurance (4). This means that non - compensated cases can be neglected and latent cases can always emerge as compensated cases in the immediate future . Moreover, statistics based on compensated cases of occupational diseases are not stable because different acceptance criteria for work - relatedness have been applied by the korea labor welfare corporation (former name of comwel) and judiciary branch (8). In korea, there are two different kinds of health insurance: national health insurance and workers' compensation insurance . Every worker with occupational ill - health can be covered by either of these two . If some occupational diseases cases are covered by the national health insurance system, official statistics on occupational diseases cannot include these cases . In order to determine the correct number, all occupational diseases covered by the two different insurances unfortunately, the national health insurance system has no screening and confirming system for occupational diseases . Occupational disease compensation will focus on the treatment, compensation, and rehabilitation as secondary or tertiary prevention . National surveys of worker health can provide useful information about ill - health workers without treatment or compensation . This information can be used to prevent occupational diseases by detection of at - risk workers as a target population for management of occupational diseases . The primary prevention of occupational diseases and injuries depends more directly on hazard surveillance, since the identification of hazards enables their reduction prior to the onset of ill - health . Occupational health surveillance is less well developed than its health counterpart due to scarcity of data sources and, with the exception of the occupational safety and health administration and the national institute for occupational safety and health surveys in the usa, the proprietary and inaccessible nature of hazard data collected by employers (5). Occupational health surveillance entails the systematic monitoring of health events and exposures in working populations in order to prevent and control occupational hazards and their associated diseases and injuries (5). Medical surveillance refers to the ongoing application of medical tests and procedures to individual workers who may be at risk for occupational morbidity to determine whether an occupational disorder may be present (5). If an individual or population is exposed to a toxin with known effects, and the tests and procedures are highly targeted to detect the likely presence of one or more effects in these persons, then this surveillance activity is more aptly described as medical screening (9). In occupational health, there are two kinds of surveillance activities, one is public health and medical surveillance and the other is hazard surveillance . The main purpose of occupational health surveillance is to identify the incidence and prevalence of known occupational diseases and injuries (5). A second broad function is to identify individual cases of occupational disease and injury in order to find and evaluate other individuals from the same workplaces who may be at risk for similar disease and injury . Another purpose of case identification may be to assure that the affected individual receives appropriate clinical follow - up, an important consideration in view of the scarcity of clinical occupational medicine specialists (10, 11). Finally, occupational health surveillance is an important means of discovering new associations between occupational agents and accompanying diseases . Discovery of rare diseases, patterns of common diseases, or suspicious exposure - disease associations through surveillance activities in the workplace can provide vital leads for a more conclusive scientific evaluation of the problem and possible verification of new occupational diseases (5). Periodic medical screening and surveillance examinations are another frequent service provided by occupational medicine physicians . The term screening focuses on the individual; screening tests are tools for secondary prevention with the goal of early diagnosis and treatment of disease in exposed workers . True' surveillance' aggregates information about individuals in order to examine patterns within a population . Properly applied, surveillance is a tool for primary prevention through the identification and elimination of the cause of disease (12). Screening examinations may be target - organ specific or substance specific, and thus tend to be more focused than preplacement evaluations (12 - 14). Based on considerable information, occupational disease management can be accomplished in order to protect and promote worker health . Many kinds of information are required to suggest the etiology of poor worker health, such as hazard, exposure level and related information in workplace . The present system of surveillance for management of occupational diseases mainly depends upon the workers' compensation and health examination systems . These two systems cannot cover all kinds of occupational diseases . In order to focus on primary prevention of occupational diseases, various data sources on hazards and exposure levels in workplaces especially, prevention of occupational diseases may be focused on the reduction of worker exposure to the occupational hazards . The workers' compensation insurance system reviews each claim case for evaluating its work - relatedness . This means that hazard factors and worker exposure to those hazard factors may be assessed . These review data can be some of the most important information for prevention of ill - health by surveillance . Most of the current surveillance system in korea depends upon the osh act . From the viewpoint of surveillance, the occupational management system in korea is well designed except for the national survey system . In the future, national surveys for detection of occupational hazards and ill - health outcomes of workers should be developed . The existing surveillance system of occupational disease can be improved by providing more refined information through statistical analysis of surveillance data . Recently, data mining has been used in order to estimate the national burden of occupational disease with other international statistics . In korea, this technique can be also introduced for development of the management system of occupational diseases.
|
A cross - sectional retrospective study was carried out according to world health organization guidelines over 6 months and included 197 general practitioners (gps) and 19,700 prescriptions.this study revealed that the overall index of rational drug prescribing (irdp) indicator for gps was below the optimal prescribing practice level.we found disparities in the irdp between gps at different health facilities . Gps at national insurance fund facilities scored lower than those at state ministry of health facilities or other health facilities such as those owned by private interests, universities, and non - governmental organizations . The irrational use of medicines is a major problem worldwide and represents the primary source of medical waste and harm . The medicines component of the health services package is more variable and dynamic than other service components, particularly in terms of coverage, quality, and cost . In recent years the overuse of medicines is diverse, and drug - prescribing indicators in developing countries are suboptimal, with core indicators varying between countries . For instance, antibiotics and injectables are overused and generic medicines are underused in sudan . The overuse of medicines not only leads to the development of drug resistance and wastes resources but also increases morbidity and mortality [3, 4]. Thus, the appropriate use of medicines is an essential factor in the provision of quality health services, patient safety, and the rational use of health resources . The world health organization (who) and the international network of rational use of drugs (inrud) have developed widely used core prescribing indicators to assess the prescribing quality of primary healthcare facilities and to enable comparisons between health facilities and prescribers . To our knowledge, no prescriber - based study has been conducted in sudan; one study of the national health insurance fund (nhif) has been conducted in health facilities . Previous studies have been based on the facilities sampling method (table 1) and have revealed antibiotic overuse [8, 9], underuse of generic medicines, and overprescribing of injectables . Other studies have revealed a relatively large average number of drugs per prescription and poor adherence to the essential medicines list (eml). These previous studies were conducted to investigate prescription patterns; however, our study investigated the prescribing practices of general practitioners (gps) and used the largest sample and a unique study unit . We used prescribing indicators as a benchmark among gps at primary healthcare centers (phccs) and as a baseline for regular assessment of prescribing quality . In sudan, the objective of this study was to use the who / inrud prescribing indicator to assess the quality of prescribing among gps at different types of phccs . We used the assessment regimen created by who / inrud to evaluate prescribing performance according to the adopted standards to monitor the improvement of rationality in prescribing practice . Before rational prescribing can be promoted, the prescribing practices of those who provide 80% of the services must be ascertained.table 1previous prescribing quality studies in sudanyeararealevelmean no . Drugs / prescription% of generic% of antibiotics% of injectable% from eml1991 n. provincephccs1.46363361996 kh statephccs1.9487322981998 kh statehospital and phccs2.1415929992004 kh stateteaching hospitals (2)1.9436510.52007 six statesphccs2.344.6662773.52010 kh statephccs243.271.813.792.72010 kh statefour pediatric hospitals249.381.33.52012 five nhif statesphccs2.654.2641499.32012 kh statehospitals and pharmacies2.837.354.338.672.8 eml essential medicines list, kh state khartoum state, n. province nile province, nhif national health insurance fund, phccs primary healthcare centers previous prescribing quality studies in sudan eml essential medicines list, kh state khartoum state, n. province nile province, nhif national health insurance fund, phccs primary healthcare centers the study was conducted in gezira state, which represents 27% of nhif; we targeted all gps (220) providing services for nhif subscribers at the primary healthcare level . These gps provide services at three types of health facilities: (1) those owned by the nhif, (2) those owned by the state ministry of health (smoh), and (3) those owned by others (private interests, universities, and non - governmental organizations [ngos]). Insured patients pay 25% of prescription costs, and pharmaceutical services are provided through a network of pharmacies owned by the nhif, smoh, and others . We collected 100 prescriptions for each gp according to who / inrud guidelines for comparisons between prescribers . The reference period of retrospective data collection was 6 months, representing the last quarter of 2014 and the first quarter of 2015 . Prescription collection was based on systematic random sampling, with an interval determined by dividing the gp s total prescriptions by 100 . Of the 220 gps, 197 (90%) had valid prescriptions over the 6 months, and the total valid number of observations was 19,700 prescriptions . Trained technical professionals collected the data . Data were reviewed and entered twice in a microsoft excel spreadsheet before being exported to stata-12 for analysis . The prescriptions data were transferred to who investigation format, checked again for accuracy, entered into an excel sheet, and individually checked once more for precision and completeness . We used the who / inrud standard method for calculating prescribing indicators (table 2). The unit of analysis used was gp (100 prescriptions for each gp).table 2adjusted prescribing standards from who and inrud indicatorsprescribing indicatorsoptimal leveloptimal irdpmean medicines per prescription (whether or not drugs dispensed)<2 1medicines prescribed by generic name (%) 100 1prescriptions with an antibiotic (%) 30 1prescriptions with an injectable dosage form (%) 10 1medicines prescribed from nhif gp s medicines list (%) 1001complementary indicator, average cost of prescription (sdg)20.31 (proxy) inrud international network for the rational use of drugs, irdp index of rational drug prescribing, nhif national health insurance fund, sdg sudanese pound, who world health organization adjusted prescribing standards from who and inrud indicators inrud international network for the rational use of drugs, irdp index of rational drug prescribing, nhif national health insurance fund, sdg sudanese pound, who world health organization to determine prescribing rationality and quality at the gp level, we used the index of rational drug prescribing (irdp) developed by yuxin and mingguang . The irdp for each gp was calculated by compounding the indices of the five prescribing indicators . The index of each prescribing indicator was calculated by dividing the optimal value by the achieved value for each . Moreover, for each type of health facility, the irdp was applied for comparison . Finally, we analyzed 19,690 prescriptions from 197 gps (10 invalid prescriptions were excluded). Data at the gp level were clustered to represent the three types of health facilities . Data were reviewed and entered twice in a microsoft excel spreadsheet before being exported to stata-12 for analysis . The prescriptions data were transferred to who investigation format, checked again for accuracy, entered into an excel sheet, and individually checked once more for precision and completeness . We used the who / inrud standard method for calculating prescribing indicators (table 2). The unit of analysis used was gp (100 prescriptions for each gp).table 2adjusted prescribing standards from who and inrud indicatorsprescribing indicatorsoptimal leveloptimal irdpmean medicines per prescription (whether or not drugs dispensed)<2 1medicines prescribed by generic name (%) 100 1prescriptions with an antibiotic (%) 30 1prescriptions with an injectable dosage form (%) 10 1medicines prescribed from nhif gp s medicines list (%) 1001complementary indicator, average cost of prescription (sdg)20.31 (proxy) inrud international network for the rational use of drugs, irdp index of rational drug prescribing, nhif national health insurance fund, sdg sudanese pound, who world health organization adjusted prescribing standards from who and inrud indicators inrud international network for the rational use of drugs, irdp index of rational drug prescribing, nhif national health insurance fund, sdg sudanese pound, who world health organization to determine prescribing rationality and quality at the gp level, we used the index of rational drug prescribing (irdp) developed by yuxin and mingguang . The irdp for each gp was calculated by compounding the indices of the five prescribing indicators . The index of each prescribing indicator was calculated by dividing the optimal value by the achieved value for each gp . Moreover, for each type of health facility, the irdp was applied for comparison . Finally, we analyzed 19,690 prescriptions from 197 gps (10 invalid prescriptions were excluded). Data at the gp level were clustered to represent the three types of health facilities . The average number of medicines per prescription (2.55: maximum 15, minimum 1) indicated a poly - pharmacy pattern, with prescriptions involving antibiotics (54.71%) and injectable formulations (12.84%). A total of 81.19% of the prescribed medicines were from the eml, and generics accounted for 46.34% of prescriptions, which is some distance from the optimal required level of 100% . The average cost per prescription was 40.57 sudanese pounds (sdgs) (table 3). Values for nhif facilities were farther from the prescribing indicator standards than were smoh and other health facilities, except for the percentage of prescriptions containing antibiotics (nhif 45.91 vs. smoh 57.24 vs. others 56.84%) (table 3).table 3prescribing indicators and health facility typestype of health facility owner or operatorsmohnhifotheroverallnumber of gps1264328197average number of drugs per prescription2.442.972.42.55medicines prescribed by generic name (%) 48.9638.4749.2846.34prescriptions containing antibiotics (%) 57.2445.9156.8454.71prescriptions containing injectable formulations (%) 12.5515.589.9712.84drugs prescribed from gp s medicines list (%) 82.9772.6589.2781.19average cost of prescription (sdgs)36.0759.5431.6940.57irdp3.463.083.753.39 gp general practitioner, irdp index of rational drug prescribing, nhif national health insurance fund, sdg sudanese pound, smoh state ministry of health prescribing indicators and health facility types gp general practitioner, irdp index of rational drug prescribing, nhif national health insurance fund, sdg sudanese pound, smoh state ministry of health the correlation between gps and irdp was statistically significant at p <0.001 . The optimal index is 5; however, the overall irdp score for gps was 3.39 (range 2.14.8). The prescribing quality indices revealed that prescribing practice was nowhere near the optimal index of 5, with nhif facilities having a lower index (3.08) than smoh facilities (3.46) and health facilities owned by others (3.75) (table 3). The objectives of this study were to use the who / inrud prescribing indicator to assess the quality of prescribing among gps at different types of phccs . We conducted a cross - sectional retrospective study over 6 months that involved 197 gps with valid prescriptions, representing 90% of the total study population (220). The study revealed that the mean number of medications per prescription was 2.55 1.32 drugs, which represents poly - pharmacy according to the benchmark we applied of more than two drugs . The mean number of drug prescriptions was 2.55; this was much closer to the 2.6 found by a study conducted in nhif facilities in 2012 in five other states . The mean number of drugs per prescription was higher than most previously reported sudanese studies when we excluded the studies by mustafa and mahmoud et al ., who reported 2.6 and 2.8 drugs per prescription, respectively (table 1).when compared with other developing countries, the mean number of drugs per prescription in sudan (2.55) was less than in mali (3.2), yemen (3.0), uganda (2.9), thailand (2.85), and pakistan (2.7) [1923]. However, gps in sudan prescribed a higher mean number of drugs per prescription than those in india (2.4), tanzania (2.2), saudi arabia (2.08), and malaysia (2.0) [2427]. Collectively, nhif facilities had a higher mean number of medications than other facilities (table 3). The major implications of poly - pharmacy are additional avoidable costs and an increased probability of adverse drug reactions . A limitation of the study was that inter - country comparisons were not adjusted according to the prevalence of chronic diseases in the population . The percentage of generic medicines prescribed was 46.34%, which is considerably lower than the standard of 100% . The calculated percentage represents a severe underuse of generic medicines that was also lower than the middle eastern mediterranean region s average use of generics (57.1%). This result is consistent with previous studies conducted in different districts in sudan (table 1). When compared with those of neighboring countries, the percentage of generic drugs per prescription in sudan (46.34%) was lower than in egypt (95.4%), ethiopia (99.16%), mali (70.4%), uganda (91.3%), and yemen (67.1%) [1921, 29, 30]. However, the percentage of generic drugs prescribed was remarkably higher in sudan than in bahrain (14.3%) and jordan (5.1%) [29, 30]. Gps in nhif facilities prescribed considerably fewer generics (38.47%) than those in smoh (48.96%) and other facilities (49.28%). The implications of low generic use are primarily the wastage of scarce health resources and a decrease in access to pharmaceuticals because of an affordability barrier . The percentage of prescriptions containing antibiotics was 54.71%, a considerably high result according to the who guideline benchmark of 30% antibiotic use . It was consistent with percentages assessed previously in other states of sudan (table 1). The percentage in the who eastern mediterranean region was 53.6%, slightly less than found for sudan in the current study . The use of antibiotics was lower in nhif facilities (45.91%) than in smoh (57.24%) and other facilities (56.84%). Antibiotic overuse can have a devastating impact in terms of the development of multi - drug - resistant bacteria, which can lead to unmanageable infectious diseases . The percentage of prescriptions containing injections was 12.84%, which is considered relatively over the optimal level, although no strict standard exists, as the who benchmark is <10% . The average prevalence of injection use in the eastern mediterranean region is higher (27.1%). Studies conducted in sudan reveal progress in the rational use of injections (table 1). This reduction is attributable to a new malaria management protocol that focuses strongly on ingestible formulations rather than injection, which was the initial dominant medication formulation . The overall percentage of medications prescribed from the eml was 81.19%, whereas the prescribing quality indicator standard is 100% . Eml adherence seems high; however, in actuality, this figure is misleading because the best achievement in core prescribing indicators was this indicator worldwide . According to the who prescribing database, on average, the middle eastern mediterranean region s percentage of medicines prescribed from the eml was 90.8% . Previous studies in sudan have often found this prescribing core indicator to be higher than observed in this study (table 1). Interestingly, we found eml adherence was lower in nhif facilities (72.65%) than in smoh (82.97%) and other facilities (89.27%). A total of 197 gps reported an irdp of 2.14.88, which is relatively low compared with other neighboring countries . For instance, ten health facilities in saudi arabia reported an irdp of 4.375 . In egypt, the same processes were conducted in ten phccs and revealed high irdp rankings, ranging from 3.92 to 4.88 . Although the irdp was not high, it was higher than the 3.32 reported in china . The index values for nhif facilities (3.08) were lower than for smoh (3.46) and other (3.75) facilities (table 3). The current study revealed that the average prescription cost was 40.57 sdg, almost double the proxy 20.31 sdg . A study conducted in five states in 2012 reported an average prescription cost of 20.5 sdg, almost half that observed in the current study . The primary cause of the cost increase is attributed to the devaluation of the national currency, particularly over the last 4 years . When comparing average costs with those in other countries, proper economic adjustment of currency values is essential . Prescriptions from nhif facilities cost more than those from other facilities, with the average prescription costing 59.54 sdg (nhif), 36.07 (smoh), and 31.69 sdg (other facilities). These disparities were attributed to the relatively high percentage of patients with chronic diseases in nhif facilities (36%), with smoh facilities having fewer such patients (18%). The authors consider the main cause of the observed suboptimal prescription quality to be low adherence to prescribing guidelines . Nhif facilities performed worse than other facilities, which could be attributed to the accountability of non - nhif facilities (all services provided by these facilities are reimbursed according to adherence to regulations), while the nhif facilities have not been subjected to that review . Appropriate medicine use is essential to the provision of quality health services, patient safety, and the rational use of health resources . The present study used the largest sample to date and a unique study unit to investigate prescribing rationality among gps at different types of health facilities providing health services for insured patients in gezira state, sudan . The study revealed that the overall irdp score for gps was less than optimal and characterized by significant disparities between gps at different health facilities, with nhif facilities receiving a lower index . Further studies should be conducted to determine the factors causing the considerable discrepancies (2.14.88 irdp) between gps at health facilities owned by the nhif, the smoh, and others (private interests, universities, and ngos). The opinions expressed by the authors do not necessarily reflect the opinions of the chulalongkorn university, thailand, or the national health insurance fund, sudan.
|
Blunt traumatic infrarenal aortic injuries are rare, with a few case reports in the literature . A more common occurrence is an intimal flap which may form after blunt injury to the aorta, and most of these will resolve with anticoagulation alone [1, 2]. Blunt aortic injury which initially presents as an intimal flap (grade i) may progress and evolve into an intramural hematoma (grade ii) or a pseudoaneurysm (grade iii). Aortic intimal flap progressing to dissection or pseudoaneurysm is an occurrence identified in 2% or less of the patients, and the majority of these occur in the thoracic aorta [1, 2]. This article presents the case of a young woman found to have an intimal flap in the infrarenal abdominal aorta after a car accident, and the injury progressed to a pseudoaneurysm over 3 months . A 47-year - old woman with a history of hypertension and smoking was involved in a high - speed motor vehicle accident and presented to the emergency department with back pain . Computed tomographic (ct) scans were obtained of her abdomen and pelvis . On a single image from the abdominal scan, what appeared to be either an intimal flap or a small amount of contrast extravasation outside of the infrarenal aorta could be seen . Her care providers had differing opinions as to what was being seen on the image . Since the abnormality was only seen on a single image, the exact etiology could not be delineated (fig . The patient was observed in the hospital overnight, had minimal complaints the next day, and was discharged on aspirin . Figure 1:initial ct scan shows enhancing vascular abnormality on the right side of the aorta, shown by the black arrow . Initial ct scan shows enhancing vascular abnormality on the right side of the aorta, shown by the black arrow . A follow - up ct scan was obtained 3 months later . At the location of the previous aortic abnormality, there was a 3 1 cm pseudoaneurysm that had formed and could now be clearly seen (figs 2 and 3). Figure 2:pseudoaneurysm now clearly seen 3 months later . Figure 3:black arrow pointing to pseudoaneurysm with enhancing flow outside of the aortic lumen . Operative repair was recommended, but the patient s aorta measured only 18 mm at the aortic bifurcation and was too small for even the smallest endovascular stent graft available at our institution . Therefore, an open replacement of her infrarenal aorta was performed using a dacron 22 mm graft . In the operating room, after the aorta was clamped and opened, a 4 mm tear in the intima had formed a mature channel into the pseudoaneurysm . The patient recovered very well and was discharged from the hospital without complications . At her 2-year follow - up, she was in good health and had no further problems, but continues to smoke . Blunt abdominal aortic trauma occurs in only 0.040.1% of all nonpenetrating traumas [3, 4]. And the vast majority of these (92%) are associated with multiple other injuries [3, 5]. Our patient had no other injuries, and there was no retroperitoneal hematoma or other signs of vascular injury in the area, as is usually seen on ct when the aorta is injured [35]. The lack of other radiographic traumatic findings added to the initial confusion as to whether there was a true injury to the aorta, or if the single image was showing artifact or an enlarged vertebral vessel . Since the majority of intimal flaps heal with anticoagulation alone (55%) or remain stable (40%), a conservative plan including daily aspirin and re - imaging in 3 months was chosen . When repeat imaging showed a 3 cm pseudoaneurysm, operative repair was necessary . Endovascular repair was initially chosen for this case, but after measuring the patient s aorta, femoral vessels and the degree of taper at the bifurcation, there was not an appropriate endovascular prosthesis available in such a small size . Only one study has compared conventional open repair with endovascular repair for blunt injuries of the abdominal aorta and found similar results in both groups . Endovascular repair is generally favored since the injuries tend to be focal and discrete, making them quite amenable to a short graft . Further, the patients usually have other significant injuries that would complicate a long, and potentially morbid, open operation on the aorta . Although all blunt infrarenal aortic injuries are unusual, most of them consist of intimal flaps or dissections [3, 58]. A post - traumatic pseudoaneurysm, as this patient had, is even more unusual after blunt trauma . One prior publication did document the delayed occurrence of a post - traumatic infrarenal aortic pseudoaneurysm that was diagnosed 3 years after injury . Endovascular repair for pseudoaneurysms must include post - procedure angiography to document no evidence of a type i or type ii endoleak, which could allow filling of the aneurysm sac and later rupture . This case report highlights the need for delayed imaging for even minor intimal flaps or small aortic injuries after trauma, since progression does occur . While the vast majority of these injuries improve over time or remain stable, a small percentage will worsen and require intervention.
|
Strains carrying proa - tev - rpt1 were grown in 6 l of sd medium to od600 0.8 to 1.2 . Cells were harvested, washed once with ice - cold water and drop - frozen in liquid nitrogen . Frozen yeast samples were then ground using an mm301 grinding mill (restch) under liquid nitrogen following manufacturer s instructions, or using a mortar and a pestle as previously described24 . Ground powder was hydrated in proteasome buffer (50 mm tris - hcl [ph7.5], 5 mm mgcl2, 1 mm edta, and 10% glycerol) supplemented with 2 mm atp, protease inhibitor tablets (complete, roche), 2 mm pmsf, 1 mm benzamidine, 10 g / ml pepstatin a, and 1 g / ml antipain . Cell extracts were cleared at 30,000 g for 30 min at 4c, and the supernatants were mixed with rabbit igg resin (cappel, mp biomedicals) for 90 min at 4c . Resins were collected at 900 g for 2 min at 4c and washed with proteasome buffer containing 50 mm nacl three times, followed by a final wash with proteasome buffer alone . Bp1 was then released from the resin by incubating with actev protease (invitrogen) at 2.5 unit / l culture in proteasome buffer containing 2 mm atp and protease inhibitors for 1 hr at 30c . Eluates were concentrated using ultrafree-0.5 centrifugal filter device with 30 kda nmwl (millipore). Strains carrying proa - tev - rpt1 were grown in 6 l of sd medium to od600 0.8 to 1.2 . Cells were harvested, washed once with ice - cold water and drop - frozen in liquid nitrogen . Frozen yeast samples were then ground using an mm301 grinding mill (restch) under liquid nitrogen following manufacturer s instructions, or using a mortar and a pestle as previously described24 . Ground powder was hydrated in proteasome buffer (50 mm tris - hcl [ph7.5], 5 mm mgcl2, 1 mm edta, and 10% glycerol) supplemented with 2 mm atp, protease inhibitor tablets (complete, roche), 2 mm pmsf, 1 mm benzamidine, 10 g / ml pepstatin a, and 1 g / ml antipain . Cell extracts were cleared at 30,000 g for 30 min at 4c, and the supernatants were mixed with rabbit igg resin (cappel, mp biomedicals) for 90 min at 4c . Resins were collected at 900 g for 2 min at 4c and washed with proteasome buffer containing 50 mm nacl three times, followed by a final wash with proteasome buffer alone . Bp1 was then released from the resin by incubating with actev protease (invitrogen) at 2.5 unit / l culture in proteasome buffer containing 2 mm atp and protease inhibitors for 1 hr at 30c . Eluates were concentrated using ultrafree-0.5 centrifugal filter device with 30 kda nmwl (millipore).
|
Worldwide, head injury is the single largest cause of death and disability following an injury . The burden of head injury is greatest in low- and middle - income countries (lamic), where 85% of the world's population live . The world health organization estimates that almost 90% of deaths due to injuries occur in these settings . Head injury is the leading cause of disability in people under 40, severely disabling 150200 people per million annually . In 2005, road traffic injuries resulted in the death of an estimated 110,000 persons, 2.5 million hospitalizations, 89 million minor injuries and economic losses to the tune of 3% of the gross domestic product in india . The accident rate of 35/1000 vehicles in india is also amongst the highest in the world . However, resources have not been diverted adequately by governments toward prevention, management and rehabilitation of head injuries in lamic such as india . Most patients with severe traumatic brain injuries (tbi) in developing countries are discharged to home - based care due to lack of rehabilitative facilities and health insurance . Those patients who are discharged in an unconscious state are particularly difficult to manage at home and are prone to decubitus ulcers, respiratory infections, inadequate nutrition, and physiotherapy . However, data is lacking on the actual load of vegetative patients and their outcomes, especially from developing countries . Patients, who remain unresponsive to the environment even though their eyes may be open, are considered to be in a vegetative state (vs). A persistent vs has been defined as a vs still present 1 month after acute traumatic or nontraumatic brain damage . As by definition, vs requires a minimum period of 1 month of remaining unconscious, most patients who remain unconscious are not labeled as vegetative at discharge . However, there are no studies assessing conversion to vs, specifically in this group of patients . In this retrospective study carried at one trauma center in india, a prospectively maintained neurotrauma registry was queried from may 2010 to february 2013 for patients who had severe traumatic brain injury glasgow coma score (gcs 8) at admission and had a motor response of m5 or lower on the gcs at discharge . Unconsciousness was described as patients with a motor score of m5 or lower on the gcs irrespective of the verbal (v) or eye (e) response . Demographic and clinical data was analyzed, and outcome assessed at 6 months after injury using a telephonic questionnaire . The questions asked were: (1) is the patient alive? (2) if alive, is the patient responding to commands (conscious)? (3) if the patient is conscious, is he able to perform activities of daily living like feeding himself, going to toilet independently and going to preinjury occupation? If the family members replied that patient had gone back to preinjury occupation it was considered as glasgow outcome scale (gos) 1, if patient was able to perform activities of daily living, but not able to go back to work it was considered as gos 2, if patient was conscious but not able to do activities of daily living, it was considered as gos 3 . If a patient remained unconscious, it was gos 4 and if the patient had died it was gos 5 . Gos 13 was considered as the unfavorable outcome and gos 45 was considered as a good outcome . Of these 166 (10.9%) were unconscious (motor response m5 on the gcs or lower) at discharge from the hospital . Average hospital stay was 24.31 days (range: 864 days) and was 16.71 days for m5, 20.63 days for m4, 26.33 days for m3, 30.59 days for m2 and 16.3 days for m1 patients [table 1]. Mortality and outcome at 6 months with respect to motor scores at the time of discharge the discharge motor score was m5 in 32 (19.3%), m4 in 44 (26.5%), m3 in 59 (35.5%), m2 in 44 (26.5%) and m1 in 9 (5.4%). 54 (52.9%) patients had died and 32 (31.4%) remained unconscious (vegetative) at 6 months . 100% of m1, 90.6% of m2, 94.3% of m3, 72.2% of m4, and 60% of m5 patients had an unfavorable outcome at 6 months . Only 16 patients (15.7%) had a good outcome (gos 12) at 6 months post injury . Incidence, as well as the severity of head injuries, the, is rising in developing countries due to rapid industrialization with a lag in legal, healthcare, and safety reforms . Delhi with a population of around 15 million has the dubious distinction of having the largest number of road traffic accidents of any city in india . The enormity of burden can be assessed by the fact that our study had more than 1500 severe head injured patients in <3 years and was conducted at only one hospital! One of the reasons for the step - motherly attitude by policy makers toward head injury prevention, management, and rehabilitation, is the lack of hard statistics of the actual burden of disease which head injuries carry . In spite of the improvement in care for head injured patients, there has not been a marked decline in the mortality rates for severe head injuries . Kagan and baker found that mortality rates were between 26.7% and 41.4% for severe tbi patients in level 1 trauma centers . Fakhry et al . In their study found 28.8% mortality rate of severe tbi patients . It has also been shown that developing (low and middle income) countries have a pooled mortality rate of 51% for severe tbi as compared to 30% for high - income countries . Nevertheless, in - hospital mortality tells only part of the story on the outcome of these patients . Six months outcome is often poorer due to lack of rehabilitative care and facilities, especially in developing countries . Most of the patients are discharged to home - based rehabilitation with tracheostomy and oro - gastric tube in situ . In our center, unconscious patients with severe tbi are discharged with tracheostomy tube in situ after ensuring that patient can maintain oxygen saturation on room air and after training relatives regarding care of tracheostomy tube, suctioning, and home - based rehabilitation . Interestingly, however, there are no studies on the outcome of patients who are discharged from the acute care facility in this unconscious state . Furthermore, a significant number (10.9% in our study) are discharged in the unconscious state . As all studies are based on admission gcs, it is also often not possible to assess how many patients remained unconscious at the time of discharge and became vegetative at 6 months . The outcomes of these patients have also not been studied properly . In our study, patients with m2 motor response had the longest hospital duration with unfavorable outcome occurring in 90% of these patients at 6 months . Gcs has remained a robust scale for assessment and prognostication in tbi and the motor score (m response) continues to have the highest predictive value within the gcs . We, therefore, decided to use motor response as criteria to differentiate unconscious and conscious patients . It may be sometimes difficult to differentiate unconsciousness from dysphasia as both disease states may show a motor response of 5 . However, left sided contusion in the posterior frontal and/or temporal regions along with the presence of gaze fixation are clues towards dysphasia . Our study had a reasonable follow - up of 61.4% of the patients at 6 months and showed the poor outcomes in this subgroup of patients . 54 (52.9%) patients (who were unconscious at discharge) had died and 32 (31.4%) remained unconscious (vegetative) at 6 months with only 16 patients (15.7%) having good outcome (gos 12) at 6 months . This study also shows that the majority of the patients (nearly 85%) who are discharged in an unconscious state will either die or become vegetative . This is the only study of its kind on patients who remain unconscious at discharge following severe tbi and reveals that around 50% will die, and another 30% become vegetative within 6 months of discharge.
|
Their marbling has been increased over many decades to meet domestic consumer preferences . In both countries, highly marbled beef is greatly prized for traditional meat cooking methods such as sukiyaki for japanese and gogigui for korean . Because of these demands, the use of heifers and steers instead of bulls, intensive feeding system, and genetic ability of wagyu and hanwoo cattle have resulted in greater fat deposition in these breeds compared to european breeds . As intramuscular fat (imf) improves beef quality at least in juiciness and flavor (hornsterin and wasserman, 1987; wheeler et al ., 1994) it is assessed in abattoirs by meat graders in various countries, including usa, australia, japan, and korea . Like other kinds of foods, meat has three functions: 1) it provides nutrition; 2) it provides deliciousness; and 3) it prevents disease . Although beef has these three functions, the main food in both japan and korea is boiled rice while beef is a side dish . Therefore, these two countries have developed the quality of beef rather than its quantity . This is quite different from foreign countries where meat is consumed as a main dish . In japanese and korean cuisine, soft and delicious beef with imf and a good red color in the past, fat was not given a good image in its role towards human health, although fat is an important energy resource for human . Recently, fat has been reported to have fewer adverse effects on health than carbohydrates, especially simple carbohydrates . In fact, meat has played a crucial role in human evolution of a healthy and well balanced diet (pereira and vicente, 2013). Furthermore, meat plays a pivotal role in nutritious diets . High quality marbled beef not only has excellent eating quality, but also contains a lot of beneficial fatty acids (troy et al ., 2016). In this regard, the current paper reviews the characteristics and health benefit of highly marbled beef from wagyu and hanwoo cattle . It has well known that wagyu cattle have high potential of accumulating imf and producing highly marbled beef . Hanwoo cattle are also known for their high imf for marbled beef similar to wagyu beef . Highly marbled wagyu loin contains more than 40% of imf, sometimes more than 60% (horii et al ., 2009), while quality grade 1 hanwoo, the highest quality grade, has approximately 28% of imf in longissimus thoracis muscle (hwang and joo, 2016). Wagyu cattle include four types of japanese cattle: the black, brown, short horn, and polled breeds . Numerous studies have investigated the meat quality, quantity, and muscle physiology of crossbreed wagyu (japanese black cattle) in foreign countries (cafe et al ., 2006; cafe et al ., 2009; greenwood et al ., 2006; greenwood et al ., 2009; may et al ., 1993). They are identified by different coat color: brown (major hanwoo), black face (heukwoo), black (jeju heukwoo), and tiger color (chickso) (jo et al ., 2012). In this review, wagyu and hanwoo are used to describe the japanese black breed and the brown coat color hanwoo, respectively . All four types of wagyu cattle have played important roles locally and in the history of mixed farming . They also played important roles in the synergies between cattle and crops, especially rice . Farmers gradually began to replace the role of cattle as draft animals and started to use industrial fertilizers approximately 50 years ago . In recent years, japanese wagyu cattle have been raised more specifically for beef production . The famous brand name wagyu not only includes the japanese black cattle produced in japan, but also includes animals or even cross - bred japanese black cattle produced in foreign countries such as australia and the united states . Similarly, the utilization of hanwoo cattle as an edible meat had been minimal for long time . Full - scale production of hanwoo as meat - type cattle has started since the 1970s . Because hanwoo cattle have maintained stable traits through pure breeding, the current blood lineage is very valuable . It is mainly spread in the korean peninsula (kim and lee, 2000). Recently, hanwoo beef has been reported to have highly marbled imf similar to wagyu beef . Especially, hanwoo beef has relatively thin muscle fiber and minimal content of connective tissues (kim et al ., 1994). It has less subcutaneous fat depth with greater ossification scores and marbling scores than those of australian angus (cho et al ., 2005). In 2013, a total of 2.64 million heads of cattle were fed for beef production in japan . Approximately 1.71 million heads were japanese black cattle (maff, 2013), and approximately 873,400 were holstein cattle ., the number of farmers producing beef was 613,000, but 86.5% of these farmers fed less than 50 heads of cattle . The mean body weight and carcass weight of beef at slaughter (26 - 30 mon of age) were 725 kg and 470 kg, respectively . High performance marbled beef production has caused japanese black cattle to comprise the greatest share of japan s wagyu cattle population (albrecht et al ., 2011; recently, the imf percentage of beef from japanese black cattle has an average value of greater than 30% (albrecht et al ., 2011; horii et al ., the total number of slaughter cattle was 1,007,000, including 883,593 hanwoo cattle, 66,485 holstein cows, and 56,923 holstein heifers and bulls (kape, 2015). The number of cattle farming households was 99,858, including 89,403 hanwoo farmers (kape, 2015). During the last decade, the number of households raising hanwoo cattle has drastically decreased from 186,000 households in 2006 to 89,403 households in 2015 (kape, 2016). The average live and carcass weights of hanwoo cattle at slaughter (26 - 30 mon of age) were 719 kg and 430 kg, respectively (kape, 2015). Wagyu carcasses are evaluated by accredited graders from the japan meat grading association (jmga) in accordance with beef carcass grading standards . First established in 1988, the present grading system assigns both yield grade (a, b, and c) and meat quality grade (1, 2, 3, 4, and 5) (jmga, 2014). In korea, all cattle carcasses should be evaluated by korean carcass grading system . Established in 1992, the korean carcass grading system presently has three levels of yield grade (yg) for meat amount (a, b, and c) and five levels of meat quality grade (qg) (1, 1, 1, 2, and 3) (kape, 2016). For beef quality grading in japan, all cattle carcasses are graded at the 6 to 7 rib section at least one hour after ribbing . The following four items are independently evaluated: beef marbling; meat color and brightness; meat firmness and texture; and fat color, luster, and quality . Meat quality grade of the carcass is then assigned according to the lowest grade of these four items . Korean beef quality grading is also estimated based on several factors, including marbling score, meat color, fat color, firmness and texture of lean meat, and maturity of the exposed loin muscle at the 13 rib interface . This means that marbling score is the most dominating determinant in korea because korean consumers have an extraordinary preference for high marbled meats . In 1988, wagyu marbling levels were assigned by the beef marbling standard (bms) using a plastic model made from silicone resin . This standard was calculated based on the circumference and area percentage of marbling particles in the rib eye section (longissimus thoracis). In october 2008, a new marbling standard using carcass photographs replaced the 1988 standard . In march 2014, an even newer marbling standard 1). Graders now determine the bms number (1 to 12) by comparing the actual carcass marbling to the standard photograph of marbling . During this process, any larger inclusions of fat at the periphery of the rib eye are not considered as marbling according to the japanese grading system . The bms of korean carcass grading system has been changed by the addition of marbling number . In 1992, when the carcass grading system was established for the first time in korea, the bms had only 5 numbers (1 to 5) with 3 qg (1, 2, and 3). However, in 1997, new qg 1 was added with new bms no . 6 and no . Furthermore, in 2004, another new qg 1 was added with new bms no . 8 and no . Hanwoo beef with qg 1 or 1 is considered as a premium class of beef in korea . Of hanwoo cattle slaughtered in 2015, 10.0% were qg 1, 26.4% were qg 1, and 31.4% were qg 1 (kape, 2016). The plentiful marbling of wagyu and hanwoo beef has attracted attention . In both japan and korea, the value of cattle carcasses is determined by a qg which considers marbling as a decisive determinant . Since the liberalization of beef importation, marbling has been greatly emphasized to differentiate domestic beef from imported beef (hirooka, 2014; hwang et al ., 2010). The high content of imf can improve the texture and juiciness of hanwoo beef and thereby its acceptability (jung et al ., 2016). Korean consumers prefer qg 1 or 1 beef because of its high imf content (kim et al ., 1999). 2015) have demonstrated that an increase in crude fat content (range 23.8 - 48.6%) can increase the tenderness, juiciness, and fattiness . However, they also reported that an increase in crude fat content can reduce the crude protein content and slightly reduce the content of umami components such as nucleic acid and glutamic acid . It is well known that imf content varies depending on feeding time, finishing diet, and breed type . To produce high qg beef, great attention has been paid to more accumulation of imf in wagyu and hanwoo muscle . One of good strategy to increase imf content in beef muscle is to extend slaughtering age . Although the marbling score is increased and reached a plateau at about 24 mon of age (choi et al ., 2002), the slaughtering age of hanwoo has been extended to increase the bms score (jo et al ., 2012). In korea, the marketing age of hanwoo has been extended to an average of 31 mon with weight of 719 kg to fatten the cattle (kape, 2015). However, average daily gain is decreased due to increased slaughtering weight (paek et al ., 1993). Recently, cattle in china are fed for unusually long periods of time before slaughter as wagyu and hanwoo . This might have contributed to their high imf and oleic acid contents (smith, 2016; tanaka, 1985). It is clear that imf increases with feeding time for grain - fed and pasture - fed cattle . However, the rate of imf increase in grain - fed cattle is faster than that in pasture - fed cattle (smith et al ., 2009). It has been reported that wagyu fed on a high - concentration diet have higher expression of adipogenic transcription factors in the subcutaneous and intramuscular adipocytes than those fed on a high - rough - age diet (yamada and nakanishi, 2012). The imf content and the numbers of preadipocytes and adipocytes are reported to be higher in wagyu than those in angus (duarte et al ., 2013). (2009) have reported that the imf contents in the longissimus muscle of wagyu, german angus, belgain blue, and holstein friesian are 23.3%, 4.4% . The wagyu and european cattle breeds did not differ in their mechanisms of postnatal fat accretion . However, they differed in their efficiency of accretion of imf (gotoh et al ., 2009). For every 1% increase of imf in the longissimus muscle, the increase amounts of subcutaneous adipose tissue in wagyu, holstein friesian, german angus, and belgain blue were 3.0, 4.3, 7.9, and 10.7 kg, respectively (gotoh et al ., 2009). Although imf content is the most dominating determinant of beef quality, the imf content is not the only parameter that decides the quality grade of beef carcass . Marbling is called shimo - furi in japanese and sang - gang in korean . It literally means frosting . In japan, marbling with a fine appearance resembling frost is highly valued, but coarse marbling is not (motoyama et al ., recently, korea also began to discriminate between fine and coarse marbling in hanwoo beef . This marbling quality contributes to the tenderness of beef because imf deposits are found mainly between muscle fiber bundles, resulting in the disorganization of perimysium connective tissue (nishimura, 2015; sasaki et al ., 2012). Therefore, the sensory of tenderness could be qualitatively affected by histological difference in marbling due to difference in tissue disorganization extent . There are several types of fatty acids: 1) monounsaturated fatty acids (mufa), 2) polyunsaturated fatty acids (pufa), and 3) saturated fatty acid (sfa). Pufa such as linoleic acid, -linolenic acid (n-3), -linolenic acid (n-6), arachidonic acid, and so on contain many important compounds such as essential fatty acids . The fatty acid that has the highest amount in beef is oleic acid (c18:1n-9). It has been reported that fatty acid compositions are different depending on breeds (smith et al ., 2006 the fatty acid compositions in highly marbled wagyu and hanwoo are considerably different from those in other cattle breeds . Highly marbled wagyu beef has a higher percentage of mufa within fat compared with other breeds (yang et al ., 1999a). (2006) have investigated oleic acid concentrations in the subcutaneous adipose tissues of wagyu, hanwoo, australian crossbred, angus (corn - fed), angus (hay - fed), and angus (weaned) and found that they are 52.9%, 47.3%, 39.8%, 39.8%, 34.6%, and 32.9%, respectively . A higher percentage of mufa will lead to a lower fat - melting point which contributes to the softness of beef fat and favorable beef flavor . It may decrease the circulating concentration of ldl cholesterol in consumers (melton et al ., 1982; rudel et al ., 1995; smith, 1994). Therefore, fatty acid compositions of beef have recently become important in the beef industry, especially in highly marbled wagyu and hanwoo cattle (1995) have investigated the effect of breed type (including japanese black) and sex on fatty acid compositions of subcutaneous and intramuscular lipids in finishing steers and heifers of pure japanese black and holstein as well as crossbred japanese black, holstein, japanese brown, and charolais . They have reported that the japanese black is genetically predisposed to producing carcass lipids containing higher concentrations of mufa than holstein, japanese brown, or charolais steers (zembayashi et al ., 1995). 1992) have also concluded that beef from purebred wagyu cattle raised in japan is rich in mufa . (2011) have compared intramuscular fatty acid composition of longissimus muscle in 26-month - old japanese black steers and holstein steers reared and fattened using a standard fattening system (table 1). In the longissimus muscle of japanese black steers, a higher percentage of unsaturated fatty acid was found than that in holstein steers (gotoh et al ., 2014) 2011) have also compared the imf content and fatty acid compositions of 21 major skeletal muscles using the same animals . Muscles from the japanese black cattle contained a greater proportion of numerous fatty acids, particularly mufa such as c16:1, c18:1, and c20:1 compared to fatty acids in holstein cattle . In japanese black cattle, the proportion of sfa including c18:0 was much lower compared to that in holstein cattle . Sfa: saturated fatty acids, mufa: monosaturated fatty acids, pufa: polysaturated fatty acids . 2005) have investigated the fatty acid compositions of hanwoo and australian angus beef and found a significant difference in fatty acid compositions between these two cattle breeds (table 2). Especially, angus beef had significantly higher n-3 pufa while hanwoo beef contained greater n-6 pufa in three different muscles (cho et al ., 2005). The difference in fatty acid composition might be attributed to the influence of different diets, forage, and grain feeding, although fatty acid profile in ruminants is not a direct reflection of the dietary fatty acid composition due to hydrogenation by rumen microorganism (enser et al ., 1998). Sfa: saturated fatty acids, usfa: unsaturated fatty acids, mufa: monosaturated fatty acids, pufa: polysaturated fatty acids . F - ratio statistic: * if p<0.05, * * if p<0.01, * * * if p<0.001 . Therefore, it can be easily anticipated that hanwoo beef has a fatty acid profile similar to that of high concentratefed animals (jo et al ., 2012). Recently, hwang and joo (2016) have evaluated the fatty acid profile of ten muscles from high marbled (qg 1) and low marbled (qg 2) hanwoo carcass and found significant differences in fat content and fatty acid composition among 10 muscles and between high and low marbled hanwoo beef . In particular, high marbled hanwoo muscles had significantly higher proportion of mufa due to higher oleic acid (c18:1) proportion, while low marbled hanwoo muscles had higher proportion of sfa due to higher proportion of stearic acid (c18:0) (hwang and joo, 2016). Stearoyl - coa desaturase (scd) was first identified and reported as one of the genes associated with beef fatty acid composition (taniguchi et al ., the composition of fatty acids stored in fat depots reflects the earlier action of scd on substrates such as stearic acid and palmitic acid (kim and ntambi, 1999). 1999b) have reported interesting correlations between scd enzyme activity and fatty acid composition in bovine adipose tissue . Although the adipogenic mechanism is extremely complicated, several genes have been identified and confirmed as either associated with or responsible for the fatty acid composition in wagyu cattle (gotoh et al ., 2014). It is generally accepted that the concentration of oleic acid in beef adipose tissue is dependent on scd expression and activity . Wagyu cattle are genetically disposed to produce more oleic acid (smith et al ., 2006). Very high heritability has been reported for oleic acid in wagyu cattle (nogi et al ., 2011). Higher levels of concentrated feed in the later fattening period can lead to higher mufa concentration in the subcutaneous adipose tissues of wagyu steer (kimura et al ., interest in beef fat and fatty acids has been increasing, especially in highly marbled beef such as wagyu and hanwoo because fatty acids composition in the diet have impact on human health . Consumption of fat and cholesterol has been reported to be linked to cardiovascular disease, obesity, and cancer (micha et al ., 2010; consequently, reduction of total fatty acid intake and replacement of sfa with pufa have been recommended . Ulbricht and southgate (1991) have demonstrated that stearic acid has no effect on plasma cholesterol level and that oleic acid can lower serum cholesterol similar to pufa . Furthermore, pavan and duckett (2013) have suggested that a higher proportion of oleic acid in beef is desirable because the consumption of high - oleic acid ground beef can increase hdl - cholesterol concentration (gilmore et al ., 2011). According to smith (2016), the amount of fat consumed in a typical portion of beef will not increase risk factors for cardiovascular disease . Clinical trials have demonstrated that ground beef containing elevated oleic acid can increase the concentration of hdl - cholesterol or at least has no negative effect on the concentration of hdl - cholesterol . In earlier research on oleic acid, the major mufa in beef, grundy et al . (1988) have found that it can lower ldl - cholesterol without affecting beneficial hdl - cholesterol . (2014) have reported that mufa can normalize or improve lipid metabolism and maintain the balance in cardiac muscle . These have implied that mufa have little effect on total cholesterol and that they are heart - healthy dietary fat that can lower ldl - cholesterol and increase hdl - cholesterol (lahey et al ., 2014). This effect is repeatable when natural foods are used to supplement diets with oleic acid . In this regard, smith (2016) have concluded that beef cattle should be raised under production conditions to increase the concentration of oleic acid in their edible tissue, i.e., by grain feeding over extended periods of time . It is obvious that consumer in the world has an overwhelmingly negative attitude toward animal fats, especially saturated fat in meat for the last several decades (ngapo and dransfield, 2006; williams and droulez, 2010). According to higgs (2000), the per capita decline in beef consumption in the us and other western countries has been attributed in large part to animal fat phobia . Consumers have been warned to reduce saturated fat in their diet and to avoid meat cuts containing high fat content . These health recommendations are obviously in conflict with the health of highly marbled wagyu and hanwoo beef . Many research studies have shown that the imf of wagyu and hanwoo beef contains a lot of mufa that could prevent arteriosclerosis . Researches have also demonstrated that high - oleic acid ground beef may reduce risk factors for cardiovascular disease (adams et al . Thus, although some consumers in japan and korea consider highly marbled wagyu and hanwoo beef as being unhealthy, there is no scientific evidence to indicate that beef that is high in oleic acid will increase risk factors for diseases (smith, 2016). Consequently, the role of animal fats in the diet should be re - evaluated because scientists around the globe increasingly doubt the validity of the so called diet - heart hypothesis it is now generally accepted that diets with low fat, high carbohydrate failed to curb obesity (drewnowski, 2015). On the other hand, more recent functional medicine research studies have suggested that the intake of fat has positive effect on human health (saito, 2016). It is essential to consume fats containing good quality fatty acids while reducing the consumption of food high in simple carbohydrates . Excessive intake of simple carbohydrates is detrimental to health because they have negative effects on the body (yu et al ., 2013). In this regard, inclusion of high fat foods with superior sensory properties in a balanced diet such as highly marbled wagyu and hanwoo beef is likely to gain wider acceptance as a well - being food in the near future . In japan and korea, highly marbled wagyu and hanwoo cattle are greatly prized for traditional meat cooking methods . Many researches have shown that wagyu and hanwoo cattle have high potential of accumulating imf and producing highly marbled beef . The beef quality grading system in both countries is primarily determined by marbling score with bms and additionally adjusted by other carcass traits . Literature suggests that imf content varies on the basis of feeding time, finishing diet, and breed type . Great attention has been paid to more accumulation of imf to produce high quality grade beef . The rate of imf increase in grain - fed cattle is faster than that in pasture - fed cattle . Highly marbled wagyu and hanwoo beef have higher proportions of mufa due to higher concentrations of oleic acid . They are heart - healthy dietary fat because they can lower ldl - cholesterol while increasing hdl - cholesterol . Clinical trials have also indicated that highly marbled beef does not increase ldl - cholesterol and that beef high in oleic acid can consistently increase hdl - cholesterol . Finally, literatures have concluded that high - oleic acid beef such as wagyu and hanwoo beef may reduce risk factors for cardiovascular diseases.
|
N - acetyl - l - cysteine (nac) is an endogenous aminothiol present both in human plasma and in urine . N-(2-mercaptopropionyl)glycine (mpg), also known as tiopronin, is a synthetic aminothiol antioxidant . Nac has been in clinical use for more than 40 years, primarily as a mucolytic agent in a variety of respiratory illness . Intravenous and oral administration of nac have been extensively used in the management of paracetamol (acetaminophen) poisoning . Mpg is primarily used in the treatment of cystinuria, but studies have shown that mpg can be used as a chelating, cardioprotecting, and radioprotecting agent, as well as an antidote to heavy metal poisoning . A number of electrochemical [59], fluorometric [1012], chemiluminescence [1315], and liquid chromatographic [1618] methods have been developed for the determination of nac and mpg in biological samples and pharmaceuticals . Spectrophotometry is the most widely used technique in pharmaceutical analysis because it is simple, economic, and easily available to most quality control laboratories . Spectrophotometric methods have also been reported for the determination of nac and mpg in pharmaceutical formulations [1925]. A coupled redox - complexation reaction has been reported for the spectrophotometric analysis of nac and mpg using 1,10-phenanthroline as the chromogenic reagent . In the present work, we report a simple and cost - effective spectrophotometric method for the reliable analysis of nac and mpg in pharmaceutical formulations . The method is also based on the coupled redox - complexation reaction between nac or mpg and fe(iii) but uses 2,4,6-tripyridyl - s - triazine (tptz) as the chromogenic reagent . Collins et al . Have introduced tptz as chromogenic reagent for determination of fe(ii). The fe(ii) complex with tptz has a twice higher molar absorptivity coefficient (2.2 10 l mol cm) than the fe(ii) complex with 1,10-phenanthroline (1.1 10 l mol cm). All spectrophotometric studies were carried out on an ultraviolet - visible, double - beam spectrophotometer (uv-1601 shimadzu, kyoto, japan), and using 1 cm quartz cells . Measurements of ph were carried out with a mettler toledo sevenmulti potentiometer (mettler toledo, schwerzenbach, switzerland) equipped with a combined glass electrode mettler toledo in lab 413 . A thermostated water bath (mgw lauda, germany) was used to keep a constant cuvette temperature of 25 0.5c . All chemicals were of analytical - reagent grade, and solutions were prepared in milliq deionised water . Separate 10 mm stock solutions of nac and mpg were prepared by dissolving 163.2 mg (1 mmol) of nac (merck, darmstadt, germany) or 163.2 mg (1 mmol) of mpg (sigma - aldrich, st . Louis, usa) in deionised water up to 100.0 ml volume and stored in the dark bottle at 4c . Dilutions were prepared daily in deionised water . Stock solution of fe(iii) (10 mm) was prepared by dissolving 270.3 mg (1 mmol) of fecl3 6 h2o (kemika, zagreb, croatia) in 50.0 ml deionised water . Then 0.5 ml of concentrated hcl was added and the volume was adjusted to 100.0 ml with deionised water . A stock solution of 10 mm tptz (merck, darmstadt, germany) was prepared by dissolving 312.3 mg (1 mmol) tptz in 2.0 ml of a 6.0 m hcl, followed by addition of deionised water up to a total volume of 100.0 ml . M) was used to cover the ph range 3.24.0 . For solutions of ph 1.0 and 2.0, two different pharmaceutical formulations of nac were analysed by the present spectrophotometric method, that is, fluimukan 200 mg granules, and fluimukan akut 600 mg dispersible tablets (lek, ljubljana, slovenia). An accurately weighed portion of the powder containing about 200 mg of nac was transferred into a 500 ml volumetric flask, and nac was dissolved in and diluted to the nominal volume with deionised water . Ten tablets of the mpg - containing drug captimer (mit gesundheit gmbh, germany) were weighed and pulverised . A powder quantity equivalent to 100 mg of mpg was dissolved in 300 ml of deionised water, filtered through filter paper (blue ribbon, s&s, germany), and the filtrate collected in a 500 ml volumetric flask was diluted by deionised water to the nominal volume . It is noteworthy that such solutions are not stable and should be analysed within 24 hours . These solutions were further diluted quantitatively with water to obtain suitable concentrations for the analysis by the proposed spectrophotometric method . Acetate buffer (20.0 ml, ph 3.6) was pipetted into a 25.0 ml calibrated flask . Then 1.25 ml of 10.0 mm fe(iii), 1.25 ml of 10.0 mm tptz, and 1.0 ml of nac or mpg solutions were added . The flask with reaction solution was filled to the nominal volume with deionised water, mixed well, and kept at room temperature (about 25c) for 30 min (mpg) or 60 min (nac). The absorbance of the produced fe(ii)-tptz complex was measured at = 593 nm against a blank solution, prepared in the same manner with 1.0 ml water instead of 1.0 ml sample solution . Nac and mpg concentrations in pharmaceutical preparations were determined by using daily prepared calibration curves . The eleven solution of every analyte were prepared for the concentration range from 1.0 m to 100.0 m . The proposed method is based on the coupled redox - complexation reaction . In the first (redox) step of the reaction (see (1)), rsh compound (nac or mpg) reduces fe(iii) to fe(ii) whereas rsh molecules themselves oxidize to thiyl radicals rs which combine to form the disulfide rssr . In the second step of the reaction (see (2)), in situ formed fe(ii) is immediately complexed by 2 molecules of tptz to form the deep - blue coloured, highly stable fe(tptz)2 complex which absorbs light at max at 593 nm . The net overall reaction can be expressed by reaction (3): (1)fe3++rshfe2++h++rs (2)fe2++2 tptzfe(tptz)22 + (3)2 fe3++2 rsh+4 tptz2 fe(tptz)22++rssr+2 h+ krishnamurti and huang have reported that the complexation of tptz is specific for fe(ii) so that this reaction can be performed in the presence of large amounts of fe(iii). The results of the present study confirm these previous results for the drugs nac and mpg serving as the reducing agents . In the literature, we were not able to find the standard reduction potential for nac and mpg . However, the calculated formal potential of the fe(iii)/fe(ii) couple of 0.578 v, equations (4) and (5) indicate that its oxidizing power in solution with tptz is more negative than in solution with 1,10-phenanthroline (1.197 v). This means that the proposed method with the tptz is selective for the determination of nac and mpg . Thiols or other reducing substances with standard (formal) potentials higher than 0.6 v would not interfere in the proposed method (see (6)); (4)e10=efe3+/fe2 + 00.05922log (fe2+fe3+[tptz]2)2, (5)e10=0.771 v0.0592log 1.2651050.077(3104)2=0.578 v (6)e20=erssr / rsh00.0592ph . In previous work, we found that the initial redox - complexation reaction rate is higher with mpg compared to nac [28, 29]. In the coupled redox - complexation reaction with mpg, the steady state value of the absorbance is reached after 30 min while in the reaction with nac the steady state value of the absorbance is reached after 60 min . With both thiols, . Equation (6) indicates that the potential for the redox system rsh / rssr depends upon the ph value of the reaction mixture . The effect of the ph was therefore investigated over the range 1.04.0 using 0.1 m hcl for ph 1, 0.01 m hcl for ph 2, and acetate buffer for the ph values 3.2, 3.5 and 3.6 . In this experiment mpg the absorbance at 593 nm increased with increasing ph up to the value of 3.6 . However, precipitation of iron hydroxide occurred at the ph above 3.8 . Therefore, a buffered reaction medium of ph 3.6 was chosen as a compromise for keeping fe(iii) in solution and achieving quantitative formation of the fe(tptz)2 complex which is stable in the ph range 3.45.8 . The influence of the fe(iii) concentration on the determination of nac and mpg at the fixed concentration of 40 m each was studied in the concentration range from 20 m to 400 m, allowing a molar ratio fe(iii)/rsh from 0.5 to 10 . In figure 2, the absorbance measured at 593 nm is plotted versus the molar fe(iii)/rsh ratio for nac and mpg . Figure 2 shows that the reaction can be forced to completion by increasing the fe(iii)/rsh ratio, for instance by increasing the fe(iii) concentration . The influence of the tptz concentration on the analysis of nac and mpg at the fixed concentration of 40 m rsh compound was studied in the range from 20 m to 400 m allowing a tptz / rsh molar ratio of 0.5 to 10 . Figure 3 shows that absorbance increased with increasing tptz / rsh molar ratio, that is, with increasing tptz concentration, to reach its maximal value at a molar excess of five . The effect of the reaction temperature on the signal intensity was examined by varying the temperature from 25c to 40c using the thermostated water pump . We found that the reaction rate increased by elevating reaction temperature (see [28, 29]). Since the proposed method is an equilibrium method, signal is recorded when the reaction reaches the state of equilibrium . The signal intensity in the state of equilibrium is the same for all the examined temperatures . The linearity of the method was investigated under the optimized conditions for nac and mpg in the concentration range from 1.0 to 100.0 m . Straight lines were obtained from linear regression analysis of the absorbance at 593 nm and the drug concentration (table 1). The lowest quantifiable concentration of nac and mpg by this method was 1.0 m each . The effect of some possible interfering cations and anions on the analysis of a fixed concentration of 40.0 m for nac and mpg was investigated for the maximum molar ratio of foreign ions . The influence of excipients that can commonly accompany nac and mpg in pharmaceutical formulations was also studied . The tolerance is defined as the foreign - ion / excipient concentration causing an error smaller than 5% for the determination of the analyte of interest . The tolerable concentration of kno3 and na2so4 was 40.0 mm (molar ratio, 1000: 1). The tolerable concentration of glucose, fructose, sucrose, boric acid, and acetic acid was 20.0 mm (molar ratio, 500: 1). Thus, the commonly excipients glucose, fructose, and sucrose do not interfere with the analysis of nac and mpg because they essentially do not react with the oxidizing agents . It should be emphasized that the contaminant / analyte concentration ratios studied in the present work are much higher than those normally found in commercial pharmaceutical products . The tolerable concentration of some other thiols, that is, d - penicillamine, l - glutathione, and l - cysteine, was 40.0 m (molar ratio, 1: 1). Thiols or other reducing substances with standard (formal) potentials higher than 0.6 v would not interfere in the proposed method . In order to evaluate the potential of the proposed method to the analysis of real samples, the method was applied to three pharmaceutical formulations of the drugs nac and mpg . The results of these analyses are presented in tables 2 and 3 . For comparison, the spectrophotometric method reported by raggi et al . These authors used 1,10-phenantroline as an chromogenic reagent, instead of tptz which is used in the present work . As shown in table 2, there were no significant differences between the values obtained by the reported method and those obtained by the proposed method (p> 0.1, student t - test). This actually suggests that the proposed method is accurate and precise as the earlier reported method . The accuracy of the method was further ascertained through the recovery studies . To the drug solutions of the granules or the tablet powder, the standard solutions of the synthetic nac or mpg these results indicate that the proposed method is accurate for the determination of nac and mpg in their commercially available pharmaceutical preparations without any significant interference by common pharmaceutical excipients which do not absorb light in the visible region . Performance characteristic of existing equilibrium spectrophotometric methods [19, 2124] and the proposed method are compared in table 4 . The proposed method is free from drastic experimental conditions such as heating unlike some of reported methods . Some other thiol compounds do not interfere in the proposed method at molar ratio 1: 1 . It is also worth mentioning that the proposed method was performed in the visible region (= 593 nm) away from the uv - absorbance of the uv - absorbing interfering excipient materials, which might be dissolved from pharmaceutical formulations . Undoubtedly, hplc is one of the most widely used techniques in routine analysis of pharmaceuticals, but it involves expensive instrumental set which many laboratories in developing and underdeveloped countries cannot afford . The proposed equilibrium spectrophotometric method based on the coupled redox - complexation reaction of the thiol drug nac or mpg with fe(iii) and tptz can be applied in every analytical laboratory as a reliable method for the determination of nac or mpg in pharmaceutical preparations . Due to the use of tptz the coloured fe(tptz)2 complex is stable in an extended period of time up to 24 hours . Regular excipients and additives present in the pharmaceutical preparations of nac and mpg do not interfere in this method.
|
Vascular malformation is known as one of the major therapeutic problem even to the most experienced clinicians . These malformations grow proportionately with age, and may involve multiple anatomical spaces and encase critical neuromuscular structures, associated with nerve damage, massive bleeding, and deformity . Management of arteriovenous malformations (avms) remains challenging because of their unpredictable behavior and high recurrence rate if treated by curettage alone without inadequate ligation of the feeder vessels . These lesions are treated by variety of techniques over the years, including surgical excision, irradiation, electrocoagulation, cryotherapy, intravascular magnesium or copper needles, systemic corticosteroids, interferon-, embolization, cryotherapy, lasers and sclerotherapy . Sclerotherapy is an effective, conservative and low cost technique for the treatment of benign vascular lesions, included vascular malformation . The sclerosant agents used are 5% sodium morrhuate, sodium psylliate, quinine urethrone, 5% ethanolamine oleate, 1% polidocanol, sodium tetradecil sulfate, and hypertonic saline . We present our experience in treating palatal vascular malformation using direct ethanol sclerotherapy as a cheep therapeutic modality for treatment of deeply seated vascular lesion . Twenty one - year old saudi male patient presented to the department of oral and maxillofacial surgery clinic at king abulaziz university complaining of swelling on the right side of the face (figure 1a). Extra - oral clinical examination revealed swelling on the right side of the face, which is soft and compressible . Intraoral examination showed a bluish swelling at the junction of soft and hard palate that bleed easily on touch . Computerized tomography (ct) and magnetic resonance image (mri) studies revealed that it is a vascular malformation that extends to the infratemporal area (figure 2). The patient was advised to have ethanol directly injected into the lesion as surgical excision was hazardous and difficult to achieve . Patient disagree with that option and disappear for 18 months and returned back with severe gingival inflammation around the whole right maxillary quadrant which appeared covered by heavy calculus as he could not brush his teeth because of bleeding that he described as extensive (figure 1c). Advised was given to the patient that the only treatment option we can offer him is the ethanol injection . The procedure and possible complications were explained to the patient and family and they agreed to that option . Under general anesthesia using fibro optic intubations, as the lesion was approaching the soft palate and there was a fear that routine nasal intubations could be hazardous to the airway, contrast medium was injected toward the engorged vascular lesion using a no . 18 venipuncture catheter (to determine the volume of the growths before treatment), followed by injection of one - third to one - quarter cavity volume of 95% ethyl alcohol into the tumor cavity according to lee and chen (figure 3). The patient was kept intubated for 48 h to guard his airway, as there was edema . Intravenous dexamethasone (0.1 mg / kg) was given for 3 days postoperatively to control inflammation . Patient was discharged from the hospital on the fifth post injection day and kept follow up every week for the first three months, then every 2 weeks for another 3 months . The lesion remarkably shrinks and the hygienist was able to thoroughly scale his teeth without any bleeding (figure 4). Figure 1a) clinical picture of the patient showing facial asymmetry as result of right zygomatic swelling; b) intraoral view shows bluish mass extending to the soft palate when the patient presented to the clinic for the first time; c) intraoral photograph of the same patient 18 months after first presentation . The lesion increased in size, bled easily and appeared darkens with bad oral hygiene and heavy calculus at the right side of the jaw . A) clinical picture of the patient showing facial asymmetry as result of right zygomatic swelling; b) intraoral view shows bluish mass extending to the soft palate when the patient presented to the clinic for the first time; c) intraoral photograph of the same patient 18 months after first presentation . The lesion increased in size, bled easily and appeared darkens with bad oral hygiene and heavy calculus at the right side of the jaw . Figure 2a) axial and b) coronal computed tomography scan obtained with contrast material shows dilated vessels that extend into the infratemporal area and multiple phleboliths can be seen . C) and d) axial t2 weighted magnetic resonance image shows high intensity lesion with flow representing vessels of different sizes . A) axial and b) coronal computed tomography scan obtained with contrast material shows dilated vessels that extend into the infratemporal area and multiple phleboliths can be seen . C) and d) axial t2 weighted magnetic resonance image shows high intensity lesion with flow representing vessels of different sizes . Figure 3a) the catheter loaded with ethanol in place during injection; b) contrast medium is injected into the lesion and an x - ray is taken to make sure that the catheter is within the lesion itself; c) an angiogram shows ethanol injection within the lesion . A) the catheter loaded with ethanol in place during injection; b) contrast medium is injected into the lesion and an x - ray is taken to make sure that the catheter is within the lesion itself; c) an angiogram shows ethanol injection within the lesion . Figure 4a) postoperative picture of the lesion one and b) three months following injection . A) postoperative picture of the lesion one and b) three months following injection . There were no complications reported in this case except some palatal ulceration which is improving with every visit . Treatment success was determined clinically by reduction in lesion size, ability of the patient to chew and to clean his teeth without bleeding, patient experience to pain and by patient satisfaction . For example: surgical excision can lead to significant loss of motor function, cosmetic problems, nerve damage, or massive bleeding and the complicated anatomy of the face and neck, may result in significant loss of motor function, cosmetic problems, nerve damage, or massive bleeding if surgery is adopted . Laser therapy presents higher costs to the patient and may result in skin atrophy, transient or permanent hyperpigmentation, slight depression of the skin and scarring . Intralesional injection of corticosteroids may cause adrenal suppression, slowed weight gain, atrophy, and necrosis . The use of sclerotherapy in the management of vascular anomalies has increased and replaced the traditional role of surgical therapy, especially for the venous lesions that are surgically difficult or at inaccessible areas . It has the advantage of low cost, no external scaring, and few complications compared to surgical treatment . Varieties of sclerosing agents have been used for the management of various vascular malformations such as 5% sodium morrhuate, sodium tetradecyl sulphate, ethanolamine oleate, ok432, bleomycin, ethanol, and hypertonic saline, alone or in various combinations . Absolute ethanol was adopted as a new scleroagent for this complex form of venous defects to improve overall treatment results with acceptable morbidity and recurrence rates . Ethanol is used most of often due to its low cost, antiseptic quality, wide availability and easy of use; however, it requires general anesthesia because the procedure is very painful . The aim of treatment is to eradicate the lesion nidus completely, which is the fundamental abnormality as even the smallest residual nidus may expand to form a recurrence . In the presented case it was difficult to achieve complete eradication of the lesion by surgical approach because of the possible hazards that are associated with the affected site . It has been suggested that ethanol cause protoplasm precipitation which subsequently causes permanent obliteration of the vessel lumen . Also do et al . Reported that ethanol has shown the ability to induce protein denaturation of the endothelial cells with subsequent vessel wall denudation and interruption, which results in the complete obliteration of the vessel lumen rather than just simple obstruction . Although various complications were reported to develop during the procedure such as local skin necrosis and fibrosis, haemoglobinuria, anaphylaxis, and some major complications were rarely reported including blood loss, acute pulmonary hypertension with cardio - pulmonary collapse, therefore, lee and chin used rubber bands to compress the patient's forehead and chin to occlude facial venous return and minimize complications, also hammer et al . Recommended to inject the ethanol slowly, over a period of several minutes and not exceeding 1 cc / kg of body weight while monitoring the pulmonary artery pressure to avoid such a catastrophic situation also, ethanol should only be used in the head and neck region by individuals and centers with professional expertise and experiences including maxillofacial surgeon, general radiology, general medicine, cardiovascular medicine, physical medicine and rehabilitation, dermatology, psychiatry, nuclear medicine, and social services with maximum efficiency to handle or at least minimize various anticipated complications . Also, careful and routine monitoring of pulmonary arterial pressure are required by the interventional radiologist, and anesthesiologist . Vascular malformations were treated with direct percutaneous injection of absolute ethanol, which resulted in remission, and alleviation of their symptoms, with no major complications . This technique provides a simple, low cost and reliable alternative treatment for venous malformation in the face and neck . Absolute ethanol sclerotherapy can deliver excellent results as an independent therapy to the infiltrating type of extra - truncular form of vm . Complications can occur but are rare . The morbidity involved should be clearly understood and accepted by the patient and family, and the risk of acute and chronic complications, either major or minor,
|
In the 1980s, the prevalence of rickets in extremely low birth weight (elbw) infants was around 50% and was 17% for fractures (1, 2). After introduction of a high mineral containing diet in the late 1980s, the prevalence decreased to 30% or lower (3, 4). There is little information, however, beyond 1985, concerning the incidence of rickets in extreme prematurity and factors that relate to its occurrence . In addition to inadequate mineral intake as a major contributing factor (5), chronic co - morbidities, like chronic lung disease, short bowel syndrome, and parenteral nutrition associated cholestasis (pnac) could also be related factors (6). Medications used in the neonatal intensive care unit (nicu), such as steroids, methylxanthines, and diuretics could theoretically increase the risk of inadequate bone mineralization (7 - 9). Other risk factors, such as immobilization from sepsis, cerebral pathology, muscular disorders and paralysis are associated with bone disease of prematurity (10). Since mineral enriched formula for the preterms began 30 yr ago, it is the standard practice to provide minerals in an attempt to reach in utero mineral accretion rates . In theory, under ideal conditions, the adventage of high mineral intake formulas should be associated with a marked reduction of rickets . However, it is often practically difficult to achieve ideal nutrition support in sick elbw infants, the current incidence of rickets in elbw infants is unknown, and the relationship of the severity of overall illness and degree of prematurity in this population is unclear . The aim of this study was to characterize the risk factors for development of rickets in elbw infants fed with high mineral containing preterm formula . As a retrospective case - control study, medical records of 55 elbw infants admitted into the severance children's hospital nicu from 2004 to 2008 that survived until 1 month of age were reviewed . All infants had their serum alkaline phosphatase (alp), calcium (ca) and phosphate (p) levels reported weekly and bone screen radiography at 1 month of age . For nutritional care, fortified human milk (ca 131 mg/100 kcal, p 71 mg/100 kcal) or a mineral fortified preterm formula (ca 112 - 141 mg / kcal, p 52 - 63 mg / kcal) was used . During parenteral nutrition, ca, p and multivitamins with trace minerals were added to parenteral nutrition, appropriately . Grade 1 was defined as a loss of dense white line, increased lucency of bone shaft, and thinning of cortex; grade 2 showed irregularity and fraying of a metaphysis with splaying and cupping; and grade 3 presented evidence of fractures . As co - morbidities, hyaline membrane disease (hmd), patent ductus arteriosus (pda), necrotizing enterocolitis (nec; using the modified bell's staging criteria), parenteral nutrition associated cholestasis (pnac, defined as direct bilirubin [db] greater than 2.0 mg / dl), bronchopulmonary dysplasia (bpd; using nih classification), retinopathy of prematurity (rop, included above stage 2), and intraventricular hemorrhage (ivh, above grade 3) were analyzed . Severe pnac was defined as elevation of db greater than 4.0 mg / dl for more than 1 month and aspartate aminotransferase (ast) and alanine aminotransterase (alt) greater than 60 moderate / severe bpd was defined in infants requiring either 28 days of supplemental oxygen therapy with oxygen, nasal continuous positive airway pressure (cpap) or positive pressure ventilation at 36 weeks postmenstrual age or discharge, whichever came first, whose gestational age was younger than 32 weeks, or at 56 days postnatal age or discharge, whichever came first, in infants whose gestational age was older than 32 weeks . Statistics were calculated with the student t - test and chi - square test for means and frequencies . Numeric data are presented as mean and standard deviation because the data were normally distributed . Calculations were performed with spss software version 17.0 (spss, chicago, il, usa). The present retrospective review of database in this study was approved by the institutional review board of the yonsei university health system, severance hospital (approval no ., 4 - 2012 - 0157). The present retrospective review of database in this study was approved by the institutional review board of the yonsei university health system, severance hospital (approval no ., 4 - 2012 - 0157). Twenty - four elbw infants (26.3 1.9 weeks, 792 99 g) were diagnosed as rickets of prematurity, and 31 infants without rickets (27.2 2.3 weeks, 871 93 g) were the control group . Rickets of prematurity was diagnosed in 43.9% of elbw infants and fracture in 13% . For the rickets group, 7 infants (29%) showed g1, 14 infants (58%) g2 and 3 infants (13%) g3 . Rickets of prematurity was diagnosed at 48.2 16.1 days of life and improved by 85.3 25.3 days of life . In patient characteristics such as mean gestational ages, birth weight, gender, and frequency of intrauterine growth retardation (iugr) the cumulative amounts (either enteral or parenteral) of ca and p administration during hospitalization were not different between the groups . For the rickets group in comparison with the control group, mean days on oxygen and ventilator use were significantly longer (p <0.05). The duration of hospitalization and parenteral nutrition were significantly longer in the rickets group versus the control group (table 1). In univariate analysis, elbw infants with rickets had a significantly higher occurrence of pda (p = 0.025), pnac (p = 0.041), severe pnac (p = 0.013), bpd (p = 0.019), and moderate / severe bpd (p = 0.012) (table 2). Common neonatal illnesses such as hmd, air leak, nec, rop, ivh and periventricular leucomalacia (pvl) were not different between the groups . In multiple regression analysis after adjustment of gestation and birth weight, rickets in elbw infants significantly correlated with severe pnac (or 18.5; 95% ci, 1.1 - 285; p = 0.042) and moderate / severe bpd (or 3.2; 95% ci, 1.2 - 26.5; p = 0.04) (table 3). The mean level of peak alp was significantly higher in the rickets group than the control group (952.2 413.8 vs 524.7 158.2 iu / l), while the mean level of the lowest ca and p levels were not different between groups (table 4). In the 1980s, fortified mineral formulas were introduced to reduce the rates of rickets and fractures in very low birth weight (vlbw <1,500 g) infants (11). Reports at that time indicated that up to 30% of vlbws had rickets with fractures (12). With advances in preterm nutrition, especially with the introduction of mineral fortified formulas, theoretically the incidence of rickets of prematurity should have dropped (3, 4). However, for increasing the survival of elbw infants, significant co - morbid conditions could affect actual mineral intake which might mitigate the effect of high mineral fortification (13). This is the first study to focus on the incidence of rickets in elbw infants after 2 decades of fortified formula use in korea . It is also the first to characterize and compare risk factors and neonatal morbidities for rickets of prematurity in elbw infants . We found that the incidence of radiologic rickets in elbw infants was extremely high at 44% (24/55) due to increased survival, and the incidence of significantly increased 18 times and 3 times for severe pnac and moderate to severe bpd, respectively . Factors commonly thought to relate to rickets of prematurity include mismatch of postnatal intake of minerals compared to intrauterine mineral transfer, low bone loading effects in the nicu, intrauterine growth restriction, chorioamnionitis, steroids, methylxanthines and diuretic usage and necrotizing enterocolitis (7 - 10, 14 - 16). Inadequate mineral nutrient (calcium and phosphorous) intake appears to play a major role in causing rickets of prematurity (10, 17). Prolonged parenteral nutrition (pn) and delayed enteral nutrition complicate delivery of adequate mineral intake and would be particularly acute in elbw infants (10). It is standard practice in nicu to provide high mineral preterm formula and human milk fortifier as an attempt to reach in utero mineral accretion rate, including the use of minimal early enteral feeding, which appears to improve bone mass at term (3, 17 - 19). However, in elbw infants, co - morbid illnesses often preclude full enteral tolerance and the actual delivery of mineral nutrients (13). Further, when pn is needed, the provision of minerals in pn can be limited by solubility issues compounded by fluid restriction in sick infants (3). Specific chronic co - morbidities, particularly chronic lung disease and short bowel syndrome which is generally associated with prolonged parenteral nutrition and pnac, are potentially serious risk factors for poor bone mineralization (6, 20, 21). Thus our findings of markedly higher risk of rickets in elbw infants with pnac (18 times) and bpd (3 times) support these associations . The limitations of this study are a small sample size of a single institution and a retrospective design . In conclusion, there is a high incidence (44%) of rickets in elbw infants, which shows an 18-fold increase in severe pnac and a 3-fold increase in moderate to severe bpd . We suggest that in elbw infants with severe pnac or moderate / severe bpd, aggressive prevention or treatment for rickets and fractures can be instituted earlier in the course of management.
|
Kyphosis is a progressive curvature of the thoracic spine, which results in rounding or bowing of the back . A curved spine accompanied by restricted neck motion and poor lung reserve present challenges for an ophthalmic surgeon, who is used to patients neck and head resting flat on the operating table and the eye in the horizontal position . Intraoperative difficulties include poor view, inability to maneuver surgical instruments properly and constant threat of elevated vitreous pressure . Several innovative solutions have been published, including the maximal reverse trendelenburg position and pillows under the head and neck, use of a donut and wedge - shaped head positioner, allowing patients to remain in the upright sitting position while their head is positioned horizontally in a modified waiting room chair, performing surgery while standing [5, 6], using a 4-section orthopedic operating table, or laying the patients on their sides . However a 49-year - old obese male with controlled secondary glaucoma needed cataract surgery in the right eye . The past ocular history was positive for recurrent uveitis and glaucoma shunt surgery in the right eye . Cataract density was + 4, and the best - corrected visual acuity was 20/200 . The anterior chamber was shallow and the glaucoma shunt tube was visible at the 11 o'clock position . The patient was planned for pupillary dilation using iris retraction hooks, lens capsule staining with trypan blue and phacoemulsification with intraocular implantation under local anesthesia . The anesthesiologist was reluctant to use general anesthesia because of the patient's disability and poor health . In the operating room, the patient could only recline to about 40 from the vertical axis despite maximal reverse trendelenburg position and a number of pillows under his back, neck, head and legs (fig . 2). While trying to focus the microscope, it became evident that by grasping the eye at the inferior limbus with a fine forceps and pulling it upwards, it could be moved to a more desirable horizontal position . A single 7/0 vicryl (polyglactin) corneal retraction suture was placed at the limbus at the 6 o'clock position to achieve the desired view (fig . The assistant surgeon was able to rotate the eye to the desired positions during the whole procedure by relaxing or pulling the suture . Patients with kyphosis may present several unique challenges to an eye surgeon, the foremost being the inability to lay the head and neck in the ideal horizontal position . The resulting poor view makes focusing and manipulation of tissues and instruments difficult . Tilting the head end of the operating table down and raising the patient's legs may compromise venous return from the orbit, causing venous engorgement and elevated posterior vitreous pressure during surgery . In addition, the patient's poor pulmonary reserve itself may further impede orbital / jugular venous return, resulting in increased posterior vitreous pressure . Other features of kyphosis that may adversely affect intraocular surgery are tenderness and stiffness of the back and difficulty in breathing . Several practical solutions have been described by very experienced surgeons but complications may still occur . A wedge - shaped pillow with a built - in donut for the positioning of the head has been used by some surgeons . Livingston and mackool recommended using more than one of these positioners in severe cases . Another approach suggested performing cataract surgery while standing, using loupes and making an inferotemporal scleral tunnel [5, 6]. The surgeons were unable to remove the subincisional cortex because of a shallow anterior chamber secondary to elevated posterior vitreous pressure . Prasad et al . Recommended using a 4-section orthopedic operating table to enable an extreme reverse trendelenburg position for cataract and glaucoma surgery . However, because of a blurred vision, these authors were unable to perform curvilinear capsulorhexis and had to resort to can - opener capsulotomy . In short, there is no single solution for the different groups of difficult patients . We have found that a single retraction suture at the inferior limbus can rotate the eye to any desired position . This may allow both the patient and surgeon to be in a comfortable position without compromising good view . It may be tried practically in all patients with kyphosis or other conditions that prevent them from reclining such as torticollis, chronic obstructive pulmonary disease, chronic congestive heart failure or morbid obesity . The surgeon can still sit on the preferred temporal side of the patient and perform intraocular surgery of choice . With this maneuver, it may be unnecessary to resort to extreme and uncomfortable tilting of the patient and avoid complications such as those described above . The authors have no financial or proprietary interest in the materials described in the article.
|
Using water as solvent in the organic reactions is one of the most important targets to organic chemists because of the easy availability, nontoxicity, and ecofriendly nature of the water [17]. In this endeavour, a number of chemical reactions such as diels alder, hetero diels - alder, 1,3-dipolar cycloaddition, oxidations, reductions, and others are performed successfully in water [13]. Also, it is reported that in few cases addition of the water increases the rate and the yield of a reaction and also enhances the enantioselectivity in a chiral synthesis . But the main problems associated with water as a solvent is its poor ability to solubilise organic reactants and incapability to create anhydrous condition for moisture sensitive organic compounds and catalysts . To overcome the solubility problem, generally a surfactant is introduced to the reaction mixture . The surfactant, due to its hydrophobic and hydrophilic nature, forms micelles with water insoluble organic compounds and promote the desired reactions to occur inside the hydrophobic ambience of the micelle core [9, 10]. Cleavage of the c = n bonds is a very important transformation in organic synthesis as the c = n functionality is widely used to protect both the carbonyl and amines . There are a number of methods used for the cleavage of c = n bonds which include acidic reagents [1113], oxidizing agents, metallic salts [15, 16], (phseo)2o, nahso3, and others . Most of these methodologies suffer from serious drawbacks like involvement of strong lewis and bronsted acids, use of toxic and costly transition metals (i.e., cr, pd, co), low temperature, longer reaction time, low yield, and difficulties in isolating the products . Therefore, development of efficient, mild and environment friendly reagents are always necessary . On the other hand, bisindoles are recently emerging as extremely important class of compounds because of their novel antibacterial and anticancer activities [1921]. That is why a number of methodologies have also been postulated for the synthesis of bisindoles [2229]. In our previous communications, we reported that surfactant- (sds-) mediated cleavage of c = n bonds could be achieved with acetic anhydride and surfactant - i2-water can be used for the deprotection of imines to carbonyls . We have also shown that bis- and tris (indolyl)alkanes can be synthesized in presence of bronsted acid in water . In continuation of our research in hydrated media, herein, we wish to disclose the dual catalytic activity of the system i2-sds - h2o which behaves as a lewis acid for the cleavage of 2,3-diaza-1,3-butadiene, 1-aza-1,3-butadienes, and oximes to produce carbonyls and amines, and the resulting reaction mixture reacts with indoles to produce bis (indolyl)alkanes in situ at room temperature under neutral conditions . For an initial study, molecular iodine was added to a mixture of 1,4-diphenyl-2,3-diaza-1,3-butadiene (1a) (1 mmol) and indole (2a) (2 mmol) in water . It was presumed that the activated imine should produce carbonyl compound in the reaction mixture which might be trapped with indole . But only a trace amount of 3,3-bis(indolyl)phenylmethane (3a) was found to be formed in the reaction . We envisioned that the poor yield of the product may be due to the insolubility of organic substrates in water . Accordingly, we added a surfactant (sds) to the reaction flask . To our delight, the reaction produced isolable amount of 3a as a brown solid but half of the 1,4-diphenyl-2,3-diaza-1,3-butadiene (1a) left unreacted in the reaction mixture . So amount of indole (2a) was doubled (4 mmol) and the same reaction condition successfully produced quantitative amount of 3a . The product was filtered out and the filtrate was treated with freshly distilled benzaldehyde (0.05 mmol) in ethanol which furnished 1a (m.p . This infers the simultaneous involvement of two c = n bonds of bis - anils, leaving behind hydrazine in the reaction mixture . Also, no self - reaction of individual starting materials leading to indole dimer (4) or pyrrole formation (5) were observed under the same reaction conditions (scheme 1). Optimization of the reaction conditions was undertaken by employing different catalyst loadings under various surfactant conditions . It was found that the best result was obtained by the application of 15 mol% of i2 containing sodium dodecyl sulphate (sds) and water at room temperature (entry 1, table 1). In absence of the catalyst no formation of 3a was observed even after stirring for 24 hours (entry 5, table 1). To study the scope and limitations of the reaction, i2-sds - h2o system was applied to the reaction of indole (2) and 2,3-diaza-1,3-butadiene derivatives (table 2, entries a the bisindoles were formed in excellent yields under the reaction condition . It was observed that the reaction was relatively faster when an electron withdrawing substituent, for example, no2, was present in the phenyl ring of the 2,3-diaza-1,3-butadienes (table 2, entry e) in comparison to the electron donating groups, for example, ome and oh (table 2, entries b and f). Identical results were obtained when 2-methylindole (2a) was used in place of indole (2) (table 2, entries g and h). All the products were characterized by their ir, h nmr, c nmr, and mass spectral data and also by comparison with the literature report (scheme 2) [24, 25]. In order to further explore the efficiency of the i2-sds - h2o system the reaction of the oximes 6 and indoles 2 was studied . When oximes (1 mmol) and indole (2 mmol) were allowed to react under the same reaction condition described earlier, bis - indolylalkanes formed (table 3). The product was filtered off and the filtrate was treated with benzaldehyde in ethanol . The resulted product was benzaldoxime, which proved the liberation of hydroxylamine during the reaction . It was found that no michael addition product was formed and only a trace amount of indole dimer 5 could be identified . The system was also applied to the reaction of 1-aza-1,3-butadienes 7 with indole (2) which produced bis (indolyl)alkanes 8 in very good yield eliminating aryl amine in the reaction mixture (table 4). All the products were well characterized by comparison of their spectral and mass data with that of the reported value [24, 25]. In conclusion, we have shown the dual catalytic activity of i2-sds - h2o system which deprotects the azadienes, oximes, and azabutadienes and produces bis (alkyl)indoles in situ when indole is present in the reaction medium . The two - step reaction can be carried out without using acid, transition metals, and organic solvents . Besides, the reaction condition is mild and can be done in water under neutral condition which contributes to the criteria of green chemistry . H nmr spectra were recorded on avance dpx 300 mhz ft - nmr spectrometer . Chemical shifts are expressed in units relative to tetramethylsilane (tms) signal as internal reference . Ir spectra were recorded on ft - ir - system-2000 perkin elmer spectrometer on kbr pellets or in chcl3 . The solvents for chromatography were distilled before use . In a 50 ml round bottom flask, 15 mol% of i2 was first dissolved in water (10 ml). 2,3-diaza-1,3-butadiene (1 mmol) and indole (4 mmol) were added and stirred in the presence of sodium dodecyl sulphate (sds) (0.02 g) for the stipulated time . The product formed was filtered off and washed with water, dried, and recrystallized from ethanol . Identical reaction condition was followed when 1-aza-1,3-butadienes and oximes were used as reactants . In this case, 2 mmol of indoles were used to react with 1 mmol of imines . Colorless solid; mp: 150152c; ftir (kbr): 3418, 3058, 1623, 1611, 1445, 1093 cm; h nmr (300 mhz, cdcl3): 5.95 (s, 1h, ar ch), 6.73(s, 2h), 7.06 (t, 2h, j = 6.8 hz), 7.187.27 (m, 3h), 7.317.36 (m, 2h), 7.367.42 (m, 6h), 7.98 (br, s, 2h, nh); c nmr (75 mhz, cdcl3): 40.7, 111.2, 119.1, 119.5, 120.4, 122.1, 123.8, 126.9, 126.9, 128.2, 129.1, 136.8, 144.8; hrms calcd for c23h18n2 (m): 322.2851, found 322.2832; anal.calcd . : c, 85.70; h, 5.59; n, 8.69; found c, 85.75; h, 5.56; n, 8.56 . Pink solid; mp: 76 - 77c; ftir (kbr): 3415, 3060, 1491, 1465, 1095 cm; h nmr (300 mhz, cdcl3): 5.91 (s, 1h, ar ch), 6.76 (s, 2h), 7.08 (t, 2h, j = 8.3 hz), 7.22 (t, 2h, j = 7.9 hz), 7.287.42 (m, 8h), 8.01 (br, s, 2h, nh); c nmr (75 mhz, cdcl3): 39.8, 111.5, 122.6, 123.8, 127.1,128.4, 129.8, 130.1, 130.9, 131.0, 131.6, 137.2, 143.5; hrms calcd for c23h17n2cl (m): 356.7371; found 356.7324; anal.calcd . : c, 77.52; h, 4.77; n, 7.86; found c, 77.48; h, 4.72; n, 7.80 . Brown solid; mp: 323325c; ftir (kbr): 3420, 1720, 1455, 1258 cm; h nmr (300 mhz, cdcl3): 5.98 (s, 1h, ar - ch), 6.85 (s, 2h), 7.107.55 (m, 11h), 8.05 (br, s, 2h, nh), c nmr (75 mhz, cdcl3): 34.8, 107.0, 110.0, 111.5, 117.8, 119.9, 120.0, 122.5, 124.8, 127.1, 136.8, 142.2; hrms calcd for c21h16n2o2 (m): 312.2621; found 312.2611; anal.calcd . C, 80.84; h, 5.12; n, 8.97; found c, 84.05; h, 5.15; n, 8.94 . The spectral data of the compounds are available in the supplementary material available online at doi: 105402/2012/635835.
|
Parental drug misuse and its effects on children and families are policy priorities in the uk and elsewhere (flavin & paltrow, 2010; hm government, 2010). Polydrug use is the norm among drug users in the uk, and benzodiazepine use is common (bird & robertson, 2011; department of health (england), 2007; hay, gannon, casey, & mckeganey, 2009; jones, mogali, & comer, 2012). Increased risks and harm, and a range of adverse effects are associated with long - term benzodiazepine use (lader, 2011, 2014; obrien, 2005). However, existing research on drug use and parenting has tended to focus on opioids, opioid substitution therapy (ost), or crack cocaine (radcliffe, 2009, 2011; rhodes et al ., 2010), and in the case of pregnancy, also alcohol, nicotine, marijuana and amphetamines (behnke & smith, 2013). In this paper, we examine accounts provided by polydrug - dependent parents about their use of, and dependence on, benzodiazepines as compared to ost . Benzodiazepine use is highly prevalent among drug users worldwide (jones et al ., 2012). Opioid - dependent and ost patients use benzodiazepines to prolong and enhance the effects of opiates (jaffe et al ., 2004), and increased rates of dependence are associated with co - occurring psychosocial problems (jones et al ., 2012). Weizman, gelkopf, melamed, adelson, and bleich (2003) estimated a lifetime prevalence of benzodiazepine dependence in the opiate - dependent population (in or out of treatment) ranging from 6194% . Benzodiazepines were originally marketed in the 1960s for the relief of anxiety, stress and insomnia (who, 1996) and remain one of the most widely used psychoactive drugs (lader, 2011). Their use within the general population is common, particularly among females (obrien, 2005). The gendered cultural meanings of diazepam (valium), a well - known benzodiazepine, was cemented in the 1966 rolling stones song mother s little helper . Benzodiazepines are recommended for the short - term treatment of anxiety and insomnia (baldwin et al ., 2013). Tolerance and withdrawal effects can develop after only a few weeks of treatment (lader, 2011). Adverse effects include sedation, impaired cognitive and psychomotor functioning, and increased likelihood of accidents and injuries (lader, 2011; obrien, 2005). Withdrawal effects vary in severity and duration, and include anxiety, insomnia, depression, impaired memory, muscle spasms and tension, and rarely, seizures and psychosis (lader, 2011). Combined benzodiazepine and opioid use is associated with increased sedation, decreased psychomotor performance (lintzeris, mitchell, bond, nestor, & strang, 2007; lintzeris & nielsen, 2010), poorer psychosocial adjustment and general health, heightened risk - taking behaviour, and increased risk of overdose (bird & robertson, 2011). However, evidence is limited (jones et al ., 2012), and few studies have focused on the combined effects of opioid and benzodiazepine dependence on pregnancy or parenting (acmd, 2003), despite evidence to suggest that both drugs are problematic in these contexts . Whilst there is evidence that parental opioid use can compromise parenting capacity and pregnancy outcomes (acmd, 2003), the health and wellbeing of children and families can also be negatively affected by social and structural factors such as poverty, poor housing, unemployment, parental stress, domestic violence and criminal justice involvement (hepburn, 2004; klee, jackson, & lewis, 2002). However research indicates that despite this complexity, there is a tendency among service users and service providers to focus on drug use alone (banwell & bammer, 2006; chandler et al ., 2013), and in most cases the primary drug of misuse (winklbaur et al ., 2008). While this focus may relate to concerns regarding the effects of specific drugs per se on parenting capacity and the immediate safety of children, it could also result in a limited view of drug dependence that neglects to consider polydrug use and the impact of socio - economic and structural inequalities . While the use of opioids and ost is stigmatising, especially in the context of pregnancy and parenthood (holland, forrester, williams, & copello, 2013), use of benzodiazepines in the context of mothering has historically been characterised in a less problematic (though not entirely positive) manner (metzl, 2003). We found no published literature which compared benzodiazepine and opioid dependence, from the perspective of parents, or expectant parents . Therefore the aim of our study was to address this gap in the evidence and to undertake a comparative thematic analysis of the ways in which parents accounted for their use of opioids, ost and benzodiazepines during and after pregnancy . This was a longitudinal, qualitative study involving 19 opioid - dependent service users over the course of approximately one year in order to examine changes over time in participants experiences with healthcare services, drug use and parenting . The truth, but rather as a resource through which to explore how parenting and drug use are understood, negotiated and mutually constructed (bury, 2001; rhodes, bernays, & houmoller, 2010). The study was carried out in scotland in an area with a mixed socio - economic profile, containing areas of significant deprivation . Ost services for drug - dependent patients are delivered via primary care and specialist community - based substance misuse services . There are local guidelines both for the management of substance misuse in pregnancy (whittaker, 2003), and parental substance use (elbeg, 2013). Notably, a large number of patients in the area are prescribed benzodiazepines in addition to ost . Participants, recruited via healthcare practitioners, were interviewed at around 2832 weeks gestation; 23 months postnatal; and 69 months postnatal . Inclusion criteria were opioid - dependence, being an expectant or recent parent, and> 18 years . All were unemployed and white, reflecting the population of opioid - dependent adults in the study area . Five participants were first - time parents, fourteen other participants had between one and three children, aged 219 . All were receiving ost at the first interview, primarily methadone, with a minority prescribed buprenorphine or dihydrocodeine . Eleven reported heroin use in the 12 months prior to the first interview and thirteen reported benzodiazepine use during the study period . In five cases, diazepam was prescribed long - term alongside ost . This reflects the pattern of poly - drug use and prescribing practices in this geographical setting (bird & robertson, 2011). In total, semi - structured interviews, lasting between 45120 minutes, addressed participants social background, drug use, experiences with parenting, and involvement with services . This was supplemented by close reading of transcripts and thematic coding by authors ac and aw (ritchie, spencer, & oconnor, 2003). The present paper is based on analysis of two content codes: benzodiazepine use and methadone practice . Accounts were compared and contrasted and analytic themes were generated and agreed by the research team . Participants gave informed consent and were provided with a 20 voucher for each interview completed . A common theme across parents accounts of all drug use was that their substance use helped to support their attempts to engage in normal daily life, providing a better context in which to undertake parenting . Positive meanings were sometimes ascribed to ost which was portrayed as enabling parents to manage their opioid - dependence in a legal, safer and relatively more socially acceptable manner (chandler et al ., 2013). This was particularly the case for parents who had only recently ceased use of illicit opioids:[t]he only way to have a normal life [] and keep a normal life to normality, to being able to live again is a methadone prescription . (alison, 3 months postnatal) [t]he only way to have a normal life [] and keep a normal life to normality, to being able to live again is a methadone prescription . (alison, 3 months postnatal) however, parents accounts more often emphasised the barriers and problems ost posed . Particularly in the post - natal period, the structures around ost prescribing (e.g. Dispensing requirements) were highlighted as having a negative impact on parents attempts to engage in a normal life or recovery - orientated activities such as training and employment: im no wanting to stay on daily supervised, especially to try and go back to work, to go back to college . (laura, 9 months postnatal) i m no wanting to stay on daily supervised, especially to try and go back to work, to go back to college . (laura, 9 months postnatal) this was particularly the case for those participants who were required to have their use of ost supervised where methadone was consumed in the pharmacy under the surveillance of the dispensing pharmacist (and any onlookers). Such practices were framed as especially problematic for parents: sometimes when i see ones in the chemist wi their weans [children] and i think they should nt be bringing their wean oot they re standing waiting for their meth and i try and sit in a seat away fae them . (melanie, antenatal) when you re being on supervised and that, because at the chemist i m at, they ve no got a bit that s blocked off, so you re standing at [the locality] swallowing your methadone in the middle of the shop flair . So you get folk looking at you [] whether i ve got [daughter] wi me or no, so it s just, there s the junkie, look at her . (caitlin, 9 months postnatal) sometimes when i see ones in the chemist wi their weans [children] and i think they should nt be bringing their wean oot they re standing waiting for their meth and i try and sit in a seat away fae them . (melanie, antenatal) when you re being on supervised and that, because at the chemist i m at, they ve no got a bit that s blocked off, so you re standing at [the locality] swallowing your methadone in the middle of the shop flair . So you get folk looking at you [] whether i ve got [daughter] wi me or no, so it s just, (caitlin, 9 months postnatal) both melanie and caitlin s accounts highlight the role of stigma in shaping the experiences of parents in ost programmes . In contrast, accounts of benzodiazepine use and dependence tended to be framed more positively, and crucially without reference to stigma . Most participants described using benzodiazepines in constructive ways: treating anxiety states, mood enhancers, providing practical and emotional support for parenting, enabling them to engage in daily routines and household tasks, and ultimately providing a context in which carol, for instance, argued that her use of illicit diazepam was controlled, and helped her manage household chores.yes, like that song, mother s little helper, that s what i like to think of it as, just sort of gets me going, puts me in a good mood . (carol, 6 months postnatal)similar justifications for illicit use were given by two fathers in the study . Here, paul s account refers to his (unsuccessful) attempts to acquire a prescription for benzodiazepines: i said to him [general practitioner] i m not taking them to get out of my face [intoxicated]. I said i just take the two at night to help me get to sleep . (paul, antenatal) yes, like that song, mother s little helper, that s what i like to think of it as, just sort of gets me going, puts me in a good mood . (carol, 6 months postnatal) i said to him [general practitioner] i m not taking them to get out of my face [intoxicated]. I said i just take the two at night to help me get to sleep . (paul, antenatal) participant s explanations for their continued use of benzodiazepines often centred on the supposed functional benefits of the drug in helping parent s cope with day - to - day life . In contrast, accounts about ost were more likely to be framed around emphasising reduction and abstinence, narratives which were largely absent when it came to benzodiazepines . This is most evident in the accounts of parents who were dependent on both benzodiazepines and ost . In nicola s final interview she reported that she was committed to reducing her methadone, contrasting starkly with her account of her benzodiazepine prescription: im fed up being stuck on something, where i wake up with my daughter, feeling like crap, and the first thing i dae is have to swallow medicine and have a cup of tea, to feel normal [] aye, i m not ready for [reducing] diazepam . That s like mother s little helper [] they help me, to want to get up in time to do stuff and everything . (nicola, 10 months postnatal) i m fed up being stuck on something, where i wake up with my daughter, feeling like crap, and the first thing i dae is have to swallow medicine and have a cup of tea, to feel normal [] aye, i m not ready for [reducing] diazepam . That s like mother s little helper [] they help me, to want to get up in time to do stuff and everything . (nicola, 10 months postnatal) divergent orientations towards methadone and benzodiazepine reduction were also discussed with tricia . In earlier interviews, tricia had rejected the idea of reducing any of her prescriptions, however, like nicola, at 10 months postnatal she reported reducing her methadone, but not her benzodiazepine dosage: i feel like i m still a junkie because i need this green liquid [methadone] every day, it s crap, but i mean i dinnae feel like that with my valium [] aye i need to stay there [on the same dose of benzodiazepine] the now, i dinnae ken [do nt know] i would get all nervous . I do need my valium and if they said to me they were going to start cutting me i would panic [] but they re not, they re just happy at me being stable just now . (tricia, 10 months postnatal) i feel like i m still a junkie because i need this green liquid [methadone] every day, it s crap, but i mean i dinnae feel like that with my valium [] aye i need to stay there [on the same dose of benzodiazepine] the now, i dinnae ken [do nt know] i would get all nervous . I do need my valium and if they said to me they were going to start cutting me i would panic [] but they re not, they re just happy at me being stable just now . (tricia, 10 months postnatal) rhetoric about stability, abstinence and dependence, therefore, were employed by participants differently according to the particular substance they were discussing . Accounts of substance use during pregnancy were for women especially more similar . In the majority of cases, women indicated that they wanted to reduce their dosage of both ost and benzodiazepine . Each of these substances were framed as problematic during pregnancy, largely centring on potential harm to the unborn baby.ive forgotten the other one, stop smoking, come off that, like the valium, and the methadone [] and i said it would be a bit much for me doing all of that [] but it s no too much for me coming down from the methadone and the valium []. Because it s going to be helping the baby and me . (iona, antenatal) i ve forgotten the other one, stop smoking, come off that, like the valium, and the methadone [] and i said it would be a bit much for me doing all of that [] but it s no too much for me coming down from the methadone and the valium []. Because it s going to be helping the baby and me . (iona, antenatal) women stressed a keen awareness that use of a range of substances might have negative effects on their babies . Those women dependent on multiple substances (the majority) described a careful balance of trying to stabilise or reduce one or more prescriptions, whilst avoiding relapse to illicit drug use . A clear contrast between parents accounts of opioid and benzodiazepine use and dependence was that the latter were often framed as a legitimate method of managing anxiety, negative emotions and past trauma . As such, while women described reducing their benzodiazepine use during pregnancy, as with nicola s account here, once the pregnancy ended, the need to reduce (based on perceived potential harm to the baby) also ceased.ive been on them maist of my life, and that s to stop paranoia, it s to stop me going ootside, and feel like everybody s looking at me, and agitated, anxiety, everything, so they know i ll no be coming off them . I ve already cut doon to ten milligrams, when i was pregnant, and nae mair, that s it . I ll sort the meth [ost], and then see aboot that [diazepam] in the later future . (nicola, 10 months post - natal) i ve been on them maist of my life, and that s to stop paranoia, it s to stop me going ootside, and feel like everybody s looking at me, and agitated, anxiety, everything, so they know i ll no be coming off them . I ve already cut doon to ten milligrams, when i was pregnant, and nae mair, that s it . I ll sort the meth [ost], and then see aboot that [diazepam] in the later future . (nicola, 10 months post - natal) while nicola reported recommencing her reduction of ost at 10 months postnatal, she maintained that she would not be doing the same with her benzodiazepine prescription . Carrie described regular use of illicit benzodiazepines to manage anxiety states, and support her parenting . As with tricia and nicola above, she justified her use of benzodiazepines, and need for a prescription of benzodiazepines, on therapeutic grounds, whilst simultaneously affirming a desire to reduce her methadone prescription: ive been taking valium, but like the drug worker says, instead of getting it fae the streets, cos you do nt know what s in it, she s going to give me a prescription [] so i m not sitting all thingy [pulls agitated face] around the kids and stuff . Cos i m a bit, still a bit, like anxious i think that s the word . But i m down to 19ml [methadone] noo, so i ve been coming doon a ml a week . (carrie, 4 months postnatal) i ve been taking valium, but like the drug worker says, instead of getting it fae the streets, cos you do nt know what s in it, she s going to give me a prescription [] so i m not sitting all thingy [pulls agitated face] around the kids and stuff . Cos i m a bit, still a bit, like anxious i think that s the word . But i m down to 19ml [methadone] noo, so i ve been coming doon a ml a week . (carrie, 4 months postnatal) when participants described benzodiazepine use as therapeutic, their accounts framed this as reasonable, responsible and more importantly, acceptable . Carrie emphasises that she was seeking, and expected to be given, a prescription for benzodiazepine, indicating that her dependence was validated by healthcare staff . Another participant, michael, maintained that the illicit benzodiazepines he bought were obtained from a reputable source and were trustworthy in terms of pharmaceutical content . These narratives supported participants arguments that their benzodiazepine use, whether illicit or prescribed, was controlled and unproblematic . Thus, participants constructed benzodiazepine use and dependence as a legitimate means to help them regulate problem emotional states which might otherwise interfere with their ability to live a normal life and effectively parent their children . Benzodiazepine use and dependence for women was frequently normalised: women described using prescribed and illicit benzodiazepines to manage anxiety, perform household chores or regulate sleep patterns . In contrast, while men in the study described using benzodiazepines for similar reasons, their accounts indicated that this was seen as problematic . One participant framed this as explicitly related to gender: ive got all these people, telling me what s right, and what s wrong, and i take valium now and again, so, therefore, i m not a good parent . How many bloody mothers oot there, do you ken that take valium? Does that stop them from being good parents []? Where s their just cause []? Where s the argument, like, because i chose to be on valium when i was young, he must be f***ed up . To me, i would like to think i m reasonably intelligent . But, fae their angle, i m no, they must think i m a total madman, which i m no. (stuart, 8 months postnatal) i ve got all these people, telling me what s right, and what s wrong, and i take valium now and again, so, therefore, i m not a good parent . How many bloody mothers oot there, do you ken that take valium? Does that stop them from being good parents []? Where s their just cause []? Where s the argument, like, because i chose to be on valium when i was young, he must be f***ed up . To me but, fae their angle, i m no, they must think i m a total madman, which i m no. (stuart, 8 months postnatal) stuart alludes to the existence of gendered stereotypes about benzodiazepine dependence suggesting that use among women and mothers is accepted, but that among men and fathers is seen as dangerous or evidence of severe personality dysfunction . While the other men in the study did not make this gendered link explicit, the four male participants who reported illicit use of benzodiazepines provided similar accounts in other ways . All asserted the therapeutic benefits of benzodiazepines, described unsuccessful attempts to acquire prescriptions and subsequently affirmed a desire or need to cease their illicit use of benzodiazepines . While it is impossible to say based on this limited sample, these accounts allude to the existence of gendered patterns of prescribing, with healthcare practitioners seeming more ready to legitimise women s use of, and dependence on, benzodiazepines . Benzodiazepine use among men was also portrayed as problematic by three women in the study who described illicit use of benzodiazepines by their partners . One participant suggested that her partner s benzodiazepine use was associated with aggression and domestic abuse, while the others clearly indicated that benzodiazepine use for their partners was more concerning than their use of other substances, particularly when combined with alcohol . This parallels findings of another study with young offenders (forsyth, khan, & mckinlay, 2011).what i m doing, i m just pottering about the house quite happy, tidying up, sorting things out, and they [benzodiazepines] make me feel happy, and i go to the shops and chat away to people, and it gives me a bit more confidence, but with him they make him angry, like i do nt know, it s weird . (carol, 9 months postnatal) what i m doing, i m just pottering about the house quite happy, tidying up, sorting things out, and they [benzodiazepines] make me feel happy, and i go to the shops and chat away to people, and it gives me a bit more confidence, but with him they make him angry, like i do nt know, it s weird . (carol, 9 months postnatal) in contrast, while women occasionally noted adverse effects of benzodiazepine use, this was generally focused on pregnancy and risks to the unborn baby . The potential harms associated with benzodiazepine use, including the potential for cognitive impairment and acute withdrawal symptoms, appeared little understood or acknowledged in most participant accounts . This was a longitudinal, qualitative study involving 19 opioid - dependent service users over the course of approximately one year in order to examine changes over time in participants experiences with healthcare services, drug use and parenting . The truth, but rather as a resource through which to explore how parenting and drug use are understood, negotiated and mutually constructed (bury, 2001; rhodes, bernays, & houmoller, 2010). The study was carried out in scotland in an area with a mixed socio - economic profile, containing areas of significant deprivation . Ost services for drug - dependent patients are delivered via primary care and specialist community - based substance misuse services . There are local guidelines both for the management of substance misuse in pregnancy (whittaker, 2003), and parental substance use (elbeg, 2013). Notably, a large number of patients in the area are prescribed benzodiazepines in addition to ost . Participants, recruited via healthcare practitioners, were interviewed at around 2832 weeks gestation; 23 months postnatal; and 69 months postnatal . Inclusion criteria were opioid - dependence, being an expectant or recent parent, and> 18 years . All were unemployed and white, reflecting the population of opioid - dependent adults in the study area . Five participants were first - time parents, fourteen other participants had between one and three children, aged 219 . All were receiving ost at the first interview, primarily methadone, with a minority prescribed buprenorphine or dihydrocodeine . Eleven reported heroin use in the 12 months prior to the first interview and thirteen reported benzodiazepine use during the study period . In five cases, diazepam was prescribed long - term alongside ost . This reflects the pattern of poly - drug use and prescribing practices in this geographical setting (bird & robertson, 2011). In total, semi - structured interviews, lasting between 45120 minutes, addressed participants social background, drug use, experiences with parenting, and involvement with services . This was supplemented by close reading of transcripts and thematic coding by authors ac and aw (ritchie, spencer, & oconnor, 2003). The present paper is based on analysis of two content codes: benzodiazepine use and methadone practice . Accounts were compared and contrasted and analytic themes were generated and agreed by the research team . Participants gave informed consent and were provided with a 20 voucher for each interview completed . A common theme across parents accounts of all drug use was that their substance use helped to support their attempts to engage in normal daily life, providing a better context in which to undertake parenting . Positive meanings were sometimes ascribed to ost which was portrayed as enabling parents to manage their opioid - dependence in a legal, safer and relatively more socially acceptable manner (chandler et al ., 2013). This was particularly the case for parents who had only recently ceased use of illicit opioids:[t]he only way to have a normal life [] and keep a normal life to normality, to being able to live again is a methadone prescription . (alison, 3 months postnatal) [t]he only way to have a normal life [] and keep a normal life to normality, to being able to live again is a methadone prescription . (alison, 3 months postnatal) however, parents accounts more often emphasised the barriers and problems ost posed . Particularly in the post - natal period, the structures around ost prescribing (e.g. Dispensing requirements) were highlighted as having a negative impact on parents attempts to engage in a normal life or recovery - orientated activities such as training and employment: im no wanting to stay on daily supervised, especially to try and go back to work, to go back to college . (laura, 9 months postnatal) i m no wanting to stay on daily supervised, especially to try and go back to work, to go back to college . (laura, 9 months postnatal) this was particularly the case for those participants who were required to have their use of ost supervised where methadone was consumed in the pharmacy under the surveillance of the dispensing pharmacist (and any onlookers). Such practices were framed as especially problematic for parents: sometimes when i see ones in the chemist wi their weans [children] and i think they should nt be bringing their wean oot they re standing waiting for their meth and i try and sit in a seat away fae them . (melanie, antenatal) when you re being on supervised and that, because at the chemist i m at, they ve no got a bit that s blocked off, so you re standing at [the locality] swallowing your methadone in the middle of the shop flair . So you get folk looking at you [] whether i ve got [daughter] wi me or no, so it s just, there s the junkie, look at her . (caitlin, 9 months postnatal) sometimes when i see ones in the chemist wi their weans [children] and i think they should nt be bringing their wean oot they re standing waiting for their meth and i try and sit in a seat away fae them . (melanie, antenatal) when you re being on supervised and that, because at the chemist i m at, they ve no got a bit that s blocked off, so you re standing at [the locality] swallowing your methadone in the middle of the shop flair . So you get folk looking at you [] whether i ve got [daughter] wi me or no, so it s just, there s the junkie, look at her . (caitlin, 9 months postnatal) both melanie and caitlin s accounts highlight the role of stigma in shaping the experiences of parents in ost programmes . In contrast, accounts of benzodiazepine use and dependence tended to be framed more positively, and crucially without reference to stigma . Most participants described using benzodiazepines in constructive ways: treating anxiety states, mood enhancers, providing practical and emotional support for parenting, enabling them to engage in daily routines and household tasks, and ultimately providing a context in which carol, for instance, argued that her use of illicit diazepam was controlled, and helped her manage household chores.yes, like that song, mother s little helper, that s what i like to think of it as, just sort of gets me going, puts me in a good mood . (carol, 6 months postnatal)similar justifications for illicit use were given by two fathers in the study . Here, paul s account refers to his (unsuccessful) attempts to acquire a prescription for benzodiazepines: i said to him [general practitioner] i m not taking them to get out of my face [intoxicated]. I said i just take the two at night to help me get to sleep . (paul, antenatal) yes, like that song, mother s little helper, that s what i like to think of it as, just sort of gets me going, puts me in a good mood . (carol, 6 months postnatal) i said to him [general practitioner] i m not taking them to get out of my face [intoxicated]. I said i just take the two at night to help me get to sleep . (paul, antenatal) participant s explanations for their continued use of benzodiazepines often centred on the supposed functional benefits of the drug in helping parent s cope with day - to - day life . In contrast, accounts about ost were more likely to be framed around emphasising reduction and abstinence, narratives which were largely absent when it came to benzodiazepines . This is most evident in the accounts of parents who were dependent on both benzodiazepines and ost . In nicola s final interview she reported that she was committed to reducing her methadone, contrasting starkly with her account of her benzodiazepine prescription: im fed up being stuck on something, where i wake up with my daughter, feeling like crap, and the first thing i dae is have to swallow medicine and have a cup of tea, to feel normal [] aye, i m not ready for [reducing] diazepam . That s like mother s little helper [] they help me, to want to get up in time to do stuff and everything . (nicola, 10 months postnatal) i m fed up being stuck on something, where i wake up with my daughter, feeling like crap, and the first thing i dae is have to swallow medicine and have a cup of tea, to feel normal [] aye, i m not ready for [reducing] diazepam . That s like mother s little helper [] they help me, to want to get up in time to do stuff and everything . (nicola, 10 months postnatal) divergent orientations towards methadone and benzodiazepine reduction were also discussed with tricia . In earlier interviews, tricia had rejected the idea of reducing any of her prescriptions, however, like nicola, at 10 months postnatal she reported reducing her methadone, but not her benzodiazepine dosage: i feel like i m still a junkie because i need this green liquid [methadone] every day, it s crap, but i mean i dinnae feel like that with my valium [] aye i need to stay there [on the same dose of benzodiazepine] the now, i dinnae ken [do nt know] i would get all nervous . I do need my valium and if they said to me they were going to start cutting me i would panic [] but they re not, they re just happy at me being stable just now . (tricia, 10 months postnatal) i feel like i m still a junkie because i need this green liquid [methadone] every day, it s crap, but i mean i dinnae feel like that with my valium [] aye i need to stay there [on the same dose of benzodiazepine] the now, i dinnae ken [do nt know] i would get all nervous . I do need my valium and if they said to me they were going to start cutting me i would panic [] but they re not, they re just happy at me being stable just now . (tricia, 10 months postnatal) rhetoric about stability, abstinence and dependence, therefore, were employed by participants differently according to the particular substance they were discussing . Accounts of substance use during pregnancy were for women especially more similar . In the majority of cases, women indicated that they wanted to reduce their dosage of both ost and benzodiazepine . Each of these substances were framed as problematic during pregnancy, largely centring on potential harm to the unborn baby.ive forgotten the other one, stop smoking, come off that, like the valium, and the methadone [] and i said it would be a bit much for me doing all of that [] but it s no too much for me coming down from the methadone and the valium []. Because it s going to be helping the baby and me . (iona, antenatal) i ve forgotten the other one, stop smoking, come off that, like the valium, and the methadone [] and i said it would be a bit much for me doing all of that [] but it s no too much for me coming down from the methadone and the valium []. Because it s going to be helping the baby and me . (iona, antenatal) women stressed a keen awareness that use of a range of substances might have negative effects on their babies . Those women dependent on multiple substances (the majority) described a careful balance of trying to stabilise or reduce one or more prescriptions, whilst avoiding relapse to illicit drug use . A common theme across parents accounts of all drug use was that their substance use helped to support their attempts to engage in normal daily life, providing a better context in which to undertake parenting . Positive meanings were sometimes ascribed to ost which was portrayed as enabling parents to manage their opioid - dependence in a legal, safer and relatively more socially acceptable manner (chandler et al ., 2013). This was particularly the case for parents who had only recently ceased use of illicit opioids:[t]he only way to have a normal life [] and keep a normal life to normality, to being able to live again is a methadone prescription . (alison, 3 months postnatal) [t]he only way to have a normal life [] and keep a normal life to normality, to being able to live again is a methadone prescription . (alison, 3 months postnatal) however, parents accounts more often emphasised the barriers and problems ost posed . Particularly in the post - natal period, the structures around ost prescribing (e.g. Dispensing requirements) were highlighted as having a negative impact on parents attempts to engage in a normal life or recovery - orientated activities such as training and employment: im no wanting to stay on daily supervised, especially to try and go back to work, to go back to college . (laura, 9 months postnatal) i m no wanting to stay on daily supervised, especially to try and go back to work, to go back to college . (laura, 9 months postnatal) this was particularly the case for those participants who were required to have their use of ost supervised where methadone was consumed in the pharmacy under the surveillance of the dispensing pharmacist (and any onlookers). Such practices were framed as especially problematic for parents: sometimes when i see ones in the chemist wi their weans [children] and i think they should nt be bringing their wean oot they re standing waiting for their meth and i try and sit in a seat away fae them . (melanie, antenatal) when you re being on supervised and that, because at the chemist i m at, they ve no got a bit that s blocked off, so you re standing at [the locality] swallowing your methadone in the middle of the shop flair . So you get folk looking at you [] whether i ve got [daughter] wi me or no, so it s just, there s the junkie, look at her . (caitlin, 9 months postnatal) sometimes when i see ones in the chemist wi their weans [children] and i think they should nt be bringing their wean oot they re standing waiting for their meth and i try and sit in a seat away fae them . (melanie, antenatal) when you re being on supervised and that, because at the chemist i m at, they ve no got a bit that s blocked off, so you re standing at [the locality] swallowing your methadone in the middle of the shop flair . So you get folk looking at you [] whether i ve got [daughter] wi me or no, so it s just, there s the junkie, look at her . (caitlin, 9 months postnatal) both melanie and caitlin s accounts highlight the role of stigma in shaping the experiences of parents in ost programmes . In contrast, accounts of benzodiazepine use and dependence tended to be framed more positively, and crucially without reference to stigma . Most participants described using benzodiazepines in constructive ways: treating anxiety states, mood enhancers, providing practical and emotional support for parenting, enabling them to engage in daily routines and household tasks, and ultimately providing a context in which carol, for instance, argued that her use of illicit diazepam was controlled, and helped her manage household chores.yes, like that song, mother s little helper, that s what i like to think of it as, just sort of gets me going, puts me in a good mood . (carol, 6 months postnatal)similar justifications for illicit use were given by two fathers in the study . Here, paul s account refers to his (unsuccessful) attempts to acquire a prescription for benzodiazepines: i said to him [general practitioner] i m not taking them to get out of my face [intoxicated]. I said i just take the two at night to help me get to sleep . (paul, antenatal) yes, like that song, mother s little helper, that s what i like to think of it as, just sort of gets me going, puts me in a good mood . (carol, 6 months postnatal) i said to him [general practitioner] i m not taking them to get out of my face [intoxicated]. I said i just take the two at night to help me get to sleep . (paul, antenatal) participant s explanations for their continued use of benzodiazepines often centred on the supposed functional benefits of the drug in helping parent s cope with day - to - day life . In contrast, accounts about ost were more likely to be framed around emphasising reduction and abstinence, narratives which were largely absent when it came to benzodiazepines . This is most evident in the accounts of parents who were dependent on both benzodiazepines and ost . In nicola s final interview she reported that she was committed to reducing her methadone, contrasting starkly with her account of her benzodiazepine prescription: im fed up being stuck on something, where i wake up with my daughter, feeling like crap, and the first thing i dae is have to swallow medicine and have a cup of tea, to feel normal [] aye, i m not ready for [reducing] diazepam . That s like mother s little helper [] they help me, to want to get up in time to do stuff and everything . (nicola, 10 months postnatal) i m fed up being stuck on something, where i wake up with my daughter, feeling like crap, and the first thing i dae is have to swallow medicine and have a cup of tea, to feel normal [] aye, i m not ready for [reducing] diazepam . That s like mother s little helper [] they help me, to want to get up in time to do stuff and everything . (nicola, 10 months postnatal) divergent orientations towards methadone and benzodiazepine reduction were also discussed with tricia . In earlier interviews, tricia had rejected the idea of reducing any of her prescriptions, however, like nicola, at 10 months postnatal she reported reducing her methadone, but not her benzodiazepine dosage: i feel like i m still a junkie because i need this green liquid [methadone] every day, it s crap, but i mean i dinnae feel like that with my valium [] aye i need to stay there [on the same dose of benzodiazepine] the now, i dinnae ken [do nt know] i would get all nervous . I do need my valium and if they said to me they were going to start cutting me i would panic [] but they re not, they re just happy at me being stable just now . (tricia, 10 months postnatal) i feel like i m still a junkie because i need this green liquid [methadone] every day, it s crap, but i mean i dinnae feel like that with my valium [] aye i need to stay there [on the same dose of benzodiazepine] the now, i dinnae ken [do nt know] i would get all nervous . I do need my valium and if they said to me they were going to start cutting me i would panic [] but they re not, they re just happy at me being stable just now . (tricia, 10 months postnatal) rhetoric about stability, abstinence and dependence, therefore, were employed by participants differently according to the particular substance they were discussing . Accounts of substance use during pregnancy were for women especially more similar . In the majority of cases, women indicated that they wanted to reduce their dosage of both ost and benzodiazepine . Each of these substances were framed as problematic during pregnancy, largely centring on potential harm to the unborn baby.ive forgotten the other one, stop smoking, come off that, like the valium, and the methadone [] and i said it would be a bit much for me doing all of that [] but it s no too much for me coming down from the methadone and the valium []. Because it s going to be helping the baby and me . (iona, antenatal) i ve forgotten the other one, stop smoking, come off that, like the valium, and the methadone [] and i said it would be a bit much for me doing all of that [] but it s no too much for me coming down from the methadone and the valium []. Because it s going to be helping the baby and me . (iona, antenatal) women stressed a keen awareness that use of a range of substances might have negative effects on their babies . Those women dependent on multiple substances (the majority) described a careful balance of trying to stabilise or reduce one or more prescriptions, whilst avoiding relapse to illicit drug use . A clear contrast between parents accounts of opioid and benzodiazepine use and dependence was that the latter were often framed as a legitimate method of managing anxiety, negative emotions and past trauma . As such, while women described reducing their benzodiazepine use during pregnancy, as with nicola s account here, once the pregnancy ended, the need to reduce (based on perceived potential harm to the baby) also ceased.ive been on them maist of my life, and that s to stop paranoia, it s to stop me going ootside, and feel like everybody s looking at me, and agitated, anxiety, everything, so they know i ll no be coming off them . I ve already cut doon to ten milligrams, when i was pregnant, and nae mair, that s it . I ll sort the meth [ost], and then see aboot that [diazepam] in the later future . (nicola, 10 months post - natal) i ve been on them maist of my life, and that s to stop paranoia, it s to stop me going ootside, and feel like everybody s looking at me, and agitated, anxiety, everything, so they know i ll no be coming off them . I ve already cut doon to ten milligrams, when i was pregnant, and nae mair, that s it . I ll sort the meth [ost], and then see aboot that [diazepam] in the later future . (nicola, 10 months post - natal) while nicola reported recommencing her reduction of ost at 10 months postnatal, she maintained that she would not be doing the same with her benzodiazepine prescription . Carrie described regular use of illicit benzodiazepines to manage anxiety states, and support her parenting . As with tricia and nicola above, she justified her use of benzodiazepines, and need for a prescription of benzodiazepines, on therapeutic grounds, whilst simultaneously affirming a desire to reduce her methadone prescription: ive been taking valium, but like the drug worker says, instead of getting it fae the streets, cos you do nt know what s in it, she s going to give me a prescription [] so i m not sitting all thingy [pulls agitated face] around the kids and stuff . Just to calm me cos i m a bit, still a bit, like anxious i think that s the word . But i m down to 19ml [methadone] noo, so i ve been coming doon a ml a week . (carrie, 4 months postnatal) i ve been taking valium, but like the drug worker says, instead of getting it fae the streets, cos you do nt know what s in it, she s going to give me a prescription [] so i m not sitting all thingy [pulls agitated face] around the kids and stuff . Just to calm me cos i m a bit, still a bit, like anxious i think that s the word . But i m down to 19ml [methadone] noo, so i ve been coming doon a ml a week . (carrie, 4 months postnatal) when participants described benzodiazepine use as therapeutic, their accounts framed this as reasonable, responsible and more importantly, acceptable . Carrie emphasises that she was seeking, and expected to be given, a prescription for benzodiazepine, indicating that her dependence was validated by healthcare staff . Another participant, michael, maintained that the illicit benzodiazepines he bought were obtained from a reputable source and were trustworthy in terms of pharmaceutical content . These narratives supported participants arguments that their benzodiazepine use, whether illicit or prescribed, was thus, participants constructed benzodiazepine use and dependence as a legitimate means to help them regulate problem emotional states which might otherwise interfere with their ability to live a normal life and effectively parent their children . Benzodiazepine use and dependence for women was frequently normalised: women described using prescribed and illicit benzodiazepines to manage anxiety, perform household chores or regulate sleep patterns . In contrast, while men in the study described using benzodiazepines for similar reasons, their accounts indicated that this was seen as problematic . One participant framed this as explicitly related to gender: ive got all these people, telling me what s right, and what s wrong, and i take valium now and again, so, therefore, i m not a good parent . How many bloody mothers oot there, do you ken that take valium? Does that stop them from being good parents []? Where s their just cause []? Where s the argument, like, because i chose to be on valium when i was young, he must be f***ed up . To me but, fae their angle, i m no, they must think i m a total madman, which i m no. (stuart, 8 months postnatal) i ve got all these people, telling me what s right, and what s wrong, and i take valium now and again, so, therefore, i m not a good parent . How many bloody mothers oot there, do you ken that take valium? Does that stop them from being good parents []? Where s their just cause []? Where s the argument, like, because i chose to be on valium when i was young, he must be f***ed up . To me but, fae their angle, i m no, they must think i m a total madman, which i m no. (stuart, 8 months postnatal) stuart alludes to the existence of gendered stereotypes about benzodiazepine dependence suggesting that use among women and mothers is accepted, but that among men and fathers is seen as dangerous or evidence of severe personality dysfunction . While the other men in the study did not make this gendered link explicit, the four male participants who reported illicit use of benzodiazepines provided similar accounts in other ways . All asserted the therapeutic benefits of benzodiazepines, described unsuccessful attempts to acquire prescriptions and subsequently affirmed a desire or need to cease their illicit use of benzodiazepines . While it is impossible to say based on this limited sample, these accounts allude to the existence of gendered patterns of prescribing, with healthcare practitioners seeming more ready to legitimise women s use of, and dependence on, benzodiazepines . Benzodiazepine use among men was also portrayed as problematic by three women in the study who described illicit use of benzodiazepines by their partners . One participant suggested that her partner s benzodiazepine use was associated with aggression and domestic abuse, while the others clearly indicated that benzodiazepine use for their partners was more concerning than their use of other substances, particularly when combined with alcohol . This parallels findings of another study with young offenders (forsyth, khan, & mckinlay, 2011).what i m doing, i m just pottering about the house quite happy, tidying up, sorting things out, and they [benzodiazepines] make me feel happy, and i go to the shops and chat away to people, and it gives me a bit more confidence, but with him they make him angry, like i do nt know, it s weird . (carol, 9 months postnatal) what i m doing, i m just pottering about the house quite happy, tidying up, sorting things out, and they [benzodiazepines] make me feel happy, and i go to the shops and chat away to people, and it gives me a bit more confidence, but with him they make him angry, like i do nt know, it s weird . (carol, 9 months postnatal) in contrast, while women occasionally noted adverse effects of benzodiazepine use, this was generally focused on pregnancy and risks to the unborn baby . The potential harms associated with benzodiazepine use, including the potential for cognitive impairment and acute withdrawal symptoms, appeared little understood or acknowledged in most participant accounts . Benzodiazepine use and dependence for women was frequently normalised: women described using prescribed and illicit benzodiazepines to manage anxiety, perform household chores or regulate sleep patterns . In contrast, while men in the study described using benzodiazepines for similar reasons, their accounts indicated that this was seen as problematic . One participant framed this as explicitly related to gender: ive got all these people, telling me what s right, and what s wrong, and i take valium now and again, so, therefore, i m not a good parent . How many bloody mothers oot there, do you ken that take valium? Does that stop them from being good parents []? Where s their just cause []? Where s the argument, like, because i chose to be on valium when i was young, he must be f***ed up . To me, i would like to think i m reasonably intelligent . But, fae their angle, i m no, they must think i m a total madman, which i m no. (stuart, 8 months postnatal) i ve got all these people, telling me what s right, and what s wrong, and i take valium now and again, so, therefore, i m not a good parent . How many bloody mothers oot there, do you ken that take valium? Does that stop them from being good parents []? Where s their just cause []? Where s the argument, like, because i chose to be on valium when i was young, he must be f***ed up . To me, i would like to think i m reasonably intelligent . But, fae their angle, i m no, they must think i m a total madman, which i m no. (stuart, 8 months postnatal) stuart alludes to the existence of gendered stereotypes about benzodiazepine dependence suggesting that use among women and mothers is accepted, but that among men and fathers is seen as dangerous or evidence of severe personality dysfunction . While the other men in the study did not make this gendered link explicit, the four male participants who reported illicit use of benzodiazepines provided similar accounts in other ways . All asserted the therapeutic benefits of benzodiazepines, described unsuccessful attempts to acquire prescriptions and subsequently affirmed a desire or need to cease their illicit use of benzodiazepines . While it is impossible to say based on this limited sample, these accounts allude to the existence of gendered patterns of prescribing, with healthcare practitioners seeming more ready to legitimise women s use of, and dependence on, benzodiazepines . Benzodiazepine use among men was also portrayed as problematic by three women in the study who described illicit use of benzodiazepines by their partners . One participant suggested that her partner s benzodiazepine use was associated with aggression and domestic abuse, while the others clearly indicated that benzodiazepine use for their partners was more concerning than their use of other substances, particularly when combined with alcohol . This parallels findings of another study with young offenders (forsyth, khan, & mckinlay, 2011).what i m doing, i m just pottering about the house quite happy, tidying up, sorting things out, and they [benzodiazepines] make me feel happy, and i go to the shops and chat away to people, and it gives me a bit more confidence, but with him they make him angry, like i do nt know, it s weird . (carol, 9 months postnatal) what i m doing, i m just pottering about the house quite happy, tidying up, sorting things out, and they [benzodiazepines] make me feel happy, and i go to the shops and chat away to people, and it gives me a bit more confidence, but with him they make him angry, like i do nt know, it s weird . (carol, 9 months postnatal) in contrast, while women occasionally noted adverse effects of benzodiazepine use, this was generally focused on pregnancy and risks to the unborn baby . The potential harms associated with benzodiazepine use, including the potential for cognitive impairment and acute withdrawal symptoms, appeared little understood or acknowledged in most participant accounts . This longitudinal qualitative study explored accounts of poly - drug use within the context of pregnancy and parenting, highlighting differential understandings and practices surrounding benzodiazepine and opioid use . Our findings illuminate a number of issues with implications for theory, policy, prevention and education . The accounts in our study resonate with others (klee, 1998; radcliffe, 2011) in demonstrating the morally difficult nature of being a drug - using parent, and the extent to which stigma can play an important role in the day - to - day lives of parents . Our findings suggest that while drug use, in general, is seen as incompatible with parenting, there are clear indications that some drugs, and types of addiction, are more acceptable than others . Crucially, our analysis indicates important differences in the way opioid and benzodiazepine use are understood and narrated within the context of parenthood . Unlike benzodiazepine use, participants in this study often described ost in negative terms even when they acknowledged that ost was helpful in treating opioid dependence . This dominant negative discourse on ost by drug users themselves, has been described elsewhere (harris & mcelrath, 2012; lloyd, 2013; radcliffe & stevens, 2008), and highlights the unique stigma attached to ost for the treatment of opioid dependence (keane, 2013). Participants described using benzodiazepines in constructive ways to enhance social and emotional functioning and engagement in normal life appealing to a self - medicating hypothesis of addiction to explain and justify continued use (jones, et al ., 2012). These meanings served to legitimise benzodiazepine dependence, contrasting sharply with participants alignment of ost with junkie identities, as documented elsewhere (keane, 2013; radcliffe & stevens, 2008). In the context of parenthood, parents were more likely to describe a desire to reduce opioid rather than benzodiazepine use, and there was evidence that illicit benzodiazepine use was considered less harmful than opioid use . This is noteworthy, because alongside this complacency were occasional notes of concern, particularly in relation to benzodiazepine use by men, and its link with increased aggression and domestic abuse (reported by some women participants). Accounts from this study provide a tentative indication of the way gender may shape understandings of benzodiazepine use . The long - term use of benzodiazepines by mothers was framed as being therapeutic and unproblematic . In contrast, while men reported using benzodiazepine for similar reasons, their accounts indicated that practitioners did not legitimise this and prescriptions were denied . These findings sit uneasily with the dominant recovery agenda in uk drug policy (valentine & treloar, 2013; wardle, 2012), where abstinence from all drug use is assumed to be both desirable and necessary for social reintegration . It may be that in practice recovery refers to particular categories of drugs, with the hierarchy of acceptability identified among service users in this study being apparently mirrored in prescribing practices and approaches taken to treating addiction by clinicians (anthierens, habraken, petrovic, & christiaens, 2007). Thus, while opioid - dependent individuals may express a desire to reduce their opioid prescriptions, this is not necessarily reflected in their orientation towards other drug use, particularly benzodiazepines . As such, the claim that opioid - dependent individuals would prefer abstinence - based treatment approaches may result from the unique stigma attached to opioids and may not apply to all drug use, or all drugs of dependence (lloyd, 2013; mckeganey, morris, neale, & robertson, 2004; neale, nettleton, & pickering, 2011). Our findings suggest a need for further preventative measures and targeted education to address benzodiazepine use and dependence within the context of pregnancy and parenting, especially in populations of parents engaged in ost programmes where stability on opioids may detract from issues associated with benzodiazepine use and dependence . Reviews of benzodiazepine prescribing (sirdifield et al ., 2013), identify a variety of reasons for inconsistent practice, and conclude that improved education and training, provision of non - pharmacological interventions, and enhanced communication with patients is required . Our findings support these recommendations, especially the need for enhanced education and training of both clinicians and patients, and extra provision of non - pharmacological interventions to promote the psychological and social functioning of parents on ost . This was an in - depth, qualitative exploration of the accounts of nineteen drug - dependent parents on ost in a specific geographical area . As such, our findings and conclusions should be read as indicative and suggestive rather than definitive . Further qualitative exploration in different geographical areas and populations is needed, as it is likely that local or cultural contexts may shape the types of narratives expressed in respect of the range of substances consumed . Our findings may have limited applicability to opioid dependent parents who are not engaged in ost programmes . However, the contrasting accounts depicted here underline the importance of qualitative research in illuminating understandings about the meanings that drugs of addiction have for those who use them (neale, allen, & coombes, 2005). Although long - term benzodiazepine use and dependence among opioid - dependent populations has been a topic of concern for some decades (who, 1996) and is associated with increased risks and harm (lader, 2011, 2014), research regarding the impact on pregnancy, parenting and family life has been limited (acmd, 2003). Our findings suggest that parents frame benzodiazepine use and dependence as largely unproblematic, less stigmatising and more legitimate than ost . We suggest these divergent accounts can be understood as drawing on differing cultural meanings attached to ost and benzodiazepine use, which are reflected in policy and practice . As such, prevention, education and policy initiatives should pay greater attention to the kind of narratives and strategies that are employed in addressing benzodiazepine use and dependence within opioid dependent populations, especially in respect of the parenting and child welfare agenda.
|
In industrialized countries, cardiovascular disease (cvd) remains the predominant cause of morbidity and mortality . It is current scientific opinion that cvd occurs as a part of a series of events that form a continuum . The first stage of this continuum corresponds to the presence of risks factors that predispose to tissue injury, such as hypertension, dyslipidemia, and diabetes . These risk factors usually activate a complex range of pathogenic pathways leading to the development of atherosclerosis and ischemic heart disease . Failure to effectively manage any stage of this continuum results in ventricular hypertrophy, heart failure, end - stage heart disease, and cardiovascular death . One of the molecular pathways that could be activated in response to these risk factors and be involved in cvd development is that of osteoprotegerin (opg) and tnf - related apoptosis - inducing ligand (trail), as reviewed in . Opg and trail are both members of the tnf superfamily, and they are widely expressed in different tissues, including the heart and the vessels, in health and disease states [4, 5]. Although initially opg actions seemed to be limited to bone metabolism and those of trail to host defense against tumors, recent studies have suggested that both molecules might actually be involved in cvd development and progression . Epidemiological studies have shown that there is an association between circulating opg, trail, and cvd . Opg was found to be directly correlated [5, 8, 9], while trail was inversely correlated, with cardiovascular morbidity and mortality [10, 11]. Likewise, opg was significantly associated with the level of c - reactive protein, which is an independent predictor of acute vascular events and adverse outcomes, while trail was negatively correlated with it . Recently, secchiero and colleagues have shown that patients with coronary artery disease have an increased opg / trail ratio, which further increases in patients developing heart failure . Consistent with this epidemiological data, experimental studies suggest that opg and trail have opposite actions, as opg has proinflammatory and proatherogenic effects [14, 15], while trail seems to be anti - inflammatory [16, 17] and antiatherogenic [1820]. Based on these premises, we hypothesized that dyslipidemia and diabetes, which are two well known risk factors for cvd, could modify the vascular and cardiac expression of opg and trail, leading to an increased opg / trail ratio at a tissue level . The aim of this study was to explore the vascular and cardiac changes of opg and trail in experimental models of dyslipidemia and diabetes . A total of 12 male c57bl/6j (cnt) mice and 24 male apolipoprotein e null (apoe) mice on a c57bl/6j background, aged 6 weeks, were studied for 14 weeks . At 6 weeks of age, apoe mice were further randomized to saline (apoe) or streptozotocin (apoe + dm), which were delivered intraperitoneally in five consecutive daily doses . The daily dose of streptozotocin (stz) (sigma - aldrich) was 55 mg / kg of body weight . After one week, blood glucose was checked and only the mice with blood glucose levels greater than 15 mm were included in the apoe + dm group . During the study period, all the mice were fed with a standard diet . The animals were kept in a temperature - controlled room (22 1c) on a 12 h light/12 h dark cycle with free access to food and water and they were fed ad libitum for the length of the study . After 14 weeks, the animals were anesthetized with an intraperitoneal injection of thiobutabarbital sodium (inactin, sigma - aldrich) (60 mg / kg body weight) and sacrificed by exsanguination via cardiac puncture . All the animal experiments were approved by the animal ethics committee of the university of trieste (i d 28.0.2008) and the italian ministry of health, conforming to the guide for the care and use of laboratory animals . At the end of the study, we measured body weight and systolic blood pressure (sbp). In particular, sbp was assessed by a computerized noninvasive tail cuff system in conscious mice . Glucose, total cholesterol, hdl cholesterol, and triglycerides were measured in the sera by autoanalyzer technique (hitachi 917, tokyo, japan). Circulating levels of opg and trail were measured in the sera by elisa (r&d systems duoset #dy459 and #dy1121). In half of the animals in each group, aortae were collected and placed in 10% neutral - buffered formalin for atherosclerosis quantification, before being processed for immunohistochemical analyses . In the other half, aortae were snap - frozen in liquid nitrogen and stored at 80c for rna extraction and gene expression analyses . Briefly, aortae were cleaned of excess fat and stained with sudan iv - herxheimer's solution . Images were acquired with a dissecting microscope (olympus bx-50) equipped with a high - resolution camera (sony xc-77ce). Digitized images were then evaluated with an image analysis system (image - pro plus 6.3 software, media cybernetics). Total plaque area was quantified as the percentage area of aorta stained red . As for the hearts, they were divided and half was put in formalin and half was put in liquid nitrogen . The part that was fixed in formalin was embedded in paraffin, cut in 4 m thick sections, and stained with hematoxylin and eosin (h&e) in order to evaluate cardiomyocyte hypertrophy . Cardiomyocyte hypertrophy was assessed by measuring the shortest diameter of 200 cells, which were selected when they showed the spindle - shaped transverse section including the elliptical nucleus . The shortest transverse diameter was measured 3 times per cell, and the values were averaged, as reported by . The other half that was snap - frozen in liquid nitrogen was used either for gene expression analyses or for immunohistochemical stainings . Gene expression of opg and trail was determined by real - time quantitative rt - pcr (reverse transcription - polymerase chain reaction) in aortic and cardiac tissue . In order to isolate mrna from the aorta and the heart, tissue was homogenized and processed as previously reported . Then, mrna was treated with the dnase inactivation reagent (ambion dna - free product #am-1906), and 3 g of treated mrna was subsequently used to synthesize cdna with superscript first strand synthesis system for rt - pcr (gibco brl). The gene expression of opg and trail was analyzed by real - time quantitative rt - pcr using the taqman system (life technologies) for opg and the sybr green system (life technologies) for trail . Fluorescence for each cycle was quantitatively analyzed by an abi prism 7900ht sequence detection system (applied biosystems). Gene expression of opg was normalized to 18s mrna, while that of trail was normalized to rps9 . Results were reported as ratio compared with the level of expression in untreated controls, which were given an arbitrary value of 1 . The presence of opg and trail in the aortae was evaluated by immunostainings on 4 m thick paraffin sections . In particular, after antigen retrieval in citrate buffer (ph6) endogenous peroxidase was quenched for 10 minutes using 3% h2o2 in pbs . To localize opg, we used a biotinylated goat anti - opg antibody (r&d systems, 1: 10 dilution) followed by a catalyzed signal amplification system (dako). To localize trail, we used a monoclonal mouse anti - trail antibody (r&d systems, 1: 50 dilution), applied overnight at 4c . Biotinylated goat anti - mouse immunoglobulins (vector laboratories, dilution 1: 200) were then used as secondary antibody, followed by streptavidin - hrp (dako). The presence of opg and trail in the hearts was evaluated by immunostaining on 5 m thick frozen sections . After neutralization of endogenous peroxidase, sections were incubated overnight with the goat anti - opg antibody (r&d systems, 1: 10 dilution) and the monoclonal mouse anti - trail antibody (r&d systems, 1: 50 dilution). Biotinylated immunoglobulins, diluted 1: 200, were then applied as secondary antibodies, followed by streptavidin - hrp (dako). In both tissues, after counterstaining with hematoxylin, all the sections were examined by light microscopy (olympus bx50wi) and digitized using a high - resolution camera (q - imaging fast 1394). The proportional area of brown staining was measured by an image analysis system (image - pro plus 6.3 software, media cybernetics) in order to quantify opg and trail expression in aortae and hearts . Apoe mice had higher levels of total cholesterol and triglycerides as compared to the cnt mice . In line with the study protocol, the mice in the apoe + dm group were hyperglycemic . Moreover, diabetes was associated with a significant reduction of body weight and a significant increase of total cholesterol as compared to nondiabetic apoe mice . Apoe mice had a significant increase in total plaque area, which increased further after the induction of diabetes (figures 1(a) and 1(b)). As for cardiac changes, dyslipidemia was associated with a significant increase in cardiomyocyte size (figures 1(c) and 1(d)), indicating cardiomyocyte hypertrophy, with no further increase after the induction of diabetes . In the aorta, the induction of diabetes was associated with a significant increase in opg gene expression and in the opg / trail ratio, while dyslipidemia had no effect on opg / trail ratio as compared to controls (figure 2(a)). By contrast, in the heart, dyslipidemia was the major determinant of opg / trail tissue changes, not only by increasing opg but also by reducing trail gene expression . So dyslipidemia increased significantly cardiac opg / trail ratio, with no further differences after the induction of diabetes (figure 2(b)). Immunostainings showed that diabetes significantly increased aortic opg expression as compared to the other groups, while trail was unchanged (figure 3). On the other hand, in the heart, it was dyslipidemia that significantly increased opg protein expression, with no further changes after the induction of diabetes . As for cardiac trail, trail protein expression decreased in the apoe and apoe + dm groups (data not shown). The levels of circulating circulating opg was 1.91 0.21 ng / ml in the control group, 2.05 0.1 ng / ml in the apoe group, and 3.1 0.19 in the apoe + dm group, such that opg increased significantly in diabetic mice as compared to the other groups (p <0.05, apoe + dm versus cnt and versus apoe group). As for trail, we were unable to measure its circulating levels, as they were below the detection levels of the elisa we used . It has already been argued that opg, which circulates at much higher levels than its ligands (rankl and trail), may be a more stable overall measure of opg / trail activity than trail . Patients with coronary artery disease have an increased opg / trail ratio, which further increases in the group of patients who develop heart failure . Dyslipidemia and diabetes, we evaluated the effects of dyslipidemia, alone and in combination with diabetes, on aortic and cardiac opg and trail expression and found that while diabetes is the major determinant of opg / trail tissue changes in the vessels, dyslipidemia is it in the heart . This data is in line with previous experimental works showing that diabetes increased opg expression and the opg / trail ratio in the aorta and that the onset of diabetes was associated with an increase of circulating opg . Consistent with these observations, in our study, we found that aortic and circulating opg increased significantly only in the group of mice with diabetes . Taken together, these findings seem to support the hypothesis that the vessels might be the source of increased circulating levels of opg in patients with diabetes and/or cvd . It has to be noted that the increase of circulating and tissue opg could be not only a risk marker but also a risk factor for atherosclerosis and cvd development . Firstly, animal models point to a role for opg in glucose metabolism regulation, as opg injections increased significantly glucose levels [12, 26], which represent one of the risk factors for cvd . This effect could be mediated by trail blockade, as trail lowers glucose levels . By offsetting trail effects, opg could also promote body weight gain and dyslipidemia, as well as atherosclerotic plaque development [18, 20]. Secondly, several studies have shown that opg has proinflammatory and profibrotic effects on the vasculature . Consistent with these actions, our group has shown that opg increases leukocyte adhesion to endothelial cells, that it increases tgf - beta - mediated fibrogenesis and proliferation in vascular smooth muscle cells, and that it increases atherosclerosis extension in diabetic apoe mice . By contrast, dyslipidemia alone did not affect opg / trail ratio in the vasculature . This data is consistent with a few in vitro studies showing that oxidized ldl did not change opg expression in human coronary artery smooth muscle cells and lymphocytes . Nevertheless, in our study, we found that dyslipidemia significantly increased opg / trail ratio in the heart, while diabetes had no additional effect on it . It has been shown that dyslipidemia is independently associated with left ventricle (lv) hypertrophy [5, 30, 31]. This was confirmed by experimental studies on apoe mice, where dyslipidemia was associated with increased lv mass in the absence of hemodynamic stress . Consistent with previous reports, here we found that dyslipidemia was associated with cardiomyocyte hypertrophy . It has been demonstrated that triacylglycerol overload and the increased availability of other lipid intermediates, such as ceramides, diacylglycerol, and oxidized phospholipids, can all activate inflammatory pathways and oxidative stress, leading to cellular apoptosis and myocardial scarring [33, 34]. It is possible that the increase in cardiac opg / trail ratio that was associated with dyslipidemia represents one of the mediators of lipid - induced cardiac remodeling . As for opg, a recent study has demonstrated that opg delivery induced lv hypertrophy, while, in vitro, cardiomyocytes transfected with aav - opg increased dramatically the expression of hypertrophy - related proteins, such as anp, -mhc, and troponin i . In the cardiac fibroblast, by contrast, we showed that trail administration to mice with diabetic cardiomyopathy had cardioprotective effects, as it reduced cardiac fibrosis and apoptosis, which are generally contributing to cardiac remodeling . In conclusion, here we found that both dyslipidemia and diabetes affect opg / trail ratio in the cardiovascular system . This could contribute to the changes in circulating opg / trail which are observed in patients with diabetes and cvd . Most importantly, these changes could mediate / contribute to atherosclerosis development and cardiac remodeling.
|
Compounds 14, 7, 8, and 11 were synthesized following our previously reported synthetic routes . Saturated derivatives 5 and 6, unique to this work, were synthesized via the hydrogenation of diastereomers 1 and 2, respectively . Palmyrolide alcohol (9) and acid (10) were prepared exploiting the known acid - catalyzed ring opening of 1, followed by treating the resultant aldehyde with either nabh4 (for 9) or naclo2 (for 10). Alcohol 12 could be accessed in a similar manner from 14-epi - palmyrolide (2). In order to detect an interaction of ()-palmyrolide a and its analogues with voltage - gated sodium channels (vgscs), we examined the ability of these compounds to antagonize veratridine - stimulated na influx in murine primary cerebrocortical neurons . We previously demonstrated that veratridine is a partial agonist at neurotoxin site 2 on the vgsc subunit . Murine cerebrocortical neurons were loaded with the na - binding benzofuran isophthalate (sbfi), and the ability of palmyrolide analogues to block veratridine - induced elevation of neuronal [na]i was determined . Sodium influx was monitored with sbfi (340/380) responses to veratridine in the absence and presence of ()-palmyrolide a and its analogues . The compounds shown are (a) ()-palmyrolide a (1); (b) 17,18-dihydropalmyrolide a (5); (c) (+) -palmyrolide a (3); (d) 17,18-dihydro-14-epi - palmyrolide a (6); (e) [c-5(r),c-7(s),c-14(r)]-palmyrolide (8); and (f) [c-5(r),c-7(s),c-14(s)]-palmyrolide (7). Data shown are from a representative experiment performed in 2 or 3 replicates for each concentration . In total 47 experiments nonlinear regression analysis of concentration response data for active analogues of ()-palmyrolide a. a three - parameter logistic fit of the palmyrolide a analogue inhibition of the response to veratridine is shown for each active compound . The compounds shown are (a) ()-palmyrolide a (1); (b) 17,18-dihydropalmyrolide a (5); (c) (+) -palmyrolide a (3); (d) 17,18-dihydro-14-epi - palmyrolide a (6); (e) [c-5(r),c-7(s),c-14(r)]-palmyrolide (8); and (f) [c-5(r),c-7(s),c-14(s)]-palmyrolide (7). Data points shown represent the mean sem of 25 experiments performed with 210 replicates each (a f). Values represent mean sem of 25 experiments each performed with 210 replicates . Naturally occurring ()-palmyrolide a is a neuroactive macrolide that was previously shown to block veratridine - induced sodium influx in neuro-2a cells (ic50 = 5.2 m) and to display significant inhibition of ca oscillation in murine cerebrocortical neurons, with an ic50 value of 3.70 m (2.295.98 m, 95% ci). We have confirmed and extended these original findings by demonstrating that synthetic ()-palmyrolide a (1, figures 2a and 3a) and its enantiomer (3, figures 2c and 3c) produced concentration - dependent antagonism of veratridine - induced increase in neuronal [na]i . The concentration response curves for these compounds were best fit by a three - parameter logistic equation . This analysis yielded an ic50 value (95% confidence interval) of 2.1 m (1.23.1, 95% ci), which was in good agreement with the ic50 value reported earlier for natural ()-palmyrolide a. we found that ()-palmyrolide a (1) and macrolide analogues 5 and 3 were approximately 39-fold more potent than the other analogues tested (figures 2a the observation that saturated congener 5 showed a comparable ic50 to synthetic ()-palmyrolide a suggests that the enamide double bond is not essential for activity . It is moreover noteworthy that acyclic analogues of ()-palmyrolide a with the natural absolute configuration were inactive as blockers of veratridine - stimulated na influx . These data indicate that the three - dimensional molecular shape of ()-palmyrolide a was crucial for the interaction with vgscs . In order to support these observations and to better understand how structure relates to biological function, an exhaustive nmr and computational analysis was next conducted on 1 and three diastereomers (i.e., 2, 7, and 8). Saturated derivatives 5 and 6 exist as a mixture of rotational isomers and precluded precise nmr assignments from being made . Chemical shift assignments of ()-palmyrolide a (1) and synthetic diastereomers 2, 7, and 8 were made using dqf - cosy, hsqc, hmbc, and h2bc spectra . The chemical shifts of these four diastereomeric compounds follow the same general trends but differ slightly, indicating that the conformations of the macrolide ring are different . For example, in each diastereomer a different methylene group exhibited degenerate chemical shifts for its two protons . Stereospecific assignments were made for most of the prochiral atoms that possessed nondegenerate shifts . The noesy spectra provided 74 nonredundant distance restraints for 1, 83 for 2, 84 for 7, and 77 for 8 . H coupling in the h nmr spectra and from the heteronuclear couplings measured by the hetloc experiments (see supporting information for all restraints). Applying the distance and torsion restraints during simulated annealing calculations produced fairly well - defined ensembles of structures . Table 2 summarizes the inputs and results of the structure calculations . To test the specificity of the restraints and their ability to discriminate between the four diastereomers, restrained simulated annealing calculations were performed for all 16 combinations of starting structure and restraint set . If the restraints correctly discriminated between conformations, then the correct combination should have the least restraint violations and the lowest energy . For all four structures we found the best restraint set for each starting structure was the correct one, namely, the restraints derived from nmr spectra of that compound (table 3). This confirms that the restraint sets were able to correctly discriminate between the diastereomers . The four ensembles generally have the same overall conformation, with the major differences being due to the orientations of the substitutents . All four diastereomers have a cisoid configuration of the n - methyl group (n - ch3) and the adjacent carbonyl despite the starting structures having a transoid configuration . Examining the trajectories reveals that the configuration converts early in the simulated annealing as the restraints take effect . The driving force in these simulations appears to be noes between h-18 and the h-2 methylene group . To quantify differences between the ensembles, we calculated root - mean - square deviations (rmsd s) between the representative structures of each ensemble (table 4). The rmsd s were calculated using the differences in the positions of the carbon, nitrogen, and oxygen atoms of the macrolide ring after aligning the structures to minimize these differences . Representative structures were selected as the structure having the smallest rmsd among all other structures in its ensemble . The rmsd s between all four representative structures were similar (table 4), with 2 having the lowest values overall, suggesting that this ensemble is the most central in comparison to the other diastereomers . Visual inspection of the ensembles shows that the macrolide ring is relatively flat, but the orientation of the tert - butyl and methyl groups alters the global shape (figure 4). In 1 the tert - butyl and methyl groups lie close to the plane of the ring, but in 7 the tert - butyl group projects almost perpendicular to the plane of the ring, and in 8 the two methyl groups project in opposite directions above and below the ring . Examining the surface electrostatic potential of the representative structures (figure 5) we find that 8 is the most similar to the active compound 1 . However, the c-14 methyl group in 1 projects to the side, whereas in 8 it is situated above the macrolide ring . Taken together, these differences between diastereomers may account, at least in part, for the observed differences in biological activity . In addition, due to the highly flexible nature of the macrolide, as evidenced through computational modeling, the minimized ligand ensembles reported here may not necessarily reflect the structure these molecules adopt when bound to their molecular target . Further consideration and investigations into structure activity relationships are ongoing and will be reported in due course . Number of diastereotopic hydrogens for which stereospecific assignments were obtained, and total number of protons with nondegenerate chemical shifts . The three numbers reported for each combination of starting structure and restraint set are number of selected structures, average amber energy, and average violation energy . The italic cells indicate the best set of restraints for each starting structure, with respect to amber energy and violation energy, and also correspond to the correct pairing . The final row is the sum of the three rmsd s above, a measure of the total difference from the other structures . The four structures in the top row are shown in a similar orientation to figure 4 . In the lower row the structures have been rotated 180 about the horizontal axis to show the rear face . The electrostatic potential ranges from red (2 kcal / mole) through white (0) to blue (+ 2 kcal / mole). These findings suggest that both synthetic ()-palmyrolide a and its enantiomer function with equal potency as vgsc antagonists to block veratridine - induced sodium influx . With regard to identification of the pharmacophore of this natural product, it appears that the intact macrolide is required since acyclic versions were inactive as inhibitors of vgscs . Moreover, analogues lacking the enamide double bond were of high potency in this assay, and thus this functionality appears unnecessary for blocking vgscs . Finally, using detailed nmr and computational approaches with the natural product and three diastereomeric analogues, it was found that the c-5c-7 anti / c-7c14 syn arrangement of stereocenters produces a unique combination of three - dimensional shape and electrostatic potential that is responsible for the potent biological activity of the natural product . In an effort to understand the similar biological activity found for the natural stereoisomer and its enantiomer, continued investigations in this area will focus on uncovering the specific molecular target and associated binding site, which may also assist in future analogue development of novel sodium channel blocking analgesics derived from palmyrolide a. unless otherwise noted, reactions were performed in flame - dried glassware under an atmosphere of dry nitrogen . Reaction solvents (ch2cl2, thf, and et2o) were purified before use in a solvent purification system under a flow of dry nitrogen . All other solvents and reagents were purchased from commercial suppliers and used as received, unless otherwise specified . Thin - layer chromatography (tlc) was performed using plates precoated with silica gel 60 f-254 (250 m) and visualized by uv light, kmno4, or anisaldehyde stains, followed by heating . Ir samples were prepared by evaporation from chcl3 or ch2cl2 on nacl plates and run on a perkinelmer spectrum one ft - ir spectrometer . For the synthetic studies, h and c nmr spectra were recorded at 300 and 75 mhz (oxford magnet with a varian 300 console), at 400 and 100 mhz (oxford magnet with a varian unity 400 console), and at 600 and 150 mhz (magnex magnet with a bruker avance iii 600 console), respectively, and are reported relative to residual solvent peak (h 7.26 and c 77.0 for h and c in cdcl3). High - resolution mass spectra were obtained using positive electrospray ionization on a bruker 12 t apex - qe fticr - ms with an apollo ii ion source at the cosmic laboratory facility at old dominion university, va . To a solution of (s, e)-6-iodo-2-methylhex-5-enoic acid (0.096 g, 0.37 mmol) in thf (3.7 ml) was added diisopropylethylamine (0.100 ml, 0.60 mmol) followed by the yamaguchi reagent (0.071 ml, 0.45 mmol). The mixture was allowed to stir at room temperature for 3 h before being concentrated in vacuo . The resultant mixed anhydride was dissolved in toluene (7.4 ml) and then added, via cannula, to a flask containing (5r,7r)-7-hydroxy-5,8,8-trimethylnonanamide (0.051 g, 0.23 mmol) and dmap (0.046 g, 0.37 mmol). After stirring at room temperature (rt) for 12 h, the reaction mixture was diluted with ch2cl2, washed with a saturated aqueous solution of nahco3, dried over mgso4, and concentrated . Purification via flash column chromatography (1:1 hexanes / etoac) afforded 0.088 g (81%) of the coupled product as a colorless oil: []d22.5 + 13.3 (c 1.98, chcl3); ir (neat, thin film) 3429, 3351, 3203, 2962, 2934, 2868, 1725, 1665, 1607, 1461, 1380, 1366, 1259, 1181, 1119, 1067, 957, 935 cm; h nmr (300 mhz, cdcl3) 6.49 (dt, j = 7.2, 14.4 hz, 1 h), 6.02 (d, j = 14.4 hz, 1h), 5.88 (bs, 1 h), 5.46 (bs, 1 h), 4.79 (dd, j = 4.5, 6.3 hz, 1 h), 2.45 (sextet, j = 6.9 hz, 1 h), 2.232.15 (m, 2 h), 2.122.05 (m, 2 h), 1.861.69 (m, 2 h), 1.611.25 (m, 6 h), 1.17 (d, j = 7.2 hz, 3 h), 1.110.99 (m, 1 h), 0.910.87 (overlapping doublet / singlet, 12 h); c nmr (75 mhz, cdcl3) 176.5, 175.8, 145.6, 79.0, 75.5, 39.3, 37.7, 35.7, 34.79, 34.77, 33.9, 32.3, 29.2, 26.1, 22.8, 21.1, 17.5; hresims m / z 474.1471 [m + na] (calcd for c19h34ino3na, 474.1476). To the coupled product (0.088 g, 0.19 mmol) in thf (19.0 ml) was added cui (0.005 g, 0.03 mmol) and cs2co3 (0.100 g, 0.30 mmol). The mixture was first degassed using nitrogen (10 min) before n, n-dimethylethylenediamine (0.050 ml, 0.46 mmol) was added . The rubber septum was quickly replaced with a glass stopper, and the reaction mixture heated to 60 c for 19 h. after cooling to rt, the reaction mixture was diluted with etoac, filtered through a short plug of silica, and concentrated . The crude product was purified via flash column chromatography (8:2 7:3 1:1 hexanes / etoac) to yield the n - h enamide intermediate (0.022 g), which was immediately dissolved in thf (0.7 ml) and cooled to 0 c . To this was added nah (0.014 g, 0.34 mmol, 60% in mineral oil) in a single portion . The reaction mixture was allowed to stir for 20 min before mei (0.100 ml) was added dropwise, followed by removal of the ice water bath . After being allowed to stir at rt for 20 min, the reaction mixture was again cooled to 0 c before being quenched with h2o, extracted using etoac, dried over mgso4, and concentrated . The crude product was purified via flash column chromatography (9:1 hexanes / etoac) to yield 14-epi - palmyrolide a (0.016 g, 25% over two steps) as a colorless oil: []d24.5 11.4 (c 0.58, chcl3); ir (neat, thin film) 2959, 2927, 2873, 1728, 1675, 1646, 1466, 1413, 1384, 1366, 1333, 1298, 1240, 1205, 1193, 1171,1121, 933 cm; h nmr (400 mhz, cdcl3) 6.63 (d, j = 13.6 hz, 1 h), 4.92 (ddd, j = 5.2, 8.8, 13.6 hz, 1 h), 4.85 (dd, j = 2.0, 9.6, 1 h), 3.05 (s, 3 h), 2.602.42 (m, 3 h), 2.32 (dt, j = 7.2, 13.6 hz, 1 h), 2.242.17 (m, 1 h), 2.031.95 (m, 1 h), 1.841.74 (m, 1 h), 1.681.54 (m, 2 h), 1.491.30 (m, 4 h), 1.26 (d, j = 7.2 hz, 3 h), 1.030.93 (m, 1 h), 0.89 (d, j = 6.4 hz, 3 h), 0.86 (s, 9 h); c nmr (100 mhz, cdcl3) 175.4, 172.8, 129.8, 110.2, 76.5, 37.2, 36.6, 35.4, 34.3, 33.6, 31.0, 29.8, 29.5, 27.3, 25.9, 24.9, 20.0, 19.2; hresims m / z 360.2504 [m + na] (calcd for c20h35no3na, 360.2509). To a solution of ()-palmyrolidea (0.008 g, 0.022 mmol) in anhydrous meoh (1 ml) was added 10% palladium on carbon (0.005 g). The atmosphere in the flask was replaced with hydrogen, and the reaction mixture was allowed to stir at rt for 18 h before being filtered through a short plug of silica . After rinsing several times with ether, the filtrate was concentrated and purified via column chromatography (8:2 hexanes / etoac) to afford compound 5 (0.006 g, 77%) as a mixture of rotational isomers (2:1 ratio): []d23 + 35.6 (c 0.48, chcl3); ir (neat, thin film) 2954, 2931, 2871, 1720, 1651, 1269, 1250, 1073 cm; h nmr (300 mhz, cdcl3, mixture of rotational isomers with mostly overlapping peaks, making the assignment of major and minor components difficult) (major isomer) 4.82 (d, j = 10.0 hz, 1 h), 3.30 (t, j = 5.0 hz, 1 h), 2.98 (s, 3 h), 2.532.65 (m, 2 h), 2.212.33 (m, 2 h), 1.211.73 (m, 14 h), 1.18 (d, j = 6.9 hz, 3 h), 0.94 (d, j = 5.9 hz, 3 h), 0.86 (s, 9 h), (minor isomer, partial) 4.92 (d, j = 10.8 hz, 0.6 h), 2.89 (s, 1.5 h), 0.91 (d, j = 6.1 hz, 1.5 h); c nmr (75 mhz, cdcl3, mixture of rotational isomers) 175.5, 174.8, 173.5, 77.8, 77.2, 48.9, 46.3, 40.4, 40.0, 38.3, 37.2, 35.2, 35.0, 33.6, 33.2, 32.98, 32.96, 31.2, 39.7, 27.9, 27.6, 27.0, 26.0, 25.9, 25.4, 23.5, 23.2, 22.2, 20.4, 20.1, 18.0, 16.5; hresims m / z 362.2660 [m + na] (calcd for c20h37no3na, 362.2665). The crude product was purified via column chromatography (8:2 hexanes / etoac) to afford compound 6 (0.006 g, 96%) as a mixture of rotational isomers (2:1 ratio): []d23 + 42.1 (c 0.5, chcl3); ir (neat, thin film) 2956, 2930, 2872, 1727, 1647, 1459, 1192, 1156 cm; h nmr (300 mhz, cdcl3, mixture of rotational isomers with mostly overlapping peaks, making the assignment of major and minor components difficult) (major isomer) 4.86 (d, j = 10.5 hz, 1 h), 3.513.42 (m, 1 h), 3.233.14 (m, 1 hz), 2.88 (s, 3 h), 2.312.48 (m, 2 h), 2.182.31 (m, 2 h), 1.971.79 (m, 2 h), 1.231.66 (m, 15 h), 1.19 (d, j = 7.0 hz, 3 h), 0.92 (d, j = 5.8 hz, 3 h), 0.86 (s, 11 h), (minor isomer, partial) 4.83 (d, j = 11.6 hz, 0.6 h), 2.91 (s, 1 h), 1.15 (d, j = 7.2 hz, 1.5 h), 0.96 (d, j = 5.7 hz, 1.5 h); c nmr (75 mhz, cdcl3, mixture of rotational isomers) 176.8, 176.6, 173.3, 173.0, 77.2, 49.1, 46.0, 40.6, 40.1, 38.0, 37.3, 35.2, 34.0, 33.9, 33.2, 33.1, 33.0, 31.3, 29.7, 28.9, 27.2, 25.9, 24.8, 23.9, 22.8, 19.9, 19.8, 19.2, 19.1; hresims m / z 362.2659 [m + na] (calcd for c20h37no3na, 362.2665). To a solution of 1 (0.007 g, 0.021 mmol) in chcl3 (2 ml) was added a 6 n aqueous hcl solution dropwise until tlc analysis showed complete consumption of the starting material . The reaction mixture was then quenched with a saturated aqueous solution of nahco3, followed by extraction using etoac . The resultant crude aldehyde was dissolved in anhydrous meoh (1 ml) and treated with nabh4 (0.015 g, 0.39 mmol). The reaction mixture was allowed to stir at rt for 1 h before being quenched with h2o, extracted using etoac, dried over mgso4, filtered, and concentrated . The crude alcohol was purified by column chromatography (100% etoac) to afford alcohol 9 (0.006 g, 73% over two steps) as a colorless oil: []d24.3 + 26.8 (c 0.20, chcl3); ir (neat, thin film) 3296, 2956, 1728, 1651, 1562, 1462, 1366, 1164 cm; h nmr (300 mhz, cdcl3) 6.10 (bs, 1 h), 4.76 (dd, j = 2.2, 9.5 hz, 1 h), 3.63 (t, j = 6.4 hz, 2 h), 2.79 (d, j = 4.8 hz, 3 h), 2.392.51 (m, 1 h), 2.002.23 (m, 2 h), 1.91 (bs, 1 h), 1.631.80 (m, 2 h), 1.221.60 (m, 10 h), 1.16 (d, j = 7.0 hz, 3 h), 0.87 (d, overlapped, 3 h), 0.86 (s, 9 h); c nmr (75 mhz, cdcl3) 176.8, 174.0, 78.6, 62.5, 40.2, 37.6, 36.2, 34.5, 33.3, 32.5, 28.8, 26.2, 25.9, 25.9, 23.5, 23.0, 20.8, 17.4; hresims m / z 380.2764 [m + na] (calcd for c20h39no4na, 380.2771). Approximately 0.3 ml of an oxidant solution prepared via the mixing of naclo2 (0.060 g) and nahpo4 (0.040 g) in h2o (1 ml) was added to a solution of palmyrolide aldehyde (prepared as above, 0.006 g, 0.016 mmol) in tert - butanol (0.25 ml) and 2-methyl-2-butene (0.1 ml). The reaction mixture was allowed to stir for 30 min before being quenched with water, extracted with etoac, dried over mgso4, filtered, and concentrated . The crude acid was purified by column chromatography (100% etoac) to afford acid 10 (0.002 g, 25%) as a colorless oil: []d23 + 10.8 (c 0.10, chcl3); ir (neat, thin film) 3306, 2960, 1727, 1633, 1164 cm; h nmr (300 mhz, cdcl3) 6.04 (bs, 1 h), 4.78 (dd, j = 10.2, 1.9 hz, 1 h), 2.82 (d, j = 4.8 hz, 3 h), 2.48 (q, j = 6.9 hz, 1 h), 2.312.41 (m, 2 h), 2.022.23 (m, 3 h), 1.601.82 (m, 4 h), 1.211.59 (m, 6 h), 1.19 (d, j = 7.0 hz, 3 h), 0.921.05 (m, 1 h), 0.88 (d, overlapped, 3 h), 0.87 (s, 9 h); c nmr (75 mhz, cdcl3) 176.4, 78.5, 40.1, 37.6, 36.2, 34.6, 34.4, 33.0, 29.7, 28.7, 26.3, 26.0, 23.0, 22.7, 20.7, 17.2; hresims m / z 394.2558 [m + na] (calcd for c20h37no5na, 394.2563). The crude product was purified via column chromatography (100% etoac) to afford compound 12 (0.004 g, 94%): []d25.5 + 30.8 (c 0.24, chcl3); ir (neat, thin film) 3304, 2950, 1729, 1649, 1560, 1462, 1366, 1163, 1074 cm; h nmr (300 mhz, cdcl3) 6.25 (bs, 1 h), 4.76 (dd, j = 9.9, 1.6 hz, 1 h), 3.553.70 (m, 2 h), 2.77 (d, j = 4.8 hz, 3h), 2.372.50 (m, 1 h), 2.27 (bs, 1 h), 2.002.20 (m, 2 h), 1.631.83 (m, 2 h), 1.211.60 (m, 10 h), 1.16 (d, j = 7.0 hz, 3 h), 0.921.04 (m, 1 h), 0.86 (d, overlapped, 3 h), 0.85 (s, 9h); c nmr (75 mhz, cdcl3) 177.0, 174.1, 78.4, 62.2, 40.0, 37.5, 36.2, 34.6, 34.5, 33.1, 32.4, 28.8, 26.1, 25.9, 23.6, 23.1, 20.7, 17.7; hresims m / z 380.2764 [m + na] (calcd for c20h39no4na, 380.2771). Primary cultures of cerebrocortical neurons were obtained from embryonic day 17 swiss - webster mice as described elsewhere . Briefly, pregnant mice were euthanized by co2 asphyxiation, and embryos were removed under sterile conditions . Cerebral cortices were collected, stripped of meninges, minced by trituration with a pasteur pipet, and treated with trypsin for 25 min at 37 c . The cells were then dissociated by two successive trituration and sedimentation steps in soybean trypsin inhibitor and dnase - containing isolation buffer, centrifuged, and resuspended in eagle s minimal essential medium with earle s salt (mem) supplemented with 1 mm l - glutamine, 10% fetal bovine serum, 10% horse serum, 100 iu / ml penicillin, and 0.10 mg / ml streptomycin (ph 7.4). Cells were plated onto poly - l - lysine - coated 96-well (9 mm), clear - bottomed, black - well culture plates (midsci) at a density of 1.5 10 cells / well . Cells were then incubated at 37 c in a 5% co2 and 95% humidity atmosphere . The culture media was changed every other day, starting from day 5 in vitro using a serum - free growth medium containing neurobasal medium supplemented with b-27, 100 iu / ml penicillin, 0.10 mg / ml streptomycin, and 0.2 mm l - glutamine . All animal use protocols were approved by the institutional animal care and use committee (iacuc) of creighton university . [na]i measurement and full in situ calibration of sodium - binding benzofuran isophthalate fluorescence ratio were performed as described previously . Cells were grown in 96-well plates and washed four times with locke s buffer (8.6 mm hepes, 5.6 mm kcl, 154 mm nacl, 5.6 mm glucose, 1.0 mm mgcl2, 2.3 mm cacl2, 0.1 mm glycine, ph 7.4) using an automated microplate washer (biotek instruments). After measuring the background fluorescence of each well, cells were incubated for 1 h at 37 c with dye - loading buffer (100 l / well) containing 10 m sbfi - am (invitrogen) and 0.02% pluronic f-127 (invitrogen). Cells were washed five times with locke s buffer, leaving a final volume of 100 l in each well . The plate was then transferred back to the incubator for 15 min to allow the cells to equilibrate after washing and placed in a flexstation ii (molecular devices) chamber to detect na - bound sbfi emission at 505 nm (cells were excited at 340 and 380 nm). Fluorescence readings were taken once every 5 s for 60 s to establish the baseline, and then 50 l of different concentrations of ()-palmyrolide a and/or veratridine was added to each well from the compound plate at a rate of 26 l / s, yielding a final volume of 200 l / well . After correcting for background fluorescence, sbfi fluorescence ratios (340/380) and concentration each palmyrolide a analogue was dissolved in dmso at a stock concentration of 50 mm and stored at 20 c until used . On the day of an experiment, this dilution in locke s buffer resulted in palmyrolide a analogue solutions that were 4 times the desired final concentration . ()-palmyrolide a (1) and analogues (2, 7, and 8) were dissolved in cdcl3 at a concentration of 2.5 mg in 50 l and transferred to a 1.7 mm nmr tube . The noesy mixing time was 500 ms, the hmbc delay was set to 6.25 ms (8 hz), and the hetloc used a dispi-2 spinlock of 60 ms duration . Chemical shift assignments were based on analysis of the dqf - cosy, hsqc, and hmbc 2d experiments using ucsf sparky . Topspin (bruker biospin) was used to analyze coupling constants in the h nmr and hetloc spectra . Noesy peak heights were converted to upper distance restraints of 3, 4, 5, or 6 using in - house perl scripts . Where restraints involved a group of atoms, pseudoatom corrections were applied by the amber restraint generation tools . Force field parameters were estimated using the gaff force field and the antechamber program in the amber 14 package . Molecular dynamics simulations were nonperiodic, vacuum simulations with a distance - dependent dielectric term . Using sander in the amber 14 package each starting structure was energy minimized, then subjected to 20 ps of simulated annealing with the nmr - derived restraints in which the temperature was raised from 10 k to 600 k then cooled to near 0 k. the simulated annealing was run 20 times for each structure with a different random number seed each time . Each collection of 20 structures was sorted by restraint violation energy, and outliers were discarded . To align structures, the selected ensemble was superimposed on c17, o12, c1318, and n19 using cpptraj . To stereospecifically assign pairs of diastereotopic hydrogens, pairs of noes that involved the diastereotopic atoms and had differential intensities were identified, then compared with the distances between these atoms in the ensemble of selected structures . If the ensemble mean of one distance was more than one standard deviation from the alternative, then the diastereotopic hydrogens were stereospecifically assigned.
|
The online version of this article (doi:10.1007/s00414 - 009 - 0352 - 9) contains supplementary material, which is available to authorized users . Microbes can negatively interfere with the postmortem assessment of alcohol abuse and in this way pose problems for forensic investigators . However, microbial forensics is often chiefly associated with the detection of highly pathogenic microbes to which humans are deliberately exposed in cases of biological terrorism [2, 3]. However, human fingertip microflora left behind on touched objects at crime scenes may potentially contain forensically relevant information that may be useful for human host inferences accessible via microbial dna fingerprinting of physical fingerprints . For example, if endogenous microbial skin species / strains with a geographically restricted distribution could be retrieved from touched objects via microbial dna analysis, the geographic origin of the human host individual could be determined indirectly . Information about the geographic region of origin can be relevant in suspect - less forensic cases where the evidence dna sample does not match either a suspect s dna profile or any in a criminal dna database . In such cases, geographic information derived from crime scene samples is expected to reduce the potential pool of suspects by allowing police investigations to concentrate on specific groups of people, i.e., those from a restricted geographic region . Numerous human genetic markers have been suggested for inferring human genetic ancestry mostly to the continental level [47], and a recent study indicated that inferring the subregion of origin of an unknown european may be feasible from autosomal genetic data . However, direct ancestry inference based on human genetic markers is currently far from perfect, initiating the question whether microbial dna may be used to supplement human dna markers in reliable ancestry reconstruction of unknown persons . Recently, it has been shown that the gastric pathogenic bacteria helicobacter pylori has intimately coevolved with its human host [9, 10]. Although this example may be of limited direct relevance for forensics, because samples containing h. pylori are usually not found at crime scenes (with the exception of bodies in cases of missing persons), it shows that in principle human geographic signatures are inferable from microbial genomes . The human skin is a complex microbial ecosystem consisting of multiple niches, which can differ drastically from each other . Interactions between skin microbes and the human host, as well as between the microbial occupants, are still poorly understood . The current knowledge on skin microbiota primarily derives from cultivation - based studies [12, 13], although molecular fingerprinting techniques have been employed more recently [14, 15]. If a comparable relationship exists between humans and their skin microbiota, as has been observed for h. pylori, new methods for human geographic origin determination could be developed based on dna analysis of fingertip microflora, with interesting new applications to molecular analyses of physical fingerprints left at crime scenes . Volunteers and microbiological procedures five dutch european subjects from rotterdam and three volunteers from dhaka, bangladesh, placed their right index finger on a colombia iii blood agar plate (biomerieux, marcy - letoile, france). Fingerprint sampling for dutch volunteers was performed in rotterdam whereas that of bangladeshi volunteers was performed in dhaka . After washing this finger with hospital soap and air drying, another fingerprint, from the same finger, was placed next to the first . Whereas the first fingerprint was expected to provide a mixture of transient and resident microbiota, the second one was assumed to provide resident microbiota only as soap removes the upper dead - skin layers including their transient microflora . After overnight incubation at 37c, colonies with different morphologies were isolated, with 20 per fingerprint (two each) from the five dutch individuals (n = 200 strains). Three weeks later, this procedure was repeated for assessment of bacterial persistence in the dutch volunteers . Agar plates from bangladeshi volunteers were shipped by courier to rotterdam after overnight incubation at 37c for further analyses . Given the diversity in genotypes encountered in the time - wise resampling experiments using dutch volunteers (see below), this procedure was not repeated for the volunteers from bangladesh . Gram staining and the determination of catalase activity were applied for the identification of staphylococci using commercially available test kits (biomrieux, marcy - letoile, france). Staphylococcus epidermidis sensu stricto was identified among the isolates by a species - specific polymerase chain reaction assay as described elsewhere . A coagulase test with slidex staph plus (biomrieux, marcy - letoile, france) was performed to detect staphylococcus aureus isolates . Were classified with the i d 32 staph api system (biomrieux, marcy - letoile, france). Genotyping bacterial isolates in order to generate dna fingerprints for the most relevant bacterial isolates, all staphylococcal isolates were subjected to pulsed - field gel electrophoresis (pfge). Pfge can be used to electrophoretically separate dna restriction fragments ranging in length between 50 and 1,000 kb . After lysostaphin and proteinase treatment and smai macrorestriction, pfge was performed in a 1% incert agarose (fmc) gel in 0.5 tbe at 14c, using a constant electric field of 6 v cm with pulse ramping from 0.1 to 30 s at a 60/60 angle for 18 h. pfge patterns were analyzed for levels of similarity with bionumerics 4.5 (applied - maths, sint martens latem, belgium). Developing forensic dna markers for human host inferences from physical fingerprints relies on the examination of the transient exogenous microflora left behind together with the physical fingerprint . However, any human host inference from fingertip microflora using physical fingerprints would require that the transient microflora is representative of the resident endogenous microflora of the same individual and is not simply reflecting microbial species / strains picked up from the environment . To test this prerequisite, we investigated and compared by means of dna fingerprinting techniques the transient superficial skin microbiota and the resident endogenous microflora of human fingertips within several individuals . In addition, we collected data at two time points to investigate time - wise microflora persistency within individuals . To this end, we used samples from five dutch volunteers and gram staining as well as catalase activity testing revealed that all bacterial skin isolates that were selected were gram - positive cocci . Most isolates were staphylococcus spp ., a small number of colonies represented micrococci (~5% of total isolates), and the vast majority (97%) of staphylococci were coagulase negative . Healthy skin is known to harbor gram - positive pleomorphic bacilli, including corynebacterium, brevibacteria, and propionibacteria sp ., but these were not detected here . Pfge is the most discriminatory typing method that is currently available for typing of staphylococci . Transient microflora (tm) was collected from physical fingerprints before washing with soap and endogenous microflora (rm) after soap washing (see materials and methods the tm showed higher numbers of pfge types than those seen in the rm in three of the five dutch subjects (table 1). This can be explained by nonendogenous species picked up from the environment and being transferred . Significant variability between the subjects was seen for both the tm and rm, as has been previously reported for other skin areas [10, 13]. Notably, the rm types encountered after washing were very similar intraindividually but very different interindividually . This suggests that certain types of bacteria are able to efficiently and persistently colonize the skin of a given individual . Within the rm, all dutch subjects had one or two dominant types, mostly staphylococcus warneri species . These types were also present within the tm of three of the five subjects, while s. epidermidis was present at various time points in all of the subjects tm . Only one subject (subject 1) showed the major rm type as the major tm type . In several subjects, the dominant rm type did not appear at all in the tm, although there was considerable overlap in nondominant species between the tm and rm in many subjects . In general, pfge types within the rm and within the tm for the same subject appeared consistent over time . Although the degree of variability changed in the 3-week period for every subject, in some subjects, it changed more drastically than in others . At time point 1, overlapping pfge types were seen in four of the five subjects in the tm and rm . However, by time point 2, only one subject (subject 4) showed any overlap . In one subject (subject 4), the major rm type did not occur in the tm of the same sampling time point 2 but was present in considerable frequency in the tm of the earlier time point 1 . Thus, although we see some resemblance between rm and tm as well as some time - wise consistency, the pattern detected is far from perfect . By viewing our results only qualitatively (ignoring type frequencies), rm signals were detectable from the tm analyses in only 50% of the dutch experiments (combining individuals and time points), which appears discouraging as basis for developing molecular markers for forensic applications to infer individual host information . Table 1staphylococcus species and pfge types from dutch fingerprints before washing with soap representing elements of the transient (tm) microflora and after washing representing resident fingertip microflora (rm) staphylococcus species and pfge types from dutch fingerprints before washing with soap representing elements of the transient (tm) microflora and after washing representing resident fingertip microflora (rm) we chose geographic inference as a test example for the type of human host information that would be interesting to retrieve from physical fingerprints by means of microbial dna analysis for forensic applications . A prerequisite for developing microbial skin markers for inferring human geographic origins would be that the endogenous fingertip microflora of humans from different parts of the world shows differences in their genetic diversity and that retrievable microbial genotypes cluster according to geographic origin of the host individuals . To test this, we obtained fingerprint microflora from native inhabitants of bangladesh collected in dhaka, bangladesh, and compared their microbiological profiles with those of the dutch volunteers . Fingertip microflora of three bangladeshi volunteers were isolated and processed in the same manner as for the dutch volunteers, although only at one time point (three individuals, two fingerprints each and 20 bacterial isolates per fingerprint, hence 3 2 20 = 120 strains; table 2). Correspondence between rm and tm was observed in two of the three subjects for one pfge type, although the persistent pfge type found differed between the subjects . Notably, subject 3 from bangladesh showed an unexpectedly higher variety of staphylococci in the rm compared to tm . Comparing pfge types between dutch and bangladeshi subjects revealed some differences, e.g., bangladeshi skin microbiota contained less s. warneri and much less s. epidermidis types compared with the dutch ones . Were found among the tm in bangladeshi (45%) than among the dutch (7%). Furthermore, none of the pfge types from the bangladesh fingerprints were seen in the dutch collection, indicating extensive geographic heterogeneity within the staphylococcus species . However, when each pfge type obtained during this study was subjected to dice - based cluster analysis for visualizing geographic structure in the skin staphylococci (see supplementary material fig . 1), the bangladeshi pfge patterns efficiently mixed with the dutch ones . Hence, information about geographic origin of the dutch and bangladeshi donors was not obvious among genotype data of the staphylococci inhabiting the human fingertip skin . Although in general a limited number of five and three persons tested would not allow for cluster analysis, the full absence of clusters as identified in the present study already shows that individual geographic inferences for forensics purposes is not possible using the approach employed here . Table 2staphylococcus species and pfge types from bangladeshi fingerprints before washing with soap representing elements of the transient (tm) microflora and after washing representing resident fingertip microflora (rm) staphylococcus species and pfge types from bangladeshi fingerprints before washing with soap representing elements of the transient (tm) microflora and after washing representing resident fingertip microflora (rm) to conclude, we see only limited geographic differentiation between microbial dna fingerprints from dutch europeans and bangladeshi south asians, indicating that geographic inferences of human hosts from fingertip microbial dna analysis is not feasible . Furthermore, our results from dna profiling of transient and resident fingertip microflora show that human fingertip microflora is too dynamic and thus does not fulfill the criteria required for forensic marker developments to infer any human host information from physical fingerprints.
|
Assisted / supported mechanical ventilation is designed to interact with patient muscle activity and' share' the work of breathing . If properly done, assisted /, the ventilatory's flow and pressure delivery must synchronize with patient effort during all three phases of breath delivery: breath initiation, flow delivery, and breath termination (cycling). Dys - synchronous interactions can overload ventilatory muscles (' imposed' loads), compromise alveolar ventilation, overdistend alveolar units, disrupt sleep patterns, and cause patient discomfort, prompting additional sedation . Carlucci and colleagues have recently studied patient - ventilator interactions in 69 acutely ill patients receiving non - invasive ventilation (niv) for a variety of reasons . They grouped these patients according to obstructive or restrictive pathophysiologies and carefully measured respiratory system mechanics (including esophageal pressure - a surrogate for pleural pressure). The patients were then initiated on niv according to a standard protocol and were assessed for triggering dys - synchronies defined as missed triggers, delayed triggers, or double triggers . Importantly, they found that these dys - synchronies were common (58% of patients experienced them with missed triggers being the most frequent). Trigger dys - synchronies were associated with niv intolerance and their prevalence was similar among the different patho - physiologic patterns . This study is important as it underscores that patient - ventilator trigger dys - synchrony is common and can be a major barrier to niv effectiveness . This study also underscores the fact that the causes of trigger dys - synchrony are complex and affect all types of patients requiring assisted / supported mechanical ventilation [3 - 5]. Like invasive mechanical ventilation, niv trigger dys - synchrony can stem from insensitive / poorly responsive breath triggering mechanisms . However, other factors also involved likely include ventilatory muscle loading patterns and their effects on the ventilatory controller, ventilatory muscle function, lung volumes at end - expiration (that is, intrinsic positive end - expiratory pressure (peep)), gas exchange effectiveness, and cortical inputs to the patient's ventilatory control center such as pain [3 - 5]. In addition, the triggering process with niv can be further hampered by the mask system with its inherent leaks and claustrophobia exaggerating dyspnea and neural drive . Importantly, this study did not address issues of flow synchrony or cycle synchrony, two other forms of patient ventilator interactions likely to impact niv tolerance but not well studied in the current literature . Flow synchrony is defined as the ability of the ventilator to provide flow in accordance with patient demand as manifest by the ventilatory muscle contraction pattern . If flow is synchronous with that contraction pattern, the inspiratory muscle pressure time profile conceptually should resemble a near normal pattern . Instead it means providing flow to' re - shape' the inspiratory muscle's pressure - time or pressure - volume profile to a more physiologic shape . In general, the variable flow features of pressure targeted breaths tend to flow synchronize easier with patient effort than clinician set flow - volume targeted breaths . An assisted / supported mechanical breath termination shorter than the neural inspiratory time (machine ti <neural ti) can lead to muscle activity beyond the machine's flow delivery phase, which can lead to high muscle loading, excessive tidal volumes and/or triggering of a second breath . In contrast, when mechanical breath cycling terminates after the inspiratory effort has ended (machine ti> neural ti), dyspnea and expiratory muscle recruitment may occur in an effort to terminate the breath . Importantly, it is worth noting that dys - synchronous interactions often result in anxiety and dyspnea, which can stimulate overall ventilatory drive . Thus, improving synchrony in one area (for example, triggering) can help facilitate achieving synchrony in other areas (for example, flow demand). In summary, patient - ventilator interactions are complex and are important to recognize and manage during both invasive and non - invasive mechanical ventilation . Carlucci and colleagues have demonstrated how common the trigger dys - synchronies are during niv and that understanding them requires assessment not only of respiratory system mechanics, but also the complex interactions of neural drive, gas exchange, muscle function, and muscle loading . Much research is needed in this area as dys - synchronies of all types can lead to overloaded muscles and dyspneic patients requiring sedation - two factors that clearly can lead to prolonged mechanical ventilation days and poor outcomes.
|
Postanginal septicaemia in the early 20 century; originally associated with a mortality reaching 90% it involves a classic triad of oropahryngeal sepsis, internal jugular vein (ijv) thrombophlebitis and metastatic abscess formation (1). Clinical findings can therefore vary considerably from neck pain and swelling associated with thrombophlebitis to pleuritic chest pain, haemoptysis, dyspnoea or arthralgia as a result of septic thromboemboli . We report a case of predominantly external jugular vein (ejv) involvement in an adolescent male with negative blood culture results . A twelve year old boy presented to the children s assessment unit with a 24 hour history of unilateral face and neck swelling on a background of seven days progressive sore throat and dysphagia . Minor systemic upset was also noted including headache, vomiting and non specific abdominal pain . A provisional diagnosis of tonsillitis had been made five days earlier by the local gp and a course of erythromycin and penicillinv commenced . Examination revealed tender swellings over the left temporal area, angle of the mandible and upper third of the sternocleidomastoid extending into the submandibular region . Examination of the oral cavity was complicated by trismus, however no obvious tonsillar enlargement, erythema or exudate was recorded . Initial blood results showed an elevated c - reactive protein of 155mg / l and white cell count of 16.6(10 * 9l). Initial imaging of the neck comprised an ultrasound scan; this demonstrated normal right sided vasculature but abnormal left ejv and retromandibular veins . These veins appeared dilated with increased wall vascularity and showed no recordable signal on doppler imaging, an appearance in keeping with an inflammatory thrombophlebitis . To note an mri brain with venography (mrv) sequences provided greater anatomical delineation (figure 1). Despite a coincidental finding of a smaller calibre left venous sinus; thrombus was not seen to extend intracranially . Lastly an echocardiogram was sought confirming a normal heart with no septal defects, vegetations or thrombus . Mrv brain images demonstrate bilateral sagittal, straight, transverse and sigmoid sinuses with no evidence of thrombus extension . Both right and left ijv as well as right ejv are clearly patent . The left ejv could not be demonstrated . Treatment was started promptly on clinical suspicion of ls and consisted of intravenous (iv) metronidazole, benzyl penicillin and dexamethasone; anticoagulation was not given . The patient remained in hospital on iv antibiotics for a total of 14 days, the noted swellings slowly decreased in size, blood results normalized and the trismus resolved . He remained afebrile throughout, developed no subsequent complications and was discharged home to complete seven weeks of oral antibiotics . Despite ijv thrombophlebitis forming a main diagnostic criterion for ls, we report a case in which the primary vascular involvement is that of the ejv, with a corresponding normal ijv . Studies have previously described ls with thrombosis of the carotid artery, intracranial venous sinus and abdominopelvic vessels (1); only three have ever described involvement of the ejv . This unusual finding helps to highlight the variable nature of this condition and the diagnostic confusion it may herald . To note there are reported cases of ls in which there was no demonstrable vascular involvement . Numerous theories have tried to explain the spread of organisms from oropharynx to the surrounding vein; haematogenous via the tonsillar vein, secondary to lymphangitis or via direct spread through deep neck spaces . (3) the incidence of ls within developed countries is now thought to lie around one per million per year, significantly reduced from the pre antibiotic era, however a resurgence over the last decade has recently been proposed . Mortality has been recorded at 6.9% however morbidity and complications remain high as the early diagnosis can often be missed and treatment delayed . (3) although classically described as following an oropharyngeal infection ls has been reported developing from other primary infective sites including the middle ear, sinuses, mastoid and teeth (1). The development of sepsis in ls is often delayed, presenting three to seven days from signs of the primary infection, which may have all but resolved (4), making accurate history taking and a high index of clinical suspicion ever more important . Ls is classically but not exclusively associated with an obligate oropharyngeal gram negative bacillus; fusobacterium necrophorum . Other causative pathogens described in the literature include streptococcus, staphylococci and bacteroides species (5). It has however been reported that in almost 13% of cases no pathogen is isolated on culture (6). Ls can also be associated with thrombophillia (thought to be endotoxin induced) (5). The role of anticoagulation however remains controversial with no conclusive literature evidence; the decision should therefore be made on clinical grounds; assessing severity of symptoms, poor treatment response and degree of thrombus extension . A recent history of a sore throat in conjunction with sepsis and or a suggestive and often declining clinical picture should always prompt early antibiotic therapy whilst a diagnosis of ls is sought; hopefully preventing the development of late embolic complications . Differential diagnoses to consider include infectious mononucleosis, parapharyngeal abscess, lymphoma, pneumonia (including atypical forms) and other embolic sources (e.g. Infective endocarditis).
|
Helicobacter pylori is a gram - negative, spiral and microaerophilic microorganism that was first isolated from the stomach of patients afflicted with peptic ulcer (1, 2). This bacterium can cause gastritis and peptic ulcer in the short - term and carcinoma of the stomach in the long - term (3, 4). Polymerase chain reaction (pcr) is the desired method of proving the presence of h. pylori in tissues due to its high sensitivity and specificity (5, 6). It was previously thought that the human stomach was the sole source of h. pylori; however, it was later found that they are present in human dental plaques, mouth, saliva, tonsils, adenoids, middle ear, nasal polyps and sinus mucosa (7). It is believed that gastroesophageal reflux is involved in many cases of upper respiratory tract disorders including pharyngoesophageal disorders, croup, oropharyngeal dysphagia, rhinosinusitis, otalgia and different forms of otitis media (8, 9). Samples from tonsil and adenoid tissues showed that they might be sources of h. pylori (10, 11). Researchers have proved that there is a connection between chronic tubotympanal disorders and gastroesophageal reflux, but the mechanism is unknown (12, 13). It is suspected that gastroesophageal reflux is involved in the pathogenesis of chronic otitis media . Evidence showed that stomach pepsin is present in the middle ear cavity of patients afflicted with chronic otitis media, as compared to the control group, supports this suspicion (14, 15). Gastroesophageal reflux results in the appearance of otolaryngology symptoms in children and anti - reflux treatments reduce frequency of infection in the middle ear (16). Many studies have been conducted on otitis media with effusion and on its correlation with h. pylori (15, 17 - 19). However, the correlation between chronic suppurative otitis media and its various aspects, such as tympanosclerosis in which deposition of acellular hyaline and calcified deposits accumulate in the lamina propria of the middle ear has not been sufficiently studied (20, 21). So, we decided to use the pcr technique to determine the role of h. pylori in tympanosclerosis . This case - control and cross - sectional study was conducted on patients who were diagnosed with chronic infection of the middle ear and were candidates to undergo surgery in the imam khomeini or apadana hospitals of ahvaz in 2013 . Patients who had operations for chronic infections of the middle ear and those who had ventilation tube inserted into their ears in the past were excluded from the study . The middle ear mucosa of the patients was examined during the surgical operations and based on this clinical evaluation, they were placed in one of the four types of normal, edema and hypertrophy, hyalinized and sclerotic and polyploid with or without cholesteatoma and this classification was recorded in the questionnaire . During the operations, samples were taken of the middle ear mucosa of the patients . In patients with sclerotic plaques, the samples were kept under sterilized conditions at 20 degrees centigrade, and were eventually sent to the laboratory of jundishapur university of medical sciences, ahvaz, iran . In the laboratory, dna was extracted using the roche high - pure template pcr kit (roche, germany) according to the manufacture protocol . Primers used to amplify the typing region were va1-f (a3436) 5-atggaaatacaacaaacacac-313 and va1-r (c1226) 5-ctgcttgaatgcgccaaac-313 for amplified 286-bp band and vag - f 5-caatctgtcaatcaagcgag-14 and vag - r 5-ctagcgtcaaaataattccaagg-314 for amplified 630-bp . The extracted dna was amplified using 5 l dna template, 0.3 l taq polymerase, 1 l dntp, 0.25 l each forward and reveres primers, 2 l mgcl2 and 5 l 10x pcr buffer, all mixed in a micro - tube and the ultimate volume reach to 50 l using nuclease - free distilled water . After activation of reaction in 95c for 5 minutes, amplification performed for 35 cycles . Cycle program for first pair primers was as: 94c for 60, 52c for 60 and 72c for 90 seconds . A final extension 72c for 5 minutes was the ultimate step of cycles . For the second pair primers, cycle program was as: 94c for 30 seconds, 56c for 60 seconds and 72c for 90 seconds . The chi - squared and the independent - samples t - test were also used to analyze the data . The selected level of significance was p <0.05 . Fifty - six patients participated in this study, of whom 29 (51.8%) were men and 27 (48.2%) women . The biopsy samples of the middle ear mucosa of 31 (55.4%) patients were h. pylori - positive . Of the 29 male patients, 15 cases were (51.7%) h. pylori - positive, while of the 27 female patients 16 cases (59.3%) were h. pylori - positive . This difference was not significant in pearson s chi - squared test (p = 0.571). The average age of h. pylori - positive patients was 30.3 years old (standard deviation = 7.6), while the average age of h. pylori - negative patients was 33.4 years (standard deviation = 9.7). This difference was not significant in the independent samples t - test (p = 0.571). Therefore, there was no significant correlation between the presence of h. pylori and the age and gender of the patients . The most common pathological type of middle ear mucosa was hyalinized and sclerotic type in 19 cases (33.9%). The polyploid type with or without cholesteatoma type was reported in 15 (26%) cases and the edematous and proliferative type with 12 (21%) cases . Examination of the middle ear mucosa of the 19 patients of the hyalinized and sclerotic type revealed that 16 (84.2%) were h. pylori - positive (figure 1) and 3 (15.8%) were h. pylori - negative; while of the 37 patients whose middle ear mucosa was not sclerotic,15 cases (40.7%) were h. pylori - positive (figure 2) 22 (59.3%) h. pylori - negative . This was a significant difference (p = 0.002), which means there was a correlation between the presence of h. pylori and tympanosclerosis of the middle ear (table 1). As for other types of middle ear mucosa (normal, polypoid with or without cholesteatoma and edema with hypertrophy), there was no significant correlation between them and the presence of h. pylori . L = ladder (100 bp), p = positive control, lanes are numbered in the following order from 1 to 2: case h. pylori - positive (286 bp), case h. pylori - negative . L = ladder (100 bp), p = positive control, lanes are numbered in the following order from 1 to 3: case h. pylori - positive (630 bp), negative control, case h. pylori - negative . Results showed that 26 (46.4%) of 56 patients had dry ears for at least three months before surgery . Of the 30 patients who did not have dry ears, 13 cases (34.3%) were h. pylori - negative and 17(56.7%) were h. pylori - positive . This was not a significant difference in pearson s chi - squared test (p = 0.832). 40 (45.2%) of the 31 patients with perforations of more than 50% were h. pylori - negative and 17 (54.8%) were h. pylori - positive . H. pylori was not significant in pearson s chi - squared test (p = 0.931). Therefore, there was no correlation between the presence of h. pylori and the size of the perforation or dryness of the middle ear . Zollner (22) was the first to use the term tympanosclerosis in 1956 to describe a common complication resulting from middle ear infections . Tympanosclerosis is an abnormal condition in the middle ear cavity in which lime particles accumulate in the tympanic membrane, tympanic cavity and ossicular chain (23, 24). It is a long - term complication of infections of the middle ear (4, 25 - 27). In available reports, the prevalence of tympanosclerosis varies from 14.1% in bhaya s report (28) to 35.64% in wu s study(21). Despite the extensive available information on the clinical, histologic and pathologic aspects of tympanosclerosis, tympanosclerosis is observed as irreversible changes in the temporal bone (13, 24). It is thought that gastroesophageal reflux may be involved in the pathogenesis of otitis media and evidence indicating the presence of stomach pepsin in the middle ear cavity of patients with otitis media, as compared to the control group, confirms it (14, 29). Gastroesophageal reflux results in the appearance of otolaryngology symptoms in children and anti - reflux treatments make frequent middle ear infections go away (16). Many studies have been conducted on otitis media with effusion and on its correlation with h. pylori (15, 17, 18); however, the correlation between chronic suppurative otitis media and its various aspects such as tympanosclerosis has not been sufficiently investigated . In tympanosclerosis, the process of deposition of acellular hyaline and calcium deposits in the lamina propria of the middle ear takes place, following which it is even possible for fixation of ossicles to occur leading to conductive hearing loss (20). The exact etiology and pathogenesis of tympanosclerosis are not completely known (9). In some studies, tympanosclerosis has been observed also as a complication of frequent otitis (21, 29). In a recent research, it has been suggested that h. pylori is the pathologic factor in tympanosclerosis (21). In our research, designed to study the correlation between h. pylori and tympanosclerosis, we found that h. pylori has a prevalence of 84.2% among patients with suppurative infection of the middle ear, while its prevalence was 40.5% in patients without tympanosclerosis . This difference (p = 0.002) indicates that h. pylori plays a role in the pathogenesis of tympanosclerosis . (26) showed that there are similar risk factors, such as increased homocysteine levels, between coronary artery atherosclerosis and tympanosclerosis . Although tympanosclerosis and atherosclerosis are two separate pathologies, they have similar histological and pathophysiologic elements and the same genetic reason has been proposed for both (2). (30) studied evidence concerning the development of inflammation caused by h. pylori in 38 patients with atherosclerotic plaques who had undergone endarterectomy and found that in most of these patients h. pylori was correlated to the inflammation, which indicated the correlation between h. pylori and atherosclerosis . (31) show that contact with h. pylori increases the risk of cardiovascular diseases even in the absence of other risk factors . Our findings suggest that h. pylori probably plays a role in the development of tympanosclerosis . (26) carried out a case - control study and found that 100% of the patients with tympanosclerosis were h. pylori - positive while only 26.9% of the patients not suffering from tympanosclerosis were h. pylori - positive (p <0.01) (21). Results of our study, while confirming those of iriz et al . (26) used the campylobacter - like organism (clo) test in h. pylori identification, while we employed the pcr method . Since the pcr method is more accurate than the clo test, our results are probably more acceptable than those iriz et al . (26), both show that there is a correlation between the presence of h. pylori and tympanosclerosis, and suggest the presence of h. pylori as the etiology for this disease; however, neither study can consider h. pylori as the definite pathogenesis for tympanosclerosis . To prove this correlation, a study should be designed to evaluate the correlation between tympanosclerosis and h. pylori by considering those pathological changes found in the examination of the middle ear mucosa that attribute the presence of inflammatory symptoms to the activity of h. pylori in the middle ear . This study offers a better understanding of the etiological and pathogenic aspects of h. pylori in tympanosclerosis that can be used in designing new treatment methods for this disease.
|
Trigeminal neuralgia (tn) is a disorder of cranial nerve (cn) v that results in severe episodes of shock - like or lancinating pain in one or more of its three divisions (v1v3). Idiopathic tn and cases due to vascular compression of cn v are categorized as classical tn . Patients diagnosed with symptomatic tn experience trigeminal - related facial pain secondary to a brain tumor, skull deformity, or multiple sclerosis (ms). Evidence suggests that the majority of cases of tn are the consequence of focal compression of the entry zone of the root of the trigeminal nerve, while only 2% of cases are observed in patients diagnosed with ms . Other than excruciating facial pain, there are no other direct medical symptoms associated with tn, and the condition does not decrease life expectancy . However, many patients with tn struggle with accomplishing tasks that affect quality of life, which is how this disorder elicits a negative impact on the social and mental wellness of the patients who suffer from this illness . Following the diagnosis of tn however, many patients experience only limited relief from medication or are unable to endure the side effects of the prescribed drugs, and in turn seek neurosurgical intervention . Currently, surgical approaches include microvascular decompression (mvd) or a number of techniques that target the trigeminal ganglion or root which involve the destruction or blockage of portions of those anatomical structures [1, 2]. Although the neurosurgical modalities are preferred in many clinical situations and have proven to be effective in achieving initial pain control, they are known to come with a variety of complications, and facial pain recurrence is likely . Stereotactic radiosurgery (srs) has proven to be an effective management approach for patients with medically and surgically refractory tn as a primary and repeat treatment modality . The use of radiosurgery in the treatment of tn dates back to sweden in the 1950's, where professor lars leksell performed radiogangliotomies directed at the gasserian ganglion . Since the time of leksell, advancements in radiosurgery and imaging technologies has led to the increasing popularity of srs as a treatment option for patients with tn . One form of srs that can be delivered to a patient is through a machine called the gamma knife (gk). The gk device is a cobalt-60-based machine, with 201 separate 4 to 18 mm collimator openings, that emits multiple gamma rays that converge on a target specified by computer planning . For specific medication intolerable patient subsets, gamma knife radiosurgery (gkrs) can be used as an initial management approach, or as a secondary management approach following radiosurgery or one or more of the various surgical modalities . As the evidence examining the role of gkrs in the management of patients with tn is increasing, it is of utmost importance for physicians to understand the criteria associated with gkrs, so that the optimal course of treatment for their patients can be prescribed . An evidence - based review on the evaluation and treatment of tn by gronseth et al . Found level c evidence indicating that gasserian ganglion percutaneous techniques, gkrs, and mvd may be considered for facial pain management for medically refractory patients . However, questions remain regarding optimal treatment modalities in specific patient subsets . For this reason, the goal of this paper is to provide a modern review of the literature thoroughly analyzing the efficacy of gkrs in the treatment of patients with tn, as well as evaluating the treatment planning and methods associated with this evolving modality . To identify contemporary studies assessing the clinical outcomes of patients treated with gkrs for tn, a pubmed search from 2006 to april 2011 was performed . Keywords for search included gamma knife or gamma knife radiosurgery or stereotactic radiosurgery trigeminal neuralgia or tic douloureux . Studies analyzed in this review included retrospective cohort studies and prospective cohort studies with 5 evaluated patients . Studies published only in abstract form and studies published in a language other than english were excluded from our analysis . Due to our broad search strategy and the vast amount of world literature, we reviewed a total of 19 studies [4, 5, 925] analyzing the efficacy of patients with tn who were treated once with gkrs (table 1). Thirteen of the 19 evaluated studies [4, 5, 919] utilized the barrow neurological institute (bni) pain intensity scale as a measurement of response to treatment (see section 3). Of these 13 studies, only two [9, 13] analyzed patients treated with gkrs as an initial management approach . With a median followup of 31 months, sheehan et al . Classified 87% of patients in bni class i - iiib, while chen et al . Classified 91% of patients in bni class i - iiib (median followup = 15 months). Chen et al . Also reported that five of the 44 patients (11%) treated with gkrs developed hypoesthesia following the procedure . The other 11 bni pain intensity scale studies we reviewed included patients where previous surgical procedures were performed in a fraction of patients [4, 5, 1012, 1519] or all patients . Of the 10 studies where previous surgical procedures were performed in a fraction of patients, nine reported outcomes in terms of categorizing patients in bni class i - iiib [4, 5, 1012, 1518]. Classified 58.6% of patients in bni class i - iiib (median followup = 48 months), kondziolka et al . Classified 71% of patients in bni class i - iiib at three years, dhople et al . Classified 72% of patients in bni class i - iiib (median followup = 29 months), han et al . Classified 76.7% of patients in bni class i - iiib (mean followup = 58 months), dhople et al . Classified 81% of patients in bni class i - iiib (median followup = 5.6 years), matsuda et al . Classified 82% of patients in bni class i - iiib (median followup = 37 months), little et al . Classified 83% of patients in bni class i - iiib (median followup = 6.3 years), dellaretti et al . Classified 89.5% of patients in bni class i - iiib (mean followup = 20.3 months), and park and hwang classified 94% of patients in bni class i - iiib with a minimum followup of 3 years . Reported clinical outcomes with respect to bni class i, which contained only 5.7% of patients . The study that evaluated gkrs where previous surgical procedures were performed in 100% of patients classified 85% of patients in bni class i - iiib, with a median followup of 36 months . We also reviewed two studies that used the excellent - good - fair - poor (egfp) categorical scale to assess patient outcomes [20, 21] (see section 3). Treated 30 patients with tn with gkrs at iran gamma knife center between 2006 and 2007 . The authors reported that 40% of patients had an excellent outcome, 10% of patients had a good outcome, 33% of patients had a fair outcome, and 17% of patients had a poor outcome following the procedure . After surgery, 15 patients (54%) reported an excellent outcome, one patient (4%) reported a good outcome, two patients (7%) reported a fair outcome, and 10 patients (36%) reported a poor outcome . The complications from mvd included facial numbness in six patients (21%), dysesthesias in three patients (11%), and delayed facial palsy in one patient (4%). Four of the 19 studies we evaluated [2225] used other methodologies in determining the effectiveness of gkrs . In a prospective controlled trial, rgis et al . Analyzed 100 patients with tn treated with gkrs and reported that 83 patients (83%) were completely pain free, 58 of which (58%) discontinued all medication following the procedure (minimum followup = 12 months). Ten patients (10%) experienced radiation - induced complications, which included facial paresthesia or hypesthesia . Performed a study investigating the short - term efficacy of gkrs in 67 patients with medically refractory tn . Overall, 77.6% of patients witnessed some degree of pain relief, with 32.6% of those patients becoming completely pain free . Of the 67 patients, 10 (14.9%) experienced complications from the procedure, which included hypoesthesia and paresthesia . Sixty eight patients (42.5%) underwent prior invasive treatments . In clinical analysis, it was found that 61% of patients were pain free without medication, 29% of patients were pain free with medication, and 10% of patients did not respond to gkrs . Thirty eight patients (49.4%) exhibited some level of pain improvement following gk treatment, with 23 of those patients (29.9%) reporting a pain - free outcome . Twelve patients (15.6%) experienced complications, which were reported to be mild facial sensory changes and mild facial nerve dysfunction . As gkrs has proven to be an effective initial treatment for tn, numerous reports have been published analyzing patients treated on multiple occasions (> 1) with gkrs . We reviewed six studies evaluating patients treated more than once with gkrs [2732] (table 2). Of these six articles, two [29, 32] utilized the bni pain intensity scale . Sixteen patients (76.2%) exhibited compelling improvements and were placed in bni class i - ii . Huang et al . Analyzed 65 medically refractory patients with tn who were treated with gkrs as a second treatment modality . Of these 65 patients, 30 (46%) had undergone gkrs as an initial management approach . The authors placed 22 patients (34%) in bni class i, 11 patients (17%) in bni class ii, four patients (6%) in bni class iiia, and five patients (8%) in bni class iiib . Overall, with a median followup of 64 months, 65% of patients reported successful results in terms of pain control rates . A total of three of the six reviewed studies evaluated patients using the egfp categorical scale [28, 30, 31]. Analyzed 37 patients treated a second time with gkrs for recurrent tn and reported that 17 patients (46%) achieved excellent pain relief, nine patients (24%) achieved good pain relief, five patients (14%) achieved fair pain relief, and six patients (16%) achieved poor pain relief . However, the authors concluded that 57% of patients experienced some form of trigeminal dysfunction following repeat radiosurgery ., huang et al . Treated 28 patients with repeat gkrs and reported that 12 patients (43%) exhibited excellent pain relief, five patients (18%) exhibited good pain relief, and two patients (7%) exhibited fair pain relief . In addition, the authors found a statistically significant (p = 0.047) correlation between cumulative radiation doses> 115 gy and facial numbness . In a separate study, huang et al . Specifically, a total of eight patients underwent mvd a mean of 7.6 months following repeat gkrs . Of the eight patients, seven (87.5%) were completely pain free at a mean of 21 months following neurosurgery . This data supports the use of mvd if multiple gk procedures are deemed ineffective . Kimball et al . Treated 53 patients with repeat gkrs and analyzed the patients not lost during followup using the marseille scale, which categorizes patients into one of five classes, with a higher class statistically indicating a worse prognosis for the patient . With a mean followup of 42 months, 20 patients (43.5%) were categorized in marseille class i - ii, six patients (13%) were categorized in marseille class iii - iv, and 20 patients (43.5%) were categorized in marseille class v. the authors also reported a statistically significant (p = 0.047) correlation between facial numbness and superior long - term pain relief . A total of 22 patients (48%) experienced trigeminal dysfunction of any kind, while 21 patients (46%) experienced numbness in the face . Since gkrs can be performed as both initial and salvage treatment options for patients who suffer from tn, its efficacy has been compared in patients who undergo one versus multiple radiosurgery procedures . We reviewed eight studies to further examine this matter [3, 3339] (table 3). Four of the eight studies utilized the bni pain intensity scale to evaluate patient outcomes [3, 3335]., it was reported that 75%, 60%, and 58% of patients with idiopathic tn had bni scores of i iiib at 1, 3, and 5 years, respectively . The 1-, 3-, and 5-year - bni scores of i iiib in patients with ms - related tn were 56%, 30%, and 20%, respectively . The authors concluded that repeat gkrs exhibited similar success rates when compared to the initial procedure . Similar to verheul et al ., park et al . Did not find differences in terms of time to initial response, time to pain recurrence, and overall pain relief when comparing patients who underwent one versus two gk treatments . However, it was observed that patients who received two gk treatments were more likely to have facial sensory changes when compared to patients treated a single time with radiosurgery . Little et al . Performed a study where 79 patients with typical tn were treated with gkrs as a salvage procedure . Approximately five years following salvage gkrs, the authors reported that 50% of patients experienced pain relief and 20% of those patients were completely pain free . In addition, a statistically significant (p = 0.029) correlation between gkrs failure and prior mvd was found . Treated 37 patients (78% had failed prior surgery) with ms - related tn with gkrs . Nine patients (24%) underwent gkrs as their first procedure . The reported 1, 3, and 5 year bni scores of i iiib were 82.6%, 73.9%, and 54%, respectively . The other four studies we reviewed utilized the egfp categorical scale as a measurement of response to treatment [3639]. Two of the evaluated studies [36, 37] were conducted by fountas et al . And analyzed patients treated with gkrs for idiopathic tn based on whether or not they had undergone previous surgical or radiosurgical procedures for facial pain control . One of the studies evaluated 106 patients (19 previous radiosurgery procedures) and concluded that the treatment group without a previous history of surgical or radiosurgical procedures exhibited superior clinical outcomes, with 1-year and 2-year complete pain relief rates of 82.5% and 78%, respectively . The 1-year and 2-year complete pain relief rate in the patient group with a history of surgical or radiosurgical procedures was 69.4% and 63.5%, respectively . As expected, similar results were found in the other study by fountas et al . ; however, no prior radiosurgical procedures were performed in the patient group with a history of prior procedures . Huang et al . Conducted a study where 89 patients with idiopathic tn were treated with gkrs as an initial management approach, 20 of which underwent a subsequent gkrs procedure for facial pain recurrence . Following the initial radiosurgical procedure, 50 patients (56%) had an excellent response, 12 patients (13.5%) had a good response, and 7 patients (7.9%) had a fair response . Following the second radiosurgical procedure, 11 patients (55%) had an excellent response and one patient (5%) had a good response . In a separate study, huang et al . Assessed 21 patients with benign tumor - related tn who were treated with gkrs as an initial or repeat procedure . Following the initial gk procedure to the tumor, 12 patients (57%) had an excellent response and 1 patient (5%) had a good response . A total of eight patients were treated with a subsequent gkrs procedure targeted at the ipsilateral trigeminal root or ganglion due to facial pain recurrence . Following the second radiosurgical procedure, the authors reported four patients (50%) with an excellent response . We identified six studies comparing patients treated with gkrs with patients treated with one of the various surgical modalities [2, 4044] (table 4). The authors of this review acknowledge the importance of percutaneous techniques in the management of tn; however, our modern literature search predominantly yielded comparison studies analyzing the efficacy of mvd when compared to gkrs . Specifically, four of the six studies [2, 4042] analyzed patients treated with gkrs against patients treated with mvd . Specifically, 36 were treated with mvd (45%), while 44 were treated with gkrs (55%). The mvd treatment arm statistically differed from the gkrs treatment arm with respect to age (median of 54 versus 74 years), preoperative symptom duration (median of 2.6 versus 7.5 years), and the presence of major comorbidities (2.8 versus 58.3%). The authors reported that patients treated with mvd exhibited superior levels of initial (100%), 2 year (88%), and 5 year (80%) actuarial pain - free rates when compared to the patients treated with gkrs (78, 50, and 33%, resp . ), with a p value of 0.0002 . In addition to increased levels of patient satisfaction, as reported by required patient surveys, the mvd treatment group also had a decreased level of permanent mild (5.6%) and severe sensory loss (0%) when compared to the gkrs treatment group (6.8% and 2.3%, resp . ). Two patients (5.6%) in the mvd group experienced permanent mild paresthesias or numbness, one (2.8%) patient experienced a cerebrospinal fluid leak from the wound, and one patient (2.8%) experienced hearing loss and diplopia . Three patients (6.8%) in the gkrs group experienced permanent mild paresthesias or numbness, one patient (2.3%) experienced a more permanent sensory numbness, and one patient (2.3%) experienced a transient headache and nausea following the gk procedure . All patients were diagnosed with typical tn and did not undergo previous gk or mvd procedures . It was reported that patients treated with mvd exhibited superior levels of complete pain relief at 12 (68%) and 18 months (68%) when compared to the gkrs group, who's complete pain relief rate was 58% at 12 months and 24% at 18 months (p = 0.089). The treatment arms did not statistically differ in terms of 90% pain relief at 12 and 18 months . This study could be criticized due to the large difference in the number of patients constituting the two treatment arms . Oh et al . Evaluated a total of 45 elderly patients (> 65 years of age) diagnosed with idiopathic tn who were treated with either mvd (27 patients) or gkrs (18 patients). It was reported that three mvd patients (11%) and three gk patients (17%) underwent previous percutaneous procedures . The mean followup period was reported to be 35.9 months for the mvd group and 33.1 months for the gkrs group . According to the bni pain intensity scale, the mvd group had a superior prognosis, with 17 patients (63%) classified in bni class i - ii compared with the 10 patients (56%) in the gkrs group classified in bni class i - ii . The observed complications following mvd included constant headache in 11 patients (40.7%), facial paresthesia in five patients (18.5%), paresthesia of the tongue in two patients (7.4%), infection at the site of incision in one patient (3.7%), an acute subdural hemorrhage in one patient (3.7%), temporary hearing loss in one patient (3.7%), and otitis media with cerebrospinal leakage in one patient (3.7%). Two patients (11%) in the gkrs group experienced paresthesia . Compared the clinical outcomes of 19 patients treated with mvd with 15 patients treated with gkrs . Nine gk patients (60%) and four mvd patients (21%) underwent previous surgical procedures . The treatment arms statistically differed (p = 0.0005) with respect to mean patient age, with the mean age of the gkrs group exceeding the mvd group by 13 years (74 versus 61 years). In addition, patient satisfaction was graded on a scale of 1 (unsatisfied) to 10 (completely satisfied). It was reported that the mean tn complexity grade was statistically different (p <0.001) between the treatment arms (gk = 5.8; mvd = 3). The average response following the procedure was determined to be 3.4 for the mvd group and 2.4 for the gkrs group (p = 0.017). Also, it was found that the satisfaction score for the mvd group was superior to the gkrs group (8.7 versus 6.4), with a p value of 0.02 . The authors reported a statistically significant correlation between tn complexity grade and clinical response (p <0.001), as well as tn complexity grade and patient satisfaction (p <0.001). To date, no randomized trials have been conducted analyzing the outcomes of patients with tn who are treated with mvd compared to gkrs . In a large review on tn management, zakrzewska and linskey found evidence that mvd is an effective treatment for long - term facial pain relief but comes with an increased risk of ipsilateral hearing loss . In addition, the authors concluded that single - dose srs is an effective treatment for long - term facial pain relief but puts patients at risk for facial numbness or facial paresthesias . Investigation into this matter in the form of a randomized controlled trial would provide the best evidence in terms of facial pain relief and procedure - related complications . In addition, we reviewed two studies comparing patients treated with gkrs with patients treated with posterior fossa exploration (pfe) [43, 44], both of which were conducted by pollock and colleagues at the mayo clinic college of medicine . One of the studies was a specific prospective comparison of 91 patients treated with pfe and 49 patients treated with gkrs for idiopathic tn as an initial management approach . The treatment arms statistically differed in terms of age (gkrs = 67.1 years; pfe = 58.2 years), with a p value <0.001 . It was reported that patients treated with pfe were more likely to be pain free and off medications at 1 year (84%) and 4 years (77%) when compared to the gkrs group (66 and 56%, resp .) Retreatment for recurrent facial pain was performed in 15% of the patients in the pfe treatment arm and 35% of patients in the gkrs treatment arm (p = 0.009). Also, it was found that nonbothersome facial numbness occurred more frequently in the gkrs group (p = 0.04). An additional study from the mayo clinic evaluated patients with recurrent tn who underwent 3 or more surgical procedures . The authors reported that patients treated with pfe exhibited superior levels of complete pain relief at 3 years of followup when compared to patients treated with gkrs, balloon compression, and glycerol rhizotomy (p <0.01) and underwent additional surgery for recurrent facial pain less often when compared to patients treated with the other modalities (p = 0.02). Clinical 006futcomes did not differ between patients treated with gkrs and patients treated with the percutaneous techniques . Srs can be performed by a variety of tools, which include gkrs, cyberknife technology, and linear accelerator (linac)-based treatment . Our analysis yielded one study whose primary endpoint was to devise a method using cyberknife treatment planning that would mimic the dosimetric characteristics of the gk treatment plan in five patients undergoing radiosurgery for tn . Both the isodose lines and critical structures were identified using the gkrs treatment plan and were transferred to the cyberknife treatment planning system . It was reported that the average length of the trigeminal nerve receiving a dose of 60 gy was 4.5 mm for the gk, 4.5 mm for the nonisocentric cyberknife, and 4.4 mm for the isocentric cyberknife . The authors found it more difficult to minimize the dose to critical structures when using cyberknife technology . Also, the dose falloff of gkrs was found to be steeper when compared to cyberknife technology due to, what the authors hypothesized, the large number of gamma rays produced which converge on the focal point with precision . As previously mentioned, the gk machine's primary functional unit is cobalt-60, which is used to emit photon energy through 201 separate 4 to 18 mm collimator openings that converge on a target specified by a treatment planning system . Balamucki et al . Performed a study examining if the half life of cobalt (5.26 years) relates to the outcomes for patients being treated for tn with gkrs . The authors collected data on 239 gkrs procedures performed at their institution between 1999 and 2004 . Patient surveys were used to measure responses to radiosurgery . With the followup time ranging from one to six months, it was reported that 80% of patients experienced some degree of pain relief and that 56% of those patients were pain free . The authors concluded that clinical outcomes remained consistent during the first half life of cobalt-60 . An area of controversy in the treatment of patients with tn is defining the optimal maximum radiosurgery dose that can be delivered to specific patient subsets . We analyzed five studies whose primary endpoint was to assess gkrs - dosing efficacy [4852]. Kim et al . Utilized the bni pain intensity scale to assess 66 tn patients treated with a gk maximum dose of 80 gy and 44 tn patients treated with a gk dose of 85 gy . Although the two groups did not statistically differ in terms of facial rain relief and procedure - related complications, the authors did report that patients treated with a gk dose of 85 gy experienced a more rapid response to treatment when compared to the patients treated with a gk dose of 80 gy . Arai et al . Analyzed 165 patients with tn treated with a gkrs dose of 80 gy . Specifically, the authors divided the patients into two groups, which differed in the radiation dose rate received (low - dose rate = 1.212.05 gy / min; high - dose rate = 2.063.74 gy / min). Using the bni pain intensity scale as a clinical evaluation method, it was reported that the low - dose - rate group and the high - dose - rate group did not statistically differ in terms of initial pain relief, maintenance of pain relief, and clinical complications . Patients in group one were treated with a gk dose <90 gy with no beam channel plugging, patients in group two were treated with a gk dose equal to 90 gy with no beam channel plugging, and patients in group three were treated with a gk dose equal to 90 gy with beam channel plugging . Although the trend did not reach full statistical significance (p = 0.054), patients in group three exhibited the highest level of pain relief, while patients in group one exhibited the lowest level of pain relief . The authors also observed that the three groups statistically differed (p <0.0001) in terms of trigeminal nerve dysfunction, with patients in group three experiencing the highest rate of mild and bothersome complications and patients in group one experiencing the lowest rate of mild and bothersome complications . Similar to the results of massager et al ., morbidini - gaffney et al . Reported positive outcomes in patients treated with gk doses> 85 gy . The authors also found that patients treated with two isocenters were more likely to have superior bni pain intensity scale scores during their course of followup when compared to patients treated with a single isocenter . The median initial dose was 80 gy, and the median retreatment dose was 45 gy . Although the authors did not report any predictors in terms of facial pain control and patient morbidity, they did compare the results of their study with seven published retreatment articles and found that successful levels of pain control (> 50%) were significantly correlated with cumulative gkrs doses> 130 gy, as well as new trigeminal nerve dysfunction (> 20%). In addition to dose selection efficacy in select patient cohorts, the radiosurgical target of cn v is another subject matter that requires further clinical investigation . We reviewed three studies [5355] analyzing specific gkrs targeting methods in the treatment of tn and one study that examined the accuracy of gkrs to its image - guided target . Compared patients treated with gkrs targeted at the dorsal root entry zone (59 patients) with patients whose radiosurgical target was the retrogasserian zone of the trigeminal nerve (41 patients). With a median followup of 30 months, the dorsal root entry target group exhibited statistically superior levels of initial complete pain remission (p = 0.003) and experienced less complications than the retrogasserian zone group (p = 0.009). Chen et al . Also reported positive results with the dorsal root entry zone - targeting approach, with a success rate of 82.8% and a complication rate of 15% . Park et al . Compared the dorsal root entry zone and retrogasserian zone - targeting methods in the treatment of 39 patients with medically refractory tn . The authors reported that the two treatment arms did not statistically differ in treatment success (bni class i - iiib) with respect to the bni pain intensity scale . However, patients treated with the retrogasserian zone - targeting method experienced a substantially shorter time of response to gkrs than patients treated with the dorsal root entry zone - targeting method (p = 0.044). Although the two groups did not statistically differ with regard to treatment - related morbidities, it was found that the patients whose targeting approach was the dorsal root entry zone experienced a greater amount of bothersome complications than the retrogasserian zone group . Massager et al . Analyzed the targeting accuracy of gkrs in 65 patients treated for tn whose six month followup mri showed focal contrast enhancement of the trigeminal nerve . The authors found that the median deviation of the coordinates between the intended radiosurgical target and the center of contrast enhancement was 0.91 mm in euclidean space . The median radiation dose fitting into the contrast enhancement region was determined to be 77 8.7 gy . This small deviation from the gkrs target explains the high accuracy and precise nature of the machine . The two most common methods of measuring patient outcomes from gkrs in the management of tn are the barrow neurological institute pain intensity scale (table 5) and the excellent - good - fair - poor (egfp) categorical scale (table 6). The bni pain intensity scale divides patients into one of five classes, with a higher class indicating a worse prognosis for the patient . Patients in bni class iiia do not experience trigeminal pain but require the use of medication . Patients in bni class iiib experience some trigeminal pain that can be satisfactorily managed with medication . Patients in bni class iv experience some trigeminal pain that is not satisfactorily managed with medication . Patients in bni class excellent outcomes are defined as complete pain relief without the need of medication . Good outcomes are defined as complete pain relief with the need of medication . Poor outcomes are defined as a <50% pain relief rate or treatment failure . For patients with medically refractory forms of tn, gkrs has proven to be an effective initial and repeat treatment option . Cumulative research suggests that patients treated a single time with gkrs exhibit similar levels of facial pain control when compared to patients treated multiple times with gkrs . However, patients treated on multiple occasions with gkrs are more likely to experience facial numbness and other facial sensory changes when compared to patients treated once with gkrs . Although numerous articles have reported mvd to be superior to gkrs in achieving facial pain relief, the findings of these comparison studies are weakened by the vast differences in patient age and comorbidities between the two studied groups and cannot be considered conclusive . Further evidence in the form of a phase iii - randomized trial is needed to confirm the clinical outcomes of patients treated with either modality . Questions remain regarding optimal gkrs dosing and targeting strategies, which warrants further investigation into this controversial matter.
|
A 55-year - old caucasian female was undergoing elective coronary artery bypass surgery following a recent myocardial infarction . Intravenous midazolam was given to the patient in the holding area, and the right radial artery was cannulated . In the operating room, intraoperative monitors, included five - lead electrocardiography, pulse oximetry, a radial artery catheter, capnography (etco2), and bladder temperature . The patient was intubated without any difficulty after routine intravenous induction with etomidate, sufentanil, and rocuronium . The right internal jugular vein was cannulated with the patient in the trendelenburg position, and a pulmonary artery catheter was advanced to the wedge position without difficulty . Additional monitors included a pulmonary artery catheter with venous saturation and continuous cardiac output monitoring as well as central venous pressure . An adult multiplane 6.0 mhz transesophageal echocardiography (tee) probe (acuson, siemens, washington, dc, usa) was placed . Systematic tee images were obtained according to the american society of echocardiography - society of cardiovascular anesthesiologists guidelines . As the cardiac surgeon harvested the left internal mammary artery, the first assistant harvested the saphenous vein from the left leg via an endoscopic approach (stryker endoscopy, san jose, ca, usa) using co2 insufflation at 4 l / min and a pressure of 14 mmhg . Approximately 20 minutes after endoscopic vein harvesting started, we noticed the patient's end - tidal co2 (etco2) had increased from 36 to 44 mmhg followed by increasing pulmonary artery pressure from 42/20 to 60/39 mmhg within 1 minute . Subsequently, systemic blood pressure dropped from 101/60 mmhg to 65/30 mmhg while o2 saturation remained at 100% . The cardiac index dropped approximately 15% from 2.2 to 1.9 l / min / m, but heart rate and central venous pressure were only slightly elevated . The inspiratory oxygen concentration fraction was adjusted from 50% to 100%, and vasopressors were administered to support the pressure . Mid - esophageal four - chamber and mid - esophageal aortic valve long - axis views were examined, but no new mitral or aortic regurgitation was noted . However, the mid - esophageal right ventricular inflow - outflow view revealed a massive snowflake appearance suggestive of gas bubbles from the right atrium to the right ventricle (fig . However, mild dilatation of the right ventricle was noted . At that time, all intravenous fluids through the central line were stopped, and all intravenous connections were checked to make sure no intravenous fluids were running . Despite these maneuvers, the snowflake appearance suggestive of gas bubbles was still present . We concluded that the gas bubbles were not caused from turbulence due to intravenous fluids or from a disconnected intravenous line, so a co2 embolism was suspected . After this observation, we kept the patient in the trendelenburg position and increased the ventilation rate to expire more co2 . A nitroglycerine drip was started to lower pulmonary artery pressure, and phenylephrine boluses were administered to maintain systemic blood pressure within an acceptable range . Further examination of tee in the mid - esophageal bicaval view revealed that the gas bubbles were originating from the inferior vena cava (fig ., we concluded that the source of the gas embolism was most likely from co2 insufflation . The surgical team was informed of these findings and they reassured us that the proximal saphenous vein was completely ligated and confirmed that most branches were adequately cauterized . The surgical team requested 5 additional minutes to complete vein harvesting based on patient stability . Our hemodynamic assessment revealed that the patient was stable, and the tee examination revealed a significant reduction in air bubbles, so the decision was made to proceed with the endoscopic vein harvesting . Over that course, the patient remained on 100% fio2, and a higher ventilation rate . The nitroglycerin drip was discontinued and intermittent small epinephrine boluses were administered for inotropic support, and phenylephrine or ephedrine were administered to maintain systemic blood pressure> 90/50 mmhg . The patient's hemodynamic status improved shortly after vein harvesting was completed, and co2 insufflation was discontinued . We noted the patient's etco2 had returned back to 35 mmhg, pulmonary artery pressure had decreased steadily back to a baseline level of 40/20 mmhg, and continued down to 30/18 mmhg, whereas systemic blood pressure stabilized at 100/60 mmhg without vasopressor support . A tee examination in the mid - esophageal right ventricular inflow - outflow view and mid - esophageal bicaval view revealed no further evidence of gas embolism . Coronary artery bypass grafting was completed without further events, and the patient recovered without any adverse neurological sequelae . Our case not only confirms the vital role of tee in the quick and accurate diagnosis of a co2 embolism during endoscopic vein harvesting but also allowed us to focus on the mid - esophageal bicaval view, a view not commonly used to identify a co2 embolism . Further review of the mid - esophageal right ventricular inflow - outflow view revealed that gas was entering the right side of the heart, but we could not determine whether the bubbles originated from the superior vena cava or the inferior vena cava . Using the mid - esophageal bicaval view, we were able to confirm that the gas embolism originated from the inferior vena cava, and that the lower extremity endoscopic site was the most likely suspect . The era of minimally invasive surgery started two decades ago and has extended its influence into cardiac surgery . The first endoscopic vein harvesting was described by lumsden et al . In 1994 . The endoscopic technique is associated with a shorter time (51.07 vs. 75.94 min), better leg wound healing, and a lower incidence of wound infections (12.0% vs. 8.8%) compared to those of conventional open vein harvesting . Other advantages of endoscopic vein harvesting compared to conventional open vein harvesting include a smaller incision, less post - operative pain, a shorter hospital stay, and better cosmetic appearance . The endoscopic vein harvesting procedure requires co2 insufflation at a flow of 4 l / min and pressure of approximately 14 mmhg to create a potential subcutaneous space . In contrast, there have been reports of co2 embolism, pneumothorax, subcutaneous emphysema, and hypercarbia . The reported incidence rate of co2 embolism ranges from 1 - 200 cases in every one million laparoscopic surgeries . The incidence of a co2 embolism during endoscopic saphenous vein harvesting with co2 insufflation procedures decreases as the severity of clinical symptoms and the volume of embolized gas increases . The incidence of venous co2 embolism of any size is 17.1%, whereas the incidence of massive gas emboli is only 0.5% . The incidence of a co2 embolism is even lower when an endoscopic approach is used to harvest arterial conduits . In our hospital, the endoscopic vein harvesting technique has been used in approximately 1,500 cases since 2005, with no reported incidence of a co2 embolism . Manifestations of a co2 embolism include hypotension, reduced cardiac output, and decreased mixed venous oxygen saturation, along with elevated pulmonary artery and central venous pressures . However, this sign may not be as dependable as was the case in our patient, as we observed an initial rise in etco2 instead of a reduction . A drop in etco2 is an indication of increased dead space and insufficient pulmonary perfusion . This condition does not generally occur unless the trapped gas in the pulmonary vascular system or the right ventricular outflow prevents blood from flowing into the lung, a condition that is generally observed with a massive embolism . Whenever co2 is used for endoscopic insufflation, co2 can directly enter the injured saphenous vein or its branches, resulting in elevated etco2 . Furthermore, a smaller amount of co2 embolized to the right heart could be released acutely, resulting in elevated etco2 . As was seen in our case, treatment for a co2 embolism includes immediate discontinuation of co2 insufflation, placing the patient in the trendelenburg position, increasing fio2 to 100%, and aspirating the central line . The latter intervention is less successful with a pulmonary artery catheter and may divert the attention of the anesthesia team from other rescue efforts . Furthermore, inotropic agents should be started to support cardiac output to push the co2 embolism into the lungs . Cardiac massage and even urgent cardio - pulmonary bypass or extracorporeal membrane oxygenation have also been described if the patient does not respond to initial resuscitation efforts . In our case, we choose to allow continued co2 insufflation to complete saphenous vein harvesting based on the patients stabile hemodynamics and on the observation that a reduction in gas entry to the right heart occurred shortly after detecting the co2 embolism . This finding was interesting, as the surgical team did not reduce insufflation flow or pressure . We believe that the source of co2 absorption was eliminated at this point, as the surgical team cauterized the open vascular structures . In summary, the use of endoscopic vein harvesting for the saphenous vein has become increasingly more common and awareness and prevention of the potential for a co2 embolism is important . As seen in our case, tee played a vital role in detection, and we believe that the mid - esophageal bicaval view should be used as the standard view during endoscopic vein harvesting . It has been suggested that the surgical team should pay special attention when cauterizing or ligating all vein branches to reduce the potential for co2 entry into the venous system to prevent further co2 embolisms . Although we allowed endoscopic vein harvesting to continue after confirmation of the co2 embolism with direct inspection of the saphenous - femoral vein junction and meticulous closure of the tears were confirmed, further investigation into the safety of this practice is warranted.
|
Drywood termites cause significant damage to wood in structures in the united states, with two species, incisitermes minor (hagen) and cryptotermes brevis (walker), being responsible for the majority of damage (su and scheffrahn, 1990; grace, 2009). The economic cost of control and repair of damage is second only to that for subterranean termites (su and scheffrahn, 1990). Remedial control of drywood termites in the united states relies primarily on either (1) fumigation of the entire structure with a toxic gas or heated air, or (2) localized chemical or physical treatments designed to eradicate small, localized colonies (lewis and haverty, 1996; lewis, 2008; lewis and rust, 2009). Fumigation treatments are likely to kill all of the termites in a structure, while localized treatments can destroy all termites in a colony, provided the treatment is delivered to the entire gallery system . The size, number, and dispersion of drywood termite colonies in a structure can vary greatly, depending on the age of the infestation and the success of preventative or remedial treatments . Drywood termite colonies also are considered single piece nesters, i.e., they nest within their food source and do not forage from the nesting site to a food source (abe, 1987). In fact, large, dispersed colonies (or even small colonies) can live in a single piece of wood or in multiple pieces of wood that are joined together (grace et al ., drywood termites are cryptic, seldom leaving obvious or visible external signs of their presence in wood . A commonly used sign for determining the presence of drywood termites is the occurrence of fecal pellets, ejected through a kick - out hole in the external surface of wood from the internal galleries (ebeling, 1975). These pellets often are found as conical piles or are scattered on horizontal surfaces below infested wood . These hexagonally sided pellets are diagnostic for drywood termites, and can be used to distinguish damage from that by other wood - destroying insects (ebeling, 1975; moore, 1992). Grace and yamamoto (2009) demonstrated the relationship between the cellulose and lignin content of the food utilized by small groups of c. brevis and incisitermes immigrans (light), and the quantity of fecal pellets produced over time . They also discussed the use of the size and number of fecal pellets for estimating both size and age of drywood termite colonies . Drywood termites excrete feces in the form of hard, even - shaped fecal pellets . These fecal pellets contain the same mixture of hydrocarbons as the insects that produced them, albeit in slightly different proportions (haverty et al ., 2005). Because cuticular hydrocarbons are species specific in termites (page et al ., 2002) rather than simply signaling the general presence of termites or providing a diagnosis of the species of termite inhabiting the wood, we postulated that these pellets could be chemically characterized so as to determine the status of a colony as active (alive) or inactive (dead). Here, we report quantification of the hydrocarbons in pellets of i. minor aged for up to 1 year after they were produced . We document the changes in proportions of selected hydrocarbons as an indication of the length of time since the pellets were excreted . Collection of termites and preparation of termite containment unit termites, i. minor, were removed from one naturally infested board (98.9 13.3 271.8 cm) collected on 19 july 2006 from lakeview, california, and stored at the university of california richmond field station . The board was cut across the grain into pieces, 58 cm thick, and stored at room temperature . A wood chisel was used to separate pieces of wood into smaller pieces, 0.51.0 cm thick . All remaining live termites, including soldiers and primary reproductives (alates), were placed in a termite containment unit (tcu). Termites thus collected were likely from a large mixed colony (booth et al ., 2010) or from multiple colonies . We were not able to assign the various galleries in the wood to any particular colony.fifteen birch tongue depressors were bundled together, and three equally spaced holes drilled across the length of the bundle using a 2.8-mm bit . Bamboo skewers, 1013 cm in length, were inserted into each of the three holes in the bundle of tongue depressors . Spaces, 36 mm, were left between each tongue depressor allowing termites access to all tongue depressors . Two sets of skewered tongue depressors were placed into a clean plastic container (17.5 12.5 6 cm), one on top of the other, such that the tongue depressors on the top layer fit into the gaps created by the tongue depressors on the bottom layer . Tongue depressors were lightly misted with water, and then 6,662 drywood termites (a mixture of pseudergates or workers, alates, and soldiers) were placed in the tcu . Tcus, with termites, were maintained in a dark cabinet in the laboratory under ambient conditions prior to collection of fecal pellets . A single colony or a mixture of two or more colonies, representing a single location within california, was prepared in this manner . Pellet collection and aging process after all the tcus had acclimated to laboratory conditions over several weeks, new holding chambers were prepared . All wood debris, pellets, dead termites, and damaged tongue depressors were discarded . The termites in the new holding chambers were maintained in the laboratory under ambient conditions for 2 weeks . At the end of this period, all pellets were removed, and sub - samples collected and readied for the aging study . Concurrently, three samples of 20 workers, three samples of 20 alates, and one sample of 20 soldiers were also collected for hydrocarbon analysis . Live termites were placed in a 20-ml scintillation vial and frozen until extraction.fecal pellets were separated from debris by sequentially sifting them through successively smaller sieves (haverty et al ., 2005). Thus, all substances such as hand lotion, lip balm, parafilm, and waxed paper were kept away from the work area . Gloves were worn when handling pellets, and implements that came in contact with pellets were wiped with a paper towel dampened with absolute ethanol to remove any oils or waxes . Pellets were separated from fine debris by removing individual pellets with forceps or with an aspirator, until a sample weighing approximately 200 mg was obtained.in developing this protocol we made one estimate and one critical assumption . The estimate was that at least 1,000 pellets were needed for each hydrocarbon analysis (based on preliminary analyses of pellets collected from drywood termites maintained in our laboratory). (1997) using c. brevis and i. snyderi (light) from southern florida . In that study, 40 i. snyderi (pseudergates or workers) produced 573 pellets over 4 weeks, slightly less than 150 pellets / wk or about 3.5 pellets / individual / wk . In a study with small groups of c. brevis and i. immigrans, grace and yamamoto (2009) found that these species produced 4.9 to 7.0 pellets / individual / wk . For our study, we assumed that i. minor would produce pellets at roughly the same rate and, therefore, we needed about 3,000 to 5,000 individuals in a tcu for this study . We prepared one tcu to collect the requisite quantity of fecal pellets.four sub - sampling intervals, each replicated three times, were used: 0, 30, 90, and 365 days from the initial collection date . Sub - samples were stored in clean, 20-ml scintillation vials, sealed with 1.5 1.5 mm mesh screen . Vials were stored in a dark cabinet at the university of california richmond field station at ambient temperature.voucher samples of i. minor pseudergates or workers and soldiers from this study (fresh, not dried) were preserved in 85% ethanol and deposited in the essig museum, university of california at berkeley (haverty et al ., extraction procedure and characterization of hydrocarbons hydrocarbons from workers, alates, soldiers, and fecal pellets of i. minor were extracted, characterized, and quantified as previously reported (haverty et al ., 2005). Frozen termite samples were thawed and dried at 70c for approximately 1 h before extraction . Each sub - sample of fecal pellets or termites was placed in a 20-ml scintillation vial, and immersed in 10 ml of n - hexane for 10 min . After extraction, hydrocarbons were separated from other compounds through 4 cm of activated sigma silica gel (70230 mesh) in pasteur pipette mini - columns . The resulting hydrocarbon fractions were evaporated to dryness under a stream of nitrogen and redissolved in 60 l of n - hexane for gas chromatography - mass spectrometry (gc - ms) analysis . A 3-l aliquot was injected into the gc-ms.gc-ms analyses were performed on an agilent 6890 gas chromatograph interfaced with an agilent 5973 mass selective detector, using agilent chemstation data analysis software (g1701ca version c.00.00). The gc - ms was equipped with an hp-1ms, fused silica capillary column (30 m 0.25 mm i.d, 0.25 m film thickness), and was operated in split mode (split ratio of 30:1), using helium as carrier gas . The column oven was programmed from 200320c at 3c min, with a final hold of 11 min . Electron impact (ei) mass spectra were obtained at 70 ev.all chemicals of interest were identified by their retention times and mass spectra . Mass spectra of methyl - branched alkanes were interpreted as described by blomquist et al . Olefins were identified by their mass spectra, although double bond positions were not determined (haverty et al ., 2005).in the text, tables, and figures, we use shorthand nomenclature to identify individual hydrocarbons or mixtures of hydrocarbons . This shorthand uses a descriptor for the location of methyl groups (x - me), the total number of carbons (cxx) in the hydrocarbon component excluding the methyl branch(es), and the number of double bonds following a colon (cxx: y). Thus, pentacosane is represented as n - c25, 11-methylnonacosane as 11-mec29, 13,17-dimethylhentriacontane as 13,17-dimec31, and heptatriacontatriene as c37:3 . Hydrocarbons are presented in the tables for each caste and worker fecal pellets in the order of elution from our gc - ms system . Statistical analysis gc - ms peak (some peaks contained more than one compound or a mixture of positional isomers) areas were converted to percentages of total hydrocarbon fraction, enabling mean (sd) relative amounts of each hydrocarbon peak for workers and alates, and overall mean (sd) of each hydrocarbon peak for the fecal pellets, to be calculated.the percentage of each hydrocarbon peak for pellets of each aging period was transformed to the log of the percentage (dependent variable y) and regressed against the days of aging (independent variable x). Hydrocarbons with slopes different from 0 (= 0.05) were separated into two groups: those with a significant positive slope and those with a significant negative slope . For each aging period (0, 30, 90, and 365 day), an index of age (iage) was created by subtracting the sum of the percentages of the hydrocarbons with a negative slope over time from the sum of the percentages of the hydrocarbons with a positive slope over time [iage = (peakpositive) minus (peaknegative), for each aging period]. The iage for each aging period then was regressed against the aging period (r development core team, 2004). The cuticular hydrocarbons for i. minor pseudergates and fecal pellets were characterized previously (haverty et al ., 2000, 2005). The composition of the hydrocarbon mixture for this species and the hydrocarbons from their fecal pellets in the present study are displayed in fig . 1total ion chromatogram of cuticular hydrocarbons from a workers of incisitermes minor (hagen) and b from fecal pellets from the same collection . Acronyms for hydrocarbons are derived as follows: x - me location of methyl groups, the total number of carbons cxx in the hydrocarbon component excluding the methyl branch(es), and cxx: y the number of double bonds following a colontable 1relative abundance of hydrocarbons from pseudergates, alates, soldiers, and fecal pellets of incisitermes minor (hagen)hydrocarbonspseudergates n = 3alates n = 3soldiers n = 1fecal pellets n = 122-mec220.06 (0.02)0.08 (0.02)0.090.11 (0.02)n - c231.30 (0.06)1.34 (0.05)1.481.35 (0.18)2-mec231.45 (0.40)1.72 (0.35)2.112.13 (0.28)3-mec231.31 (0.38)1.38 (0.30)1.712.06 (0.29)n - c240.46 (0.01)0.43 (0.02)0.480.32 (0.05)2-mec240.13 (0.03)0.19 (0.03)0.190.15 (0.02)3-mec240.08 (0.02)0.10 (0.02)0.120.11 (0.02)n - c2516.35 (0.16)11.75 (0.40)12.648.65 (1.05)2-mec250.18 (0.01)0.27 (0.01)0.240.14 (0.02)3-mec250.23 (0.04)0.36 (0.04)0.340.26 (0.03)n - c262.25 (0.15)1.17 (0.07)1.510.87 (0.12)2-mec260.14 (0.01)0.13 (0.01)0.140.07 (0.01)n - c2714.04 (0.55)6.81 (0.31)10.055.91 (0.65)2-mec270.13 (0.01)0.09 (0.01)0.130.06 (0.01)3-mec270.20 (0.01)0.19 (0.01)0.250.12 (0.01)n - c280.43 (0.05)0.17 (0.01)0.350.15 (0.03)n - c293.38 (0.33)1.27 (0.07)2.971.38 (0.18)11-mec290.06 (0.01)0.15 (0.01)0.100.09 (0.01)9,13-dimec290.70 (0.02)0.82 (0.01)0.910.63 (0.06)9,13,17-trimec290.11 (0.02)0.27 (0.00)0.160.22 (0.03)n - c300.04 (0.00)0.07 (0.00)0.100.0013-mec300.01 (0.02)0.08 (0.00)0.040.0010,14-dimec300.64 (0.06)1.45 (0.02)0.880.90 (0.03)10,14,18-trimec300.18 (0.02)0.43 (0.01)0.240.28 (0.02)n - c310.14 (0.01)0.10 (0.01)0.200.09 (0.01)15-; 13-; 11-; 9-mec310.36 (0.03)0.82 (0.01)0.420.49 (0.02)13,17-; 11,15-dimec317.45 (0.68)13.74 (0.52)8.5510.67 (1.80)9,13,17-trimec310.57 (0.05)1.19 (0.02)0.720.89 (0.06)7,11,15-trimec310.54 (0.04)0.99 (0.01)0.720.81 (0.09)14-; 12-mec320.17 (0.01)0.33 (0.02)0.190.27 (0.03)12,16-dimec322.01 (0.14)3.57 (0.05)2.222.97 (0.28)10,14,18-; 8,12,16-trimec320.46 (0.03)0.80 (0.02)0.610.82 (0.06)15-; 13-mec330.93 (0.05)1.57 (0.03)0.921.30 (0.08)13,17-; 11,15-; 9,13-dimec334.63 (0.31)6.87 (0.11)5.117.41 (1.03)9,13,17-trimec331.30 (0.08)2.02 (0.02)1.863.47 (0.33)7,13,17-trimec330.21 (0.02)0.32 (0.01)0.320.47 (0.07)c35:31.01 (0.03)2.93 (0.17)1.641.76 (0.17)c35:22.31 (0.06)4.46 (0.14)2.713.55 (0.15)12,16-dimec34; c35:10.68 (0.02)1.16 (0.03)0.851.40 (0.10)10,14,18-; 8,12,16-trimec340.28 (0.00)0.50 (0.04)0.450.89 (0.14)15-; 13-; 11-mec350.56 (0.02)0.85 (0.05)0.671.11 (0.09)13,17-dimec351.27 (0.09)1.96 (0.02)1.833.95 (0.46)9,13,17-trimec350.14 (0.01)0.28 (0.03)0.270.93 (0.14)c37:31.74 (0.06)3.33 (0.16)2.723.28 (0.34)c37:21.67 (0.06)2.55 (0.08)2.182.90 (0.10)12,16-dimec360.17 (0.01)0.34 (0.02)0.280.71 (0.08)c37:10.78 (0.02)0.76 (0.03)0.810.83 (0.06)10,14,18-trimec36; c37:10.44 (0.03)0.35 (0.05)0.430.58 (0.10)13; 11-mec370.71 (0.01)0.60 (0.04)0.770.89 (0.14)13,17-; 11,15-dimec370.87 (0.05)1.27 (0.01)1.252.13 (0.22)9,13,17-trimec370.09 (0.01)0.13 (0.01)0.130.30 (0.06)c39:30.09 (0.02)0.18 (0.02)0.290.49 (0.16)c39:3; 12-mec380.49 (0.04)0.56 (0.03)0.761.03 (0.18)14,18; 12,16-dimec380.02 (0.03)0.14 (0.01)0.140.24 (0.04)c39:1; 10,14,18-trimec382.73 (0.19)1.73 (0.04)2.531.74 (0.23)13-; 11-mec391.75 (0.09)1.03 (0.03)1.701.26 (0.20)13,17-; 11,15-dimec390.90 (0.01)1.04 (0.14)1.361.44 (0.08)9,13,17-trimec390.41 (0.03)0.17 (0.09)0.110.20 (0.03)12-; 10-mec400.38 (0.05)0.20 (0.01)0.350.26 (0.07)12,16-dimec400.27 (0.00)0.27 (0.02)0.340.32 (0.05)c41:13.31 (0.27)1.70 (0.04)2.791.58 (0.25)13-; 11-mec412.78 (0.20)1.45 (0.06)2.591.74 (0.31)13,17-; 11,15-dimec413.34 (0.13)2.90 (0.15)4.003.33 (0.19)9,13,17-trimec410.79 (0.02)0.30 (0.02)0.330.42 (0.19)12-; 10-mec420.30 (0.03)0.15 (0.01)0.250.26 (0.27)12,16-dimec420.48 (0.04)0.37 (0.02)0.520.47 (0.12)c43:12.72 (0.28)1.25 (0.06)2.271.31 (0.26)15-; 13-mec431.00 (0.14)0.46 (0.05)0.870.61 (0.16)13,17-dimec431.99 (0.16)1.18 (0.16)1.931.68 (0.28)14,18-dimec440.12 (0.02)0.07 (0.01)0.120.13 (0.06)c45:10.42 (0.09)0.16 (0.02)0.330.21 (0.07)13-mec450.000.000.000.04 (0.03)13,17-dimec450.37 (0.08)0.18 (0.02)0.340.43 (0.13)mean percent (sd) of total hydrocarbon composition . Compounds are listed in elution orderacronyms for hydrocarbons are derived as follows: location of methyl groups (x - me), the total number of carbons (cxx) in the hydrocarbon component excluding the methyl branch(es), and the number of double bonds following a colon (cxx: y)these hydrocarbons were not reported for i. minor pseudergates or fecal pellets in haverty et al . (2005)an isomeric mixture or two or more compounds co - eluted in this peak total ion chromatogram of cuticular hydrocarbons from a workers of incisitermes minor (hagen) and b from fecal pellets from the same collection . Acronyms for hydrocarbons are derived as follows: x - me location of methyl groups, the total number of carbons cxx in the hydrocarbon component excluding the methyl branch(es), and cxx: y the number of double bonds following a colon relative abundance of hydrocarbons from pseudergates, alates, soldiers, and fecal pellets of incisitermes minor (hagen) mean percent (sd) of total hydrocarbon composition . Compounds are listed in elution order acronyms for hydrocarbons are derived as follows: location of methyl groups (x - me), the total number of carbons (cxx) in the hydrocarbon component excluding the methyl branch(es), and the number of double bonds following a colon (cxx: y) these hydrocarbons were not reported for i. minor pseudergates or fecal pellets in haverty et al . (2005) an isomeric mixture or two or more compounds co - eluted in this peak hydrocarbons from termites n - alkanes and dimethylalkanes were the predominant classes of hydrocarbons in all castes and in fecal pellets (table 2), as previously reported by haverty et al . N - alkanes comprised from 23.12% to 38.39%, unsaturated components from 15.21% to 19.03%, terminally branched monomethylalkanes from 3.90% to 5.32%, internally branched monomethylalkanes from 7.70% to 9.01%, and dimethylalkanes from 25.25% to 36.18%, of the total hydrocarbon content . There was also a homologous series of trimethylalkanes, representing 8.26% to 9.48% of the total hydrocarbon content . Table 2relative abundance of hydrocarbon classes from pseudergates, alates, soldiers, and fecal pellets of incisitermes minor (hagen)hydrocarbon classpseudergatesalatessoldiersfecal pelletsnormal alkanes38.3923.1229.7718.71olefins18.3821.1120.3120.66terminally branched methylalkanes3.904.495.325.19internally branched methylalkanes9.017.708.888.33dimethylalkanes25.2436.1829.7937.40trimethylalkanes5.097.405.929.71percent of total hydrocarbon compositionall peaks with co - eluting olefins and saturated compounds are summarized as olefinsthe hydrocarbons of i. minor characterized in this study included all of the compounds reported by haverty et al . (2005), as well as 18 additional hydrocarbons (table 1). These additional hydrocarbons were not abundant, never representing more than 0.85% of the total hydrocarbon (as for the mixture of 12,16-dimec34 and c35:1 in soldiers) content, and usually much less . The detection of these additional hydrocarbons in this study are likely due to the greater concentration of the extracted hydrocarbons used or, possibly, colony to colony variation . Relative abundance of hydrocarbon classes from pseudergates, alates, soldiers, and fecal pellets of incisitermes minor (hagen) percent of total hydrocarbon composition all peaks with co - eluting olefins and saturated compounds are summarized as olefins hydrocarbons from termite fecal pellets in general, the hydrocarbons from whole - body extracts of i. minor were represented in extracts of fecal pellets . As with whole - body extracts of i. minor, dimethylalkanes were the predominant class of hydrocarbon, followed by olefins and normal alkanes (table 2). 1) were found in termites and not in fecal pellets, but these were present in small quantities, less than 0.1% of the total hydrocarbon content . The lack of these two hydrocarbons in fecal pellets may be a function simply of the concentration of the extracts . Changes in hydrocarbons of fecal pellets over time we identified 73 hydrocarbon peaks in fecal pellets of i. minor (table 1). Of these peaks (data from non - significant slopes not reported), 19 of 73 (26%) had a significant change, either positive (five) or negative (14), over time (fig . 2). This is a much higher number of statistically significant slopes (different from 0), than would be expected by chance alone (5% of 73 peaks is <4 peaks). 2changes in percent content of individual hydrocarbons, over time, from fecal pellets of incisitermes minor workers . A hydrocarbons with significant (= 0.05) negative slopes, and b hydrocarbons with significant positive slopes . Acronyms for hydrocarbons are derived as follows: x - me location of methyl groups, the total number of carbons, cxx in the hydrocarbon component excluding the methyl branch(es), and cxx: y the number of double bonds following a colonthe index, iage, for each of the three replications (a, b, and c at 0, 30, 90, and 365 day) was plotted against the associated number of days (fig . The fitted line, with a 95% confidence interval for the means to show the variability of the replicates, had a high adjusted r (= 0.888) value, suggesting that it might be possible to predict fecal age by the index . 3fitted line and 95% confidence intervals for a plot of the mean of index of age (iage) against age . Values for 30 day are jittered a small amount so that all three data points can be seen changes in percent content of individual hydrocarbons, over time, from fecal pellets of incisitermes minor workers . A hydrocarbons with significant (= 0.05) negative slopes, and b hydrocarbons with significant positive slopes . Acronyms for hydrocarbons are derived as follows: x - me location of methyl groups, the total number of carbons, cxx in the hydrocarbon component excluding the methyl branch(es), and cxx: y the number of double bonds following a colon fitted line and 95% confidence intervals for a plot of the mean of index of age (iage) against age . Values for 30 day are jittered a small amount so that all three data points can be seen we do not know the basis by which peaks increase or decrease over the 1-year period . In general, those that increased in relative abundance tended to have higher initial relative abundances; i.e., mono-, di-, or tri - methylalkanes with carbon chains of 31, 32, or 33 . Those that decreased were represented in five of the six classes of hydrocarbons, ranging from c26 to c45 . The composition of the hydrocarbon mixture of insects is genetically controlled (toolson and kuper - simbrn, 1989; kaib et al ., 1991; page et al ., 1991; coyne et al ., 1994). This composition can be slightly affected by diet and environmental conditions (hadley, 1977; espelie et al ., 1994; chapman et al ., 1995 (1996) demonstrated significant seasonal variation in quantities of some hydrocarbons of coptotermes formosanus shiraki from hawaii; these differences were small and associated with the production of alates . However, the qualitative mix of hydrocarbons has been shown to be stable over decades among species of cone beetles in the genus conophthorus (page et al ., 1990). The motivation for our study was to devise a method for the evaluation of the success or failure of drywood termite treatments, including fumigation and local application methods . With the recent classification of sulfuryl fluoride (the only fumigant active ingredient registered in california) as a greenhouse gas (mhle et al ., 2009) and the anticipated increase in local treatments, we felt that there would be considerable interest by the industry, regulatory agencies, and consumers for a simple and accurate means to determine whether or not a targeted colony / infestation is still in a structure . Our method, based on changes in hydrocarbon chemistry over time, shows promise to this end . Future research includes: (1) validating these findings for additional species of drywood termites and geographic populations of the same species, (2) validating these findings at different times of the year, and (3) exploring seasonality in pellet production and hydrocarbon quality in pellets.
|
There is a need for computer methods that can calculate the aqueous solvation free energies of solute molecules accurately and efficiently . Explicit - solvent models provide a physically accurate and atomistically detailed model of solvent, but they can be computationally expensive . Boltzmann (pb), generalized born (gb), and weighted surface area (wsa) approaches, are computationally efficient because they treat water as a continuum . However, they are sometimes inaccurate, smearing out the particulate nature of water molecules, and they may have limited transferability to situations for which they have not been optimized . Solvation modeling has often been improved by combining the advantages of implicit- and explicit - solvent models . One such approach is the semi - explicit assembly (sea) water model . In the sea approach, water s solvation behavior is precomputed in explicit - solvent simulations of water around model spheres that are then combined together as building blocks to represent any given solute structure at run time . The solvation free energy gsolv for a target solute molecule is calculated from a sum over solvating waters . Sea has been shown to predict efficiently the air - to - water transfer free energies (ghyd) of small - molecule solutes in both prospective and retrospective studies with reasonable accuracy . Even so, the sea model does not give accurate solvation free energies of ions or solutes having high charge density . Here, we describe field - sea, a considerable improvement over sea, which gives accurate free energies of transfer of ions and charged solutes, at no additional computational cost and with no degradation of the predictions for nonpolar and uncharged polar solutes . In overview, we studied full md simulations of ionic and neutral solutes in tip3p water, described below, and found that the results could be captured by using a solvation free - energy field surface (in field - sea), instead of using precomputed waters (as in sea). Moreover, we found that a weakly charged solute atom that is adjacent to a strongly charged solute atom retains some of the restrictions of its solvating water molecules that its neighboring charge has; see figure 1 . Field - sea captures this effect using an adaptive boundary method . A solvent water molecule around a solute molecule . On the left, each solute atom (weakly charged) has a predefined radius, irrespective of its neighboring solute atoms, leading to the locus of water centers shown by the black dashed curve . On the right, one solute atom is strongly charged, leading to two consequences: its own solvating water molecule is pulled in tightly, and neighboring solute atoms have tighter water interactions too . Such effects may not be captured in simplified solvation models that treat atoms as having fixed radii, independent of neighboring atoms . Below, we describe the field - sea approach to computing solvation free energies . The original sea model is described elsewhere, and our related explicit - solvent and linearized poisson boltzmann equation modeling (lpbe) are described in the supporting information (si). In both the original sea and the new field - sea described here, first, in a precomputation step, various model spheres are solvated in an explicit - solvent model, such as tip3p . This provides a database of component free energies that are used in the second step . In the second step, at the run time, any given solute molecule of interest is assembled from an appropriate concatenation of these spheres . The solute s solvation free energy is computed by summing the component sphere free energies . On the one hand, this approach provides the speed advantages of simple additivity - based models as we only need to perform the first step once for a given solvent model . On the other hand, this procedure is more accurate than additivity - based approaches because (1) sea sums are regional, not local, and (2) the database encodes the microscopic response observed in explicit - solvent simulations . The new field - sea instead captures the solvation free energy using a continuous solvation field . To do this, the charging free energies for a series of lennard - jones (lj) spheres solvated in tip3p water were calculated with thermodynamics integration (ti) in the set of precomputations (see explicit solvent free energy calculations in the si). We construct a free - energy contour (see si figure s1) as a combination of the electric field at the first solvation shell boundary (e = q / rw, where e is the signed magnitude of the electric field, q is the sphere s charge, and rw is the distance from the sphere center to the first peak of the water oxygen s radial distribution function, rdf, around the given sphere), the curvature c = 1/rw at this boundary, and the charging free energy of the spheres . Within each charge step (q), all of the data of free energy, electric field, and curvature were fitted to a formula, which can be taken as an expansion of the born model1 equation 1 will be used to calculate the free energy associated with any surface spot on an arbitrary solute solvent boundary (esub). This free energy could also be calculated from interpolation between data points on the free - energy contour . In addition to a charging free - energy contour, we also need a contour for estimating the explicit - solvent - accessible surface of a given solute molecule . To generate this, we calculated the rdf of water oxygen around each charged sphere and picked the first peak in the rdf, denoted as the boundary - sphere distance rw . All of the rw values from these spheres and their charge and lj parameters (lj and lj) were used to build an rw contour . To generate a solvent - accessible surface for a given solute, an rw for each atom is first calculated from interpolation with its partial charge, lj, and lj on the rw contour . A lee richards surface is then constructed from the nonoverlapping sections of these rw spheres centered on their associated atom sites . The fixed rw boundary is dependent upon only the individual parameters of the surface atoms . For solute molecules with multiple partial charge sites (especially molecular ions, where strong electric fields are involved), a more physical representation of the explicit - solvent - accessible surface would be one that responds to the whole solute s electric field . In other words, the surface atom distance, rw, is determined not only by the surface atom s partial charge, but also by neighboring atoms charges . Taking into account such collective electrostatic effects, we adjust the fixed rw boundary in an adaptive manner, described by the following three - step procedure: (1)we cull all surface segments within 1.4 of any solute atom . As we are starting with a lee richards solvent - accessible surface, the minimum rw possible in the surface construction is half of a water molecule diameter (corresponding to a solute atom with a 0 radius). This partial - culling process simply removes potential numerical instabilities from surface sites overlapping solute atom centers while providing some adjustable starting surface sites that penetrate within the fixed rw boundary . We calculate the electric field at a given dot a about atom a2where n is the number of solute atoms, ria represents a vector from atom i to surface dot a, and ria is its length; signa = 1 when raai=1n (qi / ria3)ria 0, and signa = 1 when raai=1n (qi / ria3)ria <0, and raa is the vector from atom a to dot a. from the electric field, we calculate the corresponding charge by3where raa is the length of vector raa . We interpolate with this new charge and atom a s lj parameters to get a new rw, rw, new . In addition, we assume that rw cannot expand (if rw, new> rw, original, we let rw, new = rw, original). This nonexpansion assumption is supported by solute solvent boundary plots of model diatomic solutes (see si figure s2). Finally, the rw, new s of all atom s potential surface dots are averaged to yield an rw for this atom, used in the later culling process . (3) we cull the buried dots adaptively . Because each dot atom distance (e.g., daa) is adjusted independently in the above procedure, the shell of potential surface dots about an atom will no longer be spherical . Thus, culling buried dots is no longer a simple process of eliminating dots within a neighboring atom s rw, and an adaptive culling process is needed . To adaptively cull buried surface dots, when we check whether a given dot a is buried by a neighboring atom b, we first determine a corresponding charge at dot a from the electric field at this dot . This is used along with atom b s lj parameters to get a new rw, rw, badp, following the above rw adjustment procedure . Atom distance, dab, with rw, badp, to determine if the dot is buried in atom b. if dab is less than rw, badp, it is removed from the set of potential surface dots . We call the new dot surface resulting from the above culling procedure the adaptive boundary . Our term field - sea refers both to the field and to the adaptive boundary . The adaptive nature of the boundary only pertains to multiatom solutes; the adaptive and fixed rw boundaries are identical for single - atom solutes, like monatomic ions . While our adaptation procedure could, in principle, be applied iteratively, we found no further improvement after a single calculation . The charging free energy can be calculated for any given field - sea surface via4where ndot is the total number of surface - exposed dots, mi is the total number of dots (exposed + occluded) for corresponding atom i (each surface dot, j, of atom i, only corresponds to 1/mi of this atom sphere s total surface area or total solvation free energy), and esub, j is the subenergy associated with exposed surface dot j, calculated from the free - energy contour . Here, esub, j is calculated from eq 1 using the signed magnitude of the electric field, ej, and the curvature at dot j, 1/rij . Ej is defined as negative when ejrij <0, where ej is the electric field (vector) at dot j, rij is the vector from atom i to its surface dot j, and rij is this vector s length . Now, we take the total solvation free energy to be the sum of polar and nonpolar components5 assuming the polar component of the free energy of transfer (gpol) can be uniquely described by both the surface electric field and geometry of the solute, this molecular gpol can be accurately calculated from the simple summation of the surface dots energies process described above . We consider the gsolv of monatomic ions as an initial test . For molecular solutes, to account for the role of solute conformation in the solvation free energy, we average gsolv results from calculations on 50 conformations (though 10 conformations are usually enough; see the si). These solute conformations were generated from 5 ns tip3p water md simulations with a 100 ps snapshot interval . We developed field - sea because of the errors that we observed in simpler methods in solvating ions; see figure 2 . The explicit - solvent curve shows the hydration asymmetry discussed by others, where positively charged solutes are less favored than negatively charged solutes of similar size . Gsolv as the function of a model lj sphere (= 0.22 nm, = 0.06538 kj / mol) charge for tip3p, lpbe, and field - sea . For comparison at infinite - dilution conditions, an ewald correction is applied to the tip3p and field - sea results . Here, we tested field - sea on the solvation free energies of monatomic ions using ion parameters developed by aqvist or joung and cheatham (table s2, si). These ions have different sizes and charges; therefore, they have different charge densities . Table 1 and figure s3 (si) show the results of field - sea calculations, compared with lpbe and tip3p . Lpbe results using the lj surface do not capture quantitatively the gsolv of ions with high charge densities . In contrast, field - sea reproduces the tip3p gsolv values regardless of the specific lj parameters and charges . These results indicate that field - sea is accurately reproducing explicit - solvent free energies of solvation of monatomic ions, provided that their charge and lj parameters are near or encompassed within the range of the rw and free - energy contours . A common approximation in simplified solvation models is to suppose that atoms have fixed atom types, where any particular solute atom has a given value of charge and radius, independent of its atomic neighbors . However, our tip3p explicit - solvent simulations described below show that this approximation is a source of error . How the solvation surface is constructed our explicit - solvent simulations show that the solvation shell is not just a simple union of the spherical surfaces of all of the atoms making up the solute molecule . Imagine a diatomic solute with partially charged atom a covalently connected to partially charged atom b. our tip3p simulations show that when atom a attracts water molecules, it also shrinks the solvation shell of waters around atom b. in this way, the solvation surface around the diatomic molecule a b can be more complex than the simple union of independent spherical solvation shells around atoms a and b. to address such situations, we developed an adaptive method that gives a more explicit - like solvation boundary . To test our adaptive boundary method, we made up 22 fictitious diatomic solutes (see si table s4), computed their solvation free energies, and compared to their solvation in tip3p . We constructed these solutes by taking pairs of ordinary simulation atom types, placing them at fixed covalent bond distance apart, and giving each atom a charge and radius that we could vary systematically over the series . Because of the fictitious charges that we give them, these are not molecules observed in nature however, they are physically plausible molecules that provide us with a systematic series for learning about how explicit - solvent models handle solvated charges . Figure 3 shows the computed free energies of these diatomic solutes from field - sea when using the fixed rw and adaptive boundaries in comparison to explicit - solvent tip3p simulations . Lpbe and original sea results are shown in the si instead of here for the sake of simplicity . In summary, we find that when the tip3p gsolv is weak, for example, when the charge density of solute atoms is low, the fixed rw boundary works fairly well . When the gsolv grows to 100 kcal / mol and larger (more negative), it becomes increasingly important to use an adaptive boundary . These strongly solvated model molecules often have large, unbalanced partial charges on the solute atoms, and these situations lead to exaggerated distortions of the explicit solvation shell . Field - sea gsolv for model diatomic solutes (triangles: fixed rw; circles: adaptive boundary) compared to tip3p simulations . Figure 4 shows how a neighboring solute atom can affect the solvation shell about another atom . The fixed rw and adaptive boundaries are identical in figure 3a as both carbon atoms are weakly charged and there is only minor collective electrostatic perturbation on the boundary . However, when the solutes are more highly charged and large charging energies are involved, as in figure 3b, the weakly charged carbon atom s solvation shell will be distorted by its neighboring highly charged oxygen atom . In this case, water molecules penetrate more deeply into the carbon s solvent - accessible surface to better solvate the oxygen charge (the right part of the white curve in the dark blue region). Also, water molecules pack more tightly around the carbon atom and reduce its apparent rw (the left part of the white curve in the blue and light blue regions). Both of these effects are captured well by adaptive field - sea boundaries, leading to field - sea charging energies that are in excellent agreement with explicit simulation results . Oxygen density around (a) weakly charged and (b) strongly charged diatomic solutes . The blue contours indicate water density greater than the bulk value, with the darker blue regions indicating the enhanced water probability density . The black line shows the nonadaptive fixed rw boundary . For the weakly charged diatomic, the adaptive and nonadaptive boundaries coincide . The adaptive and nonadaptive boundaries differ . In order to establish that the accuracy of field - sea is not degraded relative to sea on nonionic solutes, we applied field - sea with both fixed rw and adaptive boundaries to a standard set of 504 neutral small molecules . This set contains an alchemically diverse range of functional groups, for which solvation free energies are available from experiments and tip3p simulations . Figure 5 shows 504 neutral solutes solvation free energy from tip3p simulation, from the lpbe (white diamonds) and field - sea (white circles) (see si figure s4 for nonadaptive fixed rw field - sea results). Field - sea shows a rmse (root - mean - square error) of 1kt with a negligible mse (mean - signed error), comparable to the original sea and considerably better than the lpbe, which bears a systematically negative error . While the fixed rw boundary field - sea results are comparable to the lpbe (table 1), it overestimates the free energy when weakly charged c atoms are neighbored by highly charged o or n atoms, as in the cases of alcohols, amines, ethers, and esters (si table s5). These errors arise because the fixed rw boundary cannot capture water molecule penetration into the c atom s solvent - accessible surface (see figure 4b), situations the adaptive boundary handles directly . Therefore, while these are simply neutral solutes, collective solute interactions still play a clear role in their overall hydration . Figure s5 (si) compares the total solvation free energy from field - sea with experimental results . The mse / rmse of field - sea to experimental solvation free energy (0.67/1.45 kcal / mol, table s6 (si)) is comparable to that of the much more computationally expensive tip3p water model (0.66/1.22 kcal / mol). These results indicate that field - sea can accurately compute solvation free energies over the full range from charge - dense ions to neutral polar and nonpolar molecular solutes . Here, we test field - sea on an expanded set of molecular ions and biomolecules (e.g., acetate, butylammonium, etc . ; see si table s7 for the complete list and results). These are ions that are larger and more complex than the simple atomic and diatomic ions described above and should better test the need for adaptive boundary considerations . Figure 5 compares solvation energies from lpbe (orange diamond) and field - sea (orange circle; see si figure s6 for field - sea results with a fixed rw boundary) with tip3p results for 35 molecular ions . The errors for both lpbe and field - sea with a fixed rw boundary are around 10 kcal / mol (table 1). While this might be regarded as acceptable in light of the nearly 100 kcal / mol span of free energies covered in the tip3p simulations, using an adaptive boundary with field - sea has half of this rmse . Field - sea also performs well in multivalent molecular ion solvation (si figure s7) and is as accurate as explicit - solvent calculations compared to experimental values for ionic solute solvation (table s6 and figure s8, si). Md simulations of gsolv for 504 neutral solutes (white), 35 molecular ions (orange), and 22 capped amino acid dipeptides (cyan) in tip3p water, compared to (a) lpbe and (b) field - sea . We also tested our methods on 22 capped amino acids (n - acetyl - x - methylamide, x = glu, arg, leu, etc . ; si table s8), which are widely used biological models in both theoretical studies and experiments . These are useful precursor structures for the foundation of hydrophobicity scales, used in estimating the solvation of larger biomolecular structures . Here, we investigate the solvation free energies of a full series of capped amino acids with field - sea . As the size of solute increases, computing the total solvation show, lpbe (cyan diamond) and field - sea (cyan circle) both yield solvation free energies that agree well with tip3p calculations . Again, the adaptive boundary helps field - sea considerably, cutting the rmse to half of that seen from the lpbe or fixed rw cases . These results indicate that the accuracy of field - sea does not degrade as the solute size further increases . The solvation boundaries in field - sea are made from a set of surface dots . Above, we used 80 dots / atom, the same as was used in previous sea studies . What is the minimum number of grid dots that we need to properly represent the first - shell boundary? To investigate this, we performed an analysis of accuracy versus relative computational time as a function of the granularity of the boundary . This analysis indicates that the rmse for field - sea results on the 504 neutral molecule set is essentially uncompromised even down to a granularity of 5 dots / atom, without increasing the rmse above 1 kcal / mol (figure s9 and s10 (si), the granularity does not affect the accuracy for charged solutes either). At 5 dots / atom, field - sea is roughly 5-fold faster than dipolar sea at 80 dots / atom, the minimum surface granularity recommended for this method . These results indicate that while field - sea is sensitive to the physicality of the solvation boundary, it is less sensitive to the granularity of its depiction . We have described field - sea, a method for computing solvation free energies of solutes in water . It improves upon an earlier method called sea (semi - explicit assembly). Sea captured the physics of solvation by presimulating toy spheres in explicit water, collecting a database of structural and energetic properties of those waters and then assembling at run time the solvation physics as sums over appropriate toy spheres to properly represent a given solute . In field - sea, this procedure differs in using a solvation free - energy field, rather than explicit waters . Furthermore, field - sea uses an adaptive boundary, allowing solvating waters to approach a solute atom to different degrees depending on neighboring atoms . Relative to sea, field - sea captures the solvation free energies of ions and charged solutes accurately, is faster to compute, and has no degradation of performance on nonpolar and polar solutes . Both sea and field - sea offer advantages over implicit - solvent modeling in that they entail no adjustable solute atom radii parameters . Sea and field - sea are built upon a corresponding force field and explicit - solvation model . Here one of the key observations that arises from our md simulations of charged solutes in tip3p water, which is captured by field - sea, is that atoms that are adjacent to charged atoms in solutes acquire partial characteristics of those charged atoms . For example, a weakly charged atom s solvation shell is shrunk by its neighboring big charges . An implication of this for implicit - solvent modeling is that atomic radii should not be treated as fixed for solvation in water; an atom s radius in implicit - solvent modeling can depend on the nature of its neighboring atom.
|
Hydatidosisis term used to refer to infection with the parasite larva in humans and echinococcosis restricted to infection with the adult stage in carnivorous animals (1). Recently, the genetics, structure and function of the human cytosolic gst enzyme with emphasis on their roles in the cellular metabolism has been defined (2). Gst activity was detected in most mammalian tissues, especially in the liver which plays a key role in detoxification . There are different classes of gst isozymes that diverge in their specificity to xenobiotic or endogenous substrates (3). Gst enzymes involved in the cellular detoxification of a broad range of chemical substrates (4). Apart from reaction from their endogenous metabolism, gsts of helminth parasite may protect against exogenous xenobiotics as a result of immune effectors mechanisms from the host (5). Significantly higher activity has been found in intestinal cestodes and digeneas, compared with parasitic nematodes (6). Gsts activity assay has been demonstrated in the cytosol of protoscolices from sheep hydatid cysts (7). Diagnosis of hydatid disease is done by a combination of clinical signs, imaging techniques, cyst fluid examination, serological tests and molecular techniques (9). The prevalence of liver hydatid cyst was reported 4.7% in people of peru country using recombinant antigen, epc1 glutathione s - transferase [repc1-gst], in western blot technique (10). However, the hydatid cyst diagnosis technique is under developing due to specificity and sensitivity problems . In the present study, gst enzyme activity of hydatid cyst protoscolices (parasite), healthy and cystic liver tissues were compared and mentioned gst enzyme importance for diagnostic biomarker in hydatid cyst disease . Ten samples of parasites were obtained from 10 liver infected with hydatid cysts of sheep slaughtered at a localabattoir (karaj, iran). Parasites samples were washed 3 times with pbs buffer, ph 7.2, freeze - thawed 3 - 6 times in liquid nitrogen and and water bath 37c respectively and sonicated in a 150w ultrasonic disintegrator,10 sec on and 5 sec off on ice until no intact psc were visible microscopically (approximately 15 min). Then resulted suspension was centrifuged (10000 g for 30 min at 4c) and supernatant was stored at -20c (11). Sheep livers (10 health liver samples and 10 infected samples) were obtained at a local abattoir and washed 3 times with pbs buffer ph 7.2 . Then they were homogenized with 3 volumes of homogenizing buffer, pbs ph 6.5, in a glass homogenizer, so the suspension were centrifuged (10000 g for 30 minat 4c) and supernatant stored at -20c (12). The protein concentration in the extract solutions of protoscolices and sheep liver tissues were estimated by the method of bradford using bovine serum albumin as the standard (12). Gsts activity was assayed spectro photometrically at 25c with reduced glutathione (gsh) and 1-chloro-2, 4-dinitrobenzene (cdnb) as substrates . Protosolices and liver extract samples were removed from -20c freezer and allowed to thaw on ice . Cdnb 100 mm from 4c and gsh 100 mm from -20c freezer were removed and allowed to thaw at room temperature, when thawed, incubated at 30c in water bath . For each assay was prepared one ml of assay cocktail (980lpbs ph 6.5, 10l of 100 mm cdnb and 10 l of 100 mm gsh), then removed 100 l of cocktail and its remaining placed 900 l of it into 1.5 ml cuvette . To zero spectrophotometer, was used 1 ml of distilled water and to the blank cuveet added 100l pbs to 900 l of cocktail and measured absorbance at 340 nm, every1 minute, for 3 min . To the test cuvette was added 100 l of sample to 900 l cocktail, mixed and measured absorbance at 340 nm as above (13). Sds - page and coomassie blue staining were used to separate and stain the protein components of samples respectively . Molecular weights of sample proteins were compared with respect to the protein marker (12). To detect the molecular weight, rf(ratio factor) of ladder bands was calculated, standard curve was prepared in excel software and finally proteins mw were determined . Independent t - test was performed to compare the mean values of protein concentration and enzyme activity between healthy and cystic liver tissues or parasite and liver tissues . Ten samples of parasites were obtained from 10 liver infected with hydatid cysts of sheep slaughtered at a localabattoir (karaj, iran). Parasites samples were washed 3 times with pbs buffer, ph 7.2, freeze - thawed 3 - 6 times in liquid nitrogen and and water bath 37c respectively and sonicated in a 150w ultrasonic disintegrator,10 sec on and 5 sec off on ice until no intact psc were visible microscopically (approximately 15 min). Then resulted suspension was centrifuged (10000 g for 30 min at 4c) and supernatant was stored at -20c (11). Sheep livers (10 health liver samples and 10 infected samples) were obtained at a local abattoir and washed 3 times with pbs buffer ph 7.2 . Then they were homogenized with 3 volumes of homogenizing buffer, pbs ph 6.5, in a glass homogenizer, so the suspension were centrifuged (10000 g for 30 minat 4c) and supernatant stored at -20c (12). The protein concentration in the extract solutions of protoscolices and sheep liver tissues were estimated by the method of bradford using bovine serum albumin as the standard (12). Gsts activity was assayed spectro photometrically at 25c with reduced glutathione (gsh) and 1-chloro-2, 4-dinitrobenzene (cdnb) as substrates . Protosolices and liver extract samples were removed from -20c freezer and allowed to thaw on ice . Cdnb 100 mm from 4c and gsh 100 mm from -20c freezer were removed and allowed to thaw at room temperature, when thawed, incubated at 30c in water bath . For each assay was prepared one ml of assay cocktail (980lpbs ph 6.5, 10l of 100 mm cdnb and 10 l of 100 mm gsh), then removed 100 l of cocktail and its remaining placed 900 l of it into 1.5 ml cuvette . To zero spectrophotometer, was used 1 ml of distilled water and to the blank cuveet added 100l pbs to 900 l of cocktail and measured absorbance at 340 nm, every1 minute, for 3 min . To the test cuvette was added 100 l of sample to 900 l cocktail, mixed and measured absorbance at 340 nm as above (13). Sds - page and coomassie blue staining were used to separate and stain the protein components of samples respectively . Molecular weights of sample proteins were compared with respect to the protein marker (12). To detect the molecular weight, rf(ratio factor) of ladder bands was calculated, standard curve was prepared in excel software and finally proteins mw were determined . Independent t - test was performed to compare the mean values of protein concentration and enzyme activity between healthy and cystic liver tissues or parasite and liver tissues . The mean values of protein concentrations and enzyme activities for parasite, healthy and infected liver samples are presented in table 1 . Protein concentration of healthy liver was higher than infected liver (p <0.05). Significant higher gst specific activities in cystic liver samples was observed as compared with healthy liver (p <0.05). Statistical t - test showed gst enzyme activity of parasite was lower than healthy liver tissues (p <0.05). Extract samples of protoscolices, healthy and cystic liver tissues were analyzed by sds - page electrophoresis and the results are shown in fig . 1 . Sds - page gel shows gst protein bands with 24kda in parasite and 25kda in healthy liver samples . Similar cross protein bands is observing in parasite and liver sample but has been not recorded by databse . The mean values of protein amounts and gsts activity for parasite, healthy and cystic liver samples molecular weight of proteins (kda) from the extracts of parasite and liver tissues in sds - page . Lanes 1 - 3 are healthy liver samples . Lanes 4 - 6 are cystic liver samples . Lanes 7 - 9 are parasite samples (protein marker, peqgold i, lot - no . 64072) identified proteins of parasite according to molecular weight by using protein database(http://web.expasy.org) identified proteins of sheep liver tissue according to molecular weight by using protein database(http://web.expasy.org) the mean values of protein concentrations and enzyme activities for parasite, healthy and infected liver samples are presented in table 1 . Protein concentration of healthy liver was higher than infected liver (p <0.05). Significant higher gst specific activities in cystic liver samples was observed as compared with healthy liver (p <0.05). Statistical t - test showed gst enzyme activity of parasite was lower than healthy liver tissues (p <0.05). Extract samples of protoscolices, healthy and cystic liver tissues were analyzed by sds - page electrophoresis and the results are shown in fig . 1 . Sds - page gel shows gst protein bands with 24kda in parasite and 25kda in healthy liver samples . Similar cross protein bands is observing in parasite and liver sample but has been not recorded by databse . The mean values of protein amounts and gsts activity for parasite, healthy and cystic liver samples molecular weight of proteins (kda) from the extracts of parasite and liver tissues in sds - page . Lanes 7 - 9 are parasite samples (protein marker, peqgold i, lot - no . 64072) identified proteins of parasite according to molecular weight by using protein database(http://web.expasy.org) identified proteins of sheep liver tissue according to molecular weight by using protein database(http://web.expasy.org) function of hepatocytesmay be disturbed in the presence of infections (15). In our study the reduction of protein synthesis as a result of hydatid cyst causes to decrease protein concentration . Gsts can make up to 10% of cytosolic protein in some mammalian organs (16). Hepatic cells contain high levels of gst enzyme which has been found to be an indicator of hepatocyte injury in transplantation, toxicity and infections (17). The hydatid cyst infection stimulates oxidative stress and toxin production in hepatic cells . From the point of biochemical defense view gst enzyme be able to neutralization of these toxins, therefore we expect to increase activity level of this enzyme . Increase of liver protein and gst in infected mice indicates the occurrence of oxidative stress in hepatocytes due to infection (18). Serum gsta is a more sensitive marker than transaminases (alanine aminotransferase, asparatate aminotransferase and alkaline transferase) for monitoring and as an early analyst of hepatic damage (19). Therefore gst activity difference between healthy and infected host liver tissue could be concerned for hydatid cyst diagnosis . However, other infections cause to hepatocyte damage, thus gst elevation must be evaluated with other clinical and paraclinical parameters of hydatid cyst disease . Mammalian cytosolic gsts are dimeric, with both subunits being from the same class of gsts, although not necessarily identical . Gst enzyme molecular weight of parasite is reported 24 - 27 kda (13). In this research protein bands with 24kda and 25kda were found in parasite and liver tissues respectively . Gst activity in cystic liver tissue could be concerned as a biomarker for hydatid cyst diagnosis with other parameters of hydatidosis.
|
The risk of stroke and myocardial infarction is considerably increased in subjects with diabetes . Already at the time of diagnosis of type 2 diabetes, many patients have manifest cardiovascular disease (cvd). This could be due to a long presymtomatic period with increased glucose level as evident by the increased cvd risk already present with impaired glucose tolerance (igt). Thus, interest has focused on factors, not only glucose levels, in the prediabetic state that would increase the atherothrombotic process . A common, possibly genetic, antecedent of both type 2 diabetes and cvd has been proposed as the " common soil " hypotheses . Recently, markers of inflammation, such as highly sensitive c - reactive protein, have been found to predict type 2 diabetes in long - time follow up of population samples, although adjusting for measurements of obesity attenuates the relationship [8 - 12]. Such markers are weakly related to variables reflecting endothelial function such as adhesion molecules and von willebrant factor . In a large population - based study, also increased plasma levels of plasminogen activator inhibitor-1 (pai-1) were strongly related to the development of diabetes independent from insulin resistance and obesity . The possibility of elevated pai-1 being a very early risk marker of the insulin resistance syndrome and diabetes was raised . Furthermore, haemostatic variables related to endothelial function, such as von willebrant factor and factor viii, also predicted diabetes, especially in women . Data are lacking regarding other aspects of the fibrinolytic system and the development of diabetes, such as the activities of pai-1 and tissue plasminogen activator (tpa) or the mass concentration of the endothelial - derived tpa (" tpa antigen "), factors related to cvd [15 - 19] thus, there are two questions related to fibrinolytic variables and the development of diabetes . Firstly, do subjects with normal glucose tolerance, who later convert to diabetes, have disturbances in the fibrinolytic system and endothelial function that could explain their increased risk of cvd even before diabetes ensues? If so, do these changes predict future diabetes, independent of the influence of the insulin resistance syndrome, thereby pointing to other pathways to the diabetic state such as endothelial dysfunction? We studied fibrinolytic activity, as measured by tpa and pai-1 activity, and a marker of endothelial dysfunction, as measured by tpa antigen, in a population sample with normal glucose tolerance at baseline and analysed data according to conversion to diabetes or not over nine years of follow - up . This study was performed within the framework of the northern sweden monica study . In 1990 a total of 2,000 randomly selected subjects aged 25 to 64 years were invited . In all, 1,583 persons participated (79.2%). A 75-gram oral glucose tolerance test (ogtt) was performed after an overnight fast in a randomly selected subset of subjects without known diabetes . Venous plasma glucose samples were analysed by the hexokinase method (boehringer mannheim automated analysis for bm / hitachi system 717). Glucose tolerance was classified according to who criteria from 1999: normal glucose tolerance (ngt) fasting glucose <7 mmol / l and post load glucose <7.8 mmol / l, impaired glucose tolerance (igt) fasting glucose <7 mmol / l and post load glucose 7.811.0 mmol / l, and diabetes fasting glucose 7.0 weight was measured with a balance scale to the nearest 0.2 kg, and height was measured to the nearest centimetre . Bmi was calculated as total body weight (kg) / height (m). Waist circumference was measured midway between the lower rib margin and the iliac crest, which in most occasions was identical with the level of the umbilicus . All measurements were done in a standing position while breathing normally, and participants were asked to wear light underwear and remove shoes . For the measurement of waist circumference, the recording was done after a gentle breath - out . Tpa and pai-1 activities were determined by chromogenic assays, spectrolyse / fibrin and spectrolyse / pl kit (biopool ab, ume, sweden), respectively . Tpa antigen was measured by an enzyme - linked immunosorbent assay method (tintelize tpa, biopool ab). Serum insulin was determined by radio immunoassay with a double - antibody solid - phase technique (phadaseph insulin ria, pharmacia diagnostics ab, uppsala, sweden) in 1999, all participants, alive and still living in the area, were recalled for a follow - up examination . The same questionnaire and anthropometrical measurements as in the baseline survey were used . Altogether 1,148 (72.5%) subjects turned up for re - examination . Subjects who previously had performed an ogtt with normal or impaired glucose tolerance, and answered no to the question " participants, who denied having diabetes in the baseline survey and answered affirmative to the question " do you have diabetes mellitus? " At follow up, were defined as incident cases of known diabetes mellitus according tho the who criteria from 1999 . In november 2002, a questionnaire exploring details related to the diagnosis of diabetes, and to the type and duration of current hypoglycaemic treatment was sent to them . Case records were scrutinised to confirm diabetes diagnosis and time for start of insulin therapy . Subjects that started their insulin treatment within two years of diagnosis were classified as type 1 . However, for subjects fulfilling these criteria but with a age of 40 or above at onset, current bmi had to be <27 to be classified as type 1 . The research ethics committee of ume university and the national computer data inspection board have approved the northern sweden monica study . Means or medians are given for those who remained non - diabetic and those who converted to diabetes . Because the distributions for serum triglycerides, insulin and the fibrinolytic variables are highly skewed, we used logarithmically transformed values (i.e. Geometric means). The risk of incident diabetes was compared across quartiles of the fibrinolytic variables, calculated from the total sample . Logistic regression was used for calculation of odds ratios and 95% confidence intervals (ci) for the development of diabetes comparing the quartile with highest risk with the other three pooled quartiles . Stepwise adjustment for age and sex, waist, serum insulin, triglycerides and diastolic blood pressure was used . Five hundred and fifty - one subjects who initially had normal glucose tolerance returned for re - examination . A new ogtt was done in 477 of those with normal glucose tolerance and without clinically diagnosed diabetes . Thus, there was no repeated ogtt in 13%, mostly due to logistic reasons such as not being able to turn up in the morning after an over night fast . Among persons with initially normal glucose tolerance, in all 15 subjects (2.7%) had type 2 diabetes diagnosed, either clinically (n = 4) or by ogtt (n = 11) after a 9-year follow - up or 4,959 person years . Fifty - one subjects (10,7%) worsened from normal glucose tolerance to impaired glucose tolerance . Converters from ngt to diabetes were 7 years older and had higher bmi and waist circumference . Diastolic blood pressure did not differ but both fasting triglycerides, insulin, fasting and post load plasma glucose were higher in subjects with subsequent diabetes . Plasma levels of tpa antigen and pai-1 activity were higher and tpa activity was lower . Baseline characteristics of subjects with normal glucose tolerance according to diabetes or not during 9 years of follow - up data are means (sd), median (interquartile range) and [geometric means]. The risk of developing diabetes increased with increasing quartiles of tpa antigen and pai-1 activity and decreased in a similar way for tpa activity (figure 1). In the highest quartile of tpa antigen (above 8.7 g / l) nearly 9% had incident diabetes compared to none in the lowest quartile . Incidence of type 2 diabetes over nine years in subjects with normal glucose tolerance according to baseline quartiles of fibrinolytic variables . The number of cases in each quartile for tpa activity was 7, 4, 3 and 1 . Corresponding numbers for tpa antigen was 0, 1, 2 and 12 and for pai-1 activity 2, 1, 3 and 9, respectively . P values for x(linear by linear association) were 0.026 for tpa activity, <0,001 for tpa antigen and 0,007 for pai-1 activity . Logistic regression was performed with an initial model adjusting for age and sex . In a second model, waist circumference was added and in a third model, also diastolic blood pressure, serum insulin and triglycerides were added . Quartiles 13 of tpa antigen and pai-1 activity were contrasted with the fourth quartile and, for tpa activity, the first quartiles with quartile 24 (table 2). Logistic regression analysis for fibrinolytic variables at baseline with incident type 2 diabetes as the dependent variable . The lowest quartile of tpa activity was associated with a 3-fold increase in the risk of diabetes, which was attenuated after adjustment for waist circumference . After further adjustment for diastolic blood pressure, fasting insulin and triglycerides, no prediction from low tpa activity on diabetes development was seen . Subjects in the highest quartile of tpa antigen experienced more than a ten - fold increase in risk, although the confidence intervals were wide due to few cases . Taking waist circumference into account, the odds ratio diminished to 6.7 and diminished further to 5.5 when adjusting for blood pressure, triglycerides and insulin . This lead to somewhat higher age- and gender adjusted odds ratio (7.4; ci 1.830, p value 0.005). Exchanging diastolic with systolic blood pressure did not change the findings . Furter adjustment for leisure time physical activity reduced the odds ratio from 5.5 to 5.1 (p value 0.03). High pai-1 activity increased the risk of diabetes four - fold, although the result was attenuated to an insignificant or of 2.0 when all factors were adjusted for simultaneously . The risk of developing diabetes or igt during follow up (n = 66) increased stepwise across quartiles of tpa antigen, from 7.8% to 19.8% (p = 0,003, test for linear trend). When adjusted for age and sex, the odds ratio for the highest vs. the three lower quartiles of tpa antigen was 1.9 (ci 1.011.6, p = 0.04) but diminished further when also waist circumference was adjusted for, or = 1.3 (ci 0.636.5, p = 0.5). Subjects with normal glucose tolerance, who subsequently develop type 2 diabetes over the ensuing nine years, are already at baseline characterised by impaired fibrinolysis and endothelial dysfunction . Low tpa activity and high pai-1 activity is mainly explained by the presence of abdominal obesity but also by other metabolic disturbances characteristic of the insulin resistance syndrome, such as high serum levels of triglycerides and insulin . A novel finding, in this context, is that a high plasma level of the endothelial - derived tpa is only slightly explained by such factors . Thus, the development of type 2 diabetes is preceded by many years of perturbations in fibrinolytic and endothelial function, which increases the risk of atherothrombotic disease long before overt diabetes is present . Pa1 - 1 is partly synthesised in fat cells and its activity is strongly related to abdominal obesity as mirrored by high waist circumference or whr . High circulating levels of pai-1 inhibit tpa released from the vessel walls and lead to low levels of free tpa, i.e. Low tpa activity and impaired capability of thrombolysis . The only report of an association between fibrinolysis and the development of diabetes is a recent study where pai-1 antigen was an independent predictor of diabetes in american - mexicans that were followed up to 5 years . There is no known pathway whereby impaired fibrinolysis would increase insulin resistance or decrease insulin release and our finding that high pai-1 and low tpa activity precedes diabetes probably mirrors the strong relationship with intraabdominal fat and circulating levels of free fatty acids . A recent experimental study show an almost three fold increase in the level of pai-1 antigen with an infusion of triacylglycerol in healthy subjects without any impact on tpa . This effect was noted with constant levels of insulin and glucose and also increased levels of soluble vascular cell adhesion molecules-1 was found . This support our findings that adjustment for baseline triglyceride levels, which were increased in converters, did not significantly change the relationships noted for tpa antigen but did decrease those for pai-1 . It is thus possible that also tpa concentration is an inflammatory marker although we found low correlations between tpa antigen and fibrinogen and highly sensitive crp (own unpublished data). Recently, it was described in type 2 diabetes patients, that increased levels of tpa antigen, among other endothelial markers, predicted the development of urinary albumin excretion, a strong marker for cvd risk . These findings should be related to recent reports where inflammatory markers predict the development of diabetes in longitudinal studies . In most cases, pro - inflammatory substances derived from abdominal fat tissue may be the common background for these findings . We therefore find it plausible that the relation between high tpa and diabetes is a marker of some early disturbance in the vascular wall that operates independent of obesity and inflammation . Already borderline hypertension is associated with high concentrations of tpa antigen, even after adjustment for abdominal obesity, insulin and triglycerides . Thus, tpa mass may mirror an endothelial dysfunction that is not causally related to the insulin resistance syndrome but acts by a parallel pathogenetic mechanism leading to atherothrombosis [30 - 32]. Insulin resistance, on the other hand, is associated with endothelial dysfunction and impaired vasodilatation due to defects in endothelium - derived nitric oxide . Taken together, these findings put focus on the role of the vessel walls in the pathogenesis of type 2 diabetes . The relevance of impaired fibrinolysis, i.e. Low activity of tissue plasminogen activator (tpa) or high activity of its inhibitor (pai-1), as independent risk factors for cvd is unclear, as these variables seem to mirror most components of the insulin resistance syndrome . In some studies, decreased fibrinolysis, as measured by high pai-1 activity, has been associated with cardiovascular events . High levels of tpa antigen independently predict cardiovascular events both in a healthy population and in patients with prevalent coronary disease . The major shortcoming of our study is the small number of incident cases of diabetes leading to wide confidence intervals . On the other hand, the odds ratios for tpa antigen are high and consistent and based on a truly representative population sample where basal normal glucose tolerance was well defined, as were the incident cases of diabetes . Thus, the risk of bias due to selection or case ascertainment should be low . Admittedly, the lack of a renewed ogtt in 13% of the subjects could contribute to some misclassifiaction and dilute the results somewhat . The early prediabetic state, with normal glucose tolerance, is characterised by both impaired fibrinolysis and endothelial dysfunction years before glucose levels increase . Changes in endothelial function are independent from the insulin resistance syndrome and point towards a distinctly different pathway both for cardiovascular disease and for the development of diabetes . To answer a classical question from 1990 yes, the clock for coronary heart disease seems to start ticking before the onset of clinical diabetes! Bmi = body mass index ci = confidence interval crp = c - reactive protein cvd = cardiovascular disease igt = impaired glucose tolerance monica = monitoring of trends and determinants of cardiovascular disease ngt = normal glucose tolerance ogtt = oral glucose tolerance test pai-1 = plasminogen activator inhibitor-1 tpa = tissue plasminogen activator me drafted the research on fibrinolysis within the monica project, performed the statistical analysis and drafted the manuscript . Bs and bl participated in the design of northern sweden monica study and participated in its design and coordination . Supported by grants from norrbotten and vsterbotten counties, by the joint committee of northern sweden health care region, the swedish public health institute and the swedish medical research council.
|
Selective serotonin reuptake inhibitors (ssris), serotonin and norepinephrine reuptake inhibitors, and noradrenergic and specific serotonergic antidepressants are categorized as first - line treatments in many countries, including japan.1,2 thus, health care providers have the opportunity to choose an antidepressant from a variety of first - line treatment options . To select the most appropriate treatment for each patient, it is important for clinicians to be aware of the differences in efficacy between comparable antidepressants at the doses approved in their countries . One long - standing approach to comparing efficacy has been meta - analysis of several randomized controlled trials that compare widely used treatments.310 however, results have been inconsistent, perhaps partly due to the use of different methodologies . Recent meta - analyses have used mixed treatment comparisons in which both direct and indirect comparisons were used.11,12 duloxetine, a second - generation norepinephrine reuptake inhibitor that has demonstrated efficacy, safety, and tolerability in patients with mdd,1316 has been the subject of several recent mixed treatment comparisons . A recent analysis by cipriani et al12 compared the effects of 12 new - generation antidepressants in adults with mdd, and gartlehner et al11 conducted an analysis of 234 studies that included placebo as a comparator . However, these results are not applicable to clinical practice in japan, because they included data from patients taking duloxetine up to 120 mg / day, which is twice the maximum dosage (60 mg / day) approved in japan . Another drawback was the inclusion of patients who took antidepressants not approved or not even available for use in japan . Therefore, it is uncertain whether these results can be applied to daily clinical practice in countries (eg, japan) where the approved dosage for duloxetine is 4060 mg / day and ssris are limited to four compounds, ie, paroxetine, sertraline, escitalopram, and fluvoxamine . To the best of our knowledge, there are no meta - analyses that compare the efficacy of duloxetine 60 mg / day with these ssris . The primary purpose of the current study was to provide clinicians with efficacy results that would allow a comparison of duloxetine 60 mg / day with four approved ssris in japan . The eli lilly clinical trial database contains all clinical trials of duloxetine for patients with mdd that were conducted by eli lilly or its partners outside of japan . We reviewed this database and selected randomized controlled trials that included duloxetine and ssri for the acute treatment of mdd . For the ssri selection, four ssris that were approved in japan for the treatment of mdd (eg, paroxetine, sertraline, escitalopram, and fluvoxamine as of july 2014) were included . As a result, a total of four studies (three studies on duloxetine 40 or 80 mg / day versus paroxetine 20 mg / day and one study on duloxetine 60 mg / day versus escitalopram 10 mg / day) were selected (table 1). As a next step, patients who received more than the approved daily dose ranges in japan (duloxetine 80 mg / day) were excluded from the analysis . No studies meeting the criterion for comparison were excluded . Common inclusion criteria for the included studies (hmat a, hmat b, hmcv, hmcr) were as follows: male or female outpatients aged at least 18 years who met dsm - iv (diagnostic and statistical manual for mental disorders, 4th edition)17 criteria for nonpsychotic mdd and had a clinical global impression score 4, a 17-item hamilton rating scale for depression (hamd17) total score 15, or a montgomery sberg depression rating scale score 22 . The hmat study (groups a and b) was a multicenter, parallel, double - blind, randomized, placebo - controlled and active comparator - controlled study with a blinded placebo lead - in and placebo lead - out . The primary objective was to assess mean changes in hamd17 total score from baseline to endpoint (week 8). The treatments were duloxetine 40 or 80 mg / day, paroxetine 20 mg / day, or placebo . The hmcv study was a multicenter, randomized, double - blind, double - dummy, parallel, active treatment - controlled phase iii trial comparing the efficacy and safety of duloxetine 60 mg / day and paroxetine 20 mg / day for inpatients and outpatients with mdd . The study included 8 weeks of active treatment followed by a one - week dose - tapering period . The primary objective of the study was to determine whether duloxetine 60 mg / day was noninferior to paroxetine 20 mg / day in the acute treatment of patients with mdd, as assessed by the baseline - to - endpoint change in hamd17 total score over an 8-week period.13 the hmcr study was a multicenter, randomized, 8-month, placebo - controlled, double - blind study that evaluated the comparative efficacy of duloxetine and escitalopram for patients with mdd.14,15 the primary objective was to compare the onset of antidepressant efficacy for patients taking duloxetine 60 mg / day or escitalopram 10 mg / day . This objective was evaluated by testing the hypothesis that the percentage of patients taking duloxetine who met onset criteria at week 2 was not inferior to (or at least as good as) the percentage of patients taking escitalopram . The primary endpoint was mean change from baseline in hamd17 total score at week 8 . Secondary endpoints were mean change in hamd17 subscale score, response rate, remission rate, and mean change in hamilton anxiety rating scale (hama) total score from baseline to week 8 . Response was defined as a 50% reduction in hamd17 total score from baseline at week 8 . Our analyses included two groups: all randomized patients who had a hamd17 total score 15 and a subgroup of more severe patients who had a hamd17 total score 19 . This division was included because some studies suggest that patients with severe symptoms may have different treatment needs.4,18 hamd17 items include (1) depressive mood; (2) feelings of guilt; (3) suicide; (4) early insomnia; (5) middle insomnia; (6) late insomnia; (7) work and activities; (8) psychomotor retardation; (9) agitation; (10) psychic anxiety; (11) somatic anxiety; (12) somatic symptoms gastrointestinal; (13) general somatic symptoms; (14) genital symptoms; (15) hypochondriasis; (16) weight loss; and (17) insight.19 five hamd17 subscales were used for the subgroup analysis: bech (items 1, 2, 7, 8, 10, 13) and maier (1, 2, 7, 8, 9, 10), comprising items generally considered to be the core symptoms of depression; retardation (items 1, 7, 8, 14), evaluating the degree of energy and interest levels; sleep (items 4, 5, 6) assessing the degree of insomnia; and anxiety / somatization (items 10, 11, 12, 13, 15, 17) and hama total score, assessing anxiety.1923 for the analysis of primary and secondary endpoints, missing data were imputed using the last observation carried forward approach . Continuous variables were calculated using analysis of covariance based on last observation carried forward values as follows: one analysis of covariance model was calculated for each study (counting the groups a and b of the hmat study as two studies), with a fixed effect for investigator, treatment, and baseline score as covariates . Effect sizes in each model were calculated using least squares mean differences divided by the standard deviation of the residuals provided by the model of this study . Overall least squares mean estimates and effect sizes were calculated as a weighted mean of the corresponding estimates in all studies, with weights based on within - study variance, assuming a fixed study effect . The binary outcomes were analyzed using the cochran - mantel - haenszel test adjusted for study . Relative risk is presented with 95% confidence intervals (ci) and p - values . The odds ratio (or) was adjusted for the study by calculating the ors within each study and then weighting these ors across studies . Absolute numbers and averages were not adjusted for study and therefore cannot be directly compared with the ors . Safety and tolerability measures included patient - reported treatment - emergent adverse events and overall rates of study discontinuation due to adverse events . Reasons for discontinuation from the study were listed and treatment - emergent adverse events were reported using the medical dictionary for regulatory activities terminology . Safety was analyzed by treatment descriptive statistics, and categorical safety measures were evaluated using fisher s exact test . The eli lilly clinical trial database contains all clinical trials of duloxetine for patients with mdd that were conducted by eli lilly or its partners outside of japan . We reviewed this database and selected randomized controlled trials that included duloxetine and ssri for the acute treatment of mdd . For the ssri selection, four ssris that were approved in japan for the treatment of mdd (eg, paroxetine, sertraline, escitalopram, and fluvoxamine as of july 2014) were included . As a result, a total of four studies (three studies on duloxetine 40 or 80 mg / day versus paroxetine 20 mg / day and one study on duloxetine 60 mg / day versus escitalopram 10 mg / day) were selected (table 1). As a next step, patients who received more than the approved daily dose ranges in japan (duloxetine 80 mg / day) were excluded from the analysis . No studies meeting the criterion for comparison were excluded . Common inclusion criteria for the included studies (hmat a, hmat b, hmcv, hmcr) were as follows: male or female outpatients aged at least 18 years who met dsm - iv (diagnostic and statistical manual for mental disorders, 4th edition)17 criteria for nonpsychotic mdd and had a clinical global impression score 4, a 17-item hamilton rating scale for depression (hamd17) total score 15, or a montgomery sberg depression rating scale score 22 . The hmat study (groups a and b) was a multicenter, parallel, double - blind, randomized, placebo - controlled and active comparator - controlled study with a blinded placebo lead - in and placebo lead - out . The primary objective was to assess mean changes in hamd17 total score from baseline to endpoint (week 8). The treatments were duloxetine 40 or 80 mg / day, paroxetine 20 mg / day, or placebo . The hmcv study was a multicenter, randomized, double - blind, double - dummy, parallel, active treatment - controlled phase iii trial comparing the efficacy and safety of duloxetine 60 mg / day and paroxetine 20 mg / day for inpatients and outpatients with mdd . The study included 8 weeks of active treatment followed by a one - week dose - tapering period . The primary objective of the study was to determine whether duloxetine 60 mg / day was noninferior to paroxetine 20 mg / day in the acute treatment of patients with mdd, as assessed by the baseline - to - endpoint change in hamd17 total score over an 8-week period.13 the hmcr study was a multicenter, randomized, 8-month, placebo - controlled, double - blind study that evaluated the comparative efficacy of duloxetine and escitalopram for patients with mdd.14,15 the primary objective was to compare the onset of antidepressant efficacy for patients taking duloxetine 60 mg / day or escitalopram 10 mg / day . This objective was evaluated by testing the hypothesis that the percentage of patients taking duloxetine who met onset criteria at week 2 was not inferior to (or at least as good as) the percentage of patients taking escitalopram . The primary endpoint was mean change from baseline in hamd17 total score at week 8 . Secondary endpoints were mean change in hamd17 subscale score, response rate, remission rate, and mean change in hamilton anxiety rating scale (hama) total score from baseline to week 8 . Response was defined as a 50% reduction in hamd17 total score from baseline at week 8 . Our analyses included two groups: all randomized patients who had a hamd17 total score 15 and a subgroup of more severe patients who had a hamd17 total score 19 . This division was included because some studies suggest that patients with severe symptoms may have different treatment needs.4,18 hamd17 items include (1) depressive mood; (2) feelings of guilt; (3) suicide; (4) early insomnia; (5) middle insomnia; (6) late insomnia; (7) work and activities; (8) psychomotor retardation; (9) agitation; (10) psychic anxiety; (11) somatic anxiety; (12) somatic symptoms gastrointestinal; (13) general somatic symptoms; (14) genital symptoms; (15) hypochondriasis; (16) weight loss; and (17) insight.19 five hamd17 subscales were used for the subgroup analysis: bech (items 1, 2, 7, 8, 10, 13) and maier (1, 2, 7, 8, 9, 10), comprising items generally considered to be the core symptoms of depression; retardation (items 1, 7, 8, 14), evaluating the degree of energy and interest levels; sleep (items 4, 5, 6) assessing the degree of insomnia; and anxiety / somatization (items 10, 11, 12, 13, 15, 17) and hama total score, assessing anxiety.1923 for the analysis of primary and secondary endpoints, missing data were imputed using the last observation carried forward approach . Continuous variables were calculated using analysis of covariance based on last observation carried forward values as follows: one analysis of covariance model was calculated for each study (counting the groups a and b of the hmat study as two studies), with a fixed effect for investigator, treatment, and baseline score as covariates . Effect sizes in each model were calculated using least squares mean differences divided by the standard deviation of the residuals provided by the model of this study . Overall least squares mean estimates and effect sizes were calculated as a weighted mean of the corresponding estimates in all studies, with weights based on within - study variance, assuming a fixed study effect . The binary outcomes were analyzed using the cochran - mantel - haenszel test adjusted for study . Relative risk is presented with 95% confidence intervals (ci) and p - values . The odds ratio (or) was adjusted for the study by calculating the ors within each study and then weighting these ors across studies . Absolute numbers and averages were not adjusted for study and therefore cannot be directly compared with the ors . Safety and tolerability measures included patient - reported treatment - emergent adverse events and overall rates of study discontinuation due to adverse events . Reasons for discontinuation from the study were listed and treatment - emergent adverse events were reported using the medical dictionary for regulatory activities terminology . Safety was analyzed by treatment descriptive statistics, and categorical safety measures were evaluated using fisher s exact test . At baseline, patients were mostly middle - aged (mean age 40.842.0 years), female (range 63.8%67.4%), with mean hamd17 total scores ranging from 17.6 to 19.0 and mean hama total scores ranging from 14.4 to 15.8 . The majority of patients were caucasian; patients from east asia accounted for approximately 30% of duloxetine - treated and ssri - treated patients (table 2). Completion rates were approximately 70% (68.6% for duloxetine - treated patients, 72.3% for ssri - treated patients, and 66.8% for placebo - treated patients). Adverse events were common reasons for discontinuation (duloxetine - treated patients, 8.9%; ssri - treated patients, 7.1%; placebo - treated patients, 6.0%; see table 3). Discontinuation due to lack of efficacy was more likely in placebo - treated patients than in duloxetine - treated or ssri - treated patients (13.3% versus 3.2% and 3.2%, respectively). A comparison of the mean changes in hamd17 total, subscale scores and hama total score from baseline at week 8 (last observation carried forward) is shown in table 4; corresponding effect sizes are shown in figure 1 . In the total population, no statistically significant differences were found in the mean change in hamd17 total score at week 8 between duloxetine - treated and ssri - treated patients (10.08 and 9.69, respectively). However, the differences between duloxetine versus placebo and ssri versus placebo were statistically significant (p<0.01). Duloxetine and ssri were comparable on most other efficacy measures; however, duloxetine - treated patients showed a greater mean change from baseline in hamd17 retardation subscale score compared with ssri - treated patients (least squares mean difference [95% ci]) (0.33 [0.60, 0.07]). For the more severe subgroup with hamd17 total scores 19 at baseline, again statistically significant differences were found in mean change in hamd17 total scores at week 8, but greater efficacy for duloxetine was seen with the bech, maier, and retardation subscale scores compared with ssris: hamd17 bech (0.62 [1.16, 0.08]), hamd17 maier (0.65 [1.18, 0.12]), and hamd17 retardation (0.45 [0.83, 0.07]). In the total population, hamd17 total score effect sizes for duloxetine and ssri versus placebo were comparable (0.260 and 0.256, respectively). These were seen on the retardation subscales for the total population (0.337 versus 0.191, respectively) in the more severe population (0.409 versus 0.154, respectively), and on the bech and maier subscales for the more severe population (figure 1). The response rates at week 8 were 42.0% for the duloxetine - treated patients, 44.5% (n=307) for the ssri - treated patients, and 24.4% (n=77) for the placebo - treated patients . No statistically significant difference was found between the duloxetine - treated and ssri - treated patients (or 1.05; 95% ci 0.801.37). Statistically significant differences were shown for the duloxetine - treated versus placebo - treated patients (or 1.61; 95% ci 1.112.33) and the ssri - treated versus placebo - treated patients (or 1.83; 95% ci 1.272.64). The remission rates at week 8 were 35.2% for the duloxetine - treated patients, 36.1% (n=249) for the ssri - treated patients, and 21.2% (n=67) for the placebo - treated patients . No statistically significant differences were found at week 8 for the duloxetine - treated versus ssri - treated patients (or 1.11; 95% ci 0.641.92), the duloxetine - treated versus placebo - treated patients (or 1.53; 95% ci 0.743.18), or the ssri - treated versus placebo - treated patients (or 1.60; 95% ci 0.773.33). The most common treatment - emergent adverse events are summarized in table 5 . Among duloxetine - treated patients, nausea (25.7%), dry mouth (17.3%), dizziness (12.6%), constipation (11.0%), and decreased appetite (11.9%) had a higher incidence than in placebo - treated patients, but the rates of these adverse events were similar between duloxetine - treated and ssri - treated patients except for nausea and dry mouth . At baseline, patients were mostly middle - aged (mean age 40.842.0 years), female (range 63.8%67.4%), with mean hamd17 total scores ranging from 17.6 to 19.0 and mean hama total scores ranging from 14.4 to 15.8 . The majority of patients were caucasian; patients from east asia accounted for approximately 30% of duloxetine - treated and ssri - treated patients (table 2). Completion rates were approximately 70% (68.6% for duloxetine - treated patients, 72.3% for ssri - treated patients, and 66.8% for placebo - treated patients). Adverse events were common reasons for discontinuation (duloxetine - treated patients, 8.9%; ssri - treated patients, 7.1%; placebo - treated patients, 6.0%; see table 3). Discontinuation due to lack of efficacy was more likely in placebo - treated patients than in duloxetine - treated or ssri - treated patients (13.3% versus 3.2% and 3.2%, respectively). A comparison of the mean changes in hamd17 total, subscale scores and hama total score from baseline at week 8 (last observation carried forward) is shown in table 4; corresponding effect sizes are shown in figure 1 . In the total population, no statistically significant differences were found in the mean change in hamd17 total score at week 8 between duloxetine - treated and ssri - treated patients (10.08 and 9.69, respectively). However, the differences between duloxetine versus placebo and ssri versus placebo were statistically significant (p<0.01). Duloxetine and ssri were comparable on most other efficacy measures; however, duloxetine - treated patients showed a greater mean change from baseline in hamd17 retardation subscale score compared with ssri - treated patients (least squares mean difference [95% ci]) (0.33 [0.60, 0.07]). For the more severe subgroup with hamd17 total scores 19 at baseline, again statistically significant differences were found in mean change in hamd17 total scores at week 8, but greater efficacy for duloxetine was seen with the bech, maier, and retardation subscale scores compared with ssris: hamd17 bech (0.62 [1.16, 0.08]), hamd17 maier (0.65 [1.18, 0.12]), and hamd17 retardation (0.45 [0.83, 0.07]). In the total population, hamd17 total score effect sizes for duloxetine and ssri versus placebo were comparable (0.260 and 0.256, respectively). These were seen on the retardation subscales for the total population (0.337 versus 0.191, respectively) in the more severe population (0.409 versus 0.154, respectively), and on the bech and maier subscales for the more severe population (figure 1). The response rates at week 8 were 42.0% for the duloxetine - treated patients, 44.5% (n=307) for the ssri - treated patients, and 24.4% (n=77) for the placebo - treated patients . No statistically significant difference was found between the duloxetine - treated and ssri - treated patients (or 1.05; 95% ci 0.801.37). Statistically significant differences were shown for the duloxetine - treated versus placebo - treated patients (or 1.61; 95% ci 1.112.33) and the ssri - treated versus placebo - treated patients (or 1.83; 95% ci 1.272.64). The remission rates at week 8 were 35.2% for the duloxetine - treated patients, 36.1% (n=249) for the ssri - treated patients, and 21.2% (n=67) for the placebo - treated patients . No statistically significant differences were found at week 8 for the duloxetine - treated versus ssri - treated patients (or 1.11; 95% ci 0.641.92), the duloxetine - treated versus placebo - treated patients (or 1.53; 95% ci 0.743.18), or the ssri - treated versus placebo - treated patients (or 1.60; 95% ci 0.773.33). The most common treatment - emergent adverse events are summarized in table 5 . Among duloxetine - treated patients, nausea (25.7%), dry mouth (17.3%), dizziness (12.6%), constipation (11.0%), and decreased appetite (11.9%) had a higher incidence than in placebo - treated patients, but the rates of these adverse events were similar between duloxetine - treated and ssri - treated patients except for nausea and dry mouth . Our results show that duloxetine and ssri treatment within their respective approved dosage in japan demonstrated comparable efficacy with regard to overall depressive symptoms . However, certain hamd17 subscale scores responded differently to duloxetine compared with ssris, and this may clarify the difference in clinical attributes among these antidepressants . First, when assessing overall efficacy using the mean changes in hamd17 total scores from baseline, both duloxetine and ssri demonstrated greater efficacy than placebo, but did not indicate any significant difference between each other for either the total population (hamd17 total score 15) or the more severe population (hamd17 total score 19). On the one hand, this is consistent with a prior report by thase et al,4 where all randomized patients across any severity were analyzed and no significant difference in efficacy between duloxetine and ssri was found . However, on the other hand, this is inconsistent with prior reports that duloxetine 120 mg / day showed greater efficacy than ssris in patients with at least moderately severe depression.4,16 given this and the finding of a modest dose response trend for duloxetine efficacy by mallinckrodt et al16 this inconsistency may be explained by the upper limit on the dosage of duloxetine (60 mg / day) in this study . Second, when assessing energy and interest using retardation subscale scores, duloxetine showed greater efficacy regardless of baseline depression severity (hamd17 total score 15 or 19). This is consistent with previous reports by mallinckrodt et al16 and martinez et al.24 furthermore, katz et al25 reported that desipramine (a norepinephrine reuptake inhibitor) demonstrated better efficacy than paroxetine (an ssri) on psychomotor retardation symptoms . These results may be explained by the effect of duloxetine on norepinephrine, which has been shown to be associated with arousal and activity.26 the current results show some inconsistency with a report by cipriani et al in which some ssris were significantly more efficacious than duloxetine . This is partly due to the different methodologies used in that study and in our current study . In cipriani et al,12 approximately one third of the comparisons were direct comparisons from randomized controlled trials and many of the pairwise comparisons were based on only one study . Degree of heterogeneity and statistical incoherence (estimates based on the direct comparisons are not contained in the 95% ci for indirect comparisons) in the study network were detected . Study conclusions based on direct comparisons were much more conservative than those based on indirect ones . On the other hand, the strengths of this database analysis are that it analyzed individual patient data, used the same analysis method and endpoint across studies, and included similar patients . The adopted database analysis design allowed for a homogeneous patient population, with almost the same inclusion criteria and the exact same endpoint . Although our analysis resulted in a comparatively smaller number of studies and patients, it achieved high internal validity and reproducibility . In addition, direct comparisons of head - to - head data enabled us to avoid the uncertainty of how much the two different evidence levels are weighted when pooling direct and indirect comparisons . The integrated database only included studies that were conducted by eli lilly or its partners outside japan; therefore, sponsorship bias cannot be fully mitigated . Using this database resulted in inclusion of fewer studies than publication - based meta - analyses; however, this methodology enabled us to analyze individual patient data that are not available in many publications . Similarly, using this global database resulted in inclusion of caucasians as the majority (58.3%) of the patient population . Another limitation of this meta - analysis is that it only consisted of two ssris (paroxetine and escitalopram) although four ssris are available in japan . Furthermore, ssri doses used in this analysis (paroxetine 20 mg / day and escitalopram 10 mg / day) were at the lower approved dosage in japan (2040 mg / day for paroxetine, and 1020 mg / day for escitalopram), whereas the duloxetine doses used in this analysis (40 mg / day or 60 mg / day) were the dosages approved in japan . Further research that includes all available ssris using flexible dosing within their full therapeutic ranges will make it possible to generalize conclusions to the ssri group as a whole . In addition, the exclusion of patients randomized to duloxetine> 60 mg / day limits the ability to generalize conclusions in some countries with approved dosages above a maximum of 60 mg / day, but this was not within the scope of our analysis . Lastly, in these analyses, no correction for multiplicity was performed, so superiority based on p - values cannot be assessed . The integrated database only included studies that were conducted by eli lilly or its partners outside japan; therefore, sponsorship bias cannot be fully mitigated . Using this database resulted in inclusion of fewer studies than publication - based meta - analyses; however, this methodology enabled us to analyze individual patient data that are not available in many publications . Similarly, using this global database resulted in inclusion of caucasians as the majority (58.3%) of the patient population . Another limitation of this meta - analysis is that it only consisted of two ssris (paroxetine and escitalopram) although four ssris are available in japan . Furthermore, ssri doses used in this analysis (paroxetine 20 mg / day and escitalopram 10 mg / day) were at the lower approved dosage in japan (2040 mg / day for paroxetine, and 1020 mg / day for escitalopram), whereas the duloxetine doses used in this analysis (40 mg / day or 60 mg / day) were the dosages approved in japan . Further research that includes all available ssris using flexible dosing within their full therapeutic ranges will make it possible to generalize conclusions to the ssri group as a whole . In addition, the exclusion of patients randomized to duloxetine> 60 mg / day limits the ability to generalize conclusions in some countries with approved dosages above a maximum of 60 mg / day, but this was not within the scope of our analysis . Lastly, in these analyses, no correction for multiplicity was performed, so superiority based on p - values cannot be assessed . Comparison between duloxetine and ssri demonstrated comparable efficacy within the japan - approved dose range in patients with mdd . Results of the hamd17 subscale analysis indicated that duloxetine might be superior to ssris in improving loss of energy and interest.
|
We all have a very different understanding of how we define a need for help . This is most clearly felt when encountering individuals who, despite outside temperatures below zero, prefer sleeping rough in the street over the warm place in an overnight homeless shelter that a social worker or other care worker has offered them . If they additionally show no response to medical diagnoses such as open ulcers, flu infections or severe breathing difficulties, we can safely say that this person s behaviour deviates fundamentally from the expectations and understanding that health professionals would normally associate with need for action . Being exposed to people who reject such support services, which seem well - motivated and necessary from a medical point of view, is only one of several fruitful challenges that are deliberately provoked as part of the new teaching concept in the institute for the history of medicine at giessen university . The objectives are as follows: to get students to reflect systematically and critically upon conventional and thus familiar ways of thinking and acting, expectations and beliefs in medicine; to get students to reflect upon central concepts such as bedarf / bedrfnis (needs in objective vs. subjective terms) that are normative in character and have a structuring and guiding effect on medical care services; to advance and refine students soft skills, including the ability to put themselves in the position of other people, in particular those using medical services; to employ the method of participant observation in order to gain awareness of patients concrete social and environmental living conditions, in this case people on the fringe of society; and to raise students awareness of what can be deemed suitable support services for people whose behaviour is not consistent with the conventional expectations of health professionals . To get students to reflect systematically and critically upon conventional and thus familiar ways of thinking and acting, expectations and beliefs in medicine; to get students to reflect upon central concepts such as bedarf / bedrfnis (needs in objective vs. subjective terms) that are normative in character and have a structuring and guiding effect on medical care services; to advance and refine students soft skills, including the ability to put themselves in the position of other people, in particular those using medical services; to employ the method of participant observation in order to gain awareness of patients concrete social and environmental living conditions, in this case people on the fringe of society; and to raise students awareness of what can be deemed suitable support services for people whose behaviour is not consistent with the conventional expectations of health professionals . These teaching objectives are implemented and pursued, among others, in the interdisciplinary field querschnittsbereich 2 / q 2 history, ethics and theory of medicine, that is part of the approbationsordnung fr rzte/(ao: regulations for licensing doctors) (ao, 2002). As a matter of fact, some of the objectives are also presented and discussed in some medical school - curricula in medical sociology and psychology, as well as in community medicine / public health, however, in these contexts, the primary emphasis here is on the methodological and conceptual repertoire from their related disciplines, sociology and psychology . - similar teaching concepts as those presented in q 2 can also be found at an international level, where they tend to be associated with the concept of medical humanities (" kulturwissenschaften in der medizin), . Medical faculties vary in their interpretation and weighting of these teaching concepts; however, in the context of research and debate in medical education, the main focus is on the relationship between the three approaches (history, ethics, theory: additive or integrative; weighting of individual components), which are specified explicitly in the ao and which intend to introduce a reflective perspective on current medicine, . This paper sets out to discuss the possibility of supplementing the above - described methods with methodological approaches and concepts from another discipline based in cultural studies, namely medical anthropology (or medical ethnology), and to apply these in the context of a specifically designed form of experience to which students are exposed . Outside of germany, medical anthropology is an established discipline in university departments, degree courses and associations . The seminar medical care on the fringes of society: participant observation and change in perspectives has been designed with these approaches and experiences in mind . It has been offered as a seminar option in q 2 at the medical school of giessen university since the 2010 - 11 winter semester . The new teaching concept was developed on the basis of the following findings and considerations: in the standard degree courses required by the regulations for licensing doctors medical students will get to experience doctor - patient interaction almost exclusively in a hospital setting or in doctors surgeries, in other words, in institutional environments which in terms of their organisation and management of internal procedures are driven by the rationality of medical thinking (in addition to political and economic requirements). As a result, the focus is on problems as defined by physicians as well as related activities (diagnosis, therapy, consulting). The doctors and other medical staff working in such contexts are naturally familiar with the environment, but those who come to these institutions complaining of being unwell or suffering from acute illness (patients from a doctor s point of view) will often be new to this environment . This in itself can indeed become a source of additional stress, leading to feelings of, among others, uncertainty, anxiety and reluctance in doctor / patient interaction . The asymmetrical relationship between doctors and patients that is predefined by polar concepts such as ailing / healthy, laypeople / experts, those seeking help / those providing help is further exacerbated by the lack of familiarity / familiarity in the actual setting.as has been repeatedly demonstrated, the problem definitions employed in medical settings revolve around specific illnesses, perceptions of the body und self - images that have been defined by doctors and through medical research . However, they do not necessarily reflect how those attending medical care institutions would themselves define their problems and concerns . The priorities for action that result from the individual illness of the patient not seldom deviate from the priorities that are deduced from a scientifically based perception of disease in medicine, . In recent years, the debate has become increasingly systematic, for instance in relation to the treatment of patients suffering from chronic illness, e.g., acute pain syndromes, or advanced stages of cancer: it became clear that procedures that are primarily rooted in medical rationality (maximum diagnosis and therapy including all available possibilities afforded by science and technology) not seldom contradict the need of the patient, which is to live their remaining life as fully and comfortably as possibly given the circumstances according to their own subjective criteria, . However, the issue of systematically considering and ultimately prioritising the patient s perspective still continues to be on the periphery in medical training . The same applies to medico - ethical considerations and evaluations, which too will yield different conclusions if, for example, the risks of therapeutic or research interventions are systematically understood not as predefined medical entities (e.g., by way of morbidity and mortality rates for specific medical complications), but viewed and evaluated instead from the point of view of the patient . The above - outlined problem becomes clear if we consider the different aspects of meaning inherent in the conceptual pair bedarf/bedrfnis, terms referring to needs in the perspective of the physician, or the patient respectively: while the use of the term bedarf presupposes (scientific) objectivity and is therefore widely employed in the sense of measurable and essentially quantifiable entities in medical and political debates on medical care, the term bedrfnis is far more closely linked to the subjective perception of an individual or a particular predefined group.empirical research on medical care for people with migratory backgrounds in a number of different health care systems strongly points to the fact that the issues and problems as regards medical or health care services that become apparent with socially marginalised groups are by no means exclusively limited to these . On the contrary, these problems tend to be phenomena of a ubiquitous nature that apply universally in the context of medical care and doctor / patient interaction, which become strikingly apparent when dealing with socially marginalised groups . If looked upon closely, in the german health care system such phenomena, including, for example, that patients do not fully understand the medical information that is given them, or that patients perceptions of their body, and the way in which they describe illness or pain is considered inadequate by medical staff, are by no means limited to people of exotic or migratory backgrounds, but can equally be observed with native users, . Moreover, there is evidence that medical staff tends to de - individualise, standardise and in part stigmatise behaviour of people with a migrant background . Such behaviour is frequently perceived as exotic and therefore attributed to the culture or supposed biological disposition . Upon closer inspection, such stereotyping and stigmatising perceptions and evaluation may also be observed in relation to certain patients from within the own society: ample evidence in support of this is provided by patients suffering from chronic pain or obesity . Another striking example are socially marginalised groups such as black americans in the united states (e.g.,,,); but this too happens in the german health care system,, . Stereotypical ways of thinking and acting as well as implicit normative assumptions, which act as a potential source of misunderstandings, conflict or problems in medicine, can therefore be illustrated and reflected upon using the example of socially marginalised groups . In the standard degree courses required by the regulations for licensing doctors medical students will get to experience doctor - patient interaction almost exclusively in a hospital setting or in doctors surgeries, in other words, in institutional environments which in terms of their organisation and management of internal procedures are driven by the rationality of medical thinking (in addition to political and economic requirements). As a result, the focus is on problems as defined by physicians as well as related activities (diagnosis, therapy, consulting). The doctors and other medical staff working in such contexts are naturally familiar with the environment, but those who come to these institutions complaining of being unwell or suffering from acute illness (patients from a doctor s point of view) will often be new to this environment . This in itself can indeed become a source of additional stress, leading to feelings of, among others, uncertainty, anxiety and reluctance in doctor / patient interaction . The asymmetrical relationship between doctors and patients that is predefined by polar concepts such as ailing / healthy, laypeople / experts, those seeking help / those providing help is further exacerbated by the lack of familiarity / familiarity in the actual setting . As has been repeatedly demonstrated, the problem definitions employed in medical settings revolve around specific illnesses, perceptions of the body und self - images that have been defined by doctors and through medical research . However, they do not necessarily reflect how those attending medical care institutions would themselves define their problems and concerns . The priorities for action that result from the individual illness of the patient not seldom deviate from the priorities that are deduced from a scientifically based perception of disease in medicine, . In recent years, the debate has become increasingly systematic, for instance in relation to the treatment of patients suffering from chronic illness, e.g., acute pain syndromes, or advanced stages of cancer: it became clear that procedures that are primarily rooted in medical rationality (maximum diagnosis and therapy including all available possibilities afforded by science and technology) not seldom contradict the need of the patient, which is to live their remaining life as fully and comfortably as possibly given the circumstances according to their own subjective criteria, . However, the issue of systematically considering and ultimately prioritising the patient s perspective still continues to be on the periphery in medical training . The same applies to medico - ethical considerations and evaluations, which too will yield different conclusions if, for example, the risks of therapeutic or research interventions are systematically understood not as predefined medical entities (e.g., by way of morbidity and mortality rates for specific medical complications), but viewed and evaluated instead from the point of view of the patient . The above - outlined problem becomes clear if we consider the different aspects of meaning inherent in the conceptual pair bedarf/bedrfnis, terms referring to needs in the perspective of the physician, or the patient respectively: while the use of the term bedarf presupposes (scientific) objectivity and is therefore widely employed in the sense of measurable and essentially quantifiable entities in medical and political debates on medical care, the term bedrfnis is far more closely linked to the subjective perception of an individual or a particular predefined group . Empirical research on medical care for people with migratory backgrounds in a number of different health care systems strongly points to the fact that the issues and problems as regards medical or health care services that become apparent with socially marginalised groups are by no means exclusively limited to these . On the contrary, these problems tend to be phenomena of a ubiquitous nature that apply universally in the context of medical care and doctor / patient interaction, which become strikingly apparent when dealing with socially marginalised groups . If looked upon closely, in the german health care system such phenomena, including, for example, that patients do not fully understand the medical information that is given them, or that patients perceptions of their body, and the way in which they describe illness or pain is considered inadequate by medical staff, are by no means limited to people of exotic or migratory backgrounds, but can equally be observed with native users, . Moreover, there is evidence that medical staff tends to de - individualise, standardise and in part stigmatise behaviour of people with a migrant background . Such behaviour is frequently perceived as exotic and therefore attributed to the culture or supposed biological disposition . Upon closer inspection, such stereotyping and stigmatising perceptions and evaluation may also be observed in relation to certain patients from within the own society: ample evidence in support of this is provided by patients suffering from chronic pain or obesity . Another striking example are socially marginalised groups such as black americans in the united states (e.g.,,,); but this too happens in the german health care system,, . Stereotypical ways of thinking and acting as well as implicit normative assumptions, which act as a potential source of misunderstandings, conflict or problems in medicine, can therefore be illustrated and reflected upon using the example of socially marginalised groups . The three findings outlined above provided the basis for a teaching concept that incorporates the educational potential provided by concepts and procedures used in medical anthropology . Moreover, it draws on the specific experience that students gathered working with people from socially marginalised groups, or more precisely: without a permanent address . The aim was to systematically draw students attention to the following aspects and dimensions: the significance of each particular life situation, experience of suffering and particular ways of patients interaction in order to design (medical) support services that will pick up on their specific needs; in this context the concept and method of field research and participant observation from (medical) anthropology is taught;the unsettling impact an unfamiliar setting can have in the context of doctor / patient interaction, and as a consequence gaining awareness of the importance of one s own subjectivity (i.e., of the medical staff) in one s dealing with persons requiring help; in this context the modified concept of counter - transference from ethno - psychoanalysis (following devereux) is addressed;getting to know and immersing themselves in the living environments, health problems and specific needs of people living on the fringe of society following the model of cultural immersion approaches,: aside from more general phenomena such as poverty and physical neglect, we are dealing here with precarious conditions in terms of hygiene and nutrition, multimorbidity, often coinciding with psychiatric comorbidity, along with the effect of stigmatisation and shame over the (non-)use of available (medical) support services . The aim is to look closely at that which is (supposedly) exotic and bewildering, and to overcome the fear of entering unfamiliar territory;exposing the problems of the concept need for help in the context of the concrete state of a concrete individual (using the conceptual pair bedarf / bedrfnis): on the one hand, the focus here is on analysing central guiding concepts in medicine that bear relevance in relation to medical theory; on the other, the intention is to draw students attention to the fact that the medical perspective on the discomfort presented (on scientific grounds, objective) needs to be meaningfully and systematically complemented by including the patient s perspective (subjective, in the context of their biography and life situation, partly ambivalence / rejection of support services). The significance of each particular life situation, experience of suffering and particular ways of patients interaction in order to design (medical) support services that will pick up on their specific needs; in this context the concept and method of field research and participant observation from (medical) anthropology is taught; the unsettling impact an unfamiliar setting can have in the context of doctor / patient interaction, and as a consequence gaining awareness of the importance of one s own subjectivity (i.e., of the medical staff) in one s dealing with persons requiring help; in this context the modified concept of counter - transference from ethno - psychoanalysis (following devereux) is addressed; getting to know and immersing themselves in the living environments, health problems and specific needs of people living on the fringe of society following the model of cultural immersion approaches,: aside from more general phenomena such as poverty and physical neglect, we are dealing here with precarious conditions in terms of hygiene and nutrition, multimorbidity, often coinciding with psychiatric comorbidity, along with the effect of stigmatisation and shame over the (non-)use of available (medical) support services . The aim is to look closely at that which is (supposedly) exotic and bewildering, and to overcome the fear of entering unfamiliar territory; exposing the problems of the concept need for help in the context of the concrete state of a concrete individual (using the conceptual pair bedarf / bedrfnis): on the one hand, the focus here is on analysing central guiding concepts in medicine that bear relevance in relation to medical theory; on the other, the intention is to draw students attention to the fact that the medical perspective on the discomfort presented (on scientific grounds, objective) needs to be meaningfully and systematically complemented by including the patient s perspective (subjective, in the context of their biography and life situation, partly ambivalence / rejection of support services). In achieving these objectives, as briefly outlined above, in addition to the medical body of knowledge, concepts and methods from (medical) anthropology were introduced as central components of the seminar . This essentially involves the method of field research including participant observation,: central to this method is that those at the focus of medical attention will be visited in their everyday living settings . An additional effort is made to find out about their physical and social environment and their daily routines in order to comprehend the importance of these factors in relation to the patients perceptions of their body and state of mind, and in relation their help - seeking behaviour . In addition to visiting the living environment of those affected, systematic monitoring and as far as possible participating in their everyday lives, interviewing informers from the group in focus, together with the systematic documentation of experiences and reflections, form essential elements of this method, . This will enable students to get a better grasp, for example, of the behaviour displayed by the strangers they encounter (which at first glance may often seem obscure and inadequate) within the logic and conditionality of the particular contextual setting . Students will also be introduced to the central concept and methodological approach of counter - transference (as modified by the ethnologist and psychoanalyst george devereux): according to this concept contrary to a widely shared assumption researchers and other professionals working with people too respond emotionally to these persons and the conditions or behaviours observed in connection with them . Such emotional responses range from sympathy to various feelings of ambivalence to fear or aggression, which can impact upon professional interaction as well as prolong or shorten it, or even lead to selective perception and specific interpretation of observed behaviours and even persons . Following devereux, researchers or doctors are asked to systematically observe and reflect upon their own subjectivity and employ their findings, as it were, as an examination tool in its own right that will in addition to other methods yield a more holistic and rounded image of the other . Encounters with homeless people can as a result of their often radically different way of living and occasionally extreme physical neglect etc . Trigger particularly striking responses from those providing help; a situation that serves well as an introduction to systematic self - reflection, among other things, on behavioural patterns that are likely to result from such emotional responses . In addition to concepts and methods based in anthropology / ethnology and ethno - psychoanalysis, the seminar also teaches the basic principles about the general social, economic and legal conditions affecting the life of people without a permanent address . Cooperation with relevant institutions plays a major role in this: our main partner is frankfurter verein fr soziale heimsttten e.v . (fv), in the summer semester we additionally have elisabeth strassenambulanz (esa) (backed by: caritasverband frankfurt / m .) On board . The fv is an institution that has close ties with the city and offers an extensive range of services to different groups of homeless in frankfurt / main . During the winter months fv social workers drive the klte - bus to those spots where the homeless are known to congregate and, if required, supply them with tea, blankets and sleeping pads . The social workers are the first points of contact for the homeless and, if required, will arrange placements offering follow - on support services, including transport organisation . The esa provides services aimed at improving the health of women and men in housing difficulties, bearing in mind the unusual living conditions of these people . That a profound knowledge of the particular needs of homeless people as well as of institutional and legal possibilities in dealing with homeless people plays a central role in designing and implementing meaningful teaching concepts however, the focus there was on teaching concepts that concentrate mainly on providing medical treatment for socially marginalised groups, and less on the meta - level of systematic self - reflection and the ability to take on a different perspective, which is the focal point of the project presented here . The seminar is structured into a preparatory theoretical - methodological module, a practical module, namely the field work (in the winter semester with the klte - bus, in the summer semester visiting social work in the context of the esa), and a follow - up module . The seminar groups consist of around 10 students; this figure is based upon the limited number of individuals when accompanying the klte - bus and in the context of the esa (one student per appointment). The first part of the preparatory sessions (2 hours) takes place in the classrooms at giessen university . Here students are informed about the legal, social and medical situation of people on the fringe of society; previous experience and expectations from students are likewise discussed . In addition, students are familiarised with the experience of patients rejecting their offer of support, which can often be disconcerting; this includes introducing them to the different perceptions people have of illness, and to the concept of counter - transference . The structure of the responsible social institutions, particularly those based in frankfurt (fv, esa; among others) is presented and practical information on the planned field trip given . People on the fringe of society: the field work starts now . The second part of the preparatory session (2 hours) takes place on site in the rooms of the fv in frankfurt a preliminary stage of the field trip: the students leave their familiar environment in order to gain new and unfamiliar impressions . In the rooms of the overnight shelter, amidst the homeless persons staying there, fv social workers provide in - depth information interspersed with specialist and personal contributions . They also shed light on the medical and social situation of the individuals in the shelter and discuss expectations and particularities as regards the organisation of this part of the field work with the students . The field work proper does not take place in the group setting, but students go out invidudually: one student at a time accompanies the fv or esa social workers on their on - site visits to homeless people . A 6-hour period is scheduled for this hands - on experience; in the winter months it includes a trip on the klte - bus between 8 p.m. and 2 a.m.; in summer the field trip lasts just as long but takes place during the day or in the evening . Students accompany the social workers on their visits on foot or by bike or in the car; some students get to attend call - outs on the esa s medical bus . During the feed - back sessions (2x2 hours) students relate the different impressions they have had, contextualise them and explain how they felt, thus creating a wide spectrum of different impressions, evaluations and responses, which provide ample opportunities to reflect upon ways of action and potential changes in perception when dealing with patients . Possible essay topics (the seminar is assessed by essay) begin to take shape; these are discussed in - depth and in relation to how individual students approach their work, as well as formal specifications . In the essay students are asked to present their own personal observations and experiences during the field trip (e.g., feeling insecure in the unfamiliar environment, personal responses to coming face to face with the living environment, the appearance and behaviour of homeless people); in a second step the aim is to reflect upon these observations and their significance for medical thinking and acting . Given the limited number of participants (ten students per semester) and the relative short period for which the seminar has been available (since the 2010 - 11 winter semester; only three seminar groups have fully completed the class) we are thus far only able to qualitatively comment on the course; the total number of participants is still too low to allow for any meaningful quantitative - statistical analysis . To date, 31 students overall have participated in the seminar: 16 women and 15 men . The anonymous written evaluation contained three open questions (positive aspects include; negative aspects include; what do you take out of this experience for your further studies?) And nine questions to be answered by way of a graded scale (school grades a to f). Among these, three questions were of a general nature (please assess how much you have learned; relevance for training as a medical doctor; overall school grade), six related to specific aspects of the seminar, such as design and structure of the teaching concept, preparation of the lecturer, availability and comprehensibility of relevant information / literature or learning environment . The overall feedback on the structure of the course, on the preparation of the lecturer (b.m .) And on the learning environment was between positive and very positive (grade b or a in analogy to the school grading system). The questions was the seminar interesting? And the seminar encouraged reflection received the top grade (a). Somewhat in contrast likewise an unanimous perception the relevance for hands - on practical application (relevant for my training as a doctor) was recognised but felt to be less positive (grades b and c). In answering the open questions, the on - site experience with social workers and (in a different response) the individual tuition as a result of this was perceived to be particularly worthwhile . Another positive comment was that attention was drawn to how a person s concrete living environment affected their health . Finally, the opportunity to look outside the box was felt to be a profound experience that would shape the students further course of studies . The essays too contained statements that reflected the intensity of the seminar and the potential inherent in the anthropological approach complemented by field work and participant observation . The following statement has been taken from the discussion section of one of the essays: never before did i look at frankfurt s bahnhofsviertel in this way []. Another participant in the seminar felt that the field research method opened up an exotic world [for him]. The human being that crosses our daily horizon as a penniless and neglected figure on the periphery suddenly gets to be at the heart of our attention . Both in the evaluation and occasionally also in the essays the wish was expressed to actually extend the practical part of the seminar . Arrangements for receiving written feedback from seminar participants at predefined intervals (one, two and five years) have been made, and interviews about the long - term effects of learning and reflection processes are planned with focus groups . The preliminary experiences we gained with the teaching concept providing medical care on the fringe of society: participant observation and change in perspective illustrate that the spectrum of methodological approaches in q 2 (ao) can indeed be complemented by concepts from medical anthropology, in combination with exposing students to people in extreme social situations . The objective of getting students to reflect systematically upon historical, ethical - normative and theoretical foundations in medicine can therefore be extended and intensified in particular as regards the following three aspects: making students aware of the importance of the specific local setting in medical thinking and acting (aided by the concept of participant observation and field research from ethnology), the importance of the subjectivity of all those involved in doctor / patient interaction, including medical staff (aided by the modified concept of counter - transference from ethno - psychoanalysis), and the fact that key medical terms (such as medically defined need vs. individual needs of the patient) are essentially context - dependent . Making students aware of the importance of the specific local setting in medical thinking and acting (aided by the concept of participant observation and field research from ethnology), the importance of the subjectivity of all those involved in doctor / patient interaction, including medical staff (aided by the modified concept of counter - transference from ethno - psychoanalysis), and the fact that key medical terms (such as medically defined need vs. individual needs of the patient) are essentially context - dependent . At a more general level students will learn how to put themselves in the position of different protagonists in a range of medical settings, and practice the skill of reflecting critically upon putative conceptual / theoretical and normative - ethical assumptions in medicine . The teaching project therefore ties in with international models that likewise seek to integrate these teaching objectives in their medical training . The method of field research (or inspired by this in the context of medical training that of cultural immersion) has proven to be very helpful for understanding the perceptions and needs of socially or ethically marginalised groups, and in principle all other groups in health care,,,, [. In relation to this in the context of the new teaching concept the attention on social determinants of health and how they impact on the pathogenesis and course of health conditions yield synergies with other teaching concepts, for example in medical sociology, community medicine / public health or general medicine,, which focus on similar matters . Collaborations with community medicine practitioners working for example at technical colleges / fachhochschulen or other institutions outside universities could likewise bear relevance ., it will be necessary to know and familiarise oneself with the central (medical) anthropological concepts and methods . Further, opportunities will have to be created that will enable cooperation with such institutions that are willing to set up the organisational framework and make available their expertise to enable the direct contact of students with people on the fringe of society in their everyday living environments . The new curricular option described here could only be realized through the co - operation and engagement of many members of staff at the frankfurter verein fr soziale heimsttten e.v . As well as the elisabeth - straen - ambulanz frankfurt / m . (esa). We want to express special thanks to heiko ewald and christine heinrichs, together with the staff of the kltebus-project, the ostpark - project, the beratungszentrum fr aufsuchende sozialarbeit, as well as dr.
|
Foodborne liver and intestinal flukes are important groups of parasites from the public health point of view [1 - 4]. Lao peoples democratic republic (lao pdr) is located in the middle of the indochina peninsula, and the mekong river runs through the whole length of the country from north to south . Until the 1990s, the liver fluke opisthorchis viverrini and soil - transmitted nematodes, including ascaris, trichuris, and hookworms, were the major helminths prevalent among the laotian people [5 - 8]. In 1991, haplorchis taichui adult flukes were recovered for the first time from 5 laotian students studying in czechoslovakia . Since then, other intestinal flukes, including haplorchis pumilio, haplorchis yokogawai, prosthodendrium molenkampi, phaneropsolus bonnei, centrocestus formosanus, echinostoma revolutum, artyfechinostomum malayanum, echinochasmus japonicus, and euparyphium sp . Have been recovered from infected residents of vientiane municipality, phongsaly, saravane, khammouane, and savannakhet province [10 - 16]. The predominating species and the the intensity of infection with each fluke species varied by locality . For example, o. viverrini infection was predominant over h. taichui in vientiane municipality, whereas h. taichui infection was dominant over o. viverrini in saravane province . On the other hand, in phongsaly province, located in the northernmost area of lao pdr, high prevalences of h. taichui and h. yokogawai were detected with no detection of o. viverrini . After completion of the international collaboration project between the korea association of health promotion and ministry of public health (moph), lao pdr on the control of intestinal helminthiases in lao pdr from 2000 - 2004, a new 5-year project plan was started in 2007 to control foodborne trematode infections by the korea foundation for international healthcare and moph, lao pdr . In this new project, the primary goal was to control opisthorchiasis in endemic areas and to reduce the incidence of cholangiocarcinoma in the mekong river basin . For the successful implementation of this project, a desirable pre - requisite should be the elucidation of the actual status of infection with o. viverrini in each target village . The recovery of eggs only in the feces is not sufficient for this purpose, because the eggs of o. viverrini and those of minute intestinal flukes are practically indistinguishable in routine fecal examinations . The present study was performed to determine the actual status of infection with foodborne trematodes by recovery of adult flukes from riparian people of saravane and champasak province, lao pdr . Saravane province (capital city, saravane) is located about 500 km south from vientiane, and champasak province (capital city, pakse) is located nearby and just south of saravane province (fig . 1). Small riverside villages, each having 200 - 300 residents, located near the mainstream or tributaries of the mekong river were selected for this study, which included 12 villages (in 6 districts) in both saravane and champasak province . Most villagers were agricultural workers, and some had caught freshwater fish from small streams and ponds and consumed them raw or improperly cooked . A total of 1,460 fecal samples (1 sample per person) were collected from the villagers (717 men and 743 women, 12 - 82 years - of - age) from december 2009 to june 2010 . Samples were transported to the malaria stations in saravane and champasak province within 2 - 3 days of collection and were stored at 4 until examined . Trematode eggs 23 - 32 m in size were collectively recorded as small trematode eggs (ste). Fecal examinations and anthelmintic treatments were officially approved by the ministry of public health, laos, under the terms of the korea - laos agreement on foodborne trematodiases control in laos (2007 - 2011). Thirty people who were positive for ste were selected for adult worm recovery at the malaria station . After obtaining informed consent, they were treated with a single oral dose of 40 mg / kg praziquantel (distocide@; shinpoong pharm ., worms were counted and some were fixed with 10% formalin under cover slip pressure, acetocarmine - stained, and morphologically identified using a light microscope . Fecal examination results were analyzed using the student's t - test and the chi - square test . The overall helminth egg positive rate was 78.8% and 66.4% in saravane and champasak province, respectively (table 1). There were some mixed infection cases involving different kinds of nematodes, trematodes, and cestodes . The most highly prevalent was ste, which included eggs of o. viverrini, heterophyids, and lecithodendriids, with a prevalence of 69.9% (46.5 - 87.2% by district) and 46.3% (7.5 - 73.9% by district) in saravane and champasak province, respectively (table 1). The district showing the highest ste prevalence was toumlane (87.2%) in saravane province and pathumphon (73.9%) in champasak province . Paksong, an urban area of champasak province, displayed the lowest ste prevalence (7.5%) among the 12 districts surveyed . Other parasite eggs detected in saravane and champasak province included hookworms (20.1% and 22.1%, respectively), ascaris lumbricoides (5.7% and 4.0%, respectively), trichuris trichiura (0.8% and 5.6%, respectively), taenia spp . The egg positive rates were not significantly (p>0.01) different between men and women (data not shown). The adult worm collection was completed in 30 people (15 men and 15 women; 20 - 65 years; 19 in saravane and 11 in champasak) (table 2). A total of 543,852 helminth specimens were recovered (average of 18,128 per person; range 6 - 129,238 worms per person). Intestinal flukes were recovered in all 30 cases (100.0%), and o. viverrini was recovered in 17 cases (56.7%). The total number of h. taichui specimens recovered in saravane and champasak province were 409,738 (n=19; average 21,562 per person) and 132,865 (n=11; average 12,078 per person), respectively, which was markedly higher than the other helminth parasite species (table 2). The next most frequent species was h. pumilio, with 796 (n=19; average 41.9 per person) and 247 (n=11; average 22.5 per person) in saravane and champasak province, respectively (table 2), followed by o. viverrini, with 179 (n=19; average 9.4 per person) and 17 (n=11; average 1.5 per person) in saravane and champasak province, respectively (table 2). Small numbers of specimens were collected for taenia saginata, c. formosanus, p. molenkampi, and e. japonicus from a small number of people (table 2). Two haplorchis spp . Comprised 99.96% (99.95% and 99.98% in saravane and champasak province, respectively) of the total helminth specimens recovered, whereas o. viverrini comprised only 0.04% (0.04% and 0.01% in saravane and champasak province, respectively). The highest worm load of h. taichui collected from a single person was 129,159 in champasak province, followed by 97,791 and 71,647 in saravane province . The overall helminth egg positive rate was 78.8% and 66.4% in saravane and champasak province, respectively (table 1). There were some mixed infection cases involving different kinds of nematodes, trematodes, and cestodes . The most highly prevalent was ste, which included eggs of o. viverrini, heterophyids, and lecithodendriids, with a prevalence of 69.9% (46.5 - 87.2% by district) and 46.3% (7.5 - 73.9% by district) in saravane and champasak province, respectively (table 1). The district showing the highest ste prevalence was toumlane (87.2%) in saravane province and pathumphon (73.9%) in champasak province . Paksong, an urban area of champasak province, displayed the lowest ste prevalence (7.5%) among the 12 districts surveyed . Other parasite eggs detected in saravane and champasak province included hookworms (20.1% and 22.1%, respectively), ascaris lumbricoides (5.7% and 4.0%, respectively), trichuris trichiura (0.8% and 5.6%, respectively), taenia spp . The egg positive rates were not significantly (p>0.01) different between men and women (data not shown). The adult worm collection was completed in 30 people (15 men and 15 women; 20 - 65 years; 19 in saravane and 11 in champasak) (table 2). A total of 543,852 helminth specimens were recovered (average of 18,128 per person; range 6 - 129,238 worms per person). Intestinal flukes were recovered in all 30 cases (100.0%), and o. viverrini was recovered in 17 cases (56.7%). The total number of h. taichui specimens recovered in saravane and champasak province were 409,738 (n=19; average 21,562 per person) and 132,865 (n=11; average 12,078 per person), respectively, which was markedly higher than the other helminth parasite species (table 2). The next most frequent species was h. pumilio, with 796 (n=19; average 41.9 per person) and 247 (n=11; average 22.5 per person) in saravane and champasak province, respectively (table 2), followed by o. viverrini, with 179 (n=19; average 9.4 per person) and 17 (n=11; average 1.5 per person) in saravane and champasak province, respectively (table 2). Small numbers of specimens were collected for taenia saginata, c. formosanus, p. molenkampi, and e. japonicus from a small number of people (table 2). Two haplorchis spp . Comprised 99.96% (99.95% and 99.98% in saravane and champasak province, respectively) of the total helminth specimens recovered, whereas o. viverrini comprised only 0.04% (0.04% and 0.01% in saravane and champasak province, respectively). The highest worm load of h. taichui collected from a single person was 129,159 in champasak province, followed by 97,791 and 71,647 in saravane province . An extremely high predominance of intestinal flukes, in particular, h. taichui, was evident in saravane and champasak province . The liver fluke, o. viverrini, constituted only a very small portion of the helminths infected among the riparian people in the surveyed localities . Therefore, we could confirm that the real o. viverrini heavy endemic areas in lao pdr include vientiane municipality and savannakhet province, based on the previous results from our research group . Dominate in khammouane, saravane, and champasak provinces with only a low - grade endemicity of opisthorchiasis, based on our previous observations and those of the present study . Phongsaly province and luang prabang and xiengkhouang provinces are also haplorchis - dominant areas without o. viverrini endemicity (to be published). The individual worm load of h. taichui was extremely high in this study, particularly in saravane province . It was 67 times higher than in khammouane province (324 vs. 21,565), 209 times that of savannakhet province (103 vs. 21,565), and 799 times that of vientiane municipality (27 vs. 21,565). Indeed, it was even 3-times higher than that of our previous study in saravane province . This may have been due to the fact that different districts were surveyed in our earlier and present studies . The present report of intestinal flukes, including h. taichui and h. pumilio, from people in champasak province is novel . However, recovery of o. viverrini was previously reported in 3 people (5, 10, and 395 specimens) residing near pakse, the capital of champasak province . Therefore, in the present study, it was surprising to see that the worm load of h. taichui and h. pumilio was markedly higher than that of o. viverrini in champasak province . One patient, a 35-year - old man, expelled as many as 129,159 specimens of h. taichui, and thus he represents the most heavily infected case with h. taichui ever recorded in the literature . The hyperendemicity of h. taichui infection among riparian people in saravane province was closely correlated with the report of metacercarial prevalence in fish in saravane province . H. taichui metacercariae were detected in various freshwater fish species from saravane that included hampala dispar, cyclocheilichthys enoplos, mystacoleucus greenwayi, and puntioplites proctozysron with the average metacercarial density per fish of 1,532 (range 16 - 6,050), 346 (14 - 986), 337 (8 - 1,625), and 175 (2 - 863), respectively . However, the metacercariae of o. viverrini were also detected heavily in h. dispar with the average number per fish of 453 . No or very few o. viverrini metacercariae were detected in other species of fish examined in saravane province . It is strongly suggested that h. dispar is an important source of infection both for h. taichui and o. viverrini in this area . The present study indicated that the sole use of fecal examinations to detect helminth eggs does not fully allow the determination of the actual prevalence and intensity of liver and intestinal flukes in lao pdr . For example, 2 recent studies performed in champasak province reported the results of fecal examinations on the residents [18 - 20]; the ste were interpreted only as o. viverrini eggs, and the possibility for them to be eggs of intestinal flukes, in particular, haplorchis spp ., was overlooked . The adult worm recovery after chemotherapy and purgation, like our studies [10,11,14 - 16] and others, is helpful to determine the actual and relative predominance of liver and intestinal flukes in each area, although it is a tedious work and needs experts who have much experience and skill . It would be preferable to have a proper technique to distinguish the species of ste in fecal specimens . Several diagnostic techniques have been reported to be useful for morphologic discrimination of ste in fecal samples [21 - 23]. Iodine staining was helpful for discriminating lecithodendriid eggs (p. molenkampi and p. bonnei) from those of o. viverrini . Potassium permanganate temporary staining, using 1% (w / v) solution for 1 min, was also applied to discriminate the eggs of o. viverrini, h. taichui, and p. bonnei . Molecular techniques have been applied to detect o. viverrini dna in fecal samples [24 - 26]. In khon kaen, thailand, a 98% specificity and a 100% sensitivity of the pcr technique were obtained in cases of moderate to severe infections (> 1,000 epg) but only a 68% sensitivity was shown in light infections (<200 epg). In lao pdr, the pcr sensitivity was lower; only around 50% in cases even with high epg counts> 1,000 . Cetyltrimethyl - ammoniumbromide was used to remove such inhibitors, which resulted in an enhanced sensitivity of pcr technique to detect fecal o. viverrini dna, from 44.8% to 79.3% . It was stated that the primers used for pcr did not cross - react with haplorchis spp . . In this respect, the possibility of mixed infections with o. viverrini with minute intestinal flukes, including haplorchis spp ., was raised as a reason for low sensitivity of pcr technique to detect o. viverrini dna . Subsequently, pcr assays to discriminate o. viverrini from those of h. taichui and h. pumilio were developed using the internal transcribed spacer (its) regions, its1 and its2 . The pcr amplicons of o. viverrini, h. taichui, and h. pumilio were 800, 930, and 1,250 bp, respectively, for its1, which successfully differentiated the 3 species, whereas those for its2 were 380, 530, and 380, respectively, which could not discriminate o. viverrini and h. pumilio . The sensitivity of its1 pcr using fecal samples, however, was relatively low (76.2%). It may be argued that not all of the o. viverrini worms were expelled from the subjected cases by a 40 mg / kg single dose treatment with praziquantel . However, in our previous studies in vientiane municipality and savannakhet province, the same protocol as in the present study was applied, and 3 - 315 o. viverrini specimens in vientiane and 1 - 1,350 o. viverrini specimens in savannakhet were recovered individually in the diarrheic stools of the subjects within 5 - 6 hr (4 - 5 successive stools) after praziquantel administration . These observations indicate that if a person is infected with o. viverrini, a majority, if not all, of the worms are expelled by this procedure . A previous study in thailand supports this hypothesis; in 9 patients treated with 40 mg / kg praziquantel in a single dose followed by purging and whose diarrheal feces were collected at least 24 hr after purgation, 95% of all worms were expelled within the first 4 hr . A study performed in khon kaen, thailand, a hyperendemic area of opisthorchiasis, reported that the worm load of o. viverrini among 181 human autopsy cases averaged 182.4 and ranged from 1 - 2,946 per individual . In our previous studies in savannakhet and vientiane, the average worm load measured by worm recovery after praziquantel treatment and purging was 115.4 (n=29; 0 - 1,350 per individual) and 57.8 (n=18; 3 - 315 per individual), respectively therefore, it is suggested that the procedure we used is a reliable method for recovery of both liver and intestinal flukes from humans.
|
For patients and families, the issue of data quality is personal . When treatment decisions or research conclusions are based on incomplete or inaccurate information a misdiagnosis, an incomplete medication list, the wrong demographic data thanks in part to the power of health information technology, individuals have new opportunities to be part of the solution when it comes to assessing and improving data quality . Building on a framework for data quality, as the source of patient - centered data, consumers have important roles to play in reviewing and confirming their own health information and should be engaged partners in efforts to understand and improve the quality of electronic health data . For patients and families, the issue of data quality is personal . When treatment decisions or research conclusions are based on incomplete or inaccurate information a misdiagnosis, an incomplete medication list, the wrong demographic data thanks in part to the power of health information technology, individuals have new opportunities to be part of the solution when it comes to assessing and improving data quality . Consumers are not only the foundation of the data quality framework kahn et al ., but have important roles to play in reviewing and confirming their own health information along the chain of data stewardship . Recognizing patients and families as sources of valuable information and powerful forces for change in identifying and preventing errors will also help to foster a culture of safety and build a sense of partnership between providers and patients in the mutual pursuit of better health and care . Building on kahn et al.s figure following the chain of data stewardship, i have overlaid opportunities for patient engagement at each step of the process, underscoring the critical role of individuals as the original data stewards (see figure 1). The number of people with online access to their electronic health information is growing by leaps and bounds . Before the health information technology for economic and clinical health (hitech) act, patients had a right to receive a copy of their health records within 3090 days under the hipaa privacy rule . Now, thanks to meaningful use, patients have the ability to view online, download, and transmit their own records within 36 hours after a hospital discharge, or within four business days after a doctor receives the health data.1 health information is increasingly available at the click of a button with blue button . Blue button is an easy, secure method for individuals to download their medical records in digital form from a secure website offered by doctors, insurers, pharmacies or other health - related services.2 implementation of these policy changes is underway, and there are undoubtedly individuals who still struggle to access their own health information (electronically or otherwise), and work is necessary to improve the experience and utility of online access for patients . Nonetheless, online access to clinical information is an opportunity to partner with patients and families to assess and enhance the quality of health care data . As patients and families get easier access to their medical records and health data, possibly for the first time, it is inevitable that they will have feedback corrections, additions, and observations to share . In fact, the absence of health information produced, shared, and reviewed by patients themselves contributes to poor data quality . Patients and their caregivers can provide information critical to high - quality research and care delivery, including family health history, treatment side effects, changes in health status or functional status, and even treatment outcomes.3 too often, records are missing key data about health outcomes did the patient get better after the recommended course of treatment? Corrections and amendments are another important type of pghd . Patients are often the first to identify errors in their own records . Increased access by individuals to their own health information these could include updated medication lists, nontolerated medications, other allergies, and more . These and other patient generated health data complement clinical information generated by care teams to provide a comprehensive view of an individual s health, thus enhancing data quality, as well as enabling more meaningful conclusions to be drawn from secondary uses of this data . With greater online access to their health information and new tools to electronically communicate and share information with providers, patients and families can help improve the accuracy and reliability of data stored in medical records . I recently heard a speaker at the office of the national coordinator (onc) s consumer summit affectionately refer to the benefits of this new capability as an army of free fact checkers . A 2014 nationwide survey found that patients with online access to their health information overwhelmingly use this capability: 86 percent log on at least once a year, and more than half (55 percent) log on three or more times per year . Survey data show that online access has a positive impact on patients knowledge of their health, ability to communicate with doctors, and ability to correct information (for 63 percent of patients). More frequent online access has an even greater impact on ability to correct information (71 percent for frequent users, compared with 48 percent for less frequent users).4 as the original generators and stewards of their own health data, individual patients and consumers are the foundation in the data stewardship chain outlined in kahn et al.s data quality framework . Consumers also want to continue to be involved, considered, and consulted in all aspects of data capture, assessment, and use . Figure 1 takes kahn s figure and illustrates the potential data contributions of individual patients and consumers, as well as opportunities to support critical data management activities at multiple points along the chain of data stewardship . In particular, there are opportunities for consumer and patient involvement in improving the quality and integrity of data stored in electronic health records (ehrs) for clinical use (data originator box). For example, providers could share their computer screen with patients during clinical encounters, allowing patients to see their medication lists or medical records . This gesture not only engages patients in the data entry, but also offers an opportunity for patients to contribute corrections or new information to their record in person . The growing ability for patients to view, download, and patients and their families can view their health records and supply missing data or correct inaccurate data via patient portals or secure messaging with their providers . Individuals can review and verify data further down the stewardship chain via a portal offered by a health information exchange (hie). Hies collect data from multiple institutions, and some portals allow the patient to see the collective longitudinal record and to offer corrections or amendments to the whole . Finally, at the end of the data stewardship chain, consumers could review and offer feedback on the relevance or usefulness of the analysis and visualizations being created by clinical researchers and other investigators . Of course, questions remain about how best to collect and ingest information from patients into the electronic medical record . Questions, for example, such as how to authenticate data coming from patients prior to use (how to confirm when the data were created, whether they were modified in some way, what instrument was used to collect them, etc . ). Policies and procedures are still necessary to ensure that providers can receive, review, record, and respond to pghd shared by patients and families.5 a comprehensive data quality reporting framework for assessing and describing data quality may help to validate pghd and incorporate them into the medical record, and use them to inform clinical care or health care policy . We must also more effectively engage patients and families in an online health environment and educate them about the impact of data quality on their health and health care . Underlying changes to clinical culture are also necessary: moving toward viewing patients as active partners in their care, rather than as passive recipients.6 great strides are being made in patient - centered outcomes research, as exemplified by the patient centered outcomes research institute (pcori), which funds research and supports patients and other stakeholders to meaningfully partner with researchers throughout the research continuum . Looking forward, we must also broaden our focus beyond current data types and quality issues to consider relevant health data outside traditional clinical settings, such as social determinants of health (building on the institute of medicine s recommendations),7 and their place and impact in the data quality framework . Consumers have much to gain from, and contribute to, activities to assess and improve data quality.8 efforts to adopt and implement a comprehensive data quality framework should preserve and reinforce the role of individuals as the original data stewards, generating and sharing critical information to inform better research, safer clinical care, and ultimately improved health outcomes.
|
Adverse drug reactions (adrs), including interactions, in older people are a common cause of admission to hospital1 and are also a common cause of disease in hospitalized patients . Frail elderly patients appear to be particularly at risk of adrs . In some cases, this is because insufficient account is taken of the effect of age and frailty on the pharmacokinetic and pharmacodynamic of the drug, especially in relation to hepatic2 and renal elimination.3 although many adrs are recognized during the drug development process and before licensing, this is not always the case, especially when they are uncommon or rare.3 moreover, patients with severe cognitive impairment may not be able to refer symptoms related to an adr, making the recognition of this clinical condition a medical problem.4 rhabdomyolysis is a clinical and laboratory syndrome that is caused by various etiologies, involving the skeletal muscle.5 rhabdomyolysis is characterized by the leaking of myoglobin and other intracellular proteins and electrolytes into the circulation, and may be associated with a wide variety of diseases, injuries, medications, and toxins.5 it is important to recognize drug - induced rhabdomyolysis because clinical effects are usually reversible.4 rhabdomyolysis related to macrolide - statin interaction has previously been described.68 clarithromycin, like other macrolides, is an inhibitor of cyp450 3a4, the major enzyme responsible for the metabolism of several drugs, in particular some statins like simvastatin and atorvastain.69 to date, rhabdomyolysis related to clarithromycin has been reported in only one previous case report.10 we report the case of a 90-year - old caucasian male, admitted to the university hospital of pisa for dyspnea, who experienced rhabdomyolysis related to clarithromycin treatment . A 90-year - old caucasian male was admitted to the university hospital of pisa for dyspnea . He had experienced dyspnea for 2 weeks, and showed signs of pneumonia after a chest x - ray was performed . The patient was affected by alzheimer s disease, in advanced phase, and did not take any home - medication as referred by his general physician . At admission in the emergency room, clinical workup revealed mental confusion (the relatives referred progressive cognitive impairment for several months), sinus tachycardia (115 beats per minute), basilar wheezes, and rhonchi . Body temperature was 36.6c with normal systemic blood pressure (140/80 mmhg), diuresis, and blood oxygen saturation (so2% 96.2%). Routine laboratory exams, including complete blood cell count, thyroid hormones, liver (aspartate aminotransferase and alanine aminotransferase) and muscle (creatine kinase [ck]) enzymes, as well as the coagulation pattern, resulted within normal limits . Serum brain natriuretic peptide was measured and a cardiac markers curve (including myoglobin) was also started, ruling out cardiogenic dyspnea . Blood potassium and creatinine concentrations were 4.96 meq / l (reference range 3.55 meq / l) and 122.8 mol / l (reference range 4590 a diagnosis of acquired pneumonia was made and treatment with ceftriaxone (1 g four times daily, intravenous), hydration (crystalloid 1.5 l / day), aerosol with salbutamol and oxitropium, o2 inhalation (3 l / minute), and dalteparin (2500 ui, subcutaneous) was started . After the geriatric ward admission, clarithromycin (500 mg two times daily, intravenous) was also started . On the second day of hospitalization, for continuing sinus tachycardia, in the absence of any evident causes (fever, hypotension, arterial - venous fistula, thyrotoxicosis, suspected drug treatments, etc) beta - blocker treatment (bisoprolol 1.25 mg, daily) was added and a cardiac markers curve was restarted (figure 1). The second point of the curve, almost 6 hours after the third clarithromycin dose, revealed a huge myoglobin increase (1144 ng / ml; 8.5 times the upper normal range [28138 ng / ml]) without electrocardiogram modifications . U / l; 6.5 times the upper normal range [38180 u / l]) along with a mild creatinine increase (152.9 mol / l), in the absence of liver enzyme alterations (aspartate aminotransferase, alanine aminotransferase). Urine color concomitantly changed toward dark brown and hemogasanalysis revealed a slight respiratory insufficiency type 1 with normal ph . A diagnosis of rhabdomyolysis was made and clarithromycin was stopped, while the concomitant therapy with ceftriaxone, bisoprolol, and aerosol with salbutamol and oxitropium was continued . The patient was immediately treated with intravenous crystalloid hypotonic solution (80 ml / hour) and corticosteroid (40 mg methylprednisolone, intravenous). Serum ck and myoglobin levels decreased within a few days and a chest x - ray showed significant improvement . The patient was discharged home on the sixth hospital day (figure 1) with the diagnosis of iatrogenic rhabdomyolysis and acquired pneumonia of unknown etiology . Indeed, serum and urinary antigen and antibody exams excluded the presence of legionella pneumophila, streptococcus pneumoniae, and mycoplasma pneumoniae while virus infection assessments were not performed . Clarithromycin, like other macrolides, is an inhibitor of cyp450 3a4, the major enzyme responsible for the metabolism of several drugs, in particular some statins as simvastatin and atorvastatin.3,69 rhabdomyolysis related to macrolide and statins interaction has previously been described; however, rhabdomyolysis related to clarithromycin has been reported in only one previous case report.8,10 in our case, there was an evident temporal sequence between clarithromycin exposure - withdrawal and the onset - recovery from rhabdomyolysis biochemical signs, while other potential causes of muscle damage were reasonably excluded . Accordingly, the naranjo probability scale confirmed a probable relationship (score 6/9).13 a general physician and a nurse followed the patient at home, thus we are confident the home care was carried out in a correct manner, ruling out mistakes and accidental drug intake . Moreover, an interaction with other concomitant medications was improbable considering the rapid resolution after clarithromycin withdrawal and the elimination pathways of the concomitant drugs (both bisoprolol and ceftriaxone have hepatic and renal elimination routes).11,12 in addition, bisoprolol was administered at the minimal dose (1.25 mg) and both bisoprolol and ceftriaxone, as single therapy, were never related to an adverse drug reaction like rhabdomyolysis . We ruled out infection as the possible cause of muscle damage considering the sequence of the events . In fact, the patient was admitted to the hospital for dyspnea developed at home since 2 weeks, while serum ck suddenly increased 2 days after hospital admission . If rhabdomyolysis had been caused by the infection we would have expected that serum ck increased earlier, thus being already evident at hospital admission . Moreover, the diagnosis of rhabdomyolysis, unless there is a high index of suspicion, can be missed since muscular pain, swelling, and tenderness may not be prominent or even absent . The definitive diagnosis should be made by laboratory tests including serum ck and urine myoglobin.5 in our case, the patient had advanced cognitive impairment making him unable to easily refer any symptom, and the diagnosis was made by the huge elevation of biochemical markers (6.5 times the upper normal value for ck, 8.5 times for myoglobin). Overall, these findings allowed us to make the diagnosis of rhabdomyolysis with sufficient warranty . Although clarithromycin associated rhabdomyolysis is mainly due to pharmacokinetic interactions, a direct muscle toxicity might be postuled.5,10
|
Supravalvar mitral ring is a circumferential ridge or membrane arising from the left atrial wall overlying the mitral valve and frequently attached to the mitral valve.1 variable in thickness and extent, the ring ranges from a thin membrane to a thick discrete fibrous ridge.2 the membranous variety may be difficult to detect because the membrane often adheres to the anterior mitral valve leaflet while remaining just proximal to the posterior mitral leaflet . Adhesion to the valve may impair the opening of the leaflets, and this impairment may be the main mechanism of mitral valve inflow obstruction in some patients . In other patients, the ring may be large enough to protrude into the mitral valve inflow and cause obstruction . The supramitral ring may initially be incomplete and eccentric, allowing for an unobstructed flow through the mitral valve . However, turbulence can cause a progressive increase in the supravalvar membrane or ridge thickness, worsening mitral inflow obstruction.3 the same mechanism is responsible for the acquired variety of supravalvar mitral stenosis, which occurs after mitral annuloplasty for the repair of mitral regurgitation . We herein present a case of a supraventricular ring in a 17-year - old male, who presented with syncope . About 15 years ago, he had undergone a cardiac operation for ventricular septal defect (vsd) closure and mitral valve repair . In chest x - ray both lungs were clear, and the electrocardiogram result showed normal sinus rhythm, had undergone right bundle branch block, and right ventricular hypertrophy . Transthoracic echocardiography, transesophageal echocardiography, and finally cardiac catheterization revealed ejection fraction of 5055%, pulmonary hypertension with pulmonary artery pressure (pap) of 80/40 mm hg, pulmonary capillary wedge pressure of 23 mm hg, gradient in the mitral valve plane of 40 mm hg, no residual vsd, no patent ductus arteriosus (pda), bicuspid aortic valve, no aortic insufficiency, no aortic stenosis, no sub - aortic web, normal coronary arteries, mild mitral regurgitation, moderate to severe mitral stenosis, supra mitral valve ring, normal left ventricle size, moderate right ventricle enlargement, and moderate systolic dysfunction . There was a free floating high redundant obstructive membrane in the left atrium that was attached to the mid portion of the anterior mitral valve leaflet and also in the medial and base of the posterior mitral valve leaflet and large papillary muscles in the left ventricle (figure 1). It also extended just adjacent to the lower limb of the left atrium appendage mouth with a small orifice (6 mm) in the lateral side and also multiple small fenestrations (by 2 dimensional echocardiography), resulting in a severely restricted diastolic flow (mean peak gradient = 9.3 mm hg). This web was not found in mri cine turbo - flash images acquired on a 1.5 t scanner (magnetom vision - siemens) in the four - chamber view (3a) and the transverse plane, short - axis view (figure 2). The patient s ascending aorta, descending aorta, and aortic arch were tortuous with moderate narrowing of the descending aorta distal to the subclavian artery with a systolic gradient of about 30 mm hg, which was suggestive of insignificant coarctation of the aorta . After heparinization, extracorporeal circulation was established between the venae cava and the ascending aorta . Following a median sternotomy, there was a long supravalvar muscular band, which was resected (figure 3). Supravalvar mitral ring rarely occurs as an isolated defect; other congenital heart defects coexist in 90% of patients . The mitral valve itself is often abnormal and stenotic at the valvar or subvalvar level; fusion of leaflets, a small valve orifice, and abnormal papillary muscles are common abnormalities . Shone s complex is a combination of four congenital heart defects: supravalvar mitral ring, parachute mitral valve, subvalvar aortic stenosis, and aortic coarctation . Other common associated lesions in patients with supravalvar mitral ring are ventricular septal defect (vsd), pda, atrioventricular (av) canal defect, and tetralogy of fallout.4 uncommonly associated defects include atrial septal defect, cor triatriatum, left superior vena cava, unroofed coronary sinus, partial anomalous pulmonary venous drainage, pulmonary venous obstruction, double - orifice mitral valve, and wolff - parkinson - white syndrome.5 lesions such as transposition of the great arteries, atrioventricular discordance, and double - outlet right ventricle are occasionally complicated by a supravalvar left atrioventricular valvular ring . Obstruction to the mitral inflow results from the reduced area of the mitral valve orifice . When clinically significant, a diastolic pressure difference occurs between the left atrium and the left ventricle . Left atrial and pulmonary venous pressures increase, leading to exudation of fluid into the pulmonary interstitial, which increases lung stiffness . Breathlessness and tachypnea are secondary to the interstitial edema and diminished pulmonary compliance.6 in severe cases, frank pulmonary edema can occur.7 an associated atrial septal defect may decompress the left atrium, reducing or masking the severity of the mitral valve obstruction . Associated lesions such as vsd or pda, which increase the left ventricle output, exacerbate the manifestations of mitral inflow obstruction.8 conversely, a supravalvar mitral ring may be difficult to detect in conditions with a diminished pulmonary blood flow such as tetralogy of fallot.9 persistently elevated pulmonary venous hypertension leads to pulmonary arterial hypertension, rise in pulmonary vascular resistance, and eventual failure of the right ventricle and tricuspid regurgitation . It also deserves of note that predilection for race, age, and sex has not been found yet . Treatment is the surgical resection of the web, but balloon dilatation is reported to have been successfully performed under fluoroscopic and transesophageal echocardiographic guidance by some authors.10 preoperative identification of a supravalvular mitral ring is the target for obtaining good surgical results . For the identification of this congenital heart disease,
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.