Split (1)

train · 133k rows

text stringlengths 0 868k
All bacterial isolates related to the outbreaks (1 per patient) were obtained from clinical samples . The strains were identified phenotypically by rapid i d 32 strep (biomrieux, marcy letoile, france), which yielded profile 22025001100 (leuconostoc spp . (biolog, hayward, ca, usa) (98%, t = 0.708). The results were confirmed by 16s rdna sequence analysis, by a previously reported method (9), and the analysis of 1,4201,500 bp showed 99% probability that the species were lm, when compared with genbank database sequences . Antimicrobial drug susceptibility was determined by microdilution, with dademicroscan system (baxter health care, west sacramento, ca, usa), and mics were confirmed by e - test (ab biodisk, solna, sweden). For interpretation of antimicrobial drug susceptibility, clinical and laboratory standards insitute criteria (10) for leuconostoc spp . Or when appropriate streptococcus spp . The antimicrobial drug susceptibility profiles were almost identical for all genotypes and showed susceptibility to penicillin and gentamicin (mics of 0.25 mg / l and <2 mg / l, respectively) and to levofloxacin, tetracycline, quinupristin - dalfopristin, linezolid, daptomycin, erythromycin, clindamycin, and chloramphenicol . A pulsed - field gel electrophoresis (pfge) technique was used to assess the possibility of a clonal relationship among the 48 lm strains . Genomic dna was extracted, restricted with apai, and electrophoresed with chef - driii apparatus (bio - rad laboratories, richmond, ca, usa). No differences in the band profile were observed among the 42 strains of the first outbreak (genotype 1). Analysis of the 6 strains isolated in the 2006 outbreak showed different dna band patterns from those corresponding to genotype 1 (figure 2). Of the 6 isolates, 4 shared the same genotype, designated genotype 2, whereas the remaining 2 isolates showed 2 new genotypes (genotypes 3 and 4). One lm strain, isolated from the parenteral nutrition catheter of a patient involved in the 2006 outbreak (genotype 2), was identical to those isolated from blood of the same patient (figure 2) and from 3 other patients involved in the 2006 outbreak (data not shown). Mw, molecular weight marker at indicated sizes; lines 1 to 9, representative lm isolates from the first outbreak (genotype 1); lines 10, 11, lm isolates obtained from parenteral nutrition catheter and blood from the same patient (genotype 2) and identical to those from 3 different patients infected in the second outbreak (data not shown); lines 12, 13, lm isolates from 2 different patients involved in the second outbreak (genotypes 3 and 4) most of the 42 patients infected with lm genotype 1 in the first outbreak displayed severe underlying diseases (table 1); 9 of the patients died, and 3 of the deaths (7.1%) were directly related to the leuconostoc infection . The bacterial isolates were isolated from blood (52.1%), catheter (21.8%), or both (26.1%). To assess risk factors related to acquisition of lm strains, we performed a case control study . Control - patients (n = 61) were randomly selected among remaining patients with another nosocomial infection caused by a non leuconostoc spp . Microorganism isolated from a catheter, blood, or both, who were admitted to the same department and at the same time as the patients defined as case - patients . Sd, standard deviation; or, odds ratio; ci, confidence interval; ns, variable did not meet criterion for remaining in the multivariate model . Predictor variables with p<0.10 in univariate analysis were included in the multivariate model to enable simultaneous adjustment . Any process that modifies the gastrointestinal barrier (inflammation, atresia, resection, obstruction). Nosocomial infection criteria were those previously established by the centers for disease control and prevention (atlanta, ga, usa) (12). A multiple logistic regression model was developed to identify potential independent factors associated with acquisition of lm strains . Predictor variables with p<0.10 in univariate analysis were included in the multivariate model to enable adjustment . Statistical analyses were conducted with spss 14.0 software (spss inc ., chicago, il, usa). According to the multivariate analysis, previous infections (38.2% were bacteremias) (odds ratio [or] = 4.2) and parenteral nutrition (or = 27.8) all case - patients received parenteral nutrition, with the exception of 2, although they received enteral nutrition . Parenteral nutrition is a putative source of the infection because all parenteral and enteral nutrition bags are prepared in the central hospital pharmacy and then distributed to the different medical units in the hospital . This possibility was further supported by 1 finding: pfge analysis of isolates obtained from a parenteral nutrition catheter connected to a patient during the second outbreak yielded the same genotype as the isolates obtained from blood from the same patient (figure 2) and from another 3 physically separated, infected patients . The physical distance between these patients as well as the impossibility of retrograde displacement of the bacterial isolate from patient s blood makes it unlikely that the lm strain was acquired by contamination from the blood and indicates parenteral nutrition as the main source of lm transmission in the hospital outbreak . Microbiologic controls of parenteral nutrition were reinforced during the second outbreak, and as stated, only 6 cases were detected . Moreover, during the second outbreak, microbiologic analysis of environmental samples as well as samples from the digestive tract, skin, and throat of all patients involved did not yield any leuconostoc strains . Parenteral nutrition controls performed in the hospital pharmacy department are now routinely assayed for lm isolation . Since the last lm outbreak in november 2006, that 42 lm isolates from the first outbreak shared the same genotype and 4 of 6 isolates in the second outbreak also shared the same (another) genotype rules out the possibility of endogenous infections among patients and suggests a common source for each outbreak . The occurrence of cases in patients in areas that were physically separated rules out the possibility of indirect patient - to - patient spread through the hands of healthcare workers or contaminated hospital equipment (different departments do not share healthcare workers and equipment). Enteral and parenteral nutrition has previously been described (13,14) as a risk factor associated with leuconostoc - infections, although no microbiologic evidence was provided in any of the studies . With regard to previous infections in the multiple logistic regression model, this may be related to the alteration of the immune system caused by the microorganism that caused the previous infections . Two previous reports have described hospital transmission of leuconostoc spp (7,15); both outbreaks affected a small number of patients, and no epidemiologic studies were conducted to clarify the genetic relationship among the bacterial strains involved or the source of the nosocomial infection . Although up to 88 cases of leuconostoc infection have been reported in the scientific literature in the past 25 years, these cases may not be comparable to those reported here, the largest nosocomial outbreak caused by leuconostoc spp . Worldwide . This outbreak highlights the importance of lm as an emerging hospital pathogen in patients with underlying diseases and in whom parenteral nutrition may be the source of the initial infection and its spread . Every infection with lm could be a yet undetected outbreak and should result in an investigation that focuses on parenteral nutrition or products manufactured in a centralized hospital pharmacy.
The immunosuppressive receptor pd-1 and its ligand pd - l1 have been identified by dr . Tasuku honjo and his colleagues at the kyoto university as factors that induce programmed cell death . Since the mechanism mediated by pd-1 and its ligand was shown to be important for immune suppression and tolerance, it has also been reported to be involved in pathogenetic mechanisms of various diseases . Pd-1 and pd - l1 are single - pass transmembrane molecules expressed on the cell surface, which belong to the b7 family . Their expression is induced by immune - activating stimuli and is understood as a negative feedback mechanism to suppress excessive immune reactions and let immune responses cease . When the receptor pd-1 is bound by its ligand, src homology 2-domain - containing tyrosine phosphatase 2 (shp-2) and shp-1 are recruited to immunoreceptor tyrosine - based inhibitory motif and immunoreceptor tyrosine - based switch motif in the intracellular region of pd-1 and suppress antigen receptor signaling mediators . This process results in reduced production of cytokines, such as interferon (ifn)- and interleukin (il)-2, reduced cell proliferation and suppressed immune cell activation . In addition to the close involvement in homeostasis of the living body as summarized above, recent studies have shown that immunosuppressive factors, pd-1 and pd - l1, are also involved in immunosuppression in cases of tumors and chronic infections . While generally not highly expressed in normal tissues, pd - l1 is expressed at a high rate in tumor tissues in melanoma, lung cancer, colorectal cancer and ovarian cancer, and has been demonstrated to be involved in immune evasion by tumors . In patients with renal cell cancer and gastric cancer, pd - l1 has been shown to be an important prognostic determinant; also, the disease progression is faster, and the mortality is higher in patients with tumors expressing pd - l1 than in patients without detectable pd - l1 expression [51, 53]. In addition, pd - l1 expression has also been reported for other tumors including breast cancer, pancreatic cancer and bladder cancer, and pd-1 expression in tumor - infiltrating lymphocytes has been confirmed in many types of tumors including melanoma, lung cancer and intrahepatic bile duct cancer . These findings have revealed the importance of the pd-1/pd - l1 pathway as an immunosuppression mechanism in a variety of tumors . Based on the series of studies on pd-1/pd - l1 in tumor diseases, therapeutic means targeting this pathway are being developed . Specifically, these new therapeutics are biopharmaceuticals based on anti - pd-1 antibodies, anti - pd - l1 antibodies or recombinant proteins that inhibit the pd-1/pd - l1 pathway . These biopharmaceuticals have been reported to show good anti - tumor effects regardless of the tumor type and are attracting growing attention as a new, promising class of anti - tumor therapy . Fully humanized anti - pd-1 and anti - pd - l1 antibodies have already been produced and are actively tested as therapeutic agents in clinical studies (trials), with good anti - tumor effects continuing to be reported in patients with melanoma, lung cancer, renal cell cancer and some other types of cancer . In melanoma, which has a very poor prognosis, clinical trials conducted in japan and the united states have reported not only the suppressed growth of cancer cells, but also complete remission in some cases . On september, 2014, the anti - pd-1 antibody was finally released by ono pharmaceutical as a new anti - tumor therapeutic agent, and it has become a pioneer for innovative immune checkpoint inhibitors (ono pharmaceutical: https://www.opdivo.jp/contents/action/). This immune checkpoint - targeted immunotherapy was selected as breakthrough of the year 2013 by the journal science as a global revolutionary technology . Currently, merck, roche and other major pharmaceutical companies around the world are accelerating their efforts to develop similar antibody - based drugs; this class of therapeutics is gaining so much momentum and attention that the conventional concept of anti - tumor therapy is being overturned . The causative factors of bovine leukemia can be divided into viral and non - viral . Non - viral bovine leukemia is sporadic and can be subdivided into calf type, thymic type and cutaneous type involving unknown causes . On the other hand, enzootic bovine leukemia, which is caused by blv, accounts for the vast majority of cases of bovine leukemia, and its prevalence continues to increase . Blv infections are latent in the aleukemic (al) state, but can emerge as persistent lymphocystosis (pl) with non - malignant polyclonal expansion of cd5 b - cells that predominantly harbor blv provirus and rarely as malignant b - cell lymphoma in various lymph nodes after long periods of latency . The progression of enzootic bovine leukemia is accompanied by marked suppression of cell - mediated immunity [8, 9, 16], and as the pathogenetic mechanism remains unknown, there are no effective vaccines or therapeutic methods available, meaning that affected animals eventually die . Bovine leukemia was designated as a communicable disease obligated to notify under the act on domestic animal infectious diseases control when it was revised in 1997 . In 2015, 2,896 cases of bovine leukemia were reported (of which the largest number of 494 cases occurred in hokkaido), representing the disease reported in a greater number than any other bovine disease required to monitor by the act (http://www.maff.go.jp/j/syouan/douei/kansi_densen/kansi_densen.html). This number is 29.3-fold the number of cases reported in 1998 (96 affected animals), indicating that the increase has not yet been halted . Requests for urgent measures against this disease have been voiced very frequently by people practicing veterinary medicine and animal husbandry . However, a large - scale survey conducted by the national institute of animal health using specimens collected from 2009 to 2011 showed an approximate blv - positive rate of 35%, demonstrating the difficulty of implementing any project to select and replace infected cattle . Comparative analyses of blv - infected cattle by clinical condition have suggested that animals with a high viral load and persistent lymphocytosis are at a high risk of disease onset, often serving as infection sources, have a high risk of vertical transmission and have increased levels of cd4cd25foxp3 treg cells, showing increased susceptibility to opportunistic infections due to transforming growth factor - beta produced by treg cells, which reduces the production of interferon - gamma and tumor necrosis factor - alpha by cd4 t cells and impairs cellular immunity mediated mainly by the cytotoxic activity of nk cells [28, 48]. Moreover, the proliferative ability of lymphocytes in response to blv was also significantly reduced in cattle with persistent lymphocytosis, and lymphocytes were found to produce reduced levels of anti - viral cytokines, such as ifn-, il-2 and il-12 [13, 18]. Therefore, we analyzed the expression of pd-1 and its ligand, pd - l1 . Results showed that the pd-1 expression in cd4 and cd8 cells and the pd - l1 expression in virus - infected b cells increase as the disease progresses . Furthermore, pd - l1 expression negatively correlated with the ifn- expression level, an indicator of immunosuppression, while positively correlating with leukocyte count, virus titer and provirus level . Antibodies to bovine pd-1 and pd - l1 were established, and the results from pd-1 and pd - l1 binding inhibition assays confirmed that they activated anti - viral immunity and that the increase in ifn- production positively correlated with the pd-1 expression rate on cd4 t cells . And also, recombinant bovine pd - l2 (pd - l2-ig) significantly enhanced ifn- production from virus antigens - stimulated pbmcs derived from blv - infected cattle . Interestingly, the pd - l2-ig - induced ifn- production was further enhanced by treatment with anti - bovine pd-1 antibody . These results indicated that the pd-1/pd - l pathway constitutes a part of the immunosuppressive mechanism in bovine leukemia (table 2table 2.change of immune inhibitory molecules in the cause of bovine leukemia virus infectionreceptor / liganduninfectedinfected(disease status)referencesalpllymphomapd-1/pd - l1///// lag-3/mhcclass ii////n.d [17, 41]tim-3/gal-9///// ctla-4/cd80, cd86/n.d/n.d/n.d/n.dn.d n.d: not demonstrated .) We also analyzed immunosuppressive receptors other than the pd-1/pd - l1 pathway, such as lymphocyte - activation gene 3 (lag-3) [17, 41], t - cell immunoglobulin and mucin domain - containing protein 3 (tim-3), and cytotoxic t - lymphocyte antigen 4 (ctla-4; cd152) expressed in antigen - specific lymphocytes and found that expression levels of lag-3, tim-3, ctla-4 and their ligands on lymphocytes increased as the disease progressed and anti - viral immunity was activated in binding inhibition assays, as was the case for pd-1 (table 2). Currently, clinical studies of these drugs are being carried out at the hokkaido university and other institutions . Although there are many diseases in cattle involving immune abnormalities (impairments), the mechanisms underlying these diseases remain unknown . Our previous analyses have shown that immunosuppressive factors, such as pd - l1, are also involved in immune suppression seen in diseases other than bovine leukemia, namely johne s disease and bovine anaplasmosis . Furthermore, recent evidence suggests that immunosuppressive factors, such as pd-1, are involved in the reduced immune function in chronic infectious diseases, such as mastitis, bovine mycoplasmosis and bovine tuberculosis (manuscript in preparation). Our laboratory has been working on the development of a blv vaccine for many years . It is based on a vaccine antigen that was found to be promising in in vitro studies . However, although we tried various procedures, the vaccine did not prevent infection or even disease onset despite the fact that effector cells were present in vivo (data not shown). Results from the present analysis suggested that the virus s immune evasion mechanism for lymphocyte exhaustion might be related to the ineffectiveness of the vaccine . Future measures against chronic infectious diseases will require the development of a new, pre - emptive control method that targets this formidable immune evasion mechanism . To achieve this goal, results from more detailed analyses of immune exhaustion in other chronic infections are awaited . For use in humans, several immune checkpoint - targeting biopharmaceuticals have been successively developed, including those described above, and they are being actively tested in clinical trials . In the future, it is anticipated that they will be applied to veterinary medicine and animal husbandry, including diseases in cattle.
Placenta accreta is a pathology characterized by abnormal and firm attachment of the placenta to the myometrium.1 the depth of penetration of the placental villi into the myometrium defines three severity levels of placenta accreta; accreta, increta, and percreta . Accreta, the least severe and most common of the three, occurs when the placental villi attach directly to the myometrium rather than to the decidua basalis . Percreta, the most rare and severe manifestation of accreta, is the invasion of the placental villi through the entire thickness of the myometrium, and even further.2 placenta accreta tends to reoccur; however, little is known regarding the pathophysiological processes leading to this invasive placentation . The most severe complication of placenta accreta is spontaneous rupture of the uterus, which poses diagnostic challenges and management dilemmas, and can be a life - threatening event to the mother and fetus . Herein, we describe a woman diagnosed with repeated placenta accreta that was complicated by spontaneous rupture of the uterus . This case demonstrates increasing placental invasiveness and, to the best of our knowledge, is a first report of this kind . Furthermore, repeated invasive placentation occurred at the same site, and not at the cesarean section (cs) scar, which raises a fundamental question regarding the mechanism of trophoblast implantation and location of recurrence of placenta accreta . Understanding the processes that influence the timing and location of this life - threatening complication may set the basis for better diagnosis and management protocols . A 32-year - old woman in her fourth pregnancy, with parity of 2, presented at 19 weeks gestation to the gynecologic emergency department with lower abdominal pain for the past 2 days . Her obstetric history included retained placenta in both first and second deliveries, which necessitated manual revision of the uterine cavity and curettage . She had a perforation of the left posterior uterine wall during curettage in her second delivery that was laparoscopically repaired . In her third pregnancy, she presented with an acute abdomen at 19 weeks gestation and underwent exploratory laparoscopy that demonstrated a 2.5 cm rupture in the posterior uterine wall at the site of the previous perforation . Laparoscopy was turned into laparotomy; the rupture was sutured and the patient recovered well . Magnetic resonance imaging (mri) performed at 21 weeks gestation demonstrated placental tissue penetrating, but not perforating, the myometrium of the posterior uterine wall, which was indicative of placenta increta (figure 1). After counseling, the couple chose to terminate the pregnancy, and hysterotomy was performed at 22 weeks gestation . In the current pregnancy, upon admission to the emergency department, the patient presented normal vital signs, and the gynecologic examination revealed 19 weeks gestation this suspicion raised by sonography, together with the patient s history, prompted an mri at 24.2 weeks that demonstrated the presence of placenta percreta at the site of the previous placenta increta (figure 2a). Following counseling, the couple decided to continue the pregnancy, and the patient was hospitalized for observation . Rapid bedside ultrasound examination demonstrated intraabdominal bleeding, and emergency cs was performed . During laparotomy, massive intraabdominal bleeding was observed, originating from a uterine rupture with a perforating placental tissue (figure 2b). Following the delivery of the fetus and complete placental removal, as well as suturing of the uterine wall, the bleeding stopped and hysterectomy was avoided . The mother recovered well, while her neonate died of prematurity complications . Due to the ominous nature of the patient s obstetric history, placenta accreta, at any level of severity, is a rare obstetric complication with an estimated incidence of between 1 in 533 (as reported by wu et al3) and 1 in 2,500 pregnancies (as reported by miller et al1). However, once placenta accrete is diagnosed, it has a tendency to reoccur in subsequent pregnancies.4,5 little is known about recurrence of placenta accreta, and specifically its location, histopathological invasiveness, and prognosis . The only known risk factor for repeated placenta accreta is parity.6 here we report, for the first time, a case of four consecutive pregnancies complicated by abnormal placentation . In primary placenta accreta, the strongest independent risk factor has been found to be previous cs.1,7 this is explained by the tendency of implantation and placentation to occur in the scarred area.1 in the case presented here, recurrence occurred in the left uterine cornu, the site of the previous placenta increta, rather than the cs scar . Additionally, the clinical manifestation was aggravated with each consecutive pregnancy: retained placenta necessitating manual lysis and curettage in the first and second, placenta increta in the third, and spontaneous uterine rupture due to placenta percreta in the fourth . Therefore, this case presents not only placenta accreta recurrence but also increased invasiveness of the placentation . Even though placentation is prone to develop within previous cs scars, other prior uterine injuries may play a similar role, and hence are considered to be a risk factor for placenta accreta.7 it is not known whether injury location affects the risk for placenta accreta . The correlation between scarred uteri and placenta accreta is explained by a relative hypoxic environment in the scar tissue8 or the histologically abnormal structure of the scar . This abnormal structure is characterized by defective re - epithelialization and relative abundance of extracellular matrix.9 alternatively, prior uterine injury is associated with dynamic changes in decidual leukocyte distribution,10 which subsequently affects the homing of the blastocyst to its implantation site . Once placenta accreta is diagnosed, proper counseling and discussion with the patient should be undertaken regarding further management of the pregnancy in light of the complications involved.11 the most severe complication is spontaneous rupture of the uterus, as seen in this case, which poses both a diagnostic challenge and an immediate risk to the life of both mother and fetus . The incidence of spontaneous uterine rupture is reported to be approximately one in 5,000; however, this includes etiologies other than placenta accreta.12 uterine rupture due to placenta accreta is extremely rare, and a systematic review of reported cases is yet to be done . In the past, most cases were managed by hysterectomy, but conservative treatment is becoming common recently.13,14 during the operation, active bleeding stopped promptly and the patient remained hemodynamically stable . Completing the procedure outweighed the risk of blood loss involved in hysterectomy, and uterine repair was technically feasible . The location where spontaneous uterine rupture occurs has not been thoroughly studied; however, some reports associate first trimester ruptures with the fundus and third trimester ruptures with the lower uterine segment.15 in case of previous cs, the rupture usually occurs at the site of the old scar.12 in our patient, the rupture appeared in the left uterine cornu, where the placenta was invading through the myometrium, rather than in the cs scar . This could be explained by the fact that the uterine wall was already disrupted by the placenta percreta prior to the rupture, as was seen in the mri . As with rupture location, factors affecting the timing of uterine rupture due to placenta accreta while it is well established that spontaneous uterine rupture usually occurs in the third trimester,15 there have been reports of first8 and second1619 trimester ruptures as well . In our case, spontaneous rupture occurred at 24 weeks gestation; a critical time for the fetus . This gestational age marks the limit of viability, since preterm delivery around this time results in 50% long - term survival probability of the newborn.20 in the face of immediate risk for the mother, urgent cs was inevitable, even when considering the probable prematurity complications for the fetus . With the increase in conservative management of placenta percreta although systematic reviews of these complications are not yet available, this insight should be taken into account during counseling following conservative management of placenta accreta . Notes: transabdominal two - dimensional ultrasound in the transverse plane showing an abnormal placenta with thinning of the myometrium in the left posterior uterine wall, indicated by an asterisk . Similar findings are seen in the longitudinal plane in addition to fundal placental lacunas (arrow head) with increased blood flow by color doppler scanning.
The annual frequency of drug shortages increased 200% from 2006 to 2010 . Furthermore, in 2012 the food and drug administration (fda) reported a record number of 251 drugs on shortage . The increasing problem of drug shortages has the potential to adversely affect patient care, delay medical procedures, result in medication errors, and burden the health care system with additional costs [35]. When these medications are unavailable, it may lead to significant patient harm when clinicians must resort to second- or third - line agents that may have inferior or less evidence for use . This is especially true for shortages of often non - interchangeable, curative therapies such as antimicrobials and oncologic agents, which comprise the majority of shortages . A 2013 survey of infectious disease physicians found that 78% (n = 489) of respondents had to modify their choices of antimicrobial therapy because of a drug shortage in the previous 2 years . Poor patient outcomes due to a shortage were reported by 55% (n = 345) of responding physicians who reported having to use alternative agents which were less effective, more toxic, or more costly . The growing magnitude of drug shortages and the risk of patient harm they pose have gained much attention from the government, media, and researchers as strategies are developed to mitigate their effects . While progress has been made on quantifying the magnitude and causes of drug shortages, a lack of data exists on the causality of shortages on patient outcomes as well as the development of a system for reporting and monitoring patient harm on a real - time basis . There remains a need for appropriate tracking of the relationship between drug shortages and patient outcomes in the long term [1, 4]. Specifically, the need remains for a system where clinicians can report specific instances of patient harm they believe to be due to a drug shortage . Traditionally, adverse event reporting is managed through the adverse events reporting system (aers) of the fda; however, aers is known to under - represent actual events due to infrequent clinician reporting . Furthermore, drug shortages that lead to patient harm may not be recognized as adverse events . We have suggested that a novel method for maximizing the reporting of adverse events due to drug shortages would be simple, anonymous, use standardized terminology for easy tabulation, and have a mechanism for attributing causality of the adverse event to a drug shortage [1, 4]. We focused on shortages of antimicrobial drugs as they are often non - interchangeable, curative, and represent a large portion of overall shortages, thus making them particularly sensitive to shortages that result in patient harm . We hypothesized that a novel method for reporting patient harm due to antimicrobial shortages would aid in anonymous and convenient reporting of these cases of patient harm . Clinicians were asked anonymously to report occurrences of patient harm related to antimicrobial drug shortages through an online survey (surveymonkey; surveymonkey, palo alto, ca, usa) consisting of 11 questions (table 1). The survey was distributed through an editorial in pharmacotherapy, a letter in the american journal of health - system pharmacy, and through the american college of clinical pharmacy (accp) infectious diseases practice and research network (i d prn) email listserv . Reports from the survey were tabulated from august 2012 through october 2013, and three reminder emails were sent to the accp i d prn during this timeframe . This study was approved as exempt by the midwestern university institutional review board.table 1survey questions1please list the full name of your institution (for de - duplicating purposes)2how many inpatient beds does your institution currently have?3which of the following best describes the location of your institution? If yes, please list the patient s age5sex: male or female6which antimicrobial was unavailable for your patient?7please list the infection for which treatment or prophylaxis was needed8what adverse event did your patient experience?9please attribute the causality of the shortage to the adverse event that occurred in your patient unrelated: the adverse event is clearly not related to the shortage unlikely: the adverse event is doubtfully related to the shortage possible: the adverse event may be related to the shortage probable: the adverse event is likely related to the shortage10please attribute a severity to the adverse event that occurred in your patient death disabling hospitalization life threatening required intervention other (please specify)11what was the final patient outcome? Please check all that apply death treatment failure / development of resistance readmission due to treatment failure increased length of hospitalization patient transferred to an institution with a supply of antimicrobial delay of therapy suboptimal treatment other (please specify) respondents were surveyed regarding: institution (for de - duplication purposes), patient age (if <90 years old), sex, antimicrobial on shortage, type of infection requiring treatment or prophylaxis, adverse event, and patient outcome . Criteria for causality attribution were obtained from the common terminology criteria for adverse events (ctcae) of the national cancer institute . Using these criteria, the reporter assessed the relationship between the adverse event and the antimicrobial shortage as unrelated (clearly not related), unlikely (doubtfully related), possible (may be related), or probable (likely related). The severity of the adverse event was also assessed using standardized aers criteria, modified for the setting of infectious diseases . Using these criteria, the reporter classified the severity of the adverse event according to the following terminology: death, treatment failure or development of antibiotic resistance, readmission due to treatment failure, increased length of hospital stay, patient transfer to an institution with a supply of antimicrobial, delay of active therapy, canceled care, or other . Overall, there were seven de - duplicated reports of adverse events related to antimicrobial shortages . The incomplete reports did not provide the level of causality due to a shortage but did report an instance of patient harm . All institutions were in urban settings with 500740 beds (n = 3) or 100249 beds (n = 1). The infections for which these patients were being treated or receiving prophylaxis included stenotrophomonas maltophilia bacteremia, pneumocystis jirovecii pneumonia, neonatal sepsis of unknown etiology, and cytomegalovirus colitis . Final patient outcomes included death, delay of therapy, readmission, and limited access to treatment . Two adverse events (a delay in treatment and an inability to treat with other antimicrobials due to resistance) were attributed to have probable causality due to a shortage, while the remaining adverse events (death and an inability to tolerate high oral doses) were attributed to have unlikely and possible causalities due to a shortage, respectively . The antimicrobials on shortage in the incomplete reports included three cases of a shortage of sulfamethoxazole trimethoprim . The infections for which these patients were being treated or receiving prophylaxis were p. jirovecii pneumonia and stenotrophomonas spp.table 2patient vignettes of complete reports detailing adverse drug events due to antimicrobial shortagespatientage (sex)antimicrobial on shortageinfection being treatedade experiencedcausality due to shortageseverity of adefinal patient outcome1<90 (f)sulfamethoxazole trimethoprim iv stenotrophomonas maltophilia bacteremiadeathunlikelydeathdeath245 (f)sulfamethoxazole - trimethoprim ivpcp pneumonianausea / vomiting / diarrhea when given high oral dosepossiblerequired interventiondelay of therapy3<90 (f)gentamicinempiric neonatal sepsis1 h delay of treatmentprobablerequired interventionreadmission425 (m)foscarnetcmv colitisuntreatable due to resistanceprobableother: disease still presentother: obtained foscarnet outside the united states ade adverse drug event, cmv cytomegalovirus, f female, iv intravenous, m male, pcp pneumocystis jirovecii pneumonia patient vignettes of complete reports detailing adverse drug events due to antimicrobial shortages ade adverse drug event, cmv cytomegalovirus, f female, iv intravenous, m male, pcp pneumocystis jirovecii pneumonia the methodology demonstrated in this study illustrates a successful system capable of capturing real - time instances of patient harm and attributing the causality of that harm to antimicrobial shortages . By maintaining a database where the specialists most likely to manage shortages can continuously report instances of patient harm anonymously and conveniently, we believe our methodology offers an ability to capture harmful effects of antimicrobial drug shortages on patient outcomes . Clinicians wishing to report on future harms due to antimicrobial shortages can do so at: http://www.surveymonkey.com/s/antimicrobialshortages . The instances of patient harm reported in this study further underline the harmful effects of drug shortages reported elsewhere in the literature . These effects include utilization of less effective or more toxic alternative medications, medical errors, delays in procedures, and higher healthcare costs [35]. For example, two of the drugs on shortage reported in our survey are first - line agents for their respective indications (i.e., sulfamethoxazole trimethoprim for p. jirovecii pneumonia prophylaxis, and foscarnet for cytomegalovirus colitis). It is worth noting that two of the three antimicrobials reported to be on shortage in our survey required clinicians to follow special instructions to obtain a supply . Trimethoprim was available through drop shipments from the manufacturer only after the need for therapy was documented to the manufacturer . As there may be significant time lags associated with obtaining such products, special measures are required to ensure ready access to the product at the time of need . Of further note, the number of full - time equivalents allocated to shortage management has increased in many healthcare institutions; this has not seemed to curb the inability of some institutions to procure drugs on shortage . One potential solution may be increased education about procuring drugs on shortage and how best to mitigate their harmful effects, which antimicrobial stewardship programs could potentially provide . This survey methodology, a quick and anonymous online survey, offers an advantageous alternative over conventional surveys which may only provide a snapshot of the incidence of patient harm and not specific patient characteristics . The benefits of the fda aers system include that it is a publically available system for reporting adverse events and it provides a form that prompts reporters for pertinent information . However, due to issues such as prescriber disinclination to report for fear of identification and litigation, lack of time to submit reports, and lack of knowledge of the reporting structure, most adverse drug events are never reported . It has been estimated that under - reporting exists over 90% of the time . Specifically in regards to the aers system, an original study found that only 57% of prescribers were aware of aers, likely leading to reporting rates ranging from 1% to 5% . We have written about the need for standardization of assessing the impact of antimicrobial shortages on patient outcomes and suggested that the traditional method of reporting adverse events is likely under - reporting the true impact due to the time required for submissions, the complexity of the system, and the personally identifying nature of the report [1, 4]. A 2009 review of the determinants of under - reporting of adverse events found under - reporting to be influenced in part by a lack of suitable means to report the event in 75% (n = 45) of all studies, and that the available system was considered to be too bureaucratic or not easy enough in 25% (n = 45) of all studies . The methodology presented here may also be useful in assessing patient harm due to shortages in other drug classes . Reports may have been limited as respondents may have not wished to disclose medication errors or adverse events which occurred at their institutions . Accuracy of self - reporting is an inherent liability to which all surveys, including the fda aers database, are subject . The results from our survey were driven by large institutions in urban settings; however, results from elsewhere in the literature clearly demonstrate that institutions of all sizes and settings are affected by shortages [6, 11]. Despite these limitations, the results of this survey provide valuable information regarding patient harm due to antimicrobial drug shortages . Our study demonstrated a novel method for encouraging providers to report patient harm due to antimicrobial shortages . This method is standardized, anonymous, convenient, and capable of de - duplicating responses . This pilot study has revealed unique instances of patient harm with assessed causality attributed to antimicrobial shortages . Such studies may help gage the true impact of shortages and may help guide policies aimed at allocating appropriate resources to control and prevent patient harm caused by future shortages . Milena m. mclaughlin, erik skoglund, zachary pentoney, and marc h. scheetz have no conflicts of interest to disclose pertaining to the subject matter of this manuscript . This article is distributed under the terms of the creative commons attribution noncommercial license which permits any noncommercial use, distribution, and reproduction in any medium, provided the original author(s) and the source are credited.
Atrial fibrillation (af) is the most common sustained arrhythmia encountered in clinical settings . It is associated with higher risk of mortality, accounting for approximately 12% of all deaths in the general population . The prevalence of af increases substantially with age, affecting around 10% of people over 80 years old . About 0.77% of the chinese population have af . However, the exact pathogenesis of af is still unclear . Af is usually considered to be affected by multiple cardiovascular risk factors, including advancing age, male sex, hypertension, diabetes, ischemia, valvular heart disease, left ventricular (lv) dysfunction, heart failure, and obesity . Furthermore, studies have reported that genetic factors play important roles in the pathogenesis of af, such as kcna5, kcnq1, kcne2, and nup155 . Caveolin-1 gene (cav1) encodes a caveolae protein, usually expressed in atrial myocytes . Recent genome - wide association studies (gwas) have reported that a single - nucleotide polymorphism (snp), rs3807989, in cav1gene was associated with the susceptibility to af, and the association of this snp with af risk has been replicated in several populations . Olesen et al . Demonstrated that variants of rs3807989 in cav1gene are associated with af independent of traditional cardiac risk factors in caucasians . However, the findings from the study of li et al . Conflict with the results above; they showed that the snp rs3807989 in cav1 gene may not be a risk factor for af in the chinese han population . In view of this disagreement, it was necessary to perform a meta - analysis to determine the association of cav1 rs3807989 polymorphism with the risk of af in the present study . We searched for studies about the association of cav1 rs3807989 polymorphism with the risk of af in the electronic databases pubmed, medlin, and web of science before august 20, 2015 . Rs3807989 or polymorphism or 7q31 and atrial fibrillation (af). Only studies conducted in humans were included . Concurrently, we manually reviewed the references of reviews to search for additional relevant articles . If the same population was replicated in over 1 publication, only the most recent study with complete data was included in this meta - analysis . The inclusion criteria were: 1) cohort or case - control studies; 2) studies about the association between the cav1 rs3807989 (g / a) polymorphism and risk of af; 3) studies that provide detailed genetic frequency data (aa, ga, and gg) in af cases and controls for extraction; 4) studies published in english; and 5) distribution of genotype in controls was in accord with hardy - weinberg equilibrium (hwe). The exclusion criteria were: 1) duplicated studies; 2) studies not conforming to hwe; and 3) incomplete raw data . In case of disagreement on the quality scores between the 2 reviewers, differences were resolved through discussion and consultation with a third reviewer . The following information was extracted from each selected study: name of the first author, year of publication, ethnicity, sample size, age, sex, incidence of hypertension and coronary artery disease, af type, and genotypic distribution of in cases and controls . The quality of each selected study was assessed by 2 reviewers using the newcastle - ottawa scale (nos) quality system . Genotypic distribution of the controls from selected studies was assessed using hwe with fisher s exact test . All statistical analyses were conducted using stata statistical software 12 . In the current meta - analysis, 5 genetic models allelic model (g versus a), recessive model (aa versus ga + gg), dominant model (ga + aa versus gg), homozygous (gg versus aa), and heterozygous genetic models (gg versus ga) were used to confirm the relationship of cav1 rs3807989 polymorphism with the risk of af using the combined odds ratios (ors) with corresponding 95% confidence intervals (cis). The q - test and the i statistic (range, 0100%) if p<0.1 or i> 50%, the study would be judged to have significant heterogeneity and the random - effects model was used to estimate the pooled or (dersimonian and laird methods); otherwise, the fixed - effects model was used (the mantel - haenszel method). Publication bias was estimated using begg s funnel plot . Funnel plot asymmetry was determined by egger s linear regression test . We searched for studies about the association of cav1 rs3807989 polymorphism with the risk of af in the electronic databases pubmed, medlin, and web of science before august 20, 2015 . Rs3807989 or polymorphism or 7q31 and atrial fibrillation (af). Only studies conducted in humans were included . Concurrently, we manually reviewed the references of reviews to search for additional relevant articles . If the same population was replicated in over 1 publication, only the most recent study with complete data was included in this meta - analysis . The inclusion criteria were: 1) cohort or case - control studies; 2) studies about the association between the cav1 rs3807989 (g / a) polymorphism and risk of af; 3) studies that provide detailed genetic frequency data (aa, ga, and gg) in af cases and controls for extraction; 4) studies published in english; and 5) distribution of genotype in controls was in accord with hardy - weinberg equilibrium (hwe). The exclusion criteria were: 1) duplicated studies; 2) studies not conforming to hwe; and 3) incomplete raw data . In case of disagreement on the quality scores between the 2 reviewers, differences were resolved through discussion and consultation with a third reviewer . The following information was extracted from each selected study: name of the first author, year of publication, ethnicity, sample size, age, sex, incidence of hypertension and coronary artery disease, af type, and genotypic distribution of in cases and controls . The quality of each selected study was assessed by 2 reviewers using the newcastle - ottawa scale (nos) quality system . Genotypic distribution of the controls from selected studies was assessed using hwe with fisher s exact test . All statistical analyses were conducted using stata statistical software 12 . In the current meta - analysis, 5 genetic models allelic model (g versus a), recessive model (aa versus ga + gg), dominant model (ga + aa versus gg), homozygous (gg versus aa), and heterozygous genetic models (gg versus ga) were used to confirm the relationship of cav1 rs3807989 polymorphism with the risk of af using the combined odds ratios (ors) with corresponding 95% confidence intervals (cis). The q - test and the i statistic (range, 0100%) if p<0.1 or i> 50%, the study would be judged to have significant heterogeneity and the random - effects model was used to estimate the pooled or (dersimonian and laird methods); otherwise, the fixed - effects model was used (the mantel - haenszel method). Publication bias was estimated using begg s funnel plot . Funnel plot asymmetry was determined by egger s linear regression test . A p value less than 0.05 was considered statistically significant . A total of 4 articles [5,1719] involving the association of cav1 rs3807989 polymorphism with af risk were selected in this meta - analysis, including 3758 af cases and 6126 controls . A detailed flow diagram of the search process for this meta - analysis is displayed in figure 1 . Table 1 shows the main characteristics of the selected studies and the characteristics of included patients are listed in table 2 . As shown in figure 2, all 5 comparisons revealed the association between cav1 rs3807989 polymorphism and af risk after meta - analysis with fixed- or random - effects models: allelic model (g / a; or=1.228, 95%ci: 1.0611.420; p=0.006), homozygote model (gg / aa; or=1.439, 95%ci: 1.0941.894; p=0.009), heterozygote model (gg / ga; or=1.257, 95%ci: 1.0641.486; p=0.007), dominant model (gg / aa+ga; or=1.287, 95%ci: 1.0761.540; p=0.006), and recessive model (aa / ga+gg; or=0.738, 95%ci: 0.6290.867; p<0.001). The overall analyses based on all included studies suggested allelic g carriers might have a higher risk for af . Sensitivity analysis was performed to assess the influence of each selected study on the total results . Sensitivity analysis revealed that there was no single study influencing the stability of the crude results, due to no changes in the corresponding pooled ors (figure 3). Begg s funnel plot showed an approximately symmetrical shape (figure 4) and no publication bias was observed in egger s test (p= 0.666). A total of 4 articles [5,1719] involving the association of cav1 rs3807989 polymorphism with af risk were selected in this meta - analysis, including 3758 af cases and 6126 controls . A detailed flow diagram of the search process for this meta - analysis is displayed in figure 1 . Table 1 shows the main characteristics of the selected studies and the characteristics of included patients are listed in table 2 . As shown in figure 2, all 5 comparisons revealed the association between cav1 rs3807989 polymorphism and af risk after meta - analysis with fixed- or random - effects models: allelic model (g / a; or=1.228, 95%ci: 1.0611.420; p=0.006), homozygote model (gg / aa; or=1.439, 95%ci: 1.0941.894; p=0.009), heterozygote model (gg / ga; or=1.257, 95%ci: 1.0641.486; p=0.007), dominant model (gg / aa+ga; or=1.287, 95%ci: 1.0761.540; p=0.006), and recessive model (aa / ga+gg; or=0.738, 95%ci: 0.6290.867; p<0.001). The overall analyses based on all included studies suggested allelic g carriers might have a higher risk for af . Sensitivity analysis was performed to assess the influence of each selected study on the total results . Sensitivity analysis revealed that there was no single study influencing the stability of the crude results, due to no changes in the corresponding pooled ors (figure 3). Begg s funnel plot showed an approximately symmetrical shape (figure 4) and no publication bias was observed in egger s test (p= 0.666). We found a significant association of cav1 gene rs3807989 polymorphism with af risk under 5 comparisons: allelic, homozygous, heterozygous, dominant, and recessive genetic models . These findings suggested that individuals with g allele of cav1 gene rs3807989 polymorphism may experience a higher risk of af . As the most common clinical sustained arrhythmia with complex pathogenesis, af reportedly has a hereditary susceptibility . In the past few years, numerous case - control and cohort studies have strongly demonstrated the important roles of multiple genetic variants on genetic predisposition to af . Gwass have identified several susceptibility loci on chromosomes 3p22, 5q35, 7q31, 12p12, and 12q24 that are potentially associated with af . Three gwass identified snp rs3807989 in cav1 to be related with af risk in populations of european ancestry . However, several subsequent replication studies yielded inconsistent results; some studies indicated a significant association of rs3807989 with af, but the others revealed no association . The snp rs3807989 is located on the chromosome of 7q31 in the second intron of cav1 gene encoding caveolin-1 . Caveolin-1 (cav1) is a key isoform of caveolae, which are 50- to 100-nm plasma membrane vesicles that play roles in cell signaling and are rich in cholesterol . Moreover, the roles of cav1 in the regulation of plasma lipoprotein metabolism has also been shown . In addition, af risk is reportedly associated with mutations and genomic variants in genes that encode ion channels . It was reported that caveolin-1 interacts with potassium channel subunit kir2.1, generating potassium current ik1, which affects af development . Furthermore, caveolin-1 was shown to affect transforming growth factor beta 1 (tgf - b1) signaling, which has roles in atrial fibrosis . Therefore, it is possible that snp rs3807989 may enhance risk of af by regulating the function of these cardiac potassium channels and altering tgf - b1 signaling . In this meta - analysis, we pooled all eligible studies to analyze the association between cav1 gene rs3807989 polymorphism and af risk, with a sample size of 3758 af cases and 6126 controls . Firstly, in view of the influence of multiple factors on af, the results would be more precise if individual data were adjusted with some other variables associated with af risk, including coronary heart disease, hypertension, and family history . Secondly, in this meta - analysis we only included the studies published in english, which might have biased the results . Finally, only investigating the cav1 gene rs3807989 polymorphism without considering other genes or polymorphisms might have provided insufficient statistical power; therefore, further investigation of the interaction of this polymorphism with other risk factors for af is required . Our results revealed a significant association between cav1 gene rs3807989 polymorphism and susceptibility to af, suggesting that the presence of allelic g might be one of the genetic factors conferring susceptibility to af . To confirm this association,
Oro - facial - digital syndromes (ofds) are a rare heterogeneous group of development disorders in which at least nine different forms have been described . Ofd ii mohr's syndrome is transmitted as an autosomal recessive condition characterized by malformations of the oral cavity, face and digits . Facial and oral features include tongue nodules, cleft or high - arched palate, missing teeth, broad nose and cleft lip . Digital features include clinodactyly, polydactyly, syndactyly, brachydactyly and duplication of the hallux . Other systemic features include conductive deafness, choroidal coloboma, renal and congenital heart defects in variable combination . The incidence of mohr's syndrome is very rare and occurs in one in 3 lakh live births . We report a case of young indian female suffering from ofd type ii (mohr's syndrome) with otolaryngological manifestations . A 15-year - old indian female from western maharashtra born out of consanguineous marriage at full term presented with difficulty in speech and decreased hearing in both ears since birth . Her mother had a first pregnancy with premature delivery at 7 months and child died immediately after birth . She has two siblings who are normal . During infancy, she had difficulty in feeding due to the high arched palate and tongue nodules . There was no history of radiation exposure or any significant drug intake or any trauma or any major illness during pregnancy period of her mother . Vital signs revealed pulse 90/min, regular in nature, blood pressure: 120/80 mmhg right arm supine position . Clinical examination revealed mild pallor, bilateral polysyndactyly with duplicated thumbs on both hands and bilateral polysyndactyly of halluces [figures 1 and 2], missing central incisors, broad nose, high arched palate, ocular hypertelorism and unusual presentation low set ears [figure 3] and tongue nodules [figure 4]. Clinical image shows bilateral polysyndactyly of hand, bilateral duplicated thumbs clinical image shows bilateral polysyndactyly of halluces clinical image shows missing central incisors and broad nose and high arched palate and low set ears clinical image shows tongue nodule cardiac, respiratory, abdominal, neurological examinations were unremarkable and intelligence was normal . Ophthalmic examination revealed normal fundus . On investigations, hemoglobin - 10.4 g%, total leukocyte count - 7900 cells / mm, dlc- p-79%, l-13%, e-08%, platelets - 275,000/cumm . An x - ray of both hands with forearms anteroposterior (ap) view [figure 5] revealed six metacarpals in right hand showing fusion proximally of third and fourth metacarpals . An x - ray of both feet ap view [figure 6] revealed seven metatarsals on the right side and six metatarsals on the left side . X - ray of hand shows polysyndactyly and bilateral duplication of thumbs x - ray of foot shows polysyndactyly and bilateral duplication of hallux ofds are a heterogeneous group of rare malformative diseases, characterized by abnormalities of the oral cavity, maxillo - facial region and digits . Such phenotypical pattern was first described by mohr in 1941 and later defined as oro - digital - facial dysostoses by papillon - lage and psaume in 1954 and finally named ofds in 1967 by rimoin and engerton . The brachydactyly characters observed in the patient, which is one of the major symptoms of mohr syndrome is explained by norwegian geneticist mohr . There are atleast nine different forms of ofds on the basis of inheritance transmission pattern and phenotypical spectrum, of which the first two types are of common occurrence as compared with other varieties . Ofds ii is a rare autosomal recessive disease whose diagnosis is based only on clinical evidence . Frequency is rare, one in 3 lakhs live births . The molecular genetic basis is still unknown . Because of the variable clinical expression, even intrafamilial, the attribution of the correct diagnosis among the several forms of ofds is often difficult . In addition, the molecular genesis is still unknown for all ofds except for the ofd i which is related to the cxorf 5 gene (xp22.222.3) coding for ofd 1 protein . Ofd ii (mohr syndrome) is similar to ofd i in that affected individuals usually have hand abnormalities, lobulated tongues and cleft abnormalities . However, a broad nose with a bifid tip is seen in ofd ii instead of the alar hypoplasia which characterizes ofd i. the bilateral hallux, polysyndactyly when present is strongly suggestive of ofd ii . Ofd ii is characterized by distinct tongue nodules, rather than the bifid tongue more commonly seen in ofd i. the histopathology of tongue nodules of ofd ii would be either hamartoma or lipoma . Although both ofd i and ofd ii may present with porencephaly, corpus callosum agenesis is not seen in ofd ii . Conductive hearing loss, typically not seen in ofd i, has been reported in ofd ii . Ofd i is the only type in which renal cysts occur which grossly resemble adult polycystic kidney disease, although sometimes types vi and vii may also manifest with renal abnormalities . Laryngeal hypoplasia and tracheal stenosis have also been described in a small subset of individuals with ofd ii . However, cowden syndrome is characterized by multiorgan hamartomas, whereas in ofd the hamartomas are limited to the tongue alone . Unique and uncommon features noted in this case: bilateral duplication of thumbslow set ears . Bilateral duplication of thumbs with the clinical knowledge and typical radiological appearance, we diagnosed this case as mohr's syndrome type ii ofds . Ofd type ii mohr's syndrome is rarer than ofd i and gets easily confused with, therefore distinctive features and clinico - radiological knowledge between these two is essential and be considered prior to its implications in genetic counseling of such patients . The authors certify that they have obtained all appropriate patient consent forms . In the form the patient(s) has / have given his / her / their consent for his / her / their images and other clinical information to be reported in the journal . The patients understand that their names and initials will not be published and due efforts will be made to conceal their identity, but anonymity cannot be guaranteed there are no conflicts of interest . The authors certify that they have obtained all appropriate patient consent forms . In the form the patient(s) has / have given his / her / their consent for his / her / their images and other clinical information to be reported in the journal . The patients understand that their names and initials will not be published and due efforts will be made to conceal their identity, but anonymity cannot be guaranteed
During the last decades, evidence has emerged to support the relationship between periodontal infection and systemic conditions including cardiovascular diseases, diabetes, obesity and metabolic syndrome . Unlike the most common form of chronic periodontitis (cp), aggressive periodontitis (agp) develops early in life, progresses faster, and presents more destructive clinical features . It has been indicated that systemic factors play a greater role in the etiology of agp, which in turn exert greater effects on systemic conditions . As expected, higher serum levels of inflammatory mediators, such as interleukin (il)-17, tumor necrosis factor- (tnf-) and c - reactive protein (crp), have been detected in patients with cp compared to controls, which became even higher in agp patients, even if whose clinical parameters were less severe . The increased systemic inflammation burden has been suggested to be a possible link between periodontal disease and systemic health . For example, pro - inflammatory cytokines were shown to play important roles in the development of dyslipidemia and impaired glucose tolerance, which have been considered as risk factors for many systemic diseases . Leptin, since discovered in 1994, has provided important insights into the intricate network linking nutrition, metabolism, and immune homeostasis . This 16-kda adipose tissue - derived molecule plays important roles in regulating lipid and glucose metabolism, and elevated plasma leptin concentrations have been suggested as an independent risk factor for cardiovascular diseases . In recent years, clinical studies indicated an association between leptin and periodontal infection . Serum leptin concentration was reported to be significantly elevated in cp patients compared with periodontal healthy subjects, and was positively correlated with periodontal parameters including probing depth and clinical attachment loss, and could be effectively reduced by periodontal treatment . These results suggested that the systemic leptin level could be greatly influenced by the periodontal conditions, and is a potential mediator between periodontitis and systemic health . We and others have shown elevated systemic inflammatory markers including peripheral leukocytes counts, crp and il-6 in patients with agp . However, evidence is still lacking about whether there is an association between the circulating leptin concentration and the systemic inflammation in patients with agp . The aim of the present study was to evaluate the change of leptin concentration in peripheral blood in patients with agp, and to explore the relationship between leptin and systemic inflammation markers . The present study was conducted with the written informed consent of all subjects and was approved by the ethics committee of the peking university health science center . Ninety patients with generalized agp (33 males and 57 females), aged 1442 years, were recruited from the clinic of the periodontology department, peking university school and hospital of stomatology between july 2001 and may 2006 . The diagnosis criteria were defined according to the classification developed at the international workshop for a classification of periodontal diseases and conditions in 1999: the onset of periodontal disease generally occurred at <35 years of age, and there were at least eight teeth with probing depth (pd)> 6 mm and with radiographic evidence of alveolar bone loss . Other factors were also considered: familial aggregation, rapid progression, and the relationship between local factors and periodontal destruction . Forty - four healthy volunteers (16 males and 28 females), aged 2048 years, were recruited from the staff and students of the peking university school and hospital of stomatology . The inclusion criteria were no site with clinical attachment loss, no site with pd> 3 mm, no bone loss on radiographs, and less than 10% of sites with bleeding on probing . The exclusion criterions included systemic diseases, smoking, periodontal therapy within the previous year, antibiotics intake within the previous 3 months, and pregnancy . By their own acknowledgment, all study subjects were free of systemic diseases and were not taking any medication known to affect periodontal status . All recruited subjects accepted a comprehensive blood examination and were referred to physicians when necessary . All subjects belonged to the han race, which makes up the majority of the chinese population . Each study subject filled out a questionnaire that noted general background (including weight and height), medical and dental care history, oral hygiene habits, and social status . The body mass index (bmi) was calculated as weight in kilograms divided by height in meters squared . According to our previous results, systemic inflammatory markers including white blood cell (wbc) count, il-1, il-6, crp and tnf- may be correlated with periodontal infection . Serum protein variables such as albumin (alb)/globulin ratio (a / g) were also associated with the severity of periodontal destruction . A peripheral blood sample was obtained from each fasting examinee by venipuncture between 8:00 a.m. and 10:00 a.m., and was divided into two tubes . One tube contained ethylenediaminetetraacetic acid (edta) and was used for blood cell analysis by hematology analyzers (sysmex kx-21, sysmex, kobe, japan); the other did not contain edta and was used for serum protein analyses by a biochemical analyzer (hitachi 7060, hitachi, tokyo, japan). Serum protein parameters included total protein, alb, globulin, and a / g . Plasma samples were obtained from edta - containing tubes and were separated and immediately stored frozen at 70c until required for analysis . Plasma levels of leptin, il-1 and il-6 were determined using commercially available enzyme - linked immunosorbent assay (elisa) kits (r and d systems, inc ., minneapolis, mn, usa); and the lower limits of detection were 7.8 pg / ml, 1 pg / ml and 0.16 pg / ml respectively . Plasma level of crp was measured using a commercially available elisa kit (diagnostic system laboratories, inc ., plasma levels of tnf- were measured using a commercially available elisa kit (bender medsystems, inc ., vienna, austria) and the lower limit of detection was 0.13 pg / ml . These assays were performed according to the manufacturer's protocol . Plasma leptin levels were analyzed with the analysis of covariance model, controlling for age, gender, and bmi as confounders . Partial correlation coefficients between leptin and other parameters including clinical values, hematologic parameters, and pro - inflammatory cytokines were determined, controlling for the potential confounders mentioned above . The values of age, bmi, plasma leptin level, blood cell and serum protein variables were described by mean standard deviation (sd). Plasma levels of crp, il-6, il-1 and tnf- were described by median and interquartile range, and were log10 transformed for the correlation and regression analyses as a result of their nonnormal distributions . Chicago, il, usa) was used for analyses, and p <0.05 was considered as statistically significant . The present study was conducted with the written informed consent of all subjects and was approved by the ethics committee of the peking university health science center . Ninety patients with generalized agp (33 males and 57 females), aged 1442 years, were recruited from the clinic of the periodontology department, peking university school and hospital of stomatology between july 2001 and may 2006 . The diagnosis criteria were defined according to the classification developed at the international workshop for a classification of periodontal diseases and conditions in 1999: the onset of periodontal disease generally occurred at <35 years of age, and there were at least eight teeth with probing depth (pd)> 6 mm and with radiographic evidence of alveolar bone loss . Other factors were also considered: familial aggregation, rapid progression, and the relationship between local factors and periodontal destruction . Forty - four healthy volunteers (16 males and 28 females), aged 2048 years, were recruited from the staff and students of the peking university school and hospital of stomatology . The inclusion criteria were no site with clinical attachment loss, no site with pd> 3 mm, no bone loss on radiographs, and less than 10% of sites with bleeding on probing . The exclusion criterions included systemic diseases, smoking, periodontal therapy within the previous year, antibiotics intake within the previous 3 months, and pregnancy . By their own acknowledgment, all study subjects were free of systemic diseases and were not taking any medication known to affect periodontal status . All recruited subjects accepted a comprehensive blood examination and were referred to physicians when necessary . All subjects belonged to the han race, which makes up the majority of the chinese population . Each study subject filled out a questionnaire that noted general background (including weight and height), medical and dental care history, oral hygiene habits, and social status . The body mass index (bmi) according to our previous results, systemic inflammatory markers including white blood cell (wbc) count, il-1, il-6, crp and tnf- may be correlated with periodontal infection . Serum protein variables such as albumin (alb)/globulin ratio (a / g) were also associated with the severity of periodontal destruction . A peripheral blood sample was obtained from each fasting examinee by venipuncture between 8:00 a.m. and 10:00 a.m., and was divided into two tubes . One tube contained ethylenediaminetetraacetic acid (edta) and was used for blood cell analysis by hematology analyzers (sysmex kx-21, sysmex, kobe, japan); the other did not contain edta and was used for serum protein analyses by a biochemical analyzer (hitachi 7060, hitachi, tokyo, japan). Serum protein parameters included total protein, alb, globulin, and a / g . Plasma samples were obtained from edta - containing tubes and were separated and immediately stored frozen at 70c until required for analysis . Plasma levels of leptin, il-1 and il-6 were determined using commercially available enzyme - linked immunosorbent assay (elisa) kits (r and d systems, inc ., minneapolis, mn, usa); and the lower limits of detection were 7.8 pg / ml, 1 pg / ml and 0.16 pg / ml respectively . Plasma level of crp was measured using a commercially available elisa kit (diagnostic system laboratories, inc . Plasma levels of tnf- were measured using a commercially available elisa kit (bender medsystems, inc ., vienna, austria) and the lower limit of detection was 0.13 pg / ml . These assays were performed according to the manufacturer's protocol . Plasma leptin levels were analyzed with the analysis of covariance model, controlling for age, gender, and bmi as confounders . Partial correlation coefficients between leptin and other parameters including clinical values, hematologic parameters, and pro - inflammatory cytokines were determined, controlling for the potential confounders mentioned above . The values of age, bmi, plasma leptin level, blood cell and serum protein variables were described by mean standard deviation (sd). Plasma levels of crp, il-6, il-1 and tnf- were described by median and interquartile range, and were log10 transformed for the correlation and regression analyses as a result of their nonnormal distributions . Chicago, il, usa) was used for analyses, and p <0.05 was considered as statistically significant . Mean ages of control and agp groups were 25.6 3.8 years and 26.2 4.9 years, respectively . There was no difference in the mean values for age and bmi between the two groups and no significant difference for gender distribution . Mean plasma leptin level of agp group was 19.7 4.4 ng / ml, significantly higher than that of the control group (7.5 1.3 ng / ml, p <0.01). Table 1 also presented the results of blood cell analysis and serum protein assessment . Compared with the control group, significantly higher wbc and neutrophil counts were observed in the agp group; the alb and a / g were significantly lower in the agp group than in the control group (p <0.01). Population variables and blood parameters of control and agp groups * compared to the control group, p <0.01 . Bmi: body mass index; wbc: white blood cell; neut: neutrophil; lym: lymphocyte; alb: albumin; a / g: albumin / globulin ratio; agp: aggressive periodontitis; sd: standard deviation . Plasma levels of crp, il-1, il-6 and tnf- were significantly higher in agp patients compared with controls (p <0.01). Plasma levels of inflammatory cytokines of control and agp groups * compared with the control group, p <0.01 . Il: interleukin; crp: c - reactive protein; tnf-: tumor necrosis factor-; iqr: interquartile range; agp: aggressive periodontitis . Results of partial correlation analyses were shown in tables 35 . When all the subjects in both groups were pooled for analyses, after controlling for age, gender and bmi, plasma leptin level was significantly positively correlated with wbc and neutrophil counts as well as log - transformed levels of pro - inflammatory cytokines, and the partial correlation coefficients ranged from 0.199 to 0.376 (p <0.05). A negative correlation was observed between plasma leptin level and a / g as well as alb, and the r values were 0.246 and 0.198 respectively (p <0.01). Multiple linear regression analysis was performed to explore the relationship between leptin and other parameters . Gender, age, bmi and significant variables in the partial correlation analysis were evaluated . Using stepwise method, log - transformed il-1 and il-6 entered the final model, and the standardized values were 0.422 and 0.461, respectively (p <0.001). The relationship between the levels of plasma leptin and blood parameters (controlling for age, gender and bmi) * p <0.05; p <0.01 . Wbc: white blood cell; neut: neutrophil; lym: lymphocyte; alb: albumin; a / g: albumin / globulin ratio; bmi: body mass index . The relationship between the levels of plasma leptin and inflammatory cytokines (controlling for age, gender and bmi) * p <0.05; p <0.01 . Il: interleukin; crp: c - reactive protein; tnf-: tumor necrosis factor-; bmi: body mass index . Results of multiple linear regression analysis, stepwise method used (adjusted r = 0.376) although numerous research have investigated the serum leptin levels in patients with gingivitis and cp, few evidence is present about that in patients with agp, which is a distinct form of periodontitis and characterized by early onset and rapid and severe periodontal destruction, as well as its relationship with systemic inflammatory markers . As far as we knew, this study provided the first evidence about the positive association between plasma leptin levels and systemic inflammatory markers including wbc and neutrophil counts, il-1 and il-6 in patients with agp . However, previous evidence showed that resident cells in the inflammatory periodontal tissue could be an important source of inflammatory mediators, among which il-1 and il-6 were both involved . Leptin, with a striking structural similarity with il-6, shares regulatory and functional similarity with il-6 as well . Another research from our group has shown that healthy resident cells in periodontal tissues, such as gingival epithelial cells, gingival connective cells and periodontal ligament cells, all expressed leptin to some extent both in vivo and in vitro . Thus, the mechanism contributing to the up - regulation of plasma il-6 levels in periodontitis may propose the same effect on the change of plasma leptin levels . On the other hand, the released lipopolysaccharide, tnf and il-1 from periodontal infection may increase the adipose tissue leptin mrna expression, hereby circulating leptin levels more significantly as suggested by animal studies . In consistent, plasma leptin level positively correlated with the values of systemic inflammation markers even after controlling for age, gender, and bmi . Results from multiple linear regression analysis suggested that the higher plasma leptin level in agp group may attribute to elevated plasma il-1 and il-6 levels, which have been observed in agp patients according to our present and previous studies . Previous studies have observed that serum leptin levels increased as the severity of periodontal inflammation progressed, which were lowest in the controls, moderate in patients with chronic gingivitis and highest in those with cp . Our previous study found that the plasma leptin level in agp reached 20 ng / ml on average, even higher than the reported 12 ng / ml in cp with comparable pd . The rise of serum leptin level above 10 ng / ml is considered as a risk factor for cardiovascular disease . Preliminary evidence has shown the elevated serum leptin level in cp was associated with type 2 diabetes and acute myocardial infarction . Thus, it is reasonable to suspect that the even higher serum leptin levels in patients with agp may provide a stronger interrelationship between local infection and systemic conditions . In summary, plasma leptin levels may be associated with the inflammatory cytokines from periodontal infection, especially in an aggressive form . These results suggested that leptin could be a potential connection between local infection and systemic health . One of the explanations is that other factors that may affect the circulating leptin level such as body fat percentage and lifestyles were not considered in our study . Within the limitation of the present study, elevated plasma leptin concentration was associated with increased systemic levels of inflammatory markers, especially il-1 and il-6, in agp patients after controlling for age, gender, and bmi.
Breast cancer is the most common type of cancer in canadian women [1, 2]. Every year in ontario, radiation therapy has been established as an effective adjuvant therapy for breast cancer . With radiation therapy, patients no longer need to undergo mastectomy to remove the whole breast . Instead, only a small part of the breast needs to be removed, and the rest is treated by radiation therapy . Lumpectomy and whole breast radiation achieve the same survival rate as mastectomy, but offers much better cosmetic results and improved health - related quality of life [2, 7, 8]. Brachytherapy has emerged as a newer technique that may offer similar control rates as whole breast radiation with the additional benefits such as shorter treatment days and improved convenience [9, 10]. Another benefit of brachytherapy for breast cancer treatment is that it has the potential to overcome the problems associated with external beam radiation therapy, such as burning of the skin [911]. In brachytherapy, radioactive sources are implanted directly into the breast . At the toronto - sunnybrook regional cancer center, several software packages for treatment planning were analyzed, such as pinnacle and varian as well as some manual intervention procedures [2, 4, 12]. These systems use ultrasound guidance and have been shown to be very successful . However, these techniques are not suitable for breast brachytherapy because the nature of operation for breast is inherently different than for other organs; furthermore, there are no existing software solutions entirely suitable for this type of treatment [2, 7]. Consequently, we sought out to design and build a system to overcome these shortcomings for breast cancer brachytherapy . This 3d virtual simulation environment can be used for seed placement planning, dose analysis, seeds location and spacing examination, modification, visualization, and position verification . This paper presents a report on this new system called vision that was designed, developed, and refined for breast cancer brachytherapy treatment planning . Vision is based on the technique of adjuvant partial breast irradiation, uses \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$^{103}$$\end{document}103pd permanent seed implants, and was developed at the toronto - sunnybrook regional cancer center . The system achieves 99.73% accuracy in volume estimation measured against the true volume and is statistically significantly more accurate than current existing commercial software at the \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$p=0.05$$\end{document}p=0.05 level . Brachytherapy is one of the more well - known methods for cancer treatment that involves placing radioactive sources directly into or next to the area requiring treatment . This enables clinicians to deliver a high dose with minimal impact on surrounding healthy tissues . Brachytherapy has been shown to be a highly successful treatment for cancers of the prostate, cervix, endometrium, breast, skin, bronchus, esophagus, and head and neck, as well as soft tissue sarcomas and several other types of cancer [1215]. Over the last decade, increasing numbers of breast cancer patients are being treated using interstitial radioactive implants [4, 12, 15]. Systems have been created to assist in the planning for brachytherapy treatments that provide a visualization environments based on ct / mri images [1, 7, 11, 13, 16]. These systems provide doctors with an interactive source layout function, including accurate and quick dosage distribution calculation and dynamical 2d/3d display . These systems also provide features such as data acquisition, registration, segmentation, image processing, 3d reconstruction, and planning report output . Clinical practice has shown they meet the therapeutic demands . However, in these systems, there are deficiencies in the features of the treatment planning interface, validation, and verification modules and in the accuracy of the volume calculation particularly for the breast treatment [4, 12, 13]. One of the more widespread systems used is gzp6a high dose rate (hdr) brachytherapy system . In their system, the authors claim that it is an essential component for evaluating the correctness of non - predefined treatments and is easy use for medical staff . Their system is limited; however, in that, their system provides only a partial solution for the planning breast treatments . Other software systems exist but do not allow for virtual planning [1, 2, 11, 12]. In summary, general solutions for brachytherapy are known; however, there are deficiencies in each of these systems (e.g., tools, planning modules, verification modules, etc .) [1, 2, 4, 1113, 15]. These existing solutions do not adequately provide the full range of tools or support for oncologists to effectively and accurately treat breast cancer patients . Such a system is presented in this paper . In our system, called vision, an entire 3d treatment planning and verification solution are provided . In the design and development of vision, the following method was used: reading ct data set, region of interests (rois), and rt plans from pinnacle;reslicing the ct data, rois, and rt to the oblique direction;reconstructing the volume with high resolution;computing volume interpolation for accurate target volume measurement;simulating the fiducial needle and providing surgical templates;facilitating radiation source editing by designing a customized editor for managing \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$^{103}$$\end{document}103pd source model data;determining a template size for the seed implantation usually the template must cover the whole area of the rois;superimposing the simulated template onto each image that has rois along the gantry angle;providing an interface for placing needle / seeds based on the superimposed template;calculating the radial dose distributions on the seeds placed by computer simulation to avoid hot / cold spots to ensure a uniform dose distribution that will cover the entire planned target volume (ptv) by adjusting source activity and the number / position of needles / seeds;projecting the seeds back to the original image data set for 3d viewing . Reading ct data set, region of interests (rois), and rt plans from pinnacle; reslicing the ct data, rois, and rt to the oblique direction; reconstructing the volume with high resolution; computing volume interpolation for accurate target volume measurement; simulating the fiducial needle and providing surgical templates; facilitating radiation source editing by designing a customized editor for managing \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$^{103}$$\end{document}103pd source model data; determining a template size for the seed implantation usually the template must cover the whole area of the rois; superimposing the simulated template onto each image that has rois along the gantry angle; providing an interface for placing needle / seeds based on the superimposed template; calculating the radial dose distributions on the seeds placed by computer simulation to avoid hot / cold spots to ensure a uniform dose distribution that will cover the entire planned target volume (ptv) by adjusting source activity and the number / position of needles / seeds; projecting the seeds back to the original image data set for 3d viewing . The data collection phase involves a ct scanner on which the patient lies in prone position . The ct images are taken around the chest region traveling in the direction from the head to the feet . The \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$z$$\end{document}z spacing is 5 mm away from the breast and 2 mm on the breast region . Oncologists manually determine the ptv, clinical target volume (ctv), and iso center and a gantry angle on each slice around the cavity region where the tumor was removed . The gantry angle is parallel with the rib cage to protect needles from going through the rib and lung region during the operation . Seed placement is carried out on the resliced images inside the ptv contours that are reconstructed in the oblique direction . The number of interpolations between two adjacent slices is determined by the distance between them . For example, if the distance is 5 mm, then four interpolations are computed . The reslicing task is done by projecting the data set on the direction perpendicular to the gantry angle after applying interpolation on the ct images and its rois . The new reconstructed data can be described as follows: the \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$x$$\end{document}x direction is parallel with the original \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$z$$\end{document}z directionthe \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$y$$\end{document}y direction is same as the original \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$y$$\end{document}y direction with an angle that is derived from the gantry angle.from posterior to anterior: the \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$z$$\end{document}z direction parallel with the original \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$x$$\end{document}x direction with an angle equal to the gantry angle.the total number of resliced slices is automatically calculated using the rois size along the gantry angle and is described by the following equation:\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\begin{aligned} \mathrm{total\,number}_{\mathrm{reslices}} = \left (\frac{\mathrm{roi\,size\,along\,gantry\,angle}}{\mathrm{\,reslice\,thickness}} \right) + 1 \end{aligned}$$\end{document}totalnumberreslices = roisizealonggantryanglereslicethickness+1the original data set is recalculated from the view that the gantry angle is specified by oncologist and is suitable for seed placement procedure, see figs . 1 and 2.fig 2 vision s reslice views: original data (left), and reconstructed from the left image (right) the \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$x$$\end{document}x direction is parallel with the original \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$z$$\end{document}z direction the \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$y$$\end{document}y direction is same as the original \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$y$$\end{document}y direction with an angle that is derived from the gantry angle . The \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$z$$\end{document}z direction parallel with the original \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$x$$\end{document}x direction with an angle equal to the gantry angle . Vision s reslice image calculations vision s reslice views: original data (left), and reconstructed from the left image (right) the interpolation component is designed to reconstruct image data and treatment volumes from the original slice thickness and spacing (can be any size) into 1 mm in spacing . Therefore, the new resolution is always equal to 1 mm . With 5 mm spacing between two adjacent slices, four interpolated images and contours are created to achieve 1 mm of unit spacing . When creating interpolation contours, two types of interpolation process are encountered, overlapped and intersected types . The intersect type is that one contour is inside the other; the overlapped type is that one contour partially inside the other . The interpolation contour is the dividing line that is equally dividing the region between two contours when only one interpolation is required . 3morphological interpolation process morphological interpolation process when 2d contours are used to define treatment volumes, a partially subjective process is underlined . The accuracy of volume definition depends on numerous image parameters such as the contrast to noise ratio and the signal - to - noise ratio . The volume definition using 2d contours is especially difficult at the edges of the target because of the partial volume effect that is related mostly to the image slice thickness . A low inter- and intra - observer reproducibility was reported in different clinical studies, mainly because of the subjective and objective factors . Consequently, a probability function was designed in vision to study the partial volume effect of the volume definition caused by the 2d contouring method . The function is presented below using 26 for the total number of voxels in the neighborhood:\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\begin{aligned} p=\frac{\mathrm{number}\, \mathrm{of}\, \mathrm{voxels}\,\mathrm{in}\, \mathrm{the}\, \mathrm{target}\, \mathrm{volume}}{26} \end{aligned}$$\end{document}p = numberofvoxelsinthetargetvolume26the function is able to measure how many voxels belong to ptv in the neighborhood of current voxel . When the entire neighborhood of the current voxel belongs to the target volume, the probability value (output of the probability function) is 1; otherwise, it is 0 . If part of the neighborhood voxels is inside the target volume and part is outside of the target volume, the probability value is between 0 and 1 . The treatment volume is made up of all the voxels whose neighborhood probability value is greater than the threshold . When the threshold value is larger, the estimated volume is smaller (more neighborhood voxels are excluded from the target volume), see fig . The volumes generated using this probability function is more accurate than other methods when the threshold is set to 0.5.fig . 4volume refinement uses our 3d probability function; the sharp edges are removed with a degree that matches probability setting volume refinement uses our 3d probability function; the sharp edges are removed with a degree that matches probability setting task group 43 (tg-43) from the american association of physicists in medicine (aapm) is currently used at the toronto - sunnybrook regional cancer center . Other kinds of radiation seeds (also called radial sources) can be used as radiation sources . The radial sources are simulated by following aapm tg-43 guidelines for brachytherapy to calculate dose distribution on different radiation sources . A source editor interface allows the user to input the radiation source and dose distribution charts . Currently, [\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$^{103}$$\end{document}103pd (2335) best] is used for breast cancer brachytherapy . Two templates guiding the insertion of needles loaded with seeds are simulated in vision . A fiducial needle used to hook the surgical cavity, which is then attached to a template that guides the insertion of needles, is also simulated . Following image shows a real - time implantation operation using a needle one of the templates.fig . 5seed implantation vision provides an accurate, fast, and easy - to - use interface for seed placement on resliced ct data . Source placement spacing calculation in both 2d and 3d and dose volume histogram (dvh) is available . After seeds are placed on the resliced ct data set, a 3d view with the seeds can be generated for intuitive seed spacing analysis . This is a unique feature of vision that does not exist among commercial brachytherapy treatment planning software systems . This virtual 3d environment displays the seeds in the original data set that provides an intuitive viewing environment . 6virtual seed display on both patient s ptv and ctv with random placed seeds virtual seed display on both patient s ptv and ctv with random placed seeds vision s source editor provides an interface that allows sources to be input and used . Currently, \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$^{103}$$\end{document}103pd (2335) best is used for breast cancer brachytherapy . Figure 7 shows an example of source placement editing in 2d and 3d and its dose volume histogram (dvh). The dose at a particular point is calculated by summing the dose of all the seeds that affect the point . \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$^{103}$$\end{document}103pd (2335) best seed is a cylindrically symmetric source, and dose distribution is a two - dimensional and can be described in terms of a polar coordinate system with its origin at the source center where \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$r$$\end{document}r is the distance to the point of interest and \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$q$$\end{document}q is the angle with respect to the long axis of the source.fig seed placement in 2d and 3d and dose volume histogram (dvh) vision s user interface . Seed placement in 2d and 3d and dose volume histogram (dvh) the dose rate, \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$p(r,\theta) $$\end{document}p(r,), at point (r, \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\theta $$\end{document}) can be written as follows:\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\begin{aligned} p(r,\theta) = s_{k}^{\left [\frac{g(r,\theta)} {g(ro,\theta o)}\right] g(r,\theta)}, \hbox {where} \end{aligned}$$\end{document}p(r,)=skg(r,)g(ro,o)g(r,),where\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$r$$\end{document}r is the distance to the point of interest, \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\theta $$\end{document} is the angle with respect to the long axis of the source, \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$s_{k}$$\end{document}sk is air kerma strength of the source; \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\left [{\frac{g\left ({r,\theta} \right)} {g\left ({r0,\theta 0} \right)}} \right] g\left (r \right) f(r,\theta) $$\end{document}gr,gr0,0grf(r,) is dose rate constant, \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$g(r,\theta) $$\end{document}g(r,) is geometry factor, \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$g(r)$$\end{document}g(r) is radial dose function, \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$f(r, \theta) $$\end{document}f(r,) is anisotropy function . One method of verifying the plan is by projecting the virtual implants back to their original data set . This innovative feature of our vision system allows oncologists to view the implant position and spacing in 3d intuitively . The data collection phase involves a ct scanner on which the patient lies in prone position . The ct images are taken around the chest region traveling in the direction from the head to the feet . The \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$z$$\end{document}z spacing is 5 mm away from the breast and 2 mm on the breast region . Oncologists manually determine the ptv, clinical target volume (ctv), and iso center and a gantry angle on each slice around the cavity region where the tumor was removed . The gantry angle is parallel with the rib cage to protect needles from going through the rib and lung region during the operation . Seed placement is carried out on the resliced images inside the ptv contours that are reconstructed in the oblique direction . The number of interpolations between two adjacent slices is determined by the distance between them . For example, if the distance is 5 mm, then four interpolations are computed . The reslicing task is done by projecting the data set on the direction perpendicular to the gantry angle after applying interpolation on the ct images and its rois . The new reconstructed data can be described as follows: the \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$x$$\end{document}x direction is parallel with the original \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$z$$\end{document}z directionthe \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$y$$\end{document}y direction is same as the original \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$y$$\end{document}y direction with an angle that is derived from the gantry angle.from posterior to anterior: the \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$z$$\end{document}z direction parallel with the original \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$x$$\end{document}x direction with an angle equal to the gantry angle.the total number of resliced slices is automatically calculated using the rois size along the gantry angle and is described by the following equation:\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\begin{aligned} \mathrm{total\,number}_{\mathrm{reslices}} = \left (\frac{\mathrm{roi\,size\,along\,gantry\,angle}}{\mathrm{\,reslice\,thickness}} \right) + 1 \end{aligned}$$\end{document}totalnumberreslices = roisizealonggantryanglereslicethickness+1the original data set is recalculated from the view that the gantry angle is specified by oncologist and is suitable for seed placement procedure, see figs . 1 and 2.fig . 1 vision s reslice image calculations fig . 2 vision s reslice views: original data (left), and reconstructed from the left image (right) the \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$x$$\end{document}x direction is parallel with the original \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$z$$\end{document}z direction the \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$y$$\end{document}y direction is same as the original \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$y$$\end{document}y direction with an angle that is derived from the gantry angle . The \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$z$$\end{document}z direction parallel with the original \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$x$$\end{document}x direction with an angle equal to the gantry angle . Vision s reslice image calculations vision s reslice views: original data (left), and reconstructed from the left image (right) the interpolation component is designed to reconstruct image data and treatment volumes from the original slice thickness and spacing (can be any size) into 1 mm in spacing . Therefore, the new resolution is always equal to 1 mm . With 5 mm spacing between two adjacent slices, four interpolated images and contours are created to achieve 1 mm of unit spacing . When creating interpolation contours, two types of interpolation process are encountered, overlapped and intersected types . The intersect type is that one contour is inside the other; the overlapped type is that one contour partially inside the other . The interpolation contour is the dividing line that is equally dividing the region between two contours when only one interpolation is required . When 2d contours are used to define treatment volumes, a partially subjective process is underlined . The accuracy of volume definition depends on numerous image parameters such as the contrast to noise ratio and the signal - to - noise ratio . The volume definition using 2d contours is especially difficult at the edges of the target because of the partial volume effect that is related mostly to the image slice thickness . A low inter- and intra - observer reproducibility was reported in different clinical studies, mainly because of the subjective and objective factors . Consequently, a probability function was designed in vision to study the partial volume effect of the volume definition caused by the 2d contouring method . The function is presented below using 26 for the total number of voxels in the neighborhood:\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\begin{aligned} p=\frac{\mathrm{number}\, \mathrm{of}\, \mathrm{voxels}\,\mathrm{in}\, \mathrm{the}\, \mathrm{target}\, \mathrm{volume}}{26} \end{aligned}$$\end{document}p = numberofvoxelsinthetargetvolume26the function is able to measure how many voxels belong to ptv in the neighborhood of current voxel . When the entire neighborhood of the current voxel belongs to the target volume, the probability value (output of the probability function) is 1; otherwise, it is 0 . If part of the neighborhood voxels is inside the target volume and part is outside of the target volume, the probability value is between 0 and 1 . The treatment volume is made up of all the voxels whose neighborhood probability value is greater than the threshold . When the threshold value is larger, the estimated volume is smaller (more neighborhood voxels are excluded from the target volume), see fig . The volumes generated using this probability function is more accurate than other methods when the threshold is set to 0.5.fig . 4volume refinement uses our 3d probability function; the sharp edges are removed with a degree that matches probability setting volume refinement uses our 3d probability function; the sharp edges are removed with a degree that matches probability setting task group 43 (tg-43) from the american association of physicists in medicine (aapm) is currently used at the toronto - sunnybrook regional cancer center . Other kinds of radiation seeds (also called radial sources) can be used as radiation sources . The radial sources are simulated by following aapm tg-43 guidelines for brachytherapy to calculate dose distribution on different radiation sources . A source editor interface allows the user to input the radiation source and dose distribution charts . Currently, [\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$^{103}$$\end{document}103pd (2335) best] is used for breast cancer brachytherapy . Two templates guiding the insertion of needles loaded with seeds are simulated in vision . A fiducial needle used to hook the surgical cavity, which is then attached to a template that guides the insertion of needles, is also simulated . Following image shows a real - time implantation operation using a needle one of the templates.fig . Vision provides an accurate, fast, and easy - to - use interface for seed placement on resliced ct data . Source placement spacing calculation in both 2d and 3d and dose volume histogram (dvh) is available . After seeds are placed on the resliced ct data set, a 3d view with the seeds can be generated for intuitive seed spacing analysis . This is a unique feature of vision that does not exist among commercial brachytherapy treatment planning software systems . This virtual 3d environment displays the seeds in the original data set that provides an intuitive viewing environment . 6virtual seed display on both patient s ptv and ctv with random placed seeds virtual seed display on both patient s ptv and ctv with random placed seeds vision s source editor provides an interface that allows sources to be input and used . Currently, \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$^{103}$$\end{document}103pd (2335) best is used for breast cancer brachytherapy . Figure 7 shows an example of source placement editing in 2d and 3d and its dose volume histogram (dvh). The dose at a particular point is calculated by summing the dose of all the seeds that affect the point . \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$^{103}$$\end{document}103pd (2335) best seed is a cylindrically symmetric source, and dose distribution is a two - dimensional and can be described in terms of a polar coordinate system with its origin at the source center where \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$r$$\end{document}r is the distance to the point of interest and \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$q$$\end{document}q is the angle with respect to the long axis of the source.fig seed placement in 2d and 3d and dose volume histogram (dvh) vision s user interface . Seed placement in 2d and 3d and dose volume histogram (dvh) the dose rate, \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$p(r,\theta) $$\end{document}p(r,), at point (r, \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\theta $$\end{document}) can be written as follows:\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\begin{aligned} p(r,\theta) = s_{k}^{\left [\frac{g(r,\theta)} {g(ro,\theta o)}\right] g(r,\theta)}, \hbox {where} \end{aligned}$$\end{document}p(r,)=skg(r,)g(ro,o)g(r,),where\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$r$$\end{document}r is the distance to the point of interest, \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\theta $$\end{document} is the angle with respect to the long axis of the source, \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$s_{k}$$\end{document}sk is air kerma strength of the source; \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\left [{\frac{g\left ({r,\theta} \right)} {g\left ({r0,\theta 0} \right)}} \right] g\left (r \right) f(r,\theta) $$\end{document}gr,gr0,0grf(r,) is dose rate constant, \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$g(r,\theta) $$\end{document}g(r,) is geometry factor, \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$g(r)$$\end{document}g(r) is radial dose function, \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$f(r, \theta) $$\end{document}f(r,) is anisotropy function . One method of verifying the plan is by projecting the virtual implants back to their original data set . This innovative feature of our vision system allows oncologists to view the implant position and spacing in 3d intuitively . We have tested the system using more than 30 data sets of breast cancer patients selected from the toronto - sunnybrook regional cancer center after breast cancer treatment . After seed implantation, 3d viewing of target volume containing all the placed seeds is displayed . The reslice calculation our 3d reconstruction algorithm performs volume interpolation because of the non - uniform resolution of the scanned data sets . Normally, the in - plane (\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$x$$\end{document}x\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$y$$\end{document}y) resolution of a data set is greater than the out - of - plane (\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$z$$\end{document}z) resolution . Our volume interpolation algorithm in vision is able to adjust the number of interpolations between two slices automatically and then interpolate accordingly (see fig . 8). The result spacing and thickness are always a unit of 1 mm between slices . Mathematical morphology operation for medial axis finding and level set method [19, 20] are employed in the interpolation process.fig . 8plain target treatment volume 3d view, without interpolation (left), and with interpolation (right) plain target treatment volume 3d view, without interpolation (left), and with interpolation (right) our volume estimation method produces 99.73% accuracy on sphere phantom data sets . When the probability threshold of volume estimation method is set to 0.5, the volume estimation gives the highest accurate volume estimation result . A statistically significant accuracy improvement on volume estimation was achieved (99.38% from 92.38% at the \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$p=0.05$$\end{document}p=0.05 level). The true volume for this sphere phantom is as follows: 22.45 cm\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$^{3} \quad ({\mathrm{diameter}=3.5\,\mathrm{cm},\mathrm{volume}=\frac{4\pi 3^{3}}{3}}={22.45\,\mathrm{cm}^{3}})$$\end{document}3(diameter=3.5cm, volume=4333=22.45cm3). The volume output from the existing commercial software overestimated the true volume (see table 2; figs . 9, 10).table 1volume estimations using patient ct data sets using different methods (in cm\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$^{3})$$\end{document}3) case no.pinnacleno interpolationinterpolationreslice without interpolationreslice with interpolation110.019.668.789.868.85232.5932.5228.8326.9028.30313.1512.6410.8913.0210.86416.6916.0113.9015.7413.65511.2810.609.5310.679.4864.093.863.494.083.7074.123.893.314.013.30table 2volumes (in cm\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$^{3}$$\end{document}3) and reconstructed volumes after reslice by our method with interpolation and without interpolation on phantom object with known volume (22.45 cm\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$^{3})$$\end{document}3) pinnacleno interpolationinterpolationreslice without interpolationreslice with interpolation24.1624.2323.1324.3422.61fig . 9volume output from existing software, with and without the interpolation method, and pinnacles output (left graph). Volumes comparison: no interpolation, interpolation, reslice no interpolation, and reslice with interpolation (right graph)fig . 10phantom volume estimation: a comparison of several methods: pinnacle, no interpolation, interpolation (on original slices), reslice without interpolation, and reslice with interpolation volume estimations using patient ct data sets using different methods (in cm\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$^{3})$$\end{document}3) volumes (in cm\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$^{3}$$\end{document}3) and reconstructed volumes after reslice by our method with interpolation and without interpolation on phantom object with known volume (22.45 cm\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$^{3})$$\end{document}3) volume output from existing software, with and without the interpolation method, and pinnacles output (left graph). Volumes comparison: no interpolation, interpolation, reslice no interpolation, and reslice with interpolation (right graph) phantom volume estimation: a comparison of several methods: pinnacle, no interpolation, interpolation (on original slices), reslice without interpolation, and reslice with interpolation this paper described vision, a 3d computer - assisted treatment planning system we developed for breast cancer brachytherapy treatment . The system was developed using mathematical theories for accurate volume estimation and dose analysis, as well as advanced 3d visualization technologies . The patient treatment volume reconstructed by a method developed in this project significantly improved the accuracy from existing methods and guarantees the high - volume accuracy requirement of radioactive seed implantation procedure for this treatment . The vision system is a virtual 3d environment that allows radiation oncologists to perform volume measurement, seed placement, and dose distribution planning and analysis based on a set of 2d contours on patient ct images . Vision is able to embed placed seeds on original patient ct images and displayed in an institutive 3d environment that can be easily manipulated by the oncologist . Using our 3d neighborhood probability function to estimate the treatment volume, we were able to rectify the redundant voxels located outside of the target region and minimize the discrepancies in volume definition by 2d manually contouring between adjacent slices . In this research project, advanced mathematical theories were researched and applied, such as mathematical morphology theory, partial differential equations, probability statistics, and mathematical modeling . Our system achieves 99.73% accuracy in volume estimation measured against the true volume and is statistically significantly more accurate than current existing commercial software at the \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$p=0.05$$\end{document}p=0.05 level . Future work will focus on automatic source seed placement that could be adjusted by an oncologist if necessary . The purpose of this work was to optimize the seed placements such that radial dose distributions will be uniformly distributed over the entire ptv to avoid hot / cold spots . This, in turn, will assist an oncologist by minimizing the number of seeds required and potentially increasing the effectiveness of the treatment . The authors certify that we have no affiliations with or involvement in any organization or entity with any financial interest (such as honoraria; educational grants; participation in speakers bureaus; membership, employment, consultancies, stock ownership, or other equity interest; and expert testimony or patent - licensing arrangements) in the subject matter or materials discussed in this manuscript.
The histologic confirmation is necessary for the definite diagnosis and is essential in determining the treatment for patients with cardiac tumors . Depending on the various clinical situations, tissue diagnosis can be made with less invasive methods including cytologic evaluation of pericardial or pleural fluids, or percutaneous biopsy of metastatic subcutaneous lymph nodes . Open heart surgery, mediastinoscopy, and metastatic mass exploration are more invasive methods that require general anesthesia . Percutaneous transvenous biopsy of cardiac tumor can be done under the guidance of transesophageal echocardiography (tee). Recently, intracardiac echocardiography (ice) has been introduced to assist many cardiac procedures and it provides high - quality imaging like tee . Although it needs local anesthesia and venous puncture with relatively large catheter, it can give us a good guidance during the biopsy of cardiac tumors . In this report, we present two cases of cardiac masses documented by percutaneous transvenous biopsy under the guidance of an ice . A 51-year - old woman was admitted to our hospital with a 3-day history of progressive dyspnea and generalized edema . The initial electrocardiogram revealed atrial fibrillation with rapid ventricular response, low qrs voltage, and poor r progression . The chest x - ray showed a water - bottle shaped cardiomegaly and bilateral pleural effusion . The transthoracic echocardiogram (tte) showed a large amount of pericardial effusion with diastolic right atrial (ra) and ventricular collapse associated with inferior vena caval plethora . It revealed infiltrative masses along the superior and posterior aspect of ra wall (fig . The computed tomographic (ct) scan revealed infiltrating mass on ra wall (fig . 1b) and multiple tiny nodules scattered in the whole lung fields . Because the cytologic examination from the pericardial fluid was inconclusive, we performed percutaneous biopsy of the ra mass in order to establish a pathological diagnosis . After placement of an 8 fr ultra ice catheter (acunav, siemens medical solution, mountain view, ca, usa) into the ra, a 6 fr biopsy catheter was inserted into ra and several pieces of ra mass were obtained (fig . The procedure was well tolerated under local anesthesia, and no complication occurred during the procedure . Although the patient was treated with systemic chemotherapy, she died from hepatic rupture associated with multiple liver metastases at 18 months . A 53-year - old man visited our hospital with a 10-day history of progressive dyspnea and weight loss of 4 kg . The ct scan revealed a huge mass infiltrating both atrial wall and posterior mediastinal extension (fig . 2b). Because cytologic confirmation of the pleural fluid was negative and percutaneous needle biopsy of the mediastinal mass could be a high - risk procedure, we performed percutaneous ra mass biopsy in order to get prompt specimens . A 6 fr cardiac biopsy catheter and an 8 fr ultra ice catheter were percutaneously inserted into the ra through the right and left femoral vein, respectively . We obtained several pieces of ra mass with the ice monitoring (fig . 2c and d). A 51-year - old woman was admitted to our hospital with a 3-day history of progressive dyspnea and generalized edema . The initial electrocardiogram revealed atrial fibrillation with rapid ventricular response, low qrs voltage, and poor r progression . The chest x - ray showed a water - bottle shaped cardiomegaly and bilateral pleural effusion . The transthoracic echocardiogram (tte) showed a large amount of pericardial effusion with diastolic right atrial (ra) and ventricular collapse associated with inferior vena caval plethora . It revealed infiltrative masses along the superior and posterior aspect of ra wall (fig . The computed tomographic (ct) scan revealed infiltrating mass on ra wall (fig . 1b) and multiple tiny nodules scattered in the whole lung fields . Because the cytologic examination from the pericardial fluid was inconclusive, we performed percutaneous biopsy of the ra mass in order to establish a pathological diagnosis . After placement of an 8 fr ultra ice catheter (acunav, siemens medical solution, mountain view, ca, usa) into the ra, a 6 fr biopsy catheter was inserted into ra and several pieces of ra mass were obtained (fig . The procedure was well tolerated under local anesthesia, and no complication occurred during the procedure . Although the patient was treated with systemic chemotherapy, she died from hepatic rupture associated with multiple liver metastases at 18 months . A 53-year - old man visited our hospital with a 10-day history of progressive dyspnea and weight loss of 4 kg . The ct scan revealed a huge mass infiltrating both atrial wall and posterior mediastinal extension (fig . 2b). Because cytologic confirmation of the pleural fluid was negative and percutaneous needle biopsy of the mediastinal mass could be a high - risk procedure, we performed percutaneous ra mass biopsy in order to get prompt specimens . A 6 fr cardiac biopsy catheter and an 8 fr ultra ice catheter were percutaneously inserted into the ra through the right and left femoral vein, respectively . We obtained several pieces of ra mass with the ice monitoring (fig . 2c and d). The malignant primary cardiac tumors are extremely uncommon, whereas metastatic cardiac tumors occur more frequently.1,2,3) in a patient suspected of malignant cardiac tumor without an option for curative surgical treatment, histopathological confirmation is a mandatory option next to treatment strategy, regardless of its primary focus . Depending on the various clinical presentations, pathologic diagnosis can be made with less invasive methods such as cytologic evaluation of pericardial or pleural fluids, or percutaneous biopsy of metastatic subcutaneous lymph node . More invasive methods of tumor biopsy through open heart surgery, mediastinoscopy, or metastatic mass exploration may be needed when less invasive approach is not confirmative . Percutaneous transvenous biopsy of cardiac tumor is a good alternative using less invasive tool for tissue diagnosis . Traditionally, the fluoroscopy guidance is the most commonly used for the blunt endomyocardial biopsy . Because the fluoroscopy is inadequate to target the mass lesion, especially in patients with cardiac tumors, many researchers use tte or tee to guide the prompt site for biopsy.4)5) however, tte gives less clear cardiac images than tee, especially for the posterior wall mass and the patient with poor echo window,6) and tee requires general anesthesia during the procedure . Recently, the ice has been introduced to guide several cardiac procedures including device closure for congenital shunts, septal puncture, radiofrequency catheter ablation for arrhythmias, and intracardiac biopsy of tumor.7,8,9,10,11) because ice can give us clearer cardiac imaging without using the general anesthesia, it is more practical and patient - friendly . It can also reduce radiation exposure for the echocardiographer during the procedure . In this report, we showed the feasibility of the ice during targeting of the biopsy catheter, without a requirement of patient sedation . The use of ice during the procedures increase diagnostic yield and can reduce the incidence of cardiac complications associated with inadequate targeting of the biopsy catheters . It can be used for the biopsy of the mass from right - side of the heart, especially in patients with high risk for anesthesia.9,10,11) these ice - guided techniques allow the physician to safely and effectively perform endocardial biopsy with short total procedure time and less exposure to radiation.
The lancefield group g beta - hemolytic streptococci (ggs) have been recognized as pathogens causing serious infections in humans, although ggs can have a commensal relationship when present on the skin, pharynx, intestinal tract, and vagina.1 the major pathological conditions predisposing ggs infections include malignancy, alcoholism, cardiovascular disease, diabetes mellitus, bone and joint diseases, and cirrhosis of the liver . We report a rare case of endogenous endophthalmitis caused by streptococcus equisimilis, a ggs organism . A 74-year - old woman became confused in her daily living, and the confusion was concomitant with a high - grade fever on april 29, 2008 . She was admitted to a local hospital on the following day and was given intravenous ceftriaxone for 9 days . She had a history of cardiac and brain infarctions and was at the postoperative stage of uterine cancer . Ggs was detected in cultures of her blood sample and she was suspected to have infective endocarditis . Although the hospital staff had noticed a moderate swelling of her left eyelid since may 1, 2008, an ophthalmologist did not examine her until she was referred to us on may 9, 2008 . Physical examination showed the patient to be a very ill woman with a body temperature of 38c . Her left eyelids were swollen, and a moderate degree of conjunctival infection with chemosis was observed in her left eye . Transthoracic echocardiography disclosed a mobile mass associated with the mitral valve with moderate valvular regurgitation (figure 1). Laboratory tests demonstrated an elevated leucocyte count of 11850/l with 82% of polymorphonuclear cells, a c - reactive protein level of 10.65 mg / dl, lactate dehydrogenase level of 519 iu / l, amylase level of 175 iu / l, and brain natriuretic peptide level of 450.0 pg / ml . She was immediately hospitalized and on the same day (may 9, 2008) underwent emergency mitral valvuloplasty and both intravitreal and subconjunctival injections of both 1 mg / ml vancomycin and 1 mg / ml meropenem . After the surgery, she was treated with topical antibiotics (levofloxacin) and ointment (oflx) for approximately 1 month, intravenous gentamicin (200 mg / day), and intravenous penicillin g potassium (240,000 iu / day) for 9 days . Her general condition and ocular inflammation gradually improved with the medical therapy . However, her best - corrected visual acuity remained at light perception . Subsequently, cultures from both anterior chamber and vitreous biopsy specimens grew s. equisimilis, which was sequenced by polymerase chain reaction . The s. equisimilis was found to be susceptible to penicillin g, ampicillin, sulbactam sodium / ampicillin sodium, imipenem / cilastatin, levofloxacin, and vancomycin, and was resistant to erythromycin and clarithromycin . S. dysgalactiae subsp . Equisimilis hosts variants within the lancefield group a, c, l, and g carbohydrates, and was recently determined by gene sequencing to be a subspecies of group g of s. equisimilis . Exogenous ggs endophthalmitis has been reported following cataract surgery, penetrating keratoplasty and trabeculectomy.2 on the other hand, endogenous ggs - related endopthalmitis is extremely rare.1 so far, there have been only 8 cases of endogenous ggs - related endophthalmitis;35 4 cases associated with endocarditis, 1 with cellulites of the foot, 1 with facial trauma, 1 with an abscessed tooth, and 1 of unknown origin . We demonstrated a case of an endogenous ggs - related endophthalmitis where s. equisimilis was first identified from both anterior chamber and vitreous biopsies, and where identification was also first made by polymerase chain reaction . The first - line therapy of s. equisimilis - induced infections is penicillin . Besides penicillin, s. equisimilis was sensitive to all of the antimicrobial agents we administered . In our case, we suggest that a delay in the diagnosis would have worsened the general conditions of the patient, and would then lead to a poorer prognosis . At present, the efficacy of immediate ocular therapies including vitrectomy and intravitreal antibiotics against ggs - related endogenous endophthalmitis is still controversial.3 only further investigations will answer this question.
Polycystic ovary syndrome (pcos) is the most common endocrine disorder in women of reproductive age . Pcos produces symptoms in approximately 5 to 10% of women of reproductive age (1245 years old) and is thought to be one of the leading causes of the female subfertility . Pcos is a medical condition, in which there is an imbalance of the female sex hormones i.e. Elevated levels of testosterone, dhea - s, androstenedione, prolactin, and lh along with a normal, high or low estrogen levels . According to the rotterdam criteria, a diagnosis of pcos can be made in a woman if she has 2 of the following 3 manifestations: irregular or absent ovulation, elevated levels of androgenic hormones, and/or enlarged ovaries containing at least 12 follicles each . Other conditions with similar presenting signs, such as androgen - secreting tumors or cushing's syndrome, must be ruled out before a diagnosis of pcos is established . Controversies in continuation of metformin therapy throughout pregnancy, in women who have conceived after treatment of pcos, has remained a controversial topic till date . Hyperinsulinaemia, insulin resistance and impaired glucose tolerance are very common in women with pcos, particularly in those with a body mass index (bmi)> 30, but insulin resistance may occur in lean women with pcos . An insulin action in the ovary is mediated via the insulin receptor rather than the type 1 insulin - like growth factor (igf) receptor, which binds igf - i with high affinity and insulin with low affinity . Hyperinsulinaemia has shown to increase androgen production by the ovaries and hence it may play a central role in the pathogenesis of pcos . In a randomized, placebo - controlled, double blind study, done on 257 pregnant women with pcos, aged 18 - 42 years, who either received metformin or placebo from first trimester to delivery, failed to demonstrate any reduction of pregnancy - related complications, such as gestational diabetes, pre - eclampsia and pre - term delivery in the metformin group . On the contrary, a prospective study done on 98 pregnant women with pcos who received metformin (1700 3000 mg / day) before conception and up to 37 weeks of pregnancy vs. 110 normal pregnant controls, showed a significant reduction of pregnancy complications, such as gestational diabetes and gestational hypertension but an insignificant decrease in pre - eclampsia incidence with comparable mean neonatal apgar scores, weight and length between the 2 groups . Metformin has been shown to have encouraging effects on several metabolic aspects of polycystic ovarian syndrome, such as insulin sensitivity, plasma glucose concentration, and lipid profile and since women with pcos are more likely than healthy women to suffer from pregnancy - related problems like early pregnancy loss, gestational diabetes mellitus and hypertensive states in pregnancy, the use of metformin therapy in these patients throughout pregnancy may have beneficial effects on early pregnancy loss and development of gestational diabetes . However, there is little evidence of its beneficial effect on hypertensive complications in pregnancy . In a 3-year case controlled study, conducted on 197 pregnant women with pcos (confirmed by rotterdam criteria), in which cases comprised of women who continued metformin throughout pregnancy while controls were women who stopped metformin after the first trimester, it was concluded that in comparison to the control group, the study group had a significant reduction in early pregnancy loss . Besides reducing the rates of miscarriages, continuing its use in pregnancy is devoid of any adverse effects on the new born as demonstrated by a case - controlled study, measuring pregnancy outcomes, conducted on 137 women with pcos (rotterdam criteria), in which there were 3 groups . The study found that the group, which continued metformin use throughout the entire pregnancy, had diminished incidences of fetal growth restriction, preterm labor, and increased live birth rates . There were also no congenital anomalies, intrauterine deaths or stillbirths reported in the test subjects, suggesting metformin use is not related to teratogenicity . Besides the above, the group which continued metformin use in the entire pregnancy had reduced incidences of early pregnancy losses and gestational diabetes . Continuing the use of metformin during the first trimester of 66 pregnant women with pcos, demonstrated a lower percentage of small (<10 centile) and large (> 90 centile) for gestational age babies as compared to the 66 control groups of normal women without pcos who did not use metformin . Neonatal hypoglycemia was also less commonly reported in the metformin group with fewer babies requiring intravenous glucose therapy . Metformin is excreted in breast milk, but the amount secreted is clinically insignificant and there have been no reported adverse effects on breastfed infants with mothers who take metformin . A study which measured growth, motor - social development and illness in 61 nursing infants (21 males and 40 females) and 50 formula - fed infants (19 males and 31 females) born to 92 mothers with pcos who were taking metformin (median of 2.55 gm / day) throughout pregnancy and lactation, reported that none of the children had any delay in either growth or in developmental milestones . An important link exists in patients between having an abnormal glucose tolerance test and a history of recurrent spontaneous abortions . Since women with pcos are more prone than healthier women to have an abnormal glucose tolerance test during pregnancy, these women may also be at an increased risk of having spontaneous first trimester abortions . A prospective clinical - controlled trial concluded that metformin use in pregnant patients with an abnormal glucose tolerance test and history of recurrent spontaneous abortions effectively reduced the chances of first trimester abortion with improved chances of a successful pregnancy . Other attributed causes for miscarriages in women with pcos are elevated levels of androgens and luteinizing hormone . Metformin with its favorable effects on androgen and lh levels may be useful in reducing rates of early pregnancy loss when used pre conception and continued through pregnancy . Its modification of lh levels are evident by a prospective randomized controlled trial, conducted on 32 women with pcos with high pretreatment lh values and 32 women with normal cycles who were recruited to receive metformin (850 mg b.i.d) or placebo, for an average duration of 40 days . There was a significant reduction of lh values in pcos women to normal baseline with metformin therapy while the fsh and tsh levels remained normal . These women also showed reduction in their prolactin levels as compared to their previous high pretreatment levels demonstrating the effect of metformin on the pituitary . Contrary to the results of the above - mentioned study, meta - analysis of 17 randomized controlled trials found that metformin use before conception does not reduce abortion risk in women with pcos . Women with polycystic ovaries are more insulin - resistant than weight - matched women with normal ovaries . An insulin resistance is seen in 10 15% of slim and 20 40% of obese women with pcos, and women with pcos are at increased risk of developing type 2 diabetes . Obesity can negatively influence chances of conception, response to fertility treatment as well as increase risks of miscarriages and congenital anomalies along with increasing the risks for pregnancy related complications . Even a moderate amount of weight loss (5 - 10% body weight), before pregnancy, with or without metformin use has shown to be sufficient in improving metabolic markers . Metformin used throughout pregnancy in women with pcos may reduce gestational diabetes incidence by as much as 9-fold . Its use during pregnancy in women with pcos facilitates primary and secondary prevention of gestation diabetes . The reduction in incidence of gestational diabetes mellitus has been attributed to metformin's metabolic, endocrine, vascular, and anti - inflammatory effects . These effects of metformin were demonstrated in a prospective cohort study wherein 360 non - diabetic pcos patients participated who conceived while on metformin by different treatment modalities . The study group comprised of 200 women who continued metformin (1000 - 2000 mg/ day) throughout pregnancy while the control group of 160 women discontinued metformin . The results of the study concluded in favor of the women who continued metformin use who demonstrated statistically significant prevention or reduction in the incidence of gestation diabetes mellitus . Of the other studies, which were performed on patients with gestational diabetes, mellitus one was a case controlled study, done on 100 women with gdm who were exclusively treated with metformin, were compared with 100 with gdm - treated exclusively with insulin matched for age, weight, and ethnicity, showed similar baseline maternal risk factors in both groups and similar incidences of gestational hypertension, pre - eclampsia, induction of labor and rate of cesarean section, but significantly greater mean maternal weight gain from enrollment to term in the insulin group . The pregnancy outcomes in the women who were treated with metformin alone, demonstrated lesser incidence of prematurity, neonatal jaundice and admission to neonatal unit with an overall improvement in neonatal morbidity as compared to the women treated with insulin alone . There was no significant difference in the incidence of fetal macrosomia between the 2 groups of women . Interestingly, a recent randomized controlled trial, done on 100 women with gdm who did not attain euglycemia with diet, were randomized to receive therapy with insulin or oral metformin concluded that metformin was better suited than insulin for prevention of fetal macrosomia, especially in lean or in moderately overweight women developing gdm in late gestation, and insulin was preferred therapy for women with considerable obesity, high fasting blood glucose levels and an early need for pharmacological treatment . The beneficial effects of metformin in pcos women further include weight loss in obese women with significant changes in waist - to - hip ratio, normalization of abnormal lh / fsh ration, and impaired glucose tolerance as well as significant reduction in insulin resistance . Additionally, the use of metformin has a relatively low cost and diminished hazards as compared to those associated with surgical interventions. [2931] a rare but serious side effect reported within 3 weeks of imitation of metformin therapy is a mixed (hepatocellular and cholestatic) type of hepatic damage with raised ast, alt, alp and bilirubin levels. [3234] however, immediate discontinuation of metformin demonstrated an improvement in symptoms and return of liver enzymes to normal baseline value within 3 weeks . Hence, it is advisable to monitor liver function tests in patients receiving metformin therapy . It has encouraging effects on several metabolic aspects of polycystic ovarian syndrome, such as insulin sensitivity, plasma glucose and lipid profile . Its use in patients with pcos during pregnancy reduces a number of pregnancy - related complications, such as gestational diabetes and gestational hypertension . Use of metformin throughout pregnancy in women with pcos has shown to reduce the rates of early pregnancy loss, preterm labor, and prevention of fetal growth restriction . There have been no demonstrable teratogenic effects, intra - uterine deaths, still births or developmental delays reported with metformin use in pregnancy . Despite these favorable effects of metformin use with scarce serious side effects, no definite guidelines recommending metformin use in pregnant women with pcos exists and hence further research on the topic
The mucoadhesive polymer containing oral drug delivery systems has the capacity to prolong residence time of drugs at the absorption site and facilitate intimate contact with underlying absorptive surface to enhance bioavailability . Polymers used in the mucoadhesive formulations include natural, semisynthetic, and synthetic ones . In recent years, a growing interest has been identified in the development of natural polymer - based drug delivery systems due to their biodegradability, biocompatibility, aqueous solubility, swelling ability, easy availability, and cost - effectiveness . Amongst various natural polymers, alginates have been widely used in the development of drug delivery applications [36]. It is composed of linear copolymers of two monomeric units, that is, -d - mannuronic acid and -l - guluronic acid . Sodium alginate (sa) undergoes ionotropic - gelation by ca to form calcium alginate due to an ionic interaction between carboxylic acid groups of alginate chain and ca . Sodium alginate has mucoadhesive property; however, the cross - linked alginates are usually fragile [9, 10]. Therefore, blending of different mucoadhesive polymers is one of the most popular approaches to formulate ionotropically cross - linked alginate - based mucoadhesive beads [9, 11, 12]. Again, blending with suitable polymers, may improve the drug encapsulation, which is found comparatively lower in alginate - based beads prepared by ionotropic - gelation method . Ispaghula (plantago ovata f.) husk is an indigenous product of south asia and is widely used herbal product both in traditional and modern medicines . The ispaghula husk mucilage (ihm) is white, hydrophilic in nature, and forms a colorless gel in presence of water [1416]. Ihm contains a high amount of highly branched neutral arabinoxylan (arabinose 22.6%, xylose 74.6%, and traces of other sugars) and about 35% of nonreducing terminal sugar residues . Few investigations had been carried out to formulate mucoadhesive beads as drug delivery matrices using both untreated ispaghula husk and alkaline treated ispaghula husk directly as polymeric blend with sodium alginate [1, 17, 18]. However, no attempt has been taken to formulate mucoadhesive alginate - based beads using isolated ihm as polymeric blend for the use in drug delivery . In the current investigation, the utility of isolated ihm, as a possible natural polymeric - blend with sa for the development of new ihm - blended alginate beads containing glibenclamide through ionotropic - gelation, glibenclamide is a sulfonylurea used in the treatment of non - insulin - dependent diabetes mellitus (niddm, type - ii) [2, 19]. Its plasma half - life is 46 hours, which makes multiple dosing to maintain the therapeutic blood level . Therefore, it would be beneficial to develop a mucoadhesive system of glibenclamide using ihm - alginate for oral use, which might facilitate an intimate contact with the mucous membranes (i.e., mucoadhesion or bioadhesion) in the gastrointestinal tract, and thus the gastric residence could be prolonged to release glibenclamide at the target site at controlled rate over an extended period to maximize the therapeutic effect . In the development of any pharmaceutical formulation, an important issue is to design a formulation with optimized quality in a short time period and minimum number of trials [20, 21]. Traditionally, pharmaceutical formulators develop various formulations by changing one variable at a time while keeping others fixed . However, many experiments do not succeed in their purpose because they are not properly thought out and designed, and even the best data analysis cannot compensate lack of planning . Therefore, it is essential to understand the influence of formulation variables on the quality of formulations with a minimal number of experimental trials and subsequent selection of formulation variables to develop an optimized formulation using established statistical tools [5, 2224]. Factorial designs, where all the factors are studied in all possible combinations, are considered the most efficient in estimating the influence of individual variables and their interactions performing minimum numbers of experiments . A computer - aided optimization technique based on 3 (two factors and three levels) factorial design and response surface methodology was employed to investigate the effects of two independent process variables (factors), that is, sa: ihm and cross - linker (cacl2) concentration on the properties of glibenclamide - loaded ionotropically gelled ihm - alginate beads such as drug encapsulation and drug release . India), sa (central drug house, india), ispaghula husk (shree baidyanath ayurved bhawan pvt . The mucilage from ispaghula (plantago ovata f.) husk was extracted according to the previously reported method [26, 27]. An amount of 10 ml of 0.1 m hcl was heated to boil in a 100 ml flask and 1 gram of plantago ovata f. husk was added . After total change of color, the flask was finally removed from heat and the solution was filtered through a clean muslin cloth while still hot . In order to separate residual traces of mucilage, the seeds were washed twice with 5 ml of hot water and the solution obtained each time was filtered . The combined filtrate, containing the dissolved mucilage, was mixed with 60 ml of 95% ethyl alcohol, stirred, and allowed to stand for 5 hours . Finally, the supernatant liquid was decanted and the precipitate in the beaker was dried in an oven at 50c . The dried ihm cake was grounded with a mortar and passed through a sieve (0.15 mm mesh size). The isolated ihm powders were packed in a plastic bag and kept airtight desiccators until further use . The glibenclamide - loaded ihm - alginate beads were prepared by ionotropic - gelation technique using calcium chloride (cacl2) as cross - linker . Briefly, sa and ihm aqueous dispersions were prepared separately using distilled water . These dispersions were well mixed with stirring for 15 min at 1000 rpm using a magnetic stirrer (remi motors, india). The ratio of drug to polymer was maintained 1: 2 in all formulations . The final mixtures were homogenized for 15 min at 1000 rpm using a homogenizer (remi motors, india) and ultrasonicated for 5 minutes for debubbling . The added droplets were retained in the cacl2 solution for 15 min to complete the curing reaction and to produce rigid beads . The wet beads were collected by decantation and washed two times with distilled water and dried at 37c for 24 h. the dried glibenclamide - loaded ihm - alginate beads were stored in a desiccator until used . A 3 factorial design was employed for optimization with sa: ihm (x1) and concentration of cacl2 (x2) as the prime selected independent variables, which were varied at three levels, low (1), medium (0), and high (+ 1). The drug encapsulation efficiency (dee,%) and 10 hours (r10 h,%) were used as dependent variables (responses). The matrix of the design including investigated responses, that is, dee and r10 h, is shown in table 1 . The effects of independent variables upon the all measured responses were modelled using the following quadratic mathematical model generated by 3 factorial design: (1)y = b0+b1x1+b2x2+b3x1x2+b4x12+b5x22, where y is the response, b0 is the intercept, and b1, b2, b3, b4, b5 are regression coefficients . X1 and x2 are individual effects; x1 and x2 are quadratic effects; x1x2 is the interaction effect . One - way anova was applied to estimate the significance (p <0.05) of generated models . The response surface methodology was applied to analyze the effect of independent factors (sa: ihm and cacl2 concentration) on the measured responses (dee and r10 h). Accurately weighed, 100 mg of beads were taken and were crushed using pestle and mortar . The crushed powders of drug containing beads were placed in 500 ml of phosphate buffer, ph 7.4, and kept for 24 hours with occasionally shaking at 37 0.5c . After the stipulated time, the mixture was stirred at 500 rpm for 15 min on a magnetic stirrer . The polymer debris formed after disintegration of bead was removed filtering through whatman filter paper (no . 40). The drug content in the filtrate was determined using a uv - vis spectrophotometer (shimadzu, japan) at 228.5 nm . The dee of beads was calculated using this following formula: (2)dee (%) = actual drug content in beadstheoretical drug content in beads100 . Particle size of 100 dried beads from each batch was measured by optical microscopic method for average particle size using an optical microscope (olympus). Samples were gold coated by mounted on a brass stub using double - sided adhesive tape and under vacuum in an ion sputter with a thin layer of gold (3 ~ 5 nm) for 75 seconds and at 20 kv to make them electrically conductive, and their morphology was examined by scanning electron microscope (zeiss evo 40, japan). Samples were reduced to powder and analyzed as kbr pellets by using a fourier transform - infrared (ftir) spectroscope (perkin elmer spectrum rx i, usa). Spectral scanning was taken in the wavelength region between 4000 and 400 cm at a resolution of 4 cm with scan speed of 1 cm / second . The release of glibenclamide from various ihm - alginate beads was tested using a dissolution apparatus usp (campbell electronics, india). The baskets were covered with 100-mesh nylon cloth to prevent the escape of the beads . Glibenclamide - loaded ihm - alginate beads equivalent to 30 mg glibenclamide were taken in 900 ml of dissolution medium (0.1 n hcl, ph 1.2 for first 2 hours and phosphate buffer, ph 7.4 for next 8 hours). An amount of 5 ml of aliquots was collected at regular time intervals, and the same amount of fresh dissolution medium was replaced into the dissolution vessel to maintain sink condition throughout the experiment . The collected aliquots were filtered and suitably diluted to determine absorbance using a uv - vis spectrophotometer (shimadzu, japan) at 228.5 nm against appropriate blank . In order to predict and correlate the in vitro release behaviour of glibenclamide from formulated glibenclamide - loaded ihm - alginate beads, it is necessary to fit into a suitable mathematical model . The in vitro drug release data were evaluated kinetically in different mathematical models [5, 6]: (i)zero - order model: q = kt + q0, where q represents the drug released amount in time t, and q0 is the start value of q; k is the rate constant;(ii)first - order model: q = q0e, where q represents the drug released amount in time t, and q0 is the start value of q; k is the rate constant;(iii)higuchi model: q = kt, where q represents the drug released amount in time t, and k is the rate constant;(iv)korsmeyer - peppas model: q = kt, where q represents the drug released amount in time t, k is the rate constant, and n is the diffusional exponent, indicative of drug release mechanism . Zero - order model: q = kt + q0, where q represents the drug released amount in time t, and q0 is the start value of q; k is the rate constant; first - order model: q = q0e, where q represents the drug released amount in time t, and q0 is the start value of q; k is the rate constant; higuchi model: q = kt, where q represents the drug released amount in time t, and k is the rate constant; korsmeyer - peppas model: q = kt, where q represents the drug released amount in time t, k is the rate constant, and n is the diffusional exponent, indicative of drug release mechanism . The korsmeyer - peppas model was also employed in the in vitro drug release behaviour analysis of these formulations to distinguish between competing release mechanisms [5, 6]: fickian release (diffusion - controlled release), non - fickian release (anomalous transport), and case - ii transport (relaxation - controlled release). When n is 0.43, it is fickian release . The mucoadhesivity of optimized glibenclamide - loaded ihm - alginate beads was evaluated by ex vivo wash - off method [11, 12]. Freshly excised pieces of goat intestinal mucosa (2 2 cm) (collected from slaughterhouse) were mounted on glass slide (7.5 2.5 cm) using thread . Fifty beads were spread onto the wet tissue specimen, and the prepared slide was hung onto a groove of disintegration test apparatus . The tissue specimen was given regular up and down movement in a vessel containing 900 ml of 0.1 n hcl (ph 1.2) and phosphate buffer (ph 7.4), separately, at 37c . After regular time intervals, the machine was stopped and the number of beads still adhering to the tissue was counted . In vivo studies were performed in alloxan - induced diabetic albino rats of either sex (weighing 266342 grams). The experimental protocol was subjected to the scrutiny of the institutional animal ethical committee and was cleared before starting . The animals were handled as per guidelines of committee for the purpose of control and supervision on experimental animals (cpcsea). All efforts were made to minimize both the suffering and number of animals used . The rats were made diabetic by intraperitoneal administration of freshly prepared alloxan solution at a dose of 150 mg / kg dissolved in 2 mm citrate buffer (ph 3.0). After one week of alloxan administration, alloxanized rats with fasting blood glucose of 300 mg / dl or more were considered diabetic and were employed in the study for 12 hours . The alloxan - induced diabetic rats were divided randomly into 2 groups of 6 rats each and treated as follows . Group a was administered with pure glibenclamide in suspension form, and group b was administered with optimized formulation of glibenclamide - loaded ihm - alginate beads, both at a dose equivalent to 5 mg glibenclamide / kg body weight using oral feeding needle . Blood samples were withdrawn (0.1 ml) from tail tip of each rat at regular time intervals under mild ether anesthesia and were analyzed for blood glucose by oxidase - peroxidase method using accu - chek sensor comfort (roche diagnostics, germany) test strips . Statistical optimization was performed using design - expert version 8.0.6.1 software (stat - ease inc . The in vivo data were tested for significant differences (p <0.05) by paired samples t - test . All other data was analyzed with simple statistics . The simple statistical analysis and paired samples t - test ihm was isolated from ispaghula (plantago ovata f.) husk, and the average yield of ihm was found 39.86% w / w . For the 3 factorial design, a total of 9 trial formulations were proposed by design - expert version 8.0.6.1 software . According to this trial proposal, various glibenclamide - loaded ihm - alginate beads were prepared by ionotropic - gelation technique . When various dispersion mixtures containing polymer - blend (sa and ihm) and glibenclamide were dropped into the solutions containing calcium ions, gelled glibenclamide - loaded ihm - alginate beads were formed instantaneously due to electrostatic interaction between negatively charged alginate ions and positively charged calcium ions present in the cross - linking solutions . Overview of matrix of the design including investigated responses (dee and r10 h) was presented in table 1 . The values of dee and r10 h, measured for all trial formulations, were fitted in the 3 factorial design to get model equations . The design - expert version 8.0.6.1 software provided quadratic model equations involving individual main factors and interaction factors for all response parameters . The results of the anova indicated that these models were significant for all response parameters (table 2). The model equation relating dee (%) as response became dee (%) = 87.24 5.22x1 2.49x2 0.06x1x2 + 0.41x1 + 0.35x2 (r = 0.9999; f value = 10398.24; p <0.05). The model equation relating r10 h(%) as response became r10 h (%) = 83.94 + 2.37x1 + 0.01x2 + 0.34x1x2 0.13x1 0.23x2 (r = 0.9981; f value = 309.07; p <0.05). Model simplification was carried out by eliminating nonsignificant terms (p> 0.05) from previously mentioned model equations, giving dee (%) = 87.24 5.22x1 2.49x2 0.06x1x2 + 0.41x1 + 0.35x2 and r10 h(%) = 83.94 + 2.37x1 + 0.01x2 + 0.34x1x2 0.23x2 . Linear correlation plots between the actual, the predicted response variables are presented in figures 1 and 2, and their corresponding residual plots showing the scatter of the residuals versus predicted values are presented in figures 3 and 4 . The influences of main effects (factors) on responses (here, dee and r10 h) were further elucidated by response surface methodology . Response surface methodology is a widely proficient approach in the development and optimization of drug delivery devices [5, 8, 28]. Response surface methodology encompasses the generation of model equations of the investigated responses over the experimental domain to determine optimum formulation (s). The three - dimensional response surface plot is very useful in learning about the main and interaction effects of the independent variables (factors), whereas two - dimensional contour plot gives a visual representation of values of the response . The three - dimensional response surface plot relating dee (figure 5) indicates the increment of dee with the lowering of sa: ihm (x1) and increasing of cacl2 concentration (x2). However, an increment in r10 h values with the increasing of sa: ihm (x1) and lowering of cacl2 concentration (x2) is indicated by the three - dimensional response surface plot relating r10 h (figure 6). All the two - dimensional contour plots relating measured responses (figures 7 and 8) showed nonlinear relationships between independable variables, investigated for this study . Numerical optimization technique using the desirability approach was employed to develop optimized formulations with desired response (optimum quality). The desirable ranges of the independable variables (factors) were restricted to 1.00 x1 1.50 and 9.50 x2 11.50, whereas the desirable ranges of responses were restricted to 95.00 dee 100.00% and 60.00 r10 h 65.00% . The optimal values of responses were obtained by numerical analysis using the design - expert version 8.0.6.1 software based on the criterion of desirability . The desirability plot indicating desirable regression ranges for optimal process variable settings was presented in figure 9, and overlay plot indicating the region of optimal process variable settings was presented in figure 10 . In order to evaluate the optimization capability of these models generated according to the results of 3 factorial design, optimized glibenclamide - loaded ihm - alginate beads were prepared using one of the optimal process variable settings proposed by the design (prediction r = 1). The selected optimal process variable setting used for the formulation of optimized formulation was x1 = 1.35 and x2 = 10.99 . The optimized beads containing glibenclamide (f - o) were evaluated for dee (%) and r10 h(%). Table 3 lists the results of experiments with predicted responses by the mathematical models and those actually observed . The optimized glibenclamide - loaded ihm - alginate beads (f - o) showed dee of 94.43 4.80% and r10 h of 65.78 3.44% with small error values (0.94, and 3.69, resp . ), indicating that mathematical models obtained from the 3 factorial design were fitted well . The dee (%) of all these glibenclamide - loaded ihm - alginate beads was within the range between 68.03 1.77 and 94.43 4.80% w / w (tables 1 and 3). It was observed that dee (%) was increased with the lowering of sa: ihm in polymer - blend, which may be due to increase in viscosity of the polymeric solution by the ihm addition as polymeric - blend with sa . This might have prevented drug leaching to the cross - linking solution and the elevation of cross - linking by cacl2 . Again, the dee of these beads was increased with increasing cacl2 concentration in cross - linking solutions, due to the high degree of cross - linking by the concentrated calcium ions . The glibenclamide - loaded ihm - alginate beads prepared using lower cacl2 concentration might have larger pores due to insufficient cross - linking, and drug leaching may occur through the pores that may result in lower drug encapsulation . The average bead size of glibenclamide - loaded ihm - alginate beads was within the range of 0.80 0.06 to 1.47 0.12 mm (table 4). Increase in the average size of beads was found with the increasing incorporation of ihm as a polymer - blend with sa . This could be attributed due to the increase in viscosity of polymer - blend solution with incorporation of ihm in increasing ratio that in turn increased the droplet size of polymer - blend solutions to the cross - linking solutions during preparation . Again, the decrease in average size of these formulated ihm - alginate beads was observed, when concentrated cacl2 solution was used for cross - linking, which might be due to shrinkage of polymeric gel by higher degree of cross - linking . The surface morphological analysis of glibenclamide - loaded ihm - alginate beads was visualized by sem and presented in figure 11 . Their surface morphologies appeared to have rough with characteristic large wrinkles and cracks, as it was evident from the sem photographs . These cracks and wrinkles might be caused by partly collapsing the polymeric gel network during drying . The ftir spectra of pure glibenclamide, glibenclamide - loaded ihm - alginate beads, and ihm - alginate beads without drug are shown in figure 12 . The ftir spectrum of pure glibenclamide and the principal absorption peaks appeared at 3314 cm due to the nh stretching, 3116 cm for aromatic hydrogen absorption, and a peak at 1717 cm occurs due to c = o absorption peak . In the ftir spectrum of glibenclamide - loaded ihm - alginate beads, this indicates that glibenclamide maintained its identity after formulation of ihm - alginate beads through ionotropic - gelation technique . In both the ftir spectra of glibenclamide - loaded ihm - alginate beads and ihm - alginate beads without drug, the strong and broad absorption band peaks had been observed between 36003200 cm due to oh stretching along with some complex bands in the region 12001030 cm due to c o and c o c stretching vibrations, which are the characteristic of the natural polysaccharides . In addition, absorption bands in the regions 930820 cm and 785730 cm were also observed due to vibrational modes of pyranose rings of polysaccharides . The presence of strong asymmetric stretching absorption band between 1650 cm and 1620 cm and weaker symmetric stretching band near 1420 cm supported the presence carboxylate anion of alginate structure . The ftir analysis confirmed the compatibility of the glibenclamide with sa and ihm used to prepare the glibenclamide - loaded ihm - alginate beads by ionotropic - gelation technique . The in vitro glibenclamide release studies were carried out for glibenclamide - loaded ihm - alginate beads in the 0.1 n hcl (ph, 1.2) for first 2 hours and then in phosphate buffer (ph, 7.4) for next 8 hours . Glibenclamide release from these ihm - alginate beads in the acidic ph was found slow due to the shrinkage of alginate at acidic ph . The trace amount of drug release at the initial stage of the dissolution study could probably be due to the surface adhered drug . After that, glibenclamide release was observed faster in phosphate buffer (ph, 7.4) comparatively, due to the higher swelling rate of these beads in phosphate buffer . The cumulative drug released from these formulated beads containing glibenclamide in 10 hours (r10 h,%) was within the range of 65.78 3.44% to 92.07 4.05%, and this was found to be higher with the decreasing sa to ihm ratio in the polymer - blend and increasing cacl2 concentration in cross - linking solution . In case of comparatively higher ihm containing beads, the more hydrophilic property of ihm could bond better with water to form viscous gel - structure . This might blockade the pores on the surface of beads and sustain drug release profile . Again, the glibenclamide release from ihm - alginate beads prepared using higher cacl2 concentration was comparatively sustained than the beads formulated with that of lower concentration . The higher concentration of cacl2 (cross - linker) could produce high degree of cross - linking and thereby slower the drug release from highly cross - linked glibenclamide - loaded ihm - alginate beads . The in vitro drug release data from various glibenclamide - loaded ihm - alginate beads were evaluated kinetically using various mathematical models like zero - order, first - order, higuchi, and korsmeyer - peppas models . The result of the curve fitting (r) into various mathematical models is given in table 5 . When the respective r of glibenclamide - loaded ihm - alginate beads was compared, it was found to follow the zero - order model (r = 0.992 to 0.997) over a period of 10 hours . This was also observed to be closest to korsmeyer - peppas model (r = 0.985 to 0.994). The best fit of zero - order model indicated that the glibenclamide release from these ihm - alginate beads followed controlled - release pattern . The values of diffusional exponent (n) determined from korsmeyer - peppas model ranged from 1.025 to 1.115, indicating the drug release from these glibenclamide - loaded ihm - alginate beads following the super case - ii transport mechanism controlled by swelling and relaxation of polymeric - blend (sa - ihm) matrix . This could be attributed due to polymer dissolution and polymeric chain enlargement or relaxation . The ex vivo wash - off behavior of optimized glibenclamide - loaded ihm - alginate beads (f - o) using goat intestinal mucosa was found faster in intestinal ph (7.4) than that in gastric ph (1.2). In gastric ph, the percentage of beads adhered onto the goat intestinal mucosal tissue varied from 64.88 5.06% over 10 hours, whereas this was 30.47 3.86% in intestinal ph (figure 14). Thus, the results of the ex vivo wash - off test indicated that the newly developed optimized glibenclamide - loaded ihm - alginate beads had good mucoadhesivity . In alloxan - induced diabetic rats, the comparative in vivo blood glucose level and the mean percentage reduction in blood glucose level after oral administration of pure glibenclamide and optimized glibenclamide - loaded ihm - alginate mucoadhesive beads (f - o) are presented in figures 15 and 16, respectively . In case of the group treated with pure glibenclamide (group a), a rapid reduction in blood glucose level was observed within 2 - 3 hours of administration, and after that, the blood glucose level recovered rapidly towards the normal level . In case of the group (group b) treated with optimized glibenclamide - loaded ihm - alginate mucoadhesive beads, the reduction in blood glucose level was found slower than that of the group treated with pure glibenclamide (group a) up to 3 hours . Significant differences (p <0.05) were found between the blood glucose levels after administration of pure glibenclamide and optimized glibenclamide - loaded ihm - alginate mucoadhesive beads (f - o) at each time point measured . However, the reductions in glucose level were increased gradually with the increment of time in case of group b (treated with optimized glibenclamide - loaded ihm - alginate mucoadhesive beads) and were sustained over 10 hours . A 25% reduction in glucose level is considered a significant hypoglycemic effect . Therefore, the significant hypoglycemic effect by the optimized glibenclamide - loaded ihm - alginate mucoadhesive beads (f - o) was observed over 10 hours . In this investigation, glibenclamide - loaded ihm - alginate mucoadhesive beads were successfully developed and optimized . These developed optimized mucoadhesive beads demonstrated high drug encapsulation, good mucoadhesivity with the biological membrane, sustained drug release profile at a controlled rate, and significant antidiabetic activity in alloxan - induced diabetic rats over prolonged period after oral administration . Therefore, these glibenclamide - loaded ihm - alginate mucoadhesive beads were found suitable for prolonged systemic absorption of glibenclamide through sustained drug release and mucoadhesive properties after oral administration maintaining tight blood glucose level and improved patient compliance in the management of non - insulin - dependent diabetes mellitus . Moreover, the technique for the preparation of these beads was found simple, economical, and consistent . This type of beads can also be exploited for drug delivery of other drugs to improve their bioavailability and therapeutic efficacy.
Heart failure (hf) can result from cardiac overload or injury as well as from a complex interplay of genetic, neurohormonal, and inflammatory factors . Hf is classified as being associated with a reduced ejection fraction (hfref) or with a normal ejection fraction (hfnef). The percentages of patients and the mortality rates are similar in patients with hfref and hfnef . The likelihood of survival is higher in patients with hfref than in those with hfnef, and the survival rate in hfnef has not significantly improved in recent years . Various biomarkers, including those for inflammation and neurohormones, provide important information about the pathogenesis, risk stratification, and diagnosis of hf and are used to monitor response to therapy . Inflammatory markers are closely associated with pathogenesis, poor functional state, and adverse prognosis in patients with hf . Pentraxin 3 (ptx3) is a newly identified member of the pentraxin superfamily, which includes creactive protein (crp) and serum amyloid p. in contrast to crp, which is produced by the liver, ptx3 is produced by various cell types in various tissues, especially in the vasculature, in response to inflammatory stimuli . Ptx3 may reflect local inflammatory status in tissues and thus may be a new biomarker of inflammation . We recently demonstrated that plasma levels of ptx3, but not highsensitivity crp (hscrp), were significantly higher in patients with hfnef than in nonhf patients . In addition, these elevated levels of ptx3 were significantly and independently correlated with the presence of hfnef in patients with normal left ventricular ejection fraction (lvef). Other studies have also shown that ptx3 is a predictor of adverse clinical outcome in patients with hfref . Although much attention has been focused on hfref, less is known regarding factors that correlate with clinical outcome in patients with hfnef . The irbesartan in heart failure with preserved ejection fraction (ipreserve) study demonstrated that age, presence of diabetes mellitus, history of hospitalization for hf, new york heart association classification, nterminal probtype natriuretic peptide levels, and lvef were associated with adverse outcomes in patients with hfnef . This study was designed to determine the ability of plasma ptx3 levels to predict future cardiovascular events in patients with hfnef . We initially screened 747 chronic hf patients under a clinically stable condition with new york heart association functional class ii to iv who were referred to kumamoto university hospital, kumamoto, japan . None of the patients had any noncardiac causes of hflike symptoms, especially lung disease (eg, chronic obstructive lung disease). The diagnosis of hfnef was based on the criteria formulated by the european working group on hfnef . Hfref was defined as reduced systolic left ventricular (lv) function (lvef50%). Hfnef was defined as normal or mildly abnormal systolic lv function (lvef>50%) with lv diastolic dysfunction . Lv diastolic dysfunction for hfnef was defined as (1) a ratio of mitral early diastolic peak flow velocity to tissue doppler early mitral annular diastolic velocity (e / e) 15; (2) e / e 8 and <15 and btype natriuretic peptide (bnp) levels> 200 pg / ml; or (3) e / e 8 and <15 and lv mass index (lvmi) 122 g / m (females) or 149 g / m (males). Patients were excluded if they had active systemic inflammatory disease, chronic renal failure requiring hemodialysis, collagen disease, presence of malignancy, or acute coronary syndrome within 3 months preceding enrollment . The study complied with the declaration of helsinki regarding investigation in humans and was approved by the institutional review committee of each institution . The study was also conducted in accordance with the guidelines of the ethics committee of our institution . This study was registered at the university hospital medical information network clinical trials registry with the identification number umin000002170 . Flow chart showing the protocol that was used for enrollment of hfnef patients in the present study . Bnp indicates btype natriuretic peptide; e / e, ratio of mitral early diastolic peak flow velocity to tissue doppler early mitral annular diastolic velocity; hf, heart failure; hfnef, hf with normal ejection fraction; lvef, left ventricular ejection fraction; lvmi, left ventricular mass index; nyha, new york heart association . Ptx3 levels were measured using a highsensitivity enzymelinked immunosorbent assay system (values ranged from 0.1 to 20 ng / ml; perseus proteomics). Other factors that were measured included serum hscrp levels and plasma tumor necrosis factor, interleukin6, and bnp levels . Echocardiography was performed in standard parasternal and apical views by a specialized echocardiologist using commercially available ultrasound systems (vivid 7, gevingmed ultrasound; aplio xg, toshiba). Lvef was measured in biplane apical (2 and 4chamber) views using a modification of simpson's method . The e / e ratio is used as an index of lv filling pressure and abnormal lv relaxation . To assess lv diastolic function, e / e was measured, as described previously, as was the medial annulus of e / e. lv mass was calculated, as described previously, and the lvmi was expressed relative to body surface area . Patients with hfnef were followed prospectively at the outpatient clinic until december 2012 or until an endpoint occurred . The endpoint was a composite of cardiovascular death, nonfatal mi, unstable angina pectoris, nonfatal ischemic stroke, hospitalization for hf decompensation, or coronary revascularization . Cardiovascular events were ascertained from a review of medical records and confirmed by direct contact with the patients, their families, and physicians . Patients were divided into low and highptx3 groups based on the median concentration of ptx3 (3.0 ng / ml). Cardiovascular death was defined as death because of mi (within 28 days), congestive heart failure, or documented sudden death without apparent noncardiovascular causes . Mi was diagnosed as a rise or fall in cardiac biomarkers (plasma creatine kinasemb or cardiac troponint) greater than the 99th percentile of the upper limit of normal, together with evidence of myocardial ischemia with at least one of the following: ecg changes (recent stt changes, left bundle branch block, or a pathological q wave) or imaging evidence of new loss of viable myocardium or new regional wall motion abnormality . Unstable angina pectoris was diagnosed from new or accelerating symptoms of myocardial ischemia accompanied by recent ischemic sttwave changes . Ischemic stroke was diagnosed by both neurological symptoms and radiological evidence, excluding intracranial hemorrhage . Hospitalization for hf decompensation was defined as admission for symptoms typical of hf with objective signs of worsening hf requiring intravenous drug administration . Coronary revascularization was defined as coronary artery bypass grafting or percutaneous coronary intervention in patients with stable angina pectoris . For subjects experiencing 2 or more cardiovascular events, parameters with a normal distribution, as assessed by the shapirowilk test, are expressed as meansd . Parameters with a skewed distribution, such as ptx3, hscrp, tumor necrosis factor, interleukin6, and bnp levels, as well as e / e and lvmi, are shown as median values (interquartile range) and were logarithmically transformed before linear regression analysis . Differences between continuous variables were analyzed by the unpaired t test and the mannwhitney u test, as appropriate . Linear regression analysis was used to determine the associations between ptx3 and bnp levels, lvmi, inflammatory makers, and cardiovascular events . Survival data were analyzed by the kaplanmeier method and assessed by the logrank test . Age and the ability of any marker to predict cardiovascular events was assessed by cox proportional hazards regression analysis . In cox proportional hazards regression analyses, associations between groups and all other parameters were first analyzed by univariate analysis followed by multivariable analysis after adjustment for factors that were significant with univariate analysis . Model 1 incorporated the inflammatory makers ptx3, hscrp, tumor necrosis factor, interleukin6, and bnp . Model 2 incorporated the 5 prognostic factors (pf5) that were identified during the ipreserve study in patients with hfnef age, presence of diabetes mellitus, previous hospitalization for hf, new york heart association classification, and lvef as well as bnp and ptx3 . Model 4 incorporated pf5, bnp, hscrp, and ptx3 . Estimates of the cstatistic for cox proportional hazards regression models were calculated . Calibration of cox regression models was also performed by the grnnesby and borgan calibration test . The incremental effects of addition of ptx3 to pf5 and bnp levels to predict future cardiovascular events were evaluated using the net classification index (nri), as previously described . Patients were stratified into 1 of 3 risk categories based on pf5 and bnp levels measured during the mean 30month followup period: low risk (0% to <10%), intermediate risk (10% to 20%), or high risk (> 20%). Ptx3 was subsequently used to reclassify the risk category for ascertaining whether there would be improvement in the nri . The nri was calculated using the following equation: nri=([number of events reclassified as highernumber of events reclassified as lower]/number of events)([number of nonevents reclassified as lowernumber of nonevents reclassified as higher]/number of nonevents). All analyses were performed using spss version 19.0j for windows (ibm corporation), stata version 11 (stata corporation), and sas version 9.1.3 (sas institute inc). We initially screened 747 chronic hf patients under a clinically stable condition with new york heart association functional class ii to iv who were referred to kumamoto university hospital, kumamoto, japan . None of the patients had any noncardiac causes of hflike symptoms, especially lung disease (eg, chronic obstructive lung disease). The diagnosis of hfnef was based on the criteria formulated by the european working group on hfnef . Hfref was defined as reduced systolic left ventricular (lv) function (lvef50%). Hfnef was defined as normal or mildly abnormal systolic lv function (lvef>50%) with lv diastolic dysfunction . Lv diastolic dysfunction for hfnef was defined as (1) a ratio of mitral early diastolic peak flow velocity to tissue doppler early mitral annular diastolic velocity (e / e) 15; (2) e / e 8 and <15 and btype natriuretic peptide (bnp) levels> 200 pg / ml; or (3) e / e 8 and <15 and lv mass index (lvmi) 122 g / m (females) or 149 g / m (males). Patients were excluded if they had active systemic inflammatory disease, chronic renal failure requiring hemodialysis, collagen disease, presence of malignancy, or acute coronary syndrome within 3 months preceding enrollment . The study complied with the declaration of helsinki regarding investigation in humans and was approved by the institutional review committee of each institution . The study was also conducted in accordance with the guidelines of the ethics committee of our institution . This study was registered at the university hospital medical information network clinical trials registry with the identification number umin000002170 . Flow chart showing the protocol that was used for enrollment of hfnef patients in the present study . Bnp indicates btype natriuretic peptide; e / e, ratio of mitral early diastolic peak flow velocity to tissue doppler early mitral annular diastolic velocity; hf, heart failure; hfnef, hf with normal ejection fraction; lvef, left ventricular ejection fraction; lvmi, left ventricular mass index; nyha, new york heart association . Ptx3 levels were measured using a highsensitivity enzymelinked immunosorbent assay system (values ranged from 0.1 to 20 ng / ml; perseus proteomics). Other factors that were measured included serum hscrp levels and plasma tumor necrosis factor, interleukin6, and bnp levels . Echocardiography was performed in standard parasternal and apical views by a specialized echocardiologist using commercially available ultrasound systems (vivid 7, gevingmed ultrasound; aplio xg, toshiba). Lvef was measured in biplane apical (2 and 4chamber) views using a modification of simpson's method . The e / e ratio is used as an index of lv filling pressure and abnormal lv relaxation . To assess lv diastolic function, e / e was measured, as described previously, as was the medial annulus of e / e. lv mass was calculated, as described previously, and the lvmi was expressed relative to body surface area . Patients with hfnef were followed prospectively at the outpatient clinic until december 2012 or until an endpoint occurred . The endpoint was a composite of cardiovascular death, nonfatal mi, unstable angina pectoris, nonfatal ischemic stroke, hospitalization for hf decompensation, or coronary revascularization . Cardiovascular events were ascertained from a review of medical records and confirmed by direct contact with the patients, their families, and physicians . Patients were divided into low and highptx3 groups based on the median concentration of ptx3 (3.0 ng / ml). Cardiovascular death was defined as death because of mi (within 28 days), congestive heart failure, or documented sudden death without apparent noncardiovascular causes . Mi was diagnosed as a rise or fall in cardiac biomarkers (plasma creatine kinasemb or cardiac troponint) greater than the 99th percentile of the upper limit of normal, together with evidence of myocardial ischemia with at least one of the following: ecg changes (recent stt changes, left bundle branch block, or a pathological q wave) or imaging evidence of new loss of viable myocardium or new regional wall motion abnormality . Unstable angina pectoris was diagnosed from new or accelerating symptoms of myocardial ischemia accompanied by recent ischemic sttwave changes . Ischemic stroke was diagnosed by both neurological symptoms and radiological evidence, excluding intracranial hemorrhage . Hospitalization for hf decompensation was defined as admission for symptoms typical of hf with objective signs of worsening hf requiring intravenous drug administration . Coronary revascularization was defined as coronary artery bypass grafting or percutaneous coronary intervention in patients with stable angina pectoris . For subjects experiencing 2 or more cardiovascular events, parameters with a normal distribution, as assessed by the shapirowilk test, are expressed as meansd . Parameters with a skewed distribution, such as ptx3, hscrp, tumor necrosis factor, interleukin6, and bnp levels, as well as e / e and lvmi, are shown as median values (interquartile range) and were logarithmically transformed before linear regression analysis . Differences between continuous variables were analyzed by the unpaired t test and the mannwhitney u test, as appropriate . Linear regression analysis was used to determine the associations between ptx3 and bnp levels, lvmi, inflammatory makers, and cardiovascular events . The ability of any marker to predict cardiovascular events was assessed by cox proportional hazards regression analysis . In cox proportional hazards regression analyses, associations between groups and all other parameters were first analyzed by univariate analysis followed by multivariable analysis after adjustment for factors that were significant with univariate analysis . Model 1 incorporated the inflammatory makers ptx3, hscrp, tumor necrosis factor, interleukin6, and bnp . Model 2 incorporated the 5 prognostic factors (pf5) that were identified during the ipreserve study in patients with hfnef age, presence of diabetes mellitus, previous hospitalization for hf, new york heart association classification, and lvef as well as bnp and ptx3 . Calibration of cox regression models was also performed by the grnnesby and borgan calibration test . The incremental effects of addition of ptx3 to pf5 and bnp levels to predict future cardiovascular events were evaluated using the net classification index (nri), as previously described . Patients were stratified into 1 of 3 risk categories based on pf5 and bnp levels measured during the mean 30month followup period: low risk (0% to <10%), intermediate risk (10% to 20%), or high risk (> 20%). Ptx3 was subsequently used to reclassify the risk category for ascertaining whether there would be improvement in the nri . The nri was calculated using the following equation: nri=([number of events reclassified as highernumber of events reclassified as lower]/number of events)([number of nonevents reclassified as lowernumber of nonevents reclassified as higher]/number of nonevents). All analyses were performed using spss version 19.0j for windows (ibm corporation), stata version 11 (stata corporation), and sas version 9.1.3 (sas institute inc). Table 1 shows the clinical characteristics of the participating patients . The median ptx3 level was 3.0 ng / ml . Mean age, new york heart association class, and bnp levels were higher and mean body mass index, waist circumference and estimated glomerular filtration rate were lower in the highptx3 group (> 3.0 ng / ml) than in the lowptx3 group (3.0 ng / ml). Lvmi values were significantly higher in the highptx3 group than in the lowptx3 group, whereas lvef and e / e were similar in these 2 groups . Simple linear regression analysis showed a positive and significant correlation between ln(ptx3) and ln(bnp) (r=0.295, p<0.001) (figure 2a) and a significant but weak positive correlation between ln(ptx3) and ln(lvmi) (r=0.114, p<0.05) (figure 2b). Furthermore, simple linear regression analysis showed a significant but weak positive correlation between ln(ptx3) and ln(tumor necrosis factor) (r=0.106, p<0.05) but not ln(hscrp) (p=0.11) or ln(interleukin6) (p=0.80). Demographic and clinical characteristics of patients with hfnef data are meansd, number of patients (%), or median (interquartile range). Acei indicates angiotensinconverting enzyme inhibitors; arb, angiotensin ii receptor blocker; bnp, btype natriuretic peptide; cad, coronary artery disease; e / e, mitral early diastolic peak flow velocity to tissue doppler early mitral annular diastolic velocity; gfr, glomerular filtration rate; hdl, highdensity lipoprotein; hf, heart failure; hfnef, heart failure with normal ejection fraction; hscrp, highsensitive creactive protein; il6, interleukin6; ldl, lowdensity lipoprotein; lv, left ventricle; lvef, left ventricular ejection fraction; nyha, new york heart association; ptx3, pentraxin 3; tnf, tumor necrosis factor. Relationships between ptx3 and bnp levels and ptx3 levels and lvmi . Simple linear regression analysis shows a positive and significant correlation between (a) ln(ptx3) and ln(bnp) (r=0.295, p<0.001) and (b) a significant but weak positive correlation between ln(ptx3) and ln(lvmi) (r=0.114, p<0.05). Bnp indicates btype natriuretic peptide; lvmi; left ventricular mass index; ptx3, pentraxin 3 . The mean followup period was 30 months (range: 1 to 59 months). During this time, 106 of these patients experienced cardiovascular events, including cardiovascular death (n=9), nonfatal mi (n=4), unstable angina pectoris (n=13), ischemic stroke (n=9), hospitalization for hf decompensation (n=41), and coronary revascularization (n=30). The frequency of cardiovascular events was significantly higher in the highptx3 group (n=75) than in the lowptx3 group (n=31, p<0.001) (table 2). Hfrelated cardiovascular events, including cardiovascular death and hospitalization for hf decompensation, were significantly higher in the highptx3 group (n=41) than in the lowptx3 group (n=9) (p<0.001) (table 2). Kaplanmeier analysis showed that the probability of cardiovascular events was also significantly higher in the highptx3 group than in the lowptx3 group (p<0.001, logrank test) (figure 3a). Cardiovascular events in hfnef patients with low and high plasma ptx3 levels differences between the groups were assessed by the logrank test . Hf indicates heart failure; hfrelated cardiovascular events, cardiovascular death and hospitalization for hf decompensation; hfnef, heart failure with normal left ventricular ejection fraction; ptx3, pentraxin 3 . Kaplanmeier analysis for the probability of cardiovascular events . Patients with (a) high ptx3 levels and low ptx3 levels, (b) subgroups of patients with high and low ptx3 levels plus bnp, and (c) subgroups of new york heart association class ii patients with high and low ptx3 levels are shown . Bnp indicates btype natriuretic peptide; ptx3, pentraxin 3 . The combination of ptx3 and bnp levels led to identification of subgroups (n=116, highptx3 and bnp group; n=64, highptx3 and lowbnp group; n=64, lowptx3 and highbnp group; and n=116, lowptx3 and bnp group) with significantly different probabilities of cardiovascular events (p<0.001, logrank test) (figure 3b). In the lowbnp (p=0.02) and highbnp (p<0.01) groups, the probability of cardiovascular events was significantly higher in those with high ptx3 levels than in those with low ptx3 levels . Even among patients with mild hf symptoms (new york heart association class ii), the outcomes were poorer in patients with high ptx3 levels than in those with low ptx3 levels (p<0.001, logrank test) (figure 3c). The results of univariate and multivariable cox proportional hazards analyses for cardiovascular events are shown in tables 3 and 4 . Multivariable cox proportional hazards analysis identified ptx3 (hazard ratio [hr]: 1.16; 95% ci: 1.05 to 1.27; p<0.01), highdensity lipoprotein cholesterol (hr: 0.99; 95% ci: 0.97 to 0.99; p<0.05), lvmi (hr: 1.03; 95% ci: 1.05 to 1.27), and bnp (hr: 1.08; 95% ci: 1.03 to 1.14; p<0.001) as predictors of future cardiovascular events after adjustment for significant factors that were identified by univariate analysis (table 3). Using the forced inclusion model, which evaluated levels of inflammatory markers and bnp (model 1) in multivariable cox hazards analysis, ptx3, but not hscrp, significantly predicted cardiovascular events (hr: 1.17; 95% ci: 1.07 to 1.28; p<0.001). In the forced inclusion model, which included pf5 and bnp, ptx3 significantly predicted cardiovascular events (model 2: hr: 1.16; 95% ci: 1.05 to 1.27; p<0.01; model 4: hr: 1.16; 95% ci: 1.06 to 1.27; p<0.01) (table 4). Furthermore, multivariable cox proportional hazards analysis identified ptx3 (hr: 1.16; 95% ci: 1.01 to 1.35; p<0.05) and bnp (hr: 1.21; 95% ci: 1.11 to 1.31; p<0.001) as predictors of future hfrelated cardiovascular events, including cardiovascular death and hospitalization for hf decompensation, after adjustment for significant factors identified by univariate analysis . We classified patients with hfnef into 4 groups according to the levels of ln(ptx3): first quartile (<0.59, ptx3: <1.80 ng / ml), second quartile (0.59 to 1.10, ptx3: 1.80 to 3.00 ng / ml), third quartile (1.10 to 1.35, ptx3: 3.00 to 3.85 ng / ml), and fourth quartile (> 1.35, ptx3:> 3.85 ng / ml); the relative risk of total cardiovascular events was 1 (reference), 1.36, 2.71 (p<0.001 versus the reference), and 3.17 (p<0.001 versus the reference), respectively . The logtransformation values of ptx3 demonstrated a linear association with the occurrence of cardiovascular events in patients with hfnef (r=0.965, p=0.03). Cox proportional hazards analysis of factors that were predictive of future cardiovascular events in patients with hfnef after adjustment for significant factors identified by univariate analysis bnp indicates btype natriuretic peptide; cad, coronary artery disease; e / e, mitral early diastolic peak flow velocity to tissue doppler early mitral annular diastolic velocity; gfr, glomerular filtration rate; hdl, highdensity lipoprotein; hf, heart failure; hfnef, heart failure with normal ejection fraction; hr, hazard ratio; hscrp, highsensitivity creactive protein; il6, interleukin6; ldl, lowdensity lipoprotein; lvef, left ventricular ejection fraction; nyha, new york heart association; ptx3, pentraxin 3; tnf, tumor necrosis factor. Cox proportional hazards analysis of factors that were associated with future cardiovascular events in hfnef patients using forced inclusion models bnp indicates btype natriuretic peptide; ci, confidence interval; hf, heart failure; hfnef, heart failure with normal ejection fraction; hr, hazard ratio; hscrp, highsensitive creactive protein; il6, interleukin6; lvef, left ventricular ejection fraction; nyha, new york heart association; ptx3, pentraxin 3; tnf, tumor necrosis factor. We also estimated the cstatistics of pf5 alone . Separate incorporation of ptx3 and bnp into pf5 increased the cstatistics for the prediction of future cardiovascular events from 0.617 for pf5 alone to 0.656 for pf5 plus ptx3 and pf5 plus bnp (table 5). Moreover, incorporation of ptx3 and bnp into pf5 increased the cstatistics to 0.683 (p<0.05). In addition, the pf5 plus bnp plus ptx3 model performed better than the pf5 plus bnp model (cstatistics: 0.683 versus 0.656). We also confirmed good calibration for the analysis by grnnesby and borgan statistics (p=0.19). Cstatistics for cox proportional hazards analysis predicting future cardiovascular events in patients with heart failure with normal ejection fraction bnp indicates btype natriuretic peptide; pf5, the 5 factors identified in the ipreserve study as prognostic in patients with heart failure with normal ejection fraction (age, presence of diabetes mellitus, previous hospitalization for heart failure, new york heart association classification, and left ventricular ejection fraction); ptx3, pentraxin 3 . The nri was significant after ptx3 was included: 12.2% for patients without cardiovascular events, 0% for those with cardiovascular events, and 12.2% overall (p<0.01) (table 6). Reclassification of the risk of pf5 and bnp for cardiovascular events after the addition of ptx3 bnp indicates btype natriuretic peptide; pf5, the 5 factors identified in the ipreserve study as prognostic in patients with heart failure with normal ejection fraction (age, presence of diabetes mellitus, previous hospitalization for heart failure, new york heart association classification, and left ventricular ejection fraction); ptx3, pentraxin 3 . Table 1 shows the clinical characteristics of the participating patients . The median ptx3 level was 3.0 ng / ml . Mean age, new york heart association class, and bnp levels were higher and mean body mass index, waist circumference and estimated glomerular filtration rate were lower in the highptx3 group (> 3.0 ng / ml) than in the lowptx3 group (3.0 ng / ml). Lvmi values were significantly higher in the highptx3 group than in the lowptx3 group, whereas lvef and e / e were similar in these 2 groups . Simple linear regression analysis showed a positive and significant correlation between ln(ptx3) and ln(bnp) (r=0.295, p<0.001) (figure 2a) and a significant but weak positive correlation between ln(ptx3) and ln(lvmi) (r=0.114, p<0.05) (figure 2b). Furthermore, simple linear regression analysis showed a significant but weak positive correlation between ln(ptx3) and ln(tumor necrosis factor) (r=0.106, p<0.05) but not ln(hscrp) (p=0.11) or ln(interleukin6) (p=0.80). Demographic and clinical characteristics of patients with hfnef data are meansd, number of patients (%), or median (interquartile range). Acei indicates angiotensinconverting enzyme inhibitors; arb, angiotensin ii receptor blocker; bnp, btype natriuretic peptide; cad, coronary artery disease; e / e, mitral early diastolic peak flow velocity to tissue doppler early mitral annular diastolic velocity; gfr, glomerular filtration rate; hdl, highdensity lipoprotein; hf, heart failure; hfnef, heart failure with normal ejection fraction; hscrp, highsensitive creactive protein; il6, interleukin6; ldl, lowdensity lipoprotein; lv, left ventricle; lvef, left ventricular ejection fraction; nyha, new york heart association; ptx3, pentraxin 3; tnf, tumor necrosis factor. Relationships between ptx3 and bnp levels and ptx3 levels and lvmi . Simple linear regression analysis shows a positive and significant correlation between (a) ln(ptx3) and ln(bnp) (r=0.295, p<0.001) and (b) a significant but weak positive correlation between ln(ptx3) and ln(lvmi) (r=0.114, p<0.05). Bnp indicates btype natriuretic peptide; lvmi; left ventricular mass index; ptx3, pentraxin 3 . The mean followup period was 30 months (range: 1 to 59 months). During this time, 106 of these patients experienced cardiovascular events, including cardiovascular death (n=9), nonfatal mi (n=4), unstable angina pectoris (n=13), ischemic stroke (n=9), hospitalization for hf decompensation (n=41), and coronary revascularization (n=30). The frequency of cardiovascular events was significantly higher in the highptx3 group (n=75) than in the lowptx3 group (n=31, p<0.001) (table 2). Hfrelated cardiovascular events, including cardiovascular death and hospitalization for hf decompensation, were significantly higher in the highptx3 group (n=41) than in the lowptx3 group (n=9) (p<0.001) (table 2). Kaplanmeier analysis showed that the probability of cardiovascular events was also significantly higher in the highptx3 group than in the lowptx3 group (p<0.001, logrank test) (figure 3a). Cardiovascular events in hfnef patients with low and high plasma ptx3 levels differences between the groups were assessed by the logrank test . Hf indicates heart failure; hfrelated cardiovascular events, cardiovascular death and hospitalization for hf decompensation; hfnef, heart failure with normal left ventricular ejection fraction; ptx3, pentraxin 3 . Patients with (a) high ptx3 levels and low ptx3 levels, (b) subgroups of patients with high and low ptx3 levels plus bnp, and (c) subgroups of new york heart association class ii patients with high and low ptx3 levels are shown . The combination of ptx3 and bnp levels led to identification of subgroups (n=116, highptx3 and bnp group; n=64, highptx3 and lowbnp group; n=64, lowptx3 and highbnp group; and n=116, lowptx3 and bnp group) with significantly different probabilities of cardiovascular events (p<0.001, logrank test) (figure 3b). In the lowbnp (p=0.02) and highbnp (p<0.01) groups, the probability of cardiovascular events was significantly higher in those with high ptx3 levels than in those with low ptx3 levels . Even among patients with mild hf symptoms (new york heart association class ii), the outcomes were poorer in patients with high ptx3 levels than in those with low ptx3 levels (p<0.001, logrank test) (figure 3c). The results of univariate and multivariable cox proportional hazards analyses for cardiovascular events are shown in tables 3 and 4 . Multivariable cox proportional hazards analysis identified ptx3 (hazard ratio [hr]: 1.16; 95% ci: 1.05 to 1.27; p<0.01), highdensity lipoprotein cholesterol (hr: 0.99; 95% ci: 0.97 to 0.99; p<0.05), lvmi (hr: 1.03; 95% ci: 1.05 to 1.27), and bnp (hr: 1.08; 95% ci: 1.03 to 1.14; p<0.001) as predictors of future cardiovascular events after adjustment for significant factors that were identified by univariate analysis (table 3). Using the forced inclusion model, which evaluated levels of inflammatory markers and bnp (model 1) in multivariable cox hazards analysis, ptx3, but not hscrp, significantly predicted cardiovascular events (hr: 1.17; 95% ci: 1.07 to 1.28; p<0.001). In the forced inclusion model, which included pf5 and bnp, ptx3 significantly predicted cardiovascular events (model 2: hr: 1.16; 95% ci: 1.05 to 1.27; p<0.01; model 4: hr: 1.16; 95% ci: 1.06 to 1.27; p<0.01) (table 4). Furthermore, multivariable cox proportional hazards analysis identified ptx3 (hr: 1.16; 95% ci: 1.01 to 1.35; p<0.05) and bnp (hr: 1.21; 95% ci: 1.11 to 1.31; p<0.001) as predictors of future hfrelated cardiovascular events, including cardiovascular death and hospitalization for hf decompensation, after adjustment for significant factors identified by univariate analysis . We classified patients with hfnef into 4 groups according to the levels of ln(ptx3): first quartile (<0.59, ptx3: <1.80 ng / ml), second quartile (0.59 to 1.10, ptx3: 1.80 to 3.00 ng / ml), third quartile (1.10 to 1.35, ptx3: 3.00 to 3.85 ng / ml), and fourth quartile (> 1.35, ptx3:> 3.85 ng / ml); the relative risk of total cardiovascular events was 1 (reference), 1.36, 2.71 (p<0.001 versus the reference), and 3.17 (p<0.001 versus the reference), respectively . The logtransformation values of ptx3 demonstrated a linear association with the occurrence of cardiovascular events in patients with hfnef (r=0.965, p=0.03). Cox proportional hazards analysis of factors that were predictive of future cardiovascular events in patients with hfnef after adjustment for significant factors identified by univariate analysis bnp indicates btype natriuretic peptide; cad, coronary artery disease; e / e, mitral early diastolic peak flow velocity to tissue doppler early mitral annular diastolic velocity; gfr, glomerular filtration rate; hdl, highdensity lipoprotein; hf, heart failure; hfnef, heart failure with normal ejection fraction; hr, hazard ratio; hscrp, highsensitivity creactive protein; il6, interleukin6; ldl, lowdensity lipoprotein; lvef, left ventricular ejection fraction; nyha, new york heart association; ptx3, pentraxin 3; tnf, tumor necrosis factor. Cox proportional hazards analysis of factors that were associated with future cardiovascular events in hfnef patients using forced inclusion models bnp indicates btype natriuretic peptide; ci, confidence interval; hf, heart failure; hfnef, heart failure with normal ejection fraction; hr, hazard ratio; hscrp, highsensitive creactive protein; il6, interleukin6; lvef, left ventricular ejection fraction; nyha, new york heart association; ptx3, pentraxin 3; tnf, tumor necrosis factor. We also estimated the cstatistics of pf5 alone . Separate incorporation of ptx3 and bnp into pf5 increased the cstatistics for the prediction of future cardiovascular events from 0.617 for pf5 alone to 0.656 for pf5 plus ptx3 and pf5 plus bnp (table 5). Moreover, incorporation of ptx3 and bnp into pf5 increased the cstatistics to 0.683 (p<0.05). In addition, the pf5 plus bnp plus ptx3 model performed better than the pf5 plus bnp model (cstatistics: 0.683 versus 0.656). We also confirmed good calibration for the analysis by grnnesby and borgan statistics (p=0.19). Cstatistics for cox proportional hazards analysis predicting future cardiovascular events in patients with heart failure with normal ejection fraction bnp indicates btype natriuretic peptide; pf5, the 5 factors identified in the ipreserve study as prognostic in patients with heart failure with normal ejection fraction (age, presence of diabetes mellitus, previous hospitalization for heart failure, new york heart association classification, and left ventricular ejection fraction); ptx3, pentraxin 3 . The nri was significant after ptx3 was included: 12.2% for patients without cardiovascular events, 0% for those with cardiovascular events, and 12.2% overall (p<0.01) (table 6). Reclassification of the risk of pf5 and bnp for cardiovascular events after the addition of ptx3 bnp indicates btype natriuretic peptide; pf5, the 5 factors identified in the ipreserve study as prognostic in patients with heart failure with normal ejection fraction (age, presence of diabetes mellitus, previous hospitalization for heart failure, new york heart association classification, and left ventricular ejection fraction); ptx3, pentraxin 3 . To the best of our knowledge, this report is the first to show a significant association between plasma levels of ptx3, a marker of inflammation, and adverse cardiovascular outcomes in patients with hfnef . The addition of high ptx3 levels to the pf5 and bnp levels, which were previously found to be prognostic in patients with hfnef, improved their risk stratification, as indicated by a substantial increase in the cstatistics and significance of nri . Activation of the inflammatory process is important in the pathogenesis of hf and in adverse prognosis of patients with this condition . Several studies have investigated the role of inflammation as a therapeutic target, although initial trials had limited success . Consequently, specific antiinflammatory approaches for the different types and stages of hf (ie, hfnef and hfref) remain a priority, as does a better understanding of the mechanisms underlying hfrelated inflammation . The established inflammatory marker hscrp is an independent predictor of morbidity and mortality in patients with hf . Elevated crp levels predict hospitalization of hf patients, although the association between crp and hf events is no longer significant after adjustment for the presence of lv diastolic dysfunction . Consequently, the relationships between inflammatory markers and the prognosis of patients with hfnef remain unclear ., remodeling is driven by the loss of cardiomyocytes, whereas in hfnef, a systemic inflammatory state induces oxidative stress in the coronary microvascular endothelium, which drives myocardial dysfunction and remodeling . Other studies have shown that serum levels of inflammatory cytokines are high in patients with hfnef and that interleukin16, a cytokine considered an important mediator in inflammation, promotes cardiac fibrosis and myocardial stiffening in hfnef . Consequently, investigating the relationships between inflammatory markers and prognosis in hfnef is important . We observed a significant correlation between plasma levels of ptx3, a novel inflammatory maker, and future cardiovascular events in patients with hfnef . Furthermore, considerable evidence suggests that ptx3 may better reflect local inflammatory status in tissues than does liverderived crp . We previously reported that ptx3 was partly produced in the coronary circulation in patients with hfnef . These results suggest that ptx3, rather than crp, reflects vascular and cardiac inflammation in patients with hfnef and might be a cardiovascular biomarker for the assessment and management of hf . In the present study, we showed that increased inflammation as assessed by ptx3 measurement was significantly associated with poor prognosis for hfnef patients by multivariable cox hazards analysis . Ptx3 as an inflammation maker and bnp as a myocardial stress marker to the previously established prognostic factors in the ipreserve study of hfnef patients improved their risk stratification performance, as indicated by an increase in the cstatistics . These results suggest the possible relative merits of these 2 biomarkers for future risk management in hfnef . In nri analyses, the addition of ptx3 was able to provide a more appropriate risk assessment in patients who were evaluated as having a high risk state by previously described hfnef prognostic factors (pf5 plus bnp) in patients without cardiovascular events . Furthermore, the addition of ptx3 never resulted in a worse risk classification in patients with cardiovascular events . Consequently, the significance of nri was shown by incorporating ptx3 into the new riskassessment model . The site of ptx3 production in patients with hfnef remains unclear . Under normal physiological conditions, ptx3 is expressed in atherosclerotic lesions, adipose tissue, and the heart with acute and subacutephase hf; however, the types of cells that express ptx3 in failing hearts of patients with hfnef and chronic hf have not been determined . Accumulation of the extracellular matrix (ie, fibrosis) may also be pathophysiologically important in progression of the hfnef disease process and be a contributor to subsequent events . Hfnef may also be caused by structural and molecular abnormalities of the cardiovascular system, including cardiac and noncardiac factors, such as those associated with vascular functions . We recently demonstrated significant involvement of endothelial dysfunction in the prognosis of patients with hfnef, suggesting that improvement in endothelial function could be a potential therapeutic target in patients with hfnef . Ptx3 is produced by fibrous tissues and endothelial cells in response to inflammatory stimuli and is considered an important marker of vascular pathology . In patients with acute mi and infectious myocarditis, ptx3 is produced by macrophages, endothelial cells, and, to a lesser extent, myocardiocytes and is localized in the interstitium . The interstitial localization of ptx3 in human failing hearts suggests that ptx3 is produced locally by fibroblasts in the cardiac interstitium . Consequently, in patients with hfnef, ptx3 might be produced by myocardial fibroblasts and/or endothelial cells rather than in subclinical atherosclerotic lesions in patients with hfnef . We found that the frequency of hfrelated cardiovascular events, including cardiovascular death and hospitalization for hf decompensation, was significantly higher in patients with high ptx3 levels than in those with low ptx3 levels . This finding suggests that ptx3 is more predictive of future hfrelated cardiovascular events than of vascular events in patients with hfnef . We used the median value of ptx3 (3.0 ng / ml) as the cutoff point in the present study . Suzuki et al demonstrated that the median value of ptx3 was 3.7 ng / ml in patients with hfref and split the patients into 2 groups: those above and those below 4.0 ng / ml . In this study, patients with hfref were targeted, and it has already been demonstrated that patients with hfref have higher inflammatory activity than those with hfnef . We previously demonstrated that the 75% range value of ptx3 was 2.90 ng / ml in nonhf patients with risk factors (hypertension, 67.8%; diabetes mellitus, 37.4%; dyslipidemia, 57.1%; and coronary artery disease, 55.0%). Furthermore, inoue et al showed that ptx3 levels were <2.28 ng / ml in healthy volunteers . In previous studies of cardiovascular events in stable patients with coronary risk factors, thus, we consider that the median value of 3.0 ng / ml for ptx3 was a clinically meaningful cutoff point in our study . First, our study included only a relatively small number of patients in a single center . Second, the population of this study was relatively young and predominantly male; had a low prevalence of atrial fibrillation, a higher frequency of mild hf, relatively lower bnp levels; and had less frequent use of diuretics . Because our institution is an educational hospital and the design was a singlecenter study in japan, the recruited patients with hfnef might have had differences in characteristics compared with those in western studies . Consequently, a large, multiracial, multicenter study is required to confirm our results . Recent studies in mouse models have shown that ptx3 has a cardioprotective effect, suggesting that ptx3 might protect the cardiovascular system by modulating the immune inflammatory balance . Further in vivo and in vitro experiments are required to determine the exact role of high ptx3 levels in hfnef . Despite these limitations, a largescale multicenter trial is warranted to further examine the pathological role and clinical significance of ptx3 in hfnef . High plasma ptx3 levels, but not other inflammatory markers including hscrp, are significantly correlated with future cardiovascular events in patients with hfnef . We are grateful to megumi nagahiro and saeko tokunaga of the department of cardiovascular medicine, faculty of life sciences, kumamoto university, kumamoto, japan, for their skillful technical assistance.
Muscle morphological characteristics, such as anatomical muscle cross - sectional area (csa), muscle length, and muscle volume (mv) are important physiological variables for assessing the functional capacity of a muscle . Although magnetic resonance imaging (mri) and computed tomography scans are the gold standard for measuring anatomical csa and mv, ultrasound is a utilizable technique that can be easily applied to clinical assessment and field surveys1 . In a small muscle, anatomical csa and mv can be measured using multiple images of individual muscles created by portable ultrasound . One study2 investigated the validity and reliability of mv measurements of the medial gastrocnemius using three - dimensional ultrasound, and reported that ultrasound overestimated mv by approximately 2 ml (1.1%) and underestimated muscle length by 3 mm (1.3%) across all joint angles compared to mri - measured values . In addition, the same study reported excellent reliability for repeated measures of mv (intrarater correlation coefficient (icc) = 0.99) and muscle length (icc = 0.97). These results suggest that multiple ultrasound images of a small muscle can accurately measure muscle morphological variables . The foot is the point of direct contact between the body and ground surface during standing and walking . Muscle forces generated by the toes and ankles may play an important role in maintaining balance because muscle strength is essential for posture and stability3, 4 . A few studies have reported that toe flexor muscle strength is associated with postural control . For example, handa et al.5 reported significant positive correlations between toe flexor strength and one - leg standing balance with the eyes open (r = 0.443, p <0.01) as well as functional reach (r = 0.620, p <0.01), in an analysis grouping men and women together . Kurihara et al.6 examined the relationships between toe flexor muscle strength and intrinsic and extrinsic foot muscle sizes in young men and women and found significant correlations between toe flexor muscle strength and mri - measured anatomical csa in the medial parts (r = 0.775, p <0.01) and lateral parts (r = 0.739, p <0.01) of foot intrinsic muscles . Recently, abe et al.7 reported a significant positive association between toe flexor muscle strength and accelerometer - determined light and moderate physical activities and average step counts . The results of these previous studies suggest that bigger intrinsic foot muscles in active individuals may be associated with greater toe flexor strength as well as good postural control . In a previous mri study6, however, only one mri image was used to determine the anatomical csa of individual intrinsic foot muscles, even though the foot has several toe flexor muscles with differing distributions among the toes . Therefore, the purpose of this study was to test the hypothesis that toe flexor muscle strength is related to the anatomical and physiological csa of intrinsic toe flexor muscles and that these morphological and functional variables associate with physical performance . Thirty - four young adults aged 20 to 35 years (17 men and 17 women) were recruited through printed advertisements and by word of mouth . Before accepting their informed consent, a written description of the purpose and safety of the study was distributed to all of the potential subjects . All subjects were healthy and free of overt chronic disease (e.g., neuromuscular disorders, arthritic disorders, etc) as assessed by self - report . The rate of regular sports activity (at least twice a week), among the subjects was 65% (82% in men and 47% in women). The main types of sports activities were judo (29%), resistance exercise (21%), and soccer (21%) for men, and jogging / running (50%) and canoeing (25%) for women . The study was conducted in accordance with the principles of the declaration of helsinki and was approved by the ethics committee for human experiments of the national institute of fitness and sports in kanoya, japan . Anatomical csa was measured using b - mode ultrasound (aloka prosound 6, tokyo, japan) with a 7.5 mhz linear array transducer (76 mm wide) in two intrinsic toe flexor muscles, the flexor digitorum brevis (fdb) and abductor hallucis (abh), as described previously8 . All subjects lay in the prone position during scanning of the two muscles . Using anatomic landmarks described by crofts et al.8, a linear transducer coated with water - soluble transmission gel was placed on the skin surface of the measurement sites, and cross sections of each muscle were imaged . Ultrasound images of each site were stored on a personal computer, and anatomical csa was measured using image - j software . The mean values (two images) of each site were used for data analysis . All ultrasound measurements were performed on the left (non - dominant) foot, and dominance was ascertained by asking each subject which foot they used to perform well - learned skills using a questionnaire9 . The muscle volume and muscle length of the fdb were estimated using multiple ultrasound images from the sole of the foot . After foot length (the distance between the tip of the great toe and the edge of the heel) measurements, all measurement sites were marked at 50% of the foot length as well as at contiguous 1-cm intervals from the point of 50% of the foot length in both the proximal and distal directions . 1.before the start of ultrasound testing, foot length (the distance between the tip of the great toe and the edge of the heel) was measured and then all measurement sites were marked at 50% of the foot length as well as at contiguous 1-cm intervals from the point of 50% of the foot length in both the proximal and distal directions . Typical ultrasound images (young woman, 20 yr) revealing transverse scans of the foot at contiguous 1-cm intervals from the point of 50% of the foot lengthfdb: flexor digitorum brevis) and the anatomical csa of the fdb was measured using the procedure described above . Muscle volume was calculated by multiplying anatomical csa by distance interval (1 cm). The distance between the most proximal image and the most distal image in which the fdb was visible was defined as the length of the fdb muscle . To calculate physiological csa, the fiber length of the fdb was estimated using the ratio of fiber length to muscle length (average of the second, third, fourth toes) as reported by kura et al10 . The physiological csa of the fdb was calculated by dividing muscle volume by fiber length . The test - retest reliability (icc, sem and minimal difference) was previously determined using the data of 7 young subjects (5 men and 2 women) scanned twice within 7 days (at least one day apart) for anatomical csa of the fdb (0.924, 0.13 cm, 0.36 cm) and abh (0.949, 0.21 cm, 0.58 cm) and muscle volume of fdb (0.971, 0.57 cm, 1.57 cm). Before the start of ultrasound testing, foot length (the distance between the tip of the great toe and the edge of the heel) was measured and then all measurement sites were marked at 50% of the foot length as well as at contiguous 1-cm intervals from the point of 50% of the foot length in both the proximal and distal directions . Typical ultrasound images (young woman, 20 yr) revealing transverse scans of the foot at contiguous 1-cm intervals from the point of 50% of the foot length fdb: flexor digitorum brevis toe flexor muscle strength (tfs) was measured using a toe - grasp dynamometer (tkk3361, takei, tokyo, japan), as described previously11, 12 . While barefoot, subjects stood in front of a wall and the left foot then the subjects were instructed to lift the right foot and maintain a one - legged upright standing position on the dynamometer, with both hands on the wall in front of them, while holding the dynamometer grasp bar with their toes . The distance between the bar and the heel was adjusted to the foot size of the subjects so that the distal phalanges of the great toe and fifth toe and the middle phalanges of the second to fifth toes could be placed on the toe grasp bar . Subjects were allowed to perform one test trial, followed by two maximum effort trials (tfs-5-toes), and the best value of the left foot was used for the data analysis . The subjects also performed two maximum effort trials to measure toe flexor muscle strength without the contribution of the great toe (tfs-4-toes). In these trials, a small metal plate was placed between the great toe and the toe grasp bar during these measurements for preventing the great toe from grasping the toe grasp bar of the dynamometer . Maximal toe flexor strength divided by body weight was calculated to evaluate the relative toe flexor strength . The test - retest reliability of toe flexor strength (tfs-5-toes and tfs-4-toes) measurements using the icc, sem and minimal difference was previously determined using the data of 7 young subjects (5 men and 2 women) tested twice within 7 days (at least one day apart): 0.962, 1.2 kg and 3.3 kg for tfs-5-toes and 0.883, 1.1 kg and 3.1 kg for tfs-4-toes . Maximum walking speed was measured by timing each subject as they walked along a 10-meter corridor with a ceramic floor surface . The total length of the marked corridor was 14 meters, allowing 2-meter acceleration and deceleration zones . The width of the corridor was constricted to 1 meter to encourage subjects to maintain a straight course . Subjects used their own footwear and had to start 2 meters before the beginning of the start line, and to continue until the 2 meters past the goal line . After one practice trial, subjects performed two maximum speed timed trials . Subjects were asked to walk down the corridor as fast as possible without running . Times were measured with an electronic timing system (nearest 0.01 s, brower timing system, draper, usa). The best time was converted to a maximum speed measurement (unit, m / s) and the best value was used as the maximum walking speed . The test - retest reliability of this measurement using the icc, sem and minimal difference was previously determined using the procedure described above: 0.930, 0.14 the functional reach test was measured using the method described in a previously reported study4 . Before the start of the test, subjects were instructed to stand with both feet touching a marked line and to maintain that foot position throughout testing . The subject then performed shoulder forward flexion with the right shoulder until an angle of 90 degrees was reached . Next, the subjects tried to extend their middle finger as far forward as possible without moving their feet and keeping their arm parallel to the ground . The distance moved by the end of the middle finger between the starting position and maximum forward position subjects performed two trials, and the best value was used for the functional reach test . The test - retest reliability of this measurement using the icc, sem and minimal difference was previously determined fusing the procedure described above: 0.889, 2 cm and 5 cm, respectively . Before comparisons were made, the distributions of the dependent variables were tested for normality using the shapiro - wilk test . The difference between men and women was tested for significance using the unpaired student s t - test, and when variables were not normally distributed, the mann - whitney u test was used . Pearson product correlations were performed to determine the relationships between toe flexor muscle strength and intrinsic toe flexor muscle size as measured by ultrasound and between the morphological and functional variables of toe flexor muscle and physical performance . Men were taller and heavier than women . Compared with women, men had higher anatomical csa in the fdb and abh, as well as muscle volume and physiological csa of the fdb . Maximum tfs-5-toes and tfs-4-toes were higher in men than in women; however, the specific strength (tfs-4-toes per unit physiological csa) of the fdb, walking speed and functional reach were similar for both men and women (table 1table 1.maximum toe flexor muscle strength, physical performance and ultrasound measurements of intrinsic foot muscle sizes of young men and womenmenwomenoverall(n=17)(n=17)(n=34)age (yrs)24 (4)24 (4)24 (4)height (m)1.71 (0.05)1.60 (0.05)1.66 (0.07)body mass (kg)72.9 (11.4)52.1 (5.1)62.5 (13.6)body mass index (kg / m)24.8 (3.1)20.4 (2.0)22.6 (3.4)foot length (cm)25.2 (1.2)22.6 (0.7)23.9 (1.6)flexor digitorum brevisacsa max (cm)2.61 (0.38)1.65 (0.33)2.13 (0.60)mv (cm)11.95 (2.93)6.66 (2.10)9.31 (3.67)pcsa (cm)6.38 (1.04)3.95 (0.97)5.17 (1.58)abductor hallucisacsa (cm)2.89 (0.69)2.02 (0.59)2.46 (0.77)tfs-5 toes (kg)29.1 (5.3)21.2 (4.7)25.1 (6.4)tfs-4 toes (kg)10.4 (3.2)6.4 (2.6)8.4 (3.5)tfs-4 toes / pcsa (kg / cm)1.63 (0.40)1.62 (0.56)1.63 (0.48)walking speed (m / s)3.19 (0.65)3.14 (0.66)3.17 (0.64)functional reach (cm)38.1 (6.3)39.1 (4.0)38.6 (5.2)maximum toe flexor muscle strength with (tfs-5 toes) and without (tfs-4 toes) the contribution of the great toe; acsa, anatomical cross - sectional area; mv, muscle volume; pcsa, physiological cross - sectional area . * maximum toe flexor muscle strength with (tfs-5 toes) and without (tfs-4 toes) the contribution of the great toe; acsa, anatomical cross - sectional area; mv, muscle volume; pcsa, physiological cross - sectional area . * significant difference from women, p<0.001 there was a significant correlation between tfs-5-toes and tfs-4-toes of men (r = 0.739, p <0.001) and women (r = 0.731, p <0.001). Both tfs-5-toes and tfs-4-toes correlated positively with the maximum walking speed of men (r = 0.584, p = 0.014 and r = 0.553, p = 0.021, respectively), women (r = 0.748, p <0.001 and r = 0.533, p = 0.028, respectively) and the whole sample (r = 0.535, p = 0.001 and r = 0.459, p = 0.006, respectively). However, the correlations between tfs-5-toes and functional reach of both men (r = 0.399) and women (r = 0.166) were not significant (p>0.05). Anatomical csa of the abh did not significantly correlate with tfs-5-toes of either men (r = 0.034, p = 0.896) or women (r = 0.387, p = 0.125); however, the correlation of the whole sample was significant (r = 0.454, p = 0.006). For women, there were significant positive correlations between tfs-5-toes and anatomical csa max (r = 0.713, p = 0.001), muscle volume (r = 0.604, p = 0.010), and physiological csa (r = 0.687, p = 0.002) of the fdb . For men, however, the observed anatomical csa max (r = 0.143, p = 0.584), muscle volume (r = 0.332, p = 0.192), and physiological csa (r = 0.333, p = 0.191) of the fdb did not correlate significantly with tfs-5-toes . Physiological csa of the fdb correlated positively with tfs-4-toes of men (r = 0.541, p = 0.025), women (r = 0.573, p = 0.016) and the whole sample (r = 0.720, p <0.001) (fig . 2fig . 2.relationships between physiological cross - sectional area (csa) in the flexor digitorum brevis (fdb) and toe flexor muscle strength (tfs-4 toes) of young men and women . Tfs-4 open circles are men and filled circles are women). Relationships between physiological cross - sectional area (csa) in the flexor digitorum brevis (fdb) and toe flexor muscle strength (tfs-4 toes) of young men and women . Tfs-4 the main findings of the present study were that physiological csa of the fdb was significantly correlated with tfs-4-toes of both men and women; physiological csa of the fdb was significantly correlated with tfs-5-toes of women, but not that of men; there was a significant correlation between toe flexor muscle strength and maximum walking speed in both genders . In the present study, the fdb was selected as representative of the intrinsic toe flexor muscles, because a more accurate estimation of muscle volume by ultrasound and calculation of physiological csa of the muscle can be achieved than of the other intrinsic toe flexor muscles . The fdb muscle volume reliability results (icc of 0.971 and sem of 0.57 cm) indicate that the ultrasound method of the present study is a good repeatable technique for measuring muscle volume . The fdb is located in the sole of the foot and separates into four tendons that insert onto the middle phalanges of the four lateral toes10 (without the great toe). Therefore, our results demonstrate that the physiological csa of the fdb is associated with tfs-4 toes of both men and women, even though the correlation was only moderate . Toe flexor muscle strength is generated from a combination of the intrinsic and extrinsic foot muscles . In the hand, the grip strength decreases by approximately 50% after median and ulnar nerve (intrinsic muscles) blocks compared with the pre - block measurement13 . Accordingly, the contribution of extrinsic toe flexor muscles may reflect the moderate correlations between tfs-4 toes and physiological csa of the fdb . In addition, individual differences in the moment arm (located between the center of curvature of the metatarsal head and the center of the flexor tendon) and/or differences in the dominant / non - dominant sides may also be unknown factors14 . Our findings show that the anatomical and physiological csa of the fdb of women were significantly correlated with tfs-5 toes . For men only one study6 has examined the relationships between toe flexor muscle strength and intrinsic and extrinsic foot muscle sizes in young sedentary adults (14 men and 12 women) and a pooled sample was used for data analysis . That study reported significant correlations between tfs-5 toes and mri - measured anatomical csa of the medial parts (r=0.775, p<0.01) and lateral parts (r=0.739, p<0.01) of the foot intrinsic muscles, although only one mri image was used in that investigation . In the present study, the reason for the lack of a significant correlation between tfs-5 toes and the fdb muscle size observed in men is unknown . Approximately half of our young women were sedentary and the other half performed mainly jogging / running or canoeing . Therefore, our women participants may have had relatively homogeneous morphological and functional properties of the toe flexor muscles, which might partially explain the significant correlations . On the other hand, most of our young men were physically active and performed different sports including judo, resistance exercise and/or soccer . A likely explanation is that physical activity in different sports may elicit non - homogeneous features among toe flexor muscles, especially between the great toe and the four other toes . Together, the results of the present and previous studies suggest that differences in sports experience may be a factor underlying the poor correlation of tfs-5-toes and fdb muscle size in young men . Additional research into these issues is needed . In the present study, both tfs-4-toes and tfs-5-toes this finding is consistent with the results of previous studies5, 15 which found significant correlations between 10-m walking performance and tfs-5-toes (r=0.459, p<0.01)5 and improved 50-m dash time following 8 weeks of toe flexor strength training15 . Thus, the results of the present and previous studies demonstrate that toe flexor muscle strength is an important factor determining maximum walking speed . On the other hand, no significant correlation of tfs-5-toes and functional reach of either young men or women was found . Although a pooled sample with a wide age range (20 to 84 yrs) was used, one study reported a significant positive correlation (r=0.620, p<0.01) between tfs-5-toes and functional reach5 . The discrepancy in the results of the present and that previous study is not known, but the difference in subject age ranges between the two studies may have played a role . In conclusion, although toe flexor muscle strength correlated positively with walking speed in both genders, its correlation with functional reach was not statistically significant . The lack of a significant relationship between tfs-5-toes and physiological csa of the fdb in men may be related to different experiences in sports.
Cardiomyogenesis (generation of cardiomyocytes) had not been convincingly demonstrated in the adult mammalian heart until very recently; the potential for myocardial regeneration was only recognized in organisms such as fish and amphibians . However, carefully designed and performed studies have produced compelling evidence for the existence of cardiomyocytes in the adult heart, that were formed well after birth, in rodents and even humans . Although the various studies do not agree about the rate of cardiomyocyte renewal in adults, this is clearly low and inadequate to replenish the substantial losses of cells after major injuries such as a myocardial infarction . In addition, controversy surrounds the putative cellular sources of postnatal cardiomyogenesis: do new myocytes arise from proliferation of pre - exisiting ones or from cardiomyogenic differentiation of endogenous progenitors? In this review, we will present the evidence supporting the contribution of these two mechanisms in adult cardiomyogenesis and discuss their relative importance in different settings, such as normal ageing and post - myocardial injury . We will also critically present the existing methodologies that allowed the investigation of these mechanisms, with emphasis on their strengths and limitations . While lower vertebrates (such as newts and zebrafish) and neonatal mice possess a robust ability for myocardial regeneration, the ability of the mammalian heart to generate myocytes beyond the early neonatal period has been controversial . During the 20th century, the postnatal mammalian heart was viewed as a post - mitotic static organ, in which increases in mass occur exclusively through myocyte hypertrophy (i.e. Increase in cell size), rather than hyperplasia (increase in cell number). The first studies hinting towards postnatal cardiomyogenesis in the human heart can be traced back to the 1970s . By employing histopathological, biochemical and cytophotometric techniques (to measure dna content and nuclear ploidy), adler et al . They found that while normal hearts contained 2 billion cardiomyocytes, hearts with pathologic hypertrophy contained up to 4.8 billion cardiomyocytes . These findings suggest that adult human hearts may generate new cardiomyocytes during pathologic hypertrophy . In 1998, the anversa group examined explanted human hearts obtained from end - stage heart failure patients and from control subjects (who died of non - cardiovascular causes). Fluorescent immunohistochemistry (ihc), for sarcomeric proteins and propidium iodide (pi, a dna dye which labels the cell nucleus), demonstrated the presence of cardiomyocytes undergoing mitosis (either nuclear division [karyokinesis] or cell division [cytokinesis]) in control hearts (14 mitotic myocytes / million myocytes). In end - stage heart failure hearts, the number of mitotic cardiomyocytes increased 10-fold (140 mitotic myocytes / million myocytes). These rates of myocyte mitosis (if they translate into genuine proliferation) project to an annual turnover of 10% in the healthy adult human heart and 107% in the failing human heart . Fluorescent ihc for sarcomeric proteins, pi and ki67 (a protein expressed in the nucleus of cells in the active phases of the cell cycle [late g1, s, g2, and m phase]) in human hearts obtained from patients who died 412 days post myocardial infarction demonstrated ki67 expression in 4% of myocyte nuclei in the infarct border zone and in 1% of myocytes in the remote myocardium . Mitosis (karyokinesis or cytokinesis) was observed in 0.08% of myocytes (800 mitotic myocytes / million myocytes) in the border zone and 0.03% of myocytes (300 mitotic myocytes / million myocytes) in the remote myocardium . If such exceptionally high rates of myocyte cell cycling could be persisted and resulted in genuine proliferation (while no significant myocyte loss occurred post - myocardial infarction beyond the initial ischemic insult), then all myocytes lost after an infarct affecting 30% of the left ventricle could be replaced within as little as 18 days . More recently, the anversa group investigated the rates of myocyte turnover in the aging human heart . Fluorescent ihc for sarcomeric proteins, ki67, phosphorylated histone h3 (h3p, a marker of karyokinesis) and aurora - b - kinase (a marker of cytokinesis) was performed in explanted hearts from human subjects who died of non - cardiovascular causes . The investigators reported that myocyte turnover increases with age, and that female hearts possess a higher regenerative capacity compared to male hearts . In the female heart, myocyte turnover occurs at an annual rate of 10%, 14%, and 40% at 20, 60, and 100 years of age, respectively . The corresponding values in the male heart are 7%, 12%, and 32% per year . The investigators calculated that from 20 to 100 years of age, the myocyte compartment is replaced 15 times in women and 11 times in men . Performed fluorescent immunocytochemistry for h3p in dissociated myocytes isolated from explanted hearts from human subjects who died of non - cardiovascular causes . Fluorescent immunohistochemistry (in tissue sections) for mitotic kinesin - like protein was employed for investigation of myocyte cytokinesis . The investigators reported a decrease in myocyte turnover with age: annual myocyte turnover is 100% during the first year of life, decreases to 1.9% at 20 years of age and drops to 0.04% in subjects older than 40 years . The investigators calculated that during the first two decades of life, the total number of myocytes in the left ventricle increases 3.4 fold . However, it needs to be noted that while cardiomyocyte karyokinesis was detectable throughout life, no instances of myocyte cytokinesis were observed beyond 20 years of age . While the aforementioned studies demonstrate that human myocytes can re - enter the cell cycle and may possess some ability to proliferate beyond the early postnatal period, the calculated turnover rates need to be interpreted with caution . Estimations of the total number of myocytes per heart (as performed by adler et al .) Are complicated, require numerous assumptions and can be confounded by problematic discrimination of myocyte versus non myocyte nuclei (which in those studies was performed based on nuclear size and morphology). Quantification of cardiomyocyte cycling with histology (as performed by the anversa group) is prone to sampling error and can be complicated by the fact that conventional histology has been shown to be problematic for identification of cardiomyocyte nuclei (this will be discussed later). Finally, estimation of turnover rates based on exceedingly rare and brief (mitosis in adult rat cardiomyocytes lasts 1.8 h in vitro) events that may not represent instances of genuine myocyte division (mitotic events involving in karyokinesis and myocyte multinucleation, but not cytokinesis and generation of daughter cells) leaves significant room for error . Ideally, slow processes (like myocyte regeneration) need to be quantified over time, rather than based on a single snapshot . To that end, a more reliable approach to study birth of new myocytes over prolonged periods of time is the pulse - chase approach . In pulse - chase experiments cells (in our case cardiac myocytes) are exposed to a labeled compound (pulse), and then are followed for a period when the labeled compound is no longer administered (chase). However, while pulse - chase approaches can be readily implemented in experimental animals (where pulsing is typically performed through administration of nucleoside analogues), extraordinary circumstances are required for this approach with humans . Examples of such extraordinary circumstances were the above - ground nuclear testing during the cold war, which resulted in the temporary release of large quantities of c into the atmosphere between 1955 and 1963 (c pulse). After the limited nuclear test ban treaty in 1963, atmospheric c concentration dropped exponentially (chase), resulting in unique pulse - chase conditions . In a seminal study, bergmann et al . Hypothesized that postnatally generated cardiomyocytes the concentration of c in dna of myocytes can be used to retrospectively establish a date mark for when myocytes were born (by identifying the year that atmospheric c levels were similar to c levels in myocyte dna). This can be achieved since: a) c levels in the human body reflect those of the atmospheric air (c reacts with oxygen in the atmosphere to form co2, which then enters the biotope through photosynthesis); and b) dna remains stable following the last cell division . By measuring c concentration (with accelerator mass spectrometry) in dna extracted from fluorescence - activated - sorted myocyte (troponin positive) nuclei isolated from explanted hearts (12 hearts total, 10 from subjects who died of non - cardiovascular causes and 2 from patients who died due to an acute myocardial infarction), bergmann et al mathematical modeling demonstrated that postnatal cardiomyogenesis decreases with age: cardiomyocyte turnover is 1%/year at the age of 25 and gradually decreases at 0.45%/year at the age of 75, resulting in an exchange of 45% of myocytes during a 50-year span . A more recent study by the anversa group employed similar methods but yielded strikingly different results . Performed carbon dating with accelerator mass spectrometry in dna extracted from myocytes obtained from 19 healthy hearts and 17 hearts with cardiomyopathy . It should be noted that in this study myocytes were isolated based on density centrifugation, rather than fluorescence - activated cells sorting of troponin positive nuclei (as in the study by bergmann et al . ). The investigators found that the healthy adult human heart replaces its entire myocyte compartment 8 times between 20 and 78 years of age . Somewhat unexpectedly, the turnover rate of myocytes was found to be similar to that of endothelial cells and cardiac fibroblasts . It has been argued that staining of myocyte nuclei for troponin (as performed by bergmann et al .) Only identifies nuclei of senescent myocytes; this could result in significant underestimation of myocyte turnover . Another unique circumstance allowing for implementation of a pulse - chase approach to measure myocyte turnover in the human heart is the use of radiosensitizing nucleoside analogues for therapeutic purposes in cancer patients . Nucleoside analogues are incorporated into newly - synthesized dna of cycling cells and can therefore serve as markers of dna synthesis . Investigated incorportation of the thymidine analogue iododeoxyuridine (idu) into dna of myocytes by fluorescent immunohistochemistry in hearts explanted from 8 cancer patients that had previously (8 days 4 years before death and heart explantation) received infusions of the radiosensitizing agent . The investigators found idu labeling (i.e. Dna synthesis) in 2.546% of myocyte nuclei, which projects to an annual myocyte turnover of 22% . Concerns have been raised that such high turnover rates are difficult to reconcile with high labeling indices of idu after long chase periods: rapid cell turnover would presumably translate into death of a significant portion of idu - labeled myocytes as well as into substantial dilution of idu (to undetectable levels) due to rapid cell proliferation during the chase period; both processes would result in significantly lower myocyte labeling indices of idu at the time of death . A perhaps more logical explanation for the high rates of idu myocyte labeling in that study is that a substantial portion of the measured dna synthesis may represent instances of abortive cell - cyle re - entry, resulting in polypolidization or binucleation, rather than genuine myocyte proliferation (more on that later). While the investigators attempted to rule out polyploidization as a significant confounding factor (they surprisingly reported that> 80% of human myocyte nuclei are diploid, in contrast to several other studies suggesting that the majority is polyploidy), no effort was undertaken to quantify to the potential contribution of bi / multinucleation to the measured rates of dna synthesis . The estimated rates of myocyte turnover measured in adult mammalian hearts (human and mouse) are depicted schematically in figure 1 . Taken together, even though reported rates of myocyte turnover vary wildly (by more than 1 order of magnitude), the aforementioned studies convincingly establish that the human heart can generate new myocytes beyond the early postnatal period . However, studies in human subjects cannot provide insight into the cellular origins of postnatal mammalian cardiomyogenesis: do newly - generated myocytes arise from division of pre - existing myocytes or from cardiomyogenic differentiation of endogenous progenitors? A landmark study by soonpaa and field in 1998 demonstrated convincingly that preformed cardiomyocytes can actively cycle in the adult mouse heart . Pulse - chase experiments were performed in transgenic mice, in which a nuclear - localized -galactosidase reporter gene was expressed in cardiomyocytes (driven by the -myosin heavy chain [mhc] promoter). Adult mice received injections of h - thymidine and were sacrificed 4 h after the last injection . Heart sections were processed for x - gal reaction (to identify cardiomyocyte nuclei) and autoradiography (to identify incorporation of h - thymidine into the dna, i.e. Dna synthesis). Normal adult hearts had a myocyte labeling index of 0.0006% (1/180000 cardiomyocyte nuclei had incorporated h - thymidine). This projects to an annual myocyte turnover of 1% (if dna synthesis is accompanied by genuine cell division). After myocardial injury (focal cauterization), myocyte cycling in the border zone increased 14-fold (labeling index of 0.0083% [3/36000 cardiomyocyte nuclei had incorporated h - thymidine]). With regard to the cellular origins of cycling cardiomyocytes, identification of morphologically mature cardiomyocytes that have synthesized their dna within 4 h after a single injection of a nucleoside analogue) can only be attributed to dna synthesis in pre - existing myocytes (as differentiation of progenitors to mature myocytes would take longer). More recently, an elaborate study by the lee group investigated the contribution of resident myocyte proliferation to postnatal cardiomyogenesis by a combination of genetic fate - mapping, stable isotope labelling and multi - isotope imaging mass spectrometry . The investigators employed an inducible fate mapping approach utilizing bitransgenic mhc- mercremer / zeg mice . In these mice, induction of cre recombinase activity (driven by mhc promoter) by 4-oh - tamoxifen results in efficient (80%) permanent genetic labeling of myocytes (and their progeny) by green fluorescent protein (gfp). 4-oh - tamoxifen - pulsed adult, healthy bitransgenic mice underwent pulsing with n - thymidine over a 10-week period . Multi - isotope imaging mass spectrometry (which has a resolution capacity of <1 m and thus can readily distinguish cardiomyocyte nuclei from adjacent non - cardiomyocyte nuclei) in sections from explanted hearts revealed a n myocyte labeling index of 0.8% over 10 weeks; this projects to an annual rate of myocyte dna replication of 4.4% . The investigators undertook extensive efforts to calculate the contribution of abortive cell cycle re - entry (resulting in polyploidization and/or multinucleation, rather than genuine cell division) to the measured dna synthesis . Perhaps not surprisingly, they found that the majority of dna synthesis occurred in polyploid and/or multinucleated myocytes . However 17% of the measured dna synthesis could not be explained away by these confounding factors, leaving generation of new myocytes as the only likely explanation and suggesting an annual myocyte turnover of 0.74% in the healthy adult mouse heart . With regard to the cellular origins of postnatal cardiomyogenesis, n+ cardiomyocytes expressed gfp at a similar frequency as n- myocytes, suggesting that in the normal heart new myocytes are generated mainly through proliferation of pre - existing myocytes, rather than differentiation of endogenous progenitors . Similar experiments performed in adult mice post - myocardial infarction showed a 20-fold increase in myocyte division in the infarct border zone during the first 8 weeks following injury, which was also attributed to proliferation of pre - existing myocytes rather than contributions of endogenous progenitors to the myocyte pool . In a parallel study at the marbn laboratory, we attempted to quantify postnatal cardiomyogenesis and trace its cellular origins using a combination of genetic fate mapping with long - term pulsing with the nucleoside analogue bromodeoxyuridine (brdu). Healthy adult bitransgenic mhc - mercremer / zeg mice were pulsed with 4-oh - tamoxifen to genetically label pre - existing cardiomyocytes with gfp . Figure 2 depicts two genetically labeled pre - existing cardiomyocytes (pseudocolored in green) that have incorporated brdu (pseudocolored in white). Measurement of dna synthesis (brdu incorporation) in pre - exisiting (gfp+) cardiomyocytes by different methods (flow cytometry of whole cells, flow cytometry of isolated myocyte nuclei, fluorescent immunocytochemistry of dissociated cardiomyocytes and fluorescent immuhistochemistry in cardiac sections) demonstrated that 0.4% of pre - existing (gfp+) myocytes synthesized dna during 5 weeks of brdu pulsing, suggesting an annual rate of dna replication in resident myocytes of 4% . Actively cycling cardiomyocytes were smaller and more - often mononucleated compared to non - cycling myocytes . Quantification of the contributions of polyploidization and multinucleation to the measured rates of brdu incorporation demonstrated that abortive cell - cycle re - entry without genuine cell division could explain 69% of the observed dna synthesis; thus the calculated annual rate of myocyte turnover due to cardiomyocyte proliferation in the adult healthy mouse heart was 1.3% . Myocardial infarction resulted in a 2-fold increase in the total number of proliferating myocytes in the left ventricle during the first 5 weeks post - injury; this increase was attributed to an upregulation in proliferation of pre - existing myocytes in the border zone (10 fold compared to normal heart), but not in the remote myocardium . Taken together, the aforementioned studies suggest that mammalian myocytes retain a limited but measurable capacity to proliferate in the healthy adult heart, and that myocyte proliferation increases modestly in the border zone following myocardial infarction . During the past decade several studies supported the notion that the adult mammalian heart contains its own reservoir of stem cells . Numerous populations of putative adult endogenous cardiomyocyte progenitors have been proposed (including c - kit cells, sca-1 cells, side population cells, cardiosphere - forming cells, ssea-1 cells, pdgfr cells and neural - crest derived cells) largely based on expression of surface markers or functional properties that have been used to mark progenitors in other organs . The high number of distinct populations of putative endogenous myocyte progenitors is difficult to reconcile with the limited regenerative capacity of the adult mammalian heart . Importantly, while several cell types have been shown to express cardiac proteins in vitro or after delivery into recipient hearts following ex vivo expansion, their physiologic importance and contribution to cardiomyocyte replenishment in the normal or injured adult heart remains controversial . Genetic fate mapping is a powerful tool that enables study of cardiac regeneration in vivo . Perhaps the most compelling evidence indicating postnatal contribution of endogenous progenitors to the adult myocyte pool comes from a landmark study performed at the lee laboratory . Using mhc - mercremer / zeg adult bitransgenic mice, hsieh et al . Achieved inducible genetic labeling of 80% of preexisting myocytes with gfp, without any detectable labeling of progenitor - like cells (which in their inactive state presumably do not express mhc). In the normal heart, the percentage of gfp+ myocytes remained unchanged over 1 year of follow - up, indicating that progenitor cells do not contribute significantly to myocyte renewal during normal aging . In contrast, when mice were subjected to myocardial infarction the percentage of gfp+ cardiomyocytes decreased from 83% to 68% in the border zone and to 77% in the remote myocardium over a 3-month follow - up period . Following pressure - overload, the percentage of gfp+ myocytes decreased from 83% to 76% over 3 months . These results indicate that post - cardiac injury, unlabeled progenitors undergo cardiomyogenic differentiation, resulting in dilution of gfp+ myocytes by gfp myocytes (generated from unlabeled precursors) (figure 3a). Alternatively, the observed dilution of the labeled myocyte pool could be attributed to intrinsic differences between gfp+ and gfp- myocytes, i.e. Increased proliferative capacity of gfp- myocytes post - injury or increased susceptibility of gfp+ myocytes to injury (even though the latter hypothesis has not been shown to occur). Brdu pulsing revealed increased incorporation of brdu in gfp- myocytes (compared to gfp+ myocytes) post - injury, a finding also compatible with generation of new myocytes from progenitors . Based on these findings, the contribution of endogenous precursors to the myocyte pool post - injury appears to be quite substantial: over a 3-month period, 15% of myocytes in the border zone and 6% of all myocytes in the left ventricle arise from cardiomyogenic differentiation of progenitors . The results of this study (particularly the increased brdu labeling of gfp- myocytes) do not fully agree with a more recent study from the same group (described earlier), in which no increased n incorporation into gfp myocytes could be detected by multi - isotope imaging mass spectrometry, suggesting no significant contribution of endogenous precursors to the myocyte pool post - injury . This discrepancy may be a result of the very small number of mononucleated / diploid n+ myocytes (16 n+ myocytes/ 7063 myocytes analyzed) detected in injured hearts by multi - isotope imaging mass spectrometry (an extremely time - consuming method that precludes analysis of large amounts of tissue); this number may be too small to detect differences in the rate of n incorporation in gfp+ and gfp myocytes . At the marbn lab after inducible genetic labeling of cardiomyocytes by gfp, adult bitrangenic mhc - mercremer / zeg mice received daily brdu injections for 5 weeks . Comparison of brdu incorporation in gfp+ and gfp cardiomyocytes (by flow cytometry, immunocytochemistry and histology) revealed similar rates of brdu labeling in both myocyte subsets in healthy mice . These findings indicate that in the normal adult mouse heart, myocyte turnover occurs predominantly through proliferation of resident myocytes, without any measurable progenitor - mediated myocyte formation . However, post - myocardial infarction we could detect a contribution of endogenous precursors to the myocyte pool (1% of myocytes in the left ventricle arose from progenitor cell differentiation over a 5-week period post - injury) (figure 4). A different technique (viral gene tagging) to study endogenous cardiac regeneration was employed by the anversa group . Injected lentiviruses expressing gfp in the atria and ventricular apex (presumably sites of cardiac stem cell niches) of adult mice . One to 5 months later, nested polymerase chain reaction revealed common viral integration sites in c - kit+ cells, cardiomyocytes, endothelial cells and fibroblasts isolated from the infected hearts . Since lentiviruses are semi - randomly integrated in the host genome of infected cells, these results suggest that postnatally - generated cardiomyocytes, endothelial cells and fibroblasts in the healthy adult mouse heart derive from clonal activation of endogenous stem cells . Six months after viral injection, 25% of myocytes in the mid - portion of the left ventricle (a myocardial region away from the sites of viral injections) were gfp+, presumably arising from migration of gfp+ infected progenitor cells to that region and subsequent differentiation . These results indicate a remarkable capacity of the adult mouse heart for stem - cell mediated cardiomyocyte replenishment . However, it needs to be emphasized that viral gene tagging cannot reveal the identity of the parental stem cell . The fact that c - kit cells shared similar viral integration sites as cardiomyocytes, endothelial cells and fibroblasts could be a result of viral infection of a yet unknown progenitor that gives rise to all four celltypes . Fate mapping of resident myocytes or viral gene tagging cannot reveal the identity of endogenous progenitors, as they indirectly capture the net result of their activation and differentiation . This can only be performed through forward fate mapping experiments in which endogenous progenitors (but not pre - existing myocytes) are genetically labeled in a prospective manner, enabling direct visualization of their future contributions to the myocyte pool (figure 3b). Such an approach was undertaken at the fukuda lab in order to investigate the contribution of neural - crest derived cells to postnatal cardiomyogenesis . Tamura et al . Used bitransgenic mice in which activation of cre - recombinase (under the control of protein-0 promoter) induces gfp expression, resulting in genetic labeling of neural - crest derived cells by gfp . In the healthy heart, neural - crest derived (gfp+) cardiomyocytes were undetectable during the first week after birth but appeared at 2 weeks postnatally and increased in number thereafter; however, their absolute contributions to the myocyte pool were minimal (0.3% gfp+ cardiomyocytes in the septum, <0.1% gfp+ cardiomyocytes in the rest of the left ventricle). After myocardial infarction, small gfp+ cardiomyocytes (presumably arising from differentiation of neural - crest - derived cells) first appeared in the border zone 2 weeks post - injury and gradually increased in number thereafter (comprising 3% of total cardiomyocytes in the border zone at 12 weeks post - injury). While this study is limited by the fact that the activity of cre - recombinase was not temporally controlled in an inducible manner (and thus spontaneous activation of the protein-0 promoter in resident cardiomyocytes would result in gfp labeling) it suggests that progenitor cells may contribute to generation of new myocytes (especially post - injury). Using a similar forward fate mapping approach, ellison et al recently reported that endogenous c - kit+ cardiac cells are a source of newly formed cardiomyocytes, after myocardial injury, in adult rodents . The investigators used a model of a single, high isoproterenol dose that produces severe, albeit spontaneously resolving, myocardial injury . Endogenous c - kit+ cardiac cells were genetically labeled by exogenous administration of a lentivirus expressing cre - recombinase . Under the control of a c - kit promoter, in hearts of ryp reporter mice . In this mouse model, expression of cre - recombinase in c - kit+ cell results in genetic labeling of infected c - kit+ cells with yellow fluorescent protein (yfp). After isoproterenol injury, a significant fraction of cardiomyocytes were yfp+, indicating that they comprise newly generated cardiomyocytes arising from cardiomyogenic differentiation of infected c - kit+ cells . While this study suggests an important role of progenitor cell - mediated cardiomyogenesis post - injury, it is in contrast with previous studies, reporting that adult c - kit+ cells have only angiogenic but not cardiomyogenic potential . In addition, the implemented spontaneously - resolving model of heart failure may not be physiologically relevant . Finally, it needs to be emphasized that c - kit is not a specific marker of stem cells, but it is rather expressed in a variety of cells (e.g. Mast cells) and more importantly in myocytes themselves during both proliferation and differentiation . Thus, the precise expression pattern of c - kit in forward fate mapping models has to be delineated at baseline prior to temporal assessment of possible progeny, before concrete conclusions can be reached . Currently, several studies using forward fate - mapping approaches for putative markers of endogenous progenitors (including c - kit, sca-1 and nkx2 - 5) are ongoing in multiple labs . Taken together, the aforementioned studies suggest that endogenous progenitors may generate new myocytes in the adult heart . While their role in postnatal cardiomyogeneis during normal ageing appears to be limited (as most studies concur that myocyte turnover in the healthy heart most likely occurs through proliferation of pre - existing myocytes), multiple studies indicate progenitor cell - mediated cardiomyocyte renewal occurs following myocardial injury . It needs to be emphasized that the two proposed mechanisms of myocyte turnover (cardiomyocyte proliferation and differentiation of endogenous progenitors) are not mutually exclusive . The adult mammalian liver has an impressive capacity to regenerate; following acute 70% partial hepatectomy, the adult liver can fully regenerate within days (in rodents) to weeks (in humans), through division of mature hepatocytes and cholangiocytes, which re - enter the cell cycle and divide . However, during chronic liver injuries, hepatic progenitor cells also become activated and contribute to liver regeneration . In addition, inherent characteristics of cardiac tissue architecture and cardiomyocyte biology further complicate quantification of postnatal cardiomyogenesis and tracing of its cellular origins in the mammalian heart . Below, we review the major challenges when studying endogenous postnatal cardiac regeneration . First, since postnatal cardiomyogenesis in the mammalian heart most likely occurs at very low levels, pulse - chasing approaches with long pulsing periods are preferable in experimental animals, as they maximize the chance of capturing rare events of myocyte proliferation . However, long - term administration of radiolabeled thymidine or halogenated nucleoside analogues (like brdu) may be toxic and could affect the cycling rates of cardiomyocytes . Nevertheless, we did not observe any differences in the rates of actively - cycling (ki67 +) cardiomyocytes in mice that received brdu for up to 5 weeks compared to mice that did not receive brdu . Second, the use of conventional histology (which typically employs confocal microscopy for analysis of cardiac sections stained for sarcomeric proteins, dna [for nuclear identification] and [in some cases] cellular borders) to identify cardiomyocyte nuclei is problematic . Ang et al . Performed a careful study to investigate the fidelity of conventional myocyte nuclear identification using confocal microscopy . A transgenic mouse in which cardiomyocyte nuclei are genetically labelled (by a nuclear - localized -galactosidase reporter gene driven by the mhc promoter) was used as the gold - standard . The investigators demonstrated that conventional histological approaches typically misidentify myocyte nuclei 10% of the time, thus significantly compromising accurate quantification of rare events (like active cycling of myocytes). The limitations of conventional microscopy can be overcome by use of transgenic lineage reporters that mark cardiomyocyte nuclei, implementation of approaches with powerful resolution capacity (e.g. Multi - isotope imaging mass spectrometry), or analysis of enzymatically dissociated cardiomyocytes . Third, it needs to be emphasized that dna incorporation of nucleoside analogues or nuclear expression of cell - cycle proteins, while demonstrating cell - cycle activity, does not necessarily translate into genuine cell division and proliferation; important confounding factors that need to be accounted for include polyploidization (dna proliferation without karyokinesis and cytokinesis) and bi / multinucleation (dna proliferation and karyokinesis without cytokinesis), cell fusion and dna repair (figure 5). While cell fusion and dna damage and repair are exceptionally rare events that cannot account for the magnitude of measured turnover rates, polypolidization and bi / multinucleation are particularly relevant when studying cardiomyogenesis, as abortive cell - cycle re - entry is quite prevalent in myocytes (most myocytes in the mouse heart are diploid and binucleated, while most myocytes in the human heart are polyploid and mononucleated). We and others have found that the majority of the measured myocyte cell - cycle activity in the normal or infarcted mouse heart can be attributed to polyploidization and binucleation, rather than true myocyte division . Cardiomyocyte cytokinesis is a brief (the m phase occupies 2% of the cell cycle) and rare event, and detection of the cleavage furrow between diving myocytes (a hallmark of cytokinesis) is complicated by the compact myocardial architecture as well as by division of adjacent non - myocyte cells (which actively cycle at substantially higher rates compared to myocytes); thus myocyte division is difficult to visualize convincingly and quantify accurately . A more viable strategy may be to quantify the magnitude of abortive cell - cycle re - entry and subtract it from the total measured dna synthesis . To that end, measurements of ploidy levels (by flow cytometry for dna content or by visualization of the number of sex chromosomes by fluorescence is situ hybridization) and number of nuclei (preferably by analysis of dissociated myocytes) should be performed in cardiomyocytes that have incorporated nucleoside analogues . Finally, while genetic fate mapping is the only reliable tool that can be used to trace the cellular origins of organ regeneration in vivo, its implementation in studies of postnatal cardiomyogenesis does not come without problems . While several groups have used the mhc - mercremer / zeg bitrasngenic mouse for inducible marking of pre - existing myocytes, multiple studies have reported activity of the -mhc promoter in non - myocyte cells that possess characteristics compatible with endogenous cardiac progenitors . In addition, development of new lineage - tracing models that could allow for forward fate mapping of cardiac progenitors (in order to prospectively investigate their contributions to the myocyte pool) is complicated by lack of specific cardiac stem cell markers and by potential re - expression of such markers in cardiomyocytes during stress - induced activation of a fetal - gene program (figure 3). There is now ample and compelling evidence that cardiomyogenesis does occur in the adult mammalian heart, albeit at an insufficient rate to restore cardiac function after substantial cell losses such the ones that occur after a myocardial infarction . Proliferation of pre - existing cardiomyocytes appears as the dominant mechanism of generation of novel cardiomyocytes, at least during normal ageing, although after myocardial injury, differentiation of progenitor cells may also contribute to this phenomenon . Cell therapies have already reached the stage of clinical trials; most of the cells currently under investigation (with the exception of embryonic stem cells and induced pluripotent stem cells) do not differentiate into functional cardiomyocytes and act through paracrine activation of endogenous reparative and regenerative pathways . Recently, insight has been provided to the mechanisms that control exit and re - entry of cardiomyocytes to the cardiac cycle, together with ways to manipulate the potential of cardiomyocytes for division and proliferation . It is reasonable to expect that therapeutic amplification of endogenous regenerative mechanisms will bolster cardiomyocyte repopulation of injured myocardium and will result in effective therapies for cardiovascular disease and heart failure, in the not so remote future.
Data were obtained from the finnish national prescription register and special reimbursement register, maintained by the social insurance institution (sii) of finland . The national prescription register contains records of all reimbursed drug purchases of all finnish residents living in noninstitutionalized settings . The special reimbursement register includes information on all individuals who are entitled to reimbursement of medication for certain chronic diseases, such as ad or diabetes . To be included in the special reimbursement register, the diagnosis must be based on explicit predefined criteria and written documentary evidence, including results of a diagnostic test, such as imaging or blood biochemistry, must be provided to the sii by a physician . Data from these registers have previously been applied in nationwide drug utilization studies (30). In finland (population, 5.3 million), all citizens are covered by a tax - supported public health system and have access to health services, regardless of age, ethnic background, or socioeconomic status, and individual - level data on purchases of reimbursed prescription medicines and hospital visits are collected and updated continuously on statutory registers (31). Thus, these data are available on all individuals, provided that they have a social security number (i.e., all citizens and noncitizens living in finland for at least 2 years but excluding persons who were living abroad for> 1 year at the time of the study). Each resident of finland is assigned a unique social security number, and this identification number was used to track information from registers . Changes in social security numbers in the 1970s mean that reliable automated linkage without individual checking and recoding of pins is possible from 1972 onwards, and thus we included data from 1972 onwards only . Data linkage was performed by sii, and all data were de - identified before submission to the research team . No ethics committee approval was required as de - identified data were used and participants were not contacted . All community - dwelling people with a verified ad diagnosis, residing in finland on 31 december 2005 (n = 28,093) were identified from the special reimbursement register, and a single age-, sex-, and region of residence matched control subject per ad case subject (n of matched case - control pairs = 28,093) was identified . Ad diagnosis was based on the national institute of neurological and communicative disorders and stroke and the alzheimer's disease and related disorders association (nincds - adrda) and the dsm - iv criteria for ad (32,33). In brief, the main diagnostic criterion is progressive memory loss, supported by abnormal magnetic resonance imaging or cerebrospinal fluid biomarker findings . Alternative explanations for memory impairment, such as severe depression, metabolic disturbances (including hyperglycemia per se), and other forms of dementia, such as vascular dementia, needed to be excluded . The finnish current care guidelines recommend that all people with ad are treated with memantine or acetylcholinesterase inhibitors unless there is a specific contraindication (including gastric ulcer / intestinal tract operation <6 months previously or severe asthma) (34). Patients with mild or moderate ad are entitled to reimbursed ad medication, but the reimbursement is not withdrawn if / when the disease progresses . Diabetes is diagnosed on the basis of fasting capillary blood glucose concentration (sii reimbursement criterion cutoff is 7.0 mmol / l) or 2-h glucose concentration if an oral glucose tolerance test has been performed (cutoff 11.1 mmol / l) (35). Individuals with type 1 diabetes have been entitled to reimbursed insulin since 1964, whereas the criteria for reimbursed type 2 diabetes medication have varied over time . Type 2 diabetes was first mentioned in 1981 criteria stating that medication for those with type 2 diabetes is reimbursed if they have not benefited from lifestyle modification lasting at least 3 months . In 1994, the criteria for type 2 diabetes was updated to recommend 6-month dietary intervention as a first - line therapy and requesting that the pharmacotherapy for type 2 diabetes be used for at least 6 months, including a report of outcomes, before applying for special reimbursement . People with gestational diabetes have not been entitled to reimbursement, unless the need for pharmacotherapy is prolonged . Thus, we applied a robust age - based classification so that people who were <40 years of age when they were diagnosed with diabetes were classified as having type 1 diabetes and those who were at least 40 years of age were classified as having type 2 diabetes . This cutoff has been suggested as a simple and relatively reliable method for differentiating people with type 1 and type 2 diabetes (36). People with diabetes diagnosed at <65 years of age were categorized as having diabetes in midlife, and those who were at least 65 years of age when diabetes was diagnosed were classified as having late - life diabetes . Statistical analyses were performed with stata 12.0 (stata corp lp, college station, tx). The difference in the mean age of ad diagnosis between those with and without diabetes was compared with the student t test, and differences in the duration of diabetes and age at diabetes diagnosis between case and control subjects were compared with the kruskal - wallis test . The association of diabetes with ad was assessed in a case - control study including all 28,093 matched pairs . Crude ors and pooled ors according to the history of cardiovascular disease groups (no / yes) were calculated . Information on cardiovascular conditions (hyper-/hypotension, ischemic heart disease, familial hypercholesterolemia, embolisms and thrombosis, myocardial infarctions, heart failure and cardiac arrests, atherosclerosis, and aneurysms) was obtained from the special reimbursement register and finnish national hospital discharge register (details available from a .- m.t . ). Data were obtained from the finnish national prescription register and special reimbursement register, maintained by the social insurance institution (sii) of finland . The national prescription register contains records of all reimbursed drug purchases of all finnish residents living in noninstitutionalized settings . The special reimbursement register includes information on all individuals who are entitled to reimbursement of medication for certain chronic diseases, such as ad or diabetes . To be included in the special reimbursement register, the diagnosis must be based on explicit predefined criteria and written documentary evidence, including results of a diagnostic test, such as imaging or blood biochemistry, must be provided to the sii by a physician . Data from these registers have previously been applied in nationwide drug utilization studies (30). In finland (population, 5.3 million), all citizens are covered by a tax - supported public health system and have access to health services, regardless of age, ethnic background, or socioeconomic status, and individual - level data on purchases of reimbursed prescription medicines and hospital visits are collected and updated continuously on statutory registers (31). Thus, these data are available on all individuals, provided that they have a social security number (i.e., all citizens and noncitizens living in finland for at least 2 years but excluding persons who were living abroad for> 1 year at the time of the study). Each resident of finland is assigned a unique social security number, and this identification number was used to track information from registers . Changes in social security numbers in the 1970s mean that reliable automated linkage without individual checking and recoding of pins is possible from 1972 onwards, and thus we included data from 1972 onwards only . Data linkage was performed by sii, and all data were de - identified before submission to the research team . No ethics committee approval was required as de - identified data were used and participants were not contacted . All community - dwelling people with a verified ad diagnosis, residing in finland on 31 december 2005 (n = 28,093) were identified from the special reimbursement register, and a single age-, sex-, and region of residence matched control subject per ad case subject (n of matched case - control pairs = 28,093) was identified . Ad diagnosis was based on the national institute of neurological and communicative disorders and stroke and the alzheimer's disease and related disorders association (nincds - adrda) and the dsm - iv criteria for ad (32,33). In brief, the main diagnostic criterion is progressive memory loss, supported by abnormal magnetic resonance imaging or cerebrospinal fluid biomarker findings . Alternative explanations for memory impairment, such as severe depression, metabolic disturbances (including hyperglycemia per se), and other forms of dementia, such as vascular dementia, needed to be excluded . The finnish current care guidelines recommend that all people with ad are treated with memantine or acetylcholinesterase inhibitors unless there is a specific contraindication (including gastric ulcer / intestinal tract operation <6 months previously or severe asthma) (34). Patients with mild or moderate ad are entitled to reimbursed ad medication, but the reimbursement is not withdrawn if / when the disease progresses . Diabetes is diagnosed on the basis of fasting capillary blood glucose concentration (sii reimbursement criterion cutoff is 7.0 mmol / l) or 2-h glucose concentration if an oral glucose tolerance test has been performed (cutoff 11.1 mmol / l) (35). Individuals with type 1 diabetes have been entitled to reimbursed insulin since 1964, whereas the criteria for reimbursed type 2 diabetes medication have varied over time . Type 2 diabetes was first mentioned in 1981 criteria stating that medication for those with type 2 diabetes is reimbursed if they have not benefited from lifestyle modification lasting at least 3 months . In 1994, the criteria for type 2 diabetes was updated to recommend 6-month dietary intervention as a first - line therapy and requesting that the pharmacotherapy for type 2 diabetes be used for at least 6 months, including a report of outcomes, before applying for special reimbursement . People with gestational diabetes have not been entitled to reimbursement, unless the need for pharmacotherapy is prolonged . Thus, we applied a robust age - based classification so that people who were <40 years of age when they were diagnosed with diabetes were classified as having type 1 diabetes and those who were at least 40 years of age were classified as having type 2 diabetes . This cutoff has been suggested as a simple and relatively reliable method for differentiating people with type 1 and type 2 diabetes (36). People with diabetes diagnosed at <65 years of age were categorized as having diabetes in midlife, and those who were at least 65 years of age when diabetes was diagnosed were classified as having late - life diabetes . Statistical analyses were performed with stata 12.0 (stata corp lp, college station, tx). The difference in the mean age of ad diagnosis between those with and without diabetes was compared with the student t test, and differences in the duration of diabetes and age at diabetes diagnosis between case and control subjects were compared with the kruskal - wallis test . The association of diabetes with ad was assessed in a case - control study including all 28,093 matched pairs . Crude ors and pooled ors according to the history of cardiovascular disease groups (no / yes) were calculated . Information on cardiovascular conditions (hyper-/hypotension, ischemic heart disease, familial hypercholesterolemia, embolisms and thrombosis, myocardial infarctions, heart failure and cardiac arrests, atherosclerosis, and aneurysms) was obtained from the special reimbursement register and finnish national hospital discharge register (details available from a .- m.t . ). The prevalence of diabetes with reimbursed medication in 2005 was 11.4% in the whole study population, 10.7% (n = 3,012) among control subjects (i.e., those without ad), and 12.0% (n = 3,372) among ad cases . A history of cardiovascular diseases was more common among those with diabetes than those who did not have diabetes (or 2.91 [95% ci 2.663.18], n = 5,159, 80.8%, and n = 27,941, 56.1%, respectively, including those with and without ad). People with ad were more likely to have a history of clinically verified and medically treated diabetes (either type 1 or type 2 diabetes) in the unadjusted analysis (or 1.14 [95% ci 1.081.20]), and the association was strengthened after adjusting for cardiovascular diseases (adjusted or 1.31 [1.221.41]). The association between diabetes and ad was similar in individuals with no history of cardiovascular diseases (n = 23,086, or 1.39 [1.231.57]) and those with cardiovascular diseases (n = 33,100, or 1.29 [1.211.37]). The associations were similar in both sexes (adjusted or 1.27 [1.171.39] and 1.40 [1.231.59] in women and men, respectively). Association between diabetes and incident ad in the whole study population, according to previous cardiovascular disease (cvd), sex, and onset age of diabetes . * adjusted for cardiovascular diseases . Both midlife and late - life diabetes were more common among those with ad (table 1 and fig . Midlife diabetes was more strongly associated with ad than diabetes diagnosed in late life (crude or 1.42 [95% ci 1.281.60] and 1.05 [1.001.12] for midlife and late - life diabetes, respectively). The associations were strengthened after adjusting for cardiovascular diseases (pooled or 1.60 [1.341.84] and 1.25 [1.161.36] for midlife and late life, respectively). The median age at diabetes diagnosis was 71.4 years (interquartile range 64.677.0 years), ranging from 15.4 to 98.9 years . Those with ad were younger when diabetes was diagnosed (table 1) and thus the duration of diabetes was longer in case subjects than control subjects (fig . Only 54 people were <40 years of age when they were diagnosed with diabetes, suggesting that the majority had type 2 diabetes . The exclusion of these 54 people who putatively had type 1 diabetes had no effect on the association (data not shown). Age at ad diagnosis between those with and without diabetes was similar (mean age 78.0 years, sd 0.1 for both groups). Individual dots represent observations outside the 95% cis . Altogether, 757 (22.4%) of those with ad and diabetes received the entitlement of reimbursed diabetes medication after ad diagnosis . The median time interval was 2.0 years (interquartile range 0.73.9 years), and 35.9% (n = 272) of ad cases with diabetes received the decision on reimbursed medication within 1 year of ad diagnosis . In this nationwide case - control study, people with clinically verified ad were more likely to have a history of clinically verified and medically treated diabetes than the general aged population . The association between diabetes and ad was similar in individuals with or without a history of cardiovascular disease, and adjustment for cardiovascular diseases strengthened the association . Our findings also showed that in finland, ad patients who receive a diagnosis of diabetes often do so within 12 years of ad diagnosis . This is likely due to the exclusion of alternative diagnoses, which is required before receiving reimbursed ad medication . Our findings and estimates are consistent with a previous meta - analysis on type 2 diabetes and ad (1). People with type 1 diabetes have also been suggested to have an increased risk of cognitive dysfunction (9). In our study, the mean age at diabetes diagnosis was 70 years, and only 52 of all 6,384 people with diabetes were <40 years of age when they were diagnosed, suggesting that the majority had type 2 diabetes . Considering the high average age (79.7 years), it is not surprising that only a small minority of the sample were <40 years of age when diagnosed with diabetes . Mortality among people with type 1 diabetes in finland was significantly higher in the 1970s (37), so these individuals were less likely to survive to an older age than they would be today . According to the hypothesis that midlife vascular risk may be more strongly associated with ad than late - life risk factors (20), we found a stronger association with midlife diabetes than late - life diabetes . This is in line with previous studies showing that long - term diabetes is more strongly associated with cognitive impairment and dementia (38) and that diabetes in midlife increases the risk of ad (29). Although this previous study found no association between late - life diabetes and ad (29), another recent study investigating the midlife and late - life vascular risk factors concluded that the association of diabetes was of similar magnitude in both age groups (39). The age - dependent effect may be due to smaller effects of the ad disease process on midlife factors than on factors assessed in late life . Midlife vascular risk factors may also be a more accurate reflection of the vascular load during adulthood (40). The estimates from our study (unadjusted 95% ci 1.081.20) are comparable, although lower than in the meta - analysis by profenno et al . (1) (95% ci 1.331.79), although our adjusted estimates (1.221.41) are consistent with the previous findings . This could be due to differences in the definition of diabetes . In half of the studies included in that meta - analysis, the diabetes diagnosis was based on self - report or use of diabetes medication (2123,25), whereas in our study, all diabetes diagnoses were performed in healthcare settings and based on the assessment of blood glucose concentrations, which is mandatory for reimbursed diabetes medication in finland . There were also differences in sample size: the conclusions of profenno et al . (1) were based on 21,560 individuals, including 1,306 ad case subjects, whereas our sample included 28,093 ad case subjects . However, our study is limited in the sense that individuals with type 2 diabetes are underrepresented, as approximately one - third of type 2 diabetes is treated by lifestyle modifications only (36). Our sample would cover all individuals with type 1 diabetes (who were able to survive to their 70s or 80s), as the insulin replacement therapy is necessary, and the majority of people with advanced type 2 diabetes or those who did not benefit from lifestyle modification . We were not able to adjust for lifestyle or socioeconomic confounders, such as obesity, smoking, or education as these data were not available from the registers we used . However, we attempted to capture some variation in these factors by adjusting for cardiovascular diseases . Since there was no data on glycosylated hemoglobin concentrations or glucose concentrations after the reimbursement was accepted by sii, we could not assess whether those with better control of blood glucose concentrations had a different risk of ad . Diabetes is commonly undiagnosed, especially among older individuals (41), so the misclassification of people with undetected diabetes or diabetes treated with lifestyle modifications as not having diabetes is likely . This has implications for the interpretation of the results: our findings are not as informative on the association of all stages of diabetes as they are on the association of clinically verified and medically treated diabetes . Due to the lack of a systematic cognitive assessment of each person included in this study, it is likely that people with cognitive impairment and ad or other dementias were included in the control group . Thus, our results are likely an underestimation of the true association between diabetes and ad, although they are consistent with previous studies that were able to adjust for confounders or systematically assess the blood glucose concentrations of participants (1). The strengths of the study are sample size, representativeness, length of follow - up, and verified diagnosis of ad . The study sample includes all community - dwelling individuals with ad residing in finland in 2005 . We included only noninstitutionalized people, but it is unlikely that the association between diabetes and ad would be different among institutionalized individuals . We had access to data collected over 30 years, whereas previous studies on type 2 diabetes (2126), apart from a few exceptions (2729), have included <10 years of follow - up . Since the information on diabetes medication, age at diabetes diagnosis, ad, and cardiovascular diseases was extracted from the registries, the results are not affected by recall bias . Although the register - based diagnoses of ad likely underestimate the true prevalence, these diagnoses are more reliable than ad diagnoses extracted from other sources of routine healthcare data, e.g., national hospital discharge register, as the diagnoses in the special reimbursement register are based on dsm - iv and nincds - adrda criteria whereas the accuracy of diagnoses from the national hospital discharge register may vary considerably, depending on the facility (e.g., specialized geriatrics unit vs. general healthcare visit). In conclusion, results from this unique nationwide case - control study show that individuals with ad are more likely to have a history of medically treated diabetes than the older population in general and that the association is independent of cardiovascular diseases.
The interventions for carotid artery stenosis, vein graft and acute myocardial infarction could embolize a large amount of plaque debris, especially unstable, ulcerative, and thrombus containing lesions (1). Distal protection devices such as filterwire ex have been widely used in carotid artery stenting to prevent distal embolization of plaque debris (2). The large amount of atherothrombotic debris entrapped in the filter could reduce or stop antegrade flow and may be shown as no reflow phenomenon in case using filter type distal protection device . We present a case of pseudo no - reflow phenomenon after postdilatation of the stent in severe carotid artery stenosis and successful recovery with aspiration thrombectomy using export aspiration catheter . A 70-yr - old man was diagnosed with asymptomatic carotid artery stenosis during preoperative risk assessments . He had been treated in our hospital for congestive heart failure and stable angina for 2 yr . Carotid angiogram showed no significant stenosis in the left carotid artery and a 90% stenosis in the right internal carotid artery (fig . Shuttle sheath (7f, cook medical, bloomington, in, u.s.a .) Was positioned to right common carotid artery via right femoral artery . To prevent distal embolization of plaque debris during angioplasty, filterwire ex (boston scientific, natick, ma, u.s.a .) Was positioned in the right cervical internal carotid artery distal to stenotic lesion . After predilation with 4.0 mm balloon, 8 mm self - expanding wall stent (boston scientific) was positioned across the lesion and was deployed in stenotic lesion . After postdilation of the stent with 6.0 mm balloon, carotid angiogram showed abrupt complete flow interruption (fig . We decided to perform aspiration thrombectomy using export aspiration catheter (medtronic ave, santa rosa, ca, u.s.a .) (fig . After several passes of export aspiration catheter into the basket (over the filterwire ex), antegrade flow was fully restored (fig . 3). After retrieval of filterwire ex, whitish debris was noted within the basket (fig . The patient complained of slight speech disturbance and this neurological abnormality was completely recovered within 24 hr after stenting . Obstructive carotid artery lesions are known to contain friable, ulcerated and thrombolic material that have the potential to embolize during intervention and may be responsible for the majority of the neurologic events during carotid artery stenting (1). A number of " distal protection " strategies, designed to capture embolic debris released during carotid intervention, have been evaluated for their efficacy in minimizing the risk of embolic neurologic events . The intravascular filter type distal protection device offers the advantage of a constant cerebral perfusion during carotid artery stenting and allows more time for careful and precise intervention (2). During carotid artery stenting using filter type distal protection device, microscopic particles larger than the size of the filter pores (80 to 130 m) could be captured . (3) reported that carotid artery stenting with filter type distal protection device experienced flow impairment due to filter obstruction in 7.9% of procedures, which was resolved in all cases after filter removal . In our case, we suspected this pseudo - no - reflow phenomenon was induced by obliteration of filter pore by massive atherosclerotic debris . We considered to remove filter by retrieval catheter, however, this process may cause entrapment of filter device to retrieval catheter and embolize massive amount of atherosclerotic debris . Therefore, we choose aspiration thrombectomy using export aspiration catheter . After aspiration thrombectomy, flow interruption in the right internal carotid artery was completely restored, therefore, we confirmed this phenomenon as pseudo - no - reflow phenomenon instead of true no - reflow phenomenon . Yadav (4) recommended practically in his review paper if there is no forward blood flow during carotid angioplasty with filter type distal protection device, this should be aspirated before the filter is collapsed . Our case is the first case report of pseudo - no - reflow phenomenon in carotid artery stenting using filter type distal protection device and successful recovery of this phenomenon by aspiration thrombectomy using export aspiration catheter . (5) recently reported that successful management of pseudo - no - reflow phenomenon by the export aspiration catheter in ostial saphenous vein graft intervention using filterwire ex protection . In conclusion, the large amount of atherothrombotic debris entrapped in the filter during carotid intervention could stop antegrade flow . This phenomenon is pseudo - no - reflow phenomenon instead of true no - reflow phenomenon.
Although cutaneous melanoma represents less than 5% of the skin cancer is responsible for 80% of cancer deaths with this localization . Many studies have also shown that superficial spreading melanomas are found in histological contiguity with a dysplastic nevi . Tumor infiltrating lymphocytes are playing an important role, being a strong maker for the immune response in malignant melanoma . The migration of the lymphocytes occurs via high endothelial vessels (hev), blood vessels that are generally found in the lymphoid structures . Recently, some studies reported the presence of hevs in solid tumors, including melanoma . In light plump appeareance, examination being surrounded by lymphocytes.this fact supports the hypothesis of thir implication in lymphocytic migration . Hev endothelial cells express high levels of 6-sulfo sialyl lewis x ligands recognizd by the specific antibody meca-79 . In this study we have evaluated the potential correlations between the histopathological features of three different skin lesions (dysplastic nevi, thin and thick cutaneous melanomas) and the detected number of hev blood vessels (assessed by the expression levels of the meca-79). We have included formalin - fixed and paraffin - embedded tissue samples from a retrospective cohort of patients with dysplastic nevus and primary melanoma collected from 2002 to 2011 (at the department of pathology of the hospital clinico universitario, valencia). The work was conducted in accordance with the declaration of helsinki principles and under the supervision of the hospital clinico universitario ethics committee . We have analyzed a total of 60 samples, 20 of dysplastic nevi and 40 samples of primary cutaneous melanoma (20 samples of thin melanoma<1 mm and 20 samples of thick melanoma>1 mm) during a 10 year period (2002 - 2011). The included clinico - pathological characteristics were: age, gender, anatomic sites, regression, breslow thickness, mitoses, clark level, the lymphocytic infiltration (table 1). Characteristics of the patients included in the study the immunohistochemical study (envision, ref . K5007, dako, denmark) was performed with hev - specific mouse monoclonal antibody meca-79 . Endogenous peroxidase activity was blocked by incubation in s2023 (dako) for 10 min . The slides were incubated for 30 min . With primary antibody meca-79 (final dilution 100 mg / ml, 30, at room temperature). Adjacent control sections were incubated with monoclonal anti - sialyl - i antibody at the same concentrations and using the same procedure . Evaluation of the immunohistochemistry was performed by two of the authors (cm and ga), having no knowledge of clinical or molecular data, using an olympus bx40 light microscope, and leica dmd108 digital microscope (leica microsystems, germany). The comparation between groups were analyzed by the two - tailed non - parametric mann - whitney u test and kruskal - wallis test . We have included formalin - fixed and paraffin - embedded tissue samples from a retrospective cohort of patients with dysplastic nevus and primary melanoma collected from 2002 to 2011 (at the department of pathology of the hospital clinico universitario, valencia). The work was conducted in accordance with the declaration of helsinki principles and under the supervision of the hospital clinico universitario ethics committee . We have analyzed a total of 60 samples, 20 of dysplastic nevi and 40 samples of primary cutaneous melanoma (20 samples of thin melanoma<1 mm and 20 samples of thick melanoma>1 mm) during a 10 year period (2002 - 2011). The included clinico - pathological characteristics were: age, gender, anatomic sites, regression, breslow thickness, mitoses, clark level, the lymphocytic infiltration (table 1). K5007, dako, denmark) was performed with hev - specific mouse monoclonal antibody meca-79 . Endogenous peroxidase activity was blocked by incubation in s2023 (dako) for 10 min . The slides were incubated for 30 min . With primary antibody meca-79 (final dilution 100 mg / ml, 30, at room temperature). Adjacent control sections were incubated with monoclonal anti - sialyl - i antibody at the same concentrations and using the same procedure . Evaluation of the immunohistochemistry was performed by two of the authors (cm and ga), having no knowledge of clinical or molecular data, using an olympus bx40 light microscope, and leica dmd108 digital microscope (leica microsystems, germany). The comparation between groups were analyzed by the two - tailed non - parametric mann - whitney u test and kruskal - wallis test . The most common localization of primary melanoma was trunk 57.5%, followed by extremities 35% and head 7.5% . Localization of skin pigmented lesions included in the study lymphocytic infiltration was present in 80% sample of dysplastic nevus and 75% of primary melanomas . The predominant clark index was iii for 15 samples, iv in 11 samples, ii in 7 samples, v in 4 cases and i in 3 cases (fig.2). Distribution of melanoma samples by clark index ulceration was present in 25% of melanoma samples . Positive meca-79 vessels were found at 67% of primary melanoma samples (fig . 3, 4) and 30% of dysplastic nevi (fig . 5). Dysplastic nevus, meca-79 positive vessels, x20 thin cutaneous melanoma(<1 mm), meca-79 positive vessels, x20 thick melanomas (> 1 mm), meca-79 positive vessels, x20 using kruskal wallis non - parametric test we found a positive association between high endothelial vessels and anatomic sites (p<0,01). We noticed using mann - whitney test a significant correlation between meca-79+vessels and the presence of regression in melanoma samples (p<0,05). Finally we found no significant association between the number of vessels and age, gender, anatomic sites, breslow thickness, ulceration, clark level . Patients with multiple dysplastic nevi have an increased risk for development of melanoma and to make the distinguish from dysplastic nevi, melanoma sometimes can be challenging . Regression is associated with dense lymphocytic infiltrates, the process starts with a dense lichenoid infiltrate of lymphocytes, and ends with fibrosis and/or melanosis within a thickened papillary dermis . [6, 7] high endothelial vessels are implicated in lymphocytic trafficking, recently some studies reported the presence of hevs in solid tumors, including melanoma fact that sustain the implication of this type of vessels in anti - tumor response . In this study we have evaluated the potential correlations between the histopathological features of three different skin lesions (dysplastic nevi, thin and thick cutaneous melanomas) and the detected number of hev blood vessels (assessed by the expression levels of the meca-79). We observed that the highest number vessels were found in thin melanoma samples (fig.6). Situation of meca-79 positive vessels in the pigmented lesions included in the study in a similar study, martinet et al. (8) detected a high number of hevs in dubreuilh melanoma followed by superficial spreading melanoma . No significant correlation was found between meca-79+vessels and sex, gender, ulceration, breslow thickness, clark level . Presence of high endothelial vessels can predict lymphocytes infiltration by governing lymphocyte recruitment and may represent a local vascular respons facilitating the migration of lymphocytes into tumor tissue . A better understanding of tumor microenvironment and mechanisms involved in anti - tumor response can play an important role in development of future melanoma therapeutic strategies.
Fracture of stems in primary cemented hip arthroplasty is a known complication and has been attributed to varus positioning, excessive weight of the patient, resorbtion of the femoral calcar and failure of the cement mantle . Attribute this to reduction in proximal support either in the form of bone loss or an extended trochanteric osteotomy [eto] against a distally well - fixed stem . Thigh pain, late osteolysis, aseptic loosening and lack of osseous integration are some other complications of uncemented femoral components . Reconstruction of the femoral offset during revision hip arthroplasty is important for maintaining the stability of the joint . This coupled with the absence of adequate proximal support in aseptic loosening or eto can lead to increase in implant stresses when the stem is well fixed distally . [5, 6] smaller stems in particular are at a greater risk of fracture as the bending moment of a homogenous cylinder is inversely proportional to product of the young s modulus of elasticity and its area moment of inertia . The visible clips were present from the primary surgery and were used to tag the abductor repair case 1: postoperative radiograph showing a cable plate applied to support a distal peri - prosthetic fracture case 2: radiograph showing fracture through an echelon stem just distal to the extended trochanteric osteotomy site case 2: post - operative follow - up radiograph we report 3 cases of uncemented revision stem fractures . We summarize the variables affecting our patients especially regarding poor proximal support and small size of stems . A 77-year - old gentleman had a right total hip arthroplasty done in 1998 and subsequently underwent a revision in 2004 of both the femoral and acetabular components for instability and failed prosthesis . An extended trochanteric osteotomy was used to extract the femoral stem which was replaced with a cementless bowed solution stem [depuy inc . 4 years later with he presented the emergency department with deteriorating groin pain in the absence of trauma . His radiograph [x - ray 1] showed an extensive proximal osteolysis and a transverse fracture at the junction of the proximal and middle third of the stem . His re - revision surgery consisted of a proximal femoral osteotomy to remove proximal end of the stem with care . The stem was replaced with a 16 mm reef prosthesis [depuy, warsaw, indian]. The reaming caused a vancouver c type periprosthetic fracture and was treated with a dall - miles cable plate . The eto was repaired using dall - miles cables [x - ray 2]. The post operative xray was taken at the patients last outpatient visit prior to discharge at a time period of 2 years post surgery . A 71-year - old lady had had a left total hip replacement, which had been revised in 2007 for aseptic loosening . Components used were a 12 mm echelon stem [smith and nephew, memphis, tennessee]. In 2008 she presented with repeated dislocation and underwent further revision with change of liner and exchange of head . In 2009 she presented for routine outpatient review for osteoarthritis of the left knee and incidentally complained of left hip and groin pain for the past month . Her radiograph [x - ray 3] showed a fracture of the echelon stem with an obvious non - union of the eto and severe osteolysis under the stem collar . At the time of surgery the trochanteric fragment simply lifted off the femur once the dall - miles clamp was removed . A dall - miles cable was inserted distal to the claw and a proximal osteotomy was performed to reveal the upper 4 cm of the stem . A size 12.5 mm curved osteotome was used carefully throughout the stem to free it up and then using vice - grips and a series of punches the stem was extracted . As the distal cement plug was still present from the primary surgery an intramedullary wire was then passed down through it and 8 mm to 8.5 mm reamers were used to remove it . A mooreland hook was then used to retrieve cement and the canal was further reamed to 14 mm . The stem was replaced with a restoration cone bowed stem [stryker, mahwah, new jersey]. This patient continues to do well on ongoing follow - up [x - ray 4]. Case 3: full - length radiograph showing fracture through distal third portion of stem case 3: magnified view of the same radiograph showing the fractured stem an 82 year old presented to the outpatients departs with worsening difficulty while walking, increasing stiffness and pain in his left hip for 1 month . He had trouble flexing the hip and was focally tender over the greater trochanter and immediately distal to it . He had had a loosening of a left total hip replacement in 2003 that required revision . He underwent revision of the acetabular component with bone grafting of acetabulum and proximal femur . In 2007 the femur was reamed to 13 mm and a restoration stem [stryker, mahwah, new jersey] was inserted . In 2012 his radiograph [x - ray 5 and 6] showed a fracture at the femoral stem immediately proximal to the femoral isthmus . During his surgery the distal stem was well fixed and there was a prolonged and difficult trephining over the stem . The stem was eventually removed requiring a vertical cortical breach from the long trephine in distal femur . A 22 mm distal and 23 mm x 75 mm proximal body reclaim modular stem [depuy inc . He has had an uneventful course of recovery and remains pain free to date with no complaints [x - ray 7 and 8]. A 77-year - old gentleman had a right total hip arthroplasty done in 1998 and subsequently underwent a revision in 2004 of both the femoral and acetabular components for instability and failed prosthesis . An extended trochanteric osteotomy was used to extract the femoral stem which was replaced with a cementless bowed solution stem [depuy inc . 4 years later with he presented the emergency department with deteriorating groin pain in the absence of trauma . His radiograph [x - ray 1] showed an extensive proximal osteolysis and a transverse fracture at the junction of the proximal and middle third of the stem . His re - revision surgery consisted of a proximal femoral osteotomy to remove proximal end of the stem with care . The stem was replaced with a 16 mm reef prosthesis [depuy, warsaw, indian]. The reaming caused a vancouver c type periprosthetic fracture and was treated with a dall - miles cable plate . The eto was repaired using dall - miles cables [x - ray 2]. The post operative xray was taken at the patients last outpatient visit prior to discharge at a time period of 2 years post surgery . A 71-year - old lady had had a left total hip replacement, which had been revised in 2007 for aseptic loosening . Components used were a 12 mm echelon stem [smith and nephew, memphis, tennessee]. In 2008 she presented with repeated dislocation and underwent further revision with change of liner and exchange of head . In 2009 she presented for routine outpatient review for osteoarthritis of the left knee and incidentally complained of left hip and groin pain for the past month . Her radiograph [x - ray 3] showed a fracture of the echelon stem with an obvious non - union of the eto and severe osteolysis under the stem collar . At the time of surgery the trochanteric fragment simply lifted off the femur once the dall - miles clamp was removed . A dall - miles cable was inserted distal to the claw and a proximal osteotomy was performed to reveal the upper 4 cm of the stem . A size 12.5 mm curved osteotome was used carefully throughout the stem to free it up and then using vice - grips and a series of punches the stem was extracted . As the distal cement plug was still present from the primary surgery an intramedullary wire was then passed down through it and 8 mm to 8.5 mm reamers were used to remove it . A mooreland hook was then used to retrieve cement and the canal was further reamed to 14 mm . The stem was replaced with a restoration cone bowed stem [stryker, mahwah, new jersey]. This patient continues to do well on ongoing follow - up [x - ray 4]. Case 3: full - length radiograph showing fracture through distal third portion of stem case 3: magnified view of the same radiograph showing the fractured stem an 82 year old presented to the outpatients departs with worsening difficulty while walking, increasing stiffness and pain in his left hip for 1 month . He had trouble flexing the hip and was focally tender over the greater trochanter and immediately distal to it . He had had a loosening of a left total hip replacement in 2003 that required revision . He underwent revision of the acetabular component with bone grafting of acetabulum and proximal femur . In 2007 the femur was reamed to 13 mm and a restoration stem [stryker, mahwah, new jersey] was inserted . In 2012 his radiograph [x - ray 5 and 6] showed a fracture at the femoral stem immediately proximal to the femoral isthmus . During his surgery the distal stem was well fixed and there was a prolonged and difficult trephining over the stem . The stem was eventually removed requiring a vertical cortical breach from the long trephine in distal femur . A 22 mm distal and 23 mm x 75 mm proximal body reclaim modular stem [depuy inc . He has had an uneventful course of recovery and remains pain free to date with no complaints [x - ray 7 and 8]. Femoral metaphyseal bone loss and multiple hip surgery can make revision arthroplasty with cement challenging . [8 - 9] distal diaphyseal fixation achieved in extensively porous coated stems used in uncemented revision, help bypass this problem . These implants give a tight diaphyseal fit and ensure good stability to reduce the likelihood of mechanical failure . However, in these distally well fixed revision stems, finite element analysis done by busch et al . Showed that a stress riser arose at the distal end of the eto and coincided with all 5 of their fractured uncemented porous coated stems . They also found that undersized stems, high bmi (> 30) poor proximal bone support, smaller diameter stems [<13.5 mm] and extended trochanteric osteotomy were more prone to fracture . As can be seen from table 1 . Majority of these variables pertaining to the cases above are similar . In case 1 with solution stem [depuy inc . Warsaw, indiana] the fracture was at the junction between proximal and middle thirds, as the patient had been symptomatic but ambulatory for 4 months prior to diagnosis we attribute its failure to cantilever forces occurring at the said junction . Patient weight (107 kg) may have also been a contributory factor . In case 2 with echelon stem [smith and nephew, memphis, tennessee] the stem fracture was at the distal end of the eto non union keeping with the authors impression that it would lead to the earlier fracturing of the stem relative to the other two cases . The mechanism of failure as in the previous case would be cantilever forces generated by a weak proximal support . In case 3 restoration stem [stryker, mahwah, new jersey] the stem fracture was distal in comparison to the previous two cases, we believe that the stress riser was due to the distal fixation rather than a weak proximal support . What is notable is that in all cases there was an absence of trauma and all patients presented with chronic complaints . Summary of variables affecting the cases stress risers in extensively porous coated stems are derived from un - united extended trochanteric osteotomy (eto), proximal bone loss and periprosthetic fractures . In the case of an un - united eto proximal bone deficiency can be supported by cancellous impaction allografting or a strut allograft on the tension side of the femur . Impaction allografting supplements the proximomedial bone stock (calcar) and may help decrease cantilever forces . Unfortunately this is not without complication as higher hoop stresses increase the risk of fracture . The authors did not attempt to augment the proximal bone stock by this method for the same reason . Augmenting the tension side of the femoral eto with a strut allograft and securing it with proximal and distal cables was an option, unfortunately this was neither available nor routine practice in our unit . The main principle of revision surgery is to achieve a stable fixation of the femoral component . The diaphyseal portion of the femur offers adequate bone stock and can be used for the same as a tight fit also offers good rotation stability . Adequate implants and tools must be available during revision [14, 15] as stem extraction can be lengthy and difficult as it was in case 3 . Lastly when revising with modular stems one must note that most stems fail at the junction of the stem taper . This is due to reducing cross sectional area of the stem taper, it coinciding with the eto and fretting corrosion that may affect the junction . When planning complex revision cases involving long uncemented stems, attention should be given to the above - mentioned variables . X - rays of patients, which have the above, mentioned risk factors should be closely scrutinized as early diagnosis of impending failure can make revision surgery less difficult.
These include open, laparoscopic, or endoscopic approaches . However, there are disadvantages and limitations with each of these techniques . The open method requires a large incision with its associated morbidity, and the laparoscopic techniques described so far are technically challenging in the pediatric population . The endoscopic approach has poor results as the cystenteric opening is small and tends to occlude leading to recurrence and infection . We describe our combined technique of laparoscopic and gastroscopic transgastric cystogastrostomy for pseudopancreatic cysts in children . She had high amylase and lipase levels and a computed tomographic (ct) scan showed necrotizing pancreatitis . Subsequently, an abdominal ct scan revealed a well - formed wall enhancing pseudopancreatic cyst (fig . Axial cut of computed tomographic scan demonstrating pseudocyst posterolateral to stomach . Under anesthesia a pediatric pentax gastroscope (pentax medical company, montvale, new jersey, united states) three more 5-mm step ports were placed under direct vision: 2 ports on either side of the umbilicus and 1 port just under the costal arch to retract the gall bladder . Using these ports, the stomach was insufflated with air from the gastroscope and two sutures of 30 vicryl were placed to pexy the stomach to the abdominal wall using a granee needle (r - med, oregon, ohio, united states) (fig . A 12-mm port was then directly introduced into the stomach under vision of the gastroscope as well as the laparoscope (fig . It is very important to have the visualization through the gastroscope while placing the initial transgastric port as the cyst protruding from the posterior gastric wall compromises the gastric lumen severely . If performed without the visualization of the gastroscope there is a risk injury to the posterior gastric wall during the transgastric port placement . One of the other ports used for gallbladder removal was then also introduced into the stomach under vision . The 5-mm 30-degree telescope was then introduced into the stomach and the stomach was continuously insufflated with low flow . A laparoscopic needle was introduced through the laparoscopy port into the cyst to confirm the position of the cyst (fig . A harmonic scalpel was then introduced into the stomach through the same port and an opening was made into the posterior wall of the stomach in to the cyst (fig . Once this was achieved a 30-mm endo gia (covidien, mansfield, massachusetts, united states) stapler was introduced through the 12-mm umbilical port and a stapled cystogastrostomy was achieved (fig . (a) laparoscopic needle inserted in the posterior gastric wall to confirm the presence of pseudocyst . (b) harmonic scalpel used to incise the posterior wall of stomach and the pseudocyst after needle aspiration of the pseudocyst . (c) endo gia stapler being applied to the posterior gastric wall and the pseudocyst . (d) endo gia stapler applied to the posterior gastric wall and the pseudocyst . Under anesthesia a pediatric pentax gastroscope (pentax medical company, montvale, new jersey, united states) was introduced into the stomach . Three more 5-mm step ports were placed under direct vision: 2 ports on either side of the umbilicus and 1 port just under the costal arch to retract the gall bladder . Using these ports, the stomach was insufflated with air from the gastroscope and two sutures of 30 vicryl were placed to pexy the stomach to the abdominal wall using a granee needle (r - med, oregon, ohio, united states) (fig . A 12-mm port was then directly introduced into the stomach under vision of the gastroscope as well as the laparoscope (fig . It is very important to have the visualization through the gastroscope while placing the initial transgastric port as the cyst protruding from the posterior gastric wall compromises the gastric lumen severely . If performed without the visualization of the gastroscope there is a risk injury to the posterior gastric wall during the transgastric port placement . One of the other ports used for gallbladder removal was then also introduced into the stomach under vision . The 5-mm 30-degree telescope was then introduced into the stomach and the stomach was continuously insufflated with low flow . A laparoscopic needle was introduced through the laparoscopy port into the cyst to confirm the position of the cyst (fig . A harmonic scalpel was then introduced into the stomach through the same port and an opening was made into the posterior wall of the stomach in to the cyst (fig . Once this was achieved a 30-mm endo gia (covidien, mansfield, massachusetts, united states) stapler was introduced through the 12-mm umbilical port and a stapled cystogastrostomy was achieved (fig . (a) laparoscopic needle inserted in the posterior gastric wall to confirm the presence of pseudocyst . (b) harmonic scalpel used to incise the posterior wall of stomach and the pseudocyst after needle aspiration of the pseudocyst . (c) endo gia stapler being applied to the posterior gastric wall and the pseudocyst . (d) endo gia stapler applied to the posterior gastric wall and the pseudocyst . The patient tolerated the procedure well with no intraoperative complications and was started on a regular diet on the fourth postoperative day . She had well - healed scars and was tolerating a regular diet with no other problems . Pancreatic pseudocysts, because of pancreatitis, trauma, or ductal obstruction, are uncommon in children.1 however, they may require treatment if symptomatic or persist after 4 to 6 weeks . Internal drainage of pancreatic pseudocysts has traditionally been accomplished by laparotomy, although laparoscopic and endoscopic modalities have recently been described . The open technique has been shown to have mortality rates of 1 to 6%, complication rates of 10 to 40%, and recurrence rates of 5 to 20%.2 the laparoscopic technique consists of either creation of an anterior gastrotomy to create a psuedocyst gastrostomy or identification of the cyst stomach interface through the lesser sac.3 both modalities have been shown to be safe and effective in the adult literature but both can be technically challenging and cumbersome in the smaller working space in children . Endoscopic therapy alone involves identifying the region of the cyst bulge with the endoscope, needle localization of the tract, and stent placement for internal drainage . However, the cystenteric opening is limited in size which can lead to occlusion, infection, or recurrence.4 5 beckingham et al performed endoscopic drainage in 34 adults with a success rate of 71% . The failures were found to be associated with pseudocysts complicated by acute necrotizing pancreatitis and cyst wall thickness greater than 1 cm.6 repeated procedures due to catheter - related complications requiring additional anesthetics are not ideal in the pediatric population . Melman et al compared the three techniques for drainage of pancreatic pseudoscyts in adults and found lower primary success rates for endoscopic drainage as compared with laparoscopic and open cystgastrostomies as well as the need for repeat procedures.5 the approach of combined laparoscopic and endoscopic / gastroscopic pseudocyst gastrostomy using intraperitoneal and as well as intragastric visualization has been described in the adult literature but has not been previously reported in children.4 7 the use of the laparoscopy during cystgastrostomy allows for pseudocyst debridement, fashioning a large communication between the cyst and stomach, as well as minimizes the risk of complications such as gastric perforation . In addition, laparoscopy adds the ability to add other procedures if needed such as cholecystectomy as was done in this case . Gastroscopy helps in visualization of the primary transgastric port placement preventing injury to the posterior gastric wall and gastric insufflation during the procedure . Finally, the decreased need for additional port sites leads to an improved cosmetic result which is of particular interest in the pediatric population . Laparoscopic gastroscopic transgastric cystogastrostomy is a safe technique for the treatment of pancreatic pseudocysts in children.
However, due to the high computational cost required for reconstruction, its real - time imaging applications remain challenging . Bolus - chasing computed tomography (ct) angiography is a primary example which demands real - time ct feedback . To address this problem, for example, xtrillion (by terarecon, inc .) Uses an application - specific pci card, while mercury computer systems relies on blade - based linux clusters . However, the specialized hardware is expensive and unsuitable for general purpose applications . Alternatively, efforts are made using graphic cards [2, 3], since the main operation for commercial ct reconstruction is backprojection, similar to texture mapping in computer graphics . Although graphics cards are highly optimized, they do not support floating - point calculations . That the latest graphics cards can implement virtual floating - point calculations [3, 5], they do not support full 32 bits floating calculations . Another bottle - neck is that the graphic cards require data exchange between cpu and gpu . In this paper, a multi - core pc - based acceleration scheme is proposed for filtered - backprojection-(fbp-) based image reconstruction . Third, the single - instruction multiple - data (simd) technique is employed for data - level parallel processing . Fourth, the multithreading programing is done to take advantage of multi - core processors, realizing the true parallel computation capability . Finally, an intel c++ complier is used to optimize the code for intel processors . The ct reconstruction algorithm is overviewed, and then each of our acceleration techniques is described . In section 3, numerical experiments on various datasets and different pcs are presented to evaluate the speedups with our scheme and the conventional implementation . In section 4, relevant issues and research directions are discussed . The most popular multislice ct reconstruction methods remain data rebinning - based fan - beam reconstruction filtered backprojection (fbp) algorithms . Therefore, our work is focused on the typical fan - beam fbp algorithm . Note that the application of our scheme is not limited to the fan - beam case, because it can also be applied to accelerate the latest approximate cone - beam algorithms [68], which can be treated as generalized fan - beam reconstruction algorithms . In a typical ct setting, the data acquisition system (an x - ray source and a detector assembly) is rotated rapidly in the gantry while the patient on a table is translated into the gantry opening . This process is illustrated in figure 1 . Because the multi - row detector arrays span a very small cone angle, acquired helical scan data are usually rebinned into a series of virtual circular scan data for reconstruction of a stack of images . Here we assume a method from, in which the virtual fan - beam projection data are calculated according to the following formula: (1)pc (,,z0)=ph(,,z())zbza + zb + ph(,+2,z(+2))zaza + zb, where = + k 2, k n, so that za z0 zb, pc denotes virtual circular scan data, ph denotes acquired helical projection, za and zb are the distances from projections a and b to the virtual circular plane, respectively, in figure 2, and are the projection angles shown in figure 3 . After transforming helical projection data ph to circular fan - beam projection data pc, the conventional fan - beam reconstruction algorithm can be used . As the rebinning cost is insignificant, our optimization targets the reconstruction process: (2a)f(x, y, z0)=021l2pc, f(0,,z0)d, (2b)pc, f(,,z0)=pc(,,z0)dcos 22sin2h(), (2c)l = d2+r22drcos(), (2d)0 = arcsinrsin() l, where f is an object function to be reconstructed, pc, f are the filtered projection data, d is the distance from the source to the center of rotation, and h() is the ramp filter . While the inner convolution is the filtration process, the outer integration is the most time - consuming backprojection process, as shown in figure 4(a). Since the backprojection is the bottleneck, let us analyze the backprojection process as shown in algorithm 1 . Clearly, a large part of the computational cost is due to the inner loop that calculates 0, 1/l, interpolation coefficients, and accumulates the incremental contributions to the final reconstruction . In the following, we show how the backprojection can be speeded up using various techniques . For our circular fan - beam reconstruction, two types of symmetries are available, which are referred to as the right - angle symmetry and complement symmetry . The right - angle symmetry, or 90-degree symmetry, is shown in figure 5 . That is, a new pair of source and pixel positions is obtained by applying a 90-degree rotation to a current pair of source and pixel positions . The resultant 4 pairs of source and pixel positions share the same 1/l and 0, which can be calculated from (3) and (4), respectively . As the interpolation coefficients required by the backprojection are determined by 0, they are the same as well . Therefore, for the four sets under consideration, the calculations of these parameters need to be done only once: (3)lset1 = d2+r22drcos ()=d2+(xp2+yp2)2drcos(tan1(xp, yp))=d2+(yp2+xp2)2drcos(+2tan1(yp,xp))= lset2 = d2+(xp2+yp2)2drcos(+tan1(xp,yp))= lset3=d2+(yp2+xp2)2drcos(+32tan1(yp, xp))= lset4, (4)0,set1=arcsinrsin(tan1(xp, yp))l = arcsinrsin(tan1(yp, xp)/2)l=0,set2=arcsinrsin(tan1(xp, yp))l=0,set3=arcsinrsin(tan1(yp, xp)3/2)l = 0set4, where (xp, yp) denotes the pixel in the first quadrant . The following two requirements, which are usually satisfied in practice, are necessary to use the right - angle symmetry . The first requirement is that the projection data must be available at the involved four angles . Namely, the number of projections in a full scan must be divisible by 4, which is reasonable for current medical ct scanners . For instance, a somatom system generates 1160 projections per turn, while a lightspeed scanner produces 984 projections per turn . The other requirement is that the reconstruction region must be symmetric about the x- and y - axes, such as a square or a circle in the clinical imaging situation . The second type of symmetry is the complement symmetry, as shown in figure 6 . Here, a pair of source and pixel positions complements the other pair of source and pixel positions if they are symmetric with respect to a diagonal line (e.g., y = x). For these 2 pairs of source and pixel positions, l s are the same, while 0 for one has the opposite sign of that for the other, as shown by (5) and (6), respectively, (5)lset1 = d2+r22drcos ()=d2+(xp2+yp2)2drcos(tan1(xp, yp))=d2+(yp2+xp2)2drcos(2tan1(yp, xp))= lset2c, (6)0,set1=arcsinrsin(tan1(xp, yp))l = arcsinrsin(tan1(yp, xp)(/2))l=0,set1c . Therefore, such a symmetry can also be used to reduce the computational cost . The requirements for use of the complement symmetry are the same as those for the right - angle symmetry . Using these two types of symmetries, the backprojection can be significantly speeded up, since only one set of parameters needs to be calculated for the eight sets . The implementation of the backprojection is accordingly modified, as shown in algorithm 2 . Note that after the calculation of 0 and l once for 8 pairs of source and detector positions, 8 filtered projection values are put to 8-pixel positions together in the inner - loop . To evaluate the computational complexity, the time for cpu to access data must be considered, especially for the ct reconstruction process because the backprojection requires frequent visits to a great amount of filtered projection and image data . The cpu data access mechanism with multi - level caches is illustrated in figure 7 . Specifically, a cache can be used to reduce the average time to access data in the main memory (ram). The cache is a smaller, faster memory chip which stores copies of data from the most frequently used main memory locations . As long as a majority of memory accesses are to the cached memory locations, the average latency of memory accesses will be reduced to the cache latency, instead of the main memory latency . The l2 cache is faster than ram and about 1 2 mb . The slowest ram is 1 4 gb . When the processor needs to read from or write to the main memory, it first checks if the data is in the cache . If it is in the cache, we say that a cache hit has occurred; otherwise a cache miss is counted . In the case of a cache hit, however, in the case of a cache miss, it takes much longer time to access the data . Due to the limited cache capacity, one way to execute the code efficiently is to increase the hit rate by optimizing the data structures . Usually, projection data are sequentially stored in the order of, while reconstructed images are stored rowwisely . Thus, for implementation of the right - angle and symmetry, the access to 8 pairs of projection and image data will very likely result in cache misses due to the address gaps, as shown in figure 8 . Such misses within the inner loop will cause a significant latency . To address this problem, in our optimized data structures all the data are arranged into blocks indexed to reflect symmetric relationships . Therefore, the cache miss rate can be greatly reduced in the inner loop . The simd technique enables the data - level parallelism like in a vector processor, as shown in figure 9 . With an simd processor, one instruction can process a block of data at a time instead of just one datum, which is much more efficient than the conventional single instruction single - data (sisd) technique . Small - scale (64 or 128 bits) simd operations are now popular supported by general pc cpus, such as those from intel and amd [12, 13]. We use the intel sse (streaming simd extensions) instruction set to implement the simd technique in our backprojection process . Within the inner loop, we backproject 8 projection data onto 8 pixels, according to the same instructions such as interpolation, weighting, and accumulation . Therefore, we have a perfect situation to employ the simd technique . As the sse only supports simultaneous processing of 4 floating data at a time (128-bits register), 8 data are processed in two groups . In recent years their efforts have now shifted from improving the clock speed to increasing the number of cores within a processor . However, a processor with more than one core cannot achieve a better performance unless parallel computation schemes are applied . Therefore, to take advantage of multi - core processors, multi - threaded programing must be done . From the flowchart of our algorithm, thus, the backprojection can be implemented in parallel by assigning different loop ranges to various cores of the processor . After all the threads are finished, the final result can be assembled from the results of each thread . In our implementation (figure 4(b) and algorithm 2), we divide the loop of y, instead of the loop of . Usually, the number of cores on a pc is 2, 4 or 8, it is not common for n/4 to be an integer, but it is always the case for ny to be 256, 512, or 1024 . Our parallel implementation on a multi - core pc is more efficient than that on a pc cluster in terms of time required for data exchange between threads . In our case, the data exchange is via on board ram bus, while the pc cluster's data exchange via local network is significantly slower . The intel c++ compiler creates applications that can run at the fastest speeds on the intel processors . It can take the full advantage of the intel processors when compiling codes and generating object files . This provides an integrated development environment . In our implementation, we use it to optimize the code for pentium d and xeon processors . To test the gain of our scheme, we ran our accelerated code on pentium d and xeon pcs ., different sizes of projection datasets and reconstructed images were tested to evaluate the efficiency under various conditions . Here to test effeteness of each technique, the reconstruction times and speedups are tested by applying them gradually . The reconstruction experiments are done based on our hp6200 workstation and reconstructing a 512 512 image from a projection dataset (1160 672). The reconstruction results are shown by applying techniques step by step (table 2). The overall speedup and individual speedups for each technique are also calculated to show the efficiency of them . The speedup results for different projection datasets and image matrix sizes are shown in tables 3, 4, and figure 10 . Significant speedups were achieved using our scheme . In the case of 1160 views and 512 512 image, the reconstruction time was decreased from 52 seconds to 1.35 seconds . For a one - core computer, the speedup was more than 20 times . For a two - core computer, the images reconstructed using our scheme and the conventional method are shown in figure 11 . All the images were reconstructed using 32-bit floating - point data and were displayed in the same window [0.97, 1.05]. The images reconstructed using our accelerated and conventional schemes are essentially the same . As the ct reconstruction algorithm is highly parallelizable, the speedup can be improved with more cores almost linearly . For example, with two quad - core processors, the speedup that could be achieved is more than 100 . As compared to other acceleration techniques, such as those based on specialized hardware and graphics cards, our general purpose pc - based scheme is much cheaper without compromising image quality . For example, a general purpose hp or dell workstation with a top - line two quad - core processor and 8 gb ram is less than $7000 . All calculations are based on 32-bit floating point data, providing sufficient accuracy for medical imaging applications . In terms of the absolute reconstruction time for a 512 512 image from 1160 projection views if the latest multi - core processor is used, the total time can be easily decreased by several folds . As the computers we have still use the previous generation processor, the potential improvement is at least 5 times if we are equipped with the latest quad - core processors, that is, the reconstruction time may be reduced to 0.3 second . Hence, it is quite promising for real - time ct applications, such as project on bolus - chasing ct angiography . In conclusion, our acceleration scheme has integrated several techniques including utilization of geometric symmetry, optimization of data structures, single - instruction multiple - data (simd) processing, multi - threaded computation, and an intel c++ complier . As a result, it has speeded up the reconstruction process by 40 times, as compared to the conventional implementation on a general purpose pc with 2 cores . Further work is in progress to improve our results using the latest pcs and extend our scheme for cone - beam reconstruction.
The amination of c h bonds provides a route to n - alkyl and n - aryl amine derivatives that avoids typical functional group interconversions and reactants containing a functional group already present at the position where a c n bond is desired . N bonds are particularly challenging to achieve, but such reactions could directly modify complex molecules, create chemical feedstocks, or create functionalized polymers . Methods for the oxidation of alkanes by the combination of peroxides and iron complexes have been developed, but intermolecular functionalization of purely unactivated c h bonds with reagents that form products containing common nitrogen - based functionality are rare . H bonds have been catalyzed by copper complexes and occur at benzylic or allylic positions . Reactions catalyzed by dirhodium complexes are the most developed for the synthesis of complex molecules . Although remarkable developments and applications have been reported for intramolecular reactions, intermolecular reactions are more limited . H bond of the substrate, such that the preferred sites of reactions are tertiary, benzylic, and secondary c h bonds . When a nitrene is the reactive intermediate, the nitrogen - based reagent is limited to those containing just one substituent . We sought an alternative route to the intermolecular functionalization of alkyl c h bonds that could form n - alkyl amides, carbamates, and imides, in addition to the formation of sulfonamides . Amides, carbamates, and imides are more common synthetic intermediates or final products than those generated by prior copper - catalyzed reactions with alkyl c h bonds . We also sought to conduct these transformations with readily accessible complexes of first - row metals . Although copper - catalyzed reactions at allylic and benzylic c h bonds with carboxylic acids and sulfonamides in the presence of peroxides is well - known (karasch - sosnovsky reaction), and the mechanism of these reactions has been studied, the amidation of c h bonds with such reagents has been limited to reactions at benzylic c h bonds . We report the reactions of common amides, carbamates, and imides with alkanes to form n - alkyl derivatives with simple copper catalysts and a peroxide (scheme 1). The amidation of alkanes under our catalytic conditions preferentially forms the products from amidation at secondary sites over tertiary sites and even leads to the functionalization of primary c mechanistic data from the stoichiometric reactions of isolated copper amidate or imidate complexes indicate that the transformation of alkanes to n - alkyl products likely occurs by the reactions of a alkyl radicals with copper(ii) amidate and imidate complexes . H bonds, we evaluated the reactivity of benzamide (0.5 mmol) and cyclohexane (10 equiv) with 2.55.0 mol% of various copper precatalysts and oxidants . Results for the copper - catalyzed amidation of cyclohexane with benzamide are presented in table 1 . The combination of copper and tbuootbu was crucial for catalysis; other peroxide - based oxidants and redox - active 3d transition metals did not yield the amidation product . Conditions: 0.5 mmol of benzamide, 5.0 mmol of cyclohexane, 0.0125 mmol of catalyst, 0.0125 mmol of ligand, 1.0 mmol of oxidant, 1 ml of phh at 100 c for 24 h. gc yield with n - dodecane as the internal standard . The reactions catalyzed by cu(i) and cu(ii) salts without ligand gave the n - cyclohexylbenzamide in low yields (entry 14, 1027%). However, the reactions catalyzed by cu(i) and bipyridine (bipy), gave n - cyclohexylbenzamide in a measurably higher 36% yield . Reactions catalyzed by the well - defined [(l1)cucl] precatalyst (entry 8) (l1 = (((2-(dimethylamino)ethyl)imino) methyl)phenoxide) provided 83% of n - cyclohexylbenzamide . Finally, we found that the reaction of benzamide with cyclohexane catalyzed by the simple combination of phenanthroline (phen) (entry 6) or 4,7-dimethoxy - phenantronline ((meo)2phen) (entry 7) and cui formed n - cyclohexylbenzamide in nearly quantitative yield . The scope of benzamides that undergo this c h bond amination reaction is summarized in table 2 . Benzamides containing electron - withdrawing groups, such as cl, br, f, and cf3 (a d), underwent the reaction to give good yields of the corresponding amidation product (7382%). Benzamides containing electron - donating groups, such as me, bu, and ome (e k), also underwent the amidation process, but the isolated yields of the amidation products were slightly lower (5578%) than those of the benzamides containing electron - withdrawing groups . Heteroaromatic amides, such as 2-thienylamide (m) and 2-pyridylamide (l), also underwent the oxidative coupling with cyclohexane to give the corresponding n - alkyl products . The reaction of the 2-pyridylamide is noteworthy because the 2-pyridylamide product could form a strong chelating ligand that would prevent catalysis . The position of the substituent on the benzamide (ortho, meta, or para) did not have a pronounced effect on the reaction yields . Conditions: 0.5 mmol of amide, 5.0 mmol of cyclohexane, 0.0125 mmol of cui, 0.0125 mmol of (meo)2phen, 1.0 mmol of tbuootbu, 1 ml of phh at 100 c for 24 h. four equivalents of oxidant . The reactions of cyclohexane with primary and secondary alkyl amides, carbamates and imides also occurred (table 2). The yields of the reactions of cyclohexane with acetamide (n), tert - butylcarbamate (o), and toluenesulfonamide (p) to form n - cyclohexylacetamide, tert - butyl - n - cyclohexylcarbamate, and n - cyclohexyltoluenesulfonamide (38%, 42%, and 55%, respectively) were lower than those that formed n - alkyl benzamides . However, the reaction of tert - butylcarbamate, with excess tbuootbu (4 equiv) gave tert - butyl - n - cyclohexylcarbamate in 75% yield . The reactions of cyclohexane with secondary nitrogen sources (n - methylbenzamide, phthalimide, pyrrolidinone, and n - me - p - toluenesulfonamide) also occurred to form the corresponding n - alkyl products . The yields of these reactions were variable (1075%) (q t), but they do demonstrate that the mechanism cannot involve a nitrene intermediate . The reaction of phthalimide was improved from 20% to 75% by changing the solvent from benzene to 1,2-dichlorobenzene to increase the solubility of the reagent . The selectivities for amidation of various alkanes with benzamide are presented in table 3 . H bonds formed products from functionalization at the secondary c h bonds (entry 15). For example, the major products of the reactions of benzamide with trans- and cis-1,4-dimethylcyclohexane (entry 1,2) resulted from amidation of secondary c h bonds, while the minor products resulted from the amidation of primary c no product was formed from amidation of the tertiary c h bond . Likewise, the reaction of 3-ethylpentane (entry 5) occurred preferentially at secondary and primary c the reaction of 2,4-dimethylpentane (entry 7), in which the secondary c h bond is hindered, occurred exclusively at the primary c h bond . This product distribution contrasts that of most c h oxidations by a radical mechanism . For reactions of cycloalkanes ranging from cyclopentane to cyclododecane, the ring size did not affect the yield of the corresponding n - alkyl products (6980%) (entry 8). Conditions: 0.5 mmol of benzamide, 1 ml of alkane (1017 equiv), 0.0125 mmol cui, 0.0125 mmol of (meo)2phen, 2.0 mmol of tbuootbu, 1 ml of o - c6h4cl2 at 100 c for 36 h. regioselectivity determined by crude h nmr . Yield for the reaction with t - butylcarbamate . To assess whether copper - amidate and copper - imidate complexes with cu in the oxidation state of + 1 and + 2 are intermediates in the catalytic amidation reactions, we synthesized and characterized a variety of these amidate and imidate complexes supported by phen and 2-(dimethylamino)ethyl)imino)methyl) phenoxide (l1) (scheme 2). Salt - metathesis reactions of [(phen)cucl]2(-cl)2 with potassium phthalimide (kphth) or a combination of naotbu and h2nso2ph or h2ncoph in thf at room temperature yielded air- and moisture - stable [(phen)cu(phth)2] (1-phth2), [(phen)cu(nhso2ph)2] (2), and [(phen)cu(nhcoph)2] (3), respectively . Phen - ligated cu(i) complexes containing benzamidate and benzenesulfonamidate ligands were isolated from the reaction of [cu(mes)]n with phen, followed by the addition of benzenesulfonamide and benzamide to produce the corresponding products [(phen)2cu][cu(nhso2ph)2] (4) and [(phen)2cu][cu(nhcoph)2] (5). The complex [(phen)cu(phth)] (1-phth) salt - metathesis reactions of [(l1)cucl] with phthalimide (hphth), benzenesulfonamide, and benzamide produced the corresponding cu(ii) complexes of [(l1)cu(phth)] (6), [(l1)cu(nhso2ph)] (7), and [(l1)cunhcoph] (8) (scheme 2). Previous structural characterizations of phen - ligated copper(i) amidate and imidate complexes revealed that these complexes can exist as mononuclear or ion - pair species . Therefore, we assessed the atomic connectivity of 1-phth2 and 4 by single crystal x - ray diffraction (xrd) analysis . All pertinent bond distances and angles for these complexes are listed in the caption of figure 1 . Phen - ligated cu(ii) phthalimidate 1-phth2 is mononuclear in the solid state with a square planar geometry around the cu(ii) ion (figure 1). Molecular structures of [(phen)cu(phth)2] (1-phth2), [(phen)2cu] [cu(nhso2ph)2] (4), [(l1)cu(phth)] (6), and [(l1)cu(nhso2ph)] (7) shown with 50% thermal ellipsoid . Selected bond lengths () and angles () of 1-phth2: cu1n1 = 2.0480(14); cu1n2 = 2.0363(14); cu1n3 = 1.9667(14); n1cu1n3 = 170.29(5); n1cu1n2 = 93.45(5); n1cu1o1 = 92.5(3). Selected bond lengths () and angles () of 4: cu1n1 = 1.9920(15); cu1n2 = 2.1079(16); cu1n3 = 1.8553(17); n1cu1n2 = 81.75(6); n3cu1n3 = 178.92(10). Selected bond lengths () and angles () of 6: cu1n1 = 1.938(7); cu1n2 = 2.045(7); cu1n3 = 1.958(7); cu1o1 = 1.919(6); n1cu1n3 = 175.2(3); n1cu1n2 = 83.4(3); n1cu1o1 = 92.5(3). Selected bond lengths () and angles () of 7: cu1n1 = 1.956(6); cu1n2 = 2.104(6); cu1n3 = 1.972(6); cu1o1 = 1.993(5); n1cu1n3 = 170.0(2); n1cu1n2 = 83.7(2); n1cu1o1 = 91.2(2). In contrast, the copper(i) compounds were ion pairs in the solid state . The structure of phen - ligated benzenesulfonamidate 4 is an ion pair consisting of the cationic [(phen)2cu], in which cu(i) is ligated by two phen ligands in a distorted tetrahedral environment, and the linear anion [cu(nhso2ph)2] (figure 1). In contrast to the diverse molecular structures of phen - ligated copper species, complexes 6 and 7 containing the tridentate amino imine phenoxide ligands are mononuclear cu(ii) species with square - planar geometries in the solid state (figure 1). These structures are also mononuclear in solution, as evidenced by x - band epr spectroscopy recorded at 20 k in ch2cl2 indicating an axial environment . To determine whether the structures of 1-phth2 and 4 in solution differ from those in the solid state we measured the conductivities of 1-phth2, and 4 in dmso . The conductivities of 1-phth2, and 4 (1.0 mm in dmso, 25 c) were compared to those of a 1.0 mm (dmso) solution of ferrocene (0.2 cm mol) and n(bu)4cl (11.1 cm mol). The conductivity of the solutions of cu(i) complexes 4 and 5 in dmso (1.0 mm) were 33.0 and 23.1 cm mol, respectively . These values are similar to the reported values for related (phen)cu(i) amidate and imidate complexes . In contrast, the conductivity of the solution of 1-phth2 was 0.0 cm mol, showing that 1-phth2 retains its neutral, mononuclear structure in dmso . Moreover, the results for conductivity of 6 (0.0 cm mol) and 7 (0.1 cm mol) also revealed that these complexes are neutral molecules in solution . Unfortunately, the insolubility of 1-phth2 and 4 in benzene prevented the measurement of their conductivities in a less polar solvent . To gain information on the mechanism of the catalytic amidation of alkanes, we conducted catalytic and stoichiometric reactions with isolated [(phen)cu(phth)n] (n = 1, 2) complexes . These well - defined complexes contain a reactive phthalimidate group bound to copper in the oxidation states of + 1 and + 2 . First, we investigated the effect of the oxidation state of the metal in the copper complexes lying on the catalytic reaction . The reactions of cyclohexane with hphth catalyzed by 2.5 mol% of 1-phth2 and 2.5 mol% of 1-phth produced n - cyclohexylphthalimide (cy - phth) in 54% and 80% yield, respectively (scheme 3). N - methylphthalimide (me - phth) was observed in 13% and 20% yields in the reactions catalyzed by 1-phth2 and 1-phth, respectively . The observation of this side - product implies the intermediacy of a tert - butoxy radical because this radical is known to undergo -me scission to generate a methyl radical . This methyl radical can then combine with 1-phth2 to form me - phth (scheme 3). The observation of this side product suggests that the n - cyclohexylphthalimide forms from a reaction between 1-phth2 and a cyclohexyl radical generated from hydrogen atom abstraction of cyclohexane by a tert - butoxy radical . In the reaction catalyzed by 1-phth, the orange solution of 1-phth rapidly transformed to a light - blue suspension . A similar light - blue suspension was also observed in the reaction catalyzed by 1-phth2 . Moreover, 1-phth2 was isolated from a reaction of 1-phth, tbuootbu, and hphth in benzene at 100 c for 0.5 h (scheme 4). The identity of 1-phth2 was confirmed by comparison of its ir spectrum to that of the authentic sample of 1-phth2, prepared by the method in scheme 2, and by elemental analysis . The isolation of 1-phth2 from the reaction catalyzed by 1-phth clearly demonstrates that a cu(i)-imidate or amidate is a short - lived species in the presence of excess oxidant and imide or amide under catalytic conditions . Therefore, under the catalytic condition, the predominant species in the system is a cu(ii)-amidate or imidate complex . Second, we investigated the role of oxidant in the catalytic reaction by conducting a series of stoichiometric reactions with 1-phth and 1-phth2 in the presence and absence of tbuootbu . C h bond amidations of cyclohexane by copper complexes have been proposed to occur by insertion of a copper - nitrene intermediate into a c h bond or by hydrogen atom abstraction . In one study, a copper - nitrene species stabilized by sc and an isolated bridging copper - nitrene complex were shown to undergo stoichiometric reactions with cyclohexane to form n - cyclohexyl-4-methylbenzenesulfonamide and n - cyclohexyladamantane, respectively . In another study, an isolated, three - coordinate cu(ii)-nhad (ad = adamantane) complex was shown to react with cyclohexane to form n - cyclohexyladamantane; this reaction was proposed to occur by abstraction of a hydrogen atom from cyclohexane and capture of the cyclohexyl radical by cu(ii). A mechanism involving a nitrene intermediate in our system is ruled out by the reaction of secondary nitrogen reagents (i.e., phthalimide) with cyclohexane to form the corresponding n - alkyl product, but reaction of the amidate and imidate complexes with the alkane could occur . Thus, we tested the potential reactions of the copper amidate and imidate complexes with cyclohexane . To do so, we performed stoichiometric reactions of 1-phth and 1-phth2 with cyclohexane . These reactions would assess whether these complexes are capable of abstracting a hydrogen atom from cyclohexane . The reaction of 1-phth or 1-phth2 with cyclohexane (80 equiv) in mecn or benzene without tbuootbu at 100 c for 2472 h produced no cy - phth detectable by gc (scheme 5, a). The absence of any cy - phth product from these reactions rules out a mechanism involving hydrogen atom abstraction by the cu(i) or cu(ii) phthalimidates and combination of the resulting alkyl radical with the copper complexes . However, the stoichiometric reaction of 1-phth2 with cyclohexane and tbuootbu (16 equiv) for 24 h produced cy - phth (70% yield based on copper), me - phth, and cy - otbu in a 70:25:35 ratio (scheme 5, b). The analogous reaction of 1-phth with cyclohexane and tbuootbu (16 equiv) also produced cy - phth (73% yield based on copper), me - phth, and cy - otbu in a 73:21:32 ratio (scheme 5, c). Formation of the ether product has been observed from cu(i)-catalyzed decomposition of tbuootbu and recombination of a cyclohexyl radical with a cu otbu functionality . Moreover, the observation of cy - otbu suggests that [(phen)cu(phth)(otbu)] is a likely intermediate in these reactions lacking free phthalimide; reaction of the cyclohexyl radical with this complex would form cy - phth and cy - otbu . The formation of n - alkyl amides in the presence of tbuootbu, but not in the absence of tbuootbu, was observed for copper complexes 1-phth2 or 1-phth . Complexes 26 also reacted with cyclohexane to produce their corresponding n - alkyl products in the presence of tbuootbu, but not in the absence of tbuootbu . These studies provide further evidence that tbuootbu leads to formation of tert - butoxy radical, which cleaves the alkane c h bond . To investigate if the cu(ii) complex 1-phth2 and the cu(i) complex 1-phth react by a common pathway, we measured the kinetic isotope effect of the amination reactions catalyzed by these two complexes . Reactions of the combination of cyclohexane and cyclohexane - d12 in a single vessel containing phth, tbuootbu, and 2.5 mol% 1-phth2 occurred with a primary kie of 2.7 0.1 . The reaction of 1-phth under the same experimental conditions occurred with a primary kie of 3.0 0.3 . The similarity of these values is consistent with reaction of cu(i) and cu(ii) complexes through the same c h bond cleavage step . Furthermore, the catalytic reaction of cyclohexane and cyclohexane - d12 in the same vessel with benzamide and 2.5 mol% of the phen - ligated cu(ii) benzamidate complex 5 occurred with a primary kie value of 2.8 0.4 . These results imply that the same c h bond cleavage step occurs for reactions of the different copper - amidate complexes . Results from the stoichiometric and catalytic reactions of 1-phth2 and 1-phth strongly suggest that a tert - butoxy radical is responsible for the c h abstraction of cyclohexane . To assess this hypothesis further, we performed experiments that would trap the tert - butoxy and alkyl radicals . First, we conducted the catalytic reaction in the presence of diphenylmethanol (2.5 equiv) (scheme 6, a), a common probe for tert - butoxyl radical . This alcohol can react with an alkoxy radical by abstraction of the c h hydrogen atom from cu(ii)-diphenylmethoxide to form a cu(ii)-ketyl radical that is then oxidized to form benzophenone to regenerate cu(i). Alternatively, an alkoxy radical abstracts the c h bond of diphenylmethanol to form a ketyl radical . This ketyl radical undergoes another hydrogen atom abstraction at the oh group by another alkoxy radical to form benzophenone . Consistent with the generation of an alkoxy radical, the catalytic reaction conducted in the presence of diphenylmethanol formed the n - cyclohexyl benzamide product in only 47% yield, based on benzamide . Instead of the n - cyclohexyl amide, a large amount of benzophenone (2.4:1.0 ratio of benzophenone to n - cyclohexyl benzamide) formed . This reaction to form benzophenone decreases the amount of available tert - butoxy radical for hydrogen atom abstraction of cyclohexane and thus decreased the yield of the n - cyclohexyl benzamide product . Second, we probed for the formation of tert - butoxy radical by conducting the reaction in the presence of the hydrogen atom donor 9,10-dihydroanthracene . The tert - butoxy radical should abstract the weak c h bond of 9,10-dihydroanthracene over the stronger c h bonds in cyclohexane . Indeed, the catalytic reaction of benzamide with cyclohexane conducted under the standard conditions, except for the addition of 3 equiv of 9,10-dihydroanthracene, yielded anthracene as the only organic product besides tert - butanol (scheme 6, b). Finally, to probe for a transient cyclohexyl radical in the reaction, we performed the catalytic reaction in the presence of cbr4 (scheme 7, a), which would trap a cyclohexyl radical to form bromocyclohexane . The reaction of benzamide with cyclohexane and tbuootbu at 100 c for 24 h did not form any product from the amidation of cyclohexane . Instead, bromocyclohexane formed in 90% yield, based on benzamide . This result is consistent with the intermediacy of a cyclohexyl radical in the catalytic reaction . The reaction of this alkane in the presence of cbr4 and 2.5 mol% cui/(meo)2phen in benzene at 100 c for 24 h (scheme 7, b) formed the products from bromination at the tertiary and the secondary sites: cis- and trans-1-bromo-1,4-dimethylcyclohexane and cis- and trans-2-bromo-1,4-dimethylcyclohexane . The two sets of constitutional isomers formed in a ratio of 1.7:1 and a combined 86% yield based on cbr4 . The 1-bromo-1,4-dimethylcyclohexane diastereomers were obtained as a 1.2:1 mixture, indicating that the transient tertiary radical formed under this condition undergoes facile racemization . To investigate whether an alkyl radical would react with the copper imidates to form an n - alkyl product, we conducted reactions of the phthalimidate complex 1-phth2 with precursors to alkyl radicals . We chose to use peroxides as the precursors to alkyl radicals, and we performed these reactions with 1-phth2 instead of 1-phth because our data indicate that 1-phth2 is the predominant complex under catalytic conditions . The reaction of 1-phth2 with tbuootbu and (ph(me)2co)2 at 100 c for 18 h generated me - phth in 64% and 81% yield based on copper, respectively (scheme 8). The rate of -me scission of the cumyloxide radical is faster than that of the tert - butoxy radical . Thus, the higher yield of n - alkyl product from the reaction of dicumyl peroxide than from the reaction of tbuootbu is consistent with the rate of generation of the methyl radical . These results with radical probes and alkyl radicals provide strong evidence that an alkoxy radical generates an alkyl radical by hydrogen atom abstraction and that the alkyl radical combines with a copper(ii)-amidate and -imidate species to produce the amidation and imidation products . The formation of products from halogenation at the tertiary c h bond of the dimethylcyclohexane indicates that the absence of the products from amination at the tertiary c n bond (vide infra). Reactions in acetonitrile provide evidence against a carbocationic intermediate that could form by oxidation of the radical and combination of the cation with the copper amide or imidates . The amidation of cyclohexane with hphth in wet acetonitrile (scheme 3) produced me - phth (80%), and this result argues against a transient carbocation in our system . Additional measurements of kie values were conducted to determine the turnover - limiting step (tls) of the catalytic reaction . The kie determined from independent measurements of the rates of amidation of cyclohexane and cyclohexane - d12 catalyzed by 10 mol% of 3 was 2.9 0.1 . This primary kie indicates that hydrogen atom abstraction of cyclohexane by a tert - butoxy radical is the turnover - limiting step in the catalytic process . To identify the tls and to explain the observed primary kie we obtained the kinetic data by measuring the concentration of cyclohexylbenzamide and n - methylbenzamide versus time by the method of initial rates with varied concentrations of oxidant, cyclohexane, and benzamide . At copper concentrations of 23 mm, the reaction was found to be first - order in oxidant, first - order in cyclohexane, and zero - order in benzamide . The reaction order of oxidant and cyclohexane is consistent with turnover - limiting c the dependence of the reaction rate on the concentration of oxidant and cyclohexane was lower for reactions conducted with higher concentrations of these two reagents . When the concentration of oxidant and cyclohexane exceeded 1.0 m, there was little dependence of the rate of cyclohexane amidation on the concentration of these two species . The order of cu is complex; our data indicates that the reaction rate is positively dependent on the concentration of cu . However, the order of the reaction in the concentration of copper varied between first - order and essentially zeroth - order . A similar dependence of reaction rate on the concentration of copper was reported for copper - catalyzed allylic oxidation of cyclohexene by tert - butyl perbenzoate in benzene . At low concentration of copper, the rate of allylic oxidation increased with increasing concentration of copper; however, the rate of this reaction was less dependent on the concentration at higher concentrations of copper . In addition to the difference in dependence of the rate on the concentration of copper, we observed a difference in yield of the amination products as a function of the concentration of copper . Reactions conducted with a higher mol% of the cu catalyst formed the n - alkyl amide product in lower yields than the reactions conducted with a lower loading of the cu catalyst . Specifically, reactions of cyclohexane conducted with 2.8417.0 mm 5 yielded 9499% of the n - cyclohexy benzamide product, while those conducted with 34.045.5 mm 5 gave the n - cyclohexyl benzamide product in 76% yield, along with menhcoph (10%) and unreacted benzamide . Perhaps, at higher loading of cu(i), faster decomposition of peroxide leads to a higher concentration of tert - butoxy radical, relative to the concentration of copper complex, and the tert - butoxy radical undergoes processes that do not lead to the n - alkyl amide product . The tert - butoxy radical is known to undergo multiple nonproductive pathways: (1) -me scission for the methylation of the bound cu(ii)-amidate; (2) coupling of methyl radicals; and (3) reaction of tert - butoxy radical with cu(i) to form cu(ii)-otbu . The quenching of the tert - butoxy radical at high concentration of copper offers one possible explanation for the lower yield of product at high loading of cu(i) compared to low loading of cu(i) and the lower order in copper . Regardless of the origin of the effect of the concentration of copper on yield, a copper complex does not directly participate in the c h bond cleavage of cyclohexane . Several pieces of data provide evidence that copper is not required for c h cleavage of cyclohexane . For example, in the absence of copper, the reaction of adamantane with tbuootbu and cbr4 at 100 c for 24 h produced a mixture of 1-bromoadamantane and 2-bromoadamantane in a ratio of 2.6:1, respectively . The same reaction conducted in the presence of copper, formed a mixture of products containing 1-bromoadamantane and 2-bromoadamantane in a 2:1 ratio . The similarity of the ratio of products in the presence and absence of copper suggest that copper is not directly involved in the c h cleavage step . First, copper catalyzes the decomposition of tbuootbu to generate tert - butoxy radical, which is the species that cleaves the c h bond of the alkanes . Specifically, reaction of 1-phth with tbuootbu and hphth in the absence of a hydrogen atom donor (i.e., cyclohexane) leads to rapid oxidation of 1-phth to 1-phth2 and exclusive formation of me - phth, in which the methyl radical is derived from tert - butoxy radical by -me scission . Additional evidence for copper - catalyzed formation of tert - butoxy radical is the observation of benzophenone from diphenylmethanol under catalytic conditions . Second, copper participates in the events after the turnover - limiting step of c h activation by tert - butoxy radical to form the n - alkyl product . This proposal is corroborated by the reaction of methyl radicals, derived from the tertiary alkoxy radical precursors ro - or (r = tbu, ph(me)2c), with 1-phth2 to generate the me - phth product . Our proposed mechanism for c h amidation of cyclohexane by 1-phth is summarized in scheme 9 . Our proposed mechanism begins with the decomposition of tbuootbu initiated by 1-phth to produce a tert - butoxy radical and a potential intermediate containing an alkoxide and a phthalimidate ligand [(phen)cu(phth)(otbu)]. The tert - butoxy radical can regenerate tbuootbu by secondary geminate recombination or can abstract a hydrogen atom from an alkane to form an alkyl radical . In this case, the turnover - limiting step is abstraction of a hydrogen atom from cyclohexane by a tert - butoxy radical to produce a cyclohexyl radical, which recombines with 1-phth2 to expel cy - phth and regenerate 1-phth to close the cycle . This species could be a transient cu(iii) intermediate ligated by a cyclohexyl and amidate ligand . Such a species could undergo rapid reductive elimination to release the n - alkyl product and to regenerate cu(i). Prior mechanistic and dft investigations of the kharasch - sosnovsky reaction have led to the conclusion that these oxidative reactions occur by formation of a cu(iii) species, which forms the c o bond by reductive elimination . Conversely, dft calculations on the combination of a cyclohexyl radical with the three - coordinate [(nacnac)cu(ii)-otbu] (nacnac = [arnc(me)]2ch; ar = 2,6-cl2c6h3) to form cy - otbu suggest that capture of the alkyl radical at the oxygen atom of the otbu ligand is thermodynamically favorable (g = 13.4 kcal / mol), whereas combination of the alkyl radical at cu(ii) to form the square planar complex [(nacnac)cu(iii)(cy)(otbu)] is thermodynamically disfavored (g = + 14.9 kcal / mol). Thus, it is possible that the alkyl radical reacts directly with the imidate or amidate ligands to form the n - alkyl imide and amide products . The selectivity of secondary (2) and primary sites (1) over tertiary (3) sites for the amidation of alkanes by this copper system is different from the selectivity of 3> 2> 1 for hydrogen abstraction by a tert - butoxy radical . This selectivity for secondary over primary and tertiary sites has been observed in the copper - catalyzed amidation of benzylic c h bonds, and the rationale for such selectivity was based on steric effects . H bonds results from the recombination of alkyl radicals with phen - ligated cu(ii) amidate and imidate complexes; we propose that the tertiary radical is too hindered to recombine with phen - ligated cu(ii) amidate and imidate complexes and the alkyl radical undergoes decomposition . To address this proposal, we determined the mass balance of the reaction . This information would provide insight into the fate of all the alkyl radicals that could form . The amidation of adamantane afforded a ratio of 1.6 n-(adamantan-1-yl)benzamide to 1.0 n-(adamantan-2-yl)benzamide and 1-phenyladamantane . The 1-phenyladamantane product likely results from the direct reaction of 1-adamantyl radical with benzene . The observation of 1-phenyladamantane reveals another pathway by which tertiary alkyl radicals decompose in the reaction . The alkene likely forms from the decomposition of the tertiary radical, and this decomposition likely occurs because the combination of the tertiary radical with the phen copper amidate or imidate is sterically disfavored . In summary, we have described a copper - catalyzed amidation of unactivated alkanes by benzamide, sulfonamide, carbamate, phthalimide, and their derivatives . The amidation of alkanes under our catalytic conditions preferentially forms the products from amidation at secondary sites over tertiary sites . H bonds to form n - alkyl products is observed when the secondary c h bonds are hindered . Potential cu(ii)-amidate and -imidate intermediates were isolated, characterized, and demonstrated to be intermediates for c h amidation of cyclohexane . Our mechanistic data imply that the tert - butoxy radical, not a copper - nitrene or copper - aminyl species, leads to the activation of aliphatic c
Sales and service workers face customers during working hours and the standardized expression of emotions, including kindness and sympathy, are important components of their job requirements (1). Standardized expression of emotions is socially desirable, especially to the organization, and it is essential to maintaining a positive economic relationship between the customers and the sales and service workers . The standardized expression of desirable emotions and the act of hiding undesirable emotions is also an essential component of a new type of work demand (2), namely an emotional demand (34). Furthermore, these employees can be categorized as performing " emotional labor " (5). Hochschild provided the first definition of emotional labor including cognitive, bodily, and expressive components (6). For example, when customers expect a positive interaction, workers should try to smile and express happiness . Accommodation of the emotional demands from customers is an essential component of the social, and ultimately the economic, skills of sales and service workers . However, some studies have suggested that excessive emotional demands could lead to disconnect between displayed and felt emotions, or emotional dissonance . Furthermore, various studies have demonstrated that chronic exposure to emotional demands with low job control causes service workers to feel higher levels of exhaustion and cynicism (8). Emotional exhaustion in the workplace can increase suicidal ideation (9). Chronic excessive emotional demands, in turn, lead to increased risk of depression (10). Hiding one's emotions has been found to be associated with increased suicidal ideation in depressed older adults (11). Therefore, in sales and service workers, there is a possibility that excessive emotional demands, including hiding one's emotions, are linked to suicidal ideation . Actually, suicide mortality rate of sales and service workers in korea has been increasing steadily (12). Kessler et al . (13) reported the probability of transitioning from suicidal ideation to suicidal plans and then to an attempt using the national comorbidity survey from the united states . The transition probability from suicidal ideation to suicidal plans was 34%, and the transition probability from plans to an attempt was 72% . In addition, the transition probability from suicidal ideation to an unplanned suicidal attempt was 26% . These results suggest that investigations of suicidal ideation are a starting point in preventing the risk of death due to suicide . A study reported that the emotional exhaust and burn out were related to suicidal ideation in medical doctor (14), but little has known whether high emotional demands increase the risk of suicidal ideation in sales and service workers in asian countries, to our best knowledge . Emotional demands are enforced in the workplace to serve a variety of customers' demands; hence, occupational strain is increased in sales and service workers . The structure of the work organization is an important consideration in the reduction of occupational stress . A person's sense of having little or no control over their job performance or work conditions (low job control) has been associated with an increased risk of developing occupational stress, which is linked to psychological and physiological diseases (15). Low job control has been found to decrease employees' work effectiveness (1617), requiring more time and effort to meet customers' demands . A prospective cohort study in japan demonstrated that low job control is a strong predictor of suicidal death (18). Therefore, we hypothesized that emotional demands and job control in the workplace may influence suicidal ideation in sales and service workers . We also tested the demand - control hypothesis (1920) to examine whether the interaction of high job demands and low job control has an effect on suicidal ideation . We used data from the 4th korea national health and nutrition examination survey (knhanes), which consists of comprehensive questionnaires including individual covariates related to suicidal ideation and lifestyle factors (2021). The aim of this study was to investigate 1) whether high emotional demands or low job control were associated with suicidal ideation, and 2) the interactive effects of high emotional demands and low job control on suicidal ideation . Nine occupational categories in the 4th knhanes corresponded to the korean standard classification of occupations . Of the 10,023 economically active participants in the study, 1,999 sales and service workers were selected . Four participants were excluded from the study due to missing responses to questions about suicidal ideation . Finally, a total of 1,995 participants (824 men and 1,171 women) were included in the analyses . The 4th knhanes includes a questionnaire that assesses individuals for the presence of suicidal ideation during the past year . To assess suicidal ideation, participants were asked, " have you felt as though you wanted to die during past year? " Yes' or no' responses indicated the presence or absence of suicidal ideation, respectively (21). Emotional demands and job control at work were also measured by the self - report questionnaire . The following questions were asked: " i should hide my emotions while working " (22) was used to assess emotional demands, and " i have the authority to control my job, and i can use that authority during work " was used to assess the degree of job control . The response categories for these items used a 4-point likert - type scale ranging from never', rarely', yes', to always' . The yes' and always' responses were assigned a high rating and the never' and rarely' responses were assigned a low rating for both questions (emotional demands and job control). Four groups were defined as high vs. low emotional demand and job control as follows: group i had low emotional demands and high job control, group ii had low emotional demands and low job control, group iii had high emotional demands and high job control, and group iv had high emotional demands and low job control . Total family income divided by family size (total number of family members who live together) was calculated to define the household income . The standard income level was estimated according to strata of age (5-year intervals) and gender . The standard income level was categorized as low, middle - low, middle - high, or high . Smoking history was classified as non - smoker, former smoker, or current smoker . A non - smoker was defined as a person with a lifetime history of smoking fewer than 100 cigarettes . Heavy alcohol consumption was defined as drinking 7 or more glasses of alcohol on 2 or more occasions per week in men, and 5 or more glasses on 2 or more occasions per week in women . High physical activity was defined as more than 20 minutes of physical activity that was of sufficient time and intensity to produce perspiration, performed 3 or more times per week . Chi - square tests were used to compare the prevalence of suicidal ideation across demographic characteristics (table 1). The prevalence (%) of suicidal ideation is reported according to high emotional demands and low job control . The odds ratio (ors) and 95% confidence intervals (95% cis) for suicidal ideation were estimated using multiple logistic regression analysis . High physical activity was defined as more than 1/3 hour of physical activity which sufficient to get sweating, and three or more times per week . Heavy alcohol drinking was defined as drinking seven or more glasses of alcohol on 2 or more occasions per a week in men, and 5 or more glasses on 2 or more occasions per a week in women . All participants provided written informed consent for their voluntary participation in the study . The identifying information of all participants this survey was approved by the institutional review board (irb) of the korea centers for disease control and prevention (irb: 2007 - 02-con-04-p; 2008 - 04exp-01-c; 2009 - 01con-03 - 2c). Nine occupational categories in the 4th knhanes corresponded to the korean standard classification of occupations . Of the 10,023 economically active participants in the study, 1,999 sales and service workers were selected . Four participants were excluded from the study due to missing responses to questions about suicidal ideation . Finally, a total of 1,995 participants (824 men and 1,171 women) were included in the analyses . The 4th knhanes includes a questionnaire that assesses individuals for the presence of suicidal ideation during the past year . To assess suicidal ideation, participants were asked, " have you felt as though you wanted to die during past year? " Yes' or no' responses indicated the presence or absence of suicidal ideation, respectively (21). Emotional demands and job control at work were also measured by the self - report questionnaire . The following questions were asked: " i should hide my emotions while working " (22) was used to assess emotional demands, and " i have the authority to control my job, and i can use that authority during work " was used to assess the degree of job control . The response categories for these items used a 4-point likert - type scale ranging from never', rarely', yes', to always' . The yes' and always' responses were assigned a high rating and the never' and rarely' responses were assigned a low rating for both questions (emotional demands and job control). Four groups were defined as high vs. low emotional demand and job control as follows: group i had low emotional demands and high job control, group ii had low emotional demands and low job control, group iii had high emotional demands and high job control, and group iv had high emotional demands and low job control . Total family income divided by family size (total number of family members who live together) was calculated to define the household income . The standard income level was estimated according to strata of age (5-year intervals) and gender . The standard income level was categorized as low, middle - low, middle - high, or high . Smoking history was classified as non - smoker, former smoker, or current smoker . A non - smoker was defined as a person with a lifetime history of smoking fewer than 100 cigarettes . Heavy alcohol consumption was defined as drinking 7 or more glasses of alcohol on 2 or more occasions per week in men, and 5 or more glasses on 2 or more occasions per week in women . High physical activity was defined as more than 20 minutes of physical activity that was of sufficient time and intensity to produce perspiration, performed 3 or more times per week . Chi - square tests were used to compare the prevalence of suicidal ideation across demographic characteristics (table 1). The prevalence (%) of suicidal ideation is reported according to high emotional demands and low job control . The odds ratio (ors) and 95% confidence intervals (95% cis) for suicidal ideation were estimated using multiple logistic regression analysis . High physical activity was defined as more than 1/3 hour of physical activity which sufficient to get sweating, and three or more times per week . Heavy alcohol drinking was defined as drinking seven or more glasses of alcohol on 2 or more occasions per a week in men, and 5 or more glasses on 2 or more occasions per a week in women . This survey was approved by the institutional review board (irb) of the korea centers for disease control and prevention (irb: 2007 - 02-con-04-p; 2008 - 04exp-01-c; 2009 - 01con-03 - 2c). The prevalence of suicidal ideation was 10.3% in men (85 of 824) and 21.3% in women (249 of 1,171). The prevalence of suicidal ideation in workers with high emotional demands and low job control was higher than workers with low emotional demands and high job control for both genders: 13.2% and 15.1% vs. 7.4% and 8.7% in men; 26.8% and 25.4% vs. 15.0% and 18.8% in women, respectively (table 1). The prevalence of suicidal ideation was higher in women with lower individual and household income levels and in those who were heavy alcohol drinkers and current smokers compared to the women in the other groups (table 1). There was an inverse relationship between physical activity and suicidal ideation in men, but not in women . The prevalence of suicidal ideation in men was 5.5% in physically active workers and 10.6% in workers who were not physically active (p = 0.046). The ors for suicidal ideation were associated with high emotional demands in both genders (or, 2.07; 95% ci, 1.24 - 3.45 in men, or, 1.97; 95% ci, 1.42 - 2.75 in women) adjusted for age, household income, and employment characteristics (paid vs. self - employed). Low job control increased the odds of suicidal ideation in men (or, 1.96; 95% ci, 1.01 - 384), but not in women (or, 1.33; 95% ci, 0.91 - 1.93). Further adjustment for smoking, alcohol drinking and physical activity habit attenuated the association between suicidal ideation and low job control in men (model ii of table 2). Model i, adjusted for age, house hold income, pain worker (vs. self - employed worker); model ii, model i + adjusted for smoking, alcohol drinking and physical activity habit . We next analyzed the interactive effects of the two job characteristics (emotional demands and job control) on suicidal ideation . The number of male workers was 431 in group i (low emotional demands and high job control), 67 in group ii (low emotional demands and low job control), 273 in group iii (high emotional demands and high job control), and 53 in group iv (high emotional demands and low job control). The number of female workers was 486, 147, 388, and 150 in groups i, ii, iii, and iv, respectively . The prevalence rates of suicidal ideation in male workers were 7.9% (n = 34), 10.5% (n = 7), 12.8% (n = 35), and 17.0% (n = 9) for groups i, ii, iii, and iv, respectively (p for this trend is 0.008). The prevalence rates of suicidal ideation in female workers were 15.8% (n = 77), 16.3% (n = 24), 25.3% (n = 98), and 33.3% (n = 50) for groups i, ii, iii, and iv, respectively (p for this trend is below 0.001; fig . 1). Prevalence (%) of suicidal ideation for high emotional demands with low job control . Compared to group i (low emotional demands and high job control), group iii (high emotional demands and high job control; or, 1.93; 95% ci, 1.08 - 3.45 in men, or, 1.60; 95% ci, 1.06 - 2.42 in women) and group iv (high emotional demands and low job control; or, 4.60; 95% ci, 1.88 - 11.29 in men, or, 2.69; 95% ci, 1.64 - 4.40 in women) were more likely to experience suicidal ideation after controlling for age, household income, employment characteristics, smoking, alcohol drinking and physical activity habit (model ii in table 3). Ors for suicidal ideation were 1.12 and 0.98 for men and women with low emotional demands and low job control, respectively and 1.93 and 1.60 for men and women with high emotional demands and low job control, respectively . The ors for high emotional demands and low job control were 4.60 in men and 2.69 in women . These ors are somewhat greater than the sums of the ors (3.05 in men, 2.58 in women). Model i, adjusted for age, house hold income, pain worker (vs. self - employed worker); model ii, model i + adjusted for smoking, alcohol drinking and physical activity habit . In the current study, we found that high emotional demands in both gender and low job control in men are related to suicidal ideation in sales and service workers after adjustment for age, household income and employment status . Sales and service personnel are often the first workers to face customers who argue, complain, and make various demands . Because economic decisions are dependent on customer demands, standardized emotional displays are essential economic skills for sales and service workers . Hiding and expressing emotions are also important skills needed to maintain positive relationships with customers . Recently, standardized emotions used in work settings have been labeled " emotional labor " in order to adequately represent the skill set (5). In the current study, the questionnaire item " i should hide my emotions while working " was presented to sales and service workers . The response values included in the questionnaire reflect only the act of hiding one's emotions, without addressing how one expresses emotions or experiences emotional dissonance . Hence, the results of the current study cannot be applied directly to concepts of emotional labor . However, the act of hiding one's emotions is the most important component of emotional labor, and employers encourage this behavior . Therefore, we categorized respondents as high or low emotional demand based on this item in the current study . Careful attention is needed to generalize our current results to the broader concept of emotional labor . Patterns of suicide have been found to vary by occupation, and there are certain occupational and industrial groups that have an especially high risk of suicide (23). Some studies have reported that there are occupation - specific causes and methods of suicide, and this knowledge provides us with strategies to understand and prevent suicide in certain occupations (24). For example, epidemiological studies have revealed that easy access to lethal means in medically - related occupations (25), loneliness due to isolation in miners and farmers, and low income and inadequate social support systems are related to poor psychological well - being in manual workers (26). Suicide rates fluctuate according to the national macroeconomic conditions for farmers, fishery, and forestry workers (27). In light of the evidence regarding occupation - specific causes of suicide, our results suggest that high emotional demands are important risk factors for suicidal ideation in sales and service workers, and further that these factors have additive effects . The mortality rate due to suicide is steadily increasing in korean service and sales workers (12). We calculated the age - standardized prevalence of suicidal ideation in service and sales worker using the 4th knhanes: 8.6% in men, and 19.2% in women (data not shown in the results section). Prevalence was highest among non - manual occupational groups in both genders, though it was not significantly higher than the prevalence in manual occupational groups . Standardized expressions and the act of hiding one's emotions are desired by the organization regardless of their individual characteristics; however, they cause depersonalization and emotional exhaustion (28). The increase in emotional demands accelerates exhaustion and results in burnout and depression (29). These related associations support the findings of the current study, namely that high emotional demands increase the odds of suicidal ideation in sales and service workers . The relationship between low job control and suicidal ideation in men was no longer significant after adjusting for age, household income, employment characteristics, smoking, alcohol consumption, and physical activity (model ii in table 2). Furthermore, low job control in women did not show a significant relationship with suicidal ideation in any of the logistic models . Although there was an interaction effect between high emotional demands and low job control (table 3), the combination of low emotional demands and low job control (group ii) was not associated with a significant increase in the odds of suicidal ideation, whereas high emotional demands and high job control (group iii) did show this association in both genders . These results suggest that high emotional demands have a stronger relationship with suicidal ideation compared to low job control in the sales and service workers in this study . In the current study, the relationship between suicidal ideation and some of the covariates differ between men and women . First, low job control increased the odds of suicidal ideation after controlling for high emotional demands, household income, and employment characteristics in men, but not in women (table 2). The current results suggest that the association between low job control and suicidal ideation is somewhat stronger in men than in women . In contrast to previous studies (31), our study shows that lower levels of household income are more strongly related with the risk of suicide in women . High physical activity had an inverse relationship with suicidal ideation in men, but alcohol consumption and smoking did not (table 1). In contrast, women showed a significant relationship between suicidal ideation, alcohol consumption, and smoking (table 1). We hope that the gender differences found in our study communicate that gender - specific strategies are needed to prevent suicide among sales and service workers . There are several limitations of the current study . Because it is a cross - sectional study design, the direction of causality cannot be determined . The act of hiding one's emotions can be associated with personality, which may make some individual workers suffer more from stress . This indicates the possibility of an interaction between a personality trait (hiding one's emotions) and job demands affecting suicidal ideation . A more comprehensive study including personality (3233) and organization - specific factors is needed . There may also have been selection biases, namely healthy worker selection and healthy worker survival . In other words, if a worker has difficulties performing emotional labor, the worker may be less likely to select a service job (healthy worker selection). In contrast, workers who are good at hiding their emotions are more likely to keep their service job (healthy worker survival). Selection bias would attenuate the association between hiding one's emotions and suicidal ideation; nonetheless, our study shows a significant association between hiding one's emotions and suicidal ideation . However, these limitations (including the cross - sectional study design, potential influence of personality, and selection biases) should be taken into consideration when interpreting our results . Furthermore, individuals who died as a result of suicide are not included in the study . However, the rate of suicide attempts was not high enough to influence the results of the current study . The percentage of successful suicide attempts was 5.8% in koreans between the ages of 20 and 69 (34). We also could not control for past job or careers due to a lack of information . Although the employment characteristics of workers were controlled for in the regression models, specific positions held by the sales and service workers were not controlled for due to a lack of information . It is possible that workers in lower positions experienced more occupational stress than those in higher positions . Further studies are needed to clarify the effects of position on the association between high emotional demands at work and suicidal ideation . In conclusion, these results suggest that high emotional demands in both genders, as well as low job control in men, might play a crucial role in increasing the risk of suicidal ideation in sales and service workers . Furthermore, we found the interaction effects of combining high emotional demands and low job control on suicidal ideation for both genders . These interesting associations remained significant even after controlling for individual risk factors such as age, household income, employment characteristics, smoking, alcohol drinking and physical activity habit.
The traditional medical practitioner or traditional healer can be defined as someone who is recognized by the community in which he lives as competent to provide health care by using vegetable, animal and mineral substances and certain other methods based on the social, cultural and religious backgrounds as well as the prevailing knowledge, attitudes and beliefs regarding physical, mental and social well - being and the causation of disease and disability in the community . Traditional healers used different medicinal formulas from various natural substances (animal, mineral and vegetable). They have extensive knowledge on the use of plants and herbs for medicinal and nutritional purposes . The mishings are an ethnic group inhabiting the districts of dhemaji, north lakhimpur, sonitpur, tinsukia, dibrugarh, sibsagar, jorhat and golaghat of assam . A few live in and around pasighat of east siang district of arunachal pradesh . They are the second largest tribal group in north - east india, followed by the bodos . Their chief festival is ali - aye - ligang, in the month of february, which marks the beginning of the sowing season . Moreover, due to their affinity towards living close to river banks brings about malaria and water - borne diseases and they developed traditional healing practices to protect themselves from different diseases and traditional healing practices of those days are still preferred by the people of this community in this modern era . Details of medicinal plants used in india were reported and records on folk medicines used by mishing tribes is lesser known. [36] however, tribal communities in arunachal pradesh, resembling mishings i.e. Adi, apatani and nyishi also use locally available herbs for treatment of ailments. [712] traditional healing practices amongst mishing tribes is the method to treat ailments by using herbs in form of fresh drug, crushed juice, decoction of drug part and powdered medicine for oral intake and paste for local application on skin diseases and wounds . They use locally available medicinal herbs, cultivated drugs from different habitat as well as cultivating depleting medicinal plants, they have also faith on divines and worships for cure of ailments . The study reveals detailed documentation of healing practices used by traditional healers for their community health with full faith and confidence . Malaria and jaundice being the prominent diseases in north east india are widely treated by traditional healers and 68 herbs have been recorded treating malaria and about 88 for treating jaundice . In folk medicine or ethno medicinal studies, the most reliable method is one involving field survey . During various field survey in forest areas and adjoining villages, villagers were consulted about their primary method of treatment during illness . After getting information about the persons involved in local healing practices authors made attempt to come in contact with these healers with an idea of exchange of knowledge gathered from established system of herbal medicine like ayurveda and local herbs used in other adjoining community . During course of interaction knowledge about single and easily accessible compound drugs used in ayurveda and easily available in the area it involves meeting with the herbalists and experts in the field for getting first hand information . Practitioner of herbal medicines who are experts in treating in general different ailments and who are also expert in different methods of treatment were consulted for getting some first hand data . In the present study the work is restricted to some herbal - medical practitioners within different mishing groups inhabiting in assam and arunachal pradesh . The herbalists consulted were convinced about the importance of documentation of ethnic knowledge about the medicinal plants used in various curative purposes . It requires tactful handling and persuasion to bring out the information from the herbal practitioners . During course of study traditional informers on healing practices were interviewed under which in total 7 healers from dhemaji and north lakhimpur districts and 4 from foothills of east siang district were interacted some of which are mr u. c. kardong, mr lakhidhar payeng, mr khogen kardong, mrs maloti naro and other associated with the above practitioners . These traditional healers belong to 4 villages in north lakhimpur and 3 in dhemaji district of assam and one village in east siang district of arunachal pradesh . The detail information about the plants and part used in the treatment of different ailments were collected . Plant specimens were collected for identification and herbarium preparation . While most of the plants are commonly occurring plants known to most of the people, some of the plants were identified consulting the herbarium specimen in the botanical survey of india (bsi), itanagar . The herbarium specimens are preserved in the herbarium of ayurveda regional research institute, itanagar for authentication and future reference . Mishing community is one of the major tribal communities which are distributed from arunachal pradesh to plains of assam and bifurcated from time to time due to their migration from hills of arunacha pradesh to plains of assam . During this migration they developed their knowledge by acquiring from other nearby communities and used herbs available in and around their villages for various treatments of ailments [table 1]. As per information given on system it was found that long back the responsible persons in the villages was village head called gaon burha in arunachal mishing but during these interactions more than 3 persons belonging to same or different family are involved in healing practices by developing some cultivation of herbs used in their practices and not naturally occurring in the nearby areas just like aloe barbadensis, barleria cristata, glycyrrhiza glabra etc . Under healing practices of mishing community general herbalist, bone setters, ojhas related with bhoot badha, dondai using mantra tantra etc . Some common type of treatment like cuts and wound, sprain and skin diseases where external application is involved is practiced by all those who get affected immediately . Use of certain herbs like centella asiatia, houttuyinia cordata, phyllanthus emblica and terminalia citrina is in common practice as protective medicine and is commonly sold in vegetable shops . Folk medicines used by mishing community of north east india types of traditional healers amongst mishing tribes presently all traditional healers of this community are not performing the same functions, nor do they all fall into the same category . . They have their own methods of diagnosis and their own particular medicine . By interviewing it was found that there are different types of traditional healers on basis of there expertise in north east india . Traditional medical practitioners treat all age groups and all problems, using and administering medicines that are readily available and affordable . Their treatment is comprehensive and has curative, protective and preventive elements, and can be either natural or ritual or both, depending on the cause of the disease . It includes among others, ritual sacrifice to appease the ancestors, ritual and magical strengthening of people and possessions, steaming, purification (e.g. Ritual washing, or the use of emetics and purgatives), sniffing of substances, cuts, wearing charms and piercing . The ethno medicinal information regarding treatment of different diseases collected in course of field study is presented here in tabular form for easy reference . The study shows that malaria, jaundice and female menstruation problems are the prominent diseases in this community as most of the traditional healers are prescribed medicine for these treatments . In this study, 55 medicinal plants encountered from different parts of the mishing inhabitant area used by this community in their daily ailment from various diseases . Different parts of the medicinal plant species were used for curing different diseases and mostly leaves (36.84%) were used followed by stem (14.03%), root (10.52%) and bark (7.02%). Asteraceae (5 species), apocynaceae (4 species) and 3 each in euphorbiaceae, malvaceae and acanthaceae were found . Some of the plants can be categorized as highly prioritized medicinal plants as they are of immense value in curing various diseases but are in the low niche . These plants are widely used under traditional healing practices but due to multiple use they are depleting from their habitat viz . Eventually, these species are now on the freeway towards extinction due to over exploitation, road construction, encroachment of habitat by the immigrants of the neighbouring community . Local inhabitants adapted cultivating some of the locally available herbs like acorus calamus, alstonia scholaris, centella asiatica, leucas indica, nymphea stellata, tabernemontana divaricata and some others from habitats of different climatic condition like aloe barbadensis, glycyrrhiza glabra which meet out the requirement of drugs for daily requirement . Some of the prominent herbs of the area are ageratum conyzoides, clerodendrum infortunatum, leucas indica, sida acuta, solanum viarum, etc . Which are commonly available in the habitat and are used for meeting out requirement of drug for treating ailments few commonly observed trees and shrubs are alstonia scholaris, costus speciosus ficus racemosa, oroxylum indicum, plumaria alba, ricinus communis, etc . Most of the plant products after formulation are used orally, whereas for skin disease and bone facture medicines are not prescribed for oral consumption . It was found that in most of the cases the plant products are prepared with combination of some other plants or some other products . The plants uses in mixture all may not contain the properties to relief from particular disease but some might be reduced side effect on treatment . Mishing community is one of the major tribal communities which are distributed from arunachal pradesh to plains of assam and bifurcated from time to time due to their migration from hills of arunacha pradesh to plains of assam . During this migration they developed their knowledge by acquiring from other nearby communities and used herbs available in and around their villages for various treatments of ailments [table 1]. As per information given on system it was found that long back the responsible persons in the villages was village head called gaon burha in arunachal mishing but during these interactions more than 3 persons belonging to same or different family are involved in healing practices by developing some cultivation of herbs used in their practices and not naturally occurring in the nearby areas just like aloe barbadensis, barleria cristata, glycyrrhiza glabra etc . Under healing practices of mishing community general herbalist, bone setters, ojhas related with bhoot badha, dondai using mantra tantra etc . Some common type of treatment like cuts and wound, sprain and skin diseases where external application is involved is practiced by all those who get affected immediately . Use of certain herbs like centella asiatia, houttuyinia cordata, phyllanthus emblica and terminalia citrina is in common practice as protective medicine and is commonly sold in vegetable shops . Folk medicines used by mishing community of north east india types of traditional healers amongst mishing tribes presently all traditional healers of this community are not performing the same functions, nor do they all fall into the same category . . They have their own methods of diagnosis and their own particular medicine . By interviewing it was found that there are different types of traditional healers on basis of there expertise in north east india . Traditional medical practitioners treat all age groups and all problems, using and administering medicines that are readily available and affordable . Their treatment is comprehensive and has curative, protective and preventive elements, and can be either natural or ritual or both, depending on the cause of the disease . It includes among others, ritual sacrifice to appease the ancestors, ritual and magical strengthening of people and possessions, steaming, purification (e.g. Ritual washing, or the use of emetics and purgatives), sniffing of substances, cuts, wearing charms and piercing . The ethno medicinal information regarding treatment of different diseases collected in course of field study is presented here in tabular form for easy reference . The study shows that malaria, jaundice and female menstruation problems are the prominent diseases in this community as most of the traditional healers are prescribed medicine for these treatments . In this study, 55 medicinal plants encountered from different parts of the mishing inhabitant area used by this community in their daily ailment from various diseases . Different parts of the medicinal plant species were used for curing different diseases and mostly leaves (36.84%) were used followed by stem (14.03%), root (10.52%) and bark (7.02%). Asteraceae (5 species), apocynaceae (4 species) and 3 each in euphorbiaceae, malvaceae and acanthaceae were found . Some of the plants can be categorized as highly prioritized medicinal plants as they are of immense value in curing various diseases but are in the low niche . These plants are widely used under traditional healing practices but due to multiple use they are depleting from their habitat viz . Eventually, these species are now on the freeway towards extinction due to over exploitation, road construction, encroachment of habitat by the immigrants of the neighbouring community . Local inhabitants adapted cultivating some of the locally available herbs like acorus calamus, alstonia scholaris, centella asiatica, leucas indica, nymphea stellata, tabernemontana divaricata and some others from habitats of different climatic condition like aloe barbadensis, glycyrrhiza glabra which meet out the requirement of drugs for daily requirement . Some of the prominent herbs of the area are ageratum conyzoides, clerodendrum infortunatum, leucas indica, sida acuta, solanum viarum, etc . Which are commonly available in the habitat and are used for meeting out requirement of drug for treating ailments few commonly observed trees and shrubs are alstonia scholaris, costus speciosus ficus racemosa, oroxylum indicum, plumaria alba, ricinus communis, etc . Most of the plant products after formulation are used orally, whereas for skin disease and bone facture medicines are not prescribed for oral consumption . It was found that in most of the cases the plant products are prepared with combination of some other plants or some other products . The plants uses in mixture all may not contain the properties to relief from particular disease but some might be reduced side effect on treatment . The traditional healing practices in mishing tribes of arunachal pradesh and assam was insufficiently documented and authors made efforts to document the healing practices used by mishing community with details of methodology and doses . To cope up with the objectives authors made interaction with villagers in different villages in dhemaji and north lakhimpur districts of assam and foot hills of east siang district of arunachal pradesh to know about genuine and reliable traditional healers in the area and came in contact with 11 traditional healers who are engaged in herbal treatment . During course of interaction 55 different herbs and their parts were found using in various treatments . These herbs were belonging to herbs, shrubs and tree either from locally available sources or adapted through cultivation in their small herbal gardens . Prevalent diseases treated by the mishing healers are jaundice, malaria, menstrual disorders, joint pains skin diseases etc . Prior to this certain other plants used by mishing tribes of assam were described . However, most of the plants involved in traditional practice described in this paper are different and if some of the plants are reported in these communications they are for other diseases . The description of all above mentioned plants are on the basis of ethno medicinal knowledge . Plants are used by mishing community in different places on the basis of availability of those plants and the proper knowledge about efficacy of those plants against the particular disease . For safe uses of different medicinal plants, we need randomised clinical trials for some of the manual therapies and further research is need to ascertain the efficacy and safety of several other practices and medicinal plants . We have to develop a proper study about the traditional medicine and the ratio of curative measurement applied to different patients on the use of those plants . The study on such types of documentation is of great importance for north eastern institute of folk medicine in the sense that the institute will get sufficient information on traditional healers and mode administration of medicine for treating ailments on one hand and sufficient tool for proving authenticity of drugs used in healing practice through pharmacology, phytochemistry and other pharmaceutical constants . Similarly services of these traditional healers are of great importance to public as they are rendering their services to public in very remote places where people are really in need of health services . These traditional healers need to be involved in all sorts of trainings to youngsters as well as refreshing their knowledge with healers of other communities . Though they are acquiring and correlating their knowledge with established records and information available with other communities . Involving cultivating and using aloe barbadensis and glycyrrhiza glabra is the example and availability of drugs from other climatic zones in the crude drugs markets of major markets in assam strengthen the concept of exchanging knowledge with other communities . The role of government for the existence of this system of medicine should be: 1 . To give due recognition to their contribution and involvement; 2 . To delineate the specific scope, limit and role of traditional healers in public health promotion; 3 . To undertake research and development activities; 4 . To provide orientation and support to folk - healers; 5 . To monitor and
To differentiate between the individual diagnoses of patients presenting at memory clinics with cognitive complaints and often depressive symptoms, more accurate diagnostic measures are needed . The term subjective cognitive impairment (sci) describes patients with subjective cognitive complaints and occurs before mild cognitive impairment (mci). Which persons should be treated or investigated further, it is important to find reliable correlates of both subjective cognitive complaints and objective cognitive impairment . Objective cognitive impairment has been found in 11% of nondemented elderly, while estimates of memory complaints in nondemented elderly range from 22 to 56% . For early diagnosis of dementia and alzheimer's disease (ad), it is important to know when cognitive complaints are accurate, i.e. Reflect actual performance, but the existing findings regarding accuracy of complaints in mci are divergent . Significant associations between cognitive complaints and performance have been found in a few community - based samples, while other studies have not found such associations . One review study suggests that nondemented individuals are generally able to accurately identify their cognitive problems, while patients with ad dementia underestimate their cognitive problems . Early ad is typically characterized by neuronal loss in the medial temporal lobes and memory impairment . The degree of awareness of one's cognitive state may decrease as the disease progresses and frontal lobe functions decrease . Combinations of ad - related csf biomarkers (tau and a proteins) predict the development of dementia in mci . The findings from one recent study indicate that csf levels of a42 are already fully decreased at least 5 - 10 years before conversion to ad dementia, whereas total tau (t - tau) and phosphorylated tau (p - tau) seem to be later markers . Previously, we have found associations between memory and csf tau levels in the sci / mci sample, and associations between csf biomarkers and cognition in mci have been found by other researchers . Still, many aspects regarding the relationship between biological changes related to degeneration in terms of csf biomarkers and clinical symptoms in predementia stages remain unclear . The association between csf biomarkers and both cognitive complaints and performance has not been studied in sci . Depressive symptoms occur commonly in sci and mci and constitute another known risk factor for dementia . People that are depressed complain, and the criteria for depression include sci and/or objective cognitive impairment . Positive correlations have been found between depression and memory complaints in a few studies of normal and cognitively impaired samples . Our first hypothesis is that individuals with sci judge their performance more accurately than mci patients . The second hypothesis is that cognitive complaints are associated with depressive symptoms and csf biomarkers are associated with objective cognitive impairment . The project was approved by the south - eastern norway committee for medical research ethics . Patients with subjective cognitive complaints which had lasted 6 months or more and who had attended a university - based memory clinic between september 2005 and january 2010 were assessed for inclusion in the study . Inclusion criteria were no or very mild problems with activities of daily living and global deterioration scale (gds) score 2 (sci, n = 23) or 3 (mci, n = 47) as determined from a clinical interview and screening tests . Screening tests included parameters 13 - 20 (memory, disorientation, abstract thinking, visuospatial ability, language, sensory aphasia, visual agnosia, and apraxia) from the stepwise comparative status analysis (step), word fluency, interference, and numeral - letter items from the i - flex, and items from the neurobehavioral cognitive status examination (cognistat) as well as mini - mental state examination (mmse). To be classified as gds 2, subjects had to score 28 on mmse, 0 on step variables, a total sum <2 on the elements from i - flex, and there had to be a maximum of one domain where they scored 0.5 on the clinical dementia rating (cdr) scale . Subjects classified as gds 3 scored 26 on mmse, 1 on step variables, 2 on i - flex variables, and there were more than one cdr domain where they scored 0.5, albeit none where they scored 1 . The following criteria for exclusion were established: psychiatric disorder (including major depressive episode), stroke, cancer, drug abuse, solvent exposure or anoxic brain damage . The four neuropsychological variables, used in the analyses, were termed: word list memory (30-min recall) of the rey auditory verbal learning test (ravlt), visual memory (30-min recall) of the rey complex figure test (rcft), working memory of the letter - number sequencing subtest, wechsler adult intelligence scale third edition, and response inhibition (naming colors of the ink of inconsistently colored names) of the color - word interference test . Self - reported depressive symptoms were assessed by the symptom checklist-90-r (scl-90-r) on the same day as the neuropsychological examination was performed . The questionnaire consists of 90 items and is designed to evaluate a broad range of psychological problems and symptoms of psychopathology, including a 13-item subscale for depressive symptoms . The items are rated on a five - point scale of distress from not at all to extremely. In addition to scl-90-r, depressive symptoms were assessed using a short version of the geriatric depression scale, namely gds-15 . Two of the scl-90-r items concern memory and concentration complaints, which are rated on a five - point scale of distress from not at all (0) to extremely (4). Csf samples were collected by lumbar puncture through the l3/l4 or l4/l5 inter - space . Csf concentrations of a42, t - tau, and p - tau were routinely examined using commercially available enzyme - linked immunosorbent assay kits (innogenetics, belgium). Raw scores of the csf variables were used in all analyses . Both raw scores and frequencies of pathological levels t - tau level was considered abnormal if t - tau 300 ng / l for patients under 50 years,> 450 ng / the statistical package for social sciences (spss 16.0) was used for all statistical analyses . To compare characteristics of the patient groups, the independent - samples t test and the test were used . The pearson correlation method was used to test for associations between cognitive complaints and test performance . Linear multiple regression analysis was performed to assess the impact of depressive symptoms and csf biomarkers on subjective cognitive complaints and cognitive performance . The variable of depressive symptoms was entered together with one of three csf variables at a time as the predictor variables . Only one csf variable was included per model because of the colinearity among the predictor variables . As there was a significant group difference in age, age was used as a confounder in each model . The term the project was approved by the south - eastern norway committee for medical research ethics . Patients with subjective cognitive complaints which had lasted 6 months or more and who had attended a university - based memory clinic between september 2005 and january 2010 were assessed for inclusion in the study . Inclusion criteria were no or very mild problems with activities of daily living and global deterioration scale (gds) score 2 (sci, n = 23) or 3 (mci, n = 47) as determined from a clinical interview and screening tests . Screening tests included parameters 13 - 20 (memory, disorientation, abstract thinking, visuospatial ability, language, sensory aphasia, visual agnosia, and apraxia) from the stepwise comparative status analysis (step), word fluency, interference, and numeral - letter items from the i - flex, and items from the neurobehavioral cognitive status examination (cognistat) as well as mini - mental state examination (mmse). To be classified as gds 2, subjects had to score 28 on mmse, 0 on step variables, a total sum <2 on the elements from i - flex, and there had to be a maximum of one domain where they scored 0.5 on the clinical dementia rating (cdr) scale . Subjects classified as gds 3 scored 26 on mmse, 1 on step variables, 2 on i - flex variables, and there were more than one cdr domain where they scored 0.5, albeit none where they scored 1 . The following criteria for exclusion were established: psychiatric disorder (including major depressive episode), stroke, cancer, drug abuse, solvent exposure or anoxic brain damage . The four neuropsychological variables, used in the analyses, were termed: word list memory (30-min recall) of the rey auditory verbal learning test (ravlt), visual memory (30-min recall) of the rey complex figure test (rcft), working memory of the letter - number sequencing subtest, wechsler adult intelligence scale third edition, and response inhibition (naming colors of the ink of inconsistently colored names) of the color - word interference test . Self - reported depressive symptoms were assessed by the symptom checklist-90-r (scl-90-r) on the same day as the neuropsychological examination was performed . The questionnaire consists of 90 items and is designed to evaluate a broad range of psychological problems and symptoms of psychopathology, including a 13-item subscale for depressive symptoms . The items are rated on a five - point scale of distress from not at all to extremely. In addition to scl-90-r, depressive symptoms were assessed using a short version of the geriatric depression scale, namely gds-15 . Two of the scl-90-r items concern memory and concentration complaints, which are rated on a five - point scale of distress from not at all (0) to extremely (4). Csf samples were collected by lumbar puncture through the l3/l4 or l4/l5 inter - space . Csf concentrations of a42, t - tau, and p - tau were routinely examined using commercially available enzyme - linked immunosorbent assay kits (innogenetics, belgium). Raw scores of the csf variables were used in all analyses . Both raw scores and frequencies of pathological levels t - tau level was considered abnormal if t - tau 300 ng / l for patients under 50 years,> 450 ng / the statistical package for social sciences (spss 16.0) was used for all statistical analyses . To compare characteristics of the patient groups, the independent - samples t test and the test were used . The pearson correlation method was used to test for associations between cognitive complaints and test performance . Linear multiple regression analysis was performed to assess the impact of depressive symptoms and csf biomarkers on subjective cognitive complaints and cognitive performance . The variable of depressive symptoms was entered together with one of three csf variables at a time as the predictor variables . Only one csf variable was included per model because of the colinearity among the predictor variables . As there was a significant group difference in age, age was used as a confounder in each model . The term demographic data were similar in sci and mci except for age . As expected, cognitive performance (mmse, word list / visual memory, response inhibition, and working memory) was significantly better in sci compared to mci, but both groups reported a similar degree of memory and concentration complaints . Depressive symptoms were not significantly different between the groups, although there was a high variability in depression scores in both groups . Csf a42 levels were higher (but not significantly so) in sci compared to mci, while t - tau levels were significantly lower and p - tau levels were lower at trend level in sci compared to mci . There was a significant negative relationship between visual memory performance and concentration complaints as well as between response inhibition and both memory and concentration complaints in patients with sci (the better the test performance, the less complaints). In the same group, there were also negative relationships between memory complaints and performance on tests of working memory, word list and visual memory, but they were only significant at trend level . In mci, significant positive relationships were found between word list / visual memory performance and concentration complaints, i.e. A lower performance was associated with less complaints . No significant associations were found between test performance and memory complaints in mci . In order to assess the impact of depressive symptoms and csf biomarkers (explanatory variables) on the reported cognitive complaints and cognitive performance (the dependent variables), linear regression analyses were performed (tables 3, 4). Scl-90-r depressive symptoms, but not csf biomarkers, predicted subjective memory and concentration complaints in both groups of patients . In contrast, csf biomarkers (a42, t - tau, and p - tau) were significant predictors of cognitive test performance . In the sci group (table 3), a42 was a significant predictor of word list / visual memory and p - tau was a significant predictor of response inhibition . In the mci group (table 4), t - tau was a significant predictor of word list memory (significance at trend level was achieved for visual memory), and p - tau was a significant predictor of visual memory (significance at trend level was achieved for word list memory). We also explored the associations of depression with cognitive complaints and test performance, using gds-15 as the depression measure . The results were largely similar in sci, with the exception that the gds-15 score was negatively associated with response inhibition . In mci, the gds-15 score did not correlate with cognitive complaints or test performance (data not shown). Demographic data were similar in sci and mci except for age . As expected, cognitive performance (mmse, word list / visual memory, response inhibition, and working memory) was significantly better in sci compared to mci, but both groups reported a similar degree of memory and concentration complaints . Depressive symptoms were not significantly different between the groups, although there was a high variability in depression scores in both groups . Csf a42 levels were higher (but not significantly so) in sci compared to mci, while t - tau levels were significantly lower and p - tau levels were lower at trend level in sci compared to mci . Table 2 shows the correlations between test performance and cognitive complaints . There was a significant negative relationship between visual memory performance and concentration complaints as well as between response inhibition and both memory and concentration complaints in patients with sci (the better the test performance, the less complaints). In the same group, there were also negative relationships between memory complaints and performance on tests of working memory, word list and visual memory, but they were only significant at trend level . In mci, significant positive relationships were found between word list / visual memory performance and concentration complaints, i.e. A lower performance was associated with less complaints . In order to assess the impact of depressive symptoms and csf biomarkers (explanatory variables) on the reported cognitive complaints and cognitive performance (the dependent variables), linear regression analyses were performed (tables 3, 4). Scl-90-r depressive symptoms, but not csf biomarkers, predicted subjective memory and concentration complaints in both groups of patients . In contrast, csf biomarkers (a42, t - tau, and p - tau) were significant predictors of cognitive test performance . In the sci group (table 3), a42 was a significant predictor of word list / visual memory and p - tau was a significant predictor of response inhibition . In the mci group (table 4), t - tau was a significant predictor of word list memory (significance at trend level was achieved for visual memory), and p - tau was a significant predictor of visual memory (significance at trend level was achieved for word list memory). We also explored the associations of depression with cognitive complaints and test performance, using gds-15 as the depression measure . The results were largely similar in sci, with the exception that the gds-15 score was negatively associated with response inhibition . In mci, the gds-15 score did not correlate with cognitive complaints or test performance (data not shown). This study has investigated correlates of cognitive complaints and cognitive test performance in patients with sci and mci . Depressive symptoms and csf biomarkers were assessed as possible correlates because of their importance for the differential diagnosis of dementia . Subjects with sci were included since they constitute a group of particular interest for the early detection of neurodegenerative disease . In addition to neuropsychological data, we have studied both memory and concentration complaints, while most of the existing studies have aggregated the complaints into one complaint score instead of analyzing them by domain . We have used the self - rating questionnaires scl-90-r and gds-15 for the assessment of cognitive complaints and depressive symptoms . Relatively high mmse scores (sci mean score 29 and mci mean score 28) imply that most of patients are reliable sources of information . Still, a decrease in reliability is expected with disease progression (e.g., from sci to mci). The sci and mci groups studied reported a similar amount of memory and concentration complaints . Cognitive complaints increased with decreasing cognitive function in sci and decreased with decreasing cognitive function in mci . These results suggest that patients with incipient cognitive difficulties (sci), not satisfying the clinical criteria for mci, assess their cognitive abilities more correctly, while patients with mci tend to underestimate their cognitive difficulties . Similarly, disagreement between patients and their informants was associated with mci but not sci in another recent study . Depressive symptoms, but not csf biomarkers, were significantly associated with cognitive complaints, which is in accord with the findings from earlier studies of normal and cognitively impaired samples . We have not found an association between depressive symptoms and cognitive impairment, except for the association between response inhibition and depressive symptoms as measured by gds-15 in sci . In comparison, depressive symptoms were negatively correlated with cognitive functioning in another recent study of healthy middle - aged and older adults . Taking into account that depressive symptoms in midlife or in late life are associated with an increased risk of developing dementia, the association between depressive symptoms and response inhibition / cognitive complaints in our study may reflect an etiologic relationship between depression and very early cognitive changes due to dementia . We found negative associations between memory and csf tau measurements in the mci subsample and positive associations between a42 and memory in the cognitively healthier sci subsample . We have previously found similar associations between tau and memory in the overlapping sci / mci sample, which was not divided into sci and mci . To our knowledge, this is the first study of patients with sci and mci, giving support to the amyloid cascade hypothesis by using cognitive data . Here, we find the associations between memory and csf a42 in sci and the associations between memory and tau biomarkers in mci, which agrees with recent findings of buchhave et al ., suggesting that altered a metabolism precedes tau - related pathology and neuronal degeneration in ad . Incipient ad is the most prevalent underlying disease and is characterized by white matter diffusivity changes encompassing the memory network . In addition to memory performance, we have studied working memory and response inhibition . In sci, response inhibition was significantly associated with memory / concentration complaints and csf p - tau, while working memory was associated with memory complaints at trend level . These findings suggest that response inhibition is a sensitive measure of early cognitive decline in predementia phases . Previously, we have found that worse performance on response inhibition was associated with increased white matter diffusivity underlying the superior frontal cortex . An important limitation has to do with the difficulties of detecting effect sizes in small group data sets, exposing the method to type ii error . With few subjects in the sci group although an extensive screening procedure was used for the classification of subjects, the groups may be overlapping and may contain, among other conditions, chronic ischemic disease, normal aging, early - stage ad, and non - ad predementia . Still, a high variance in depression scores and high relationships between depressive symptoms and cognitive complaints suggest that some of the subjects could be included due to cognitive complaints related to their depressiveness . A cross - sectional study design may not be optimal since depressive disturbances can fluctuate and may not be present at every examination . The follow - up of the populations studied will help determine the long - term clinical significance of the results . This study aims to improve early diagnosis of dementia by investigating correlates of cognitive complaints and cognitive test performance in sci and mci . Considering the question if cognitive complaints reflect actual performance, the results from this study demonstrate that patients with sci, not satisfying clinical criteria for mci, assess their cognitive abilities more correctly, while patients with mci tend to underestimate their cognitive difficulties . Further, the findings shed light on the nature of cognitive complaints and cognitive impairment by demonstrating that depressive symptoms are associated with cognitive complaints, while degenerative changes (relating to pathological levels of csf biomarkers) are associated with an objective cognitive decline in high - risk predementia states . The results of the present manuscript are preliminary and need further confirmation on larger, prospective samples.
Major problem in ocular therapeutics is the attainment of optimal drug concentration at the site of action, which is compromised mainly due to precorneal loss resulting in only a small fraction of the drug being ocularly absorbed . The effective dose administered may be altered by increasing the retention time of medication into the eye by using in situ gel - forming systems . The anatomy, physiology, and biochemistry of the eye render this organ exquisitely impervious to foreign substances . The challenge to the formulator is to circumvent the protective barriers of the eye without causing permanent tissue damage . Ophthalmic ointments ensure superior drug bioavailability by increasing the contact time, minimizing the dilution by tears, and resisting nasolacrimal drainage . Major disadvantage of ointment, providing blurred vision, due to this it could be used either night time or for treatment on the outside and edges of the eyelids . Suspension as ophthalmic delivery systems relies on the assumption that particles may persist in conjunctival sac . Precorneal drug loss can be minimal, such as retarding drainage by using diffusion - controlled, nonerodible polymeric insert . The major disadvantage of inserts is the lack of patient acceptance owing to difficult administration . The development of newer, more sensitive diagnostic techniques and therapeutic agents render urgency to the development of more successful ocular delivery systems . The primitive ophthalmic solution, suspension, and ointment dosage forms are clearly no longer sufficient to combat these diseases, and current research and development efforts to design better therapeutic systems are the primary focus of this research work . The aim of the present investigation is to formulate an in situ gel using novel gum system . In situ gel solution increases the residence time and also sustain the release mechanism of the drug . Sodium alginate and hpmc - e 50lv was obtained from the nice chemicals, ahmedabad, india . The polymeric solution was prepared by dispersing required quantity of sodium alginate as main polymer and hpmc- e 50 lv, hpmc- k4 m as co - polymers in water using a magnetic stirrer until the polymers completely dissolve . Aqueous solution of moxifloxacin hydrochloride was added in to the polymeric solution with continuous stirring . The ph of the solution was adjusted to 6.5 using 0.1 n naoh/0.1 n hcl . The in situ gel formulations are depicted in table 1 . Formulation design of in situ gelling system the formulated in situ gel solution was tested for clarity, ph, gelling capacity, and drug content estimation . Evaluation parameters of formulations the gelling capacity of the prepared formulation was determined by placing a drop of the formulation in a vial containing 2 ml of freshly prepared simulated tear fluid and visually observed . The time taken for its gelling the samples were analyzed at 37c 0.5c by a circulating bath connected to the viscometer adaptor prior to each measurement. [710] the angular velocity of the spindle was increased 1 to 4 and the viscosity of the formulation was measured . The drug content estimation was carried out by diluting 1 ml of prepared formulation in 100 ml of distilled water and analyzed using uv - visible spectrophotometer (shimadzu uv-1700 pc, shimadzu corporation, japan) at 290 nm . The in vitro release of moxifloxacin hydrochloride from the prepared formulations was studied using a modified diffusion testing apparatus . The freshly prepared simulated tear fluid (ph 7.4) was used as a diffusion medium . Semi permeable membrane, previously soaked in the diffusion medium for overnight, was tied to one end of a specially designed glass cylinder (open at both ends) having inner diameter of 3.4 cm . Two milliliter of formulation was accurately pipette into the glass cylinder known as donor chamber . The cylinder was suspended in a beaker (acceptor chamber) containing 100 ml of diffusion medium so that the membrane just touches the surface of the medium . Acceptor chamber was maintained at a temperature of 37 2c with a stirring rate of 50 rpm using magnetic stirrer . About 1 ml of sample was withdrawn at a time interval of 1 hour and replaced with an equal volume of fresh diffusion medium . The aliquots were diluted with the diffusion medium and analyzed at 290 nm using uv spectrophotometer . In a similar manner, 2 ml of pure drug solution (0.5% w / v in distilled water) and 2 ml marketed product (milflox) were studied in a similar manner . The standard minimum inhibitory concentration (mic 2 g / ml) of control and developed formulations containing moxifloxacin were prepared . A total of 60 ml of nutrient agar media was prepared and sterilized at 15 lb / sq - inch pressure for 18 minutes in an autoclave; 0.5 ml of microorganism suspension was poured into the above medium which is maintained at temperature of 52c to 58c . After solidification of the media, sterile solutions of moxifloxacin hydrochloride (standard solutions) and the developed formulations diluted suitably with sterile distilled water (test solutions) were poured in to the cup of sterile nutrient agar petri plates . This was previously seeded with test organisms (escherichia coli and staphylococcus aureus). After allowing diffusion of the solutions for 2 hours the zone of inhibition (zoi) was measured around each cup and compared with that of control . Ocular irritation study was performed on optimized formulation in four albino rabbits (male), each weighing about 2 to 3 kg, and 0.1 ml of the optimized sterile moxifloxacin hydrochloride formulation was instilled in to cul - de - sac twice a day for a period of 14 days . Sterile optimized ophthalmic formulation was filled in glass vials, closed with gray butyl rubber closures and sealed with an aluminium caps . The vials contain optimized formulation were kept in stability chamber, maintained at 40 2c and 75 5% rh for one month . Samples were withdrawn weekly and estimated for drug content, ph, visual appearance, gelling capacity and in vitro drug release . The polymeric solution was prepared by dispersing required quantity of sodium alginate as main polymer and hpmc- e 50 lv, hpmc- k4 m as co - polymers in water using a magnetic stirrer until the polymers completely dissolve . Aqueous solution of moxifloxacin hydrochloride was added in to the polymeric solution with continuous stirring . The ph of the solution was adjusted to 6.5 using 0.1 n naoh/0.1 n hcl . The in situ gel formulations are depicted in table 1 . Formulation design of in situ gelling system the formulated in situ gel solution was tested for clarity, ph, gelling capacity, and drug content estimation . The gelling capacity of the prepared formulation was determined by placing a drop of the formulation in a vial containing 2 ml of freshly prepared simulated tear fluid and visually observed . The time taken for its gelling was noted . The samples were analyzed at 37c 0.5c by a circulating bath connected to the viscometer adaptor prior to each measurement. [710] the angular velocity of the spindle was increased 1 to 4 and the viscosity of the formulation was measured . The drug content estimation was carried out by diluting 1 ml of prepared formulation in 100 ml of distilled water and analyzed using uv - visible spectrophotometer (shimadzu uv-1700 pc, shimadzu corporation, japan) at 290 nm . The in vitro release of moxifloxacin hydrochloride from the prepared formulations was studied using a modified diffusion testing apparatus . The freshly prepared simulated tear fluid (ph 7.4) was used as a diffusion medium . Semi permeable membrane, previously soaked in the diffusion medium for overnight, was tied to one end of a specially designed glass cylinder (open at both ends) having inner diameter of 3.4 cm . Two milliliter of formulation was accurately pipette into the glass cylinder known as donor chamber . The cylinder was suspended in a beaker (acceptor chamber) containing 100 ml of diffusion medium so that the membrane just touches the surface of the medium . Acceptor chamber was maintained at a temperature of 37 2c with a stirring rate of 50 rpm using magnetic stirrer . About 1 ml of sample was withdrawn at a time interval of 1 hour and replaced with an equal volume of fresh diffusion medium . The aliquots were diluted with the diffusion medium and analyzed at 290 nm using uv spectrophotometer . In a similar manner, 2 ml of pure drug solution (0.5% w / v in distilled water) and 2 ml marketed product (milflox) were studied in a similar manner . The drug was allowed to diffuse through a solid agar medium . The standard minimum inhibitory concentration (mic 2 g / ml) of control and developed formulations containing moxifloxacin were prepared . A total of 60 ml of nutrient agar media was prepared and sterilized at 15 lb / sq - inch pressure for 18 minutes in an autoclave; 0.5 ml of microorganism suspension was poured into the above medium which is maintained at temperature of 52c to 58c . After solidification of the media, sterile solutions of moxifloxacin hydrochloride (standard solutions) and the developed formulations diluted suitably with sterile distilled water (test solutions) were poured in to the cup of sterile nutrient agar petri plates . This was previously seeded with test organisms (escherichia coli and staphylococcus aureus). After allowing diffusion of the solutions for 2 hours the zone of inhibition (zoi) was measured around each cup and compared with that of control . Ocular irritation study was performed on optimized formulation in four albino rabbits (male), each weighing about 2 to 3 kg, and 0.1 ml of the optimized sterile moxifloxacin hydrochloride formulation was instilled in to cul - de - sac twice a day for a period of 14 days . Sterile optimized ophthalmic formulation was filled in glass vials, closed with gray butyl rubber closures and sealed with an aluminium caps . The vials contain optimized formulation were kept in stability chamber, maintained at 40 2c and 75 5% rh for one month . Samples were withdrawn weekly and estimated for drug content, ph, visual appearance, gelling capacity and in vitro drug release . In the present investigation, efforts were made to prepare the sustained release moxifloxacin hydrochloride in situ gel forming ophthalmic solution using polymers such as sodium alginate and hpmc . Sodium alginate a novel ophthalmic gel - forming mucoadhesive polymer, which gets converted to gel in the presence of divalent - cations (calcium ion) present in the lachrymal fluid (ph 7.4), was used as the gelling agent . The prepared in situ gel formulations were evaluated for clarity, ph measurement, gelling capacity, drug content estimation, rheological study, in vitro diffusion study . The ph of in situ gel solution was found to be around 6.5 for all the formulations . The formulation should have an optimum viscosity that will allow for easy instillation into the eye, which would undergo a rapid sol to gel transition (triggered by ion exchange) as shown in table 2 . Rheological evaluation of all the formulation exhibited newtonian flow before gelling and exhibited pseudoplastic flow after gelling in the eye . Additionally, the gel formed in situ should maintain its integrity without dissolving or eroding for a prolonged period . Rheological studies of formulations formulations f1 to f6 (before gelling) formulations f1 to f6 (after gelling) from the in vitro results it was observed that percentage release of the drug from the developed formulations f1 (93.86%), f2 (92.78%), f3 (89.97%), f4 (82.80%), f5 (80.49%), and f6 (78.71%) as shown in figure 3 . This could be the reason of higher concentration of sodium alginate and hpmc k4 m among the developed formulations . By observing the drug release profile it can be conclude that release is not stagnant even end of 10 hours . Formulation f6 showed highest zone of inhibition values against s. aureus (28.66 mm) and e. coli (30.99 mm), respectively, compared to other developed formulations . Comparative in vitro diffusion profile of pure drug, marketed product and f1 to f6 formulations antimicrobial efficacy study was performed on f6 formulation using gram + ve s. aureus and gram -ve e. coli organism . The zone of inhibition of f6 ophthalmic formulation found to be 28.66 and 30.99 mm, respectively, for gram + ve s. aureus and gram -ve e. coli organism . The study indicated moxifloxacin hydrochloride retained its antimicrobial activity when formulated as gel forming ophthalmic system against both selected s. aureus and e. coli . Zone of inhibition values of formulation f1 to f6 and pure drug at the concentration of 2 g / ml against staphylococcus aureus and escherichia coli ocular irritation study was performed using healthy albino rabbits after getting prior permission from the institutional animal ethics committee . The eyes of each rabbits were examined at particular time interval after instillation of the optimized formulation (f6). No ocular damage or abnormal clinical signs to the cornea, iris or conjunctiva were visible . The result of ocular irritation studies indicates that formulations containing all ingredients are non - irritant to rabbit eye . Accelerated stability studies were carried out at 40 2c at 75 5% rh for 1 month using stability chamber . The samples were analyzed periodically on every week, and found that there are no changes in visual appearance, clarity, ph, and gelation . Assay values after 1 month of storage are found almost same (deviating not more than one percent). Moxifloxacin hydrochloride, a broad spectrum antibacterial agent used in the treatment of ocular infections, was successfully formulated as in situ gel - forming eye drops using sodium alginate as a gelling agent in combination with hpmc as a viscosity enhancing agent . Thus, the developed formulation is a viable alternative to conventional eye drops by virtue of its ability to enhance bioavailability through its longer precorneal residence time and ability to sustain drug release . Also important is the ease of administration afforded and decreased frequency of administration resulting in better patient acceptance.
Neurofibromatosis affects 1:3,000 individuals, and characterized by largely benign but often debilitating tumors that grow in the nervous system . Its course is unpredictable: it can cause a variety of benign nerve tumors including plexiform, dermal, and optic glioma tumors; in some cases malignant peripheral nerve sheath tumors can develop in the plexiform tumours . Down's syndrome is one of the most common and easily recognized genetic conditions in humans . The estimated prevalence in the united states is approximately 15 per 10,000 live births (ie, 1 out of every 700) most often, it is the result of nondisjunction on chromosome 21 during maternal meiotic division . We herein present the case of a 17-year - old boy with complaints of skin lesions over the back associated with mild itching since 3 months . He was a known case of down's syndrome with a history of seizures in childhood [figure 1]. The lesions gradually increased in size and number, and similar lesions started developing over his forehead since 23 weeks . On examination, multiple skin colored papules of varying size were present over the entire back and the forehead . Velvety thickening of the skin and hyperpigmentation of the axillae suggestive of acanthosis nigricans was present . The characteristic features of down's syndrome, including simian crease, mongoloid facies, and mental retardation were present . Canities and a solitary keloid over the chest were also seen apart from the clinical features of down's syndrome . On oral examination, scrotal tongue, abnormal dentition, and other investigations such as ct scan brain, 2d echo, and ecg were normal . Histopathology of the nodule from the back revealed focally thinned out epidermis with intact basal layer; the papillary dermis showed a mild perivascular infiltrate . Deeper dermis showed a benign spindle cell proliferation suggestive of neurofibromatosis [figure 3]. Physical appearance of down's syndrome (a) neurofibromas (b) sebaceous cyst (c) acanthosis nigricans, and axillary freckling (d) scrotal tongue focally thinned out epidermis with intact basal layer with the papillary dermis showing a mild perivascular infiltrate . The presentation of a patient with two unrelated genetic disorders is uncommon, although not statistically impossible . However, in two of these reports, a third medical condition was also present . In one report, breast cancer was reported . In the other, our patient had down's syndrome, neurofibromatosis, dental anomalies, and ocular defects and keloids . In the large majority of cases, trisomy 21 there is no current evidence to support the idea that this is anything other than a chance occurrence . The two conditions are not related, and the likelihood of a person being born with these two conditions is approximately 1 in 2,700,000 births . They however overlap in their manifestations . Both are associated with intellectual impairment to differing degrees . Macroglossia occurs in both conditions, as may facial, dental, and occlusal abnormalities . Hearing and speech are affected in both conditions, as may the ability to maintain an acceptable level of oral hygiene . Mutations in the gene results in abnormal control of cell growth, differentiation, and aberrant myelination . Our patient with of neurofibrmatosis type 1 with down's syndrome is the first such to have a keloid and sebaceous cyst apart from myopia and dental anomalies . The unpredictable nature and course of the two genetic disorders along with multiple acquired conditions in this patient make it difficult for patients, teachers, care givers, and medical / dental providers to create and maintain long - term care plans . The authors certify that they have obtained all appropriate patient consent forms . In the form the patient(s) has / have given his / her / their consent for his / her / their images and other clinical information to be reported in the journal . The patients understand that their names and initials will not be published and due efforts will be made to conceal their identity, but anonymity cannot be guaranteed . The authors certify that they have obtained all appropriate patient consent forms . In the form the patient(s) has / have given his / her / their consent for his / her / their images and other clinical information to be reported in the journal . The patients understand that their names and initials will not be published and due efforts will be made to conceal their identity, but anonymity cannot be guaranteed.
Micropolar fluids are those fluids consisting of randomly oriented particles suspended in a viscous medium, which can undergo a rotation that can affect the hydrodynamics of the flow, making it a distinctly non - newtonian fluid . They constitute an important branch of non - newtonian fluid dynamics where microrotation effects as well as microinertia are exhibited . Modelling and analysis of the dynamics of micropolar fluids have been the field of very active research due to their application in a number of processes that occur in chemical, pharmaceutical, and food industry . Such applications include the extrusion of polymer fluids, solidification of liquid crystals, cooling of a metallic plate in a bath, animal bloods, exotic lubricants, and colloidal and suspension solutions, for example, for which the classical navier - stokes theory is inadequate . The essence of the theory of micropolar fluids lies in the extension of the constitutive equations for newtonian fluids so that more complex fluids can be described by this theory . In this theory, rigid particles contained in a small fluid volume element are limited to rotation about the centre of the volume elements described by microrotation vector . It is well known that heterogeneous mixtures, such as ferro liquids, colloidal fluids, most slurries, and suspensions, are some liquids with polymer activities which behave differently from newtonian fluids . The main difference is that these types of fluids have a microstructure and exhibit microrotational effects and can support surface and body couples which are not present in the theory of newtonian fluids . In order to study such types of fluids eringen developed the theory of microfluids which include the effect of local rotary inertia, the couple stress, and inertial spin . This theory is expected to be successful in analyzing the behavior of non - newtonian fluids . Eringen also developed the theory of micropolar fluids for the case where only microrotational effects and microrotational inertia exist . He extended the theory of thermomicropolar fluids and derived the constitutive law for fluids with microstructure . An excellent review of micropolar fluids and their applications was given by ariman et al . . In view of lukaszewicz, micropolar fluids represent those fluids which consist of randomly oriented particles suspended in a viscous medium . Several authors have studied the characteristic of the boundary layer flow of micropolar fluid under different boundary conditions . Takhar and soundalgekar [6, 7] studied the flow and heat transfer of micropolar fluid past a porous plate . Further, they [8, 9] discussed these problems past a continuously moving porous plate . Often experimental and analytical investigations of free convection flows are carried out by the researchers, since in many situations in technology and nature, one continually encounters masses of fluid arising freely in an extensive medium due to the buoyancy effects . [10, 11] investigated the natural convection from a heated vertical plate in micropolar fluid . The problem of flow and heat transfer for a micropolar fluid past a porous plate embedded in a porous medium has been of great use in engineering studies such as oil exploration and thermal insulation . Raptis and takhar and kim have considered the micropolar fluid through a porous medium . All the above mentioned studies are limited only to applications where radiative heat transfer is negligible . The role of thermal radiation in the flow heat transfer process is of great relevance in the design of many advanced energy conversion systems operating at higher temperatures . Thermal radiation within these systems is usually the result of emission by hot walls and the working fluid . Nuclear power plants, gas turbines, and the various propulsion devices for aircraft, missiles, satellites, and space vehicles are examples of such engineering areas . Perdikis and raptis illustrated the heat transfer of a micropolar fluid in the presence of radiation . Raptis studied the effect of radiation on the flow of a micropolar fluid past a continuously moving plate . Recently, elbashbeshy and bazid and kim and fedorov have reported on the radiation effects on the mixed convection flow of micropolar fluid . Makinde examined the transient free convection interaction with thermal radiation of an absorbing emitting fluid along moving vertical permeable plate . Rahman and sattar studied transient convective flow of micropolar fluid past a continuous moving porous plate in the presence of radiation . Moreover, when the radiative heat transfer takes place, the fluid involved can be electrically conducting in the sense that it is ionized owing to high operating temperature . Accordingly, it is of interest to examine the effect of the magnetic field on the flow . Thermal radiation effects on hydromagnetic natural convection flow with heat and mass transfer play an important role in manufacturing processes taking place in industries for the design of fins, glass production, steel rolling, casting and levitation, furnace design, and so forth . The process of fusing of metals in an electrical furnace by applying a magnetic field and the process of cooling of the first wall inside a nuclear reactor containment vessel where the hot plasma is isolated from the wall by applying a magnetic field are examples of such fields where thermal radiation and magnetohydrodynamics (mhd) are correlative . This fact was taken into consideration by abd - el aziz in his study on micropolar fluids . Raptis and massalas studied magnetohydrodynamic flow past a plate by the presence of radiation . The rotating flow of an electrically conducting fluid in presence of magnetic field has got its importance in geophysical problems . Investigation of hydromagnetic natural convection flow in a rotating medium is of considerable importance due to its application in various areas of geophysics, astrophysics, and fluid engineering, namely, maintenance and secular variations in earth's magnetic field due to motion of earth's liquid core, internal rotation rate of the sun, structure of the magnetic stars, solar and planetary dynamo problems, turbo machines, rotating mhd generators, rotating drum separators for liquid metal mhd applications, and so forth . It may be noted that coriolis and magnetic forces are comparable in magnitude and coriolis force induces secondary flow in the flow - field . Changes that take place in the rotation suggest the possible importance of hydromagnetic spin - up . Taking into consideration the importance of such study, unsteady hydromagnetic natural convection flow past a moving plate in a rotating medium mention maybe made of research studies of singh, raptist and singh, tokis, nanousis, and singh et al . . This problem of spin - up in magnetohydrodynamic rotating fluids has been discussed under varied conditions by takhar et al . . The study of heat and mass transfer due to chemical reaction is also very importance because of its occurrence in most of the branches of science and technology . The processes involving mass transfer effects are important in chemical processing equipment which is designed to draw high value products from cheaper raw materials with the involvement of chemical reaction . Ibrahim and makinde investigated radiation effect on chemically reactive mhd boundary layer flow of heat and mass transfer past a porous vertical flat plate . Babu and satya narayan examined chemical reaction and thermal radiation effects on mhd convective flow in a porous medium in the presence of suction . Das and sivaiah investigated studied the effect of chemical reaction and thermal radiation on heat and mass transfer flow of mhd micropolar aid in a rotating frame of reference . Convection problems associated with heat sources within fluid - saturated porous media are of great practical significance in geophysics and energy - related problems, such as recovery of petroleum resources, cooling of underground electric cables, storage of nuclear waste materials groundwater pollution, fiber and granular insulations, chemical catalytic reactors, and environmental impact of buried heat generating waste . [32, 33] presented an analysis on mhd free convection and mass transfer adjacent to moving vertical plate for micropolar fluid in a rotating frame of reference in presence of heat generation / absorption and a chemical reaction using perturbation technique . Babu and narayana analyzed unsteady free convection with heat and mass transfer flow for a micropolar fluid through a porous medium with a variable permeability bounded by a semi - infinite vertical plate in the presence of heat generation, thermal radiation and first - order chemical reaction . The current development of magnetohydrodynamics application is toward a strong magnetic field (so that the influence of electromagnetic force is noticeable) and toward a low density of the gas (such as in space flight and in nuclear fusion research). Under this condition the rotating flow of an electrically conducting fluid in the presence of a magnetic field is encountered in cosmic fluid dynamics, medicine and biology . Mhd was pioneered cowling and he emphasized that when the strength of the applied magnetic field is sufficiently large, ohm's law needs to be modified to include hall current . The hall effect is merely due to the sideways magnetic force on the drafting free charges . The electric field has to have a component transverse to the direction of the current density to balance this force . In many works of plasma physics, much attention is not paid to the effect caused due to hall current . However, the hall effect cannot be completely ignored if the strength of the magnetic field is high and the number of density of electrons is small as it is responsible for the change of the flow pattern of an ionized gas . Hall effect results in a development of an additional potential difference between opposite surfaces of a conductor for which a current is induced perpendicular to both the electric and magnetic field ., saha et al ., and ahmed et al . Have presented some model studies on the effect of hall current on mhd convection flow because of its possible application in the problem of mhd generators and hall current . Preeti and chaudhary analyzed an unsteady hydromagnetic flow of a viscoelastic fluid from a radiative vertical porous plate, taking the effects of hall current and mass transfer into account . Studied the heat and mass transfer in unsteady free convection flow with radiation absorption past an impulsively started infinite vertical porous plate subjected to strong magnetic field including the hall effect . Investigated the simultaneous effects of hall current and free stream velocity on the magneto hydrodynamic flow over a moving plate in a rotating fluid . Recently, seth et al . Investigated the problem of an unsteady mhd free convective flow past an impulsively started vertical plate with ramped temperature immersed in a porous medium with rotation and heat absorption taken into account the hall effect . When heat and mass transfer occur simultaneously in a moving fluid, the relations between the fluxes and the driven potential are important . It has been found that an energy flux can be generated not only by temperature gradients but by composition gradient as well . The energy caused by a composition gradient is called the dufour or the diffusion - thermo effect, also the mass fluxes can also be caused by the temperature gradient and this is called the soret or thermal diffusion effect; that is, if two regions in a mixture are maintained at different temperatures so that there is a flux of heat, it has been found that a concentration gradient is set up and in a binary mixture, one kind of a molecule tends to travel toward the hot region and the other kind toward the cold region . The dufour effect is neglected in this study because it is of a smaller order of magnitude than the magnitude of thermal radiation which exerts a stronger effect on the energy flux . Soret or thermal diffusion effect has been utilized for isotope separation in mixtures between gases with very light molecular weight (h2, he) and medium molecular weight (n2, air) and it was found to be of a magnitude that it cannot be neglected due to its practical applications in engineering and sciences . Soret effects due to natural convection between heated inclined plates have been investigated by raju et al . . M. g. reddy and n. b. reddy investigated soret and dufour effects on steady mhd free convective flow past an infinite plate . Mohamed studied unsteady mhd flow over a vertical moving porous plate with heat generation and soret effect . Practically, in many engineering applications, the particle adjacent to a solid surface no longer takes the velocity of the surface . The particle at the surface has a finite tangential velocity; it slips along the surface . This flow regime is called the slip - flow regime and this effect cannot be neglected . The fluid slippage phenomenon at the solid boundaries appear in many applications such as microchannels or nanochannels and in application where a thin film of light oils is attached to the moving plates or when the surface is coated with special coating such as thick monolayer of hydrophobic octadecyltrichlosilane, that is, lubrication of mechanical device, where a thin film of lubricant is attached to the surface slipping over one another or when the surfaces are coated with special coating to minimize the friction between them . Chaudhary and jain examined the effects of radiation on the hydromagnetic free convection flow set up due to temperature as well as species concentration of an electrically conducting micropolar fluid past a vertical porous plate through porous medium in slip - flow regime . Chaudhary and sharma [49, 50] studied the free convection flow past a vertical porous plate with variable suction in slip - flow regime . Have considered the magnetohydrodynamic unsteady flow of a viscous stratified fluid through a porous medium past a porous flat moving plate in the slip flow regime with heat source . Singh and kumar presented the fluctuating heat and mass transfer on unsteady free convection flow of radiating and reacting fid past a vertical porous plate in slip flow regime using perturbation analysis . Kumar and chand have studied the effect of slip conditions and the hall current on unsteady mhd flow of a viscoelastic fluid past an infinite vertical porous plate through porous medium . Recently, oahimire et al . Investigated the effects of thermal - diffusion and thermal radiation on unsteady heat and mass transfer by free convective mhd micropolar fluid flow bounded by a semi - infinite vertical plate in a slip - flow regime under the action of transverse magnetic field with suction . To the best of our knowledge, considerably less work has been done concerning the combined effect of hall current and soret effect on chemically reactive magnetomicropolar fluid flow incorporating the effect of rotation in slip flow regime in the presence of radiation and heat absorption . The results are in accordance with the physical realities which validate the correctness of our work presented here . Consider an unsteady hydromagnetic flow of an incompressible, viscous, and electrically conducting micropolar fluid past an infinite vertical permeable plate embedded in a uniform porous medium in slip - flow regime and in a rotating system taking hall current, thermal radiation, soret effect, and chemical reaction into account . The coordinate system is chosen in such a way that x - axis is considered along the porous plate in vertically upward direction, y - axis is taken along the width of the plate, and z - axis normal to the plane of the plate in the fluid as shown in figure configuration (figure 1). Since the plate is infinite in extent in x- and y- directions, hence all physical quantities will be independent of x and y and they are functions of z and t only; that is, u/x = u/y = v/x = v/y = 0, and so forth . A magnetic field of uniform strength b0 is applied in a direction parallel to z - axis which is perpendicular to the flow direction . It is assumed that the induced magnetic field generated by fluid motion is negligible in comparison to the applied one . This assumption is justified because magnetic reynolds number is very small for liquid metals and partially ionized fluids which are commonly used in industrial applications . It is assumed that there is no applied or polarized voltage so the effect of polarization of fluid is negligible . This corresponds to the case where no energy is added or extracted from the fluid by electrical means . The entire system is rotating with an angular velocity about the normal to the plate . It is assumed here that the hole size of the porous plate is significantly larger than the characteristic microscopic length scale of the porous medium . The fluid is considered to be a gray, absorbing - emitting but nonscattering medium and the rosseland approximation is used to describe the radiative heat flux . The radiative heat flux in the x - direction is considered negligible in comparison with that of z - direction . When the strength of the magnetic field is very large, the generalized ohm's law in the absence of electric field takes the following form: (1)j+eeb0jh=evh+1enepe . Under the assumption that the electron pressure (for weakly ionized gas), the thermoelectric pressure and ion - slip conditions are negligible; now the above equation becomes (2)jx=eh01+m2mvu, jz=eh01+m2mu+v, where u is the x - component of v, v is the y - component of v, and m (= ee) is hall parameter . The suction velocity is assumed to be w = w0(1 + aet with these foregoing assumptions, the governing equations under boussinesq approximation can be written in a cartesian frame of reference as follows consider the following: (4)ut+wuz2v = +r2uz2+gttt+gccc ukr2z+e2h02mvu1+m2,vt+wvz+2u = +r2vz2uk+r1ze2h02mu+v1+m2 . Consider the following: (7)ct+wcz=dm2cz2+dmkttm2tz2rccc. The initial and boundary conditions suggested by the physics of the problem are (8)u=v=0, 1=2=0,t = t, c=ckkkkkkkkkkkkkkikkfor t0,(9)u=ur+luz, v=0,1=12vz, 2=12uz,t = tw, c=cwikkkkkkkkkkkkkkkkkkkat z=0u0, v0, 10,20, tt, ccikkkkkkkkkkkkkkkkkkkkkias zikkkkkkkkkkkkkkkkkkkkkkikfor t>0 . The boundary condition for microrotation components 1 and 2 describes its relationship with the surface stress . In the above boundary condition (9) the plate is in uniform motion and subjected to variable suction and slip boundary condition . In the parameter l = ((2 m1)/m1)l, l is the molecular mean free path and m1 is the tangential momentum accommodation coefficient . Integration of continuity equation (3) for variable suction velocity normal to the plate gives (10)w=w01+aet, where w0 represents the normal velocity at the plate which is positive for suction and negative for blowing . The radiative heat flux term by using rosseland approximation is given by (11)qr=43art4z. We assume that the temperature differences within the flow are such that t may be expressed as a linear function of the temperature t. this is accomplished by expanding t in a taylor series about t and, neglecting higher - order terms, we have (12)t44t3t3t4 . By using (11) and proceeding with analysis, we introduce the following dimensionless variables: (14)u = uur, v = vur, z = zur,t = tur2, =ur2, 1=1ur2, 2=2ur2,gr=gttwtur3, gc=gccwcur3,r=2ur2, s = w0ur, =r,=tttwt, c = cccwc, k = kur22,m=eh0ur, =j, pr=cpk, sc=dm, f=4t3kar, q = q2ur2k, sr = dmkttwttmcwc, =rcur2, h = lur. In view of (14), the governing equations (4)(7) and (13) reduce to the following dimensionless form: (15)uts1+aetuzrv = 1+2uz2+gr+gmm21+m2 + 1ku 2z+mm21+m2v,(16)vts1+aetvz+ru = 1+2vz2m21+m2 + 1kv+1zmm21+m2u,(17)1ts1+aet1z=21z2,(18)2ts1+aet2z=22z2,(19)ts1+aetz=1pr1 + 4f32z2qpr,(20)cts1+aetcz=1sc2cz2+sr2cz2c . The boundary conditions (8)-(9) in view of (14) are then given by the following dimensionless form: (21)u = v=0, 1=2=0, =0, c=0kkkkkkkkkkkkkkkkkkkkkkkkkkkkkfor t0u=1+huz, v=0, 1=12vz,2=12uz, =1, c=1kkkkkkkkkkkkkkkkkkkkkkkkkat z=0u0, 10, 20,0, c0kkkkkkkkkkkkkkkkkkkkas zkkkkkkkkkkkkkkkkkkkkkkkfor t>0 . To simplify (15)(18), we substitute the fluid velocity and angular velocity in the complex form as v = u + iv, = 1 + i2 and we get (22)vts1+aetvz+irv = 1+2vz2+gr+gmm21+m2 + 1kv izimm21+m2v,ts1+aetz=2z2 . The associated boundary conditions (21) become (23)v=0, =0, =0, c=0kkkkkkkkkkkkikkkkkkkkkkfor t0v=1+huz, =i2vz, =1, c=1kkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkiat z=0v0, 0, 0, c0kkkkkkkkkkkkkkkkkkikkkkkkkkkkas zkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkfor t>0 . In order to reduce the above system of partial differential equations to a system of ordinary differential equations in dimensionless form, we represent the translational velocity v, microrotation velocity, temperature, and concentration c as (24)vz, t = v0z+etv1z+o2,z, t=0z+et1z+o2,z, t=0z+et1z+o2,cz, t = c0z+etc1z+o2 . By substituting the above equations (24) into (19), (20), (22)-(23) and equating the harmonic and nonharmonic terms and neglecting the higher - order terms of o(), we obtain the following pairs of equations for (v0, 0, 0, c0) and (v1, 1, 1, c1). Zero - order equations are: (25)1+v0+sv0a1v0+gr0+gmc0+i0=0,0+s0=0,3 + 4f0+3prs03q0=0,c0+sscc0scc0=sr0. First - order equations are: (26)1+v1+sv1a2v1+gr1+gmc1 + av0+i1=0,1+s11=sa0,3 + 4f1+3prs13q+pr1 = 3prsa0,c1+sscc1sc+c1=sscac0srsc1. The prime denotes differentiation with respect to y. the corresponding boundary conditions can be written as (27)v0=1+hv0z, v1=hv1z,0=i2v0z, 1=i2v1z,0=1, 1=0, c0=1, c1=0 at z=0v00, v10, 00,10, 00, 10,c00, c10kkkkkkkkkkkas z. solving (25)-(26) satisfying the boundary conditions (27) we obtain the expression for translational velocity v, microrotation velocity, temperature, and concentration c as (28)vz, t = b11er5z+b8er1z+b9er3z+b10es/z+etb20er7z+b13er1z+b17er5z+b18es/z+b19er6z + b14er2z+b15er4z+b16er3z + b17er5z+b18es/z+b19er6z,(29)z, t = d1es/z+etd2er6z+b12es/z,(30)z, t = er1z+etb1er1zer2z,(31)cz, t = b3er3z+b2er1z+etb4er3z+b5er1z + b6er2z+b7er4z . The exponential indices and the coefficients appearing in (28)(31) are given in the appendix . In technological applications, the wall shear stress, the wall couple stress, and the heat and mass transfer rate are often of great interest . The skin friction coefficient (cf) at the wall in dimensionless form is given by (32) cf=wz=0ur2=1+1+i2vzz=0(33) = 1+1+i2 b11r5+b8r1+b9r3+b10s+b17r5+b18s+b19r6 + etb20r7+b13r1+b17r5+b18s+b19r6 + b14r2+b15r4+b16r3 + b17r5+b18s+b19r6 . The couple stress coefficient (cm) at the plate is defined by (34)mw=zz=0 and in the dimensionless form it is given by (35)cm = mwjur=1+2zz=0=1+21zz=0+i2zz=0=1+2d1s+etd2r6+b12s. Knowing the temperature field, it is interesting to study the effect of the free convection and thermal radiation on the rate of heat transfer and this is given by (36)qw=ktz43art4zz=0 . Using t4tt 3t the above equation becomes (37)qw=ktwtur1 + 4f3zz=0 . The rate of heat transfer between the fluid and the plate is studied in terms of nondimensional nusselt number, which is given by (38)nu = xqwktwt=rex1 + 4f3zz=0, where rex = urx/ is the local reynolds number (39)nurex1=1 + 4f3zz=0=1 + 4f3r1+etb1r1r2 . The definitions of the local mass flux and the local sherwood number are, respectively, given by (40)jw=dmczz=0,shx = jwxdmcwc=rexczz=0,shxrex1=czz=0=b3r3+b2r1+etb4r3+b5r1+b6r2+b7r4 . In the preceding sections, the governing equations along with the boundary conditions are solved analytically employing the perturbation techniques . The effects of main controlling parameters as they appear in the governing equations are discussed on the temperature, concentration c, translational velocity v, microrotation, skin - friction cf, nusselt number, and sherwood number . In order to get a physical insight of the problem the above physical quantities are compiled numerically and displayed graphically . In the entire calculations we have chosen = 0.01, = 0.1, t = 1 and a = 1 while pr, s, f, q, sr, sc, m, m, gr, gm, r, h, k,, and are varied over the range which are listed in the figure legends . The numerical values of fluid temperature computed from the analytical solutions (29) are illustrated graphically versus boundary layer coordinate z in figure 2 for various values of prandtl number (pr), suction parameter (s), heat absorption parameter (q), and radiation parameter (f). The values of prandtl number are chosen as pr = 0.71, 0.025, and 7.0 which physically correspond to air, mercury, and water at 25 temperature and one atmospheric pressure . It is inferred that the temperature falls more rapidly for water in comparison to air which is physically true thus the thermal boundary layer falls quickly for large value of prandtl number . The thickness of thermal boundary layer is greatest for pr = 0.025 (mercury) than for pr = 0.71 (air), thereafter for pr = 7 (water) and finally the lowest for pr = 11.62 (water at 4c); that is, an increase in prandtl number results in a decrease of temperature . The reason underlying such a behavior is that pr signifies the relative effects of viscosity to thermal conductivity and smaller values of prandtl number possess high thermal conductivity and therefore heat is able to diffuse away from the surface faster than at higher values of pr . The fluid temperature also decreases with an increase of heat absorption parameter (q) and suction parameter (s). The temperature decreases with an increase in the heat absorption parameter because when heat is absorbed the buoyancy forces decrease the temperature profiles . The effect of thermal radiation parameter (f) is to enhance the fluid temperature throughout the boundary layer region . This is consistent with the fact that thermal radiation provides an additional means to diffuse energy because thermal radiation parameter f = 4t/kar and therefore an increase in f implies a decrease in rosseland mean absorption coefficient ar for fixed values of t and k. thus it is pointed out that radiation should be minimized to have the cooling process at a faster rate . The temperature profiles attain their maximum value at the wall and decrease exponentially with z and finally tend to zero as z . Hence the accuracy is checked and it validates that the analytical results for temperature is correct . Graphical results of concentration profiles c for different values of schmidt number (sc) and chemical reaction parameter () are displayed in figure 3(a). The values of schmidt number are chosen to represent the most common diffusing chemical species which are of interest and they are sc = 0.22 (hydrogen), sc = 0.3 (helium), sc = 0.6 (water vapor), sc = 0.94 (carbon dioxide) and sc = 2.62 (propylbenzene) at 25c temperature and one atmospheric pressure . A comparison of curves in the figure show the concentration distribution decreases at all points in the flow field with an increase in schmidt number because smaller values of sc are equivalent to increasing chemical molecular diffusivity (d). This shows that the heavier diffusing species have a greater retarding effect on the concentration distribution . Furthermore, it is interesting to note that concentration profiles fall slowly and steadily for hydrogen (sc = 0.22) and helium (sc = 0.30) but falls very rapidly for water vapor (sc = 0.6) and propylbenzene (sc = 2.62). Physically this is true because of the fact that the water vapor can be used for maintaining normal concentration field whereas hydrogen can be used for maintaining effective concentration field . Similar effects are seen in the case when chemical reaction parameter () is increased . Further, this figure clearly demonstrates that the concentration profiles decrease rapidly when chemical reaction parameter is increased this is due to the fact that boundary layer decreases with an increase in the value of in this system, results in the consumption of the chemical and hence result in decreasing concentration profile . The effects of heat absorption parameter (q) and soret number (sr) on concentration profiles across the boundary layer are displayed in figure 3(b). The results show that concentration boundary layer suppresses with an increase in heat absorption parameter and soret number . The profiles fall rapidly with an increase of soret number and thereafter increase and tend to zero as z . Figure 3(c) is plotted to show the effects of radiation parameter (f) and suction parameter (s) on the species concentration profiles . It is revealed that the presence of suction parameter diminishes the concentration distribution whereas reverse phenomena are observed with increasing values of radiation parameter . In figures 3(a)3(c) the concentration profiles attain their maximum value at the wall and decrease exponentially with z and finally tend to zero as z . Hence it is found to be in good agreement with boundary condition given in (23). Moreover these figures provide a check of our analytical solution for the concentration field . The microrotation profiles () against span wise coordinate z incorporating the effect of various parameters influencing the flow field are demonstrated in figures 4(a)4(h). It is revealed from figures 4(a)4(h) that these profiles attain a distinctive maximum value near surface of the plate and decrease properly on increasing boundary layer coordinate z to approach free stream value . Figure 4(a) shows the influence of prandtl number (pr), suction parameter (s) and radiation parameter (f) on microrotation profiles . Physically, it is true due to the fact that an increase in prandtl number increase the viscosity of the fluid, so the fluid becomes thick and consequently leads to a decrease in velocity . This figure further indicates that the microrotation profiles decrease with an increase in suction parameter (s) because sucking decelerates the fluid particles through the porous wall and hence reduce the growth of the fluid boundary layer as well as thermal and concentration boundary layers . Indicating the usual fact that suction stabilizes the boundary layer growth . This is because when the intensity of heat generated through thermal radiation increases, the bond holding the components of the fluid particle is easily broken and the fluid velocity will increase . From figure 4(b) it is perceived that microrotation profiles decrease with an increase in heat absorption parameter (q). Figure 4(c) elucidates the influence of magnetic parameter (m) and hall parameter (m) on microrotation profiles (); it is clear from these curves that these profiles increase when magnetic parameter and hall current parameter are increased . The profiles corresponding to m = 0 reveals that microelements close to the wall are unable to rotate; hence, is very small . Figure 4(d) demonstrates the effect of thermal and concentration buoyancy forces, that is, grashof number (gr) and modified grashof number (gm) on the microrotation profiles . Here the negative value of grashof number (gr <0), physically, corresponds to heating of the plate while the positive value (gr> 0) represents cooling of the plate . Hence, it is observed from the comparison of the curves that an increase in thermal grashof number leads to an increase in the velocity due to an enhancement in buoyancy forces . An increase in grashof number indicates small viscous effects in the momentum equation and consequently causes an increase in the velocity profiles . Furthermore, the comparison of the curves illustrates that velocity increases with increasing gm . The modified grashof number (gm) represents the relative strength of concentration buoyancy forces to viscous hydrodynamic force . As expected, the fluid velocity increases and the peak value is more distinctive due to an increase in the species buoyancy force . The profiles attain a maximum value near the wall and then decrease rapidly to approach the free stream value . Hence we are confident at the accuracy of our solution given by (30). For various values of rotational parameter (r), figure 4(f) presents the effect of viscosity ratio () and material parameter () on . The magnitude of microrotation is greater for a newtonian fluid (= 0) with given parameters as compared with micropolar fluids (0). Also, it is observed that the magnitude of microrotation profiles decrease with an increase in material parameter () and viscosity ratio (). Rarefaction effects that give rise to slip flow become significant when the molecular mean free path is comparable to characteristic length of the system . The microrotation profiles presented in figure 4(g) incorporate the influence of rarefaction parameter (h) and permeability parameter (k). It is noticed that an increase in the value of rarefaction parameter decreases the magnitude of microrotation profiles while the comparison of curves for different values of permeability parameter (k) reflects that profiles increase with increasing values of k. a similar behavior is also expected because when we increase the permeability it increases the size of the pores inside the porous medium due to which the drag force decreases and hence the magnitude of microrotation profiles increases . Microrotation profiles showing the variation of soret parameter (sr), schmidt number (sc), and generative chemical reaction () are presented in figure 4(h). It is analyzed that the influence of sr, sc, and is to reduce the magnitude of microrotation profiles . Comparison of the curves in this figure indicate that the magnitude of microrotation profiles is the greatest for helium (he: sc = 0.3) and then for carbon dioxide (co2: sc = 0.94) and the lowest for propylbenzene (c9h10: sc = 2.62). Physically it is justified this figure also displays the fact that these profiles decrease during the destructive reaction (> 0). Figures 5(a)5(h) illustrate graphically the behavior of translational velocity (v) versus boundary layer coordinate z for various involved parameters governing the flow field . For various values of prandtl number (pr), suction parameter (s), and radiation parameter (f), it is clearly evident that translational velocity decreases on increasing pr because since prandtl number is the ratio of kinematic viscosity to thermal diffusivity, so as pr increases, the kinematic viscosity of the fluid dominates the thermal diffusivity of the fluid which leads to decreasing of the velocity of the flow field . Moreover, it is noticed that velocity first increases in the region adjacent to the plate and then decreases on moving away from the plate with increase in the suction parameter (s) showing the suction has a stabilizing effect on the flow field . This figure also incorporates the fact that radiation (f) tends to accelerate the translational velocity throughout the boundary layer region . Physically, it is true, as higher radiation occurs when temperature is higher and ultimately the velocity rises . The velocity distribution attains maximum value in the neighborhood of the wall and then decrease to approach the free stream value . The effect of heat absorption parameter on translational velocity (v) is depicted in figure 5(b) and it is found that velocity reduces due to the presence of heat absorption parameter (q). Figure 5(c) incorporates the influence of magnetic parameter (m) and hall parameter (m) on the translational velocity profiles (v). This phenomenon has an excellent agreement with the physical fact that the presence of transverse magnetic field in an electrically conducting fluid always generates a resistive type of force called lorentz force which is similar to drag force and hence serves to decelerate the flow . Form this figure it is also found that hall currents (m) tends to accelerate the fluid velocity throughout the boundary layer region which is consistent with the fact that hall currents induces flow in the flow field . The combined effect of thermal and concentration buoyancy forces on the translational velocity are depicted in figure 5(d). It is evident from this figure that with an increase in grashof number (gr) and modified grashof number (gm), which is a measure of thermal and concentration buoyancy forces, there is a substantial growth in the momentum boundary layer for the same reasons as explained earlier in this section . Figure 5(e) depicts the effect of rotational parameter (r) on the fluid velocity and it is perceived that rotation tends to retard fluid velocity throughout the flow field . This is due to the reason that coriolis force is dominant in the region near to the axis of rotation . Variation of translational velocity profiles for different values of soret parameter (sr), schmidt number (sc), and chemical reaction () are displayed in figure 5(f). The comparison of the curves shows that the velocity of the flow field decreases due to an increase in schimdt number and soret number . It is also observed from this figure that velocity decreases during the destructive reaction (<0). Figure 5(g) depicts the influence of viscosity ratio () and permeability parameter (k) on the translational velocity (v). For different values of permeability parameter this figure shows that velocity increases with increasing values of k while an increasing viscosity ratio () results in an enhancement of the total viscosity in fluid flow because is directly proportional to vortex viscosity which makes the fluid more viscous and so weakens the convection currents and hence the velocity decreases . Figure 5(h) incorporates the effect of slip or rarefaction parameter (h) and material parameter () on the translational velocity (v). It is observed that an increase in the values of rarefaction parameter result in an enhancement of the flow field inside the boundary layer . This behavior is readily understood from the velocity slip condition at the surface (23). The case when h = 0 corresponds to the no slip condition and in the present case it reduces to the case when the plate moves with constant velocity in the longitudinal direction . The effects are more visible in the region near to the plate and afterwards it fall slowly and steadily to its free stream value as z . Lastly the velocity decreases with increasing material parameter (). In figures 5(a)5(h) we observe that the velocity become maximum in the vicinity of the plate and then decreases away from the plate and finally takes asymptotic values far away from the plate . The numerical values of nusselt number computed from the analytical solution given in (39) are presented graphically versus time (t) in figure 6 for various values of prandtl number (pr), suction parameter (s), heat absorption parameter (q), and radiation parameter (f). It is noteworthy that the prandtl number, suction parameter, heat absorption parameter, and radiation parameter enhance the rate of heat transfer at the surface of the plate . The reason behind this phenomenon is explained earlier in the text . The rate of heat transfer is more for water (pr = 7.0) than that of air (pr = 0.71). C(0) at the porous plate versus time (t). From all these figures it is analyzed that sherwood number increase with an increase in schmidt number (sc), chemical reaction parameter (), soret number (sr), suction parameter (s), heat absorption parameter (q), and radiation parameter (f). The variation of couple stress coefficient (cm) for various involved parameters is displayed in figures 8(a)8(h) versus time (t). Figure 8(a) exhibits that couple stress coefficient decreases with increasing values of radiation parameter (f) and suction parameter (s) it increases with increasing values of prandtl number (pr). The effect of heat absorption parameter (q) on cm is shown in figure 8(b) and it is found that couple stress coefficient enhances with the rise in the values of q. from figures 8(c)8(f) it is apparent that the effect of increasing values of magnetic parameter (m), hall parameter (m), grashof number (gr), modified grashof number (gm), rotational parameter (r) and viscosity ratio () are to decrease the values of couple stress coefficient whereas reverse effect is found on increasing the values of material parameter (). Figure 8(g) shows a substantial growth in couple stress coefficient with increasing values of slip parameter (h) while reverse happen for increasing values of permeability parameter (k). Finally, the schmidt number (sc), soret number (sr), and chemical reaction parameter () have the tendency to increase couple stress coefficient and this is clearly visible in figure 8(h). From all these figures from figures 8(a)to 8(h) it is understandable that as time progresses couple stress coefficient (cm) is getting enhanced whereas from figures 9(a)to 9(h) it is visible that skin friction coefficient (cf) is getting suppressed for increasing values of time (t). The skin friction is an important phenomenon which characterizes the frictional drag at the solid surface, so the numerical values of skin friction coefficient (cf) computed from (33) is presented in figures 9(a)9(h) taking different values of f, s, pr, q, m, m, gr, gm, r, sc, sr,,,, k, and h. the skin friction coefficient increases with increasing values of radiation parameter while it decreases with increase in suction parameter, prandtl number, and heat absorption parameter and this fact is depicted in figures 9(a) and 9(b). It is noticed from figure 9(c) that the skin friction coefficient is reduced due to an increase in magnetic field strength as expected, since the applied magnetic field tends to impede the flow motion and thus reduces the surface friction force while the hall parameter tends to increase the skin friction . Figure 9(d) demonstrates the growth in skin friction for increasing values of thermal buoyancy parameter (gr) and modified grashof number (gm) because an increase in buoyancy effect in mixed convection flow leads to an acceleration of the fluid flow which increases the friction factor . An opposite trend is observed for increasing values of rotational parameter; that is, cf decreases with an increase in r. the influence of schmidt number (sc), soret number (sr), and chemical reaction parameter () on skin friction coefficient is exhibited in figure 9(f) and all these parameters tend to retard the surface friction forces . Finally, figures 9(g) and 9(h) exhibit a significant growth in cf with increasing values of viscosity ratio, permeability parameter, and slip parameter while reverse happens with increasing material parameter . The effects of various parameters on the temperature, concentration c, translational velocity v, microrotation, skin - friction cf, nusselt number, and sherwood number are examined . From the present calculations, we arrive at the following findings.thermal radiation tends to enhance fluid temperature whereas there is a decrement in fluid temperature with an increase of prandtl number, suction parameter, and heat absorption parameter.the species concentration profiles decrease at all points in the flow field with an increase in schmidt number, chemical reaction parameter, heat generation parameter, soret number, and suction parameter but are enhanced with an increase in radiation parameter while these physical quantities show reverse trend for sherwood number.thermal radiation, magnetic parameter, hall parameter, and permeability parameter tend to enhance the microrotation distribution whereas these physical quantities have reverse effect on couple stress coefficient.microrotation profiles decrease with an increase in prandtl number, material parameter, slip parameter, soret number, schmidt number, and chemical reaction parameter whereas these physical quantities have reverse effect on couple stress coefficient.microrotation profiles and couple stress coefficient decrease with an increase in suction parameter, rotation parameter, and viscosity ratio.thermal radiation parameter, permeability parameter, and slip parameter tend to enhance the translational velocity profiles throughout the boundary layer region and the skin - friction coefficient.prandtl number, magnetic parameter, suction parameter, rotation parameter, soret number, schmidt number, chemical reaction parameter, viscosity ratio, and material parameter tend to enhance both translational velocity profiles and skin - friction coefficient.slip parameter increases the translational velocity profiles but decreases the skin - friction coefficient.thermal radiation parameter, prandtl number, suction parameter, and heat absorption parameter tend to enhance dimensionless rate of heat transfer, that is, nusselt number . Thermal radiation tends to enhance fluid temperature whereas there is a decrement in fluid temperature with an increase of prandtl number, suction parameter, and heat absorption parameter . The species concentration profiles decrease at all points in the flow field with an increase in schmidt number, chemical reaction parameter, heat generation parameter, soret number, and suction parameter but are enhanced with an increase in radiation parameter while these physical quantities show reverse trend for sherwood number . Thermal radiation, magnetic parameter, hall parameter, and permeability parameter tend to enhance the microrotation distribution whereas these physical quantities have reverse effect on couple stress coefficient . Microrotation profiles decrease with an increase in prandtl number, material parameter, slip parameter, soret number, schmidt number, and chemical reaction parameter whereas these physical quantities have reverse effect on couple stress coefficient . Microrotation profiles and couple stress coefficient decrease with an increase in suction parameter, rotation parameter, and viscosity ratio . Thermal radiation parameter, permeability parameter, and slip parameter tend to enhance the translational velocity profiles throughout the boundary layer region and the skin - friction coefficient . Prandtl number, magnetic parameter, suction parameter, rotation parameter, soret number, schmidt number, chemical reaction parameter, viscosity ratio, and material parameter tend to enhance both translational velocity profiles and skin - friction coefficient . Thermal radiation parameter, prandtl number, suction parameter, and heat absorption parameter tend to enhance dimensionless rate of heat transfer, that is, nusselt number.
We report a case of sle - associated myopericarditis in a young male without clear evidence of viral infection based on viral markers in blood . The patient's cardiac function dramatically improved after treatment with steroids without any additional complications . A 19-year - old male was admitted to the combined armed forces hospital with a 7-day history of fever, cough, dyspnea, orthopnea, and chest pain . Based on the chest radiograph and computed tomography, he was diagnosed with a pericardial effusion and pneumonia (fig . 1a), and was transferred to our hospital for evaluation of the cause and treatment . His blood pressure was 110/70 mmhg, pulse rate was 112 beats / min, respiratory rate was 24 breaths / min, and body temperature was 38. jugular veins were engorged . On cardiac auscultation, the cardiac rhythm was regular and rapid, summation gallops were heard at the cardiac apex, and there were pericardial friction rubs along with left lower sternal border in the sitting position . Bilateral pretibial pitting edema was present on admission . On admission, blood tests showed white blood cell count of 5,420/mm, hemoglobin 10.6 g / dl and platelet count of 94,000/mm . C - reactive protein was 4.59 mg / l (normal, 0 - 3 mg / l). The blood chemistry revealed blood urea nitrogen to be 24.0 mg / dl, creatinine 1.1 mg / dl, total protein 5.7 g / dl, and albumin 2.6 g / dl . The levels of cardiac markers were elevated; troponin - i 0.87 ng / ml (normal, 0 - 0.05 ng / ml) and myoglobin 371 ng / dl (normal, 16.3 - 96.5 ng / dl). An electrocardiogram (ecg) revealed sinus tachycardia and diffuse t - wave inversion in which leads (fig . Echocardiography demonstrated severe left ventricular systolic dysfunction {left ventricular ejection fraction (lvef) was 18%} with severe global hypokinesia and preserved wall thickness (fig . A large amount of pericardial effusion was observed 13 mm anterior to the right ventricle, 18 mm around the right atrium and 2 mm posterior to the lv . At first, we suspected viral myopericarditis, and started conservative treatment for congestive heart failure and pericarditis . But, there was no improvement in lvef as well as in the clinical findings . Viral markers for cytomegalovirus, coxsackie virus b type 2, herpes simplex virus, and epstein - barr virus were all negative . During conservative treatment, he complained of new - onset ankle joint pain and tender erythematous swellings in both the ankles . The immunofluorescence tests were positive for anti - nuclear antibody (1: 640 titre), anti - dsdna antibodies (683.4 iu / ml), and anti - extractable nuclear antigen antibodies (anti - sm, anti - rnp, anti - ro, and anti - la), and the complement level was low (table 1). We concluded that the patient had sle according to the american rheumatism association / american college of rheumatology classification criteria for sle . On the 13th day of admission, we started treatment with high - dose glucocorticoids (methylprednisolone 1,000 mg intravenously daily for three days followed by 1 mg / kg per day in divided doses). On follow - up examination, ecg showed normalization of t - wave inversion (fig . 2c) and echocardiography obtained just before discharge showed improved systolic function (fig . Chest x - ray also showed improving consolidation in both the lung fields and cardiomegaly (fig . Complement 3 was normalized and anti - dsdna antibodies decreased from 683.4 iu / ml to 383.8 iu / ml (who u / ml, normal 0 - 93). He was discharged on the 33rd day of admission with oral prednisolone, and he visited the outpatient department 1 month later . In this 1 month, he had no symptoms . Echocardiography revealed normal lvef, without significant valvular disease and pericardial effusion compared to the last examination (table 2). Subsequently, the steroid medication was tapered and it was planned to maintain him on sle - specific treatment in the rheumatologic department . Sle is an autoimmune inflammatory disease of unknown etiology that affects various parts of the body, including all components of the cardiovascular system.1) the prevalence of lupus ranges from approximately 40 - 150 cases per 100,000 in the usa.2) in adults, the female - to - male ratio is 7 - 15: 1.3) cardiac involvement in sle may comprise of involvement of the pericardium, myocardium, endocardium, heart valves, and coronary or pulmonary arteries.4) pericardial involvement is the most frequent cause of symptomatic cardiac disease5) and is the most common echocardiographic finding in sle patients . The pericardium can be involved by acute and chronic inflammatory changes; granular deposition of immunoglobulin and c3, demonstrated by direct immunofluorescence,6) supporting the role of immune complexes in the development of pericarditis . Myocarditis is an uncommon, often asymptomatic manifestation of sle with a prevalence of 8 - 25% in different studies.7) global hypokinesis may be an echocardiographic indication of myocarditis and is present in approximately 6% of sle patients.8) the gold standard for diagnosing myocarditis in sle remains the endomyocardial biopsy.9) however, an endomyocardial biopsy is invasive with procedure - related risks and the diagnostic yield is low in 10 - 20% of cases, so it is not powerful enough to confirm the diagnosis.10) lupus myocarditis can be diagnosed based on clinical suspicion and echocardiographic evidence of a reduced lvef and segmental or global wall motion abnormality, once the other etiologies, such as viral and ischemic cardiomyopathy, have been excluded.9)11) immunofluorescence studies demonstrate fine granular immune complexes and complement deposition in the walls and perivascular tissues of myocardial blood vessels, supporting the hypothesis that lupus myocarditis is an immune complex - mediated disease . Lupus myocarditis, although mild, has to be treated immediately with high - dose corticosteroids . In the most severe forms, it is necessary to use intravenous pulse corticosteroid therapy (methylprednisolone 1 g / day for three consecutive days) followed by high doses of oral prednisone . Immunosuppressants, namely cyclophosphamide or azathioprine, and intravenous igg may be beneficial in the treatment of myocarditis.5) early mechanical circulatory supports help to save the life and prevent multi - organ failures in patients with fulminant myocarditis.12) in the present case, the patient was initially diagnosed with myopericarditis on the basis of his symptoms, diffuse t - wave inversion on ecg, elevated cardiac markers and echocardiographic findings . However, there was no improvement in his symptoms and the common cardiotrophic viral markers were all negative . Also, the patient had pericarditis, thrombocytopenia and proteinuria . Because the previous typical clinical signs and the positive immunofluorescence tests were suitable for making the diagnosis of sle, we confirmed the diagnosis of myopericaditis associated with sle in this patient . After a provisional diagnosis of myopericarditis with sle was made, he was treated with intravenous corticosteroid pulse therapy (methylprednisolone 1 g / day for three consecutive days) followed by high doses of oral prednisone . After 3 days of steroid therapy, the patient's signs and symptoms were stabilizing and echocardiographic findings were improved . Initially, we had considered myopericarditis to be caused by viral infection; however, the final diagnosis was myopericarditis during presentation of primary sle based on the clinical manifestations, echocardiography, immunofluorescence tests and good response to steroid therapy . Because the treatment of sle induced myopericarditis should be needed for some specific therapy such as corticosteroid, this case shows that careful investigation is needed for search of the cause of myopericarditis in a young male, and not only viral infection but also autoimmune disease should be investigated for . In this report, we described the first case of a korean young male sle patient in whom the first manifestation was of myopericarditis and treatment with glucocorticoids resulted in a good clinical outcome.
The rapidly increasing use of microwave radiation, has raised public concern about possible detrimental effects of non - ionizing radiation sources which work in this frequency range (13). Radio detection and ranging (radar) equipments send and transmit high - power rf waves by producing a high - voltage and high frequency alternating electrical current . Radar workers are routinely exposed to pulsed high frequency electromagnetic fields, which are produced to locate and identify the presence, direction or range of airplanes, ships, control towers or other, usually moving objects . Nowadays, radar systems, which operate at radio frequencies (rf) between 300 mhz and 18 ghz, are widely used for navigation, aviation, national defense, weather forecasting and even to speed control (hand - held police radars). As radiations emitted by radar systems must travel long distances in order to detect objects, the power must be relatively high at transmission site . Recent studies conducted on the health effects of occupational exposure to military radar radiations indicate some detrimental effects such as induction of oxidative stress (decreased glutathione concentration vs. increased concentration of malondialdehyde) (4), reduced fertility (5), increased level of dna damage and chromatid breaks (6). Furthermore, some non - emf hazards such as radar equipment - related electrical injury are also reported (7). There are also reported risks such as increased incidence of hemolymphatic cancers that can be caused by microwaves generated by radars or ionizing radiation produced by electronic devices producing the microwaves (8). On the other hand, there are published reports that could not show any detrimental effect in radar workers . In a 40-year controlled longitudinal belgian study, no increase in all - cause mortality in military personnel who were in close contact with radar equipments was found (9). Over the past years our laboratory has focused on studying the health effects of exposure of humans to some common sources of electromagnetic fields such as mobile phones (1012), mri (13) and possible implications of pre - exposure to radiofrequency radiations (1416). The aim of this study was to assess if occupational exposure of military radar personnel affect their general health . This study was conducted on apparently healthy male and female workers employed in a military radar site with a frequency range of 218 ghz . In this study, health effects of this radiation in personnel who routinely work with radar systems are investigated . All required permissions were obtained from the authorities . As in this study informed consent was essential before enrolling a participant, 100 workers (mean age of 33.426.87 years, ranged 2450 years) including 91 males and 9 females participated in the study, gave their informed consent before beginning the study . A previously approved questionnaire (10) including personal information, job status, possibility of exposure to other sources of electromagnetic fields (mobile phones, crts, etc) and adverse health symptoms (self reported) was used . The 28-item general health questionnaire (ghq) initially developed by goldberg and hillier to screen for somatic symptoms, anxiety and insomnia, social dysfunction, and severe depression was used as a self - administered tool for assessment of general mental health and mental distress . The validity and reliability of the persian version of this questionnaire, which is understandable to almost every iranian, was approved previously (17). A modified bracy simple visual reaction time test (18) that was developed in the center for research in radiation sciences (crrs), shiraz university of medical sciences, was used in this study . Visual reaction time (vrt) of all participants was recorded with a simple blind computer - assisted - visual reaction time test . To evaluate participants sustained attention and response time, the participants were asked to respond as quickly as possible by a single right click on a computer mouse when a red square on the display was replaced by a green one . The students had to perform some preliminary tests for orientation with the test . In this stage, reaction time after orientation, to reduce random variation of measurements, each test was repeated 7 times in both real and sham exposure phases . Modified wechsler memory scale test the test includes four subtests including forward and backward digit span, paired words and word recognition . After training, to perform the wms digit span memory test, participants were asked to repeat back a list of digits, which were spoken live - voice, by an expert member of our research team at a rate of approximately one digit per second . This study was approved by the research ethics committee at the shiraz university of medical sciences and informed consent was obtained from all participants . This study was conducted on apparently healthy male and female workers employed in a military radar site with a frequency range of 218 ghz . In this study, health effects of this radiation in personnel who routinely work with radar systems are investigated . All required permissions were obtained from the authorities . As in this study informed consent was essential before enrolling a participant, 100 workers (mean age of 33.426.87 years, ranged 2450 years) including 91 males and 9 females participated in the study, gave their informed consent before beginning the study . Seventy one percent of these workers had university degrees (b.sc and m.sc). A previously approved questionnaire (10) including personal information, job status, possibility of exposure to other sources of electromagnetic fields (mobile phones, crts, etc) and adverse health symptoms (self reported) was used . The 28-item general health questionnaire (ghq) initially developed by goldberg and hillier to screen for somatic symptoms, anxiety and insomnia, social dysfunction, and severe depression was used as a self - administered tool for assessment of general mental health and mental distress . The validity and reliability of the persian version of this questionnaire, which is understandable to almost every iranian, was approved previously (17). A modified bracy simple visual reaction time test (18) that was developed in the center for research in radiation sciences (crrs), shiraz university of medical sciences, was used in this study . Visual reaction time (vrt) of all participants was recorded with a simple blind computer - assisted - visual reaction time test . To evaluate participants sustained attention and response time, the participants were asked to respond as quickly as possible by a single right click on a computer mouse when a red square on the display was replaced by a green one . The students had to perform some preliminary tests for orientation with the test . In this stage, reaction time after orientation, to reduce random variation of measurements, each test was repeated 7 times in both real and sham exposure phases . The test includes four subtests including forward and backward digit span, paired words and word recognition . After training, to perform the wms digit span memory test, participants were asked to repeat back a list of digits, which were spoken live - voice, by an expert member of our research team at a rate of approximately one digit per second . This study was approved by the research ethics committee at the shiraz university of medical sciences and informed consent was obtained from all participants . As shown in table 1, the mean age of the participants was 33.426.87 (ranged 2450) years . Forty eight percent of the participants had worked 8 hours or less than 8 hours per day, while forty - eight and two percent of the participants had worked 910 hours per day and more than 10 hours per day, respectively . Only one percent of the participants had worked less than 5 days per week, while 84% and 15% of the participants had worked 5 days per week and 6 days per week, respectively . Moving to work experience as a cardinal factor that determines the occupational health effects, 20% of the participants had work experiences of 24 months or less while 30%, 35% and 15% had work experiences in the range of 25148, 49120 and more than 121 months, respectively . On the other hand, considering the average distance of the participants from radar antennas, 33% had worked in distances of 4 meters or less, while 47% and 20% had worked in distances of 510 meters and more than 10 meters, respectively . Mean (sd) ghq-28 scores of participants in all subsets and the scores in each subsection of somatic symptoms, anxiety/ insomnia, social dysfunction, and severe depression are shown in table 2 . The mean scores of ghq for somatic symptoms in radar workers and the control group were 1.03 0.49 and 1.45 0.26 (p<0.0001), respectively . The scores for anxiety / insomnia in radar workers and the control group were 0.99 0.58 and 1.70 1.40 (p<0.001), respectively . For social dysfunction the scores in radar workers and the control group were 1.08 0.34 and 1.49 0.29 (p<0.0001), respectively . Finally, for severe depression these scores in radar workers and the control group were 0.44 0.52 and 1.66 0.35 (p<0.0001), respectively . The mean scores of ghq for somatic symptoms in the control group and radar workers who worked 8 hours, 910 hours and more than 10 hours per day were 1.45 0.26, 1.07 0.50, 1.03 0.48 and 0.61 0.07 (p<0.0001), respectively . For anxiety / insomnia, the mean scores in the control group and radar workers who worked 8 hours, 910 hours and more than 10 hours per day were 1.70 1.40, 1.02 0.62, 0.99 0.56 and 0.82 0.36 (p<0.001), respectively . For social dysfunction, the mean scores in the control group and radar workers who worked 8 hours, 910 hours and more than 10 hours per day were 1.49 0.29, 1.08 0.36, 1.09 0.34 and 0.93 0.25 (p<0.0001), respectively . For severe depression, the mean scores in the control group and radar workers who worked 8 hours, 910 hours and more than 10 hours per day were 1.66 0.35, 0.52 0.54, 0.40 0.51 and 0.07 0.08 (p<0.0001), respectively . Altogether, the total scores of ghq for all 4 subsets in the control group and radar workers who worked 8 hours, 910 hours and more than 10 hours per day were 1.53 0.22, 1.82 0.38, 1.77 0.49 and 2.08 0.64 (p<0.0001), respectively . On the other hand, work experience played a significant role in ghq scores . The mean scores of ghq for somatic symptoms in the control group and radar workers who had work experiences of 24 months, 2548, 49120 and more than 120 months were 1.45 0.26, 1.04 0.40, 1.01 0.48, 0.91 0.49 and 1.18 0.59 (p<0.0001), respectively . For anxiety / insomnia, the mean scores in the control group and radar workers who had work experiences of 24 months, 2548, 49120 and more than 120 months were 1.70 1.40, 0.97 0.47, 1.08 0.53, 0.89 0.70 and 1.08 0.60 (p<0.001), respectively . For social dysfunction, the mean scores in the control group and radar workers who had work experiences of 24 months, 2548, 49120 and more than 120 months were 1.49 0.29, 0.96 0.29, 1.13 0.34, 1.11 0.41 and 1.07 0.25 (p<0.0001), respectively . For severe depression, the mean scores in the control group and radar workers who had work experiences of 24 months, 2548, 49120 and more than 120 months were 1.66 0.35, 0.40 0.55, 0.47 0.47, 0.49 0.56 and 0.35 0.52 (p<0.0001), respectively . On the other hand, the distance from the antenna played also a significant role in mean ghq - scores of the participants . The mean scores of ghq for somatic symptoms in the control group and radar workers who had worked at an average distance of 4 meters, 510 and more than 10 meters were 1.45 0.26, 1.06 0.40, 1.05 0.54 and 0.95 0.50 (p<0.0001), respectively . For anxiety / insomnia, the mean scores in the control group and radar workers who had worked at an average distance of 4 meters, 510 and more than 10 meters were 1.70 1.40, 1.10 0.55, 0.97 0.62 and 0.89 0.54 (p<0.001), respectively . For social dysfunction, the mean scores in the control group and radar workers who had worked at an average distance of 4 meters, 510 and more than 10 meters were 1.49 0.29, 1.13 0.34, 1.04 0.29 and 1.10 0.47 (p<0.001), respectively . For severe depression, the mean scores in the control group and radar workers who had worked at an average distance of 4 meters, 510 and more than 10 meters were 1.66 0.35, 0.43 0.42, 0.43 0.60 and 0.49 0.50 (p<0.0001), respectively . Altogether, the total scores of ghq for all 4 subsets in the control group and radar workers who had worked at an average distance of 4 meters, 510 and more than 10 meters were 1.53 0.22, 1.54 0.22, 1.49 0.23 and 1.49 0.43, respectively . These differences were not statistically significant (p=0.77). The relationship between reaction time and the participants work experience is shown in table 3 . Chi - square test revealed a statistically significant relationship between work experience and reaction time (p <0.001). On the other hand, there was a significant relationship between participants age and the reaction time (p <0.001). After adjustment for age, reaction time remained associated with work experience . The reaction time of the radar workers and the control group in different age categories is shown in table 4 . This table clearly shows that regardless of the age category, there is a statistically significant difference between reaction time of the radar workers and the control group . The scores of the short - term memory of radar workers and the control group for each subtest are shown in table 5 . According to this table, for all subtests (forward and backward digit span, paired words and word recognition), the scores of the radar workers are significantly higher than those of the control group . Results showed that the mean reaction time in radar works was significantly lower than that of the control group (238.58 + / 23.47 milliseconds vs 291.86 + / 28.26 milliseconds, p<0.0001). These results may lead us to this conclusion that occupational exposure to radar radiations decreases reaction time, which may lead to a better response to different hazards . On the other hand, the scores of forward digit span, backward digit span, word recognition and paired words in radar workers were significantly lower than those of the control group (3.56 + / 0.77 vs. 4.29 + / 1.06, p<0.0001; 2.70 + / 0.69 vs. 3.62 + / 0.95, p<0.0001; 3.37 + / 1.13 vs 5.86 + / 1.11, p<0.0001; 13.56 + / 1.78 vs. 15.21 + / 2.20, p<0.0001, respectively). Findings of reaction time in this study generally confirm the findings of our previous study that indicated exposure to mobile phone radiations caused decreased reaction time in university students (12). Generally speaking, our findings are in contrast with those of other investigators who have reported detrimental health effects of the occupational exposure to radar radiations such as decreased sperm motility and viability in highly exposed group compared to those of the lowly exposed and control groups (19), increased sperm dysmorphia and alteration in quality of semen in response to changes in microwave frequency, distance, intensity, exposure time and quality of shielding (20), increase in frequency of micronuclei (21). On the other hand these findings are not in line with those reports that showed biological alterations without major clinical implications such as increased igg, igm and iga level and decreased count of lymphocytes and t8 cells (22) or even some beneficial bioeffects such as lower all - cause mortality rate in military conscripts who served in battalions with anti - aircraft radars versus controls (9). Investigation of the general and more specifically mental health that is believed to be an integral and essential component of health was among the main goals of this study . The who constitution states: health is a state of complete physical, mental and social well - being and not merely the absence of disease or infirmity . In this light, mental health is more than the absence of mental disorders or disabilities (23). Exposure to radiofrequency radiation has not consistently been shown to have an effect on well - being or self - reported symptoms such as headache, fatigue, dizziness and concentration difficulties (24). In this light, our study interestingly showed that the scores of ghq for all 4 subsets in the control group were higher than those of radar workers . This clearly indicates that the levels of psychological distress in radar workers are less than those of the control group . In the former soviet union anecdotal reports of symptoms such as insomnia, memory loss, and headache led to some early reports indicating possible psychiatric or psychological effects of exposure to electromagnetic fields (25). However, after several decades, these reports are still unconfirmed but recently, hypotheses relating emf to problems such as neurodegenerative disorders have attracted a worldwide interest (26). In our study, the short - term memory scores in radar workers were less than those of the control group . This finding is in line with the results obtained in a study on 317 seventh grade students (144 boys, 173 girls, median age 13 years). In this study, in children who reported more mobile phone voice calls, the accuracy of working memory was poorer and reaction time for a simple learning task was shorter (27). Despite much dissimilarity, some of our findings are clearly in contrast with some recent studies that report lack of evidence for a direct association between frequency and severity of non - specific physical symptoms and higher levels of emf exposure (10, 11, 28). Altogether, the results obtained in this study indicate that occupational exposure to radar microwave radiations are not linked to major adverse health effects . However, as the short - term memory scores in radar workers were less than those of the control group, attempts for reducing exposure of radar workers to radiofrequencies generated by radar systems should be performed . Ethical issues (including plagiarism, informed consent, misconduct, data fabrication and/or falsification, double publication and/or submission, redundancy, etc) have been completely observed by the authors.
A 4-year - old male neutered domestic shorthair cat was presented to the oregon state university cardiology service for suspected pericardial effusion . Cardiac tamponade was documented and pericardiocentesis yielded purulent fluid with cytologic results supportive of bacterial pericarditis . The microbial population consisted of pasteurella multocida, actinomyces canis, fusobacterium and bacteroides species . Conservative management was elected consisting of intravenous antibiotic therapy with ampicillin sodium / sulbactam sodium and metronidazole for 48 h followed by 4 weeks of oral antibiotics . Re - examination 3 months after the initial incident indicated no recurrence of effusion and the cat remained free of clinical signs 2 years after presentation . Bacterial pericarditis is a rare cause of pericardial effusion in cats . Growth of p multocida, a canis, conservative management with broad - spectrum antibiotics may be considered when further diagnostic imaging or exploratory surgery to search for a primary nidus of infection is not feasible or elected . Pericardial disease in cats is relatively uncommon, with a reported prevalence ranging from 1.0 - 2.3% in post - mortem studies . The most common causes of pericardial effusion in cats results from congestive heart failure secondary to cardiomyopathic disease and neoplasia . Other less frequently cited etiologies include trauma, disseminated intravascular coagulation, uremic pericarditis, peritoneopericardial diaphragmatic hernia, feline infectious peritonitis, coagulopathy, hypoalbuminemia and infective pericarditis . Infective pericarditis includes viral, bacterial, fungal or parasitic colonization of the pericardium, and is rarely reported in cats . This case report describes a cat with bacterial pericarditis with previously undocumented microorganisms and a favorable clinical response to conservative medical management . A 4-year - old male neutered domestic shorthair cat presented to the primary veterinarian after being found recumbent and dyspneic at home . Mild pyrexia (39.5c), muffled heart sounds and weak femoral pulses were identified on physical examination . Thoracic radiographs revealed a globoid cardiac silhouette, and the cat was referred immediately to the oregon state university (osu) cardiology service for suspected pericardial effusion (figures 1 and 2). Review of the incoming thoracic radiographs suggested a large - volume pericardial effusion with a small amount of concurrent pleural effusion . The cat s past pertinent history was unremarkable; it was an indoor cat with no historical altercations with the other household cat . There is a generalized increase in cardiac silhouette size with dorsal deviation of the thoracic trachea . The increased opacity of the cranial mediastinum is most consistent with fat infiltration ventrodorsal radiograph . The cat is positioned obliquely upon presentation to osu, the cat was depressed but responsive . It was hypothermic (36.7c) and tachypneic (60 breaths per minute) with a high - to - normal heart rate (220 beats per minute). Its mucous membranes were blanched and tacky; no capillary refill time could be obtained . The cat s heart sounds were muffled and femoral pulse quality was poor . Echocardiography was performed emergently, confirming a large volume of anechoic pericardial effusion with cardiac tamponade (figure 3; see also supplementary material). A small volume of pleural effusion was also present, likely due to impaired filling of the right heart with cardiac tamponade . Pericardiocentesis was prioritized and buprenorphine (0.15 mg / kg iv, buprenex; rickitt benckiser healthcare) was administered for sedation . Following aseptic skin preparation of the right fourth sixth intercostal space at the costochondral junction, pericardiocentesis performed with an 18 g intravenous catheter resulted in the removal of 80 ml of malodorous opaque red - tinged fluid flecked with white particles . Cytologic evaluation of the pericardial fluid indicated a markedly increased nucleated cell count (138,100/l; international system of units si: 138.1 10/l) consisting of 20% macrophages and 80% degenerative neutrophils, many with intracellular bacteria of various types . These findings were consistent with a septic suppurative exudate; consequently, the pericardial fluid was submitted for aerobic and anaerobic bacterial culture and antimicrobial susceptibility . Testing for non - bacterial microorganisms (fungal, viral etiologies) was not performed . Diastolic collapse of the right atrium and ventricle was noted, consistent with cardiac tamponade . The lumens of the right ventricle (rv) and left ventricle (lv) are labeled . The pericardial effusion is diffusely present around the ventricles (*) the signs of cardiogenic shock resolved following pericardiocentesis . The echocardiographic examination was completed with no evidence of structural heart disease or neoplastic masses . Cardiac tamponade was abolished and a small amount of residual pericardial and pleural effusions remained after pericardiocentesis . Other diagnostics performed included complete blood count (cbc), chemistry panel, urinalysis, feline immunodeficiency virus (fiv) and feline leukemia virus (felv) antigen testing (idexx laboratories), blood pressure measurement and ecg . The cat s blood pressure was 130 mmhg (doppler method) and its ecg indicated sinus rhythm with a left anterior fascicular block - like pattern . The relevant laboratory test abnormalities are listed in table 1; abnormalities were consistent with sepsis (eg, transitional leukogram, mild hyperbilirubinemia). The urine sample was obtained several hours after fluid therapy, indicating a urine specific gravity of 1.018 without bilirubin, glucose, protein, cells or bacteria present . Wbc = white blood cell diagnostic and therapeutic options were discussed with the cat s owners, including the recommendation to pursue computed tomography (ct) to search for a local thoracic or distant source of infection . Owing to financial limitations, the owners elected to pursue conservative management with hospitalization and empiric parenteral antibiotic therapy . Ampicillin sodium / sulbactam sodium (30/kg mg iv q8h; aurobindo pharma), metronidazole (15 mg / kg iv q12h; claris lifesciences) and intravenous fluid therapy (lactated ringer s solution) were initiated . The cat s 5% dehydration deficit was replaced over 6 h, followed by a maintenance fluid rate of 20 ml / h . Over the next 48 h, a cbc and chemistry panel were repeated 2 days after presentation; the relevant results are presented in table 1 . After 2 days of hospitalization, the cat was transitioned to oral medications and discharged with instructions to receive amoxicillin / clavulanic acid (20 mg / kg po q8h; pfizer) and metronidazole (10 mg / kg po q12h; watson pharma private) for 4 weeks . At the time of discharge, the pleural effusion was likely either residual pleural fluid from impaired diastolic filling of the right heart during cardiac tamponade, or the result of pericardial effusion leakage following percardiocentesis . The final aerobic culture results yielded heavy growth of both pasteurella multocida and actinomyces canis . Aerobic antimicrobial susceptibility testing suggested p multocida was sensitive to ampicillin though resistant to clindamycin and tobramycin . The cat presented to osu for re - evaluation 1 week after discharge and was reported to have normal appetite, energy and demeanor at home . A recheck cbc indicated normalization of the white blood cell count (8970/l; si 8.97 10/l) with an unremarkable leukogram . Furthermore, the chemistry panel indicated complete resolution of the previous electrolyte disturbances, as well as normalization of creatine kinase and alanine aminotransferase . Continuation of the antibiotic regimen was recommended and recheck examination was advised following completion of the course . The cat was re - evaluated by echocardiography 3 months after its initial presentation, and no recurrent effusion was noted . Feline bacterial pericarditis has been sparsely reported in the veterinary literature . In a large - scale retrospective study of pericardial effusion in 146 cats, several mechanisms can result in septic pericarditis, including pericarditis secondary to localized spread of infection (eg, pneumonia, suppurative mediastinal lymphadenitis), hematogenous infection, extension of endocarditis / myocarditis, or direct inoculation resulting from penetrating wounds, migrating foreign material or surgery . The associated clinical signs are often related to hemodynamic compromise from pericardial effusion or related to systemic infection (eg, pyrexia, weight loss). Of the published case reports, some have shown a documented predisposing infection, whereas the inciting etiology was not conclusively identified in others . A cat in one report developed bacterial pericarditis in close temporal proximity to a dental prophylaxis with a common oropharyngeal microorganism, peptostreptococcus . Clavulanic acid for approximately 3 weeks and a full recovery was reported 6 weeks after completion of the antibiotic course . Another recent case report described bacterial pericarditis in an intact female cat with pyometra and hematogenous spread of escherichia coli . That cat responded well to a 4 week course of enrofloxacin and metronidazole following peri - cardiectomy, and remained clinically stable 1 year later . Conversely, another published report of feline bacterial pericarditis identified infection with a mixed population of enterobacteriaceae species and coagulase - negative staphylococcus species without an obvious predisposing cause . An anaerobic culture was not performed, and the cat responded favorably to an 8 week course of broad - spectrum antimicrobial therapy . Owing to the multiple organisms involved, direct inoculation via a penetrating wound or foreign material the case reported here did not have a readily apparent systemic or focal infection, or any immune - modulating systemic diseases; however, an exhaustive search was not pursued . Bite wounds are generally associated with the oral flora of the biting animal rather than the skin flora of the victim . The most common aerobic isolate in cat bites is p multocida, and anaerobic isolates commonly include fusobacterium and bacteroides species . Though the cat reported here was exclusively housed indoors, another cat was present in the household and may have incited the infection through an unwitnessed altercation . Less likely, this infection may have resulted from atraumatic hematagenous spread of bacteria and alternate sources of infection (eg, odontogenic, esophageal, pleuropulmonary) were not systematically excluded . While the incidence and causes of septic pericarditis vary across species, the diagnostic approach and therapeutic goals remain the same . Identification of the specific pathogen(s), related antibiotic susceptibility and source of the infection are paramount . Cytology and culture of the pericardial fluid is crucial in the diagnosis of septic cases, unlike most other causes of pericardial effusion . In addition, blood cultures are advised in humans as they are positive in 4070% of cases . Aerobic and anaerobic susceptibility testing is also recommended, although most laboratories do not routinely perform susceptibility testing on anaerobic isolates . As anaerobic pericarditis is associated with odontogenic infection, esophageal disease, pleuropulmonary infection, abdominal infection and pelvic infection in humans, a thorough search for adjacent and distant infections owing to the low incidence and small number of published case reports, the ideal therapy for septic pericarditis in cats is unclear . Results of susceptibility testing facilitate antibiotic selection, although, if unavailable, broad - spectrum coverage is recommended based on the wide range of bacterial isolates reported . The standard of care in affected humans involves aggressive medical management, including an indwelling pericardial catheter for drainage and targeted antibiotic therapy . In dogs affected by bacterial pericarditis, eradication of the source of the infection is imperative and surgical exploration is indicated in cases that have failed medical management or have suspected abscessation identified on diagnostic imaging . Consequently, advanced imaging, exploratory surgery and pericardectomy could be advised in affected cats, although, interestingly, complete recovery has been reported with antibiotics alone in previous cases and the cat reported here . The development of constriction is an important potential sequela to septic and non - septic pericarditis, and should be assessed on patient follow - up . Constriction is theorized to occur secondarily to the influx of inflammatory cells into the pericardial space, ultimately leading to proliferation of fibrotic connective tissue and neovascularization . These changes can result in a loss of pericardial elasticity and thus limit diastolic filling . In a prospective human study, 9/500 (1.8%) patients developed constriction over a median follow - up time of 72 months . While overall constriction is a rare complication of human viral or idiopathic pericarditis (<0.5%), the risk of constriction was highest in the bacterial pericarditis group (33%). The prevalence of constriction in cats is unknown, although echocardiographic evidence of constrictive physiology was identified in one cat with septic pericarditis . Constrictive pericarditis is difficult to definitively diagnose, but echocardiographic findings of a thickened pericardium and respiratory variation of> 25% in mitral inflow velocities can be highly suggestive . In the case presented here, no subjective or clinical evidence of constrictive pericarditis was identified during the limited echocardiograms during recheck examinations; however, concern exists for its development nonetheless . The cat reported here fully recovered following conservative therapy consisting of pericardiocentesis and broad - spectrum antibiotic treatment . Larger retrospective or prospective studies could help further characterize treatment strategies and prognosis in affected cats.
Germline mutations in the tumor suppressor genes brca1 and brca2 account for 3% to 5% of all breast cancer cases and 10% to 15% of ovarian cancer cases . The lifetime risk of breast cancer in brca1 and brca2 mutation carriers is estimated at 47% to 66% and 40% to 57%, respectively . The ovarian cancer risk in brca1 and brca2 mutation carriers is estimated at 35% to 46% and 13% to 23%, respectively . The median onset age for breast cancer in brca mutation carriers is 40 to 50 years, while that for sporadic cases is 60 to 70 years . Previous studies conducted in unaffected brca mutation carriers have indicated that prophylactic mastect - omy effectively reduces the residual lifetime risk of breast cancer to <5% . However, this evidence was derived from retrospective and short - term follow - up prospective studies, so it is not clear whether a bilateral risk - reducing mastectomy (rrm) provides better survival when compared with intensive surveillance . Risk - reducing salpingo - oophorectomy (rrso) has been demonstrated to reduce risk of ovarian cancer to 85%, also derived from retrospective and short - term follow - up . They recommend rrso for brca mutation carriers especially upon completion of child - bearing in the national cancer center network guidelines because of the absence of reliable methods of early detection and the poor prognosis associated with advanced ovarian cancer, although they hold rrm to an option for brca mutation carriers . In japan, risk - reducing surgery as well as genetic counseling or genetic test is outside the health insurance, so we perform risk - reducing surgery for brca mutation carriers in the limited hospital facilities after the ethics committee granted permission . The safety and feasibility of nipple - sparing mastectomy (nsm) or skin - sparing mastectomy (ssm) in brca mutation carriers is debatable, and a consensus of which procedure should be performed has not yet been reached . We report a 38-year - old japanese women diagnosed with brca2 mutation that underwent prophylactic bilateral ssm with excision of the nipple to preserve the areola skin . Furthermore, we provide a review of the literature on the risk management of brca mutation carriers, especially the concepts and procedures of rrm . A 38-year - old japanese woman was diagnosed as a brca2 mutation carrier after genetic counseling and testing and was referred to kitano hospital in april 2014 to undergo risk - reducing surgery . Her father had been diagnosed with prostate cancer when he was 49 years old; he had died from the disease 2 years later . Her mother was alive but had a history of arrhythmia that was diagnosed when she was 64 years old . Her paternal grandmother had been diagnosed with breast cancer when she was 54 years old and had died from the disease 10 years later . Although her maternal grandfather died at the age of 72 years because of metastatic cancer, the precise details were not known . Her ancestry was japanese, and she was unaware of any ashkenazi jewish heritage . Because of her family history, the fact that she was a widowed mother with three children, and her knowledge of hereditary breast and ovarian cancer, she worried about that, and consulted a genetic counselor to undergo brca mutation testing . After genetic counselor showed all of the risk management options for brca mutation carriers, frequent mammography, breast magnetic resonance imaging (mri), clinical breast examinations, chemoprevention, and prophylactic surgery including extent of cancer risk reduction, risks associated with surgeries, reconstructive options, management of menopausal symptoms, and reproductive desires, addressing psychosocial, social, and quality of life aspects, she finally desired rrm and rrso . The ethics committee granted permission for the rrm in may 2014, and we provided informed consent prior to the rrm . The need for rrso remained to be discussed because of concerns associated with rrso such as menopausal disorders caused by iatrogenic fertility . Breast mri showed rapid early enhancement with linear and ductal distribution in both the breasts, and the possibility of ductal carcinoma in situ could not be ruled out . Axillary node enlargement was not observed . In july 2014, to improve aesthetic and psychological outcomes according to her preference, she underwent a bilateral ssm with excision of the nipple to preserve the areola skin . Using indigo carmine, we demarcated the perimeter of the breast tissue preoperatively to ensure complete excision of the mammary gland . Immediate breast reconstruction was performed using the standard prosthetic reconstructive technique of two - stage expander - implant reconstruction . On pathological examination she was disease - free at a 1-year follow - up and her general condition was good . Although the american society of clinical oncology has previously recommended that brca mutation testing should be conducted only for those with at least a 10% likelihood of carrying a mutation, it is currently recommended for any individual with a suggestive family history if the result would affect the magnitude of medical management . Risk management for brca mutation carriers includes frequent mammography, breast mri, clinical breast examinations, chemoprevention, and prophylactic surgery . Previous studies conducted in unaffected brca mutation carriers have indicated that prophylactic mastectomy effectively reduces the residual lifetime risk of breast cancer to <5% . Conducted a prospective study of 139 pathogenic brca1/2 carriers, among whom, 76 underwent prophylactic mastectomy and 63 were followed by regular surveillance . They showed that there were no cases of breast cancer after rrm with a mean follow - up 2.91.4 years, whereas there were eight cases of breast cancers in the surveillance group after a mean follow - up of 31.5 years . Conducted a retrospective study of 639 women with a family history of breast cancer that underwent prophylactic mastectomy . With a median follow - up of 14 years, they reported that prophylactic mastectomy was associated with a 90% reduction in the incidence of breast cancer, with only seven women developing breast cancer . However, randomized controlled trials to evaluate the potential impact of rrm on survival have not been conducted, and it remains unclear whether bilateral rrm improves survival compared with intensive surveillance . The only available data is derived from risk estimates assessed using mathematical models of risk - reducing interventions . Developed a monte carlo model of breast screening with annual mammography plus mri in subjects aged 25 to 69 years; rrso was performed in those aged 40 to 50 years and rrm was performed in those aged 25 to 50 years . They reported that rrm at age 25 plus rrso at age 40 years maximizes survival probability, substituting mammography plus mri screening for rrm seemed to offer comparable survival . As far as chemoprevention is concerned, tamoxifen reduced breast cancer incidence among healthy brca2 carriers by 62% . In this case, after we discussed all of the risk management options for brca mutation carriers recommended by the national comprehensive cancer network (nccn) guidelines, she has finally chosen to have rrm, because she has believed rrm might release from the fear of future cancer more than other cancer preventive options . She made choice to have rrm by her responsibility that 37-year - old widowed mother with three young children, concerning that prophylactic mastectomy effectively reduces the residual lifetime risk of breast cancer to <5% which is superior than chemoprevention, although addressing psychosocial effect of mastectomy, and risks associated with surgeries . Bresser et al . Reported that 95% of women opted for rrm because of decreased cancer - related psychological distress . They tend to have young children and a greater awareness of the genetic nature of cancer in the family compared with those who opt for regular surveillance, as well as in this case . For brca1 or brca2 mutation carriers at high risk for ovarian cancer, the absence of reliable methods of early detection and the poor prognosis associated with advanced ovarian cancer have impelled them to the performance bilateral rrso after completion of childbearing, ideally by age 35 to 40 years . As to the chemoprevention option, oral - contraceptive use protected against ovarian cancer both for carriers of the brca1 mutation (odds ratio, 0.5; 95% confidence interval, 0.30.9) and for carriers of the brca2 mutation (odds ratio, 0.4; 95% confidence interval, 0.21.1). In this case, the need for rrso remained to be discussed in the ethics committee, and she underwent rrm at first before rrso, as following reasons: firstly, the most important reason is that there is the difference between the risk of breast cancer and of gynecologic cancer in age of 30s in brca2 mutation . The timing of rrso is controversial, while nccn guidelines panel recommends rrso for women with a known brca1 or brca2 mutation, typically between ages 35 and 40 years and upon completion of childbearing . It is well established that among women with brca2 mutation, the risk of gynecologic cancer is only 2% to 3% by the mean age of 50 years, while it increases in the late 30s in women with brca1 mutation . However, the risk of breast cancer is over 20% in 30s in women with brca2 mutation . Secondly, mutation carriers who undergo rrso at a young age face medical problems such as osteoporosis, and cardiovascular disease, as well as quality - of - life issues associated with menopause, hot flashes, vaginal dryness, sexual dysfunction, sleep disturbances, and cognitive changes . Thirdly, women who undergo bilateral mastectomy but who have ovaries intact can use oral contraceptive safety for protecting against ovarian cancer . Oral contraceptive use has been associated with a small increase in the risk of breast cancer in young and old women . In a large meta - analysis, current use of oral contraceptives was associated with a relative risk 1.2 for breast cancer . She has not use oral contraceptive even after rrm, because she desire to have children, but she can take oral contraceptive after she gave up having children . Fourthly, short - term hormone replacement therapy after rrso may be useful after rrm to improve their quality - of - life for women without increasing the risk of breast cancer, when no history of breast cancer has confirmed pathologically . As far as the method of rrm is concerned, ssm and nsm are increasingly performed instead of the conventional total mastectomy to allow for immediate breast reconstruction and to achieve a natural aesthetic outcome . The oncological risk associated with remaining mammary gland is unclear, and there remains a small risk of cancer arising beneath the nipple and areola in nsm . Reynolds et al . Evaluated 62 nipple - areolar complex (nac) tissues from 33 female brca1/2 mutation carriers who underwent mastectomy and found that 24% of nacs contained terminal duct lobular units (tdlus), with only 8% found in the nipple papilla, and they estimated that nsm might be appropriate and oncologically safe for women with brca mutation carriers, but tdlus can be found in the nac and are more likely at the base of the nipple, so the significance of this for long - term risk is unknown . However, hartmann et al . Reported that no significant difference in the incidence of breast cancer between women who underwent subcutaneous mastectomy and those who underwent total mastectomy . The prose study followed 105 brca1/2 mutation carriers who underwent a bilateral prophylactic mastectomy, at least 30% of whom had subcutaneous mastectomies . At 6.4 years of follow - up, two women who underwent subcutaneous mastectomies developed breast cancer, with one developing metastatic breast cancer in the axilla and the other developing breast cancer in residual breast tissue . In a review of the literature, van verschuer et al . Reported that 21 primary breast cancers occurred after 6,044 prophylactic mastectomies, three occurred after a total mastectomy, and 17 occurred after a conservative mastectomy, but that the majority of primary breast cancers did not originate near nac or skin flap but were found in the chest wall or axilla . They suggested that oncological surgeons should be diligent, ensuring complete removal of all glandular tissue, especially in the axillary tail and chest wall, and that the skin flaps and nac should be dissected as thin as possible . Current nsm and ssm techniques aim for skin flaps <5 mm and for a nac thickness of 2 to 3 mm . Ssm and nsm using peri - areolar or inframammary incisions can be challenging, because of difficulty of removal of remaining mammary gland in all quadrants and in the axillary tail . Detection of brca1/2 mutations gave rise to a new concept in prophylactic medicine, although risk management for brca1/2 mutation carriers requires further discussion . It is generally accepted that a randomized controlled study design would allow a better evaluation of risk reducing surgery on cancer risk and mortality reduction, it is generally accepted that randomized approach would not be ethical for the management of these patients and therefore, this field of research is limited to undertaking observation studies, which intrinsic methodological limitation . The patient finally described herein chose to undergo bilateral ssm for rrm with the excision of the nipple and preservation of the areola skin . The best choice of risk reduction for brca mutation is different from each others, so it is important that the decision making should be made with knowledge of risk management options, through receiving counseling about the risks and benefits of each options.
Data for the analysis were collected through structured phone interviews with a national sample of 27 hmos . The surveyed hmos include 15 hmos currently serving rural medicare risk enrollees, 1 hmo that recently dropped its medicare risk contract to serve rural enrollees, and 11 hmos that have commercial enrollees in 5 or more rural counties, but no rural medicare risk enrollees . The study also analyzed secondary data on hmo characteristics, medicare risk enrollment, and aapcc rates . The risk sample consisted of hmos serving 100 or more rural medicare risk enrollees as of december 1995, stratified by the number of rural medicare risk enrollees . The commercial sample consisted of hmos that had five or more rural counties in their commercial service areas, but were not serving rural medicare risk enrollees as of december 1995; this sample was stratified by census region . Interview protocols were developed using the literature on hmos and medicare risk contracts, including the 1990 mathematica study, and consisted of open - ended questions and probes regarding the hmo's decisionmaking, experiences, and future plans regarding medicare risk products in rural areas . At each hmo, one or more senior managers who were knowledgeable about the hmo's medicare risk product or the hmo's decision not to offer the product were interviewed . Three of the hmos in the risk sample had pre - tax equity and fiscal responsibility act (tefra) of 1982 demonstration projects, five hmos began their medicare risk contracts between the mid-1980s and 1991, and eight hmos signed contracts after 1993 . These hmos range in age from 8 to 51 years, with a median age of 13 years (table 1). Six are mixed - model hmos, seven are individual practice associations (ipas), one is a group model, and one is a staff model . The 11 hmos in the commercial sample are younger than those in the risk sample, and a greater percentage are ipa models (table 2). Only 2 of these plans have more than 100,000 enrollees, compared with 12 of the 15 plans with rural medicare risk enrollees . The percentages of for - profit hmos and nonprofit hmos in the two groups are similar . Compared with hmo plans nationally (interstudy, 1996), the hmos in the risk sample are older, have larger total enrollment, are less likely to have for - profit tax status, and are more likely to be mixed - model hmos . Their organizational characteristics resemble those of all hmos with medicare risk contracts (physician payment review commission and prospective payment assessment commission, 1995). The risk sample hmos represent more than one - fourth of the 50 hmos nationally that were serving at least 100 rural medicare risk enrollees at the end of 1995 . Therefore, we are reasonably confident that the study results are generalizable to all hmos that were serving rural medicare risk enrollees when the study was conducted . However, the results may not be fully generalizable to new health plans, e.g., provider - sponsored organizations (psos), that develop to contract with the medicare program on a risk basis in the future . Most of the risk sample hmos cited a combination of factors in their decisions to serve rural medicare risk enrollees . These hmos are all well - established plans with large commercial populations, and several indicated that their decision to offer a medicare risk product in rural areas was influenced by their experiences offering commercial products in those areas . Seven hmos cited the presence of significant senior populations in some rural areas as a motivating factor for offering the medicare risk product . For six hmos, having an established provider network in rural areas was a major factor . The hmos were especially interested in contracting with major employers with large numbers of retirees in rural areas . One hmo official stated: we wanted to have a well - rounded offering, from a provider and consumer perspective, by covering medicare and medicaid as well as commercial . This hmo added that it did not enter the medicare risk business thinking it would make money . Two hmos described hcfa's requirement that a medicare risk service area be contiguous as a factor in their decisions . Two hmos specifically mentioned competition from other hmos in rural areas as a motivating force for serving rural medicare enrollees . Geographic necessity, i.e., the desire to expand in a state that is mostly rural, played a role in one hmo's decision to expand to rural counties . Secondary effect; it chose to serve urban areas and portions of the nearby rural counties just came with them . Four hmos described aapcc rates as one of several factors they considered in their decisions to serve rural counties . One hmo selected rural counties where aapcc rates were not outrageously low compared with the urban counties in its service area; other hmos indicated that they were serving rural areas in spite of low aapcc rates . These hmos balanced low rural aapcc rates with other factors such as capacity in the provider network, provider willingness to work with the plan, the growing number of retirees in some rural areas, and a desire to establish their medicare risk products in advance of the competition . For the commercial sample, aapcc rates emerged as the most important factor in hmos' decisions not to offer a medicare risk product in rural areas . Several hmos described low aapcc rates in rural counties as the only reason why they are not offering a medicare risk product in the rural portions of their commercial service areas . Other hmos cited a combination of factors, including low aapcc rates, inability to develop a sufficient provider network, and small numbers of medicare beneficiaries . These findings are in accord with research indicating that the rural counties currently served by medicare risk hmos have significantly larger populations, higher population density, and higher aapcc rates, and are more likely to be located adjacent to urban areas, compared with rural counties not served by medicare risk hmos (moscovice, casey, and krein, 1998). Most of the risk sample hmos cited a combination of factors in their decisions to serve rural medicare risk enrollees . These hmos are all well - established plans with large commercial populations, and several indicated that their decision to offer a medicare risk product in rural areas was influenced by their experiences offering commercial products in those areas . Seven hmos cited the presence of significant senior populations in some rural areas as a motivating factor for offering the medicare risk product . For six hmos, having an established provider network in rural areas was a major factor . The hmos were especially interested in contracting with major employers with large numbers of retirees in rural areas . One hmo official stated: we wanted to have a well - rounded offering, from a provider and consumer perspective, by covering medicare and medicaid as well as commercial . This hmo added that it did not enter the medicare risk business thinking it would make money . Two hmos described hcfa's requirement that a medicare risk service area be contiguous as a factor in their decisions . Two hmos specifically mentioned competition from other hmos in rural areas as a motivating force for serving rural medicare enrollees . Geographic necessity, i.e., the desire to expand in a state that is mostly rural, played a role in one hmo's decision to expand to rural counties . Secondary effect; it chose to serve urban areas and portions of the nearby rural counties just came with them . Four hmos described aapcc rates as one of several factors they considered in their decisions to serve rural counties . One hmo selected rural counties where aapcc rates were not outrageously low compared with the urban counties in its service area; other hmos indicated that they were serving rural areas in spite of low aapcc rates . These hmos balanced low rural aapcc rates with other factors such as capacity in the provider network, provider willingness to work with the plan, the growing number of retirees in some rural areas, and a desire to establish their medicare risk products in advance of the competition . For the commercial sample, aapcc rates emerged as the most important factor in hmos' decisions not to offer a medicare risk product in rural areas . Several hmos described low aapcc rates in rural counties as the only reason why they are not offering a medicare risk product in the rural portions of their commercial service areas . Other hmos cited a combination of factors, including low aapcc rates, inability to develop a sufficient provider network, and small numbers of medicare beneficiaries . These findings are in accord with research indicating that the rural counties currently served by medicare risk hmos have significantly larger populations, higher population density, and higher aapcc rates, and are more likely to be located adjacent to urban areas, compared with rural counties not served by medicare risk hmos (moscovice, casey, and krein, 1998). The 15 hmos in the rural sample have rural medicare service areas that range in size from 1 county to 20 counties, with a median of 5 rural counties . Twelve of these hmos currently have a rural medicare service area that is smaller than their rural commercial service area . The differences between the hmos' medicare and commercial service areas range from one county to the majority of rural counties in a state . These hmos most frequently cited low aapcc rates and difficulty contracting with providers in some counties as reasons for selective exclusion of rural counties from their medicare service areas . Five of the 15 risk sample hmos and 3 of the 11 commercial sample hmos identified hcfa's access standards (which require that enrollees have access to primary and specialty care within certain distance or travel times) as federal requirements that are more difficult for the hmo to meet in rural areas . Monopolies in some rural counties (e.g., counties with a single ipa or hospital that refuses to negotiate a capitated contract) make it more difficult to meet the access standards . The risk sample hmos reported using a variety of reimbursement methods for their medicare risk products, depending on the hmo model type, its ability to negotiate capitated contracts, and/or the volume of medicare risk patients . Most frequently, these hmos pay some or all rural physicians on a discounted fee - for - service (ffs) basis, while capitating urban physicians . The risk sample hmos reported varying degrees of competition from other hmos in their rural medicare risk service areas . Most of the hmos, however, reported that competition is limited to one or two other medicare risk plans in a portion of their rural service areas, in contrast to the significant competition that exists in many urban areas . For a few hmos, competition in their rural service areas is primarily in the form of medicare cost and/or supplemental products . Five hmos did not know whether the utilization patterns of their rural medicare risk enrollees differ from those of urban enrollees . For most of these hmos, rural enrollees comprise a small percentage of their medicare risk enrollees, and they have not examined rural utilization patterns separately . A few hmos have not observed any differences in rural and urban utilization patterns while others, including two hmos with large numbers of rural enrollees, reported that utilization has been higher in rural areas . Of the 15 hmos with rural medicare risk enrollees, 8 hmos were able to differentiate between the financial experience of their medicare risk product in rural areas and in urban areas . Five of these eight hmos said their medicare risk products were unprofitable in rural areas (and either profitable or breaking even in urban areas), while two hmos said they were breaking even in rural areas and making a profit in urban areas . One hmo reported that its financial experience in both urban and rural areas has been moderately positive . One hmo did not describe its financial experience with the medicare risk product, and six hmos described their overall financial experience without distinguishing between rural and urban areas . Two of these hmos said their medicare risk products were unprofitable overall, two hmos said they were breaking even, and two reported that their financial experience varied from county to county within their service area . In addition, the interviewed hmo that dropped its medicare risk contract did so because both the hmo and the rural clinic, its only provider in the area, were experiencing financial losses under the risk contract . No clear relationship emerged between the hmos' financial experience with medicare risk products in rural areas and either the length of time the hmo has offered the product or the number of rural enrollees . The hmos that reported unprofitable medicare risk products in rural areas include both hmos that have had these products for several years and hmos that began offering them more recently . They also include some hmos with large numbers of rural medicare risk enrollees, as well as hmos with relatively fewer rural medicare risk enrollees . Hmos with low rural aapcc rates (less than $375) were more likely to say their medicare risk products are losing money in rural areas, while those with moderate rural rates ($375 to $499) were more likely to say they are breaking even or profitable . Four of the 15 hmos with medicare risk products in rural areas plan to expand their rural medicare service areas in the near future . One of these hmos plans to add two rural counties, and the other three hmos plan to add several rural counties . Likely to add one rural county, while another hmo will only add medicare enrollees from nearby rural areas who obtain care in urban areas . Four hmos have no plans to expand their rural medicare service areas; one of these hmos plans to drop some rural counties unless rates increase or contracting requirements change . For three hmos, future rural expansion depends on aapcc changes; one of these hmos is also evaluating the status of some rural counties in its current service area . Two hmos may expand their medicare risk service areas in the future as they expand their commercial service areas . Among the group of hmos not currently serving rural medicare risk enrollees, one of the two hmos with urban medicare risk enrollees plans to serve rural enrollees in the future, and the other plans to serve them if its rural aapcc rates increase . Three hmos in the commercial sample are considering medicare risk contracts, but have not decided whether to submit applications or which counties would be in their service areas . Six hmos have no plans to serve rural medicare risk enrollees in the near future . Two of these hmos have submitted medicare risk applications for urban service areas, and another is preparing such an application . One hmo applied for a medicare cost contract; a second was considering a medicare cost or medicare select product, and a third was considering a traditional medicare supplemental product . Four of the 15 hmos with medicare risk products in rural areas plan to expand their rural medicare service areas in the near future . One of these hmos plans to add two rural counties, and the other three hmos plan to add several rural counties . Likely to add one rural county, while another hmo will only add medicare enrollees from nearby rural areas who obtain care in urban areas . Four hmos have no plans to expand their rural medicare service areas; one of these hmos plans to drop some rural counties unless rates increase or contracting requirements change . For three hmos, future rural expansion depends on aapcc changes; one of these hmos is also evaluating the status of some rural counties in its current service area . Two hmos may expand their medicare risk service areas in the future as they expand their commercial service areas . Among the group of hmos not currently serving rural medicare risk enrollees, one of the two hmos with urban medicare risk enrollees plans to serve rural enrollees in the future, and the other plans to serve them if its rural aapcc rates increase . Three hmos in the commercial sample are considering medicare risk contracts, but have not decided whether to submit applications or which counties would be in their service areas . Six hmos have no plans to serve rural medicare risk enrollees in the near future . Two of these hmos have submitted medicare risk applications for urban service areas, and another is preparing such an application . One hmo applied for a medicare cost contract; a second was considering a medicare cost or medicare select product, and a third was considering a traditional medicare supplemental product . The results summarized in this article underscore the importance of aapcc rates as a factor in hmos' decisions to offer medicare risk products in rural areas, but also identify several other factors that influence these decisions, including the hmo's experience with commercial hmo products in rural areas, whether the hmo has an established rural provider network (or believes it can successfully develop one), employer demand for retiree coverage, the presence of sufficiently large senior populations, the hmo's corporate mission, contiguous service area requirements, and competition from other hmos . This article also shows that aapcc rates and provider network considerations are important factors in decisions made by a number of hmos to exclude rural counties in their commercial service areas from their medicare risk contract service areas . These results suggest that the changes in the aapcc payment methodology are most likely to affect the willingness of two groups of hmos to serve rural medicare risk enrollees . The first group is hmos that have excluded rural counties in their commercial service areas from their medicare risk contract service areas primarily because of low aapcc rates . The second group includes hmos that serve rural commercial populations, but do not offer a rural medicare risk product because of low aapcc rates in those rural counties . Hmos that are serving rural medicare risk enrollees unintentionally or only at the hmos' urban facilities appear unlikely to increase the number of rural enrollees they serve as a result of the aapcc changes . Increases in rural aapcc rates will not directly affect other factors cited by some hmos as disincentives to medicare risk product development in rural areas . These include small numbers of rural medicare beneficiaries or the unwillingness of rural providers to contract with the hmo on a capitated basis . However, the aapcc changes may indirectly reduce some of these barriers . For example, to the extent that increased aapcc rates allow hmos to offer rural physicians, hospitals, and other providers more favorable reimbursement, the aapcc changes may encourage previously reluctant rural providers to participate in hmo provider networks . Alternatively, some of these rural providers may be motivated by increased aapcc rates and the potential regulatory flexibility of federal pso standards to develop psos, either in competition with hmos or as joint ventures with hmos or insurance companies . Although the majority of medicare risk enrollees are individuals, this study indicates that large employers seeking hmo coverage for retirees now play a growing role in encouraging hmos to offer medicare risk products in some rural areas . This article also suggests that competition in a few medicare risk markets is motivating some hmos to expand their medicare risk service areas to include rural counties . In another sign of potential near - term growth in the rural medicare risk contract market, several hmos described a proposed strategy of initially developing their medicare risk product in urban areas where aapcc rates are higher and contracting with providers is easier, and then expanding to rural areas . A number of hmos, however, reported financial losses on their rural medicare risk products, and nearly all of the hmos currently serving rural medicare risk enrollees indicated that their financial experience in rural areas has been less positive than in urban areas . The for - profit hmos interviewed have clear expectations that their medicare risk products will be profitable or will not be continued . A number of the non - profit hmos suggested that they did not expect to make money on a rural medicare risk product, however, they acknowledged the need to break even over the long term . Some indemnity insurers with substantial numbers of rural medicare beneficiaries in supplemental products operate affiliated hmos and are encouraging their rural commercial populations to move to managed care . The future of medicare risk contracting in rural areas may depend in part on whether these organizations decide to offer medicare risk products through affiliated hmos, and the degree to which they encourage their medicare supplemental subscribers to move to managed care . The success of medicare risk contracting in rural areas also will depend on whether increased aapcc rates allow hmos to offer rural enrollees the type of medicare risk products that have competed successfully with medicare supplemental products in higher aapcc urban markets, i.e., products with zero premiums or low premiums compared with supplemental products, as well as additional benefits such as prescription coverage.
This randomized, double - blind, placebo - controlled, parallel group, 24-week study with a subsequent 24-week extension enrolled male and female patients with type 2 diabetes between 29 july 2008 and 4 july 2009 . The study took place at 105 sites in argentina, canada, india, mexico, peru, philippines, taiwan, and united states and was completed on 15 june 2010 . Institutional review boards or independent ethics committees approved this protocol, and each patient provided written informed consent . Patients 18 years old having fasting c - peptide 1.0 ng / ml and bmi 45.0 kg / m entered group a or b. group a patients had received 12 weeks of pioglitazone 30 or 45 mg / day and had hba1c 7.0 and 10.5% . Group b patients were drug naive for the previous 10 weeks with hba1c 8.0 and 11.0% or had received pioglitazone 15 mg / day or any dose of rosiglitazone with hba1c 8.0 and 11.0% or had received 8 weeks of metformin 1700 mg / day or sulfonylurea less than or equal to half the maximal dose with hba1c 7.0 and 11.0% . Group b patients could not be on> 1 oral antidiabetic medication, and patients on more than half the maximum dose of sulfonylurea or metformin were excluded . Group b patients underwent a 10-week dose - optimization period in which their initial therapy was discontinued, and pioglitazone 30 mg / day was started and increased to 45 mg / day if possible . Group b patients were discontinued if their fasting plasma glucose (fpg) was> 270 mg / dl (15.0 mmol / l) after 3 weeks or after 6 weeks with hba1c <7.0 or> 11.0% . Exclusion criteria included aspartate or alanine aminotransferases> 2.5 times the upper limit of normal, total bilirubin> 2.0 mg / dl, serum creatinine 2.0 mg / dl, urine albumin / creatinine ratio> 1,800 mg / g, calculated creatinine clearance <50 ml / min, and congestive heart failure class iii and iv . Patients with prerandomization hba1c 7.0 and 10.5% entered the 2-week, single - blind lead - in period and received diet and exercise counseling . Randomized patients received double - blind dapagliflozin 5 or 10 mg or placebo every day (oral administration) with open - label pioglitazone 30 or 45 mg / day, stratified by pre - enrollment diabetes treatment group a and b. to ensure adequate representation from group a, randomization was set to recruit at least one - third of the patients from this group . The primary objective compared the change at 24 weeks from baseline in hba1c with each dose of dapagliflozin plus pioglitazone versus placebo plus pioglitazone . Secondary objectives included change from baseline in fpg, postprandial glucose (ppg) measured by 120-min postchallenge response to an oral glucose tolerance test, and total body weight . If fpg was> 270 mg / dl (15.0 mmol / l) (week 48),> 240 mg / dl (13.3 mmol / l) (week 812), or> 200 mg / dl (11.1 mmol / l) (week 1224), then patients were eligible to receive open - label rescue medication (metformin or sulfonylurea). Patients completing the first 24 weeks of the study were eligible for an additional 24 weeks . During weeks 24 to 48, if hba1c was> 8.0 (week 2536) or> 7.5% (week 3647), patients were eligible to receive open - label rescue medication . Data obtained after rescue were excluded from the efficacy analysis but included in safety analysis . Adverse events, laboratory abnormalities, and vital signs were assessed for the safety and tolerability of treatment . Hypoglycemia definitions are in the supplementary appendix and were documented for any event the investigator considered to be a hypoglycemic event, regardless of blood glucose measurement . Signs, symptoms, and events suggestive of urinary tract infection (uti) and genital infection were solicited at every visit . Preferred term lists included a broad spectrum of signs and symptoms of utis and genital infections in addition to specific diagnoses . Seated blood pressure was determined after 5 min of rest followed by the orthostatic blood pressure measurements . Average blood pressure was determined from three replicate measurements taken at least 1 min apart in each position (seated, supine, and standing). Statistical analyses at week 24 (last observation carried forward) including changes from baseline in hba1c, fpg, ppg, and body weight were performed using ancova with treatment group as an effect and baseline value and strata based on pre - enrollment antidiabetic therapy as covariates in the model . Secondary end points were tested for significance sequentially . At week 48, analyses of change from baseline in hba1c, fpg, ppg, and body weight were performed using longitudinal repeated - measures analysis over time including the fixed categorical effects of strata based on pre - enrollment antidiabetic therapy, treatment, week, and treatment - by - week interaction as well as the continuous fixed covariates of baseline measurement and baseline measurement - by - week interaction . Rescue was added as an additional effect to the mixed model when the analysis was performed on data regardless of rescue . Statistical analyses at week 24 (last observation carried forward) including changes from baseline in hba1c, fpg, ppg, and body weight were performed using ancova with treatment group as an effect and baseline value and strata based on pre - enrollment antidiabetic therapy as covariates in the model . Secondary end points were tested for significance sequentially . At week 48, analyses of change from baseline in hba1c, fpg, ppg, and body weight were performed using longitudinal repeated - measures analysis over time including the fixed categorical effects of strata based on pre - enrollment antidiabetic therapy, treatment, week, and treatment - by - week interaction as well as the continuous fixed covariates of baseline measurement and baseline measurement - by - week interaction . Rescue was added as an additional effect to the mixed model when the analysis was performed on data regardless of rescue . Of the 972 enrolled patients, 558 met the entrance criteria, and 480 entered the lead - in phase with pioglitazone . Almost equal numbers of patients came from group a (48%, 200 out of 420) and group b (52%, 220 out of 420) (supplementary fig . The proportion of patients who were discontinued or rescued for lack of glycemic control was less with dapagliflozin (1118%) than with placebo (34%). Demographics and baseline characteristics treatment with dapagliflozin 5 and 10 mg added on to pioglitazone resulted in statistically significant mean reductions in hba1c, fpg, and ppg when compared with placebo at week 24 (table 2) and were maintained through week 48 (table 2). The mean reduction from baseline in hba1c with dapagliflozin plus pioglitazone ranged from 0.82 to 0.97% compared with 0.42% with the placebo plus pioglitazone at week 24 (p = 0.0007 and p <0.0001 for dapagliflozin 5- and 10-mg groups, respectively .) At 48 weeks, the mean reductions in hba1c were maintained, and dapagliflozin groups ranged from 0.95 to 1.21% compared with 0.54% with the placebo plus pioglitazone . 1a) and similar between groups a and b over time (data not shown). 1b) in the dapagliflozin groups and significant at week 24 (table 2). At week 48, a greater reduction in mean change from baseline in ppg was observed with dapagliflozin plus pioglitazone (60.4 to 80.9 mg / dl [3.35 to 4.49 mmol / l]) than with placebo plus pioglitazone (25.4 mg / dl [1.41 mmol / l]) (table 2). Change from baseline at weeks 24 and 48 in efficacy parameters, vital signs, and laboratory values changes in glycemic parameters for placebo (circles), dapagliflozin 5 mg (squares), and dapagliflozin 10 mg (triangles) all plus pioglitazone 30 mg . A: mean change from baseline in hba1c after adjustment for baseline value over time . B: mean change from baseline in fpg after adjustment for baseline value over time . D: mean change from baseline in total body weight after adjustment for baseline value over time . Includes patients who took at least one dose of double - blind study medication . The increase in mean urinary glucose to creatinine ratio from baseline was maintained in the dapagliflozin groups over time (fig . The placebo group experienced a mean increase in body weight of 3.0 kg through week 48 . Dapagliflozin groups had a slight weight reduction initially, followed by gradual weight gain toward the baseline values at week 24 and gains of 1.4 and 0.7 kg for 5 and 10 mg, respectively, at week 48 (table 2 and fig . These changes for the dapagliflozin groups were significant at week 24 compared with placebo, maintained throughout 48 weeks (table 2), and appeared to be dose - dependent over time (fig . The placebo group experienced a mean increase in seated blood pressure at weeks 24 and 48, whereas both dapagliflozin groups experienced mean decreases (table 2). Small mean increases in hematocrit occurred in both dapagliflozin treatment groups (1.362.04%), whereas the placebo showed 0.44% change at week 48 . Small changes were observed on mean fasting ldl cholesterol (1.13.4% for dapagliflozin and 4.5% for placebo), total cholesterol (0.02.0% for dapagliflozin and 1.9% for placebo), triglycerides (3.74.2% for dapagliflozin and 13.5% for placebo), and hdl cholesterol (4.17.2% for dapagliflozin and 1.3% for placebo) at week 48 . No clinically relevant changes in calcium, magnesium, phosphorous, or serum 25 hydroxyvitamin d concentrations were apparent in any treatment group throughout the study (data not shown). There were small increases within the normal limits for parathyroid hormone and small mean changes in bone markers (serum procollagen type 1 n - propeptide, cooh - terminal telopeptide of type 1 collagen, n - terminal telopeptide of type 1 collagen, and osteocalcin) compared with placebo, which were unlikely to be clinically significant . The proportion of patients who reported at least one adverse event was similar for dapagliflozin (68.170.7%) and placebo (66.9%) through week 48 . One death due to septic shock was reported on day 117 in the dapagliflozin 5-mg group within 2 days of presenting with acute cholecystitis . Discontinuations were low and similar between the dapagliflozin and the placebo groups, none due to hypoglycemia . Adverse and special interest events through week 48 all of the renal events listed in table 3 occurred during the first 24-week period, and no additional events occurred during the second 24-week period . They included serum creatinine increase (four events), creatinine renal clearance decrease (one event), glomerular filtration rate decrease (one event), and abnormal renal function test (one event). The proportion of patients with an event suggestive of uti was 7.9, 8.5, and 5.0% with placebo, dapagliflozin 5 mg, and 10 mg, respectively, through week 48 . Signs, symptoms, and other events suggestive of genital infection were more common in both dapagliflozin treatment groups (8.69.2%) than in the placebo group (2.9%) through week 48 . Most events suggestive of uti or genital infection were of mild or moderate intensity; none of these events were serious or led to withdrawal from the study except for one patient (dapagliflozin 5 mg) with recurrent utis . Patients treated with pioglitazone plus dapagliflozin 5 or 10 mg had a lower rate of peripheral edema (4.3 and 2.1%, respectively) compared with pioglitazone plus placebo (6.5%) (table 3). Two patients (one female and one male) from the dapagliflozin 5-mg group experienced limb fractures (one foot and one hand, respectively) during the first 24-week period . One patient on placebo had an event of heart failure, and one patient on dapagliflozin 5 mg had urothelial bladder cancer detected on day 144 . In this study, the addition of dapagliflozin to pioglitazone lowered hba1c levels and attenuated the pioglitazone - related weight gain in patients with type 2 diabetes inadequately controlled on pioglitazone alone . Dapagliflozin acts in the kidney by inhibiting the reabsorption of glucose (15,16) and is not only capable of reducing fpg but also reabsorption of higher glucose load postprandially as shown in this study . These beneficial effects of dapagliflozin on hyperglycemia were maintained for almost 1 year and were consistent with sustained pharmacodynamic activity on glycosuria . The glucosuria induced by sglt-2 inhibition might be suspected to lead to hypoglycemia, utis, and genital infections . However, hypoglycemia events were rare in this study . No clear relationship to dapagliflozin was observed for events suggestive of utis, although one patient withdrew from the trial due to recurring utis . Consistent with previous reports (5,6,8), events suggestive of genital infections were higher in patients on dapagliflozin than on placebo . Urinary excretion of glucose also leads to caloric loss and the addition of dapagliflozin to pioglitazone can potentially mitigate weight gain due to pioglitazone . The differences between placebo and dapagliflozin - treated groups in weight were mainly driven by continuous weight gain in the placebo group, reflecting probably that pioglitazone was initiated or optimized during the prerandomization period, whereas no meaningful changes from baseline occurred in dapagliflozin groups . Dapagliflozin, acting as a mild diuretic, may also mitigate the fluid retaining effects of pioglitazone as evidenced by fewer reports of edema . Some studies suggest that pioglitazone may modestly lower blood pressure (17), a beneficial effect for patients with diabetes . When dapagliflozin was used as monotherapy (5) or in combination therapy (6,8), there was also some suggestive mild lowering of blood pressure . In this study, addition of dapagliflozin to pioglitazone was associated with a modest further decrease in blood pressure beyond the effect of pioglitazone alone in the absence of any ill effects such as hypotensive events or measured orthostatic hypotension . Thus, along with effects on weight, dapagliflozin may add to the blood pressure benefit of pioglitazone . Congestive heart failure, bladder cancer, or bone fractures, known side effects of long - term use of pioglitazone, were rare events; too rare at this stage to infer any effect on the risk of these events with the addition of dapagliflozin (13,14,18). Two fractures did occur in the dapagliflozin 5-mg group, but all patients received pioglitazone, and thiazolidinediones are known to increase the risk of fractures (19). Dapagliflozin added on to pioglitazone resulted in sustained glycemic benefits in both fasting and postprandial plasma glucose concentrations . As a possible mild diuretic and consistent glucouretic, dapagliflozin mitigated the weight gain and fluid retention due to pioglitazone . Even though more genital infections occurred with dapagliflozin than placebo, dapagliflozin added on to pioglitazone was effective and well - tolerated . The direct removal of glucose by dapagliflozin complements the insulin - sensitizing action of pioglitazone, providing a potential combination that balances well the benefits and risks of therapy for some patients with type 2 diabetes.
Chronic kidney disease (ckd) is a public health problem that affects more than 20 million people in the us . An average dialysis patient may require more than 12 medications . A pooled analysis identified 1,593 medication - related problems in 385 dialysis patients, with over- or under- dosing errors accounting for 20.4% of these issues . Despite the large number of patients affected and the devastating consequences of medication related problems, our understanding of the impact of kidney disease on drug disposition is incomplete, particularly for those drugs eliminated primarily by non - renal pathways . Obviously, clearance of drugs that depend primarily on the kidneys for elimination is reduced, but significant changes also occur in drug exposure with medications that are eliminated by the liver, intestine, and possibly other organs . In 2009, the fda published a survey of new drug applications (nda) approved between january 2003 and july 2007 that assessed the impact of renal impairment on systemic exposure of new molecular entities . In this analysis, nda sponsors for 37 orally administered drugs included renal impairment studies as part of their submission; 23 (62%) of these were eliminated by non - renal pathways (defined as fraction eliminated via renal route <15). Despite being cleared non - renally, 13 of these 23 new drugs (57%) showed an average 1.5-fold increase in area under the plasma concentration - time curve (auc) in renally impaired patients compared with health controls . In fact, the change in drug exposure for five drugs cleared mainly by hepatic metabolism and/or transport were of a magnitude (viz . Duloxetine auc + 2.0-fold, tadalafil auc + 2.7- to 4.1-fold, rosuvastatin cplasma + 3-fold, telithromycin auc + 1.9-fold, solifenacin auc + 2.1-fold) that required labeling recommendations for dose adjustment in renally impaired patients . Seven other drugs showed an effect of renal impairment on drug exposure but did not require dosage adjustment (aliskiren, alfuzosin, aprepitant, ranolazine, vardenafil, darifenacin, and lanthanum). These data along with a large body of earlier literature suggest that ckd alters the pharmacokinetics of drugs that are cleared by non - renal mechanisms; however, the underlying molecular mechanisms accounting for these pharmacokinetic changes remain poorly defined (reviewed by nolin, leblond and others). The purpose of the present mini - review is to highlight the present gaps in our understanding of the impact of ckd on non - renal drug clearance involving metabolism and transport processes and to identify areas of opportunity for future research . The following is a brief introduction to the key drug - metabolizing enzymes and drug transporters whose function is known to be altered in ckd . Phase i drug metabolism, involving oxidation, reduction, and hydrolysis, generally converts drug molecules to more polar or water soluble metabolites that are readily excreted by the kidneys or via the biliary system . Drug oxidation, which is particularly known to be altered in ckd, is catalyzed by two large families of enzymes, namely the cytochrome p450 (cyps) and flavin - containing monoxygenases (fmos). Many of the cyps exhibit genetic polymorphisms which range from gene duplication resulting in gene overexpression to null mutations producing a non - functional enzyme . The recent focus of cyp research is on enzymes expressed in the liver and the intestinal mucosa, which govern the oral bioavailability (i.e., first - pass metabolism) and systemic metabolic clearance of drug molecules . Human hepatic cytochrome p450s include cyp3a4 and 3a5 (40% of total liver p450 content), cyp2cs (25%), cyp1a2 (18%), cyp2e1 (9%), cyp2a6 (2%), cyp2d6 (2%) and cyp2b6 (<1%), as well as fmo3 . Human intestinal cyps that are functionally important include cyp1a1, cyp3a4, cyp3a5, and cyp2j2 . Cyp1a1, cyp1a2, cyp3a5, cyp4a1, and fmo1 are also expressed in human kidneys, but at levels much lower than in the liver and intestine . Many drugs or their phase i metabolites also undergo conjugation reactions mediated by phase ii enzymes . In particular, n - acetylation and o - glucuronidation of drugs or drug metabolites are known to be altered in ckd . The liver and intestinal mucosa are the major sites for the biotransformation of drugs and drug metabolites by phase ii enzymes (figure 1). It should be noted that the products of phase i and phase ii metabolism are not always pharmacologically inactive or less toxic than the parent drug . Transporters are transmembrane proteins facilitating the passage of both drugs and other xenobiotics across biological barriers encountered during drug absorption, tissue distribution, and excretion . Transporters, like drug - metabolizing enzymes, are expressed differentially across body tissues and are characterized as either uptake or influx transporters (transport into the cellular barrier) or efflux transporters (transport out of the cellular barrier). The importance of transporters in governing the intestinal absorption of drugs and nutrients and renal tubular secretion or reabsorption of drugs or their metabolites is increasingly being recognized . On the other hand, the role of hepatic sinusoidal transporters in regulating the access of drug substrates to the hepatocellular enzymes and that of canalicular transporters in biliary excretion of drugs and/or their conjugate metabolites are not as widely appreciated . Recent studies in experimental models of ckd have demonstrated altered expression and/or activities of intestinal and hepatic drug transporters that could modulate the respective intestinal absorption and hepatic uptake and metabolism of drugs . More than 75 commonly used drugs have been reported to exhibit altered non - renal clearance in patients with ckd (see table 1 for compilation). Only a few are subject to primary phase ii metabolism, namely o - glucuronidation (diacerein, morphine, oxprenolol, and zidovudine) and n - acetylation (isoniazid and procainamide). In almost all cases, reduced non - renal clearance, along with an increase in oral bioavailability in some cases (especially for drugs that undergo first - pass metabolism in the intestinal mucosa and/or liver), was observed in ckd . A case in point is the diminished non - renal clearance of nimodipine, which could result in as much as a 7-fold increase in its auc, although the increase in drug exposure is usually more modest (1.5 - 3.0-fold), variable across patients, and dependent upon the degree of renal impairment and the dialysis regimen in patients near or at the end - stage of renal disease . Increased clearance has been reported for a handful of drugs, including phenytoin, fosinopril, cefpiramide, nifedipine, bumetanide, and sulfadimidine . At least in the case of phenytoin, the apparent acceleration in non - renal clearance is attributed to reduced binding of phenytoin to albumin in uremic serum resulting in a higher fraction of circulating drug being available for uptake and metabolism by the liver . A number of mechanisms have been hypothesized for the impairment of drug metabolism in ckd, particularly metabolic pathways mediated by cyp enzymes . The supporting evidence is drawn largely from experimental studies in animal models of acute and chronic renal failure . The proposed mechanisms include: alterations in gene transcription and protein translation, reduced cyp expression due to inhibition of hemoprotein biosynthesis and/or increased enzyme degradation, depletion of co - factors (e.g., supply of nadph), and direct competitive inhibition of cyp enzyme by circulating uremic constituents . Supply of -aminolevulinic acid is recognized as a rate - limiting step in the hepatic synthesis of cytochrome p450 hemoproteins . Total microsomal cytochrome p450 content is consistently reduced in various experimental models of renal failure, and mitochondrial -aminolevulinic synthetase activity is depressed in the two - step 5/6 nephrectomy model in rats . Leber et al . Reported that intraperitoneal supplementation of -aminolevulinic acid in rats following subtotal nephrectomy normalized the level of cytochrome p450 in the liver, but did not reverse the reduction in cyp activities; hence, interference of hemoprotein synthesis is not a major mechanism of uremia s effect on cyp functioning in the rat . In addition, there is no experimental evidence in support of a diminished pool of hepatic nadph / nadh in renal failure, thereby limiting microsomal oxidation reactions . Currently, the two most likely mechanisms are transcriptional and/or translational modifications and direct competitive inhibition of the cyp enzymes . Nolin et al . Have provided a thorough summary of experimental studies conducted over the past decade, which clearly demonstrated reduced expression of cyp genes and gene products (i.e., reduced mrna and protein, or reduced protein with no change in mrna) in several animal models of ckd . The precise mechanism(s) of the down - regulation of cyp genes in these ckd models remains unknown . Also, there is no prima facie evidence that transcriptional and/or translational modifications in cyp genes involved in drug metabolism occur in humans with ckd . The only available human data come from ex vivo studies of uremic serum obtained from patients with end - stage renal disease (esrd), which showed that incubating rat hepatocytes in primary culture with uremic human serum led to a decrease in protein expression and activity for all the major xenobiotic - metabolizing cyps (i.e., 1a, 2c, 2d, 3a and 4a families), except for cyp2e1 . Observed that, while pre - hemodialysis serum caused significant reductions in cyp protein expression compared to serum from healthy controls, post - dialysis serum showed no effect . Fractionation of uremic serum by ultrafiltration and size - exclusion hplc revealed that the inhibitory constituents have a molecular weight range between 10 and 15 kda . These investigators postulated that proinflammatory cytokines and parathyroid hormone, which have the requisite molecular size and are known to be elevated in ckd, could mediate the down - regulation of cyps in ckd . Indeed, a follow - up study by the same group provided strong evidence that parathyroid hormone was a major component in uremic rat serum responsible for cyp down - regulation, and parathyroidectomy abolished the alteration in cyp transcription and translation . Possible mechanisms of parathyroid hormone s effect on cyp gene regulation include increased camp production, elevations in intracellular calcium, and/or activation of the nf-b pathway . Down - regulation of cyp gene expression in response to proinflammatory cytokines and other mediators of acute phase response (e.g., interleukin-1, interleukin-6, tumor necrosis factor-, interferon) are well established . It is also possible that circulating uremic constituents interfere with signaling of nuclear receptors involved in transcriptional activation of cyp genes, such as pregnane - x - receptor (pxr) and constitutive androstane receptor (car). Also, uremic plasma ultrafiltrate and peritoneal dialysate have been shown to inhibit vdr - rxr hetero - dimerization and attenuate activation of vitamin d responsive genes, which include cyp3a4 . The ex vivo evidence for uremia - induced transcriptional and translational modifications appears convincing, but there are caveats . Interspecies differences exist in the binding and activation of nuclear receptors (e.g., pxr) that regulate transcription of cyp genes, particularly between rodents and humans . In addition, the human orthologs of rat cyp enzymes often have vastly different drug substrate selectivity . The degree of uremia in animal models often exceeds that observed in stage iii ckd subjects and may not be generalizable to this population; however, it may mimic the uremic state observed in patients with stage iv ckd or in sub - optimally dialyzed stage v subjects . Hence, caution should be exercised in extrapolating genomic and functional data gathered from studies with rat hepatocytes and severely uremic animal models to the clinical context in ckd patients . It would be of considerable interest to repeat the ex vivo studies of uremic human serum on short term cyp regulation using a three - dimensional human hepatocyte culture system (vide infra). The presence of circulating, competitive inhibitor(s) of cyp enzymes in uremic blood or plasma was demonstrated in some of the early experimental studies . As early as 1985, terao et al . Showed a reduced extraction of s - propranolol a high intrinsic clearance cyp substrate, by livers isolated from normal rats perfused with uremic blood . Furthermore, livers from acute renal failure rats showed no reduction in s - propranolol extraction when perfused with normal blood from control rats . This set of cross - perfusion experiments presented the first evidence of a rapidly acting inhibitory factor(s) in uremic blood directly affecting the functioning of hepatic cyp enzymes . A later study by the same laboratory showed that a low molecular weight ultrafiltrate fraction (<10 kda) of uremic plasma obtained from esrd patients was capable of inhibiting the oxidative metabolism of s - propranolol in human liver microsomes mediated by cyp2d6 and cyp1a2 . Corroborating evidence of circulating uremic inhibitors have also been provided by yoshitani et al . Who showed that uremic sera from experimental models of acute renal failure in rats were capable of inhibiting oxidative metabolism of losartan in rat liver microsomes . Likewise, taburet et al . Reported that uremic plasma from esrd patients inhibited the metabolism of the cyp2c9 probe tolbutamide and the cyp3a probe midazolam in human liver microsomes from donors with normal renal function . Another piece of indirect evidence comes from pharmacokinetic studies in esrd patients undergoing hemodialysis; where the metabolic clearance of both propranolol and telithromycin following oral administration was partially or completely normalized when the drug was given shortly after a regular dialysis session compared to before dialysis . The rapid reversibility of uremia s effect is more consistent with dialytic removal of competitive enzyme inhibitors than reversal of uremia - induced down - regulation of cyp . While the latter process normally takes several days to achieve in accordance to the turnover half - life of cytochrome p450s (24 hours), downregulation in the expression of one or more cyp proteins until now, no systematic investigation has been undertaken to identify the putative cyp inhibitors in uremic blood of ckd patients . Unfortunately, our incomplete understanding of the effect of uremia on drug metabolism means that we are unable to predict which drug substrates and under what clinical circumstance would we expect to encounter a significant perturbation in metabolic clearance that warrants dosage adjustment . Early on, it was hypothesized that uremic inhibition of metabolic clearance may be confined to drug substrates of select cyp subfamilies if competitive enzyme inhibition by circulating uremic inhibitors is cyp specific . Soon it became apparent that uremic inhibition is observed in members of nearly every major drug - metabolizing cyp subfamilies; more puzzling is the fact that inhibition is inconsistent in its manifestation across substrates for the same cyp isoenzyme . For example, most of the lipophilic -adrenergic blockers are metabolized to a large extent by cyp2d6 . Whereas the first - pass and systemic clearance of orally administered propranolol and bufuralol are significantly reduced in ckd patients resulting in 3- to 5-fold increases in auc, the same is observed with substrates of cyp3a: first - pass metabolism and systemic clearance of midazolam are not affected by renal dysfunction; in contrast, increased oral bioavailability and decreased systemic clearance have been reported for other cyp3a - selective substrates, such as the antidepressant reboxetine and the dihydropyridine calcium channel blockers nicardipine, nimodipine, and nitrendipine . Thus, until we have identified the uremic constituents that modulate cyp - mediated metabolism, we will not begin to appreciate the exact nature and complexity of the effects of kidney disease on drug metabolism . For cyp enzymes exhibiting allosteric behavior, such as cyp1a1, cyp2b6, cyp2c8, cyp2c9, and cyp3a4/5, heterotropic cooperativity induced by two substrates or a substrate - inhibitor pair can lead to either apparent activation or inhibition in metabolism . The outcome of interactions become even harder to predict when multiple inhibitors are present, which is the likely scenario in uremia; such complex uremia retention solute - drug interactions will require meticulous enzyme kinetic studies . For those substrates whose first - pass metabolism is inhibited, we will need to delineate the separate effects of uremia on drug extraction at the intestinal mucosa versus that at the liver . Leblond et al . Have shown that uremia - induced down - regulation of some cyps is tissue - specific; for example, chronic renal failure in rats induced by two - stage, 5/6 nephrectomy resulted in a significant down - regulation in cyp1a2 in the intestine but not in the liver, whereas the opposite is observed with cyp2c11 . Some of the variability in the effects of renal disease on drug metabolism undoubtedly reflects differences in the stage of kidney disease and severity of uremia of patients between studies . There is always the problem of unrecognized confounders, such as differences in diet and nutritional support that may give rise to variations in composition and levels of uremic toxins, and the ever present problem of assessing drug - drug interactions . There is increasing awareness that uptake transport of drugs across the sinusoidal membrane of hepatocytes regulates the access of drug substrates to hepatocelluar enzymes as well as canalcular transport into the bile canaliculi, and can be a rate - limiting step in the overall process of hepatic drug clearance . In 1984, bowmer, yates and their colleagues reported that the hepatic uptake of two anionic dyes (indocyanin green and bromosulfophthalein) that are non - selective oatp substrates were reduced in acute renal failure rats . The functional and clinical significance of these findings did not become evident until a series of recent investigations showed that inhibition of uptake transport into the liver may explain to a large extent the reduced non - renal clearance observed in ckd patients for several commonly used drugs that are moderately good to high affinity substrates of human hepatic oatps: erythromycin, eprosartan, fexofenadine, and digoxin . The inhibitory mechanism(s) of hepatic drug uptake was explored to a limited extent in the above referenced studies . Incubated normal rat hepatocytes with uremic serum drawn from patients with esrd and showed a 29% decrease in oatp1a4 expression and a 37% increase in p - gp expression in rat hepatocytes exposed to uremic serum compared with those exposed to healthy serum; the effect on oatp is consistent with the in vivo finding of a 63% decrease in the oral clearance of fexofenadine . A subsequent in vitro investigation with digoxin by tsujimoto et al . Also yielded similar findings it would be important to replicate these findings in human hepatocytes since the complement of human sinusoidal oatps (oatp1b1, oatp1b3, and oatp2b1) are not functional orthologs of rat sinusoidal oatps . It is also relevant to note that among the various anionic uremic toxins tested, 3-carboxy-4-methyl-5-propyl-2-furanpropionic acid (cmpf) was consistently shown to be the most potent inhibitor of roatp or hoatp for the uptake of erythromycin, eprosartan, and digoxin, with a ki in the order of 20 to 50 m, which is within the plasma concentration range reported in uremic patients (median 254 m, maximum 392 m). Another uremic constituent, p - cresol it is important to recognize that sinusoidal uptake transport and intracellular processing by hepatocellular metabolism and canalicular secretion into bile are coupled kinetic processes; moreover, either or both transport and metabolic steps can be altered by uremia to produce the net effect of reduced hepatic clearance . Hence, in vitro modeling of functional disruption of hepatocellular processes must be evaluated in a cell - based system that maintains the coupling of transport at the sinusoidal membrane and enzymatic function at the endoplasmic reticulum . All in vitro studies conducted to date in this area have used hepatocytes isolated from rat or human livers and maintained in short - term, conventional monolayer culture; as a result, the hepatocytes do not retain cell polarity (i.e., sinusoidal versus canalicular membrane domain) and rapidly de - differentiate . Over the past decade, the sandwich - cultured human hepatocyte model (sch) has gained favor in order to study the complex interplay between metabolic enzymes and transporters . When cultured on a substrate of biocoat with an overlay of matrigel or collagen, primary hepatocytes develop a cuboidal three - dimensional structure with intact bile canaliculi and proper localization of efflux transporters (e.g., oatps, p - gp, mrps, and concentrative / equilibrative nucleoside transporters), while maintaining functional metabolic enzymes (e.g., cyps, udp - glucuronosyltransferases). This system features the connecting between sinusoidal uptake, intracellular metabolism, and efflux into the bile canaliculi, and allows assessment of the net effects of these sequential processes on heaptic drug processing . Exposing sch to uremic serum or its derived fractions could provide a more realistic in vitro model for investigating the alterations in drug metabolism and transport observed in ckd patients . An emerging novel approach to enhancing in vitro tissue or organ system models relevant to altered drug metabolism microphysiological systems utilize microfluidic technologies, can incorporate three dimensional architecture and mimic physiological fluid shear stress . These microphysiological systems frequently use human cell sources to overcome concerns about species differences in drug transport and metabolism . Human microphysiological systems are currently under development at the university of washington and other institutions, and should expand our ability to explore the interactions between kidney disease and hepatic drug metabolism and transport . Microphysiological systems can also feature microvascular endothelial cells and perivascular cells cultured on a 3-dimensional scaffold that form luminal or microvasular structures; hence, the systems can recapitulate normal perfusion flow and the resulting physiological dynamics of solute transport . It is conceivable that eventually we will be able to capture the impact of impairment in kidney function on hepatocyte function through coupling of vascularized microphysiological systems based on human kidney and liver . Great strides have been made in understanding the effects of ckd on drug disposition in the past 15 years, particularly on how uremia affects hepatic drug metabolism and coupled transport . Nonetheless, as highlighted in this review, important questions remain regarding the underlying uremic mechanisms . Until we fully understand uremia s impact on drug metabolism and transport at the cellular and molecular level, it will be difficult to develop a rational strategy for drug dosing in the ckd population . It is also clear that progress will depend on the application of novel techniques and methodologies to delineate the complex and multiplex details of uremia s effect on the drug disposition system.
In this article we will use the term variable number tandem repeat (vntr) to encompass both microsatellites and minisatellites however not all tandem repeat domains are polymorphic in repeat copy number . Sva elements only represent 0.13% of the genome, representing ~2700 elements, constituting the youngest of the retrotransposable elements in the human genome and are hominid specific . They consist of a hexamer repeat (ccctct), an alu - like sequence, a gc - rich vntr, a sine and a poly a - tail as with other retrotransposons much effort has been expended on the retrotransposition event itself giving rise to disease . This has resulted in the identification of at least 8 well characterized diseases in which the retrotransposition event has caused the disease, in the majority of cases by affecting alternative slicing our hypothesis is that the sva element could impart a hominid specific regulatory twist on regulation of the gene in which they have inserted (assuming that insertion is not in an exon or destroys intron / exon boundaries etc). In the promoter they would act as classical mediators of gene expression . Analysis of human genome release 19 (hg19) indicates that of the 2676 sva elements in the human genome, 433 are present within 10 kb 5 of the main transcriptional start site 1 . Sva elements are functional in conventional reporter gene assay both in vitro (cell line) and in vivo (chick embryo) 2 . Sva elements are polymorphic, most clearly via vntr domains (flanking and internal) a. we have previously shown in other genes (as have many others) that vntrs are both polymorphic biomarkers associated with disorders and transcriptional regulatory domains in vivo and in vitro b. vntrs are common regulatory domains in viruses; i. they in part control hsv-1 virus latency in dorsal root ganglia (via a similar cccctc repeat to that found in the flanking sequence of the sva element) ii . Sva elements can be associated with active chromatin adjacent to: a. positive affymetrix probe arrays in the human cns b. encode active histone marks 4 . Sva elements have the potential to form structures which may be strong modulators of genome structure / function: a. potential g4 quadruplex b. strong cpg component approaching the classical requirements to be defined as cpg islands, which is consistent with their differential methylation in tumors in our analysis of the fus sva element we generated reporter gene constructs that were analyzed in both the neuroblastoma cell line, sk - n - as and a chicken embryo model the distance of the sva element from its site of action on a specific promoter or transcriptional start site can be quite large . It has been demonstrated by us and others when attempting to reproduce endogenous gene expression in transgenic models, that regulatory domains utilized by a locus can be 100kb+ away from the gene itself . Our own studies on the endogenous expression of the neuropeptide, substance p encoded by the tac1 gene demonstrated that although the gene itself from 5 to 3 utr was 8 kb, we required a dna fragment of 350 kb to reproduce the appropriate expression patterns the recent evolution of sva elements has imposed restricted sequence variation in each of the sva subclasses; this may allow a concerted response to challenge by groups of sva elements with similar primary sequence based on sequence specific dna binding proteins . In this manner it might be possible for sva elements containing similar primary sequence such as is present in the hexamer repeat or central vntrs to bind similar transcription factors based on shared consensus dna binding domains . Thus alterations in active transcription factor complement in the cell might modulate several sva elements by the same signal transduction pathways . The frequency of sva element retrotransposition is estimated to be 1:916 births which would correspond to 7 10 our recent work suggests that sva elements can in part modulate genome function via their action as a transcriptional or epigenetic modulator . Polymorphism in the vntrs within these retrotransposons demonstrates a mechanism not only for differential regulatory function associated with genotype but a way to rapidly integrate polymorphism in the sva element as a potential biomarker for disease association without the requirement for retrotransposition.
Bicycle riding is popular throughout the world for transportation, recreation, sports, and health - related benefits . 53% are men . In korea, according to the needs of the times, such as economic development and increased leisure time, a trend for preferring environmentally friendly sports, and growing interest in health and well - being, the awareness of cycling as a leisure sport has recently increased . There were 24,406 recreational bicycle riders in 911 bicycle clubs in korea as of january 2010 . Bicycling is an ideal form of aerobic, nonimpact exercise with established protective cardiovascular effects and a beneficial influence on the risk of hypertension, diabetes, and stroke . Although there are controversies about changes to the genitourinary system in subjects who cycle, bicycle riding has been known as a common source of acute traumatic injuries as well as overuse injuries [4 - 6]. Bicycling studies suggest perineal trauma, pressure, or both may have a role in these genitourinary hazards . Many of them directly affect the genitourinary tract, causing genital numbness, erectile dysfunction (ed), priapism, infertility, hematuria, and effects on serum prostate - specific antigen (psa) levels . Many healthy recreational bicycle riders have questioned urologists about the relationship between bicycle riding and prostate - related lower urinary tract symptoms (luts). But to the best of our knowledge, there has been no study of luts in male recreational bicyclists . With this study, our goal was to evaluate the impact of bicycle riding on luts and sexual dysfunction in men with the use of amateur marathoners as a control group of physically equivalent individuals with a low level of perineal pressure or trauma . A total of 22 healthy male amateur bicycle riders from two bicycling clubs in jeonju, korea, were studied . The recruitment criteria were age between 40 and 50, bicycling period of more than 1 year before the study, three or more times of cycling per week, and 30 minutes or more of cycling duration per time . The controls were 17 healthy male marathoners from an amateur marathon club in jeonju, korea ., all subjects were informed about the experimental procedures, which were in accordance with the ethical standards of chonbuk national university hospital, and were required to give written informed consent . The evaluation contained a study questionnaire assessing sports participation habits, urological and medical history, the international prostate symptom score (ipss), the international index of erectile function (iief), the international continence society (ics) male questionnaire - short form, the overactive bladder symptom score (oabss), and the premature ejaculation diagnostic tool (pedt). An ipss of more than 7 defined the voiding dysfunction (vd) group, and erectile ed was defined as a score of 21 or less on the iief-5, an abridged 5-item version of the iief-15, which ensured identification of the mildest forms of ed . Furthermore, we examined serum total prostate - specific antigen (tpsa), free prostate - specific antigen (fpsa), uroflowmetric values, postvoid residual (pvr) urine volume, and transrectal ultrasound (trus, b&k medical, herlev, denmark) of the prostate in all subjects . Chicago, il, usa). To test differences between the two groups in serum tpsa, fpsa, uroflowmetric values, pvr urine volume, calculated volume of the prostate using trus, and the total or subscale score of each questionnaire, we used independent - sample t - tests with statistical significance as p<0.05 . Also, we compared the two groups for the prevalence of vd and ed by using the chi - square or fisher's exact tests with statistical significance as p<0.05 . A total of 22 healthy male amateur bicycle riders from two bicycling clubs in jeonju, korea, were studied . The recruitment criteria were age between 40 and 50, bicycling period of more than 1 year before the study, three or more times of cycling per week, and 30 minutes or more of cycling duration per time . The controls were 17 healthy male marathoners from an amateur marathon club in jeonju, korea ., all subjects were informed about the experimental procedures, which were in accordance with the ethical standards of chonbuk national university hospital, and were required to give written informed consent . The evaluation contained a study questionnaire assessing sports participation habits, urological and medical history, the international prostate symptom score (ipss), the international index of erectile function (iief), the international continence society (ics) male questionnaire - short form, the overactive bladder symptom score (oabss), and the premature ejaculation diagnostic tool (pedt). An ipss of more than 7 defined the voiding dysfunction (vd) group, and erectile ed was defined as a score of 21 or less on the iief-5, an abridged 5-item version of the iief-15, which ensured identification of the mildest forms of ed . Furthermore, we examined serum total prostate - specific antigen (tpsa), free prostate - specific antigen (fpsa), uroflowmetric values, postvoid residual (pvr) urine volume, and transrectal ultrasound (trus, b&k medical, herlev, denmark) of the prostate in all subjects . Chicago, il, usa). To test differences between the two groups in serum tpsa, fpsa, uroflowmetric values, pvr urine volume, calculated volume of the prostate using trus, and the total or subscale score of each questionnaire, we used independent - sample t - tests with statistical significance as p<0.05 . Also, we compared the two groups for the prevalence of vd and ed by using the chi - square or fisher's exact tests with statistical significance as p<0.05 . A total of 22 recreational bicyclists ranging in age from 42 to 57 years completed the questionnaires and were included in the assessment . The riders had cycled for a period of 1 to 10 years (range, 4.052.04 years), 3 to 6 times per a week (range, 4.231.19 times), and with 60 to 240 minutes of cycling duration per time (range, 9159 minutes). The subjects' body mass index (bmi) ranged from 22.8 to 34.6 kg / m (range, 25.92.67 kg / m). There were no significant differences between the two groups in age, bmi, comorbidities, or exercise habits (table 1). There were no significant differences in the total and subscale scores of the ipss between the two groups . The prevalence of vd on the basis of the ipss was not significantly different between the two groups (8/22 vs. 4/17, p=0.494). There were no significant differences in total and subscale scores of the iief between the two groups . The prevalence of ed based on the iief was not significantly different between the two groups (11/22 vs. 10/17, p=0.748). Also, we found no statistical differences in other questionnaires such as the oabss, ics male questionnaire - short form, and pedt (table 2). As shown in table 3, there were no significant differences between the two groups regarding uroflowmetric parameters such as peak urinary flow rate (qmax), voided urine volume, or pvr urine volume . In all subjects, prevoid urine volume was at least 150 ml and voided urine volume was at least 125 ml . In the cyclists, the mean calculated volume of the prostate by trus was 23.32 cc and there was no statistically significant difference between the two groups (23.32 vs. 23.71, p=0.848). Also, the serum tpsa level was within the normal range in all subjects and there was no significant difference between the two groups (0.800 vs. 0.888, p=0.470). The prevalence of a significantly low qmax, excess pvr, or benign prostatic hyperplasia was not significantly different between the two groups (table 3). The most common bicycling - associated urogenital problems are nerve entrapment syndromes presenting as genitalia numbness, which was reported in 50% to 90% of cyclists, followed by erectile dysfunction in 13% to 24% . Other less common symptoms include priapism, penile thrombosis, infertility, hematuria, torsion of the spermatic cord, prostatitis, perineal nodular induration, and elevated psa, which are reported only sporadically . Bicycle riding is used throughout the world for well - known exercise, fitness, and recreational benefits . As such, it is not surprising that these statements have created much controversy . In our study population, we investigated in particular the relationship between bicycle riding and luts or sexual dysfunction by use of questionnaires; thus, we did not ask the study group about complications such as genitalia numbness . To date recently, saka et al reported that bicycle riding has no impact on serum psa levels and urinary flow parameters . The goal of their study was to investigate whether professional bicycle riding altered plasma concentration of tpsa, fpsa, percent free psa (f / t psa), and urinary flow parameters in healthy men . We present a cross - sectional study of the effects of bicycle riding, a sport with perineal impact, on genitourinary function in men . In our study, the subjects were amateur recreational bicycle riders from clubs, and we aimed to find any hazards of bicycle riding in male luts or sexual dysfunction . Our hypothesis was that if bicycle riding had any impact on the genitourinary tract there would be significant differences in genitourinary functional parameters between a regular long - term bicycle - riding group and control group of physically equivalent individuals with a low level of perineal pressure or trauma, such as a regular long - term marathon running group . However, there were no significant differences between the two groups regarding the questionnaires, uroflowmetric parameters, pvr urine volume, prostate volume, or serum psa level . Thus, we found the inverse of our hypothesis: that bicycle riding may have no hazardous impact on genitourinary health in recreational male bicycle riders . The prevalence of luts or vd as defined by an ipss of 8 was not significantly different between the two groups . Physical activity has been documented to be protective against luts in previous studies, and the perineal impact of bicycle riding does not seem to offset that effect . Many of the bicyclists enrolled were very energetic and confident of their health, and there were no significant differences in the uroflowmetric analysis results, trus - measured prostate volume, or serum psa level . Bicycle - riding - induced perineal impacts do not have enough influence on the prostate mechanically or physiologically . Previous reports about the effect of bicycling on serum psa concentrations were not conclusive, but in recent studies the dominant finding was that there was no statistically or clinically significant change in psa levels regardless of cycling [7 - 12]. No other published data have compared questionnaires evaluating luts, uroflowmetric analysis results, or trus - measured prostate volume of regular long - term amateur bicycle riders with a control group of physically equivalent individuals with a low level of perineal pressure or trauma such as a regular long - term runner group . Previous studies have reported an association between bicycling and sexual dysfunction, but those studies were based on biological measurements such as penile blood flow, focused on sexual dysfunction after prolonged exposure to perineal impact, or suggested a trend but no strong association . The results of our study support the observation of others that bicycle riding has no effect on luts and male sexual function . First, the cross - sectional study structure may have affected the validity of the results . We did not collect baseline data about luts and sexual dysfunction parameters before activity from either group . We implemented a cross - sectional study design as an efficient and cost - effective investigation to perform a preliminary exploration for an association with the potential to generate additional hypotheses for more structured research . Second, the small number of subjects may have introduced some selection bias into the results . However, we suspect that the influence of the bias may be weak because almost all of the 5th and 6th decades of each club participated in our study . We plan to do vertical, annual follow - up studies of the subjects . The fact that the results of our study are consistent with data from other studies in similar sports supports the validity of our results and decreases the chance of systemic errors . More assessment of the effect of bicycle riding on the human pelvic anatomy and genitourinary complaints is warranted to further validate the results of this study . Concern about bicycle riding as a leisure sport has recently increased as many urological outpatients and healthy recreational bicyclists have questioned urologists about the relationship between bicycle riding and prostate - related luts and sexual dysfunction . In our opinion, bicycle riding seems to have no statistically measurable effect on luts or sexual functioning in men, at least in amateur recreational bicyclists . There is a need for further large - scale research on this subject and study of the underlying mechanisms leading to cycling - related luts and sexual dysfunction.
However, it is difficult to determine an appropriate resection line using only the laparoscopic approach . For more appropriate resection, laparoscopic and endoscopic cooperative surgery (lecs) on the other hand, gastric plexiform angiomyxoid myofibroblastic tumor (pamt) has recently emerged as a new entity among gastrointestinal mesenchymal tumors which was first described by takahashi et al . In 2007 . This is a rare tumor with equal gender distribution and occurs primarily in adults with a wide age range of 783 years [3, 4]. However, the bland nuclear features, low proliferative index and absence of necrosis, vascular invasion, recurrence and metastasis in all cases of pamt reported to date justify its characterization as a benign tumor . Suggested that vascular invasion and extragastric extension of the tumor were not typically observed in pamt . Currently, distal or partial gastrectomy remains the treatment of choice . To our knowledge, a 39-year - old male patient visited our hospital because of epigastric pain . In an upper gastrointestinal endoscopy examination, gastroscopy revealed a 3.5 3.0 cm sessile polypoid mass with a smooth surface in the anterior wall of the gastric antrum with a recessed area . We considered that this tumor was located in the muscle layer (fig . 1). The ct scan showed a heterogeneous tumor in the gastric antrum, which was drastically enhanced with contrast medium, and consisted of a number of highly stained small nodules around the tumor rim (fig . 2). Radiological imaging suggested differential diagnoses of angioma and solitary fibromyxoma because of the hypervascular nature of the tumor . However, because the tumor did not protrude into the lumen of the stomach, these diagnoses were unlikely . Lecs combines laparoscopic gastric resection with endoscopic imaging for tumor location and determining an appropriate resection line . Aggregations of small polypoid nodules, red - colored and angiomatous, were characteristically seen on the serous membrane surface, and appeared like a metastatic lymph node nodule (fig . First, we located the tumor and cut the surrounding mucosa of the lesion by endoscope . We perforated the gastric wall at the distal side of the tumor using needle knife without injuring the pylorus . Next, the seromuscular layer was dissected laparoscopically with an ultrasonically activated device tracing the mucosal line cut . A partial gastrectomy by lecs revealed the tumor at the antrum of the greater curvature side of the stomach, and the incision line was closed on suturing by layer - to - layer anastomosis . The tumor was composed of bland spindle cells which were separated by abundant myxomatous stroma and showed plexiform growth in the entire stomach wall (fig . The tumor cells were negative for cd117 (c - kit), cd34 and s-100 protein, but diffusely positive for smooth muscle actin consistent with predominant myofibroblastic differentiation (fig . The tumor was especially characterized by multiple nodules protruding outward from within the serosa, and we diagnosed the patient with pamt . The patient received supportive care without any specific medication during hospitalization and had no recurrence or metastasis during follow - up for 9 months after the surgery . Pamt is a rare mesenchymal tumor of the stomach, which consists of spindle cells with myofibroblastic characteristics . Estimated that the frequency of pamt is less than 1/150 that of gastrointestinal stromal tumor, but only 28 cases of pamt have been reported, including the present case . The prevalence of pamt does not vary by sex (m: f = 1: 1) and it can develop at any age (range: 783 years). There are few reports describing the ct findings for pamt [2, 7]. They reported that ct findings of tumor location in the gastric antrum, a heterogeneous internal enhancement effect, and small nodules with a strong enhancement in the rim could be used for radiologic diagnosis of pamt . In our case, all three ct findings were evident . Pamt is considered a benign tumor . However, due to its rarity, the true biological potential of pamt remains unknown . So, complete resection when functional preservation is possible is appropriate . On the other hand, lecs is the best procedure for complete resection while preserving the pylorus because of the gastric antrum of predilection for pamt . To our knowledge, when a myxoid spindle cell lesion is observed in endoscopic biopsy or when there are characteristic ct findings, pamt should be included in the differential diagnosis.
Myelodysplastic syndromes (mdss) represent a group of clonal hematological disorders characterized by progressive cytopenia reflecting defects in erythroid, myeloid and megakaryocytic maturation . Anemia, neutropenia and thrombocytopenia, separated or in combination, despite a hyper- or normocellular marrow define mds . Hypoplastic mds (h - mds) accounts for 1217% of all patients with mds . Clonality studies of mature blood cells and immature progenitors suggest that a myeloid lymphoid stem cell might be the principal target for clonal transformation at least in a major part of mds . An association between mds and autoimmune disorders and with chronic t - cell disorders like large granular lymphocytic leukemia (lgl) has been recognized and is suggestive of an abnormal functioning immune system in mds . Lymphoproliferative disorders, especially t - prolymphocytic leukemia (pll) developing in an h - mds patient, is extremely rare and has an aggressive course . We are reporting a unique case of t - pll developing in h - mds, and this is probably the first case report in the literature . A 45-year - old male was admitted with generalized weakness, palpitation, gradual weight loss and frequent syncopal attacks for more than 2 years . On examination, the iron profile was: serum iron 115.50 g / dl, total iron binding capacity 177.10 ng / ml and markedly elevated b12 levels (> 2000 pg / ml). Hemoglobin was 3.9 gm%, total leukocyte count was 2100 cells / cumm, platelet count was 70,000 cells / cumm and reticulocyte count was 0.8% at the time of admission . Pancytopenia [figure 1a] was persistent on every visit and the peripheral smear showed normocytic and macrocytic rbcs, leukopenia, hypogranular and pseudo pelger - huet neutrophils [figure 1b and 1c], which were characteristic with relative lymphocytosis and no blasts in the peripheral smear; the platelet count was reduced . The bone marrow aspiration smears and cell block preparation showed severe hypocellularity (<20% for his age) [figure 1d]. Sparse erythroid cells with dyserythropoiesis [figure 2a and 2b], minimal dysmyelopoietic (hypogranular and hyposegmented myeloid cells - 10%) and dysmegakaryopoietic (hypolobated and micromegakaryocytes [figure 2c and 2d] features were evident with blasts <5% and absence of fibrosis in biopsy sections . The possibility of aplastic anemia and hypoplastic acute myeloid leukaemia (h - aml) were ruled out . A diagnosis of primary h - mds was made in the absence of chemotherapy and radiotherapy . The patient was transfusion dependent and later started on thalidomide . On follow - up within few months, because of persistent pancytopenia, the patient was subjected for repeat bone marrow study, where the smear and section showed cellular marrow with diffuse infiltrate of mature lymphocytes (60%) [figure 3a and b] with no evidence of improved hematopoiesis . The neoplastic cells showed a mature t - cell immunophenotype, cd3 +, cd4 +, cd5 +, cd7 + and cd8 +, and tdt-, cd20-, cd23-, cd79a-, cd34-, bcl2- and cyclind1-, and was diagnosed as t - pll . (d) hypocellular marrow - cell block preparation h and e, 10 (a) dyserythropoiesis with multinucleation in bma . (c) dysmegakaryopoiesis - cell block h and e, 40. (d) dysmegakaryopoiesis bma (a) lymphoid infiltrate in bma . The diagnosis may be difficult in h - mds if the aspirate is so sparsely cellular as to preclude cytogenetic studies . Significant clonal cytogenetic abnormalities are present in only half of all mds cases, and full karyotype analysis, which requires cells in metaphase, may not be possible because cells may be scarce or senescent . We encountered similar problems when there was hypocellular marrow, but later, when diagnosed as t - pll, the marrow culture showed a normal karyotype . There is growing scientific evidence supporting the hypothesis that cytogenetic abnormalities are not the initiating clonal event but are acquired during disease progression . H - mds has yet to be shown to alter the disease course or prognosis, but some studies suggest benefit from immunosuppressive therapeutics . It is presently unknown whether h - mds patients have a preceding, but unrecognised, phase of excessive apoptosis insufficiently compensated by hyperproliferation, or whether their disease is more related to aplastic anemia . Several years ago, in vitro studies have proven that autologous cytotoxic t - lymphocytes can exert an inhibitory effect on mds myelopoiesis . An association between mds and autoimmune disorders and with chronic t - cell disorders like lgl has been recognized and is suggestive of an abnormal functioning immune system in mds . But, occurrence of t - pll in h - mds is extremely rare and, possibly, this is the first case in the literature . The immunophenotype is that of mature t - cell, which is usually cd4 + but, occasionally, can be cd8 +, which was evident in our case . Expression of cd7 helps to distinguish it from other clpds, like sezary syndrome and adult t - cell leukemia / lymphoma . To conclude, the finding of activated and clonal t - cell population in mds is further argument for the use of immunosuppression to treat the cytopenias of mds.
Intracranial foreign bodies via the transorbital route are rare.1 amongst cases of transorbital intracranial injury, projection of the foreign body through the superior orbital fissure occurs in an estimated 68% and damage typically occurs to the brainstem, cavernous sinus, or temporal lobe.2 introduction of a foreign body via the orbit can occur either via missile projection or via stab injury, and the trajectory into the brain may be related to the mechanism of injury.23 obtaining a thorough history and establishing a high level of suspicion for these types of injuries when periorbital trauma is found on physical exam is important, as in the case of missiles the patient may be unaware that a foreign body was retained24 and stab injuries may be associated with psychiatric illness that may limit reliable history . 567 here we describe a unique foreign body within the brain: the bristled end of an electric toothbrush, which entered the parenchyma of a patient's right temporal lobe as a projectile through the medial orbit . The case is framed here in a description of the radiographic findings as a function of the mechanism of injury relative to similar cases, the surgical decision making involved in safe extraction of intracranial foreign bodies via modern modified skull base technique, and considerations for antibacterial prophylaxis . A 35-year - old woman employed as a dental hygienist was transferred from an outside facility to our level - one trauma center after presenting with a foreign body in her right orbit . She reported that while at home the prior evening, she was in the bathroom with her husband who became enraged when his electric toothbrush failed to work properly, and that he threw the device at a nearby wall . The toothbrush (sonicare; philips, andover, massachusetts, usa) reportedly shattered into numerous pieces upon impact with the wall and one of these flew directly into the patient's right medial orbit . She stated that in addition to pain, initially she had blurred but not absent vision in the right eye . At the time of presentation to our institution, her eye had swollen shut and she complained of constant, severe aching pain in her right eye and a bilateral headache that radiated to the back of her neck . At the outside facility the patient was medicated for pain and given piperacillin / tazobactam (zosyn, pfizer, new york, new york, usa), and a computed tomography (ct) scan of the head and a ct angiogram (cta) were obtained, as were basic serum laboratories . On examination at our institution the patient had stable vital signs; she had a glasgow coma scale (gcs) of 15 and was in moderate distress . Her right eyelid was swollen shut, and there was no obvious external foreign object visible . There was a small curvilinear laceration just below her medial canthus, and her lacrimal punctum were intact . A cta and a thin - cut ct scan of the head were obtained prior to surgery for surgical planning and neuronavigational purposes (fig . A foreign body with visible bristles consistent with the head of the toothbrush was visualized entering medially to the globe, traveling through the superior orbital fissure (sof), and breaking through the greater sphenoid wing into the middle fossa with a laterally displaced fragment and ending in the anterior temporal lobe (fig . The optic canal was intact; however, the shaft of the toothbrush head did appear to touch the optic nerve . Preoperative computed tomography (ct) and computed tomography angiography (cta) with toothbrush violating the right middle fossa . (a) axial ct with fracture through the right sphenoid bone with toothbrush bristles visible . (d) lateral cta showing proximity of foreign body to right middle cerebral artery (mca) bifurcation . After neurosurgery service evaluation, ophthalmology was consulted and the decision was made to perform urgent surgical extraction of the foreign body . The patient was consented for a modified frontotemporal orbitozygomatic craniotomy with extraction of the intraorbital and intracranial portions of the toothbrush . In the operating room a curvilinear incision was made behind the hairline from the root of the zygoma curving gently toward the contralateral mid - pupillary line . A two - piece supraorbital modification of the orbitozygomatic approach was performed as described previously8 by drilling three bur holes one at the mccarty keyhole, one in the inferior squamous bone, and one in the posterior frontal calvarium . These were connected with a foot - plate drill to create a pterional craniotomy, and the drill was also used to extend the craniotomy anteriorly to the edge of the orbital bar . A reciprocating saw was used to score a sagittal cut through the orbital rim lateral to the supraorbital foramen and then a coronal cut medial to lateral along the anterior skull base toward the superior orbital fissure, as well as a lateral cut just lateral to the frontozygomatic suture down to the superior orbital fissure . The sphenoid wing was drilled down and the lateral orbital wall was partially taken down to the superior orbital fissure to further decompress the orbit (fig . 3b). The temporal lobe could then be elevated, and the skull base followed toward the superior orbital fissure until the bristles of the toothbrush head could be located (fig . The sphenoid was then drilled laterally to the trajectory of the foreign body until there was sufficient space to mobilize the toothbrush (fig . 3c). When the head of the toothbrush was freed and mobile it was pulled posteriorly while simultaneously maintaining pressure on the toothbrush shaft to keep it pressed down against the skull base to help prevent additional friction on the optic nerve (fig . Ophthalmology measured the intraocular pressure immediately before (19 mm hg) and after surgical treatment (8 mm hg). (d) distal end of toothbrush fragment exiting middle fossa (note downward pressure being placed to keep it against the skull base and preventing further damage to optic nerve). Her vision remained 20/400 throughout her 3-day hospitalization, and limited lateral rectus function was noted . Our infectious disease team was consulted for recommendations for antibiotic coverage for intraparenchymal oral flora . She was also evaluated by our social work service and was deemed safe to return home with her husband . Two weeks postictus, the patient noted improving pain and improving vision (20/50). Since the event she had quit her job as a dental hygienist after neurosurgery service evaluation, ophthalmology was consulted and the decision was made to perform urgent surgical extraction of the foreign body . The patient was consented for a modified frontotemporal orbitozygomatic craniotomy with extraction of the intraorbital and intracranial portions of the toothbrush . In the operating room a curvilinear incision was made behind the hairline from the root of the zygoma curving gently toward the contralateral mid - pupillary line . A two - piece supraorbital modification of the orbitozygomatic approach was performed as described previously8 by drilling three bur holes one at the mccarty keyhole, one in the inferior squamous bone, and one in the posterior frontal calvarium . These were connected with a foot - plate drill to create a pterional craniotomy, and the drill was also used to extend the craniotomy anteriorly to the edge of the orbital bar . A reciprocating saw was used to score a sagittal cut through the orbital rim lateral to the supraorbital foramen and then a coronal cut medial to lateral along the anterior skull base toward the superior orbital fissure, as well as a lateral cut just lateral to the frontozygomatic suture down to the superior orbital fissure . The sphenoid wing was drilled down and the lateral orbital wall was partially taken down to the superior orbital fissure to further decompress the orbit (fig . 3b). The temporal lobe could then be elevated, and the skull base followed toward the superior orbital fissure until the bristles of the toothbrush head could be located (fig . The sphenoid was then drilled laterally to the trajectory of the foreign body until there was sufficient space to mobilize the toothbrush (fig . 3c). When the head of the toothbrush was freed and mobile it was pulled posteriorly while simultaneously maintaining pressure on the toothbrush shaft to keep it pressed down against the skull base to help prevent additional friction on the optic nerve (fig . Ophthalmology measured the intraocular pressure immediately before (19 mm hg) and after surgical treatment (8 mm hg). (d) distal end of toothbrush fragment exiting middle fossa (note downward pressure being placed to keep it against the skull base and preventing further damage to optic nerve). Her vision remained 20/400 throughout her 3-day hospitalization, and limited lateral rectus function was noted . Our infectious disease team was consulted for recommendations for antibiotic coverage for intraparenchymal oral flora . She was also evaluated by our social work service and was deemed safe to return home with her husband . Two weeks postictus, the patient noted improving pain and improving vision (20/50). Since the event she had quit her job as a dental hygienist . The neurosurgical literature contains an abundance of reports of foreign bodies that have entered the cranial vault via the sof . Penetrating traumatic injury of the brain via the skull is relatively uncommon, representing 0.4% of traumatic head injuries,9 and though the transorbital route certainly represents only a small fraction of these injuries, descriptions of foreign bodies entering the brain via the sof are especially interesting as it is second in size only to the foramen magnum as a route to the brain that can be traversed without bony fracture . Protection of the brain within a strong bony enclosure is an extremely conserved feature of vertebrate evolution; therefore, brain injuries that bypass this guard highlight a chilling vulnerability to relatively low force mechanisms . This report adds not only another novel man - made object to the list of those that have entered living human brain, but also draws attention to a unique trajectory and mechanism of insertion as well as approaches to surgical management and considerations for prevention of infection . Reports of toothbrush injury upon the brain are rare . Excluding reports of nonpenetrating toothbrush - induced seizures,1011 there is only one report of a toothbrush handle entering the brain.12 in that case the handle end entered the sof and terminated in the medial middle fossa; the bristled end of the brush, however, remained well outside of the orbit . Although there has been a prior report of the bristled end of a toothbrush entering the medial orbit,13 the brush in that case avoided the sof and ended up extracranially in the ethmoid sinuses . Most reports of intracranial foreign bodies that enter through the sof describe objects that approximate a wedge or stylus shape, allowing them to dissect through tissue planes, slide against the orbital walls, and pass through the slitlike sof . Examples of these types of foreign bodies include pens and pencils,451214 chopsticks,1516 paintbrush handles,17 and knives.1819 the blunt, widened end of a toothbrush makes for an atypical missile head and warrants special consideration for removal . Many reports of intracranial foreign bodies entering via the orbit describe a cautious orbital removal, pulling the object out of the brain via the orbit after appropriate imaging has been obtained . Other cases are managed via extensive surgical approaches,18 but even in many of these cases the goal is protection of critical anatomy and reduction of bony obstacles prior to withdrawal of the object via the orbit and repair of dural defects after removal . Descriptions of anterograde removal of transorbital intracranial foreign bodies are scarce.320 although the head to shaft ratio of the foreign body described here is considerably less than that of a hunting arrow, the anterograde technique of removing the intracranial foreign body along its trajectory of entry as described by o'neill et al20 was felt to have the lowest risk of additional injury to brain parenchyma, neurovasculature, and the optic nerve in this case, given the enlarged leading end of the toothbrush . The patient's presentation was consistent with a traumatic sof syndrome (rochon - duvigneaud syndrome), prompting urgent decompression of the sof by removal of the foreign body.21 the orbitofrontal modification of the frontotemporal orbitozygomatic approach used in this case allowed for decompression of the orbit and an improved trajectory, and also allowed the brain to sag away from the temporal skull base, thus minimizing the need for brain retraction while drilling the skull base . The majority of reported transcranial foreign bodies that traverse the sof are introduced in a stabbing fashion, presumably at relatively low velocities . Missile - type entry is less common and is believed to be more likely to involve bony fracture rather than simply following the course of the orbital walls into the sof at the orbital apex.23 in this case the lightweight toothbrush head became a projectile missile after it detached from the heavy battery base unit upon impact with a wall . The resultant injury with a trajectory through the sof but with fracture of the medial sphenoid wing was fittingly somewhere in between a low - velocity stab wound where the bony anatomy guides the entire trajectory and a maximal velocity missile injury where the foreign body shows little respect for the bony structures . The trajectory in this case notably fits the zone - entry model outlined by turbin et al2 in which an entry point in the medial inferior aspect of the lower eyelid (zone 3c) predicts temporal lobe injury and sphenoid wing injury . This case also serves as testimony to the potentially minimized physical exam findings with transorbital intracranial injuries . If the shaft of the foreign body remains visibly protruding from the orbit, it is likely to garner quite a lot of attention regardless of the true extent of intracranial injury however, as numerous authors have pointed out in similar cases, if the entire object lies behind the plane of the face, the initial physical presentation can mute what may end up being a very drastic intracranial injury . This is perhaps best illustrated in a case where the diagnosis of a transorbital intracranial pen was overlooked until autopsy.5 any foreign body entering the brain parenchyma under unsterile conditions raises a significant concern for cerebritis, meningitis, or abscess formation even after rapid complete extraction of the offending object . In their review of transorbital penetrating injuries, schreckinger et al4 recommended initiation of broad - spectrum antibiotics with good central nervous system (cns) availability early on, but admittedly there are no data - supported guidelines for postoperative microbe control . In a 1977 review of 42 cases of retained transorbital intracranial wooden bodies, nearly half of the patients developed intracranial abscess.22 another pre - ct era study described 13 infections in a review of 44 patients (30%) with transorbital intracranial injury.1 importantly however, in 16 of the patients in that group (36%) diagnosis was delayed for more than 24 hours (most more than 1 week). In the modern neurosurgical era, gross total removal should be possible early on in the vast majority of cases and the risk of serious infection considerably lower . Even in an era of frequent neuroimaging, it should be noted that a high index of suspicion may be necessary for rapid diagnosis of retained foreign bodies in cases of periorbital trauma . In turbin et al's more recent 2006 review,2 4 of 21 cases (19%) of occult (delayed diagnosis) transorbital intracranial foreign bodies were described as complicated by abscess or meningitis, whereas 1 of 16 cases (6%) of nonoccult injury was described as complicated by abscess . In the case described here, the toothbrush bristles exposed to the oral flora of another individual were introduced into the orbit and brain parenchyma of our patient . Used toothbrush bristles are known to harbor an extensive variety of aerobic and anaerobic pathogens originating from cutaneous and oral flora.2324 therefore, despite the lack of evidence supporting postsurgical prophylaxis, at the recommendation of our infectious disease service broad prophylactic coverage with clindamycin and ciprofloxacin for 1 week was considered appropriate . We present a unique case of transorbital traumatic brain injury from a bristled toothbrush head projectile . Surgical management of transorbital intracranial injury should take into account intraocular pressure, the presence of an orbital apex syndrome or superior orbital fissure syndrome, the potential for additional damage to neurologic or vascular anatomy, and the potential need for bony decompression and dural repair . Modern skull base approaches that permit simultaneous orbital decompression with optimal brain exposure and operative trajectories may be well suited to penetrating orbital injuries . Attention to the shape of the foreign body and surrounding neurovascular structures should guide whether an anterograde or retrograde (back out through the orbit) removal is indicated . Although wooden objects have a reputation as potent fomites, bristled oral - care objects should also be regarded as high risk for infection if they violate natural defensive barriers . A multidisciplinary approach to transorbital intracranial injuries is recommended with ophthalmology, neurosurgery, infectious disease, and potentially facial plastics services involved early on in management . Given the high incidence of either psychological disease and or violence associated with these types of injuries in the literature, psychiatric or social work consults should be strongly considered as well.
Because of the therapeutic potential of inhibiting fatty acid amide hydrolase (faah) for the treatment of pain, inflammatory, or sleep disorders, there is a continuing interest in the development of selective inhibitors of the enzyme . The distribution of faah is consistent with its role in regulating signaling fatty acid amides including anandamide (1a) and oleamide (1b) at their sites of action (figure 1). Although faah is a member of the amidase signature family of serine hydrolases for which there are a number of prokaryotic enzymes, it is the only well - characterized mammalian enzyme bearing the family s unusual ser ser lys catalytic triad . Early studies following the initial identification of the enzyme led to the disclosure of a series of substrate - inspired inhibitors that were used to characterize the enzyme as a serine hydrolase . Subsequent studies disclosed several classes of inhibitors that provide opportunities for the development of inhibitors with therapeutic potential . These include the reactive aryl carbamates and ureas that irreversibly carbamylate the faah active site catalytic serine . A second, and one of the earliest classes, is the -ketoheterocycle - based inhibitors that bind to faah by reversible hemiketal formation with the active site catalytic serine . Many of these reversible, competitive inhibitors have been shown to be selective for faah versus other mammalian serine hydrolases as well as efficacious analgesics in vivo . In these studies, 2 (ol-135) emerged as a potent (ki = 4.7 nm) and selective (> 60300 fold) prototypical faah inhibitor that induces analgesia and increases endogenous anandamide levels . It lacks significant off - site target activity, does not bind cannabinoid (cb1 or cb2) or vanilloid (trp) receptors, and does not significantly inhibit common p450 metabolism enzymes or the human ether - a - go - go related gene product (herg). The analgesic effects of 2 are observed without the respiratory depression or chronic dosing desensitization characteristic of opioid administration or the increased feeding and decreased motor control characteristic of cannabinoid (cb) agonist administration . It possesses a relatively short duration of in vivo activity relative to irreversible inhibitors, although further conformational constraints in the c2 acyl chain of 2 have provided inhibitors that are not only orally active but also exhibit extended durations of in vivo activity . Activity relationship (sar) studies on 2 exploring substitution of the central oxazole, the c2 acyl side chain, and the central heterocycle, the x - ray characterization of inhibitor - bound complexes defined key features that impact inhibitor affinity and selectivity . These include not only the ser241 hemiketal formation with the inhibitor electrophilic carbonyl and its interaction with the enzyme oxyanion hole but also an unusual ser217-mediated oh h - bond to the activating heterocycle and the key anchoring interaction of the terminal phenyl group of the c2 acyl chain . The structural studies also revealed that cys269 is located adjacent to c5 of the inhibitor pyridine substituent, which in turn is engaged in a series of intricate interactions in the enzyme cytosolic port . Herein, we report results of a systematic study of candidate inhibitors containing modifications at the pyridyl c5-position of 2 and related inhibitors that in principle could covalently trap this proximal cys269 to provide inhibitors that alkylate or cross - link the faah active site . In turn, this could be expected to enhance their potency, potentially enhance their selectivity, and extend their in vivo duration of action (figure 2). Herein, we detail the systematic inhibitor modifications that led to the discovery and characterization of such inhibitors and the unexpected trends that the additional strategically placed electrophiles display . The series 1 analogues (322) were accessed from 5-(tributylstannyl)oxazole 1e(36) by stille coupling with the appropriate 2-chloro- or 2-bromopyridine (scheme 1). This was followed typically by tbs ether deprotection (bu4nf) and oxidation of the liberated alcohol with dess martin periodinane (dmp) to provide the corresponding -ketoheterocycles: 3, 7, 9, 14, and 1822 . The remaining inhibitors were accessed by further modification of the pyridyl c5 substituent (scheme 1). The second series, in which the pyridine of 2 is replaced with an alkyl linker to the pendant electrophile, was accessed by sonogashira coupling of 5-bromooxazole 1f(43) with the appropriate alkyne (scheme 2). The alkyne intermediate was reduced to the corresponding alkane with h2 and palladium on carbon or palladium hydroxide . This was followed by tbs ether deprotection (bu4nf) and oxidation of the liberated alcohol with dess martin periodinane (dmp) to yield the series 2 c5-substituted oxazoles: 23 and 28 . Further elaboration of the terminal electrophile (r group) yielded the remaining compounds: 2427 and 2932 . The initial characterization of the candidate inhibitors and their comparison with 2 was conducted using purified recombinant rat faah (rfaah) expressed in escherichia coli(55) at 2023 c as previously disclosed . The initial rates of hydrolysis (> 1020% reaction) were monitored using enzyme concentrations below the initially measured ki values by following the breakdown of c - oleamide, and ki values were established as previously described (dixon plot). Series 1 was developed directly on the basis of 2 (ki = 4.7 nm), placing a potential thiol - capturing electrophile at the 5-position of the pyridine ring (58, 11, 12, 14, and 1622). Thioesters 5 and 16 were expected to be the most straightforward traps for the cys269 thiol by thioester exchange . Without preincubation of the inhibitors with the enzyme, these inhibitors along with their precursors (322) were tested for binding and inhibition of rfaah (figure 3). All display potencies similar to 2, exhibiting ki values in the low nanomolar range . In series 2, the pyridine ring was replaced by an alkyl chain of appropriate length capped with the thiol - engaging moiety . As modeled, this flexible linker is able to reach through the cytosolic pocket and place the potentially reactive electrophile proximal to cys269 . Like the series 1 inhibitors and without preincubation with the enzyme, all series 2 inhibitors exhibited effective faah inhibition with potencies that approach or match that of 2 (figure 3). Because the cys269 alkylation was expected to be slow relative to the rapid hemiketal formation, the time - dependent inhibition of faah was examined . This was accomplished by preincubation of the inhibitors with recombinant rfaah for a period of 16 h. as previously observed, reversible, competitive inhibitor 2 does not display time - dependent inhibition of faah, and its ki value remains unchanged with the enzyme in contrast, a select subset of inhibitors (11, 14, 17, and 2022) in series 1 exhibited significant increases in potency, displaying 220-fold improvements in ki over the same time period, consistent with slow irreversible inhibition of faah . Surprisingly, thioesters 5 or 16 did not exhibit this time - dependent increase in enzyme inhibition potency . Similarly, chloride 12 was found to be relatively nonpotent and insensitive to preincubation with the enzyme, whereas the corresponding bromide 11 was initially more potent and exhibited the most pronounced time - dependent increase in potency of all inhibitors . Both nitrile 7 and its imidate 8, where the candidate electrophile is attached directly to the pyridyl ring, did not display time - dependent increases in potency, whereas both the homologated nitrile 14 and its imidate 17, where a methylene spacer separates the electrophile and pyridyl ring, did exhibit increases in potency with the enzyme inhibitor preincubation . Of the series of inhibitors that might be expected to serve as michael acceptors for a thiol conjugate addition (1822), including the,-unsaturated ester 18 and nitrile 19, only those bearing the weaker activating substituents (2022 vs 18 and 19) that would be expected to react slower and to be intrinsically less reversible displayed the exceptionally potent and time - dependent faah inhibition improvements . Notably and throughout this series, it was not the anticipated electrophiles that exhibited the time - dependent inhibition of faah characteristic of a slow irreversible inhibitor, but rather it was a less - well - recognized alternative (14 and 17 vs 16, 11 vs 12, and 2022 vs 1819). Finally, no inhibitor in series 2 that bears the flexible linker to the second electrophile displayed the time - dependent increases in potency, indicating that the conformationally restricted placement of the second electrophile is important to observation of the targeted alkylation . For the inhibitors that displayed time - dependent increases in inhibitor potency, enzyme activity did not recover after this time period and is indicative of irreversible enzyme inhibition . The compounds that demonstrated time - dependent improvements in potency were further investigated by lineweaver -ketoheterocycle inhibitors including 2 were shown to display well - behaved competitive, reversible inhibition kinetics . Despite expectations but consistent with the lack of time - dependent faah inhibition, lineweaver burk kinetic analysis of thioesters 5, 16, and 25 after 3 h preincubation with the enzyme confirmed that they also behave as reversible, competitive inhibitors, analogous to 2 and related -ketoheterocycle inhibitors (figure 5). Thus, despite the expectations of a facile transthioesterification with cys269, the thioesters exhibit enzyme inhibition characteristic of reversible inhibitors, suggesting that reaction with cys269 does not occur . Significantly, thioesters 5 and 25 were recovered unchanged from the assay buffer (6 h) and from enzymatic assays (5), indicating that they are not undergoing chemical hydrolysis or transient enzyme adduct formation and subsequent hydrolysis under the conditions of the assay . Burk kinetic analysis of 5, 16, and 25 demonstrate reversible, competitive inhibition . In contrast, the inhibitors that demonstrated a time - dependent increase in inhibitor potency also exhibited noncompetitive inhibition of faah when preincubated with the enzyme for 3 h prior to lineweaver this is expected of irreversible enzyme inhibition and consistent with cys269 alkylation or addition to the pendant electrophile . In the case of 11, this entails cys269 thiol nucleophilic displacement of the benzylic bromide to provide the corresponding thioether, and its structure has been confirmed by x - ray analysis of the inhibitor bound to faah . The noncompetitive enzyme inhibition presumably entails thiol nucleophilic addition to the electrophile to provide the cys269-linked thioimidate for 14 and 17, and it presumably involves an apparent irreversible thiol conjugate addition to 2022 . Interestingly, both the,-unsaturated nitrile 19 and ester 18, which do not exhibit time - dependent increases in inhibitor activity or the potent ki values consistent with irreversible inhibition, displayed mixed kinetics, exhibiting competitive inhibition at low inhibitor concentrations and noncompetitive inhibition at high concentrations . Presumably, this indicates that the thiol conjugate addition products derived from 18 and 19 are either formed less effectively or, more likely, that they may be sufficiently reversible at 23 c to less effectively trap cys269 as an apparent irreversible inhibitor of the enzyme . Burk analysis demonstrates noncompetitive faah inhibition for (a) 11, (b) 14, (c) 17, (d) 20, (e) 21, and (f) 22 . Dialysis dilution (4 c, 18 h, 370-fold) of the faah - inhibitor mixture following 3 h of preincubation with 2 restored full enzyme activity, consistent with its reversible enzyme inhibition, whereas the mixtures containing 11, 14, and 1722 remained relatively unchanged, failing to restore faah activity, indicative of irreversible enzyme inhibition under the conditions monitored (4 c, ph 9, figure 7). It is notable that 14 and 17 (not shown), which presumably form a cys269 thioimidate adduct, do not appear to be even slowly reversible under these conditions . Similarly, 2022 displayed irreversible inhibition of faah, consistent with their time - dependent, noncompetitive enzyme inhibition . Interestingly, dialysis dilution at 4 c also did not restore enzyme activity with both the,-unsaturated nitrile 19 and ester 18, which do not exhibit time - dependent faah inhibition and displayed concentration - dependent mixed competitive / noncompetitive kinetics in the lineweaver this suggests that their inhibition of faah following the 3 h incubation (22 c) is not reversible at 0 c . Unfortunately, the reversibility of 18 and 19 at 23 c could not be established because of the instability of faah at 23 c over the dialysis time frame . Faah mixtures illustrates reversible inhibition by 2 and establishes irreversible faah inhibition by 11, 14, and 1722 . After 3 h preincubation of purified recombinant rat faah with compounds at concentrations that result in inhibition of ca . 80% enzyme activity (22 c; 3 h; 100 nm, 2; 80 nm, 11 and 14; 100 nm, 18 and 19; 150 nm, 20; and 80 nm, 21 and 22), and following measurement of residual enzyme activity, dialysis dilution (4 c, 18 h, 370-fold dilution) of the mixtures resulted in nearly full recovery of enzyme activity for 2 but little or no recovery of enzyme activity for 11, 14, and 1722 under the conditions monitored (4 c, ph 9); conducted in triplicate and reported as the percent enzyme inhibition sd . The selectivity of the time - dependent, irreversible faah inhibitors 17 and 2022 were examined along with 11 and 14 that were recently disclosed using activity - based protein profiling (abpp) of the serine hydrolases . Abpp methods permit the testing of serine hydrolases in their native state and eliminate the need for their recombinant expression, purification, and the development of specific substrate assays . Because inhibitors are screened against many enzymes in the proteome in parallel, both relative potency and selectivity can be simultaneously evaluated . Previous studies have shown that the -ketoheterocycle class of inhibitors are selective for faah, although four enzymes have emerged as potential competitive targets: triacylglycerol hydrolase (tgh), hydrolase containing domain 6 (abhd6), monoacylglycerol lipase (magl), and the membrane - associated hydrolase kiaa1363 . Each inhibitor was tested for its effects on the fluorophosphonate (fp)-rhodamine probe labeling of serine hydrolases in the mouse brain (contains kiaa1363, magl, and abhd6) and heart membrane (contains tgh) proteome at concentrations ranging from 10 nm to 100 m . The selectivity assessments were conducted following 6 h inhibitor incubation with the proteomes and all inhibitors showed superb selectivity for faah over kiaa1363 and abhd6 (> 10-fold), excellent selectivity over magl (> 200-fold), and good selectivity over tgh (figure 8). Abpp selectivity screen in mouse brain membrane proteome (1 mg / ml) with fp - rhodamine (100 nm), inhibitor preincubation with the proteome was conducted for 6 h. in initial efforts to screen for in vivo inhibition of faah and its subsequent pharmacological effects, the set of inhibitors displaying the time - dependent, irreversible faah inhibition (11, 14, 17, and 2022) were examined alongside of 2 for their ability to increase the endogenous levels of a series of lipid amide signaling molecules that are substrates for faah in both the brain (cns effect) and liver (peripheral effect, not shown). Thus, the effects of the inhibitors on the endogenous levels of the faah substrates anandamide (aea), oleoyl ethanolamide (oea), and palmitoyl ethanolamide (pea) were measured . Notably, it is the increase in endogenous levels of anandamide and its subsequent action at cannabinoid (cb1 and cb2) receptors that are thought to be responsible for the analgesic and anti - inflammatory effects of faah inhibitors . Administration of inhibitor in three mice per time point for an initial screen (30 mg / kg). Significantly, increases in endogenous levels of anandamide in the brain requires> 90% inhibition of faah for in vivo enzyme inhibition . With the exception of imidate 17, which matched the increased anandamide levels observed with 2 after 3 h, each of the additional inhibitors proved to be roughly equivalent (11, 14, and 20> 21 and 22), increasing anandamide levels approximately 2-fold over that of 2 and approximately 3-fold over vehicle treatment (figure 9)., 30 mg / kg, n = 3). With pea and oea, which show significant enhancements in endogenous levels with partial enzyme inhibition and are less sensitive to the extent of faah inhibition, all of the inhibitors that displayed time - dependent, irreversible faah inhibition matched or exceeded the activity of 2, producing elevations of 312-fold over vehicle . Of these as a result, more detailed dose- and time - dependent studies of 11 and 14 were conducted as reported elesewhere . The results of these studies revealed that they cause accumulation of all three lipid amides in the brain with peak levels achieved within 1.53 h, that these elevations exceed those achieved with the reversible inhibitor 2, that these elevations are maintained> 6 h (vs 23 h for 2), consistent with irreversible enzyme inhibition, and that they exhibit long acting in vivo activity in a mouse model of neuropathic pain . The design, synthesis, and characterization of -ketoheterocycles that additionally target the remote cys269 nucleophile found in the cytosolic port of faah provided inhibitors that slowly react with the enzyme nucleophile, effectively providing time - dependent, irreversible inhibitors of the enzyme that maintain or enhance their selectivity for faah over other serine hydrolases . The electrophiles capable of targeting cys269 were incorporated as a c5 substituent on the pyridyl group of the 5-(pyrid-2-yl) oxazole of 2 and ranged from the reactive benzylic bromide 11 to the otherwise benign nitrile 14 . The irreversible inhibitors of faah displayed an expected sensitivity to the position of the electrophile introduction, but those that were successful exhibited surprising trends in apparent reactivity toward cys269 that would not be easily predicted . A preliminary in vivo characterization of the identified irreversible faah inhibitors confirmed their ability to raise endogenous brain levels of the enzyme substrates, including anandamide, in mice to a greater extent (> 2-fold) and for a longer duration (> 6 h) than the reversible -ketoheterocycles on which they are based . Two of these (11 and 14) were characterized in greater detail, as reported elsewhere, along with their long acting in vivo efficacy in a mouse model of neuropathic pain . C - labeled oleamide was prepared from c - labeled oleic acid as described . The truncated rat faah (rfaah) was expressed in e. coli and purified as described, and the purified recombinant rfaah was used in the inhibition and reversibility assays unless otherwise indicated . The purity of each tested compound (> 95%) was determined on an agilent 1100 lc / ms instrument using a zorbax sb - c18 column (3.5 mm, 4.6 mm 50 mm, with a flow rate of 0.75 ml / min and detection at 220 and 253 nm) with a 1098% acetonitrile / water/0.1% formic acid gradient (two different gradients). The enzyme reaction was initiated by mixing 1 nm rfaah (800, 500, or 200 pm rfaah for inhibitors with ki 12 nm) with 20 m c - labeled oleamide in 500 l of reaction buffer (125 mm triscl, 1 mm edta, 0.2% glycerol, 0.02% triton x-100, and 0.4 mm hepes, ph 9.0) at room temperature in the presence of three different concentrations of inhibitor . The enzyme reaction was terminated by transferring 20 l of the reaction mixture to 500 l of 0.1 n hcl at three different time points . The c - labeled oleamide (substrate) and oleic acid (product) were extracted with etoac and analyzed by tlc as detailed . Burk kinetic analysis was performed as described, confirming competitive, reversible inhibition for 5, 16, and 25 and noncompetitive inhibition for 11, 14, 17, and 2022 (figures 5 and 6). The reversibility of faah inhibition by 2, 11, 14, and 1722 was assessed by dialysis dilution using purified recombinant rfaah . The enzyme was placed in 15 ml of faah assay buffer (125 mm tris, 1 mm edta, 0.2% glycerol, 0.02% triton x-100, and 0.4 mm hepes, ph 9.0). The dialysis experiment was performed in the predialysis mix at or near the apparent ic80 . The final assay inhibitor concentrations used were 100 nm, 2, 18, and 19; 80 nm, 11, 14, 21, and 22; and 150 nm, 20 . Samples were preincubated with the enzyme for 3 h at room temperature (22 c) before 300 l was removed and assayed in triplicate in a faah activity assay . The remaining sample (2.7 ml) was injected into a dialysis cassette employing a 10 000 mw cutoff membrane . The mixture was dialyzed against 1 l of pbs at 4 c on a stir plate for 18 h. the postdialysis faah activity was assessed by assaying 300 l samples taken from the dialysis cassettes in triplicate . Faah activity is expressed as a percentage of vehicle - treated faah (dmso alone) and is shown in figure 7 . Mouse tissues were dounce - homogenized in pbs buffer (ph 8.0), and membrane proteomes were isolated by centrifugation at 4 c (100 000 g, 45 min), washed, resuspended in pbs buffer, and adjusted to a protein concentration of 1 mg / ml . Proteomes were preincubated with inhibitors (10100 000 nm, dmso stocks) for 6 h and then treated with fp - rhodamine (100 nm, dmso stock) at room temperature for 10 min . Reactions were quenched with sds - page loading buffer, subjected to sds - page, and visualized in - gel using a flatbed fluorescence scanner (mirabio). Labeled proteins were quantified by measuring integrated band intensities (normalized for volume); control samples (dmso alone) were considered to have 100% activity . Inhibitors were prepared as a saline emulphor emulsion for intraperitoneal (i.p .) Administration by vortexing, sonicating, and gently heating neat compound directly in an 18:1:1 v / v / v solution of saline / ethanol / emulphor . Male c57bl/6j mice (<6 months old, 2028 g) were administered inhibitors in saline emulphor emulsion or an 18:1:1 v / v / v saline / emulphor / ethanol vehicle i.p . At a volume of 10 l / g weight . After the indicated amount of time (1, 3, or 6 h), mice (n = 3 for each compound at each time point) were anesthetized with isofluorane and killed by decapitation . Total brains (400 mg) and a portion of the liver (100 mg) were removed and flash frozen in liquid n2 . Animal experiments were conducted in accordance with the guidelines of the institutional animal care and use committee of the scripps research institute . Tissue was weighed and subsequently dounce - homogenized in 2:1:1 v / v / v chcl3/meoh / tris ph 8.0 (8 ml) containing standards for lipids (50 pmol of d4-pea, 2 pmol of d4-aea, and 10 nmol of pentadecanoic acid). The mixture was vortexed and then centrifuged (1400 g, 10 min). The organic layer was removed, dried under a stream of n2, and resolubilized in 2:1 v / v chcl3/meoh (120 l), and 10 l of this resolubilized lipid was injected onto an agilent g6410b qqq instrument . Lc separation was achieved with a gemini reverse - phase c18 column (5 m, 4.6 mm 50 mm, phenomonex) together with a precolumn (c18, 3.5 m, 2 mm 20 mm). Mobile phase a was composed of 95:5 v / v h2o / meoh, and mobile phase b was composed of 65:35:5 v / v / v . The flow rate for each run started at 0.1 ml / min with 0% b. at 5 min, the solvent was immediately changed to 60% b with a flow rate of 0.4 ml / min and increased linearly to 100% b over 10 min . This was followed by an isocratic gradient of 100% b for 5 min at 0.5 ml / min before equilibrating for 3 min at 0% b at 0.5 ml / min (23 min total per sample). The following ms parameters were used to measure the indicated metabolites in positive mode (precursor ion, product ion, collision energy in v): aea (348, 62, 11), oea (326, 62, 11), pea (300, 62, 11), d4-aea (352, 66, 11), and d4-pea (304, 62, 11). The capillary was set to 4 kv, the ionization source was set to 100 v, and the delta emv was set to 0 . Lipids were quantified by measuring the area under the peak in comparison to the standards (n = 3 for each inhibitor at each time point).
To introduce a case of iridoschisis patient who underwent cataract surgery successfully without pupil device . A 64-year - old female who showed iridoschisis of her both eyes underwent cataract operation at her right eye without a pupillary device . The preoperative and postoperative ophthalmologic examinations including visual acuity, intraocular pressure, reaction of anterior chamber, and degree of damage on iris was evaluated respectively . Iris fibrils were held in place by ophthalmic viscosurgical device (ovd, sodium hyaluronate 3%-sodium chondroitin sulfate 4%, viscoat) that was injected into the anterior chamber . A small capsulorrhexis was made and the nucleus was delivered with low - power phacoemulsification, most of which was performed under the anterior capsule . There were no intraoperative complications such as tear of the iris, hyphema, loss of mydriasis, or rupture of the posterior lens capsule . The edema of corneal stroma and inflammation of anterior chamber was shown at immediate - postoperative period, but completely subsided 2 weeks later . In iridoschisis patients, there is a risk of aspiration of iris fibers during cataract surgery . With adequate use of ovd and careful modulation of surgical devices, a 64-year - old female presented with gradual loss of vision in the right eye (od) of one year duration . About six months ago, she had undergone intracapsular cataract extraction, anterior vitrectomy, and scleral fixation of intraocular lens (iol) in the left eye (os). At that time, the preoperative best corrected visual acuities (bcva) were 20/400 od, 20/30 os . The slit lamp biomicroscopy of both eyes (ou) showed clear cornea, deep and clear ac, and the angle was wide open . Both eyes had splitting of the anterior layers of the iris with fibrillar degeneration extending from 3 to 6 o' clock od, and from 4 to 6 o' clock os . Additionally, there was diffuse atrophy of iris from 11 to 1 o' clock os (fig . The right eye showed nuclear and cortical cataract associated with posterior subcapsular cataract, and the left eye was pseudophakia . Specular microscopy of the od revealed regular, hexagonal shape of endothelial cells without any abnormalities like bullae or guttae, and the endothelial cell count was 2865 cells / mm . Pupil dilation is performed using 3 drops of tropicamide 0.5% and phenylephrine hydrochloride 0.5% at 5-minute intervals 1 hour prior to surgery . Topical anesthesia was applied using alcaine and 3% lidocaine, and a paracentesis was done at 10 o' clock . A 2.75 mm main clear corneal incision was performed using the keratome blade . A dispersive ophthalmic viscosurgical device (ovd), sodium hyaluronate 3%-sodium chondroitin sulfate 4% (viscoat, alcon) was injected through the clear corneal wound to stabilize the anterior chamber and protect the iris stroma by displacing aqueous from the ac and pushing the iris strands from the pupillary aperture . An anterior continuous curvilinear capsulorhexis not exceeding over the pupillary margin was performed using the 26 g needle and capsular forceps . After hydrodissection and hydrodelineation, careful phacoemulsification was performed (allergan sovereign phaco system, sov680330) for nucleus removal with special care not to touch the iris tissue . Aspiration was used to clean residual cortical fibers from the capsular bag . When a loss of the protective effect of viscoelastic material was observed during surgery, the maximum limit of the vacuum was 300 mmhg and the aspiration rate, 20 cc / mmhg . The height of the irrigation bottle is maintained less than 60 cm to minimize the turbulence within the chamber . Total us time was 48 seconds with a mean final rate of 10% of potency . The capsular bag was inflated with viscoelastics, and a single - piece acrylic intraocular lens (acry - sof sa60at, alcon) was inserted . The iol was safely placed in the capsular bag and centered, followed by aspiration of the residual viscoelastics . Finally, bss carbacol (carbachol 0.01%, miostat) was used to constrict the pupil . Postoperatively, the inflammatory response in the ac was moderate, some fibrillar materials were seen . The cornea showed some descemet folds, and the pupil was round and undamaged (fig . One week after surgery, the uncorrected visual acuity was 20/100 od, and improved to 20/30 on the two weeks postoperative day . There were traces of cells in the ac, but no fibrillar materials were seen (fig . The patient's last visit was 1 month after surgery when ucva was 20/40, and bcva 20/20 . Iridoschisis is a very rare condition resulting in one or more layers of the anterior iris surface . A localized area of iris stroma is cleaved in two with the anterior atrophic portion disintegrating into fibrils . The separated stromal fibers go through a degenerative process in which they detach and free float in the anterior chamber, creating a " shredded wheat " appearance . The condition primarily affects the inferior iris quadrants and rarely superior quadrants.9 - 13 glaucoma occurs in 50% of the cases and is of the angle closure type.15 whether iris changes are responsible or iridoschisis occurs more frequently in eyes that are predisposed to angle closure is unclear.16 while primary angle closure glaucoma has been implicated in iridoschisis formation, the affected fibers may bow forward, leading to anterior synechiae and angle closure glaucoma.5,6,14,15 in the present case, the anterior chamber angle was wide open and the iop were within normal limits . It is a matter of concern that the clinicians are prone to misdiagnose this condition, especially in the case with dark colored iris . There have been only three cases of report in 1990's.13,14 differential diagnosis must include axenfeld - reiger anomaly, ices, or other conditions which accompany the degenerative change of iris stroma . An abnormal corneal endothelium that migrates across the chamber angle on to the surface of the iris is the common feature of the ice syndromes.17 the iris in ices is usually atrophic rather than split, and peripheral anterior synechiae (pas) extends to schwalbe's line specular microscopy has shown the abnormal corneal endothelial cells, so called " ice cells ", which are pleomorphic and resemble corneal guttata . It occurs mostly unilateral and the clinical symptoms are presented earlier than iridoschisis (about 3 or 4 decades). There is hypoplasia of the iris stroma with filaments connected to abnormal peripheral cornea.18 in this case, the clinical features most coincidence with iridoschisis, rather than ices or axenfeld - reiger syndrome . The condition was bilateral and there was no pas or connection of iris fibrils with peripheral cornea . Specular microscopy showed normal shape and count of corneal endothelial cells . Considering that our patient had been diagnosed as bilateral ices before, there may have been other misdiagnosed and unreported cases . Because iridoschisis is associated with aging, cataract is often a concomitant issue.2 the disorganized anterior layer of the iris and fibrillar material in the pupillary axis has a tendency to become drawn in by the suction of the i / a cannula and phaco tip during phacoemulsification . Pupil dilation in these patients is also poor because this condition may be associated with pseudoexfoliation syndrome or atrophy of the pupillary margin.11 if the loose iris fibrils become drawn and entrapped in the aspiration port, there is a strong chance of complications like bleeding, iris tears, loss of mydriasis, and disruption of the blood - aqueous barrier.9 many methods have been tried to stabilize the iris fibers during cataract operation in the presence of iridoschisis . Most of them are based on mechanical restraint of the disorganized iris using flexible iris hooks, iris retractors or pupil expanders, such as multiple iris hooks or graether pupil expander.2,9,11,12 these mechanical supports provide additional pupillary dilation, stabilize the capsule, and trap some of the fibers at pupillary margin during phacoemulsification . But these supportive devices can also induce strain and trauma to iris tissue resulting in increased inflammation after postoperative period . Sometimes they lead to defects in the pupillary margin or to an atonic pupil.11 moreover, long, free - floating, torn fibers may not be trapped and may still extend over the rim into the surgical field.9 in withdrawing these instruments, iris fibers can be trapped in the stab incisions, and such fibers may act as an entrance for epithelial cells and micro - organisms.9 in this case, without mechanical restraint of iris, we minimized the iris trauma through the right choice of the viscoelastic material, careful manipulation of phaco tip or i&a cannula, and reducing the turbulence by using the minimum required fluidic parameters achieved with lowering the total phaco power and the height of the irrigation bottle . The allergan sovereign phaco system has a peristaltic fluidic pump system with vacuum range of 0~500 mmhg and flow range of 0~40 cc / min . The maximal fluidic parameters showed in the presented case were relatively lower than the values that had been usually set for conventional cataract surgery . Viscoat has been known to have a very high dynamic viscosity at high shear rate . This property and a poor cohesion provide a better corneal endothelial protection during in vitro phacoemulsification . 19,20 although the removal time of ovd is longer with dispersive viscoat than other cohesive ovds (sodium hyaluronate 1.4%, healon gv, or sodium hyaluronate 1.0%, provisc),21 viscoat is less influenced by turbulent flow while cohesive ovds tend to be washed out suddenly which could result in sudden collapse of anterior chamber.21,22 furthermore, the cohesive ovd fragment behind the iol is exposed to too little turbulent flow to move towards the aspiration port unless the i&a tip is placed behind the iol or a special technique is used.23 a small capsulorhexis that did not extend vertically beyond the middle of the pupil was performed deliberately to allow he anterior capsule to act as an additional barrier between the iris and instruments . To protect the friable and disorganized iris from further damage, if a loss of the protective effect or the movement of iris fibril were observed, the ovd was injected additionally . The machine settings, including flow rate and vacuum limit, as well as port diameter are different between phacoemulsification needle and i / a tip . The former is related to the retention ability of ovds and the latter to removal property.23 although we were not able to manage the diameter of phaco or i&a tips, the minimum possible amount of us energy, bss flow rate and vacuum limit enabled the surgical procedures to be performed under safer environment . There was no iris trauma, intraoperative iris bleeding, or posterior capsular rupture during surgery . The corneal edema had disappeared by two weeks after surgery, and the ac inflammation had subsided after one month postoperatively . The final bcva od had improved from the preoperative one, from 20/400 to 20/20 . This is a case which emphasizes the importance of exact preoperative diagnosis and differential diagnosis in iridoschisis . In the absence of proper clinical impression and proper preoperative preparation, our patient had been diagnosed as ices, and underwent icce, anterior vitrectomy and scleral fixation of iol on the contralateral eye (os). In conclusion, for iridoschisis is a very rare condition and easy to be confused with other diseases, one must consider this condition into differential diagnosis if the iris abnormalities are suspicious.
Neural stimulation has a long history of use in a range of therapeutic applications, including regulating organ function and treating a variety of neurological disorders . Neurostimulators are also used to provide forms of sensory perception; for example, electrical stimulation of auditory neurons using electrodes implanted in the cochlea can provide hearing sensations to people with a severe to profound hearing impairment . A related application is visual prostheses (bionic eyes), in which electrodes implanted within the visual system are used to electrically elicit visual percepts in people with minimal light perception . This research has expanded in recent years, and several distinct techniques are being developed . These include stimulation of the visual cortex using cortical electrode arrays, and stimulation of retinal neurons using electrode arrays implanted at various intraocular sites . One such device being developed by bionic vision australia (bva) targets retinal neurons using an electrode array implanted in the suprachoroidal space, between the choroid and scleral layers of the eye . This implantation site has the advantages of surgical simplicity and long term stability at the expense of increased distance from the retinal neuronal targets which may increase the charge levels required to elicit percepts and limit spatial resolution, . Whilst preclinical studies can provide some insight into the specifications required for a neurostimulator that will be efficacious for a suprachoroidal retinal prosthesis, there are still many unknowns . For example, the electrical properties of the electrode - tissue interface and the charge levels required to elicit a neural response are undetermined for degenerated human retina . To address this, 1). The percutaneous connector provides a direct electrical connection to each electrode in the device, allowing maximum flexibility in the stimuli applied . This enables the stimulation parameter space to be thoroughly explored using an external stimulator and the performance of a suprachoroidal implant to be evaluated . The results can then be used to inform the design of future devices, including fully implanted systems . (a) an electrode array (top left) designed to be implanted in the suprachoroidal space of the eye is connected to a percutaneous connector (bottom right) via a leadwire . (b) the percutaneous connector is implanted behind the ear and provides an external electrical connection to the implanted electrodes . (c) a schematic illustration of the electrode layout of the array (not to scale). Twenty stimulating electrodes (\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $17\times 600 \mu \text{m}$\end{document} and \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $3\times 400 \mu \text{m}$\end{document} diameter) are arranged in a hexagonal grid, which is surrounded by thirteen interconnected \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $600\mu \text{m}$\end{document} diameter electrodes that form a guard - ring return . An additional return electrode (not shown) is implanted subcutaneously close to the percutaneous connector . (a) an electrode array (top left) designed to be implanted in the suprachoroidal space of the eye is connected to a percutaneous connector (bottom right) via a leadwire . (b) the percutaneous connector is implanted behind the ear and provides an external electrical connection to the implanted electrodes . (c) a schematic illustration of the electrode layout of the array (not to scale). Twenty stimulating electrodes (\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $17\times 600 \mu \text{m}$\end{document} and \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $3\times 400 \mu \text{m}$\end{document} diameter) are arranged in a hexagonal grid, which is surrounded by thirteen interconnected \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $600\mu an additional return electrode (not shown) is implanted subcutaneously close to the percutaneous connector . To minimize the risk of harmful effects of stimulation, it is essential that the external neurostimulator adheres with established design principles of safe electrical stimulation . These include the use of charge - balanced biphasic pulses, post - stimulus electrode shorting and output coupling capacitors to maintain charge recovery,, charge limits and charge density limits to prevent damaging stimulation being delivered, as well as appropriate electrical isolation in accordance with iec60601 - 1 . The use of constant - current stimulation pulses is also required to ensure that changes in impedance at the electrode - tissue interface are intrinsically compensated for, allowing precisely predetermined amounts of charge to be reliably delivered . To fully exploit the unrestricted access to the electrodes provided by the percutaneous connection 2) must have appropriately wide ranges and a resolution that allows flexibility in the values used . Preclinical studies investigating suprachoroidal stimulation using a feline model have used phase widths ranging from \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $100\mu \text{s}$\end{document} to 3ms, with 300-\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $1200\mu \text{s}$\end{document} recommended as optimal for eliciting visual responses whilst balancing charge and current requirements . As shorter phase widths require larger currents to deliver a given amount of charge, the neurostimulator must have an adequately high maximum output current . For example, a biphasic pulse with 500nc per phase, a charge level that has been required in some preclinical suprachoroidal stimulation studies,, would require a current of 5ma when using a \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $100\mu \text{s}$\end{document} phase width . The compliance voltage, the maximum voltage that can be produced to maintain delivery of a specified constant current, must also be sufficiently high . The compliance voltage required is dependent on the current delivered, the phase width and the electrode impedance, defined as the peak voltage of a biphasic pulse divided by the stimulus current amplitude . A preclinical study using suprachoroidal electrodes of the same size as those used in this study (\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $600\mu \text{m}$\end{document} diameter) recorded electrode impedances between 11 - 15k\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $\omega $\end{document} using \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $75\mu \text{a}$\end{document} pulses with a \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $25\mu \text{s}$\end{document} phase width, suggesting a high voltage compliance will be required to use large currents . Other preclinical studies that used smaller, higher - impedance electrodes (\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $\le 395\mu \text{m}$this stimulator was capable of eliciting visual responses using currents up to 2ma . Consequently, a maximum compliance voltage of 40v is considered a suitable requirement, as it provides headroom for using short (\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $\le 100\mu \text{s}$\end{document}) phase widths and higher currents . A high degree of electrode configurability is also required to enable delivery of stimuli via various combinations of active and return electrodes; for example, a configuration using a single remote return electrode has been theorized to have different current spread properties than a configuration using multiple nearby electrodes as the return, which may affect percept appearance, . Additionally, it is desirable for the external stimulator to be small and portable to facilitate stimulation whilst the patient is mobile . Charge - balanced, constant - current biphasic stimulus pulse parameters . Whilst there are various commercial neurostimulators available from companies such as natus neurology inc . (grass technologies), digitimer limited, and fhc incorporated, they generally have limitations in one or more of the specifications required ., usa) is a constant - current biphasic stimulator that can deliver up to 15ma and has a high degree of electrode configurability when combined with an esax electrode switching array (natus neurology inc . However, the resolution of the pulse parameters is restricted to a small number of steps, the frequency range is limited to 2 - 100hz and the current accuracy is only specified for loads of 100-\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $2000\omega $\end{document}. The need to combine separate modules and the need for a mains power supply also limit the portability of the system . Taking into account all of the requirements, there appears to be no appropriate neurostimulator available for use in evaluating a suprachoroidal implant, and consequently a custom solution was required . This article details the design of a highly configurable, high compliance voltage, 32-electrode neurostimulator, known as neurobi, and its application in determining whether visual percepts could be elicited using a prototype suprachoroidal electrode array implanted in one patient with approximately 20 years of light perception vision only due to retinitis pigmentosa . The configurability of neurobi together with its capability to deliver stimulation across a wide range of parameters make it suitable not only for use with a prototype suprachoroidal electrode array, but also for many other clinical applications, including prediction and suppression of epileptic seizures through stimulation of subdural electrode arrays, and deep brain stimulation . The major functional components of neurobi and its place within a typical patient - testing setup are illustrated in fig . 3 . Under the control of a host personal computer (pc) and an embedded microcontroller, neurobi is designed to deliver sequences of highly adjustable (table 1) charge - balanced, constant - current biphasic pulses to any combination of outputs connected to an implanted electrode array . The pulses are generated using a single current source whose direction is switched to reverse the polarity of the stimulating electrodes and produce the alternating phases . A switch array connects the pulse generation circuitry to the desired output configuration via coupling capacitors . Figure 3.block diagram illustrating the major functional components of neurobi and its place within a typical patient - testing setup.table 1neurobi stimulus parameters.current amplitude0-l0ma (\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $\mathrm{1}\mu\mathrm{a\hspace{0.33em}steps}$\end{document})phase width\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $20\mu\mathrm{s-3ms}\hspace{0.33em}(\mathrm{1}\mu\mathrm{s\hspace{0.33em}steps}{)}$\end{document}interphase gap\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $20\mu\mathrm{s-3ms}\hspace{0.33em}(\mathrm{1}\mu\mathrm{s\hspace{0.33em}steps}{)}$\end{document}stimulation period\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $160\mu\rm{s-5s}$\end{document}number of outputs32electrode configurabilityarbitrarynominal compliance voltageselectable 10/20/30/40vdependent on phase width and interphase gap used block diagram illustrating the major functional components of neurobi and its place within a typical patient - testing setup . Dependent on phase width and interphase gap used a maximum phase width of 3ms was chosen to be consistent with preclinical experiments . The maximum interphase gap was also set to 3ms to allow gaps equal to the phase width to be used . A maximum current amplitude of 10ma was chosen to allow the use of narrow phase widths (e.g \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $100\mu \text{s}$\end{document}). The maximum compliance voltage was set to 40v, but was made adjustable under software control to allow lower levels to be used if high voltages were not required . Using a lower compliance voltage setting minimizes the risk of high voltages accidentally being applied to tissue and also reduces the power consumption of the device by lowering the supply rails . A resolution of \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $1\mu \text{a}$\end{document} and \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $1\mu \text{s}$\end{document} was used to maximize the flexibility in the selectable values . The connection to the host pc is via universal serial bus (usb), which provides power and communication to neurobi to configure device settings, control the delivery of stimuli and to record data . Communication messages consist of packets of bytes, which include a start byte to mark the beginning of a message, a command identification byte specifying the message function, a number of data bytes and a checksum byte for message verification . External trigger lines are also provided by neurobi, which can be used to initiate delivery of preloaded stimuli and to indicate when pulses are being delivered . The power and data lines of the usb connection and the trigger lines are isolated within neurobi to 5kv . The isolated usb data line is then converted into four universal asynchronous receiver / transmitters (uart) using a quad serial - to - usb converter (ft4242h, ftdi chip, uk). This allows the host pc to communicate with neurobi over four serial ports, with different ports used for sending command messages, debug information, stimulus current measurements, and voltage waveform data recorded by neurobi . The four uarts are connected to the microcontroller (kinetis k40 mk40x256vlq100, freescale semiconductor, usa), which is responsible for controlling the function of neurobi, including handling communication, managing power settings, buffering sequences of pulses for delivery, and coordinating stimulus generation . The isolated usb power is routed through to a power management chip (ltc3567, linear technology, usa) that supplies power to the system and opportunistically charges a lithium polymer battery . The battery is primarily used to ensure safe shutdown in the event that usb connectivity is unexpectedly lost, but can also be used as the sole power supply for the device to facilitate ambulatory applications by eliminating the need for a portable computer (e.g. Laptop, tablet, or single - board computer) to power the device . The power management chip generates a 3.3v regulated supply that provides power to the microcontroller and communication circuitry, and an unregulated supply that feeds a step - up converter and two low - noise 5/3.3v dc supplies . The step - up converter is capable of generating the high - voltage supply rail required to power the pulse generation and routing circuitry with a software - controllable compliance voltage of 10, 20, 30, or 40v . The use of a single switched current source to generate the stimulus pulses has the advantage of intrinsic charge matching for symmetric biphasic pulses, as the same circuitry is used to produce both phases . It also has the benefit of requiring only a single high - voltage supply, as opposed to the dual supplies that would be required if a source and sink were used . The design of a precision current source with a compliance voltage of up to 40v, a slew rate sufficient for generating microsecond - scale pulses, as well as high efficiency and an output impedance high enough to ensure less than 1% variation in current across tissue loads, required careful consideration . A discrete bipolar junction transistor (bjt) based topology was used as it could be tailored to meet these specifications, at the expense of increased design complexity . In comparison, operational amplifier based topologies such as the improved howland current pump used in some other neurostimulators,, are limited by the capabilities of the operational amplifier used . A chip that could meet the slew rate, supply rail and output offset requirements for this application was not identified . A linearized bjt and current mirror were used to create the current source (fig . An improved wilson current mirror was used to achieve high output impedance and to mitigate error due to finite base current . Additional matched transistors are connected in parallel on the output side to provide accurate current scaling . This also improved power efficiency by minimizing the total branch current required for a given output current . Matched emitter degeneration resistors were also used to improve bjt beta matching and the output impedance of the current source . Figure 4.current source used to generate stimulus pulses, consisting of a linearized bjt and an improved wilson current mirror with additional current scaling . Current source used to generate stimulus pulses, consisting of a linearized bjt and an improved wilson current mirror with additional current scaling . The current source is connected to quad high - voltage single - pole single - throw switches (adg5412, analog devices, usa), which are used to interchange the direction of current flow to produce biphasic pulses . A high voltage 4-channel multiplexer (mux) (adg5404, analog devices, usa) is then used to route the current to either the switch array or to one of three low temperature coefficient resistive loads that are used to verify the amplitude and for calibration . A high input impedance waveform capture circuit comprising a fully differential amplifier and a 16-bit analog - to - digital converter (ad7694, analog devices, usa) is also connected across the output lines of the current direction switches . This is used for current - source calibration and to measure the voltage waveform across the output electrodes during stimulation with a sampling rate of 100 kilosamples per second . Each output can be individually connected as either an active or return line using high - voltage 4-channel muxs (adg5204, analog devices, usa). When not being used for stimulation, each output can be set to be open circuit or connected to a common point . The common - point connection allows electrodes to be shorted together after stimulation, which is an established method for removing residual charge in tissue due to charge imbalance . All high - voltage switches and muxs used in neurobi feature trench isolation to prevent latch - up due to electrode voltages beyond supply rails . As stimulation safety was of paramount importance to the design of neurobi, coupling capacitors are used on each output for protection against residual direct current (dc) due to leakage and charge imbalance . Including capacitors also protects tissue in the event that an output stage fails catastrophically by blocking dc from being applied to the electrodes . Choosing an appropriate capacitor size is a compromise between compliance voltage reduction and physical size . A \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $10\mu \text{f}$\end{document} ceramic (x7r) capacitor was chosen as for a 500nc per phase pulse, a stimulation level which has been used preclinically to measure evoked responses with a suprachoroidal array,, the compliance voltage reduction is only 50mv whilst using a reasonably sized surface - mount package (1210). The outputs of neurobi are connected to the patient s implanted electrode array via an electrode enable switch box . This additional safety feature allows the electrodes to be individually connected to or disconnected from neurobi . The electrode enable switch box consists of an array of momentary push buttons each connected to a low - voltage normally - open relay . When the button for a particular electrode is pressed, power is supplied to the coil of the relay by a simple toggle on / off circuit and the connection is established . An led in the push button is powered through a second pole of the relay to indicate that the electrode is connected . Stop button is connected to the electrode enable box which removes the power from the relays when actuated, causing them to revert to the open state and completely disconnecting the stimulator . This allows the patient or researcher to immediately cut off all stimulation in the event that any discomfort or other unexpected effects occur . To deliver a stimulus, commands are first sent from the host pc to load neurobi with the desired pulse parameters (phase width, interphase gap, rate) and electrode configuration (fig . 5). Up to 256 different stimulus parameter sets and 255 electrode configurations can be loaded . Before each parameter set or electrode configuration is stored, the nominated values are checked against defined limits and any unacceptable values are rejected . Commands can then be sent to trigger the delivery of a stimulus using a particular parameter set and electrode configuration with a specified current amplitude and number of repetitions . Prior to any stimulus being delivered, the charge per phase is calculated within neurobi and compared to a safe limit . The user can set the charge limit to an appropriate value by sending a command message from the host pc . Stimuli comprising different electrode configurations and pulse parameters can then be delivered, either one at a time or in a sequence . Stimulus delivery process . Stimuli comprising different electrode configurations and pulse parameters can then be delivered, either one at a time or in a sequence . Prior to neurobi being used clinically with patients, extensive functional and safety testing was performed both internally and by independent external engineers . Stimulation pulses were delivered to a variety of test loads using a range of parameters, with the resulting output waveforms verified for accuracy (fig . The current output was measured to be accurate to within 2% for currents greater than \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $100\mu \text{a}$\end{document}. The output impedance and voltage compliance were characterized for a range of output current levels (fig . The charge injection, the amount of unwanted charge injected into the output current path due to stray capacitance within the switching integrated circuits, was also measured and found to be less than 1nc . Figure 6.stimulation waveform recorded across a 10k\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $\omega $\end{document} test load using a fluke 190 - 204 scopemeter (fluke corporation, usa). The measured pulse parameters correspond with the defined settings of \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $200\mu \text{s}$\end{document} phase width, \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $100\mu \text{s}$\end{document} interphase gap, 1.5ms stimulation period and 1ma current amplitude . (b) measured compliance voltage as a function of output current using a 3ms phase width (worst case) with nominal settings of 10, 20, 30, and 40v . Voltage compliance is reduced for long phase widths and large currents due to charging of the output coupling capacitors . Stimulation waveform recorded across a 10k\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $\omega $\end{document} test load using a fluke 190 - 204 scopemeter (fluke corporation, usa). The measured pulse parameters correspond with the defined settings of \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $200\mu \text{s}$\end{document} phase width, \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $100\mu \text{s}$\end{document} interphase gap, 1.5ms stimulation period and 1ma current amplitude . (b) measured compliance voltage as a function of output current using a 3ms phase width (worst case) with nominal settings of 10, 20, 30, and 40v . Voltage compliance is reduced for long phase widths and large currents due to charging of the output coupling capacitors . The residual dc resulting from stimulation of the suprachoroidal electrode array using neurobi was measured in vitro for a range of pulse parameters under various load conditions . Preclinical studies establishing a safe limit for residual dc in a suprachoroidal retinal prosthesis have not been reported . However, dc levels of less than 100na have been shown to cause no damage when applied to the cochlea . Based on this data a risk analysis was performed in accordance with iso 14971, covering failure modes and the use of neurobi with human subjects . Both neurobi and the electrode enable box passed electrical safety tested to australian standard (as) 3551 (2004) and the electromagnetic emissions of neurobi were found to conform with as cispr11 (2011). Additionally, neurobi passed electrostatic discharge immunity testing in accordance with as 61000.4.2 (2002). The initial application for neurobi was to determine whether visual percepts could be elicited in one patient with profound vision loss using a suprachoroidal electrode array . Measurement of electrode impedances was also required to verify connectivity and to inform compliance voltage requirements . Following approval from the royal victorian eye & ear hospital human research ethics committee and trial registration (www.clinicaltrials.gov, trial #nct01603576), one patient with profound vision loss due to retinitis pigmentosa was selected through a clinical screening process . The selected patient was a 52 year old female with rod - cone dystrophy and approximately 20 years of light perception only vision . Informed consent was obtained in accordance with the declaration of helsinki . Following preliminary testing with this patient, further details on patient selection are reported elsewhere . The suprachoroidal electrode array (fig . 1) consisted of twenty platinum discs (\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $17\times 600 \mu \text{m}$\end{document} and \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $3\times 400 \mu \text{m}$\end{document} diameter) arranged in a hexagonal grid within a silicone substrate . The implant also included thirteen interconnected \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $600\mu \text{m}$\end{document} platinum discs and two 2 mm platinum discs for use as return electrodes . Each electrode was individually connected via a helical platinum / iridium wire to the pins of a titanium percutaneous connector, which was implanted behind the patient s ear . The lead wire and electrode array were tunneled subcutaneously to the orbit and inserted into the suprachoroidal space through a scleral incision . An additional electrode was also implanted adjacent to the percutaneous connector for use as a remote return . Stimulus delivery was controlled using a purpose - built graphical user interface, called eyesee, running on the host pc . Eyesee was responsible for managing experimental procedures, communicating with neurobi via a custom device driver and applying additional safety features, including enforcing charge limits . Ideally, the maximum charge that can be safely delivered using a suprachoroidal array would be defined through preclinical safety studies . However, whilst chronic suprachoroidal stimulation safety studies have been performed, they are yet to define a safe charge limit precisely . In the absence of more appropriate data, the shannon model of safe levels of electrical stimulation with a \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $k$\end{document} value of 1.85, as shown in, was used to define maximum charge limits . If the specified charge per phase exceeded the relevant limit, 447nc for a \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $600\mu \text{m}$\end{document} electrode and 298nc for a \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $400\mu \text{m}$\end{document} electrode, eyesee would not deliver the stimulus . The compliance voltage required for a given stimulus was also estimated before stimulus delivery using the nominated current amplitude and measured electrode impedances to ensure it was within range . Electrode impedances were measured using biphasic pulses and were defined as the voltage at the end of the first phase divided by the current amplitude (fig 8). The voltage waveforms were recorded using the neurobi waveform capture circuit and an average of 50 pulses was used to calculate the impedance for each electrode . A common - ground configuration was used, where one active electrode was stimulated against all others . In this configuration, the parallel connection of multiple return electrodes created a low - impedance path, so that the recorded impedance value was dominated by the impedance of the individual active electrode . (a) current waveform measured by stimulating a test load and dividing the recorded voltage samples by the known resistance . (b) voltage waveform recorded from an implanted \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $600\mu \text{m}$\end{document} electrode using a common - ground return . Both waveforms were recorded using the neurobi waveform capture circuit and are the average of 50 pulses . Filled circles = averaged samples, open circle (marked by arrow) = voltage data point used to calculate impedance . Example current and voltage waveforms used to measure electrode impedance . (a) current waveform measured by stimulating a test load and dividing the recorded voltage samples by the known resistance . (b) voltage waveform recorded from an implanted \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $600\mu \text{m}$\end{document} electrode using a common - ground return . Both waveforms were recorded using the neurobi waveform capture circuit and are the average of 50 pulses . Filled circles = averaged samples, open circle (marked by arrow) = voltage data point used to calculate impedance . Stimulation parameters of \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $500\mu \text{s}$\end{document} phase width, \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $20\mu \text{s}$\end{document} interphase gap, \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $75\mu \text{a}$\end{document} current amplitude and 500pps rate, were chosen for measuring electrode impedances, based on the results of preclinical studies, . Using these parameters, impedances were measured to be 16.5 - 20k\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $\omega $\end{document} (\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $600\mu \text{m}$\end{document} electrodes), 23.5 - 25.5k\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $\omega $\end{document} (\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $400\mu \text{m}$\end{document} electrodes) and 2.5 - 5.5k\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $\omega $\end{document} (return electrodes). Two electrodes were initially detected as open circuit, but those faults were traced to poor contacts within the percutaneous connector that were rectified later by replacing an externally accessible component . The \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $600\mu \text{m}$\end{document} impedances measured were approximately 5k\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $\omega $\end{document} higher than those recorded preclinically, however this can be attributed to different phase widths being used (\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $500\mu \text{s}$\end{document} vs \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $25\mu \text{s}$\end{document}) and differences between a sighted feline model and a degenerate human retina . An iterative stair - case procedure was used, whereby stimuli with progressively increasing charge per phase were delivered until a percept was reported by the subject . The charge per phase this process was repeated until 8 turning points had been recorded, with the average of the last six turning points used as the perceptual threshold . If the charge per phase increased to the safe charge limit, the procedure was aborted and the electrode was considered to be unable to elicit a visual percept using the stimulation parameters selected . Perceptual threshold values were recorded in units of nc and also in db re 10nc, as perceived brightness is expected to be proportional to the logarithm of stimulus intensity . The threshold - estimating procedure was performed on nineteen electrodes, with one \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $600\mu \text{m}$\end{document} electrode excluded as it was apparently open - circuit due to a poor contact in the percutaneous connector . Based on results of preclinical studies, stimulation parameters of \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $500\mu \text{s}$\end{document} phase width, \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $20\mu \text{s}$\end{document} interphase gap, 50pps rate, and 0.5s duration were chosen with a monopolar electrode configuration, where an individual electrode was stimulated against one of the 2 mm intraocular returns . Charge per phase was modulated by adjusting the current amplitude . Visual percepts were successfully elicited on all \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $600\mu \text{m}$\end{document} electrodes tested, with threshold levels in the range 100 - 370nc (20 - 31.4db). The safe charge limit was reached before a perceptual threshold could be obtained for two of the \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $400\mu \text{m}$\end{document} electrodes, whilst the other \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $400\mu \text{m}$\end{document} electrode produced a percept with a threshold of 190nc (25.6db). Two \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $600\mu \text{m}$\end{document} electrodes were also tested using a common - ground configuration, producing perceptual thresholds of 176nc (24.9db) and 360nc (31.1db). Shapes varied from simple ovals filled with cream - grey light, to complex shapes with multiple light and dark regions . The location of phosphenes in the visual field was also reported to vary in a manner consistent with the layout of the electrode array . Preliminary clinical test results have shown it to be effective in eliciting visual percepts in a profoundly vision - impaired subject with approximately 20 years of light perception vision only, implanted with a suprachoroidal electrode array . The final device is a highly configurable neurostimulator in a relatively small form factor, with dimensions of 170 mm \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $\times \,\, 130 $\end{document}mm \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $\times \,\, 55 $\end{document}mm and weight of 800 g (fig . Figure 9.photo of neurobi (top right), electrode enable switch box (bottom) and stop button (top left). Photo of neurobi (top right), electrode enable switch box (bottom) and stop button (top left). By stimulating individual electrodes with neurobi the perceptual thresholds are approximately 2 times higher than those measured using chronic epiretinal stimulation in humans, however higher thresholds are expected as a suprachoroidal implant is further from the retinal stimulation targets . These results suggest that the suprachoroidal space is a viable implantation site for a retinal prosthesis . Further work is required to characterize the phosphenes elicited and to determine how they can be used to functionally improve the patient s vision . Following this successful preliminary testing, two additional patients have been implanted with the suprachoroidal device and all three patients have been subject to weekly psychophysics sessions . Psychophysics testing is being performed to determine the optimum stimulation parameters for a suprachoroidal retinal prosthesis; to characterize the appearance and location of the visual percepts elicited; and to investigate how to build useful visual information by stimulating multiple electrodes closely in time . A head - mounted video camera has also been integrated with neurobi and the host pc to provide real - time stimulation based on the visual scene in front of the patient . This has allowed standard visual acuity tests to be performed and enabled patient performance to be assessed in a number of activities of daily living, such as navigation and object recognition . The initial results obtained suggest that the full capabilities of neurobi will be required to undertake psychophysics testing with the prototype suprachoroidal electrode array . The threshold levels measured (100 - 370nc) are approaching the defined safe charge limit for a \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $600\mu \text{m}$\end{document} electrode (447nc). Subsequently, stimuli up to the limit will be required to be able to stimulate at levels above threshold . The safe charge limit corresponds to \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $894\mu \text{a}$\end{document} for a \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $500\mu \text{s}$\end{document} phase width; however, if shorter phase widths are used, higher currents will be required . For example, if a \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $100\mu \text{s}$\end{document} phase width is used the safe limit would correspond to 4.47ma, which is still well within the capabilities of neurobi . The electrode impedances measured suggest that the highest compliance voltage setting (40v) will also be required . Using ohm s law as a crude estimator of compliance voltage requirements, a series combination of a \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $400\mu \text{m}$\end{document} electrode (up to 25.5k\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $\omega $\end{document}) and a return electrode (up to 5.5k\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} $\omega $\end{document}), as used in a monopolar configuration, could require up to 31v when stimulated at 1ma . Whilst it is not expected that the electrode - tissue interface will behave as a purely resistive conductor, this approximation illustrates that a high voltage compliance capability may be required in some conditions . To the authors knowledge, the capabilities of neurobi in terms of current output, compliance voltage, electrode configurability and portability are not achievable with commercially available external or implantable stimulators . This flexibility of neurobi will be used with psychophysics testing to explore and refine the stimulator specifications required for a suprachoroidal implant . These can then be used to inform production of a fully implantable stimulator device that is designed to meet those requirements . Its versatility makes it suitable for use in stimulating any neural interface with an externally accessible connection . Additionally, with relatively minor modifications, the switch array can be expanded to 128 channels and setup to route electrode connections to external recording equipment when not being used for stimulation . Currently, neurobi is being used preclinically to test spatiotemporally complex patterns of stimulation that have been proposed for suppressing epileptic seizures and is being integrated into an existing closed - loop system for epileptic seizure detection and suppression, . It is also intended that neurobi will be used in a seizure prediction system that probes cortical excitability using subdural electrodes, for cortical mapping prior to surgical resection, and in a closed - loop deep brain stimulation system . Whilst the effectiveness of symmetric biphasic waveforms (as in figure 2) for neurostimulation is well established, other waveforms, such as sine waves or asymmetric biphasic pulses,, may provide benefits such as greater neuronal selectivity and/or reduced perceptual thresholds . A stimulator with arbitrary waveform capabilities will allow these concepts to be evaluated, including whether they are safe for chronic use . The capability to simultaneously deliver current to multiple electrodes in a controlled manner would allow advanced stimulation strategies to be applied, such as current steering which has the potential to improve the spatial resolution of retinal prostheses, . A device with the necessary capabilities is required to evaluate the safety and efficacy of such strategies . The initial application for neurobi was to evaluate the capabilities of a suprachoroidal retinal prosthesis in visually impaired humans . Using neurobi, reproducible phosphenes were successfully elicited in one patient with light perception vision only, suggesting that the suprachoroidal space is a viable implantation site for a retinal prosthesis . The results obtained from subsequent experiments performed using neurobi will guide the design of next - generation devices and progress the development of a commercially viable visual prosthesis that can provide functional vision to the profoundly vision - impaired . The configurability of neurobi also makes it suitable for use in a number of other clinical neurostimulation applications and it is already being used to develop treatments for epilepsy and other neurological disorders . As such, neurobi is a valuable tool for translating clinical research into therapeutic devices.
Urolithiasis in children remains endemic in our region afflicting children of <1 year to 15 years of age . In fact stone disease comprises more than 60% of the urological disease burden in a urology center . Many children present late with large stone burden associated with varying degree of renal failure . In developed countries, management of pediatric stone disease has shifted from the historic open surgical procedures to newer minimally invasive techniques (mis), e.g., shockwave lithotripsy (swl), percutaneous nephrolithotomy (pcnl), ureterorenoscopy (urs) utilizing ultrasound and laser as a source of intracorporeal lithotripsy. [35] although our experience is similar where mis techniques constitute the mainstay of treatment of patients with stones, large number of stone formers presenting with complex and neglected stones and their geographic / demographic variables still necessitate treatment by open surgery . In this paper, we describe the need and outcome of open surgical procedures in the era of mis from the perspective of a developing country . This is a retrospective analysis of 3969 pediatric stone surgeries performed in 3053 patients between january 2004 and december 2008 at a tertiary care urology center . The whole treatment was offered free to all patients on a model based on community government partnership where the infrastructure is provided by the government and funds by the community . This allows our center to provide free comprehensive treatment with the lifelong follow - up . Hospital records were reviewed for demographics, area of residence, travel distance, and socioeconomic factors from the medical social department . Clinical history, operation notes, pertinent radiographic, and laboratory findings and procedures undertaken were recorded from the patients records . Apart from the type of surgery performed, other factors analyzed included stone bulk and complexity, blood transfusions, hospital stay, stone free rates, and intra- and postoperative complications . Swl was advised for stone size up to 1.5 cm, preferable with normal renal functions, good cortical thickness, no or minimal hydronephrosis, and without urinary tract infection (uti). Ultrasound combined with x - ray was used for stone imaging . Swl in majority of the children were performed under general anesthesia; however, in selected older children intravenous sedation has been used . Pcnl was performed in patient with stones greater than 1.0 cm, favorable pelvicalyceal anatomy, age more than 1 year, preferably good cortical thickness, and no uti . Open surgery was performed in children with large bulk of stones, anatomical abnormalities, marked obstructive cortical atrophy and scarring, gross hydronephrosis, or uti . Nephrectomy was performed in end - stage kidneys with stones including pyonephrosis / xanthogranulomatous pyelonephritis . Ureteric stones: ureterorenoscopy using holmium: yag (ho: yag) laser or pneumatic lithoclast was used to fragment ureteric stones upto 1.5 cm, preferably in lower and midureter . Lager stones greater than 1.5 cm, and impacted stones with uti, or with anatomical abnormalities wanting open surgical correction (ureteroneocystostomy) were managed by ureterolithotomy . Vesical stones: perurethral cystolithotripsy (pucl) was performed in stones upto 2.5 cm using pneumatic lithoclast or ho: yag laser . Large size stones with uti and lower urinary tract abnormalities were managed by percutaneous cystolithotripsy (pccl) and cystolithotomy . Furthermore open surgery was undertaken where logistic and economic factors made this modality the preferred choice for the patients . Swl was advised for stone size up to 1.5 cm, preferable with normal renal functions, good cortical thickness, no or minimal hydronephrosis, and without urinary tract infection (uti). Ultrasound combined with x - ray was used for stone imaging . Swl in majority of the children were performed under general anesthesia; however, in selected older children intravenous sedation has been used . Pcnl was performed in patient with stones greater than 1.0 cm, favorable pelvicalyceal anatomy, age more than 1 year, preferably good cortical thickness, and no uti . Open surgery was performed in children with large bulk of stones, anatomical abnormalities, marked obstructive cortical atrophy and scarring, gross hydronephrosis, or uti . Nephrectomy was performed in end - stage kidneys with stones including pyonephrosis / xanthogranulomatous pyelonephritis . Ureteric stones: ureterorenoscopy using holmium: yag (ho: yag) laser or pneumatic lithoclast was used to fragment ureteric stones upto 1.5 cm, preferably in lower and midureter . Lager stones greater than 1.5 cm, and impacted stones with uti, or with anatomical abnormalities wanting open surgical correction (ureteroneocystostomy) were managed by ureterolithotomy . Vesical stones: perurethral cystolithotripsy (pucl) was performed in stones upto 2.5 cm using pneumatic lithoclast or ho: yag laser . Large size stones with uti and lower urinary tract abnormalities were managed by percutaneous cystolithotripsy (pccl) and cystolithotomy . Furthermore open surgery was undertaken where logistic and economic factors made this modality the preferred choice for the patients . In the last two decades, over 7235 patients presented with urolithiasis in our outpatient department (opd) and emergency room . Establishment of a dedicated pediatric stone clinic increased the number of patients many fold as a result about 42% (3053) presented within the last 5 years . Between january 2004 and december 2008, 3969 surgeries were performed in 3053 patients by minimally invasive methods and/or open surgery [table 1]. The mean age of the patients was 6.35 3.7 with a male - to - female ratio of 2.8:1 and a range of 25 days (<1 month) to 15 years . These patients required initial management in the form of hemodialysis in 210 (40.5%), peritoneal dialysis in 30 (5.7%), percutaneous nephrostomy (pcn) in 163 (31.4%), and double j stent placement in 114 (22%). Anatomical abnormalities included complex pelvicalyceal anatomy in 98, pelviureteric junction obstruction (pujo) in 35, ectopic, horseshoe, cross - fused ectopic kidneys in 40, and duplex system with nonfunctioning upper or lower moiety in 14 patients . Many of the factors were prevalent in combination and about one - third of the open surgeries were performed due to inability to visit the center on multiple occasions either for economic or logistic reasons, i.e., place of residence several hundred kilometers from the center . Of the 3053 patients, 1404 (46%) were from rural areas with a mean travel distance of 175 145 km (even upto 1000 km) and a mean travel time of 13 8 h by road transport . Of the 1404 patients from rural area, 547 (39%) were managed by open surgery as compared to 362 (22%) of the patients from urban areas . One of the reasons of necessitating open surgery is the large stone burden and this includes partial staghorn and staghorn stones . The mean size of the kidney stone was 5.05 5.88 cm, ureter 1.95 1.33 cm, and bladder 7.6 3.2 cm . Stones at multiple sites in 305 (26%) and large stone burden in 440 (37.4%) [figure 1] were other important factors . Gross hydronephrosis and thin cortex with thickness in the range 0.3 - 0.6 cm were the other factors . Children <1 year and majority of infants, those with large burden were treated by open surgery . The other group included coagulation disorders, hemoglobinopathies, and comorbids where open surgery was undertaken after corrective measures to avoid similar treatment on repeated occasions for mis . Overall success rate was 90% in pcnl, 96% in urs, 100% in cystolithotripsy, and 81% in swl . Mean hospital stay, blood requirement, and stone - free rates were similar in pyelolithotomy and pcnl . Surgical modalities in pediatric stone formers frequencies of factors necessitating open surgery complex large stone burden . (a) large stones at multiple sites specially in right ureter . Outcome measures in minimally invasive surgery and open surgery comparison of outcome and complications in various modalities for treatment of renal stones advances in technology have changed the management of stone disease . There has been a paradigm shift from open surgical procedures to the era of mis . In developed countries, more than 95% of patients the few that still require open surgery are the patients with anatomical abnormalities and complex large stone burden . In fact open surgery is now a last resort when all else fails with mis . However there is a contrast when it comes to developing countries where open surgery still retains its importance in the armamentarium for the management of stone disease . Indications for open surgery from our experience can be divided into two groups first technical which are more or less prevalent in every part of the world . These include anatomical abnormalities, complex and large stones, neglected stones with renal failure, and failed mis and second socioeconomic which are generally specific to developing countries . Considering the first criteria, the disease is endemic with large number of patients and a significant proportion of present with complex and large stone burden and many in renal failure . Almost 1/5th of our population present in renal failure and other reports from the region give a similar picture with a range of 5 - 15% . This is in contrast to developed countries where the overall burden is small and patients present early due to high degree of awareness, screening, and availability of urological services . In our population, open surgery therefore remains the preferred approach for patients with complex stone burden, specially where these are associated with anatomical abnormalities, e.g., pelvic uretro junction obstruction (pujo), horseshoe kidneys, pelvic kidney, malrotated kidney, severe obstruction, cortical atrophy and scarring, and with uti or sepsis . Socioeconomic factors that necessitate open surgical procedures include poor infrastructure, paucity of urological facilities, and residence of poor patients in the rural areas . Considering pakistan as an example of a developing country, the per capita income is $1,000 and 33% of the population lives below the poverty line mostly in rural areas and the government expenditure on health is 1.3% of gdp . Facilities where available are offered at a cost which is beyond majority of the patients . They therefore seek alternate therapies and only present at tertiary centers when the stone burden has become too large, patients are in sepsis, and/or varying degree of renal failure . These factors combined with poverty, malnutrition, and logistic problems all contribute to the neglected stone disease . Therefore when patients travel long distances to the tertiary care centers, they prefer open surgery as one - time treatment because repeated visits are economically not feasible . Almost a third of our patients from rural areas preferred open surgery to avoid costs of travel, board and lodge in the city, even though all treatment is offered free at our center . Our policy of free treatment, therefore, brings patients to us from far and wide as reflected by the large number of surgeries performed at our center . Management of stone disease, therefore, has to be viewed in the context of the technical aspects related to disease pattern and burden and the socio - economic conditions of the patients . Presently, at our center 70% of the surgeries are by mis where the number of patients is very large as compared to that which is seen in centers in developed countries with low incidence of stone disease . Although mis has enabled us to treat large number of patients with excellent stone - free rates, swl 81%, pcnl 90%, urs 96%, and cystolithotripsy 100% which are comparable to other centers in the world, for the large stone burden with prevalence rate of 10 - 15% mis will have little impact . We therefore have to invest in preventative and awareness strategies to reduce the stone burden . Economic forecasts for the region predict that the two reasons that necessitate open surgery are likely to persist in the foreseeable future . Therefore mis and open surgery will be required side by side and will remain important components for the management of stone disease . Minimally invasive surgery is the way forward; however the pattern of stone disease, patient volume, and overall economy still gives open surgery the therapy of choice status in many situations . Therefore the scope of open surgery will remain much wider for a large population of patients for considerable time in developing countries.
Patients undergoing orthopedic surgery are of different ages and sizes . Regional analgesia and anesthesia are often beneficial for these patients . The choices of anesthesia are as varied as the operations done through the scope, and include general blocks, central neuraxial blocks, peripheral nerve blocks, and intra - articular local anesthetic techniques.1 in the last decade, bupivacaine has been the most frequently used agent for spinal and epidural anesthesia.2,3 in ambulatory surgery, such as diagnostic knee arthroscopy, bupivacaine may delay the recovery of motor function and cause urinary retention, leading to delayed discharge.4,5 unilateral spinal anesthesia is frequently used in lower limb surgery.6,7 several advantages are claimed for this anesthetic technique, including fewer hemodynamic complications,8 selective block on the operated side, avoidance of unnecessary paralysis on the nonoperated side, better mobilization during the recovery period, lower incidence of postoperative urine retention,9 as well as good patient satisfaction.10 to achieve successful unilateral anesthesia, several factors are required, including needle shape and bevel direction, site and speed of injection of anesthetic, volume, baricity, and concentration of the anesthetic solution, as well as an appropriate degree of operating table inclination.11,12 moreover, patient posture is thought to be fundamental in determining the level of anesthesia spread, particularly when a hyperbaric anesthetic solution is used.13 previous studies have failed to determine the ideal dose of local anesthetic to achieve unilateral spinal anesthesia . Therefore, our aim was to evaluate the influence of the dose of hyperbaric bupivacaine on the success of unilateral spinal anesthesia by assessment of maximum sensory and motor block on the operative and nonoperative sides during knee arthroscopy and its effect on hemodynamics . This study was carried out as a prospective, randomized, double - blind clinical trial . After approval of the local ethics committee and informed patient consent was obtained, 80 male and female patients undergoing diagnostic knee arthroscopy in routine surgical theaters at the suez canal university hospital in ismailia were enrolled in this study . Inclusion criteria were american society of anesthesiologists (asa) score i ii, age 2150 years, body mass index <30 kg / m, and height 160180 cm . Patients with skin infection at the site of regional anesthesia, coagulopathy, taking anticoagulant drugs, having allergy to local anesthetic drugs, hypovolemia, low fixed cardiac output, neurologic disorder, or spine deformity were excluded from the study . The patients were randomly allocated into four groups (n = 20 each) receiving different doses of hyperbaric bupivacaine 0.5% . Group 1 received 5 mg, group 2 received 7.5 mg, group 3 received 10 mg, and group 4 received 12.5 mg . All patients were given 2 mg midazolam intravenously as premedication, as well as an intravenous infusion of 7 ml / kg of lactated ringer solution . Standard monitoring was used, including noninvasive blood pressure, electrocardiogram, peripheral pulse oximetry, and respiratory rate measurements . All patients were placed in a lateral position on the operative side, while the vertebral column was positioned as horizontally as possible . Under complete aseptic technique and after back sterilization, dural puncture was performed using a midline approach at the l3l4 interspace with a 25 gauge spinal needle . Using sealed envelopes prepared according to a computer generated randomization table, patients in each group received different doses of bupivacaine (marcaine spinal heavy, astra, sweden), ie, group 1 received 5 mg bupivacaine 0.5% 1 ml, group 2 received 7.5 mg bupivacaine 0.5% 1.5 ml, group 3 received 10 mg bupivacaine 0.5% 2 ml, and group 4 received 12.5 mg bupivacaine 0.5% 2.5 ml . After observation of free flow of cerebrospinal fluid, the spinal needle aperture was turned toward the dependent side and the selected dose of local anesthetic solution was injected slowly with an injection speed of 0.5 ml/10 seconds without further aspiration maneuvers . Patients were maintained in the lateral decubitus position for a 20-minute period, after which patients were turned to the supine position.11,14 an independent blinded observer evaluated the evolution of sensory and motor blocks on both sides immediately after turning the patient supine for 20 minutes after the block, and then after 10 minutes . Sensory block was assessed as complete loss of sensation to pinprick (via a 23 gauge hypodermic needle). Motor block was assessed using a modified bromage scale whereby patients were asked to flex the limb at the hip, knee, and ankle joints, and the results were recorded as 0 = no motor block, 1 = hip blocked, 2 = hip and knee blocked, 3 = hip, knee, and ankle blocked.9 patients were judged ready for surgery when complete loss of pinprick sensation was reported at t12 on the operative limb . Postoperative analgesia included oral ketorolac (50 mg every eight hours), with the first dose administered before surgery by the intravenous route.9 requirement for rescue analgesia was recorded . Motor and sensory block was monitored in the postanesthesia care unit at 10-minute intervals until time to complete regression of spinal block . Occurrence of adverse events, including nausea, vomiting, pruritus, and urine retention was also recorded . Statistical analysis was performed using the program spss version 15 (spss inc, chicago, il). Demographic data, onset times to anesthetic block, and surgery times were analyzed by one - way analysis of variance (anova), whereas changes over time were analyzed with a two - way anova for repeated measures . Categoric variables were analyzed using contingency table analysis and the chi - square test with the appropriate corrections . All patients were placed in a lateral position on the operative side, while the vertebral column was positioned as horizontally as possible . Under complete aseptic technique and after back sterilization, dural puncture was performed using a midline approach at the l3l4 interspace with a 25 gauge spinal needle . Using sealed envelopes prepared according to a computer generated randomization table, patients patients in each group received different doses of bupivacaine (marcaine spinal heavy, astra, sweden), ie, group 1 received 5 mg bupivacaine 0.5% 1 ml, group 2 received 7.5 mg bupivacaine 0.5% 1.5 ml, group 3 received 10 mg bupivacaine 0.5% 2 ml, and group 4 received 12.5 mg bupivacaine 0.5% 2.5 ml . After observation of free flow of cerebrospinal fluid, the spinal needle aperture was turned toward the dependent side and the selected dose of local anesthetic solution was injected slowly with an injection speed of 0.5 ml/10 seconds without further aspiration maneuvers . Patients were maintained in the lateral decubitus position for a 20-minute period, after which patients were turned to the supine position.11,14 an independent blinded observer evaluated the evolution of sensory and motor blocks on both sides immediately after turning the patient supine for 20 minutes after the block, and then after 10 minutes . Sensory block was assessed as complete loss of sensation to pinprick (via a 23 gauge hypodermic needle). Motor block was assessed using a modified bromage scale whereby patients were asked to flex the limb at the hip, knee, and ankle joints, and the results were recorded as 0 = no motor block, 1 = hip blocked, 2 = hip and knee blocked, 3 = hip, knee, and ankle blocked.9 patients were judged ready for surgery when complete loss of pinprick sensation was reported at t12 on the operative limb . Postoperative analgesia included oral ketorolac (50 mg every eight hours), with the first dose administered before surgery by the intravenous route.9 requirement for rescue analgesia was recorded . Motor and sensory block was monitored in the postanesthesia care unit at 10-minute intervals until time to complete regression of spinal block . Occurrence of adverse events, including nausea, vomiting, pruritus, and urine retention was also recorded . Statistical analysis was performed using the program spss version 15 (spss inc, chicago, il). Demographic data, onset times to anesthetic block, and surgery times were analyzed by one - way analysis of variance (anova), whereas changes over time were analyzed with a two - way anova for repeated measures . Categoric variables were analyzed using contingency table analysis and the chi - square test with the appropriate corrections . There were no significant differences in age, gender, body mass index, and duration of surgery between the patients in the four groups (table 1). No statistically significant difference was found between the four groups for heart rate changes during surgery (figure 1). There was a statistically significant decrease in mean arterial blood pressure in group 3 and 4 patients who had been injected with 10 mg and 12.5 mg, respectively . In group 3, this drop lasted for only 15 minutes and, thereafter returned to near baseline values, while in group 4 this drop remained until the end of the operation (figure 2, table 2). Sensory block on the nonoperative side was significantly less than that on the operative side . In group 1 and in group 2, strict unilateral anesthesia was reported among 90% and 85% of patients, respectively, in whom the level of sensory block on the operative side was t10 and t8, respectively . In groups 3 and 4, none of the studied patients showed strict unilateral spinal anesthesia and the sensory block in the non - operative side reached t12 and t8 levels, respectively, while the level of sensory block in the operative limb reached t6 and t5, respectively (tables 3, 4, and 5). Motor block on the operative side was statistically significant when compared with the nonoperative side (p <0.05). Motor block on the operative side in groups 2, 3, and 4 was statistically significant compared with motor block on operative side in group 1, while no statistically significant difference was reported when comparing pairs of the former three groups . Unilateral motor block (modified bromage scale 0) was reported in 95% of patients in group 1, 90% in group 2, and only 5% in group 3, while none of the patients in group 4 showed unilateral motor block (table 6). The time required for regression of motor block (bromage scale 0) was more prolonged with higher doses and the difference was statistically significant . The regression time was 59.8 (55100), 98.3 (60120),123.9 (60150), and 148.9 (110180) minutes for groups 1, 2, 3, and 4 respectively . The incidence of nausea, vomiting, and urine retention was similar in the four study groups (table 7). The ideal selective spinal anesthesia for knee arthroscopy would provide minimal or no motor blockade at the end of the surgical procedure, such that the patient can be fast tracked.5 using a minidose of lidocaine - fentanyl15 or hyperbaric bupivacaine,16 ben - david et al discharged their knee arthroscopy patients at 145 minutes and 202 minutes, respectively . As regards the hemodynamic effects of different doses of hyperbaric bupivacaine during surgery, no statistically significant differences were found between the four study groups with regard to heart rate changes during surgery . Hypotension is a common complication of spinal anesthesia, occurring in 15%17 to 33%18 of patients when larger doses of local anesthetic have been used . Unilateral spinal anesthesia with hypobaric or hyperbaric bupivacaine was associated with less hypotension,19,20 which is consistent with our results . In our study, unilateral spinal anesthesia (regarding sensory block) was reported by 90% and 85% of patients in group 1 and group 2, respectively, while in group 3 and group 4 none of the studied patients showed unilateral anesthesia . For motor block, unilateral anesthesia was recorded in 95% of patients in group 1, 90% in group 2, and only 5% in group 3, while none of the patients in group 4 showed unilateral spinal anesthesia . Valanne et al21 compared the effect of 4 mg and 6 mg of hyperbaric bupivacaine for spinal anesthesia in 106 ambulatory adult patients undergoing knee arthroscopy . However, rapid regaining of motor function was reported with the lower dose . In our study, the time to regression of motor block was found to be significantly increased with increasing the injected dose of hyperbaric bupivacaine, with mean times of 59.8, 98.3, 123.6 and 148.9 minutes in groups 1, 2, 3, and 4, respectively . In another study, fanelli et al9 compared unilateral and conventional bilateral bupivacaine spinal block in outpatients undergoing knee arthroscopy . In the unilateral group, they used 8 mg of hyperbaric bupivacaine 0.5% in 50 patients in lateral decubitus position after spinal injection was maintained in the unilateral group for 15 minutes . They found that, for the unilateral group, sensory and motor blocks on the operated limb were t9 (t12t2) with a bromage score 0/1/2/3 in 0/2/3/45 patients, respectively, in the unilateral group . Two segment regressions of sensory level and home discharge required 81 25 minutes and 281 83 minutes with bilateral block, and 99 28 minutes and 264 95 minutes with unilateral block . Borghi et al22 carried out a prospective, randomized, blinded study among 90 asa i and ii outpatients scheduled for elective knee arthroscopy . After placement of the patients in the lateral decubitus position, they received spinal block with 4, 6, or 8 mg of 0.5% hyperbaric bupivacaine on the operative side, injected slowly with the needle orifice directed toward the dependent side using a 25-gauge whitacre needle . The maximum level of sensory block on the operative and nonoperative sides was, respectively, t10 (t12t6) and (<l2) in the 4 mg group, t8 (t12t6) and (<l5) in the 6 mg group, and t7 (t12t5) and (<t10) in the 8 mg group . Unilateral sensory block was observed in 27 patients in the 4 mg group (90%), 28 patients in the 6 mg group (93%), and 23 patients in the 8 mg group (77%, p <0.28). Complete unilateral motor block was observed in 29 patients in the 4 mg group (97%), 28 patients in the 6 mg group (93%), and 28 patients in the 8 mg group (93%, p = 0.80). Complete regression of spinal anesthesia required 71 20 minutes in the 4 mg group (range 40110 minutes), 82 25 minutes in the 6 mg group (range 30160 minutes), and 97 37 minutes in the 8 mg group (range 50 to 120 minutes). Analysis of side effects showed that the injected dose did not affect the incidence of side effects, such as nausea, vomiting, urinary retention, or need for analgesia . Although our study was different from other studies regarding dose, position, and patients being kept on the lateral side for 20 minutes, our results were found to be consistent with earlier ones because higher doses of hyperbaric bupivacaine were associated with higher levels of maximum sensory and motor block and longer duration to achieve regression of sensory block . Unilateral sensory and motor block, a faster recovery profile, and a stable hemodynamic state can be achieved with doses of 5 mg and 7.5 mg of hyperbaric bupivacaine 0.5% injected slowly through pencil - point directional needles in patients who are maintained in the lateral decubitus position for 20 minutes . However, 7.5 mg of hyperbaric bupivacaine 0.5% was the dose required for adequate unilateral spinal anesthesia with adequate sensory and motor block.
Noncompaction cardiomyopathy (nccm) is a recently recognized rare disorder [1, 2]. It is characterized by prominent myocardial trabecularizations, and deep intertrabecular recesses leading to the spongy appearance of the myocardium . The disease is frequently associated with systolic and diastolic heart failure (hf), ventricular arrhythmias, and systemic embolization . Alterations in arterial function have been demonstrated in patients with hf [5, 6]. With two - dimensional transthoracic echocardiography (tte), ascending aortic diameter changes during a heart cycle can be measured . When blood pressure data are also available, aortic elasticity can be characterized [7, 8]. This study was designed to examine aortic stiffness in nccm patients and to compare these results to age- and gender - matched controls . A total of 20 patients with typical echocardiographic features of nccm were investigated [3, 9]. Clinical assessment included medical and family history, physical examination, electrocardiography, two - dimensional echocardiography, and, in most cases, contrast echocardiography . Their results were compared to 20 age- and gender - matched controls without apparent cardiovascular disease . Informed consent was obtained from each patient, and the study was approved by the institutional review board and complied with the declaration of helsinki . Table 1.clinical and demographic data of nccm patientsnccm patientsage (years)38 16male (%) 8 (40)diabetes (%) 1 (5)index eventarrhythmia (%) 6 (30)heart failure (%) 8 (40)screening (%) 6 (30)electrocardiogramatrial fibrillation (%) 2 (10)lv hypertrophy (%) 3 (15)left bundle branch block (%) 6 (30)nccm noncompaction cardiomyopathy clinical and demographic data of nccm patients nccm noncompaction cardiomyopathy previously proposed echocardiographic diagnostic criteria for nccm by jenni et al . Were used: (1) absence of coexisting cardiac anomalies, (2) segmental, excessive thickening of the left ventricular (lv) wall with a two - layered structure: a thin, compacted epicardial layer and a much thicker, noncompacted layer with the characteristic appearance of numerous, prominent trabeculations (meshwork) and deep intertrabecular recesses, (3) color doppler evidence of deeply perfused intertrabecular recesses, and (4) predominant localization of thickening in the lv apical, midlateral, and midinferior walls . Hypertensive heart disease was excluded by clinical and echocardiographic examinations (septal thickness <13 mm). Systolic and diastolic blood pressures (sbp and dbp, respectively) were measured in the supine position with an automatic mercury cuff sphygmomanometer from the left arm after 10 min of rest . None of the patients or controls used coffee or tea within 1 h before blood pressure measurements . All patients underwent a complete two - dimensional tte and doppler study using a philips sonos 7500 echocardiography equipment (philips, best, the netherlands) in the left lateral decubitus position from multiple windows . The lv wall segments were analyzed according to the 9-segment model as described by jenni et al . . Systolic and diastolic ascending aortic diameters (sd and dd, respectively) were recorded in m - mode at a level of 3 cm above the aortic valve from a parasternal long - axis view (fig . 1). The sd and dd were measured at the time of maximum anterior motion of the aorta and at the peak of the qrs complex, respectively . 1measurements of systolic (sd) and diastolic (dd) diameters of the ascending aorta are shown on the m - mode tracing obtained at a level 3 cm above the aortic valve measurements of systolic (sd) and diastolic (dd) diameters of the ascending aorta are shown on the m - mode tracing obtained at a level 3 cm above the aortic valve aortic stiffness index () was defined as ln(sbp data are reported as means standard deviation . For variables, student s t test and analysis of variance (anova) test the reproducibility of the aortic diameter measurements was tested in all nccm patients at both systole and diastole by two independent, blinded observers . A total of 20 patients with typical echocardiographic features of nccm were investigated [3, 9]. Clinical assessment included medical and family history, physical examination, electrocardiography, two - dimensional echocardiography, and, in most cases, contrast echocardiography . Their results were compared to 20 age- and gender - matched controls without apparent cardiovascular disease . Informed consent was obtained from each patient, and the study was approved by the institutional review board and complied with the declaration of helsinki . Table 1.clinical and demographic data of nccm patientsnccm patientsage (years)38 16male (%) 8 (40)diabetes (%) 1 (5)index eventarrhythmia (%) 6 (30)heart failure (%) 8 (40)screening (%) 6 (30)electrocardiogramatrial fibrillation (%) 2 (10)lv hypertrophy (%) 3 (15)left bundle branch block (%) 6 (30)nccm noncompaction cardiomyopathy clinical and demographic data of nccm patients nccm noncompaction cardiomyopathy were used: (1) absence of coexisting cardiac anomalies, (2) segmental, excessive thickening of the left ventricular (lv) wall with a two - layered structure: a thin, compacted epicardial layer and a much thicker, noncompacted layer with the characteristic appearance of numerous, prominent trabeculations (meshwork) and deep intertrabecular recesses, (3) color doppler evidence of deeply perfused intertrabecular recesses, and (4) predominant localization of thickening in the lv apical, midlateral, and midinferior walls . Hypertensive heart disease was excluded by clinical and echocardiographic examinations (septal thickness <13 mm). Systolic and diastolic blood pressures (sbp and dbp, respectively) were measured in the supine position with an automatic mercury cuff sphygmomanometer from the left arm after 10 min of rest . None of the patients or controls used coffee or tea within 1 h before blood pressure measurements . All patients underwent a complete two - dimensional tte and doppler study using a philips sonos 7500 echocardiography equipment (philips, best, the netherlands) in the left lateral decubitus position from multiple windows . The lv wall segments were analyzed according to the 9-segment model as described by jenni et al . . Systolic and diastolic ascending aortic diameters (sd and dd, respectively) were recorded in m - mode at a level of 3 cm above the aortic valve from a parasternal long - axis view (fig . 1). The sd and dd were measured at the time of maximum anterior motion of the aorta and at the peak of the qrs complex, respectively . 1measurements of systolic (sd) and diastolic (dd) diameters of the ascending aorta are shown on the m - mode tracing obtained at a level 3 cm above the aortic valve measurements of systolic (sd) and diastolic (dd) diameters of the ascending aorta are shown on the m - mode tracing obtained at a level 3 cm above the aortic valve aortic stiffness index () was defined as ln(sbp / dbp)/[(sd - dd)/dd], where ln is the natural logarithm . Data are reported as means standard deviation . For variables, student s t test and analysis of variance (anova) test the reproducibility of the aortic diameter measurements was tested in all nccm patients at both systole and diastole by two independent, blinded observers . The presenting symptoms were hf in eight (40%) and arrhythmias in six (30%) patients . The remaining six (30%) asymptomatic patients were nccm relatives and were diagnosed after family screening (table 1). Three hf patients were in nyha - class iii hf and the other five were in nyha - class ii . Cardiac medication used in nccm patients were: angiotensin - converting enzyme inhibitors in 13 (65%), beta - blockers in 11 (55%), oral anticoagulant therapy in 10 (50%), diuretics in 8 (40%), digitalis in 2 (10%), and nitrate in 1 (5%). The number of noncompacted segments in the nccm patients was 4.6 2.0 in the nccm group and (as seen in table 2) these patients had significantly increased lv dimensions and reduced lv ejection fraction . Aortic stiffness index () was significantly increased in nccm patients compared to controls . For controls, nccm patients with moderate hf, and nccm patients with severe hf, values were 3.5 1.1, 7.9 5.5, and 10.4 1.8, respectively (p <0.001). Aortic stiffness indices of all individual patients and controls are presented in fig . 2 . Table 2.transthoracic echocardiographic and blood pressure data in nccm patients and normal subjectsgroup 1 (normal subjects)group 2 (nccm patients)lv end - diastolic diameter (mm)47.4 3.661.0 10.9lv end - systolic diameter (mm)29.9 2.948.2 12.3lv ejection fraction (%) 67.5 5.936.0 17.6systolic aortic diameter (mm)26.7 4.126.6 4.4diastolic aortic diameter (mm)23.3 3.824.6 4.3pulsatile change in aortic diameter (mm)3.4 1.12.0 1.2systolic blood pressure (mmhg)125.2 12.9120.4 17.4diastolic blood pressure (mmhg)77.8 8.574.1 9.6aortic pulse pressure (mmhg)47.4 8.746.3 11.7aortic stiffness index ()3.5 1.18.3 5.2continuous variables are given as mean standard deviationlv left ventricular, nccm noncompaction cardiomyopathyp <0.001fig . Nccm noncompaction cardiomyopathy transthoracic echocardiographic and blood pressure data in nccm patients and normal subjects continuous variables are given as mean standard deviation lv left ventricular, nccm noncompaction cardiomyopathy individual indices of nccm patients and control subjects . Nccm noncompaction cardiomyopathy the mean standard deviation difference in values obtained by two observers for the measurements of aortic diameter at systole was 0.7 2.2 mm, with a correlation coefficient between these independent measurements of 0.88 (p <0.01) (figs . The difference between these observations was 0.05 1.95 mm, with a correlation coefficient between observations of 0.9 (p <0.01). The difference in values that were detected by observers was within twofold of the standard deviation of the mean (figs . 3a interobserver correlation (r = 0.88, p <0.01) between aortic systolic diameters in nccm patients . B interobserver correlation (r = 0.9, p <0.01) between aortic diastolic diameters in nccm patients . Nccm noncompaction cardiomyopathy a interobserver correlation (r = 0.88, p <0.01) between aortic systolic diameters in nccm patients . B interobserver correlation (r = 0.9, p <0.01) between aortic diastolic diameters in nccm patients . The presenting symptoms were hf in eight (40%) and arrhythmias in six (30%) patients . The remaining six (30%) asymptomatic patients were nccm relatives and were diagnosed after family screening (table 1). Three hf patients were in nyha - class iii hf and the other five were in nyha - class ii . Cardiac medication used in nccm patients were: angiotensin - converting enzyme inhibitors in 13 (65%), beta - blockers in 11 (55%), oral anticoagulant therapy in 10 (50%), diuretics in 8 (40%), digitalis in 2 (10%), and nitrate in 1 (5%). The number of noncompacted segments in the nccm patients was 4.6 2.0 in the nccm group and (as seen in table 2) these patients had significantly increased lv dimensions and reduced lv ejection fraction . Aortic stiffness index () was significantly increased in nccm patients compared to controls . For controls, nccm patients with moderate hf, and nccm patients with severe hf, values were 3.5 1.1, 7.9 5.5, and 10.4 1.8, respectively (p <0.001). Table 2.transthoracic echocardiographic and blood pressure data in nccm patients and normal subjectsgroup 1 (normal subjects)group 2 (nccm patients)lv end - diastolic diameter (mm)47.4 3.661.0 10.9lv end - systolic diameter (mm)29.9 2.948.2 12.3lv ejection fraction (%) 67.5 5.936.0 17.6systolic aortic diameter (mm)26.7 4.126.6 4.4diastolic aortic diameter (mm)23.3 3.824.6 4.3pulsatile change in aortic diameter (mm)3.4 1.12.0 1.2systolic blood pressure (mmhg)125.2 12.9120.4 17.4diastolic blood pressure (mmhg)77.8 8.574.1 9.6aortic pulse pressure (mmhg)47.4 8.746.3 11.7aortic stiffness index ()3.5 1.18.3 5.2continuous variables are given as mean standard deviationlv left ventricular, nccm noncompaction cardiomyopathyp <0.001fig . Nccm noncompaction cardiomyopathy transthoracic echocardiographic and blood pressure data in nccm patients and normal subjects continuous variables are given as mean standard deviation lv left ventricular, nccm noncompaction cardiomyopathy individual indices of nccm patients and control subjects . The mean standard deviation difference in values obtained by two observers for the measurements of aortic diameter at systole was 0.7 2.2 mm, with a correlation coefficient between these independent measurements of 0.88 (p <0.01) (figs . The difference between these observations was 0.05 1.95 mm, with a correlation coefficient between observations of 0.9 (p <0.01). The difference in values that were detected by observers was within twofold of the standard deviation of the mean (figs . 3a interobserver correlation (r = 0.88, p <0.01) between aortic systolic diameters in nccm patients . B interobserver correlation (r = 0.9, p <0.01) between aortic diastolic diameters in nccm patients . Nccm noncompaction cardiomyopathy a interobserver correlation (r = 0.88, p <0.01) between aortic systolic diameters in nccm patients . B interobserver correlation (r = 0.9, p <0.01) between aortic diastolic diameters in nccm patients . Nccm is a recently recognized disorder characterized by a loosened, spongy myocardium associated with a high incidence of progressive systolic and diastolic hf . In recent studies, alterations have been demonstrated in arterial function in patients with chronic hf [1114]. To the best of authors s knowledge, this is the first time that the aortic distensibility in a series of nccm patients was examined . In this study, increased aortic stiffness index () was found in nccm patients compared to age- and gender - matched controls . In prior studies, it has been shown that pulsatile changes in ascending aortic vessel diameter can be indirectly measured during routine tte . Stefanadis et al . Found that noninvasive measurements of aortic distensibility were as accurate as invasive methods . Aortic stiffness index () relies on aortic and blood pressure data and is one of the most frequently used parameters to characterize arterial stiffness [7, 8]. Increased aortic stiffness is an independent risk factor, predictor of cardiovascular mortality, and a contributor to lv afterload [15, 16]. Increased aortic stiffness occurs early during the development of pacing - induced congestive hf in animals [17, 18] and has also been described in clinical patients with hf [5, 6], with comparable changes in arterial distensibility in ischemic and idiopathic dilated cardiomyopathy . . Demonstrated that the distensibility of the proximal aorta is markedly reduced in older patients with hf due to lv systolic dysfunction beyond the changes from the aging process . Giannattasio et al . Described that arterial compliance is impaired in congestive hf, and although more marked in severe congestive hf, the impairment is manifested in mild congestive hf as well . Nakamura et al . Described vascular hypertrophic remodeling and endothelial dysfunction - associated alterations in vascular wall elastic properties in limb muscle conduit arteries in patients with congestive hf . Poelzl et al . Described an intriguing relationship between phenotype changes and functional impairment in peripheral conduit arteries of hf patients . Neurohormonal changes associated with hf include an increase in sympathetic drive and an activated renin angiotensin system resulting in increased plasma norepinephrine levels causing vasoconstriction and sodium retention [2023]. Early atheromatous changes and endothelial dysfunction can also be associated with hf, and can affect vascular elasticity . However, there is also an interaction between aortic stiffening and hf . Aortic stiffening can increase lv load causing lv stiffening with increased wall tension, early impairment in diastolic lv relaxation, and contractility inducing lv hypertrophy and fibrosis [26, 27]. These results suggest that aortic stiffness may contribute to the progression of systolic and diastolic lv dysfunctions . During this study, brachial cuff pressure measurement instead of a direct assessment of aortic pulse pressure by catheter was used . However, previous studies demonstrated an excellent correlation in aortic distensibility measured by invasive and noninvasive methods . Coronary artery disease is correlated with increased aortic stiffness and was not excluded in most but not in all our patients by coronary angiography . The aortic elastic properties of control patients were somewhat larger than those described in the literature . The reason for this can be the larger body mass index (29.0 5.1 kg / m) in our controls . However, a relatively higher in the normal subjects in our study only strengthens the abnormal findings in the nccm patients . Increased aortic stiffness can be observed in patients with nccm with moderate to severe hf.
Peribiliary cysts are cystic dilatations of the peribiliary glands of the liver hilum and portal tracts, which lack communication with the lumen of the biliary tree [1, 2]. Peribiliary cysts are often under diagnosed, however, as they are usually asymptomatic and the reported prevalence based on imaging diagnosis is only 9% in among patients with cirrhosis . They are therefore often discovered incidentally, though rarely can lead to symptoms such as obstructive jaundice, and intrahepatic ductal dilatation on cholangiography, which may be misinterpreted as intrahepatic or hilar cholangiocarcinoma (cca) [1, 6]. Misdiagnosis of peribiliary cysts as cca in patients with decompensated cirrhosis may lead delay or denial in listing an otherwise suitable candidate for orthotopic liver transplantation (olt). We present a case of a patient awaiting olt, with a new finding of intrahepatic biliary ductal dilatation initially thought to be secondary to cca, but ultimately diagnosed as multiple peribiliary cysts . His decompensations included hepatic encephalopathy and ascites for which he underwent transjugular intrahepatic portosystemic shunt procedure . In may 2015, the patient was hospitalized for acute on chronic liver failure, with a rise in his model for end - stage liver disease (meld) score from 19 to 35 . On physical examination, he had jaundice, abdominal distension and bilateral peripheral edema . Initial blood tests revealed an alkaline phosphatase at 599 u / l (reference <125 u / l) and total bilirubin at 13.6 (direct bilirubin 11.6). U / l (normal 045 u / l) and aspartate transaminase (ast) 358 u / l (normal 035 u / l). Carbohydrate antigen 19 - 9 (ca 19 - 9) was normal at 4 . Baseline hepatic function tests from 2 weeks prior revealed an alkaline phosphatase of 93, total bilirubin of 6.4, direct bilirubin of 2.7, alt of 23, ast of 85 and inr of 2 . Magnetic resonance imaging (mri) of the abdomen revealed increased t2 signal intensity within the bile ducts and significant dilation predominantly of the left biliary ductal system, with a lesser dilation of the right - sided bile ducts (fig . 1). This was a new finding as compared to imaging from 6 months prior to hospitalization . The cholestatic pattern of liver enzyme abnormality and new biliary ductal dilatation in the absence of choledocholithiasis or a pancreatic head mass was concerning for cca . Figure 1:mri abdomen demonstrating increased t2 signal intensities along the left bile ducts and to lesser extent the right bile ducts . Mri abdomen demonstrating increased t2 signal intensities along the left bile ducts and to lesser extent the right bile ducts . Endoscopic ultrasound (eus) demonstrated a complex cystic mass at the hilum measuring 29.8 28.6 mm . Endoscopic retrograde cholangiopancreatography (ercp) revealed an irregular common hepatic duct with a stricture at the hilum and a stricture of the left intrahepatic duct, with proximal intrahepatic ductal dilation (fig . There was suspicion that the liver hilum was biopsied rather than the targeted cystic mass, thus cca could not be ruled out . The decision was made to perform a biopsy of the cystic mass at the time of olt and to abort transplantation if there was evidence of malignancy . Figure 2:ercp demonstrating mild - to - moderate intrahepatic ductal dilatation with multifocal biliary strictures . Ercp demonstrating mild - to - moderate intrahepatic ductal dilatation with multifocal biliary strictures . In june 2015, the patient underwent olt . Both manual inspection and frozen section examinations of four lymph nodes from the portal structures and the distal margin of the common bile duct ruled out malignancy . Examination of the explant revealed a 4.0 3.5 2.0 cm cystic area at the hilum, 0.2 cm from the bile duct margin . The cysts appeared to run adjacent to the right and left hepatic ducts and caused focal narrowing of the bile duct lumen with proximal biliary ductal dilatation . Figure 3:the liver was grossly cirrhotic with an ill - defined lesion consisting of multiple variably sized cystic spaces in the hilar area that did not communicate with the bile ducts . Sections of the cystic spaces showed variably sized cystic structures predominately lined by simple cuboidal to columnar biliary - type epithelium . The liver was grossly cirrhotic with an ill - defined lesion consisting of multiple variably sized cystic spaces in the hilar area that did not communicate with the bile ducts . Sections of the cystic spaces showed variably sized cystic structures predominately lined by simple cuboidal to columnar biliary - type epithelium . Peribiliary cysts may present a diagnostic challenge in the patient with end - stage liver disease, due to the possibility of being mistaken for cholangiocarcinoma [3, 7]. Such a misdiagnosis can result in delay in listing for olt or even inappropriate exclusion from transplantation, in otherwise acceptable candidates . Therefore, awareness of this condition is of critical importance to the transplant physician and surgeon . The ideal imaging modalities to identify peribiliary cysts include magnetic resonance cholangiography / pancreatography (mrcp) and drip infusion cholangiographic computed tomography (dic - ct). While mri can demonstrate the presence of cysts, a diagnostic feature of peribiliary cysts is their lack of communication with the biliary tree . This can be confirmed using mri with 2d and 3d mrcp sequences, where the cysts appear as a string of bead - like lesions along the hepatic hilum and/or bile ducts . Dic - ct is another option to diagnose peribiliary cysts, though prior reports where peribiliary cysts were diagnosed by dic - ct were in patients without liver disease . Dic - ct may have a limited role in identifying peribiliary cysts in patients with decompensated cirrhosis since it requires normal hepatic function to clearly depict the bile ducts . Hepatic dysfunction and hyperbilirubinemia are known to result in insufficient delineation of the bile ducts when using dic - ct . Therefore, mrcp may be a better modality for identifying peribiliary cysts in those with end - stage liver disease . In our patient, the diagnosis of peribiliary cysts was not made until explant examination despite performance of mri without mrcp, eus and ercp . Although the patient did not undergo mrcp, the combination of mri and ercp could have led to a diagnosis of peribiliary cysts prior to examination of the explant . Our case, therefore, demonstrates the importance to the transplant community of being cognizant of this condition, and further suggests that a diagnosis of peribiliary cysts should be considered in patients with cirrhosis who present with intrahepatic biliary dilatations and obstructive jaundice . In conclusion, we present a case which demonstrates that peribiliary cysts may present with imaging findings concerning for cca . Imaging with mrcp and dic - ct can make a definitive diagnosis, though the degree of hepatic dysfunction may limit the usefulness of dic - ct . The diagnosis of peribiliary cystic disease should be considered in patients with end - stage liver disease who present with cholestasis and biliary ductal dilatation, along with negative biopsy of the biliary ductal system for malignancy.
A 49-year old woman presented in october 2007 with abdominal bloating, pain, and obvious ascites . After imaging data was obtained, in december 2007 the patient underwent total abdominal hysterectomy (tah)/bilateral salpingo - oophorectomy (bso) and debulking surgery to remove as much of the tumour as possible . After surgery the patient was diagnosed with serous ovarian adenocarcinoma, stage iii c. first - line chemotherapy was the recommended taxol / carboplatin combination standard - of - care for 3 cycles, which finished in march 2008 . In june 2010 the patient relapsed and there was recurrence of disease, presenting as rapidly accumulating ascites . The patient was rechallenged with platinum second - line; treatment was taxol / carboplatin for 6 cycles, which was completed in october 2010 . The patient then agreed to participate in a phase ii study investigating the ca-125 doubling time in patients with advanced disease treated with tamoxifen citrate . In april 2011 there was recurrence of disease, and in august 2011 the patient received trabectedin + pld combination for 5 cycles as fourth - line therapy . The patient achieved a good clinical response according to ca-125 measurement, and the chemotherapy was stopped given the good clinical status of the patient . In january 2012 the patient experienced disease progression and received subsequent treatment with gemcitabine / carboplatin / bevacizumab combination therapy for 6 cycles, plus bevacizumab 15 mg / kg every 3 weeks as maintenance therapy . In june 2013 the patient experienced further disease progression and received taxol / carboplatin as weekly treatment for 6 cycles until january 2014, after which the patient's disease was stable . Disease recurrence occurred in march 2014, with ascites, para - aortic lymph node involvement, and peritoneal disease . The patient was subsequently re - challenged with trabectedin + pld as seventh - line of chemotherapy . 1a), and ct imaging showed a clinical response and improvement in symptoms (fig . The dose of trabectedin + pld was adjusted for this patient due to grade 3 fatigue . The trabectedin dose was reduced from 1.1 to 0.9 mg / m, and pld was reduced from 30 to 25 mg / m . The management plan for this patient is to continue treatment with trabectedin + pld until disease progression . The patient has finished 11 cycles so far and is still in remission, and continues to do well . In summary, this case study describes a new concept in the management of a roc patient who has received 7 different lines of chemotherapy and has experienced recurrent disease . Trabectedin + pld combination was effective as a non - platinum / non - taxane alternative to intercalate between platinum - based therapies . In fact, trabectedin has been administered for 6 or more cycles in 52% of patients treated with the combination dose and schedule respectively . The combination regimen has been used for up to 21 cycles, and no cumulative toxicities have been observed in patients treated with multiple cycles . So whilst doxorubicin is limited by its cumulative dose due to cardiotoxicity, trabectedin plus pld can be used to disease progression . In the case study described here the patient is doing well, and will continue maintenance treatment with trabectedin + pld, with repeat echo every 12 weeks, until disease progression . As with all cytotoxic regimens there are some practical considerations to treating patients with trabectedin + pld . Infusion at a dose of 1.1 mg / m, immediately after pld 30 mg / m, for the treatment of ovarian cancer (fig . The following steps must be taken when administering the combination: all patients must receive corticosteroids e.g. 20 mg of dexamethasone i.v . Infusion of trabectedin 1.1 mg / m, immediately after pld, every 3 weeks through a central venous line all patients must receive corticosteroids e.g. 20 mg of dexamethasone i.v . Infusion of trabectedin 1.1 mg / m, immediately after pld, every 3 weeks through a central venous line as with other cytotoxic regimens, monitoring of patients receiving trabectedin + pld is recommended (box 1). The patient must satisfy the following criteria for initiation of treatment and prior to each re - treatment: absolute neutrophil count (anc) 1,500/mmplatelet count 100,000/mmbilirubin upper limit of normal (uln)alkaline phosphatase 2.5 uln (consider hepatic isoenzymes 5-nucleotidase or gamma glutamyl transpeptidase (ggt) to determine whether the elevation is of hepatic or osseous origin.albumin 25 g / l.alanine aminotransferase (alt) and aspartate aminotransferase (ast) 2.5 mol / l) or creatinine clearance 60 ml / mincreatine phosphokinase (cpk) 2.5 ulnhaemoglobin 9 g / dl absolute neutrophil count (anc) 1,500/mm platelet count 100,000/mm bilirubin upper limit of normal (uln) alkaline phosphatase 2.5 uln (consider hepatic isoenzymes 5-nucleotidase or gamma glutamyl transpeptidase (ggt) to determine whether the elevation is of hepatic or osseous origin . Alanine aminotransferase (alt) and aspartate aminotransferase (ast) 2.5 uln serum creatinine 1.5 mg / dl (132.6 mol / l) or creatinine clearance 60 ml / min creatine phosphokinase (cpk) 2.5 uln otherwise treatment should be delayed and/or reduced for up to 3 weeks until the criteria are met, as highlighted in the case study above (box 2). A single institution's experience with trabectedin + pld combination, as a non - platinum / non - taxane alternative to intercalate between platinum - based therapies is reported here . A real - life case study is presented of a heavily - treated patient with advanced disease who was treated with trabectedin + pld fourth - line and subsequently rechallenged at seventh - line, who continues to do well on treatment . This case study demonstrates the utility of the combination at any line of relapse in roc patients with advanced disease . Professor tahir received speaker fees from pharmamar for his participation at the bgcs 2014 symposium.
Song et al.1 first reported the anterolateral thigh (alt) flap as a septocutaneous flap based on the descending branch of the lateral circumflex femoral artery (lcfa) in 1984 . Recently, the alt flap has become a popular option for soft tissue reconstruction of the oral cavity23 . It is easily raised and has long and good caliber vascular pedicles with suitable vessel diameter, different tissues with large amounts of skin are available, and there is minimum morbidity at the donor site2 . However, the alt flap has been criticized due to variations in vascular pedicles and perforator anatomy, making flap elevation challenging4 . Kimata et al.5 and kawai et al.6 reported anatomical variations in the alt flap in the japanese population and surgical concerns regarding dissection of the flap . Valdatta et al.7 and yu8 reported flap characteristics in the western population . The alt flap is mostly supplied by one to three perforators of the descending branch of the lcfa . It can be located clinically by measuring the midpoint of a line drawn from the anterior superior iliac spine (asis) to the superolateral border of the patella . However, there is some variation in the location of these perforators . In addition, the oblique branch of the lcfa often runs between the descending and the squatransverse branches of the lcfa9 . However, many reports have shown that harvested alt flap has more musculocutaneous perforators (up to 87%)13 . In the present study, we investigated the surgical anatomy of the alt flap in a series of eight cases, focusing on the pattern of perforators and variation in pedicle course compared with previous studies . Cases of reconstructive surgery using alt free flaps were enrolled from the database of all patients who underwent ablative surgery for oral and maxillofacial cancers from 2014 to 2015 in the department of oral and maxillofacial surgery in asan medical center (seoul, korea). Eight patients were included in the study, and their medical records were carefully reviewed . Demographic data included gender, age, pathological data, tumor stage, primary site, and whether adjuvant raidotherapy was performed . Operative records were reviewed regarding flap size, thickness, pedicle length, and anastomosis of vessels . The number of perforators included in the skin peddle was counted, and the perforators feeding skin were investigated as to whether they ran through the septum in the vastuslateralis muscle (septocutaneous) or through the intramuscular portion (musculocutaneous). (fig . 1) yu8 and urken et al.10 noted that the course of the main pedicle in alt free flaps derived from three origins of the lcfa . Variation in the pedicle course was recorded according to classification as types i, ii, and iii . In type i, the vascular pedicle derives from the descending branch of the lcfa, and that in type ii from the transverse branch of the lcfa . 2) we considered the pedicles of type iii unusable, as did yu8 and urken et al.10, due to the small caliber and short length . Therefore, patients with type iii variation were excluded because it was not possible to use the alt flap . The study protocol was reveiwed and approved by the institutional review board of asan medical center (s2016 - 1056 - 0001). The mean age of patients was 61 years, and the male to female ratio was 4:4 . The eight cases comprised six squamous cell carcinomas, one adenoid cystic carcinoma, and one osteosarcoma . (table 1) microvascular reconstructions with alt free flaps were performed for all surgical defects in the maxilla (five cases), buccal mucosa (two cases), and floor of the mouth (one case). (table 1) the mean flap size was 10.05.6 cm, and the mean thickness was 1.0 cm . Lcfas were anastomosed with the facial artery in four cases, superior thyroid artery in two cases, and superficial temporal artery in two cases . In vein anastomosis, one or two venae comitantes were used, and recipient veins included the facial, superior thyroid, superficial temporal, external jugular, and branches of internal or external jugular veins. (table 2) all flaps successfully survived . Although one case showed partial necrosis at the edge of flap, it did not affect the result of reconstruction . 3) type i pedicles were present in five patients, and type ii pedicles in three patients who needed intramuscular dissection for flap elevation . However, type iii pedicles, which are reported to occur in 1% to 5% of patients810, were not observed in the eight cases. (table 3) it has moderate thickness, low morbidity at the flap donor site, long pedicle length, and appropriate vessel diameter . In addition, a simultaneous two - team approach can be used, with the feasibility of two skin islands based on two separate cutaneous perforators28 . With these advantages, the alt flap has become the workhorse for oral and maxillofacial reconstruction . In our serial cases, flaps of various sizes were elevated according to defect size in the oral and maxillofacial area, which ranged from 4 to 7 cm in width and 7 to 12 cm in length . Harvested soft tissue of these sizes was considered adequate to cover most defects caused by resection of oral and maxillofacial cancers except in rare cases of a huge tumor mass that might be inoperable or should only be covered by a latissimus dorsi flap . In a study of alt flap characteristics in the western population by yu8, the mean flap thickness was 19.9 mm in women and 12.9 mm in men . Nakayama et al.11 reported the average thickness of alt flap in asian population to be 7.1 mm, with intermediate thickness of subcutaneous fat compared to other free flaps used in oral and maxillofacial reconstruction such as the radial forearm free flap and rectus abdominis flap . The thickness of the harvested flap in our cases ranged from 0.6 to 1.5 cm (mean, 1.0 cm), which was comparable to the previous results . A flap thickness of about 20 mm might be the limit for use in soft tissue reconstruction of the oral and maxillofacial area, especially for the buccal mucosa and tongue except in total glossectomy . In our study, the maximum thickness of an alt flap was 1.5 cm . The thickness of the alt flap was considered appropriate for oral and maxillofacial defects regardless of gender . Urken et al.10 reported that the vascular pedicle of alt flaps varied from 8 to 16 cm, although this could vary depending on patient stature, extent of proximal dissection of the lcfa, and location of skin perforators . The length of pedicles in alt free flaps might be not a limitation for reconstruction of oral and maxillofacial area . In our series, there were no problems related to pedicle length, even when used for large defects in the maxilla with microvascular anastomosis of the flap to neck vessels such as the facial, superior thyroid, and superficial temporal vessels . Despite these many advantages, the complicated distribution of feeding perforators and the anatomical variation of pedicle courses in the muscular structures of the alt area yu8 reported that perforators are most consistently located around the midpoint of the reference line from the asis to the superolateral border of the patella . Kimata et al.5 also reported that cutaneous perforators were concentrated near the midpoint of this reference line . Chana and wei12 reported that the majority of skin perforators were located within a circle of 3 cm radius centered at this midpoint . Xu et al.13 reported that at least one perforator was located in the inferolateral quadrant of this circle in 80% of cases . However, choi et al.2 reported that the cutaneous perforators were broadly distributed from 4/10 to 8/10 area between the asis and the superolateral border of the patella . In this study, the flaps in four cases included one perforator, and the flaps in the other four cases included two perforators . However, the number of perforators did not affect the survival or viability of the harvested flaps . We could find at least one main perforator in a circle of 3 cm radius centered at the midpoint of the reference line . Feeding perforators can be classified into two categories: septocutaneous perforators, which were first reported by song et al.1, run in the intermuscular space, and musculocutaneous perforators penetrate the vastus lateralis muscle14 . Valdatta et al.7 reported that only five of 34 perforators identified were septocutaneous (14.7%). Kimata et al.5 reported that 31 of 171 perforators (18.1%) were septocutaneous perforators . In 38 elevations of alt flaps from a total of 160 perforators in a cadaver study by choi et al.2, 28 perforators (17.5%) were septocutaneous and 132 perforators (82.5%) were musculocutaneous . Similarly, xu et al.13 and zhou et al.15 reported that septocutaneous perforators were found in 40.8% of 42 cadavers and in 37.5% of 32 patients . These studies suggest that the blood supply of the alt flap is mostly derived from musculocutaneous perforators . Therefore, a more refined surgical technique is required to dissect these perforators through the vastus lateralis muscle2 . This additional procedure was time - consuming and cumbersome, but did not affect the design or size of flap that could be harvested . The second important consideration is the course of the main pedicle of the alt free flap . 2) in type i, the most common (90%), the descending branch sends off one to three cutaneous perforators to the flap . Surgical dissection type ii accounts for 4% of the cases and requires tedious dissection to free the pedicle from the vastus lateralis along its entire length16 ., the alt flap cannot be used for free tissue transfer, and the cutaneous perforator is a direct branch of the profundus femoris vessels . It pierces the rectus femoris muscle to reach the skin and is therefore more anteriorly located . Because of the small caliber and short pedicle length, however, it has been reported that the flap could be converted to an anteromedial thigh flap1017 . In our cases, the alt free flap could be used for reconstruction of various soft tissue defects, including those of relatively large size . . Some anatomical variations, such as the distribution of perforator and courses of pedicles, might be a barrier for the application of alt free flap to various reconstruction cases . However, these problems can be overcome with an understanding of anatomical variation and meticulous surgical dissection . Alt free flaps are considered reliable options for reconstruction of soft tissue defects of the oral and maxillofacial area.
Diabetic retinopathy is the most common complication in diabetes.1,2 it is a chronic, progressive, potentially sight - threatening disease of the retinal microvasculature that is associated with prolonged hyperglycemia and other conditions linked to diabetes mellitus such as hypertension.3 the threat to sight is due to either growth of new vessels leading to intraocular hemorrhage and possible retinal detachment with profound sight loss or localized damage to the macula of the eye with loss of central visual acuity.3 grading of diabetic retinopathy is based on visible signs of increasing severity on ophthalmoscopy and on imaging . Diabetic retinopathy is classified as proliferative or nonproliferative (background / preproliferative) retinopathy based on the presence or absence of abnormal new vessels, respectively . Subgroups of nonproliferative diabetic retinopathy (mild, moderate, preproliferative) reflect increasing severity of the disease, which consequently results in shortening of screening intervals.4 nonproliferative diabetic retinopathy is typically managed by optimizing the patient s general health . It is hypothesized that this technique reduces the amount of ischemic retina, and thus the production of angiogenic molecules . Diabetic maculopathy is divided into three types, based on whether it causes focal, ischemic or diffuse edema, and may include tractional (vitreoretinal) or nontractional (intraretinal) components.3 the management of diabetic macular edema has advanced significantly with the introduction of anti - vegf (vascular endothelial growth factor) treatments.3 however, macular laser treatment still plays a major role in treating noncenter - involving macular edema.5 vision loss due to diabetic retinopathy is one of the leading causes of visual loss worldwide and is an important cause of impaired vision and disability in the working - age population.6,7,8 advanced diabetic eye disease has a negative influence on quality of life.6 therefore, eye screening for the diabetes population aims to identify patients with early signs of sight - threatening disease to facilitate efficient treatment and prevent loss of sight . The danish registry of diabetic retinopathy (diabase) was established to monitor the development of diabetic eye disease in denmark and to evaluate the accessibility and effectiveness of diabetic eye screening programs with focus on interregional variations.9 the main aim of the registry is to enable evaluation of quality of care for patients with diabetic eye disease . The target population includes all patients diagnosed with diabetes in denmark . At present, denmark (5.5 million inhabitants) has ~320,000 diabetes patients with an annual increase of ~27,000 newly diagnosed patients.10 the prevalence of diabetes in denmark has more than doubled since 1996 and was 5737 per 100,000 people in 2012.10 diabase contains data on all diabetes patients aged 18 years who attend screening for diabetic eye disease in the five regions of denmark . Eye examination of children with diabetes is recorded in the children diabetes registry (dandiabkids [children and teenagers with diabetes <18 years old]). In 2011, the adult diabetes registry (adult patients with diabetes from 18 years old), the diabase, and the dandiabkids joined to form the danish diabetes database.9 diabase receives data collected from hospital eye departments and private ophthalmological practices where diabetes patients aged 18 years attend diabetic eye screening . In denmark, diabetes care is managed by both primary care physicians in private practice and hospital - based endocrinologists . Diabetic eye screening for most patients attending their primary care physician is delivered by an ophthalmologist in private practice . Patients being followed in endocrinology departments receive diabetic eye screening in the eye department of the respective hospital . An annual report analyzing diabetes screening data from the previous year is issued every spring by the steering committee . The systematic collection of outpatient data from hospitals in denmark started in 2007 and was extended nationwide in 2010 . Data collection on patients screened by ophthalmologists in private practice started in 2013 . In 20142015, the registry included data from 77,968 diabetes patients;11 of these patients, 57,985 had been screened by ophthalmologists in private practice, whereas 20,291 patients had been screened in hospitals.11 key quality indicators for diabase were selected according to international standards for good clinical practice: two process indicators to examine efficiency and three performance indicators to examine outcome9 (table 1). Indicator measurements are based on the collection of data with regard to the following main variables:9 registering screening unitpatient name and unique danish identification numberdate of screening visitindication for screeningprevious eye surgerybest corrected visual acuityscreening method (slit lamp examination or retinal photography)diabetic retinopathy and maculopathy grading according to wilkinson et al12quality of screening photographdefinition of next examination (screening, treatment)interval to next screening visit . Registering screening unit patient name and unique danish identification number date of screening visit indication for screening best corrected visual acuity screening method (slit lamp examination or retinal photography) diabetic retinopathy and maculopathy grading according to wilkinson et al12 quality of screening photograph definition of next examination (screening, treatment) interval to next screening visit . The data on diabetes type and duration of disease are recorded in the adult diabetes registry . A diabase report containing calculations of the key indicators is published every year . At annual meetings, data issues, interregional variations, and definition of indicators diabase identifies patients with newly diagnosed maculopathy as diabetic maculopathy, newly diagnosed . In case of treatment for diabetic eye disease after completion of treatment, patients re - enter regular diabetic eye screening and are described as resumed routine screening.9 patients with treated diabetic maculopathy are recorded in the category treated maculopathy, stable . Diabase classifies treated patients as laser - treated proliferative diabetic retinopathy, stable . In case of relapse requiring additional laser treatment, patients are labeled laser - treated proliferative diabetic retinopathy, recurrence . Until 2013, this indicator measured the proportion of diabetes patients who received eye screening at least every 2 years . However, the interval for screening visits should be tailored to the severity of disease.4,5 to provide the basis for individualized eye screening intervals, the definition of this indicator was changed to measure the proportion of patients who were screened within the defined time interval (table 2). Neither hospital eye departments nor ophthalmologists in private practice met the standard for this variable (at least 90% of patients should obtain eye screening within the defined interval). As this is the first year, this indicator is calculated in its altered state, the amount of data collected is still insufficient to provide a proper analysis . The nationwide prevalence of nonproliferative diabetic retinopathy is 18%, with 47% of patients screened in hospitals and 14% by ophthalmologists in private practice (table 3). Mild nonproliferative diabetic retinopathy alone contributes to 13%, while 78% of diabetes patients do not have diabetic retinopathy . However, there are differences between patients screened in hospitals and by ophthalmologists in private practice . Eighty - six percent of patients screened by ophthalmologists in private practice display no retinopathy, with minor interregional variations . Only 53% of patients screened in hospitals have no diabetic retinopathy, with a wide interregional disparity . These numbers indicate that a higher proportion of patients with more severe diabetes are being treated in hospital departments compared to private ophthalmological practice . In the central denmark region, 11% of patients screened in hospitals have proliferative diabetic retinopathy, newly diagnosed, a significantly higher number than in other regions of denmark . Even though diabase clearly defines the criteria for classification of preproliferative versus proliferative diabetic retinopathy, regional traditions may play a role in differing interpretations . Sight - threatening subtypes (newly diagnosed and previously treated recurrent proliferative diabetic retinopathy) comprise 3% of patients . The overall prevalence of patients without diabetic maculopathy is 97% in the registry (91% screened in hospitals vs 98% screened by ophthalmologists in private practice). Only 2% of all patients have newly diagnosed diabetic maculopathy, and an equally small number of patients have stable maculopathy after treatment (table 4). Diabetic retinal changes may progress as well as regress, essentially depending on medical treatment and diabetic control . The proportion of diabetes patients progressing to a more severe level of diabetic eye disease is a key outcome measurement for diabase (table 5). This requires at least two eye screening visits with retinopathy and maculopathy grading . To calculate this indicator, patients with the poorest - seeing eye and in the most severe stage of disease at the first of the screening visits are excluded from the assessment . Furthermore, the proportion of diabetes patients regressing to a milder stage of diabetic eye disease is assessed (table 6). This also requires at least two eye screening visits with retinopathy and maculopathy grading . To calculate this indicator, patients with the poorest - seeing eye and in the mildest stage of disease (none) at the first of the screening visits are excluded from the assessment . In 20142015, however, this figure is lower than that reported during 20132014 (14%).9 five percent of patients screened by ophthalmologists in private practice progress to a more severe disease compared to 15% of patients screened in hospitals . The proportion of patients regressing to a milder stage of disease has been analyzed for the first time in 20142015 . Eighteen percent of patients screened in hospitals regress to a milder stage of disease (interregional variation between 12% and 23%). Twenty - four percent of patients screened by ophthalmologists in private practice regressed to a milder stage of disease . Nonetheless, the percentage of these patients is significantly higher in the north denmark region (58%) than in the other regions, where percentages vary between 19% and 28% . This difference may be based on variations in grading due to region - specific circumstances . Diabase identifies patients with newly diagnosed maculopathy as diabetic maculopathy, newly diagnosed . In case of treatment for diabetic eye disease, screening is temporarily discontinued . After completion of treatment, patients re - enter regular diabetic eye screening and are described as resumed routine screening.9 patients with treated diabetic maculopathy are recorded in the category diabase classifies treated patients as laser - treated proliferative diabetic retinopathy, stable . In case of relapse requiring additional laser treatment, patients are labeled laser - treated proliferative diabetic retinopathy, recurrence . Until 2013, this indicator measured the proportion of diabetes patients who received eye screening at least every 2 years . However, the interval for screening visits should be tailored to the severity of disease.4,5 to provide the basis for individualized eye screening intervals, the definition of this indicator was changed to measure the proportion of patients who were screened within the defined time interval (table 2). Neither hospital eye departments nor ophthalmologists in private practice met the standard for this variable (at least 90% of patients should obtain eye screening within the defined interval). As this is the first year, this indicator is calculated in its altered state, the amount of data collected is still insufficient to provide a proper analysis . The nationwide prevalence of nonproliferative diabetic retinopathy is 18%, with 47% of patients screened in hospitals and 14% by ophthalmologists in private practice (table 3). Mild nonproliferative diabetic retinopathy alone contributes to 13%, while 78% of diabetes patients do not have diabetic retinopathy . However, there are differences between patients screened in hospitals and by ophthalmologists in private practice . Eighty - six percent of patients screened by ophthalmologists in private practice display no retinopathy, with minor interregional variations . Only 53% of patients screened in hospitals have no diabetic retinopathy, with a wide interregional disparity . These numbers indicate that a higher proportion of patients with more severe diabetes are being treated in hospital departments compared to private ophthalmological practice . In the central denmark region, 11% of patients screened in hospitals have proliferative diabetic retinopathy, newly diagnosed, a significantly higher number than in other regions of denmark . Even though diabase clearly defines the criteria for classification of preproliferative versus proliferative diabetic retinopathy, regional traditions may play a role in differing interpretations . Sight - threatening subtypes (newly diagnosed and previously treated recurrent proliferative diabetic retinopathy) comprise 3% of patients . The number of patients with recurrence after treatment is very small . One percent of patients are recorded as laser treated and stable . The overall prevalence of patients without diabetic maculopathy is 97% in the registry (91% screened in hospitals vs 98% screened by ophthalmologists in private practice). Only 2% of all patients have newly diagnosed diabetic maculopathy, and an equally small number of patients have stable maculopathy after treatment (table 4). Diabetic retinal changes may progress as well as regress, essentially depending on medical treatment and diabetic control . The proportion of diabetes patients progressing to a more severe level of diabetic eye disease is a key outcome measurement for diabase (table 5). This requires at least two eye screening visits with retinopathy and maculopathy grading . To calculate this indicator, patients with the poorest - seeing eye and in the most severe stage of disease at the first of the screening visits are excluded from the assessment . Furthermore, the proportion of diabetes patients regressing to a milder stage of diabetic eye disease is assessed (table 6). This also requires at least two eye screening visits with retinopathy and maculopathy grading . To calculate this indicator, patients with the poorest - seeing eye and in the mildest stage of disease (none) at the first of the screening visits are excluded from the assessment . In 20142015, however, this figure is lower than that reported during 20132014 (14%).9 five percent of patients screened by ophthalmologists in private practice progress to a more severe disease compared to 15% of patients screened in hospitals . The proportion of patients regressing to a milder stage of disease has been analyzed for the first time in 20142015 . Eighteen percent of patients screened in hospitals regress to a milder stage of disease (interregional variation between 12% and 23%). Twenty - four percent of patients screened by ophthalmologists in private practice regressed to a milder stage of disease . Nonetheless, the percentage of these patients is significantly higher in the north denmark region (58%) than in the other regions, where percentages vary between 19% and 28% . This difference may be based on variations in grading due to region - specific circumstances . Diabase identifies patients with newly diagnosed maculopathy as diabetic maculopathy, newly diagnosed . In case of treatment for diabetic eye disease, screening is temporarily discontinued . After completion of treatment, patients re - enter regular diabetic eye screening and are described as resumed routine screening.9 patients with treated diabetic maculopathy are recorded in the category diabase classifies treated patients as laser - treated proliferative diabetic retinopathy, stable . In case of relapse requiring additional laser treatment, until 2013, this indicator measured the proportion of diabetes patients who received eye screening at least every 2 years . However, the interval for screening visits should be tailored to the severity of disease.4,5 to provide the basis for individualized eye screening intervals, the definition of this indicator was changed to measure the proportion of patients who were screened within the defined time interval (table 2). Neither hospital eye departments nor ophthalmologists in private practice met the standard for this variable (at least 90% of patients should obtain eye screening within the defined interval). As this is the first year, this indicator is calculated in its altered state, the amount of data collected is still insufficient to provide a proper analysis . The nationwide prevalence of nonproliferative diabetic retinopathy is 18%, with 47% of patients screened in hospitals and 14% by ophthalmologists in private practice (table 3). Mild nonproliferative diabetic retinopathy alone contributes to 13%, while 78% of diabetes patients do not have diabetic retinopathy . However, there are differences between patients screened in hospitals and by ophthalmologists in private practice . Eighty - six percent of patients screened by ophthalmologists in private practice display no retinopathy, with minor interregional variations . Only 53% of patients screened in hospitals have no diabetic retinopathy, with a wide interregional disparity . These numbers indicate that a higher proportion of patients with more severe diabetes are being treated in hospital departments compared to private ophthalmological practice . In the central denmark region, 11% of patients screened in hospitals have proliferative diabetic retinopathy, newly diagnosed, a significantly higher number than in other regions of denmark . Even though diabase clearly defines the criteria for classification of preproliferative versus proliferative diabetic retinopathy, regional traditions may play a role in differing interpretations . Sight - threatening subtypes (newly diagnosed and previously treated recurrent proliferative diabetic retinopathy) comprise 3% of patients . The overall prevalence of patients without diabetic maculopathy is 97% in the registry (91% screened in hospitals vs 98% screened by ophthalmologists in private practice). Only 2% of all patients have newly diagnosed diabetic maculopathy, and an equally small number of patients have stable maculopathy after treatment (table 4). Diabetic retinal changes may progress as well as regress, essentially depending on medical treatment and diabetic control . The proportion of diabetes patients progressing to a more severe level of diabetic eye disease is a key outcome measurement for diabase (table 5). This requires at least two eye screening visits with retinopathy and maculopathy grading . To calculate this indicator, patients with the poorest - seeing eye and in the most severe stage of disease at the first of the screening visits are excluded from the assessment . Furthermore, the proportion of diabetes patients regressing to a milder stage of diabetic eye disease is assessed (table 6). This also requires at least two eye screening visits with retinopathy and maculopathy grading . To calculate this indicator, patients with the poorest - seeing eye and in the mildest stage of disease (none) at the first of the screening visits are excluded from the assessment . In 20142015, however, this figure is lower than that reported during 20132014 (14%).9 five percent of patients screened by ophthalmologists in private practice progress to a more severe disease compared to 15% of patients screened in hospitals . The proportion of patients regressing to a milder stage of disease has been analyzed for the first time in 20142015 . Eighteen percent of patients screened in hospitals regress to a milder stage of disease (interregional variation between 12% and 23%). Twenty - four percent of patients screened by ophthalmologists in private practice regressed to a milder stage of disease . Nonetheless, the percentage of these patients is significantly higher in the north denmark region (58%) than in the other regions, where percentages vary between 19% and 28% . This difference may be based on variations in grading due to region - specific circumstances . Diabase was established by n andersen in collaboration with the danish ophthalmological society and the organization of danish ophthalmologists in private practice,13 based on the status screening for diabetic retinopathy in denmark.14 the registry is led by a steering committee of medical retina specialists representing the five regions of denmark, the chairman of the danish ophthalmological society, and the chairman of the organization of danish ophthalmologists in private practice . Initially, the register was partly funded by hovedstadens sygehusfllesskab (association of hospitals in the capital region of denmark). Diabase is funded and operated by the danish clinical registries (rkkp), which is financed and owned by the five danish regions . The systematic collection of data from diabetic eye screening in denmark is still in the development process . Data analysis from diabase s latest annual report (20142015)11 reveals a decrease in the prevalence of diabetic retinopathy from 26% to 22% compared to the previous report (20132014), whereas the number of patients diagnosed with diabetes has increased between 1996 and 2012.10 additionally, the proportion of patients with regression (20%) is greater than the proportion of patients with progression (10%) of diabetic retinopathy . The diabase is a useful tool to observe the quality of screening, prevalence, and progression / regression of diabetic eye disease . Thus, it contributes to ensure a high quality of care for diabetes patients in denmark . Reducing the overall morbidity and mortality associated with diabetes by preventing complications may help to relieve the large economic burden of the disease.
Most of the time, chemotherapy works in leukemia patients; however, despite high remission rate after chemotherapy, relapse always exists . Hence, it is highly necessary to find markers that enable the prediction of relapse . Monitoring minimal residue disease (mrd) is an important clinical factor in the assessment of response to chemotherapy, guiding therapeutic intervention and predicting relapse . There are pressing needs to choose a marker to detect mrd for a greater population of patients . The wt1 gene is located on the short arm of chromosome 11 in locus 11p13, encoded as a zinc - finger transcriptional factor that has recognized as an important regulator of normal and malignant hematopoiesis, and also, this gene is known to control cellular apoptosis . The expression of wt1 gene in blast leukemia may cause resistance of blast to apoptosis and cause poor clinical outcomes . The normal expression of wt1 is restricted in adults to a few numbers of tissues . In the normal bm, wt1 expression is limited to cd34 + cells and there are not in peripheral blood (pb) cells; therefore, expression of wt1 is limited to early progenitors of the blood system, several studies have demonstrated that wt1 is overexpressed in acute myeloid leukemia (aml), acute lymphoblastic leukemia (all), myelodysplastic syndrome (mds), and blast crisis of chronic myeloid leukemia (cml), and this gene is highly expressed in more than 80% of aml patients in bone marrow (bm) and pb in comparison with normal control . This overexpression of wt1 in acute leukemia could thus represent a universal molecular marker of malignant hematopoiesis and is suggested as the usefulness of quantitative assessment of wt1 expression as a marker for mrd . The biological functions of wt1 overexpression in patients with acute leukemia are not clearly understood, but it has been suggested that wt1 affects the pathogenesis of human leukemia during cellular differentiation and growth arrest . Low expression of wt1 and high expression of it are accompanied with clinical remission and relapse, respectively, which shows the fact that wt1 may be a potential prognostic factor and a therapeutic target in aml . Here, we analyzed wt1 expression in a cohort of 126 patients with aml using real - time quantitative reverse transcription polymerase chain reaction (rq - rt - pcr) and considered the usefulness of this marker for predicting relapse in our regions . A total of 126 aml patients consisting of 70 males (55.6%) and 56 females (44.4%) with a median age of 26 years (age range of 176 years) were recruited for the wt1 overexpression study . All patients were diagnosed with aml at the molecular pathology and cancer research center from april 2014 to june 2015, a total of 14 months . This clinical study was approved by the ethics committee of participating institutions and each patient provided informed consent before the initiation of the studies, 2 ml of bm aspiration or pb sample was collected in the ethylenediaminetetraacetic acid and heparin vacutainer from all 126 patients for the molecular and cytogenetic study, respectively, before treatment . The wt1 overexpression was defined in this study as 50 copies wt1/10 abl in pb sample and 250 copies wt1/10 abl in bm sample . Aml was defined based on criteria which are written below and definitive diagnosis was done by an expert hematologist . Patient characteristics presence of 20% myeloid blasts in bm or pb specimenpositive myeloperoxidase, specific and nonspecific esterase, sudan black, and periodic acid schiff staining of patient's slidepositive markers such as cd13, cd117, cd64, cd14, and cd117 in peripheral samplesdiscovering aml - related genetic disorders such as t(8;21), t(15;17), and t(6;9). Presence of 20% myeloid blasts in bm or pb specimen positive myeloperoxidase, specific and nonspecific esterase, sudan black, and periodic acid schiff staining of patient's slide positive markers such as cd13, cd117, cd64, cd14, and cd117 in peripheral samples discovering aml - related genetic disorders such as t(8;21), t(15;17), and t(6;9). Mononuclear cells, including leukemic blasts, were separated from bm or pb samples on a ficoll histopaque 1077 (sigma - aldrich company, saint louis, mo, usa) density gradient . Total rna was extracted using rneasy mini kit following the manufacturer's protocol (qiagen, hilden, germany). Samples were incubated for 10 min at 20c, 45 min at 42c, and 3 min at 99c, followed by 10 min at 4c . To construct a wt1 plasmid and abl plasmid for the standard curve in the rq - pcr assay, we added the following primers and reagents with a final volume of 50 l to amplify a wt1 and abl rt - pcr product: wt1-forward primer: exon 7 - 5_-ggcatctgaga ccagtgagaa-3_wt1-reverse primer: exon 10 5_-ggactaattca tcgaccggg-3abl - f: tgg aga taa cac tct aag cat aac taa aggtabl - r: gat gtagtt gct tgg gac . Wt1-reverse primer: exon 10 5_-ggactaattca tcgaccggg-3 abl - f: tgg aga taa cac tct aag cat aac taa aggt abl - r: gat gtagtt gct tgg gac . Pcr buffer 1x: 10 mm tris - hcl, 50 mm kcl (ph 8.3), mgcl2:2.5 mm (final concentration), dntp: 200 m (final concentration), 400 nm of each primer (final concentration), taq enzyme: 1 u and 3 l of cdna product . Use the following thermal cycler temperatures and time conditions: initial melting at 95c for 30 s, 35 pcr cycles at the following conditions: 94c for 30 s, 65c for 1 min, 72c for 1 min . Then, we cloned the pcr products into the instaclone pcr cloning kit (thermo scientific) according to the manufacturer's instructions . The selected clones were screened for the presence of the insert by pcr and then sequenced for confirmation . The plasmid was extracted using the genejet plasmid miniprep kit (thermo scientific) and quantified spectrophotometrically . The copy number for 1 six successful serial dilutions (10,0000, 10,000, 1000, 100, and 10 copies) of each genes were prepared . The expression ratio was given in 100 wt1/abl, and wt1 overexpression was defined in this study as 50 copies wt1/10 abl in pb sample and 250 copies wt1/10 abl in bm sample as previously recommended . A dilution series of a known concentration of abl and wt1 plasmid was used for the creation of a standard curve . The pcr conditions, primer, and probe for the detection and amplification of pml - rara, aml1-eto, cbfb - myh11, and nup - dek samples have been described elsewhere . All the rt - rt - pcr reactions were performed on a 7700 abi platform . In each reaction, 5 l of cdna was amplified . Each reaction contained 12.5 l of mastermix (taqman universal pcr master mix), 200 nm hybridization probe (wt1-probe: cttacagatgcacagcaggaagcacactg), 300 nm of each primer ([wt1-f: caggctgcaa taagagatattttaagct] and [wt1-r: gaagtcacactggtatggtttctca]). The rq - pcr primers and probe for abl are as follows: forward primer 5_-tggagataacactc taagcataactaaaggt-3, reverse primer 5_-gatgtagttgcttgggaccca-3, taqman probe 5_-ccatttttggtttgggcttcacaccatt-3 . Sterilized water to reach a final volume of 25 l 50 cycles of denaturation at 95c for 15 s followed by annealing / extension at 60c for 60 s was added . Chromosome analysis was performed on synchronized 24 h and 48 h using fdur / uridine block with cell density of 10 cells / ml . Aliquots of bm aspirate were suspended in rpmi 1640 supplemented with 20% fetal calf serum, l - glutamine, and antibiotics . After 24 h incubation at 37c, colcemid was added to a final concentration of 0.05 g / ml for 30 min . The cells were exposed to a hypotonic solution (0.075 mol / l kcl) for 30 min at 37c and then fixed three times in methanol: acetic acid (3:1, v / v) for 30 min each . Clonal karyotypic abnormalities were identified and described according to the 2013 international system of human cytogenetic nomenclature . Statistical analysis was done using spss v 13 (spss inc ., chicago, il, usa). Whitney, student's t - test, and anova, were applied according to data distribution and the results interpretations are described in the next section . Data were reported in the form of mean standard deviation in the present study and . Mononuclear cells, including leukemic blasts, were separated from bm or pb samples on a ficoll histopaque 1077 (sigma - aldrich company, saint louis, mo, usa) density gradient . Total rna was extracted using rneasy mini kit following the manufacturer's protocol (qiagen, hilden, germany). Samples were incubated for 10 min at 20c, 45 min at 42c, and 3 min at 99c, followed by 10 min at 4c . To construct a wt1 plasmid and abl plasmid for the standard curve in the rq - pcr assay, we added the following primers and reagents with a final volume of 50 l to amplify a wt1 and abl rt - pcr product: wt1-forward primer: exon 7 - 5_-ggcatctgaga ccagtgagaa-3_wt1-reverse primer: exon 10 5_-ggactaattca tcgaccggg-3abl - f: tgg aga taa cac tct aag cat aac taa aggtabl - r: gat gtagtt gct tgg gac . Wt1-reverse primer: exon 10 5_-ggactaattca tcgaccggg-3 abl - f: tgg aga taa cac tct aag cat aac taa aggt abl - r: gat gtagtt gct tgg gac . Pcr buffer 1x: 10 mm tris - hcl, 50 mm kcl (ph 8.3), mgcl2:2.5 mm (final concentration), dntp: 200 m (final concentration), 400 nm of each primer (final concentration), taq enzyme: 1 u and 3 l of cdna product . Use the following thermal cycler temperatures and time conditions: initial melting at 95c for 30 s, 35 pcr cycles at the following conditions: 94c for 30 s, 65c for 1 min, 72c for 1 min then, we cloned the pcr products into the instaclone pcr cloning kit (thermo scientific) according to the manufacturer's instructions . The selected clones were screened for the presence of the insert by pcr and then sequenced for confirmation . The plasmid was extracted using the genejet plasmid miniprep kit (thermo scientific) and quantified spectrophotometrically . The copy number for 1 six successful serial dilutions (10,0000, 10,000, 1000, 100, and 10 copies) of each genes were prepared . The expression ratio was given in 100 wt1/abl, and wt1 overexpression was defined in this study as 50 copies wt1/10 abl in pb sample and 250 copies wt1/10 abl in bm sample as previously recommended . A dilution series of a known concentration of abl and wt1 plasmid was used for the creation of a standard curve . The pcr conditions, primer, and probe for the detection and amplification of pml - rara, aml1-eto, cbfb - myh11, and nup - dek samples have been described elsewhere . All the rt - rt - pcr reactions were performed on a 7700 abi platform . In each reaction, 5 l of cdna was amplified . Each reaction contained 12.5 l of mastermix (taqman universal pcr master mix), 200 nm hybridization probe (wt1-probe: cttacagatgcacagcaggaagcacactg), 300 nm of each primer ([wt1-f: caggctgcaa taagagatattttaagct] and [wt1-r: gaagtcacactggtatggtttctca]). The rq - pcr primers and probe for abl are as follows: forward primer 5_-tggagataacactc taagcataactaaaggt-3, reverse primer 5_-gatgtagttgcttgggaccca-3, taqman probe 5_-ccatttttggtttgggcttcacaccatt-3 . Sterilized water to reach a final volume of 25 l 50 cycles of denaturation at 95c for 15 s followed by annealing / extension at 60c for 60 chromosome analysis was performed on synchronized 24 h and 48 h using fdur / uridine block with cell density of 10 cells / ml . Aliquots of bm aspirate were suspended in rpmi 1640 supplemented with 20% fetal calf serum, l - glutamine, and antibiotics . After 24 h incubation at 37c, colcemid was added to a final concentration of 0.05 g / ml for 30 min . The cells were exposed to a hypotonic solution (0.075 mol / l kcl) for 30 min at 37c and then fixed three times in methanol: acetic acid (3:1, v / v) for 30 min each . Slides were prepared and then air dried . Preparations were banded with the g - banding technique . Clonal karyotypic abnormalities were identified and described according to the 2013 international system of human cytogenetic nomenclature . Whitney, student's t - test, and anova, were applied according to data distribution and the results interpretations are described in the next section . Data were reported in the form of mean standard deviation in the present study and . To generate a standard curve and define the sensitivity of wt1 monitoring, a dilution series of rna from the cell line k562 expressing wt1 was performed . K562 rna could be successfully detected in normal pb rna in a dilution of 1:20,000 . The mean slope of 3.3 0.3 (correlation coefficient range: 0.9840.993) was close to optimal pcr reaction . Drn threshold of 0.1, the intercept of the standard curve was 40.3 0.3, which was compatible with our defined detection limit of ct = 39 . Thereby, we found our designed primers and probe suitable for wt1 quantification . In this study, we evaluated the wt1 gene expression in aml patients . In a total of 126 patients, 55.6% and 44.4% were men and women, respectively, where the patients with ages under 15 years were considered as children who were 31.7% and patients with ages above 15 years were considered as adults who were 68.3% . In this study, there were 66.7% pb samples and 33.3% bm samples . The age of patients varied from 1 to 76 years, with the median of 26 years . The wt1 gene overexpression was detected in 81% (104 of 126) of all patients, with frequency of 17.5% copies of wt1/10 abl in bm and 63.5% copies of wt1/10 abl in pb samples (p = 0.0001, p = 0.0001, respectively). The diagnosis of aml was made according to the french american british (fab) and who classification . The standard giemsa banding techniques were applied in the karyotyping of leukemia . In 126 patients, ten patients were positive for aml1-eto, ten patients for cbfb - myh11, 14 for pml - rara, and two for nup - dek . A total of seventy patients had not any of recurrent translocation, 12 patients had other cytogenetic abnormalities, and eight patients had complex aberrant karyotypes . In addition, wt1 expression levels were analyzed in 12 blood and two bm samples of healthy donors . The mean expression level of wt1 in normal bms samples was 19 (range 1721). In all ten analyzed pb samples, wt1 expression was very low and undetectable [table 2]. Wilms tumor 1 expression levels in the peripheral blood and bone marrow of healthy controls as compared to acute myeloblastic leukemia patients at diagnosis we also detect the median wt1 gene expression in each who classification and fab subtype [tables 3 and 4], highest levels of wt1 expression were seen first in patients with normal karyotype at diagnosis and second in cbfb - myh1, and lowest levels were detected in patients with aml1-eto positive . In fab subtype, the highest levels of wt1 at diagnosis were assessed in the m1 subtype and the lowest levels were observed in the m6 subtype . Wilms tumor 1 expression at diagnosis, according to different cytogenetic or molecular subgroups wilms tumor 1 expression according to cytomorphological subtypes to generate a standard curve and define the sensitivity of wt1 monitoring, a dilution series of rna from the cell line k562 expressing wt1 was performed . K562 rna could be successfully detected in normal pb rna in a dilution of 1:20,000 . The mean slope of 3.3 0.3 (correlation coefficient range: 0.9840.993) was close to optimal pcr reaction . Drn threshold of 0.1, the intercept of the standard curve was 40.3 0.3, which was compatible with our defined detection limit of ct = 39 . Thereby, we found our designed primers and probe suitable for wt1 quantification . In this study, we evaluated the wt1 gene expression in aml patients . In a total of 126 patients, 55.6% and 44.4% were men and women, respectively, where the patients with ages under 15 years were considered as children who were 31.7% and patients with ages above 15 years were considered as adults who were 68.3% . In this study, there were 66.7% pb samples and 33.3% bm samples . The age of patients varied from 1 to 76 years, with the median of 26 years . The wt1 gene overexpression was detected in 81% (104 of 126) of all patients, with frequency of 17.5% copies of wt1/10 abl in bm and 63.5% copies of wt1/10 abl in pb samples (p = 0.0001, p = 0.0001, respectively). The diagnosis of aml was made according to the french american british (fab) and who classification . The standard giemsa banding techniques were applied in the karyotyping of leukemia . In 126 patients, ten patients were positive for aml1-eto, ten patients for cbfb - myh11, 14 for pml - rara, and two for nup - dek . A total of seventy patients had not any of recurrent translocation, 12 patients had other cytogenetic abnormalities, and eight patients had complex aberrant karyotypes . In addition, wt1 expression levels were analyzed in 12 blood and two bm samples of healthy donors . The mean expression level of wt1 in normal bms samples was 19 (range 1721). In all ten analyzed pb samples, wt1 expression was very low and undetectable [table 2]. Wilms tumor 1 expression levels in the peripheral blood and bone marrow of healthy controls as compared to acute myeloblastic leukemia patients at diagnosis we also detect the median wt1 gene expression in each who classification and fab subtype [tables 3 and 4], highest levels of wt1 expression were seen first in patients with normal karyotype at diagnosis and second in cbfb - myh1, and lowest levels were detected in patients with aml1-eto positive . In fab subtype, the highest levels of wt1 at diagnosis were assessed in the m1 subtype and the lowest levels were observed in the m6 subtype . Wilms tumor 1 expression at diagnosis, according to different cytogenetic or molecular subgroups wilms tumor 1 expression according to cytomorphological subtypes wt1 gene is a tumor suppressor gene that is associated with wt and other related syndromes such as wagr and denys drash . Unlike other tumor suppressors such as p53 or rb1, wt1 expression in normal adult tissues is limited to a number of mainly genitourinary system . In normal bm, progenitor cells expression of wt1 gene is very low and limited only in the beginning; however, numerous studies suggest that increased expression of wt1 in aml, all, mds, and blastic phase of cml can be seen . The wt1 gene expression can be used as a molecular marker for hematopoietic malignancies . Many studies have mentioned that using quantitative gene expression can be used to assess the exact extent of residual disease (mrd), with respect to the biological role of wt1 gene expression in leukemia patients; this gene involved in pathogenesis of leukemia as stopping cell growth and differentiation by suppressing duplication numerous studies have indicated that the prognosis in leukemia patients is inversely associated with the expression of wt1 . Since the majority of aml patients express very high values of wt1 at diagnosis, the assessment of wt1 expression provides a strong method for monitoring the persistence of the disease after chemotherapy or bm transplantation or during the treatment . Wt1 gene is expressed in more than 80% of patients with aml in both pb and bm samples . Wt1 overexpression is used as a panleukemic marker to determine the amount of residual disease (mrd) and is a good marker for patients with no cytogenetic or molecular abnormalities (about 50%). The overexpression of wt1 gene in this study was 81%, which our results were similar to other studies . For example, in one study, the expression of this gene were shown in more than 90% of aml patients and they mentioned wt1 can be used as a marker for mrd; in this study, the expression of wt1 gene was performed before and after transplantation, and the results of chimerism was compared with flow cytometry and concluded that the wt1 expression in aml patients is associated with the amount of residual disease . Another study conducted in 2014 indicated that wt1 expression was limited to cd34/cd38 cells and this feature makes wt1 useful as a unique marker for determining the amount of residual disease in aml patients . In another study, baba et al . Conducted the level of wt1 which was significantly related to the percentage of blast in bm among mds cases, and the refractory anemia (ra) cases showed significantly lower wt1 level than patients with ra with excess blast and concluded that wt1 might be a good marker to differentiate low blast percentage mds and cytopenia . In our study, the expression of wt1 in aml was studied, but in other studies, the overexpression of wt1 gene was seen in 75% of acute leukemia and blastic phase of chronic myeloid . The wt1 gene had been highly expressed in most patients of aml and all and in blastic phase of cml and mds . The degree of mrna expression of wt1 gene are increased with the progression of the disease; furthermore, wt1 gene is known as a tumor suppressor and there is evidence indicating that wt1 has oncogenic role in leukemogenesis and tumorigenesis . Aml is a hematopoietic stem cells malignancy known by increasing clonal myeloid blast, which categorizes mainly into three different groups, good, moderate, and bad based on chromosomal abnormalities . About half (50%40%) of aml patients with normal karyotype or normal cytogenetic classified in the medium - risk group; however, there is a paradox in this group on how to respond to chemotherapy and prognosis for the treatment that makes it difficult to make decisions about continuing the treatment . A number of other molecular markers in response to the therapy and disease prognosis in aml with normal cytogenetics (cn - aml) is important such as nucleophosmin gene (npm1) and flt3 gene . Identification of mutations in these genes to assess how to treat and prognosis in patients with cn - aml are important . The wt1 is an important regulatory factor of normal and malignant blood cells . On the other hand, the resistance of leukemic blasts against apoptosis leads to poor clinical status of the patient, so regulating the apoptotic and antiapoptotic pathways is associated with improved treatment and survival in aml patients . In our study, we first examined the level of wt1 in 12 pb samples and two bm samples from healthy donors and determined that the wt1 expression in normal pb and bm samples were very low, these data provide a stable basis for the use of wt1 as mrd target, all aml patients were classified according to who criteria and the frequency of the most common translocations involving: t(15; 17), inv (16), t(8; 21), and t(6; 9) are calculated, patients who had none of these recurrent translocations were 71.4% of the patients . In our cases, patients who had t(15; 17) had the highest frequency (11.1%), and an equal number of aml patients with t(8; 21) and inv (16) had a frequency of 7.9% and two patients had t(6; 9). While stergaard et al . Compared the wt1 expression level between patients who were positive for the selected fusion gene, the average wt1 gene copies in each of the 10 copies of the abl gene is calculated, most wt1 gene copy number was observed in the group of patients who had normal cytogenetic, and then, in patients with inv (16) and the lowest wt1, gene copy was observed in patients with t(8; 21). Our findings are somewhat different with candoni et al ., most of the copy of the wt1 gene was observed in patients who had inv (16) with an average of 23,100 copies and then in patients who had normal cytogenetic with npm1 mutations, with an average of 14,400 copies . In another study by stergaard et al . Had somewhat different results and the maximum amount of copies of the wt1 gene were in patients with t(15; 17) and the lowest amount of copies were in patients with t(8; 21). In this study, we also examined wt1 gene copies in each of the morphological groups based on the fab classifications, maximum copy of the wt1 gene were in the m1 with an average of 403.94 and the lowest were in the m6; increased expression of wt1 in m1 can be explained by an increase in the number of blasts in this group . The data of patients presented in this study show that an accurate quantitative amount of the wt1 transcript provided by the rq - pcr methods allows us to distinguish between normal and abnormal expression levels of wt1 gene, we significantly observed a great variation in wt1 level in de novo aml patients, which in this study did not show clear correlations to cytogenetically prognostic subgroups . With the concordance between wt1 gene mrd and hematological findings in both groups of fusion transcript - negative and transcript - positive patients, our study extremely supports the use of wt1 as a strong mrd marker.
Men, aged> 30 years, with type 2 diabetes were recruited from barnsley hospital nhs trust, barnsley, u.k . Most of the subjects were recruited from the retinal screening program, which is attended by virtually all patients with diabetes in the barnsley area . Subjects were given written and verbal information regarding the study, and 355 men gave their informed consent to take part . The study population comprised patients with diabetes usually managed in primary care facilities as well as secondary care patients . Other measurements included blood pressure, a1c, nonfasting lipid levels, height, weight, and waist circumference . The main data from the study were published previously in diabetes care (2). Patients were seen in the morning between 8:00 and 10:00 a.m. symptoms of hypogonadism were assessed by completion of the androgen deficiency in the aging male (adam) questionnaire, which was validated to assess hypogonadism in aging men (19). Serum total testosterone, total estradiol, and shbg were measured by an enzyme - linked immunosorbent assay using commercially available kits (drg diagnostics, marburg, germany). Bioavailable testosterone was determined by a modification of the ammonium sulfate precipitation method described by tremblay and dube (20). Free testosterone was calculated from total testosterone and shbg by the formula of vermeulen et al . . These methods of assessing bioavailable and free testosterone have been used in previous studies from our research team and have determined to be reliable for the assessment of men with diabetes and vascular disease (17). A1c was assessed using a menarini analyser ha8160 (menarini diagnostics, florence, italy). Serum lipid parameters were assessed by olympus analyzers (olympus diagnostics, hamburg, germany). Testosterone and shbg were log - normally distributed and were converted to a normal distribution to allow use of student's t test for comparison of group means . With smaller groups, the normal distribution was assessed using single - sample kolmogorov - smirnov testing . The two - sample kolmogorov - smirnov test was used to compare groups when data did not fulfill the normal distribution . Results were initially considered statistically significant at p <0.05 . Because of multiple statistical testing patients were seen in the morning between 8:00 and 10:00 a.m. symptoms of hypogonadism were assessed by completion of the androgen deficiency in the aging male (adam) questionnaire, which was validated to assess hypogonadism in aging men (19). Serum total testosterone, total estradiol, and shbg were measured by an enzyme - linked immunosorbent assay using commercially available kits (drg diagnostics, marburg, germany). Bioavailable testosterone was determined by a modification of the ammonium sulfate precipitation method described by tremblay and dube (20). Free testosterone was calculated from total testosterone and shbg by the formula of vermeulen et al . . These methods of assessing bioavailable and free testosterone have been used in previous studies from our research team and have determined to be reliable for the assessment of men with diabetes and vascular disease (17). A1c was assessed using a menarini analyser ha8160 (menarini diagnostics, florence, italy). Serum lipid parameters were assessed by olympus analyzers (olympus diagnostics, hamburg, germany). Testosterone and shbg were log - normally distributed and were converted to a normal distribution to allow use of student's t test for comparison of group means . With smaller groups, the normal distribution was assessed using single - sample kolmogorov - smirnov testing . The two - sample kolmogorov - smirnov test was used to compare groups when data did not fulfill the normal distribution . Results were initially considered statistically significant at p <0.05 . Because of multiple statistical testing, we performed a bonferroni correction to minimize the chance of type 2 errors . In our cross - section of 355 men with type 2 diabetes, 186 were not treated with statins . Of 169 men treated with statins, 81 were treated with atorvastatin, 66 with simvastatin, 15 with pravastatin, and 7 with other statins (3 with fluvastatin, 1 with cerivastatin, and 3 with unknown statin). Patients treated with statins did not significantly differ from untreated individuals in age, waist circumference, bmi, a1c, or blood pressure (table 1). Total cholesterol and ldl cholesterol levels were lower in men taking statins, but there were no significant differences in hdl cholesterol or triglyceride levels (data not shown). Mean sex hormone levels, measures of obesity, and cholesterol levels in men treated with any statin, atorvastatin, and simvastatin compared with untreated men p values given for student's t test comparing treated patients with the untreated group . Total testosterone was significantly lower in the statin and atorvastatin groups but not in the simvastatin group . Bioavailable and free testosterone levels were not significantly lower in any group . Both statins were associated with lower cholesterol levels, but none of the groups were significantly different in terms of obesity . Total testosterone levels were significantly lower in men treated with statins, and there was a trend toward lower shbg levels, but this did not reach statistical significance (table 1). Bioavailable testosterone, calculated free testosterone, and serum estrogen levels were not significantly different between the groups . The symptom score from the adam questionnaire was not significantly altered in those men receiving statin therapy . There were sufficient numbers of men treated with simvastatin and atorvastatin to consider these groups more closely (tables 1 and 2). These groups were not significantly different from untreated men in terms of bmi, waist circumference, blood pressure, a1c, or age . Total cholesterol and ldl cholesterol levels were lower in both groups compared with those in untreated men but were not significantly different between simvastatin- and atorvastatin - treated groups . Men treated with simvastatin did not have significantly different total, bioavailable, or free testosterone, estradiol, or shbg levels than untreated men (fig . 1 and table 1). In contrast, men treated with atorvastatin had an average total testosterone level 1.96 nmol / l (56 ng / dl) less than that in untreated men . There was a trend toward lower shbg levels in this group (35.3 vs. 27.6 nmol / l, p = 0.022). Further analysis revealed an apparent dose - response relationship, with the lowest testosterone levels seen in men taking higher doses of atorvastatin (table 3). Nmol / l (108 ng / dl) less than that of untreated men (table 3), but this value did not reach statistical significance (p = 0.017). Shbg was also reduced without reaching significance (p = 0.043), but free and bioavailable testosterone levels were unaltered . No significant differences were seen in sex hormone levels when the simvastatin - treated men were split into similar groups (data not shown). There were no significant differences in age, bmi, waist circumference, blood pressure, or a1c in any of the atorvastatin- or simvastatin - treated subgroups . Characteristics of patients untreated with statins and those treated with atorvastatin and simvastatin p values given for student's t test . There were no significant differences in age, anthropomorphic data, glycemic control, or blood pressure . Total and ldl cholesterol are lower in the statin - treated group, reflecting the primary action of the drugs . Mean testosterone levels in untreated men and those treated with atorvastatin or simvastatin; 95% cis are shown . International guidelines suggest that testosterone replacement is invariably warranted when the total testosterone level is <8 nmol / l (231 ng / dl) or the free testosterone level is <0.18 nmol / l (346 ng / dl) or a free testosterone between 0.18 and 0.25 nmol / l . * p <0.01; + p <0.05 . Average testosterone, shbg, and measures of obesity in men treated with atorvastatin split into two groups: those treated with 10 mg and those treated with 20 mg or more the 10-mg atorvastatin group was compared with the no statin group with student's t test; significant results are shown in boldface . The 20-mg atorvastatin group was compared with the no statin group using a two - sample kolmogorov - smirnov test . There is a trend toward lower total testosterone and shbg levels in men taking the higher doses of atorvastatin, but this does not reach statistical significance . In our cross - section of 355 men with type 2 diabetes, 186 were not treated with statins . Of 169 men treated with statins, 81 were treated with atorvastatin, 66 with simvastatin, 15 with pravastatin, and 7 with other statins (3 with fluvastatin, 1 with cerivastatin, and 3 with unknown statin). Patients treated with statins did not significantly differ from untreated individuals in age, waist circumference, bmi, a1c, or blood pressure (table 1). Total cholesterol and ldl cholesterol levels were lower in men taking statins, but there were no significant differences in hdl cholesterol or triglyceride levels (data not shown). Mean sex hormone levels, measures of obesity, and cholesterol levels in men treated with any statin, atorvastatin, and simvastatin compared with untreated men p values given for student's t test comparing treated patients with the untreated group . Total testosterone was significantly lower in the statin and atorvastatin groups but not in the simvastatin group . Bioavailable and free testosterone levels were not significantly lower in any group . Both statins were associated with lower cholesterol levels, but none of the groups were significantly different in terms of obesity . Total testosterone levels were significantly lower in men treated with statins, and there was a trend toward lower shbg levels, but this did not reach statistical significance (table 1). Bioavailable testosterone, calculated free testosterone, and serum estrogen levels were not significantly different between the groups . The symptom score from the adam questionnaire was not significantly altered in those men receiving statin therapy . There were sufficient numbers of men treated with simvastatin and atorvastatin to consider these groups more closely (tables 1 and 2). These groups were not significantly different from untreated men in terms of bmi, waist circumference, blood pressure, a1c, or age . Total cholesterol and ldl cholesterol levels were lower in both groups compared with those in untreated men but were not significantly different between simvastatin- and atorvastatin - treated groups . Men treated with simvastatin did not have significantly different total, bioavailable, or free testosterone, estradiol, or shbg levels than untreated men (fig . 1 and table 1). In contrast, men treated with atorvastatin had an average total testosterone level 1.96 nmol / l (56 ng / dl) less than that in untreated men . There was a trend toward lower shbg levels in this group (35.3 vs. 27.6 nmol / l, p = 0.022). Further analysis revealed an apparent dose - response relationship, with the lowest testosterone levels seen in men taking higher doses of atorvastatin (table 3). Nmol / l (108 ng / dl) less than that of untreated men (table 3), but this value did not reach statistical significance (p = 0.017). Shbg was also reduced without reaching significance (p = 0.043), but free and bioavailable testosterone levels were unaltered . No significant differences were seen in sex hormone levels when the simvastatin - treated men were split into similar groups (data not shown). There were no significant differences in age, bmi, waist circumference, blood pressure, or a1c in any of the atorvastatin- or simvastatin - treated subgroups . Characteristics of patients untreated with statins and those treated with atorvastatin and simvastatin p values given for student's t test . There were no significant differences in age, anthropomorphic data, glycemic control, or blood pressure . Total and ldl cholesterol are lower in the statin - treated group, reflecting the primary action of the drugs . Mean testosterone levels in untreated men and those treated with atorvastatin or simvastatin; 95% cis are shown . International guidelines suggest that testosterone replacement is invariably warranted when the total testosterone level is <8 nmol / l (231 ng / dl) or the free testosterone level is <0.18 nmol / l (346 ng / dl) or a free testosterone between 0.18 and 0.25 nmol / l . * p <0.01; + p <0.05 . Average testosterone, shbg, and measures of obesity in men treated with atorvastatin split into two groups: those treated with 10 mg and those treated with 20 mg or more the 10-mg atorvastatin group was compared with the no statin group with student's t test; significant results are shown in boldface . The 20-mg atorvastatin group was compared with the no statin group using a two - sample kolmogorov - smirnov test . There is a trend toward lower total testosterone and shbg levels in men taking the higher doses of atorvastatin, but this does not reach statistical significance . This is the first study to analyze fully testosterone levels and hypogonadal symptoms in comparison with statin use in a population receiving routine medical management . Those treated with atorvastatin had lower levels of total testosterone with a trend toward lower shbg compared with untreated men, whereas those treated with simvastatin were not significantly affected . Statin treatment did not significantly affect the biologically active fractions of testosterone, symptoms of hypogonadism, or estradiol levels . This study demonstrates that treatment with statins in this group can be a confounding factor in the assessment of hypogonadism . Total testosterone is the primary test used in the diagnosis of hypogonadism, and the effect of atorvastatin could potentially lead to misdiagnosis of the condition in men with normal free and bioavailable testosterone levels . Alternatively, it is possible that reductions in total testosterone without changes in bioactive testosterone fractions have clinical effects in view of findings suggesting that shbg - bound testosterone may be biologically active (13). The adam questionnaire failed to detect an increase in hypogonadal symptoms in groups with lower total testosterone levels, but the questionnaire does not correlate closely with testosterone levels, and men with diabetes have a high level of false - positive hypogonadal symptoms (2) such as erectile dysfunction owing to vascular and neuropathic factors, medications, and depression . Atorvastatin is a more potent statin than simvastatin, thus causing a greater reduction in the total cholesterol and hence total testosterone levels . No patients in our study were treated with other potent statins such as rosuvastatin so we are unable to confirm that atorvastatin reduces testosterone and shbg levels secondary to more potent effects on cholesterol levels . Indeed, cholesterol and other lipid fraction levels were not significantly different between simvastatin- and atorvastatin - treated groups . In a normal physiological state, luteinizing hormone (lh) promotes uptake of cholesterol by the testis and stimulates testosterone synthesis . A reduction in testosterone is sensed by the hypothalamic - pituitary axis and leads to greater lh release, which completes a negative feedback loop and maintains testosterone levels . The apparent failure of the hypothalamic - pituitary - testicular axis to respond and maintain testosterone levels in the statin - treated patients in our study may be explained by the hypogonadal - obesity - adipocytokine hypothesis (1). The majority of the patients in our study were overweight or obese . In this population, greater production of adipocytokines such as tumor necrosis factor-, interleukin-6, and leptin and increased estradiol from metabolism of testosterone by aromatase in adipose tissue inhibit lh release from the pituitary gland, which leads to lower circulating testosterone levels . In our study, gonadotrophin levels were only tested in men with total testosterone levels <12 mmol / l (2), leaving us unable to test this hypothesis . The most likely reason that bioavailable and free testosterone levels are unaltered despite lower total testosterone is a homeostatic mechanism via reduced shbg production . An alternative hypothesis is that atorvastatin causes a primary reduction in shbg with consequent reductions in total testosterone . There was a consistent trend toward low shbg levels in all groups with reduced levels of total testosterone, although these low levels did not reach statistical significance . Shbg is produced in the liver, the primary site of action of the statins, but the mechanism by which statins could alter shbg is unknown . Shbg levels are known to be modulated by a number of factors including downregulation by insulin resistance and upregulation by estrogens (21). We are aware of one clinical trial assessing the effects of atorvastatin on testosterone levels in men . The results showed a nonsignificant fall in total testosterone and no change in shbg (4). These data are insufficient to confirm or refute our findings relating to atorvastatin, and it may be that the study allowed insufficient time for changes to develop . Some trials have shown that simvastatin reduces serum testosterone levels (911), whereas others have shown no effect (68). Our data suggest that any effect of simvastatin in reducing serum testosterone levels is not clinically significant in men with type 2 diabetes . We are not aware of any previous evidence for an effect of any statin on shbg levels . Nmol / l (231 ng / dl) are hypogonadal, that men with total testosterone levels> 12 nmol / l (346 ng / dl) do not have hypogonadism, and that men with levels between 8 and 12 nmol / l need consideration for treatment depending on their clinical picture (18). An endocrine society clinical practice guideline suggested a diagnostic cutoff value of testosterone of <10.4 our findings are important in this context because statin treatment was associated with lower total testosterone levels of 11.9 nmol / l (340 ng / dl) (versus 13.4 nmol / l [384 ng / dl]). Men treated with 20 mg / day atorvastatin had an average total testosterone level of only 9.6 nmol / l (275 ng / dl), which is 3.8 nmol / l (109 ng / dl) lower than that of men not treated with statins . Thus, statin treatment may lead to reductions in total testosterone levels to <12 or 10.4 nmol / l in many men but will not significantly alter bioavailable or free testosterone levels or hypogonadal symptoms . We recommend a low threshold for measuring or calculating bioavailable or free testosterone in men receiving statin therapy . It has now been confirmed that reductions in total testosterone are accompanied by similar changes in free and bioavailable testosterone and a high prevalence of hypogonadal symptoms (2). Furthermore, short - term studies in small numbers of hypogonadal diabetic men have shown improvements in glycemic control, central obesity, and serum leptin during testosterone replacement therapy (23,24). Other short - term studies have shown beneficial effects on further cardiovascular risk factors including total cholesterol levels (25). In this context, the assessment of hypogonadism in men with type 2 diabetes is likely to increase in frequency . Assessment of the clinical syndrome of hypogonadism can be challenging in this group because of the confounding effects of vascular disease, psychological factors, and medications on symptoms such as erectile dysfunction . This assessment is complicated by low shbg levels, which have long been associated with insulin resistance, leading to suggestions that low testosterone levels in type 2 diabetes are due to low shbg rather than to reductions in bioactive testosterone fractions . This suggestion has been refuted by studies showing low free and bioavailable testosterone levels in men with type 2 diabetes (2) and meta - analysis data suggesting relatively small changes in shbg in men with diabetes (22). The realization that statin treatment may reduce total testosterone and shbg levels in this patient group serves to refocus attention to a subgroup who are particularly likely to have low shbg levels with the potential for a misdiagnosis of hypogonadism . In summary, this large data set is the first to suggest a significant effect of statins in lowering total testosterone and shbg levels in a population of men with type 2 diabetes . The findings have important implications for the diagnosis of hypogonadism in men receiving statin treatment . The opportunity to conduct similar studies of men with type 2 diabetes, comparing men treated with statins to untreated men, has now probably passed owing to the almost ubiquitous use of statins in this group . Limitations of this study are its observational nature and the resultant inability to prove causality . Statin - treated men did not differ from other men in terms of age, blood pressure, obesity, or glycemic control, but unidentified confounders cannot be excluded . Therefore further longitudinal or interventional studies are also needed to assess the effects of statins on androgen status in various patient groups and could include assessment of gonadotrophins and prolactin, which were not measured here . Researchers should also investigate mechanisms that lead to changes in shbg and total testosterone in this context.
Techniques involving solid supports play crucial roles in the development of genomics, proteomics, and in molecular biology . However, solid - phase tools have been employed to a much lesser extent in glycobiology and glycomics . There are a number of classical methods for immobilization of mono- and oligosaccharides to commercially available matrices and supports . These methods have, for example, been used for the preparation of affinity columns with specific ligands . Increased attention has been given to the development and application of magnetic separation techniques, which employ small magnetic particles . Antibodies, dna / rna / oligonucleotide / aptamer binding proteins, albumin, hemoglobin, and enzymes have been purified by magnetic techniques . In our laboratory fe3o4 magnetite particles prepared by coprecipitating fe2 and fe3 with either dacron or a network of polysiloxane - polyvinyl alcohol, magnetic particles containing levan, a homopolysaccharide of fructose residues in 2, 6-glycosidic linkage, are proposed to purify lectins . The latter glycoproteins and/or oligomeric proteins are found in a diverse assortment of organisms and have the extraordinary property of binding specifically, reversibly, and noncovalently to carbohydrates . Lectin - carbohydrate interactions are extensively studied in different scientific disciplines, from basic to applied natural and clinical sciences . Such inter- and multidisciplinarity corroborates the importance to develop new methodologies for the study of lectin - saccharide interactions and the potential applications in clinical diagnostics . In the present work a composite of the carbohydrate levan and magnetite lectins complexed specifically to the composite were separated from other contaminant proteins by washing with a high ionic strength solution and obtained from composite with specific monosaccharide . The washing procedures were facilitated by the magnetic field and all process can be automated . The seed lectins from cratylia mollis (camaratu bean), cramoll [9, 10] and canavalia ensiformis (con a) were used as models . Con a and potato lectin from solanum tuberosum have already been purified by magnetic techniques using dextran and chitosan as ligands, respectively . The aim of this work was to evaluate the use of zimomonas mobilis levans insolubilized and ferromagnetized (fmzag-12l), to purify fructose / specific lectins using lectin preparations of c. mollis seeds . Cramoll 1, 4 and cramoll 1 were obtained through a previously established protocol from a c. mollis seed extract (10%, w / v) that was ammonium sulfate fractionated; fraction (f) 40 to 60% saturated (f4060) was affinity chromatographed in sephadex g-75 (cramoll 1, 4) followed by ion exchange chromatography in cm - cellulose (cramoll 1 and cramoll 4). Cramoll 3 was also obtained from the above mentioned seed extract through a previously described protocol; the 0 to 40% ammonium sulfate fraction (f040) was molecular exclusion chromatographed in sephadex g-100 . Levan (l) was produced by zimomonas mobilis strain zag-12 (departamento de antibiticos, universidade federal de pernambuco, brazil) and abbreviated from now on as zag-12l . A solution containing fe and fe ions in a molar ratio of 1.1 m: 0.6 m was prepared from fecl36h2o and fecl24h2o in distilled water; 50 ml of 2% zag-12l in distilled water was then added and the ph was raised to 11.0 by adding drop wise 1 m nh4oh . Mixture was then heated up to 85 3c and incubated for 30 minutes with vigorous stirring . The ferromagnetic levan obtained (fmzag-12l) was centrifuged 5 times to remove solid material . The product was dried for 24 hours at 50c, ground and kept at room temperature . Aqueous suspensions of magnetic particles were prepared by coprecipitation of fe (iii) and fe (ii) in the presence of nh4oh and polymer . The protein content was carried out by lowry et al . Using bovine serum albumin as standard, at a range of 0500 g / ml and absorbance reading at 720 nm . Lectin sample solutions (50 l) were serially 2-fold diluted in 0.15 m nacl, in microtiter u - plates and incubated with of a 2.5% (v / v) suspension of glutaraldehyde treated erythrocytes from new zealand white rabbit (50 l). The titer, defined as the lowest sample dilution which showed hemagglutination, was established after 45 minutes incubation according to correia and coelho . Hemagglutinating activity (ha) corresponded to the reciprocal titer . The ha inhibition (hai) was assayed by 2-fold serial dilution of lectin sample solutions (50 l) in 50 l of 200 mm levan or fructose solutions, followed by 15 minutes incubation and addition of erythrocyte suspension . H unidimensional spectra were recorded in a bruker drx 400 mhz (bruker, germany) with a triple resonance 5-mm probe . The lectins (1 ml) con a, cramoll 1, 4, cramoll 3, and f4060 were each incubated with fmzag-12l particles (1 ml containing 10 mg) for 2 hours at 4c, under constant agitation . Afterwards, the magnetic particles were recovered by a magnetic field (6 000 oe) and supernatant was collected . The remaining unspecific bound proteins were eluted with 0.15 m nacl (1 ml) by recovering the magnetic particles under the magnetic field and collecting the supernatant . Finally, adsorbed lectin was eluted with either 0.3 m d - glucose (con a and cramoll 1, 4) or d - galactose (cramoll 3 incubation) in 0.15 m nacl (1 ml) recovering the magnetic particles . The collected supernatants had their absorbancies at 280 nm and ha analyzed; page for native and basic proteins were performed according to reisfeld et al . . C. mollis (camaratu bean) is a native forage from the semi - arid region of pernambuco state, northeastern of brazil, and belongs to fabaceae family, taxonomically related with c. ensiformis species from which seeds are obtained con a. c. mollis seeds have been considered an important lectin source, giving multiple cramoll molecular forms with different carbohydrate specificities: cramoll 1, cramoll 2, and cramoll 4 are specific for glucose / mannose whereas cramoll 3 is galactose specific . A preparation containing cramoll 1 and cramoll 4 together (cramoll 1, 4) showed a higher hemagglutinating activity (ha) when compared with the isolated cramoll 1 and cramoll 4 as well as con a. these lectin preparations (cramoll 1, cramoll 4, and cramoll 1, 4) are inhibited by different carbohydrates (d - glucose, d - mannose, -d - methyl - mannoside, and d - fructose, among others) in distinct concentrations . Cramoll 1, 4 and cramoll 1 were successfully used in different biological assays as well as in structural and electrochemical studies [1521]. The nmr analysis of zag-12l used in this work revealed a spectrum profile corresponding to the fructose residues protons . H nmr spectrum shows seven protons between 3.4 and 4.2 ppm indicating that the polysaccharide produced by z. mobilis was levan type with the linkage of (2 6) fructofuranoside (figure 1). No signals in the anomeric region (5.3 to 4.3 ppm) levans from erwinia herbicola, acetobacter xylinum, and bacillus subtilis (natto) showed the same structural characteristics analyzed by nmr . Hai of cramoll 1, cramoll 1, 4, cramoll 3, and con a by fructose and levan revealed that all lectins presented ha inhibited by fructose and its polymeric derivative (table 1). However, inhibition of cramoll 1, 4 activity by the commercially acquired levan was less intensive . Previous studies of this preparation specificity using different monosaccharides showed that d - fructose inhibited cramoll 1, 4 ha at the same d - mannose proportion . Mo et al . Reported that con a did bind to d - fructofuranosyl groups present in plant and microorganism levans whereas banana (musa acuminate) lectin reacted only with microorganism levans . It is important to observe that banana lectin and con a (structurally similar to cramoll 1) are both glucose / mannose specific . The inhibition of lectins by levans suggested that magnetized levan could be potentially used as an affinity matrix to investigate or purify lectins that recognize fructose . Figure 2 shows the con a elution profile by using particles of ferromagnetic levan composite (fmzag-12l). Proteins unspecifically bound to the particles were completely washed out with 0.15 m nacl from the 1st to the 8th washes (8 ml) and a second peak emerged after 0.3 m glucose addition at the 10 - 11th fractions . It is worthwhile to draw attention to the fact that equal profile was attained four times indicating its reproducibility and the reuse of the particles . This preparation containing both lectin isoforms was previously purified from c. mollis seed extract by ammonium sulfate fractionation and affinity chromatography in sephadex g-75 . The particles washed with 0.15 m nacl again showed that from the 1st to 8th fraction (8 ml of washes) all unspecifically bound proteins were removed and a second peak emerged after 0.3 m glucose introduction . Similar to con a purification this procedure was four times reproduced using the same fmzag-12l . The protein peak eluted at the 14th fraction showed two bands (cramoll 1 and cramoll 4) by polyacrylamide electrophoresis to basic and native proteins (figure 3(b)) similar to previously reported pattern . None specific binding to fmzag-12l was detected when cramoll 3 was used (data not shown). Recently, the importance of protein - protein interaction has been pointed out in certain oligomeric lectins since differences among their quaternary organizations appear to be directly related to those among their functions . Lectin binding sites have been deeply characterized by many workers to understand carbohydrate interaction of these versatile proteins [2729]. The evaluation of fmzag-12l to purify cramoll lectins from f4060 preparation is presented in figure 4(a). Three different concentrations of the ammonium sulfate preparation per 10 mg of fmzag-12l were used: 1.8 mg / mg, 1 mg / mg, and 0.5 mg / mg of protein / mg magnetic particles . All concentrations showed a second protein peak (9th-10th fractions) eluted by 0.3 m glucose addition at the 8th washing with 0.15 m nacl . The polyacrylamide gel electrophoresis to basic and native proteins of the fraction (10th) collected from the 10 mg f4060 purification showed only cramoll 1 protein band (figure 4(b)). Furthermore, the pure lectin cramoll 1 showed ha of 256 and was inhibited by all levans (table 1). The purification of this lectin is relevant due to its several applications such as neoplastic tissue marker . Cramoll 1 showed a higher intensity of staining to transformed tissues than normal ones: also, encapsulation of cramoll 1 into liposomes produced an improvement in its in vivo antitumor activity against sarcoma 180 compared with free cramoll 1 solution . The lectin purification using only the ferromagnetic particles, namely, absent of levan, did not show any protein peak after 0.3 m glucose addition (control). It is interesting to notice that cramoll 4 was collected when a purified preparation was incubated with the fmzag-12l (figure 3(b)) but it was not obtained when a lesser purified preparation (f4060) was used (figure 4(b)). Probably, higher amounts of cramoll 1 than cramoll 4 in preparation f4060 and/or different binding constant values for the magnetic levan - lectin can justify these discrepancies . Furthermore, the ferromagnetic composite of levan is synthesized by a simple and inexpensive method . Cramoll 1 was purified by this fast two - step procedure (ammonium sulfate fractionation and fmzag-12l affinity binding) instead of the laborious and time consuming three - step protocol previously described . Finally, it is important to investigate if other polysaccharides could replace the levan in the composite synthesis and be used to lectin purification.
Although the incidence of mets is known to depend on lifestyle, diet, and physical activity,1,2 it is also suggested that genetic factors may play an important role . For example, the risk for mets may be increased by the presence of common snps within the fto - associated gene, the mc4r gene, and the ppar gene . As the expression profile of the corresponding proteins is strictly dependent on the genetic information within their genes, functional implications of these three polymorphisms seem to be significant . However, their exact mechanisms of action are still not clear . The fto gene is located on chromosome 16 and encodes 2-oxoglutarate - dependent nucleic acid demethylase . The gene is expressed in many tissues, especially in the hypothalamus, responsible for the control of energy balance.3,4 increases in the hypothalamic expression of fto are associated with the regulation of energy intake but not with the feeding reward.5 few snps within fto gene were found to play a role in obesity and t2dm.69 to date, three snps (rs9939609, rs1121980, and rs1558902) have been associated with obesity and bmi in caucasian and hispanic americans.3,6,7 the association of rs9939609 (a> t variant) with obesity was found to be the strongest, especially in the dominant model of inheritance.10 in addition, a link between the fto rs9939609 polymorphism and obesity and mets has been confirmed in many studied populations, including in europe.1116 the mc4r and leptin genes are essential in the hypothalamic regulation of appetite.17,18 the mc4r gene plays an essential role in the maintenance of energy balance and is stimulated by endogenous melanocortins.19 its mutations account for 2.4%4% of morbidly obese people; the polymorphisms of this gene have also been associated with obesity.20 common variants within the mc4r gene have been reported as the second strongest association signal for common obesity in the gwas.21 in adult europeans, the mc4r rs17782313 (c> t variant) polymorphism has been widely studied and found to predispose to obesity.21 with regard to mets, the studied association with the mc4r rs17782313 polymorphism disappears after adjusting for wc, indicating that the association with mets is driven by the association with this factor.22 moreover, studies on males proved that the rs17782313 polymorphism is associated with lower hdl concentration23 and elevated dbp.14,24 ppars are nuclear receptors, participate in adipogenesis and lipid metabolism, regulate insulin sensitivity, and participate in transformations in the energy system.25 of the three types of ppars (,, and), the best known is ppar, with two isoforms ppar1, which is expressed in many tissues, and ppar2, which is expressed almost exclusively in adipocytes.26 the ppar activation plays an important role in adipocyte differentiation and maturation, lipid metabolism and transport, and improving insulin sensitivity.27,28 the ppar gene is located on the short arm of chromosome 3 at 3p25 band . The most common ppar gene polymorphism is rs1801282 (c> g variant), resulting from proline being replaced with alanine.29 some literature data indicate a relationship between the rs1801282 polymorphism and metabolic disorders.30 healthy nonsmoking men carrying the mutant allele of rs1801282 polymorphism are at a high risk for mets and insulin resistance.30 in a large study of the caucasians, the rs1801282 was linked to wc in patients with t2dm.31 however, it must be remembered that other researchers found no such associations.32 in addition, ppar is involved in the activation of androgen receptor (ar), which may affect the action of androgens.33 literature studies on men show significant relationships between mets and hormonal changes . It is emphasized that a decrease in fts and tst promotes the development of metabolic disorders, while disorders of carbohydrate metabolism, lipid metabolism and obesity contribute to hypogonadism.3437 this indicates that these pathologies are interrelated . Both cross - sectional and longitudinal epidemiological studies indicate that the level of shbg is lower in men with mets.3840 other researchers emphasize, however, that the relationships between mets and either ts or shbg are stronger in younger men.34,35 dehydroepiandrosterone does not seem to play a significant role in the development of mets in men.34,37,41 finally, the conclusions of the emas support the supposition that e2 levels in aging men are not related to the development of mets.42 despite some knowledge on the interrelationships between metabolic and hormonal disorders in men, we still do not know which factors trigger them . It remains to be solved whether they are environmental or lifestyle factors, or genetic factors, and what comes first regarding the genetic factors that with a high probability are responsible for mets and associated disorders, it seems important to find any potential links with hormonal disturbances . We hypothesized that the selected genetic polymorphisms (fto rs9939609, mc4r rs17782313, and ppar rs1801282) may contribute to the occurrence and increase in metabolic and androgen disorders in aging men . We aimed to examine the relationships between the fto rs9939609, mc4r rs17782313, and ppar rs1801282 and the prevalence of mets and related disorders, such as ht, t2 dm, and obesity . In addition, we aimed to analyze the relationships between selected polymorphisms and the parameters of lipid profile, including tch, ldl, hdl, tg, sex hormones, including tst, fts, e2, dheas, shbg, and anthropometric parameters, including bmi, wc, and abp in middle - aged and elderly men, which may contribute to increased knowledge about the mutual relationships between metabolic and sex hormone disorders in aging men . This study involved 272 caucasian men aged 5075 years (mean age 626.4 years) who voluntarily signed up after receiving information about the study from their doctors at primary health - care centers in the city of szczecin (poland). The exclusion criteria in this study included cancer treatment, receiving steroids (including t and dehydroepiandrosterone), thyroid disease, and receiving neuroleptics or antidepressants . The medical questionnaire showed that none of the participants exceeded a daily alcohol intake of 40 g. we excluded patients on slimming diets or showing above - average physical activity . Patients participating in the study filled in an original questionnaire (questions about lifestyle including nutritional habits, smoking, alcohol intake, demographics status, physical activity, diseases, and drug intake). The study was performed in accordance with the declaration of helsinki and approved by the bioethics committee of the pomeranian medical university in szczecin (kb-0012/159/12). The men in the study were informed about the details of the research project and expressed their written consent to participate in the study . Surveys revealed that 150 people suffered from ht (55.1%), 50 people had t2 dm (18.4%), and statins were taken by 30 of the men (11.0%). Mets was diagnosed according to the 2005 idf criteria for european men (wc 94 cm and at least two of the following: fpg 100 mg / dl or t2 dm treatment; abp 130/85 mmhg or ht treatment; hdl <40 mg / dl or dyslipidemia treatment; and tg 150 mg / dl or dyslipidemia treatment). In order to accurately measure wc, a physician located patients upper hip bone and then placed a tape measure around bare stomach just above the hip bone . Each time, the measuring tape was parallel to the floor and adjacent to the patient s body . During measurement, bmi was calculated; we assumed that bmi in the range of 18.524.99 denotes normal weight, of 2529.99 indicates overweight, and of 30 means obesity . To assess the sbp and dbp, the sphygmomanometer was used . The smallest cuff size covering ~2/3 of the right upper arm and encircling the entire arm completely, was selected . Bp was measured in a supine position after 15 minutes rest, and only one of the physicians performed all of the bp measurements using a standardized protocol . Blood was taken from the tested men on an empty stomach from an ulnar vein, between 7.30 am and 9.00 am . For the biochemical and hormonal assays, blood was drawn into a tube with a coagulator and gel separator and then centrifuged . For the genetic assays, blood was collected into tubes with ethylenediaminetetraacetic acid (anticoagulant). The sera were stored at 70c . In the blood serum, we determined tch, ldl, hdl, tg, and fpg by spectrophotometric method, with the use of reagent kits (biolabo; aqua - med, lodz, poland). Mets was diagnosed according to the criteria of the idf from 2005.43 enzyme - linked immunosorbent assay was used to determine serum concentrations of dheas, tst, fts, e2, and shbg with the use of reagent kits (drg medtek, warsaw, poland). Genetic investigations were carried out in a laboratory of the department of gerontobiology, pomeranian medical university, szczecin, poland . Genomic dna from peripheral blood leukocytes was extracted using an extraction kit (high pure pcr template preparation kit; roche, mannheim, germany) according to the manufacturer s instructions . Protocols for polymorphisms fto rs9939609, mc4r rs17782313, and ppar rs1801282 followed previously published polymerase chain reaction - restriction fragments length polymorphism techniques,4446 which were performed in a hightech thermocycler cycler - technology for life (sensoquest, gottingen, germany). The genotypes were determined by 2%3% agarose gel electrophoresis (agarose; sigma - aldrich, munich, germany) stained with dna - star dye (lonza, inc, rockland, me, usa). All results were found to be reliable . For each of the loci, we performed analyses in overdominant models of inheritance followed by the adopted recessive models of inheritance (fto: aa + ta vs tt; mc4r: cc + ct vs tt; and ppar: gg + cg vs cc). Statistical analysis was performed using the statview software, version 5.0 (sas institute inc ., continuous variables (ie, bmi, abp, tst, fts, shgb, e2, dheas, tg, tch, ldl, hdl, and fpg) were described by am with standard deviation, median, and range . In the description of qualitative variables (ie, genotype, t2 dm, ht, mets, overweight and obesity, and statin treatment), we presented the number (n), which is also expressed as a percentage . First, test was used to verify whether genotype frequencies fit to the hardy weinberg (h w) equilibrium . Then, an analysis of variance test was used to assess the associations between the genotypes fto rs9939609, mc4r rs17782313, and ppar rs1801282 polymorphisms and the anthropometric indicators, hormonal and metabolic parameters . In the next step, the assessment of relationships between genotypes and the qualitative variables was performed using a test of independence . To evaluate whether the studied polymorphisms determined any of the anthropometric and metabolic indices, which were found to be significant in previous analyses, we used the logistic regression analysis for the determination of odds ratio (or) and 95% confidence intervals . This study involved 272 caucasian men aged 5075 years (mean age 626.4 years) who voluntarily signed up after receiving information about the study from their doctors at primary health - care centers in the city of szczecin (poland). The exclusion criteria in this study included cancer treatment, receiving steroids (including t and dehydroepiandrosterone), thyroid disease, and receiving neuroleptics or antidepressants . The medical questionnaire showed that none of the participants exceeded a daily alcohol intake of 40 g. we excluded patients on slimming diets or showing above - average physical activity . Patients participating in the study filled in an original questionnaire (questions about lifestyle including nutritional habits, smoking, alcohol intake, demographics status, physical activity, diseases, and drug intake). The study was performed in accordance with the declaration of helsinki and approved by the bioethics committee of the pomeranian medical university in szczecin (kb-0012/159/12). The men in the study were informed about the details of the research project and expressed their written consent to participate in the study . Surveys revealed that 150 people suffered from ht (55.1%), 50 people had t2 dm (18.4%), and statins were taken by 30 of the men (11.0%). Mets was diagnosed according to the 2005 idf criteria for european men (wc 94 cm and at least two of the following: fpg 100 mg / dl or t2 dm treatment; abp 130/85 mmhg or ht treatment; hdl <40 mg / dl or dyslipidemia treatment; and tg 150 mg / dl or dyslipidemia treatment). In order to accurately measure wc, a physician located patients upper hip bone and then placed a tape measure around bare stomach just above the hip bone . Each time, the measuring tape was parallel to the floor and adjacent to the patient s body . During measurement, bmi was calculated; we assumed that bmi in the range of 18.524.99 denotes normal weight, of 2529.99 indicates overweight, and of 30 means obesity . To assess the sbp and dbp, the sphygmomanometer was used . The smallest cuff size covering ~2/3 of the right upper arm and encircling the entire arm completely, was selected . Bp was measured in a supine position after 15 minutes rest, and only one of the physicians performed all of the bp measurements using a standardized protocol . Blood was taken from the tested men on an empty stomach from an ulnar vein, between 7.30 am and 9.00 am . For the biochemical and hormonal assays, blood was drawn into a tube with a coagulator and gel separator and then centrifuged . For the genetic assays, blood was collected into tubes with ethylenediaminetetraacetic acid (anticoagulant). The sera were stored at 70c . In the blood serum, we determined tch, ldl, hdl, tg, and fpg by spectrophotometric method, with the use of reagent kits (biolabo; aqua - med, lodz, poland). Mets was diagnosed according to the criteria of the idf from 2005.43 enzyme - linked immunosorbent assay was used to determine serum concentrations of dheas, tst, fts, e2, and shbg with the use of reagent kits (drg medtek, warsaw, poland). Genetic investigations were carried out in a laboratory of the department of gerontobiology, pomeranian medical university, szczecin, poland . Genomic dna from peripheral blood leukocytes was extracted using an extraction kit (high pure pcr template preparation kit; roche, mannheim, germany) according to the manufacturer s instructions . Protocols for polymorphisms fto rs9939609, mc4r rs17782313, and ppar rs1801282 followed previously published polymerase chain reaction - restriction fragments length polymorphism techniques,4446 which were performed in a hightech thermocycler cycler - technology for life (sensoquest, gottingen, germany). The genotypes were determined by 2%3% agarose gel electrophoresis (agarose; sigma - aldrich, munich, germany) stained with dna - star dye (lonza, inc, rockland, me, usa). All results were found to be reliable . For each of the loci, we performed analyses in overdominant models of inheritance followed by the adopted recessive models of inheritance (fto: aa + ta vs tt; mc4r: cc + ct vs tt; and ppar: gg + cg vs cc). Statistical analysis was performed using the statview software, version 5.0 (sas institute inc ., cary, nc, usa). Continuous variables (ie, bmi, abp, tst, fts, shgb, e2, dheas, tg, tch, ldl, hdl, and fpg) were described by am with standard deviation, median, and range . In the description of qualitative variables (ie, genotype, t2 dm, ht, mets, overweight and obesity, and statin treatment), we presented the number (n), which is also expressed as a percentage . First, test was used to verify whether genotype frequencies fit to the hardy weinberg (h w) equilibrium . Then, an analysis of variance test was used to assess the associations between the genotypes fto rs9939609, mc4r rs17782313, and ppar rs1801282 polymorphisms and the anthropometric indicators, hormonal and metabolic parameters . In the next step, the assessment of relationships between genotypes and the qualitative variables was performed using a test of independence . To evaluate whether the studied polymorphisms determined any of the anthropometric and metabolic indices, which were found to be significant in previous analyses, we used the logistic regression analysis for the determination of odds ratio (or) and 95% confidence intervals . The characteristics of the study group and descriptive analysis of the metabolic and hormonal parameters are listed in table 1 . Normal body weight was found in 65 patients (23.9%), overweight was found in 130 patients (47.8%), and obesity was found in 77 (28.3%). We found no associations between fto rs9939609, mc4r rs17782313, and ppar rs1801282 polymorphisms and the qualitative variables (mets, t2 dm, ht, obesity, and overweight), and also in the overdominant and recessive models of inheritance (table 3). In the case of continuous variables, we found that fto rs9939609 polymorphism inherited only in the recessive pattern, which was associated with ldl concentration; the difference in ldl concentration was statistically significant (aa + at: 136.1851.57 mg / dl vs tt: 153.0462.48 mg / dl; p=0.03). We also found that the presence of two mutant alleles was associated with higher tch level (tt: 223.0764.94 mg / dl and aa + at: 207.354.9 mg / dl; p=0.05). There was no other evidence of links between the analyzed continuous variables and the fto rs9939609 polymorphism in any of the analyzed models of inheritance . However, the association between the recessive genotype of rs9939609 polymorphism and sbp was close to statistical significance (p=0.07). Analyzing the relationship between the continuous variables and the mc4r rs17782313 polymorphism, we demonstrated that men with the cc and ct genotypes had a significantly greater wc (cc + ct: 103.9112.61 cm vs tt: 99.7710.88 cm; p=0.005) (table 4). For other continuous variables, we found no statistically significant relationships with the mc4r rs17782313 polymorphism in both models of inheritance . This study showed no connection between the ppar (rs1801282) polymorphism and the studied continuous variables . In the final step of our experiments, we aimed to establish whether recessive genotypes of the polymorphisms determined any of the clinical conditions (t2 dm, mets, ht, overweight, and obesity), or continuous variables anthropometric, hormonal, and metabolic indices by means of logistic regression . We found no statistical significance with regard to the relationship between fto rs9939609, mc4r rs17782313, and ppar (rs1801282) polymorphisms and any of the clinical conditions mets, t2 dm, ht, overweight, and obesity (p>0.05). On the other hand, two mutant alleles of fto rs9939609 polymorphism were found to be related to a minimal elevation of ldl, and the recessive genotype (tt homozygotes) of mc4r rs17782313 polymorphism was associated with a reduction in wc . The remaining anthropometric and biochemical parameters showed no statistical significance in the logistic regression model . In this study, we found no relationship between the presence of fto rs9939609, mc4r rs17782313, and ppar rs1801282 polymorphisms and the incidence of t2 dm, ht, mets, and obesity in caucasian men aged 5075 years, living in the city of szczecin (poland). We also found no links between the presence of these polymorphisms and the levels of the tested hormones (tst, fts, e2, and dheas) and shbg . With regard to biochemical parameters, we found a statistically significant association between the levels of tch and ldl and the fto rs9939609 polymorphism in the recessive model of inheritance . We proved that mutant homozygotes had higher tch and ldl concentrations in comparison to other genotypes . In the group of anthropometric parameters, possessing two mutant alleles was found to be associated with lower wc in comparison to wild - type homozygotes and heterozygotes for the analyzed snp . Our results on the fto rs9939609 polymorphism stand in contrast to a study in which non - caucasian subjects demonstrated links between the fto rs9939609 polymorphism and the occurrence of mets.47 moreover, that study also reported that an increased risk for mets, especially in men, is associated with the presence of at least one wild - type allele . This regularity is also mentioned in a meta - analysis by freathy et al,48 where allele a frequency correlated with lower hdl and higher tg concentrations and other components of mets, but after adjusting for bmi, this relationship became statistically insignificant . In this study, we found no statistically significant relationships between either hdl or tg level and the fto rs9939609 polymorphism . However, we did observe a relationship between the presence of the fto rs9939609 polymorphism and both ldl and tch concentrations . Our results indicated that the men with at least one allele of wild type had significantly lower levels of tch and ldl compared to the men with the tt (mutant) genotype . Probably, lipid concentrations result primarily from the lifestyle of middle - aged and older men, including a high - calorie diet and low physical activity . Carlos et al15 concluded that rs9939609 variant predisposes to obesity in portuguese population aged 1850 years . Woehning et al16 found that the polymorphism is linked to initial body weight, based on the results of their cross - sectional study in adults aged 1872 years . Liguori et al49 proved that in a population of obese subjects of italian origin, ta heterozygotes of rs9939609 are more prone to develop mets (or 2.53). A study by jacobsson et al50 finds no relationship between the fto rs9939609 polymorphism and bmi in elderly men from sweden, indicating that its contribution to the incidence of obesity decreases with age . Zavatarri et al51 showed no association between the fto rs9939609 polymorphism and the parameters of lipid metabolism and stressed that aa homozygotes are particularly predisposed to obesity . Population studies conducted by gustavsson et al52 on gothenburg residents confirmed that aa and ta genotypes have a greater wc and a higher bmi compared to tt genotype . All the aforementioned results stand in contrast to our findings, showing the lack of relationship between metabolic parameters and the fto rs9939609 polymorphism . It may have been due to the relatively small size of the group and the differences in selection of the participants in terms of age and gender . Our male population was aged between 50 and 75 years, while there is evidence that in people aged> 65 years, the relationship between the fto rs9939609 polymorphism and obesity is reduced, especially in men.53 with respect to the mc4r rs17782313 polymorphism, some researchers emphasize the role of c (wild - type) allele being associated with a higher risk for insulin resistance, t2 dm, and ht incidence, independently of bmi.54 the relation between the mc4r rs17782313 polymorphism and obesity was also described by xi et al.55 with regard to mets, the association with the mc4r rs17782313 polymorphism disappears after adjusting for wc, indicating that the association with mets is driven by the link with this factor,13 which shows that c allele may predispose to abdominal obesity . This is confirmed by our results where men with at least one c allele had a significantly higher wc, in addition to a higher bmi, although that difference was not statistically significant . Therefore, it can be assumed that the wild - type homozygous and heterozygous genotypes of mc4r rs17782313 polymorphism promote the accumulation of visceral fat . On the other hand, marcadenti et al14 found that mc4r rs17782313 is positively associated with neck circumference and bmi in women and negatively associated with bp in men . However, the study was conducted in non - caucasians, which makes the comparisons complicated . In this study, we found no statistically significant associations between the ppar rs1801282 polymorphism and mets, t2 dm, ht, overweight, obesity, and anthropometric and biochemical parameters in men aged between 50 and 75 years . On the other hand, tellechea et al30 found that in men from argentina, with the exception of caucasians, the rs1801282 polymorphism showed a relation with the occurrence of mets diagnosed using the criteria of the national cholesterol education program / adult treatment panel iii and with insulin resistance, especially in nonsmokers . However, those studies were conducted among younger men, so it can be assumed that environmental influences were lower . As in this study, milewicz et al56 did not observe any association between the studied ppar rs1801282 polymorphism and mets and metabolic parameters in postmenopausal women from poland . Also studies conducted on an ethnically diverse group of people (caucasian, south asian, and african american) did not show any association between the ppar rs1801282 polymorphism and mets.32 dytfeld and horst - sikorska29 highlighted the role of diet in metabolic disorders in patients with the ppar rs1801282 polymorphism and modification of the genotype by environmental factors, which can lead to diverse phenotypes . On the other hand, kruzliak et al31 conducted analyses in a group of> 1000 caucasians with t2 dm and proved that the homozygous slovene females with wild - type alleles had lower wc in comparison with homozygous females with mutated alleles . All in all, these findings were not replicated in this study, probably due to gender and age differences . In this study on men, we found no relationship between the fto rs9939609 polymorphism and the concentration of hormones dheas, e2, tst, fts, and shbg . In the available literature, we found no reports on the relationships between the fto rs9939609 and mc4r rs17782313 polymorphisms and the levels of sex hormones in men . In this study, we also found no such relations . Hainerov et al,57 based on the results of studies in young obese men with hypogonadism and g181d mutation in the mc4r gene, reported that obesity caused by the mutation in the mc4r rs17782313 polymorphism indirectly contributes to hormonal changes, as the adipose tissue is an active endocrine organ . In this study, we found no association between the ppar rs1801282 polymorphism and tst, fts, e2, dheas, and shbg concentrations, but the study included men aged> 50 years, in whom metabolic disorders are mainly the result of lifestyle . Studies of park et al58 in men have shown that the ppar polymorphisms play a significant role in tumorigenesis as a tumor suppressor and ppar agonists may have a beneficial effect in the treatment of prostate cancer . It is, therefore, necessary to conduct further studies on the possible associations between the ppar rs1801282 polymorphism and hypogonadism, prostatic hyperplasia, and prostate cancer . Some studies59,60 have demonstrated the importance of dietary factors and physical activity level for the development of mets . Lifestyle modification is effective in resolving mets and reducing the severity of related abnormalities (fpg, wc, sbp, dbp, and tg) in patients with mets.59 although it does not necessarily influence any given risk factor as much as dedicated drugs, its benefit lies in a moderate reduction in all the metabolic risk factors . Genetic factors in mets are still under investigation . Our results and other researchers findings show that metabolic disorders in middle - aged and elderly people, including mets and its components, are mainly the effect of lifestyle, including many years of improper eating habits and low physical activity, while genetic predisposition plays a much less significant role . Also in case of a singular snp within the gene, it may be difficult to fully explain the risk for metabolic disorders and related traits.61 this phenomenon may be linked to potential gene gene interactions . In case of singular snp, other modest - risk variants may be the origin of the risk or control the expression of the particular risk factor.62 on the other hand, if an snp may be an independent risk factor for a given clinical event, its effect can be observed with the passage of time . In complex diseases such as metabolic disorders, the effect of biallelic polymorphisms is most visible in the elderly, as the majority of independent environmental factors (eg, eating habits) remain at relatively stable levels . That is why this period of life is the most appropriate to observe the direct influence of genetic variation on the value of a given clinical parameter . Patients aged> 50 years, ie, those we studied in this research, are therefore the optimal group in this context . However, it must be remembered that this study had significant limitations, as we included patients who reported voluntarily and we did not exclude patients with extreme obesity . Due to the multitude of statistically insignificant results, we performed a post hoc power analysis using the g * power software.63 the power of tests, which showed no statistical significance, was below the recommended level of 0.8.64 on the other hand, tests showing statistical significance had an acceptable power, reaching as high as 0.84 . In our opinion, the small power of tests may be responsible for the great number of statistically insignificant results of the analysis . In order to increase the power of the tests, the sizes of the study groups would have to increase significantly . Besides, in a genetic association study, a reliable assessment of the prevalence of alleles increases with sample size (which means a greater number of alleles at a given locus). One should also take into account additional factors, such as the adopted model of inheritance, and especially the frequency of risk alleles at a given locus and the risk for the disease in a given population . In conclusion, a limited number of statistically significant results in this study may have been caused by the insufficient number of patients in the study, and thus the low power of statistical tests . The fto rs9939609 and mc4r rs17782313 gene polymorphisms have little significant relationships with metabolic health problems (t2 dm, ht, overweight and obesity, and lipid disorders) and do not result in androgen disorders in aging men . However, our results extend the knowledge on genotype susceptibility for metabolic disturbances in relation to a specific geographical area of residence.
Since the breakthrough discovery of the obligatory role of the vascular endothelial cells by furchgott and zawadzki in 1980, endothelial pathophysiology has been intensely investigated, and the term " endothelial dysfunction " has been referred to in the scientific literature over 50,000 times (pubmed search, may 2012). It is well known that the endothelial dysfunction is associated with aging, hypertension, atherosclerosis, and numerous other physiological and pathophysiological processes . Nitric oxide (no), prostacyclin, and endothelium - derived hyperpolarizing factor (epoxyeicosatrienoic acid) are the three major substances involved in the endothelium - dependent vasodilator pathways . The mechanism of endothelial dysfunction is largely due to the reduced bioavailability of endothelium - derived no by oxidative stress . Accordingly, the hallmark of endothelial dysfunction is impaired endothelium - dependent vasodilation, which is mediated by no . A free radical is defined as any species that contains one or more unpaired electrons . Reactive oxygen species (ros) is a collective term that includes both oxygen free radicals, such as superoxide (o2), hydroxyl (oh), peroxyl (roo), and hydroperoxyl (ho2) radicals, and certain non - radical oxidizing agents, such as hydrogen peroxide (h2o2), hypochlorous acid (hocl), and ozone (o3), that can be readily converted to free radicals . No and peroxynitrite (onoo) are the most relevant reactive nitrogen species in the cardiovascular system . Many studies have demonstrated that angiotensin - converting enzyme (ace) inhibitors have induced many beneficial effects on the endothelial function in animal models and humans, have improved the endothelial function in hypertension, and have reduced the risk associated with cardiovascular disease . There have been numerous attempts to decrease the major complications associated with cardiac surgery, and there is increasing evidence that ace inhibitors hold promise as protective cardiovascular agents for cardiac surgery patients . The mechanisms of the protective effects of ace inhibitors involve multiple factors, including those relating to their antioxidant effects . In several experimental studies, only sulfhydryl (sh)-containing ace inhibitors such as captopril and zofenopril exerted the endothelium protective effect, but in other studies, the non - sh - containing ace inhibitor also showed similar effects . Therefore, the present study was designed to evaluate the antioxidant effects of ace inhibitors with or without a sh group (captopril and enalapril, respectively) and to identify the involved mechanisms . All of the animal procedures were approved by the animal care and use committee of hanyang university . Twenty - five male new zealand white rabbits (koatech, pyeongtaek, korea) weighing between 2.0 and 2.5 kg were anesthetized with 3% to 5% sevoflurane in 4 l / min of 100% oxygen in a restraint chamber . The marginal ear vein was cannulated, and heparin (1,000 iu / kg) was administered intravenously . After 10 minutes, the rabbit was sacrificed by exsanguination from the carotid artery . The infrarenal abdominal aorta was carefully excised and placed in a petri dish filled with 4 krebs - henseleit solution of the following composition (mm): nacl 120.0, nahco3 25.0, kcl 5.0, nah2po4 1.4, mgso4 1.2, cacl2 2.5, and glucose 11.0 . The vessel was cleaned of fat and connective tissue with extreme caution not to damage the endothelium or smooth muscle . The vessel rings were mounted between two l - shaped steel hooks in water - jacketed (370.5) organ baths filled with 5 ml of krebs - henseleit solution . The medium was continuously gassed with a mixture of 95% of o2 and 5% of co2 throughout the experiment . The lower hook was fixed to the organ chamber, and the upper hook to the force transducer (tsd125c; biopac systems inc ., the isometric tension was continuously recorded on a personal computer with a data acquisition system (mp100 system, biopac systems inc .) Via a transducer amplifier (da100c, biopac systems inc . ). All the vessels were first equilibrated for 90 minutes, and the resting tension was set to 2 g gradually . During the equilibration period, the chamber medium was exchanged every 15 minutes . After the equilibration period, the endothelium integrity was assessed by precontracting the aortic ring with 10 m of norepinephrine (ne) and a subsequent relaxation with cumulative concentrations (310, 10, 310, and 10 m) of acetylcholine (ach). An aortic ring with an endothelial function (relaxation) greater than or equal to 80% was considered to have an intact endothelium, and was included in the experiment . A constant current of 15 ma was applied for 35 seconds using two circular platinum wire electrodes (each 7 mm in length) located at the bottom of the organ baths . The vessel ring was mounted over 1 cm apart from the electrodes to avoid direct electrical injury . At 15 minutes of equilibration after the pretest and medium exchange, various concentrations (10, 310, 10, and 310 m) of captopril or enalapril were added and incubated for 15 minutes . After exposure to ros generated by electrolysis, the medium was exchanged again . The contraction and relaxation curves changes of the aortic tone by ach were expressed as percentages, and they were used as the experimental values . Cu / zn superoxide dismutase (sod) and catalase, the two important antioxidant enzymes, were inhibited to investigate the mechanism of the antioxidant activity of captopril and enalapril . Diethyldithiocarbamate (detca) was used for cu / zn sod inhibition, and 3-amino-1,2,4-triazole (3at) for catalase inhibition . After the pretest and equilibration period (15 minutes), the vessels were pre - incubated with 0.5 mm of detca for 30 minutes or 50 mm of 3at for 60 minutes . Captopril (310 m) or enalapril (310 m) was added and incubated during the last 15 minutes of pre - incubation, and the vessel rings were then exposed to electrolysis - induced ros . After refreshing the medium, ne - induced contraction and the series of ach applications were then repeated . Ne, ach, captopril, enalapril, detca, and 3at were purchased from sigma - aldrich, inc . The responses to ach are expressed as the percentage of the ach - induced relaxation, in the same vessel, during the pretest . When appropriate, the student t - test or one - way analysis of variance (anova) followed by a post test for linear trend and the dunnett test were performed . All of the curve fittings and statistical analyses were performed using prism ver . 5.0 (graphpad software inc ., san diego, ca, usa). A p - value less than 0.05 twenty - five male new zealand white rabbits (koatech, pyeongtaek, korea) weighing between 2.0 and 2.5 kg were anesthetized with 3% to 5% sevoflurane in 4 l / min of 100% oxygen in a restraint chamber . The marginal ear vein was cannulated, and heparin (1,000 iu / kg) was administered intravenously . After 10 minutes, the rabbit was sacrificed by exsanguination from the carotid artery . The infrarenal abdominal aorta was carefully excised and placed in a petri dish filled with 4 krebs - henseleit solution of the following composition (mm): nacl 120.0, nahco3 25.0, kcl 5.0, nah2po4 1.4, mgso4 1.2, cacl2 2.5, and glucose 11.0 . The vessel was cleaned of fat and connective tissue with extreme caution not to damage the endothelium or smooth muscle . The vessel rings were mounted between two l - shaped steel hooks in water - jacketed (370.5) organ baths filled with 5 ml of krebs - henseleit solution . The medium was continuously gassed with a mixture of 95% of o2 and 5% of co2 throughout the experiment . The lower hook was fixed to the organ chamber, and the upper hook to the force transducer (tsd125c; biopac systems inc ., goleta, ca, usa). The isometric tension was continuously recorded on a personal computer with a data acquisition system (mp100 system, biopac systems inc .) Via a transducer amplifier (da100c, biopac systems inc . ). All the vessels were first equilibrated for 90 minutes, and the resting tension was set to 2 g gradually . During the equilibration period, the chamber medium was exchanged every 15 minutes . After the equilibration period, the endothelium integrity was assessed by precontracting the aortic ring with 10 m of norepinephrine (ne) and a subsequent relaxation with cumulative concentrations (310, 10, 310, and 10 m) of acetylcholine (ach). An aortic ring with an endothelial function (relaxation) greater than or equal to 80% a constant current of 15 ma was applied for 35 seconds using two circular platinum wire electrodes (each 7 mm in length) located at the bottom of the organ baths . The vessel ring was mounted over 1 cm apart from the electrodes to avoid direct electrical injury . At 15 minutes of equilibration after the pretest and medium exchange, various concentrations (10, 310, 10, and 310 m) of captopril or enalapril were added and incubated for 15 minutes . After exposure to ros generated by electrolysis, the medium was exchanged again . The contraction and relaxation curves changes of the aortic tone by ach were expressed as percentages, and they were used as the experimental values . Cu / zn superoxide dismutase (sod) and catalase, the two important antioxidant enzymes, were inhibited to investigate the mechanism of the antioxidant activity of captopril and enalapril . Diethyldithiocarbamate (detca) was used for cu / zn sod inhibition, and 3-amino-1,2,4-triazole (3at) for catalase inhibition . After the pretest and equilibration period (15 minutes), the vessels were pre - incubated with 0.5 mm of detca for 30 minutes or 50 mm of 3at for 60 minutes . Captopril (310 m) or enalapril (310 m) was added and incubated during the last 15 minutes of pre - incubation, and the vessel rings were then exposed to electrolysis - induced ros . After refreshing the medium, ne - induced contraction and the series of ach applications were then repeated . Ne, ach, captopril, enalapril, detca, and 3at were purchased from sigma - aldrich, inc . The responses to ach are expressed as the percentage of the ach - induced relaxation, in the same vessel, during the pretest . When appropriate, the student t - test or one - way analysis of variance (anova) followed by a post test for linear trend and the dunnett test were performed . All of the curve fittings and statistical analyses were performed using prism ver . 5.0 (graphpad software inc ., san diego, ca, usa). A p - value less than 0.05 in a dose - dependent manner, the captopril - treated vessel rings preserved ach - induced endothelium - dependent relaxation against the ros attack (fig . 1). At the highest concentration (10 m) of ach, the 10, 310, 10, and 310 m captopril treated groups showed a relaxation rate of 1.9%1.2%, 81.2%1.9%, 86.0%2.1%, and 89.1%0.8%, respectively (n=15 for each group; anova and post test for linear trend; both p<0.0001). The treatment of enalapril showed a similar effect (fig . The 10, 310, 10, and 310 m enalapril - treated groups had relaxation rates of 1.8%1.2%, 10.0%2.1%, 73.9%5.7%, and 89.1%0.8%, respectively (n, 13 to 15; anova and post test for linear trend; both p<0.0001). The relaxation rate of the detca+captopril group was significantly lower than the control (captopril - only) group after the ros attack (73.0%2.4% vs. 86.8%1.1%; n=15; p<0.0001) (fig . Detca exerted the same effect with enalapril (73.0%2.4% vs. 86.8%1.1%; n=15; p<0.0001) (fig ., 3at pretreatment did not alter the relaxation rate of the captopril - treated group nor the enalapril - treated group (fig . In a dose - dependent manner, the captopril - treated vessel rings preserved ach - induced endothelium - dependent relaxation against the ros attack (fig . 1). At the highest concentration (10 m) of ach, the 10, 310, 10, and 310 m captopril treated groups showed a relaxation rate of 1.9%1.2%, 81.2%1.9%, 86.0%2.1%, and 89.1%0.8%, respectively (n=15 for each group; anova and post test for linear trend; both p<0.0001). The treatment of enalapril showed a similar effect (fig . The 10, 310, 10, and 310 m enalapril - treated groups had relaxation rates of 1.8%1.2%, 10.0%2.1%, 73.9%5.7%, and 89.1%0.8%, respectively (n, 13 to 15; anova and post test for linear trend; both p<0.0001). The relaxation rate of the detca+captopril group was significantly lower than the control (captopril - only) group after the ros attack (73.0%2.4% vs. 86.8%1.1%; n=15; p<0.0001) (fig . Detca exerted the same effect with enalapril (73.0%2.4% vs. 86.8%1.1%; n=15; p<0.0001) (fig ., 3at pretreatment did not alter the relaxation rate of the captopril - treated group nor the enalapril - treated group (fig . In the present study, both captopril and enalapril exerted an antioxidant effect against the electrolysis - induced ros in the rabbit aortic rings . This antioxidant effect was partially reduced by detca pretreatment, but it was not affected by 3at pretreatment . Ach - induced vasorelaxation requires the integrity of the vascular endothelium, thus " endothelium - dependent " relaxation . Ach binds to the muscarinic receptor of the endothelial cell, and the intracellular calcium level increases, which leads the endothelial nitric oxide synthase (enos) to produce no . The produced no diffuses to the vascular smooth muscle cell, and it activates the soluble guanylyl cyclase, which eventually converts the guanosine triphosphate to cyclic guanosine monophosphate (gmp) inducing smooth muscle relaxation . In addition, the cyclooxygenase (cox) pathway producing prostacyclin is also related to the endothelium - dependent vasorelaxation . The endothelium is a major regulator of vascular homeostasis that maintains the balance between vasodilation and vasoconstriction, inhibition and promotion of the proliferation and migration of smooth muscle cells, prevention and stimulation of the adhesion and aggregation of platelets, as well as thrombogenesis and fibrinolysis . Upsetting this balance leads to endothelial dysfunction and damage to the arterial wall . These homeostatic effects are largely mediated by no, a pivotal endothelium - derived substance . No is a diffusible substance with a half - life of a few seconds, and it is formed from l - arginine by oxidation of the guanidine - nitrogen terminal . Vascular endothelial cells normally generate ros as " second messengers " that might regulate endothelial cell growth and proliferation, endothelial barrier function, vasorelaxation, and vascular remodeling . Ros production has been known to occur in the endothelium, but also within the media and adventitia, all of which may impair no signaling within vascular tissue to endothelium - dependent and endothelium - independent vasodilators . Superoxide anion can be generated by various enzymes such as nicotinamide adenine dinucleotide phosphate oxidase, xanthine oxidase, cox, no synthase, lipoxygenase, cytochrome p450 monooxygenases, and enzymes of the mitochondrial respiratory chain . Superoxide anion and transition metals such as iron and copper react with hydrogen peroxide to form highly reactive hydroxyl radicals through the fenton reaction (fe+h2o2fe+oh+oh) and the haber - weiss reaction (o2+h2o2oh+oh+o2). No and superoxide anion rapidly interact to form peroxynitrite, a potent oxidant also capable of oxidizing sh groups and thioethers, as well as nitrating and hydroxylating aromatic groups, including tyrosine, tryptophan, and guanine . At high concentrations, peroxynitrite is cytotoxic and may cause oxidative damage to proteins, lipids, and dna . Oxidative stress, however, may cause endothelial dysfunction or cell death through various pathways . Superoxide anions reduce the bioavailability of no and directly inhibit its main target: soluble guanylyl cyclase . The major target of ros is no, but the resultant formation of peroxynitrite also causes endothelial dysfunction by oxidation of the zn - thiolate complexes within enos and the essential cofactor tetrahydrobiopterin (bh4). As a result of the oxidation of bh4, enos becomes " uncoupled " and produces ros rather than no . In addition, peroxynitrite inhibits guanylyl cyclase, inactivates the prostacyclin synthase by tyrosine nitration, and further enhances oxidative stress by inhibiting sod . Hydroxyl radicals, another ros, can induce cell damage through the peroxidation of lipids and sh groups . On the other hand, oxidative stress can also induce apoptosis of endothelial cells by activation of apoptosis signal - regulating kinase 1 and c - jun n - terminal kinase . In the present study, we used the buffer solution electrolysis method to produce the oxidative stress to the vascular rings . The ros generation system by electrolysis of a physiological salt solution has the advantage that a wide range of ros are produced without addition of enzymes or chemicals, which themselves may influence the experiment . Furthermore, the short duration of exposure to ros allows the measurement of responses to various drugs, without the continuous inactivation of no or the possible oxidation of drugs by ros . This electrolysis system generates superoxide anions, hydroxyl radicals, hydrogen peroxide, singlet oxygen, and hypochlorite . The endothelium - dependent vasorelaxation is almost completely abolished by exposure to ros . In the present study, endothelium - dependent vasorelaxation was severely compromised in the aortic rings with low concentrations of captopril or enalapril pretreatment . The vasoconstrictor response to 1 adrenoceptor stimulation is impaired by exposure to ros . Because we used ne for preconstriction of the vessels in the present experiment, we applied a duration and intensity (35 seconds and direct current 15 ma, respectively) of constant current electrolysis that compromised endothelium - dependent vasorelaxation but did not affect ne - induced vasoconstriction . The predominant isoform cu / zn sod is inhibited by the cu chelator detca . In the present study, this represents that superoxide anion scavenging activity is related to the mechanism of the antioxidant effect of captopril and enalapril . Hydrogen peroxide is scavenged by catalase, and this enzyme is inhibited by 3at . In the present experiment, pretreatment with 3at did not affect the antioxidant effect of captopril and enalapril, suggesting that their endothelium protective effect is not associated with hydrogen peroxide scavenging action . Many researchers have reported that only sh - containing ace inhibitors possess an antioxidant effect [10,24 - 26]. The sh moiety easily undergoes oxidation and disulfide exchange reactions and can be converted into disulfides through the interaction with free radicals . By this process, it can serve as a free radical scavenger, thereby protecting the endothelial function . On the other hand, some investigators have reported that non - sh - containing ace inhibitors also exerted an endothelium protective effect against free radical injury . It was reported that ramiprilat, a non - sh - containing ace inhibitor, protects against free radical injury in isolated working rat hearts . The investigators explained that ramiprilat inhibits free radical - induced damages mainly by stimulation of prostacyclin synthesis and/or release, because their data showed that the addition of indomethacin (5 mol / l) completely abolished the protective effects of ramiprilat . This interpretation seems confusing, however, because in a later study it was demonstrated that cox inhibitors, such as indomethacin, possess antioxidant properties . In another experiment concerning this issue by fujita et al ., they found that quinaprilat, a non - sh - containing ace inhibitor, could ameliorate both apoptosis and necrosis through the up - regulation of constitutive enos via an increase of bradykinin, with the resulting increase of nitric oxide in the cultured human aortic endothelial cells . The b2 receptor is constitutively expressed, but the b1 receptor is normally absent and is only induced under inflammatory conditions in humans . Rabbit blood vasculature, however, is rich in b1 receptor sites; hence, this difference between species should be considered when interpreting the results . One limitation of the present study is that the amount of ros generated by electrolysis could not be measured due to the lack of methodologies . A device that can measure the real - time amount of ros in the vicinity of the electrodes would be beneficial . This method may offer clues for elucidating the exact ros composition ratio in the electrolyzed buffer solution . It remains to be investigated whether other ace inhibitors, with or without a sh group, also protect endothelium against ros . Further studies on prostacyclin inhibition without any interactions with ros may clarify the relevance of prostacyclin in the endothelium protective effects of ace inhibitors . Performing these studies would more clearly explain the exact mechanism of the known beneficial effects of ace inhibitors in cardiac surgery patients . Both captopril (a sh - containing ace inhibitor) and enalapril (a non - sh - containing ace inhibitor) protect endothelium against free radical injury in a dose - dependent manner in isolated rabbit abdominal aortas.
Rehabilitation nutrition is a combination of both rehabilitation and nutrition care management, and this concept is used with international classification of functioning, disability and health guidelines to evaluate nutrition status and to maximize functionality in the elderly and other people with disability . Rehabilitation nutrition may further improve physical and mental function, activities of daily living, and quality of life . The term rehabilitation nutrition is quite different from that of nutritional rehabilitation . In contrast, rehabilitation nutrition not only refers to nutritional improvement but also to rehabilitation in people with disability [1, 2]. The key aims of rehabilitation nutrition assessment are to assess the following: (1) the presence and cause of malnutrition; (2) the presence and cause of sarcopenia; (3) the presence and cause of dysphagia; (4) the adequacy of nutrition care management with prediction of future nutritional status; and (5) whether rehabilitation for functional improvement, such as resistance training and endurance training, can be conducted . The prevalence of malnutrition in rehabilitation settings is high . In elderly patients hospitalized for rehabilitation, the prevalence of compromised nutrition status was estimated to be 4967% . In australia, 33 and 51.5% of patients admitted to rehabilitation hospitals were classified as malnourished and at nutritional risk using the mini nutritional assessment (mna) and the mna short - form (mna - sf). One study using pooled mna data found that the prevalence of malnutrition in elderly people was highest in rehabilitation settings (rehabilitation, 50.5%; hospital, 38.7%). Another study using the mna - sf revealed a 40.8% prevalence of malnutrition in rehabilitation settings . A systematic review found that malnutrition in older adults admitted for rehabilitation has a negative effect on functional recovery and quality of life following discharge to the community . Furthermore, rehabilitation outcome has been shown to be poor in malnourished patients with stroke, hip fracture, hospital - associated deconditioning [10, 11], and a variety of other diseases . The prevalence of sarcopenia in rehabilitation settings is also high: 1030% in community - dwelling elderly and 40% in ambulatory rehabilitation facility - dwelling elderly 60 years and older . Another study revealed that 46.5% patients admitted to a subacute geriatric care unit who underwent a rehabilitation intervention met the diagnostic criteria for sarcopenia . The european working group on sarcopenia in older people categorized sarcopenia into primary sarcopenia (age - related sarcopenia) and secondary sarcopenia (i.e., activity-, disease-, or nutrition - related sarcopenia). Assessment of the multifactorial causes of primary and secondary sarcopenia is indispensable because rehabilitation nutrition for sarcopenia differs depending on its etiology . Treatment of age - related sarcopenia includes resistance training, protein and amino acid supplementation, smoking cessation, and pharmaceutical therapies [16, 17]. Pharmaceutical therapy of sarcopenia is likely to advance in the near future because our understanding of the role of regulators in sarcopenia has increased [18, 19]. Early ambulation, exercise, and avoiding bed rest are important for preventing and treating activity - related sarcopenia . Treatment of disease - related sarcopenia includes therapies for advanced organ failure, inflammatory disease, malignancy, and endocrine disease, while treatment of nutrition - related sarcopenia includes appropriate nutrition management to increase muscle mass [16, 17]. In cases of age-, activity-, disease-, and nutrition - related sarcopenia, stroke, hip fracture, and hospital - associated deconditioning are major causes of disability in inpatient rehabilitation facilities . In the usa, the six largest diagnostic impairment categories receiving inpatient rehabilitation include stroke, lower extremity fracture, lower extremity joint replacement, debility, neurologic disorders, and brain dysfunction . Hip fracture is a leading cause of disability in lower extremity fracture patients, and debility is synonymous with hospital - associated deconditioning . In japan, common causes of inpatient rehabilitation in convalescent rehabilitation wards are stroke (47.9%); orthopedic diseases, including hip fracture (35.2%); disuse syndrome (10.5%); and traumatic brain and spinal cord injury (5.4%). These data indicate that management of patients with stroke, hip fracture, and hospital - associated deconditioning is an important part of inpatient rehabilitation . The term sarcopenic dysphagia refers to difficulty swallowing due to sarcopenia of generalized skeletal muscles and swallowing muscles [22, 23]. Age - related loss of the tongue and geniohyoid muscle mass has been studied in the elderly [24, 25]. Sarcopenic dysphagia is an important current and future public health issue, because it is common in the elderly and can lead to aspiration pneumonia, the prevalence of which is increasing with the aging of society . Therefore, we review rehabilitation nutrition for stroke, hip fracture, hospital - associated deconditioning, and sarcopenic dysphagia, and then assess the level of research interest in rehabilitation nutrition . More than 60% of patients remain disabled, 50% of patients suffer from hemiparesis, and 30% remain unable to walk without assistance . As the benefits of rehabilitation are beyond doubt, rehabilitation strategies play center stage in optimizing functional recovery after stroke [27, 28]. Both malnutrition and obesity are nutritional problems in stroke . According to a recent systematic review, malnutrition and dysphagia respectively occur in 8.249.0% and 24.352.6% of subjects following stroke . In subgroup analysis, the odds of malnutrition were significantly increased during the rehabilitation stage (odds ratio (or), 2.445; 95% confidence interval (ci), 1.0095.925). Tissue wasting, sarcopenia, and cachexia may impair and delay poststroke rehabilitation and worsen the prognosis, and increasing evidence suggests that patients who are overweight and mildly obese may actually have a better outcome . Analysis of data from the china national stroke registry on patients grouped according to their body mass index (bmi) into underweight (<18.5 kg / m), normal weight (18.522.9 kg / m), overweight (2327.4 kg / m), obese (27.532.4 kg / m), or severely obese (32.5 kg / m) found that overweight was independently associated with favorable 3-month functional recovery (or, 1.24; 95% ci, 1.121.38), but severe obesity was independently associated with higher 3-month mortality (or, 2.01; 95% ci, 1.103.69). In stroke patients admitted to a rehabilitation hospital, the underweight group had the lowest functional independence measure (fim) efficiency, followed by the obese and normal - weight subgroups . The overweight group had the highest fim efficiency (p = 0.05) when compared with the obese subgroup . These results indicate that outcome is better in overweight stroke patients than in underweight stroke patients . Skeletal muscles are the main effector organs impacted by disability in stroke, but little attention is paid to structural, metabolic, and functional alterations of muscle tissue after stroke [27, 28]. Stroke - induced sarcopenia is difficult to differentiate from hemiparesis in terms of evaluating muscle strength and physical performance . Therefore, diagnosis of stroke - induced sarcopenia is a challenging task . In a systematic review of loss of skeletal muscle mass after stroke, lean tissue mass was significantly less in the paretic than the nonparetic lower limb (median, 342.3 g; 95% ci, 247.0437.6 g) and upper limb (median, 239.9 g; 95% ci, 181.7298.2 g), and midthigh muscle cross - sectional area (median, 15.4 cm; 95% ci, 13.816.9 cm) was significantly less in individuals at least 6 months poststroke . Mechanisms of muscle wasting in stroke - related sarcopenia include disuse atrophy, spasticity, inflammation, denervation, reinnervation, impaired feeding, and intestinal absorption . A randomized study comparing intensive nutritional supplementation to routine nutritional supplementation was performed in 116 undernourished stroke inpatients . Compared with those on standard nutritional supplements, patients receiving intensive nutritional supplementation improved more on measures of motor function (total fim, fim motor subscore, 2 and 6-min timed walk tests, p <0.002). In a randomized, controlled trial comparing routine care with individualized, nutritional care aiming to prevent weight loss in acute stroke patients at nutritional risk, 20.7% of the intervention group lost 5% weight compared with 36.4% of the control group (p = 0.055) at follow - up . The intervention group had a significantly higher increase in qol score (p = 0.009) and in handgrip strength (p = 0.002). In a cochrane database of systematic review, nutritional supplementation in acute and subacute stroke was associated with reduced frequency of pressure sores (or: 0.56; 95% ci: 0.320.96), and increased energy intake (mean differences (md), 430.18 kcal / day; 95% ci, 141.61718.75) and protein intake (md, 17.28 g / day; 95% ci, 1.9932.56). These results indicate that nutrition support for stroke rehabilitation patients at malnutrition or nutritional risk seems to improve nutrition intake and rehabilitation outcome . Hip fractures are associated with more disability, health care costs, and mortality than all other osteoporotic fractures combined . In 2005, hip fractures in the usa were estimated to account for 14% of total fractures but 72% of total fracture - related health care costs . Compared with its pre - fracture level, post - fracture function is deteriorated in 60% of patients with hip fracture . The demographic trend worldwide is that more and more people are suffering from hip fracture . The number of hip fractures is expected to rise from 1.6 million in 2000 up to 6.3 million in 2050 . Malnutrition prevalence was lowest when assessed by bmi (13%), followed by mna - sf (27%), international classification of disease, 10th revision, australian modification (icd10-am) (48%), albumin (53%), and geriatrician individualized assessment (55%). Malnutrition prevalence in hip fracture was 37.5% using icd10-am criteria in another study . Nutrition status assessed by mna in one hip fracture study revealed that 8.8% of elderly patients were undernourished, 43.7% at risk of malnutrition, and 47.5% well - nourished . Nutrition status in another hip fracture study revealed that 11.6% were malnourished, 44.2% at risk of malnutrition, and 44.2% were well - nourished . Serum albumin level (p = 0.0004; or, 5.8541) and bmi (p = 0.0192; or, 1.1693) significantly influenced mortality after hip fracture . Malnutrition and being at risk for malnutrition are common in patients with hip fracture and seem to affect rehabilitation outcome . The prevalence of sarcopenia in patients with hip fracture is high . In the sarcopenia and hip fracture study, another study in women with hip fracture revealed that 58% were sarcopenic . Using normative data from the new mexico elder health study, 64.0% of female hip fracture inpatients and 95.0% of male hip fracture inpatients admitted to rehabilitation wards had sarcopenia . Analysis of other data revealed that 21.8% of female hip fracture patients and 86.7% of male hip fracture patients had sarcopenia . In 357 japanese patients immediately after hip fracture, 44.7% of women and 81.1% of men had sarcopenia, and the presence of sarcopenia was independently associated with the occurrence of hip fracture . On the other hand, only 4 of the 71 hip fracture patients (5.6%) a cochrane database systematic review of nutritional supplementation in elderly patients with hip fracture found weak evidence for the effectiveness of protein and energy supplements . One trial of multinutrient intravenous feeding followed by oral supplements found a reduction in the number of participants with complications (rr, 0.21; 95% ci, 0.100.46), but not in mortality rate (rr, 0.11; 95% ci, 0.012.00). A controlled prospective cohort study in patients with hip fracture found a significant association of multidisciplinary postoperative nutritional care with a decline in the number of malnourished patients and a decline in the euroqol (p = 0.004) after 3 months of the intervention . In a randomized, controlled study, nutritional support actively supervised by a dietician and guided by repeated measurements of resting energy requirements was achievable and improved outcomes in geriatric patients following surgery for hip fractures . Multidisciplinary nutritional care reduced nutritional deterioration during admission (5.4 vs. 20.5%; p = 0.049), and increased the rate of discharge directly back to the community (48.0 vs. 17.6%; p = 0.012) in a pragmatic intervention study . A high - protein nutritional intervention - based study on -hydroxy--methylbutyrate, vitamin d3, and calcium in obese and lean aged patients with hip fractures and sarcopenia will be implemented . These results indicate that nutrition support for hip fracture patients may improve nutrition status and rehabilitation outcome . Hospital - associated deconditioning is characterized by the functional decline that occurs during acute hospitalization due to illness or injury, or both, and is unrelated to a specific neurological or orthopedic insult, or both . Several concepts have been proposed to explain the consequences of inactivity and disuse in the hospital, and include debility, disuse syndrome [10, 21], hospital - associated deconditioning [11, 55], hospitalization - associated disability, and post - hospital syndrome . During hospitalization, patients are commonly deprived of sleep, experience disruption of normal circadian rhythms, are nourished poorly, have pain and other discomfort, confront a baffling array of mentally challenging situations, receive medications that can alter cognition and physical function, and become deconditioned by bed rest or inactivity . Hospitalization - associated disability occurs in approximately one - third of patients older than 70 years of age and may be triggered even when the illness that necessitated the hospitalization is successfully treated . Malnutrition is associated with poor rehabilitation outcome in hospital - associated deconditioning . In an acute rehabilitation setting, obese patients with deconditioning show greater improvement in fim scores, compared with patients whose bmi is in the normal range or lower (bmi 18.5). This lower bmi group shows the smallest increase in fim motor scores with rehabilitation . In elderly patients with deconditioning, admission norton scale scores were correlated with discharge walking fim scores (r = 0.32; p = 0.003), discharge transfer fim scores (r = 0.30; p = 0.005), and length of rehabilitation (r = 0.37; p <0.0001). In our previous prospective cohort study, 87.6% of patients were malnourished, 12.4% were at risk for malnutrition, and there were none with normal nutritional status . In multiple regression analysis, the mna - sf score, albumin level, and cachexia status were significantly associated with the barthel index score at discharge . These results indicated that patients with hospital - associated deconditioning may experience not only activity - related sarcopenia but also nutrition - related and disease - related sarcopenia . Nutrition management and sarcopenia treatment in patients with hospital - associated deconditioning may lead to improvement of disability, although further studies are required . Sarcopenic dysphagia is characterized by the loss of swallowing muscle mass and function associated with generalized loss of skeletal muscle mass and function . The prevalence of dysphagia has been reported to be 11.438% in community - dwelling elderly individuals [6064] and 4068% in nursing home residents [6567]. Dysphagia management is important because dysphagia is common in the elderly and increases the risk of related complications such as aspiration pneumonia, choking, dehydration, malnutrition, and a lower quality of life following the loss of the joy of eating . Furthermore, sarcopenic dysphagia is not only the result of aspiration pneumonia, but also an important cause of recurrent aspiration pneumonia . Age - related loss of swallowing muscles has been studied [24, 25]. Swallowing muscles include the intrinsic muscle of the tongue and the mimic, masticatory, suprahyoid, infrahyoid, palatal, pharyngeal, and esophageal muscles . Tamura et al . Evaluated thickness of the central part of the tongue in the elderly using ultrasonography and showed mid - arm muscle area and age were associated independently with tongue thickness . These results indicate that tongue muscle mass is associated with generalized skeletal muscle mass and aging . A decrease in the cross - sectional area of the geniohyoid muscle has been shown to occur with increasing age, with this area being significantly smaller in aspirators compared with non - aspirators, but only in older men . These findings suggest that geniohyoid muscle atrophy may be a component of decreased swallowing safety and aspiration in older adults with presbyphagia or frailty of swallowing . Mid - upper arm circumference and calf circumference were correlated with dysphagia [22, 68]. The circumference of the mid - upper arm in older japanese adults with suspected swallowing disorders was correlated significantly with swallowing function . It is likely that the general reduction in lean body mass, including the swallowing muscle mass, is responsible for the association between mid - upper arm circumference and swallowing function, and indicates the presence of sarcopenic dysphagia . Another study revealed that swallowing measures had significant correlations with the functional and nutritional measures including serum albumin levels, mid - upper arm circumference, and calf circumference but not with age . Given that sarcopenia is exacerbated by disease, inactivity, and malnutrition, sarcopenia involving the swallowing muscle mass and its function may account for this result . Malnutrition results in both increased adductor pollicis muscle fatigability and an altered pattern of muscle contraction and relaxation which are reversible by nutritional supplementation . However, deglutition muscles that have a moderate to high percentage of type ii fibers may be among the first to atrophy at malnutrition because malnutrition affects type ii muscle fibers to a much greater extent than it does type i fibers [69, 70]. Furthermore, malnutrition was associated with dysphagia and head lifting strength which reflects the strength of the suprahyoid muscles in frail older adults . Therapy for sarcopenic dysphagia includes dysphagia rehabilitation, treatment of sarcopenia, and nutrition improvement . The core components of dysphagia rehabilitation are oral health care, rehabilitative techniques, and food modification . Therefore, nutrition management to increase muscle mass is indispensable for sarcopenic dysphagia rehabilitation, and the concept of rehabilitation nutrition is useful . Further research on sarcopenic dysphagia is required, although consensus diagnostic criteria for sarcopenic dysphagia have been proposed . We searched seven major rehabilitation journals cited in the article publishing in physical and rehabilitation medicine and indexed by pubmed . These rehabilitation journals were the archives of physical medicine and rehabilitation, clinical rehabilitation, journal of rehabilitation medicine, the european journal of physical and rehabilitation medicine, the american journal of physical medicine and rehabilitation, disability and rehabilitation, and international journal of rehabilitation research . Of 24,214 pubmed entries for these seven journals, 185 (0.8%) and 8 (0.03%), respectively, contained the words nutrition and sarcopenia on 25 april 2014 (table 1). Four articles (one editorial and three reviews) published in the european journal of physical and rehabilitation medicine contained the word sarcopenia and were about sarcopenia and muscular modifications in disabling pathologies [7477]. Though the importance of nutrition in rehabilitation was already recognized in the 1940s, interest in nutrition and sarcopenia in rehabilitation medicine has remained very low.table 1number of pubmed entries retrieved in a search of seven rehabilitation journals for the terms nutrition and sarcopenia . Accessed on 25 april 2014 from www.pubmed.gov journal nametotal no . Of entriesnutritionsarcopeniaarchives of physical medicine and rehabilitation11,856962clinical rehabilitation1,768101journal of rehabilitation medicine1,49960european journal of physical and rehabilitation medicine52355american journal of physical medicine and rehabilitation3,123300disability and rehabilitation3,638270international journal of rehabilitation research1,807110total24,214185 (0.8%) 8 (0.03%) number of pubmed entries retrieved in a search of seven rehabilitation journals for the terms nutrition and sarcopenia . Accessed on 25 april 2014 from www.pubmed.gov in japan, interest in rehabilitation nutrition has increased in recent years . Using the japan medical abstracts society database, we searched for articles in four major japanese rehabilitation journals including the japanese journal of rehabilitation medicine, sogo rihabiriteshon, journal of clinical rehabilitation, and medical rehabilitation . Of the 38,898 entries of these four journals, 1092 (2.8%) and 55 (0.1%), respectively, contained the words nutrition and sarcopenia on 25 april 2014 (table 2). When the search was limited to entries after 2010, 4.4 and 0.7%, respectively, contained the words nutrition and sarcopenia.table 2number of japan medical abstracts society database entries retrieved in a search of four japanese rehabilitation journals for the words nutrition and sarcopenia . Accessed on 25 april 2014 from http://www.jamas.or.jp/about/english.html entire periodfrom 2010journal nametotalnutritionsarcopeniatotalnutritionsarcopeniathe japanese journal of rehabilitation medicine24,457545174,41913615sogo rihabiriteshon7,75913681,100315journal of clinical rehabilitation4,6021809839538medical rehabilitation2,080231217789720total38,8981,092 (2.8%) 55 (0.1%) 7,136317 (4.4%) 48 (0.7%) number of japan medical abstracts society database entries retrieved in a search of four japanese rehabilitation journals for the words nutrition and sarcopenia . Accessed on 25 april 2014 from http://www.jamas.or.jp/about/english.html we established the japanese association of rehabilitation nutrition in 2011; its membership in april 2014 had increased to more than 3300 people and included physical therapists, registered dietitians, speech - language - hearing therapists, etc . Moreover, 629 people attended the 3rd congress of the japanese association of rehabilitation nutrition held in 2013 . Interest in rehabilitation nutrition is increasing in japan because of the emergence of a rapidly aging society, high number of convalescent rehabilitation beds, and high number of nutrition support teams in hospitals . The aging rate in japan is the highest in the world (i.e., 25.1% in october 2013). The number of convalescent rehabilitation beds available under the japanese medical insurance system has increased since 2000 to 68,316 in march 2014 . These data suggest that the number of disabled elderly with malnutrition and sarcopenia is increasing at an accelerated pace . The number of hospitals that have nutrition support teams certified by the japan council for nutritional therapy was 1001 in 2013 . Many physical therapists, occupational therapists, and speech - language - hearing therapists are actively involved in nutrition support teams and interested in nutrition care management . Collaborative studies of rehabilitation nutrition have been undertaken by the japanese association of rehabilitation nutrition . Furthermore, the japanese society for sarcopenia, cachexia and wasting disorders was established in 2014 . Further, more focused, research on rehabilitation nutrition will be needed because the number of elderly with disability is expected to increase in developed countries as the population ages [79, 80]. The prevalence of malnutrition and sarcopenia in physically disabled elderly patients who undergo rehabilitation is high . In contrast, the amount of research focused on nutrition and sarcopenia in rehabilitation medicine is very low . The major causes of disability in inpatients of rehabilitation facilities, including stroke, hip fracture, and hospital - associated deconditioning, are often complicated by malnutrition and sarcopenia . Sarcopenic dysphagia is common in the elderly population and is not only the result of aspiration pneumonia, but also an important cause of recurrent aspiration pneumonia . Because primary and secondary sarcopenia often coexist in people with disability, rehabilitation nutrition can be used to improve their functionality (fig . 1). Further studies on rehabilitation nutrition are important in a rapidly aging society, where the number of elderly with disability is expected to increase.fig . Frail elderly with stroke or hip fracture becomes sarcopenia with disability because of hemiparesis, dysphagia, immobilization, catabolism due to acute inflammation, and undernutrition . Rehabilitation for hemiparesis, dysphagia, immobilization, and nutrition care management for catabolism due to acute inflammation and undernutrition are usually provided separately . Sarcopenia with disability induces sarcopenic dysphagia which is characterized by the loss of swallowing muscle mass and function associated with generalized loss of skeletal muscle mass and function . Rehabilitation nutrition can be used to improve functionality in people with sarcopenic dysphagia and sarcopenia with disability mechanism of sarcopenia with disability in frail elderly with stroke and hip fracture . Frail elderly with stroke or hip fracture becomes sarcopenia with disability because of hemiparesis, dysphagia, immobilization, catabolism due to acute inflammation, and undernutrition . Rehabilitation for hemiparesis, dysphagia, immobilization, and nutrition care management for catabolism due to acute inflammation and undernutrition are usually provided separately . Sarcopenia with disability induces sarcopenic dysphagia which is characterized by the loss of swallowing muscle mass and function associated with generalized loss of skeletal muscle mass and function . Rehabilitation nutrition can be used to improve functionality in people with sarcopenic dysphagia and sarcopenia with disability
Presentations vary, complications differ and yet, management remains the same, which is removal . Nothing galvanizes the team as when the code for a foreign body (fb) is communicated, especially if the case is a kid where such situation is usually encountered . Presentation is acute in vegetable foreign body aspiration, especially in kids of age group 1 - 3 years, with new onset wheeze, breathlessness or fever . It tends to be less dramatic in non - organic foreign bodies unless there is lung collapse or involvement of trachea . Occasionally non - organic fb can be retained for years with bizarre presentation, which can be mistaken for endobronchial tumors or bronchiectasis . Such fb is a cause for a significant heartburn to both the patient and treating physician as unless it is removed it causes chronic symptoms and leads to irreversible damage . The case of interest is one such with the diagnosis missed for over 14 years . A 16-year - old male was diagnosed with bronchial asthma since childhood, had recurrent hospital admissions with exacerbations . Patient reported a recent worsening of symptoms for the last year for which he was evaluated and chest radiology revealed left lower lobe collapse . He was taken up for a bronchoscopy, which revealed a web - like stenosis of distal left main stem bronchus with a residual lumen of about 4 mm [figure 1] and in view of small residual lumen an ultrathin pediatric bronchoscope (olympus bf type 3c160) was used . Bronchoscope could be negotiated past the stenotic segment and to our surprise found a freely mobile object moving between upper and lower lobes with each breath [figure 2]. Patient was questioned after the procedure regarding history of aspiration and he denied recollecting any incident . Whistle was blown when the patient's father said that the patient had aspirated a whistle or part of one when he was about 2 years of age . He had a violent bout of cough for which he was evaluated and suspected whistle was removed . Now with the diagnosis clear, patient was taken up for rigid bronchoscopy, intubated with size 6 ventilating tracheobronchosope and bevel was positioned at distal left main bronchus . Flexible bronchoscope was introduced through this conduit and mercedes benz like peripheral cuts given using eletrocautery knife to the web like stenosis [figure 3]. Serial balloons introduced across the stenotic segment and gradually dilated up to 10 mm, bronchoscope negotiated beyond to visualize the foreign body . The fb was extracted using cryoprobe introduced through the channel of flexible bronchoscope [figures 4 and 5]. The fb turned out to be a piece of plastic probably part of the whistle aspirated 14 years back [figure 6]. Stenosis at distal left main stem bronchus foreign body beyond stenosis electrocautery knife to make radial incisions cryo - extraction of foreign body from bronchus foreign body being taken into rigid barrel plastic foreign body after removal retained non - organic foreign bodies are great masqueraders presenting with non - specific symptoms and high propensity of being missed unless index of suspicion is high . The longest duration of retained fb in english literature is 39 years, a case of wooden chip reported from japan . History of fb is the first clue to making a diagnosis but is unfortunately forthcoming only in few of the cases that too in retrospect . Evaluation should be undertaken even if fb was removed previously and patient has symptoms as part of it could have been retained as it was in our case . Symptoms range from none to chronic cough, wheezing, hemoptysis and recurrent episodes of chest infections . In our country profile of symptoms are generally non specific but documented episodes restricted to one side or lobe warrant evaluation for endobronchial lesions . Chest x - ray is the next step in assessing these patients; it has a high sensitivity for detecting metallic foreign bodies and can also reveal subtle signs like lobar collapse or hyperinflation . Chest x - ray has been shown to reveal the fb as opacity in only 14 - 20% among both adults and pediatric population . This has been the case in all reports of retained fb of over 10 years in english literature including ours . Flexible bronchoscopy should be undertaken if radiology reveals or suspects fb; also in cases of unexplained longstanding non - specific symptoms with negative radiology and no alternate diagnosis . Luminal appearance of fb after years of residence is rarely clear, especially if one is unsure of what they are looking for . Granulation tissue can be exuberant and mimic tumor in appearance, attempts to biopsy it can result in significant bleeding which can further compromise vision . Stenosis of bronchus like the one seen in our patient is a relatively uncommon complication seen in about 8% of cases as against 62.9 - 76.5% incidence of granulations in two large series . Even among patients with stenosis only minority require management of the same and in our case was required due to presence of tight stricture in the main stem bronchus . There is consensus regarding rigid bronchoscopy for management of fb in pediatric patients as these patients are sicker, hypoxemic, cannot cooperate, have poor reserve and flexible bronchoscope lacks robust instruments for retrieval due to small working channel . Further, flexible bronchoscopy is useful in only confirming the presence of fb in stable pediatric patients, thus avoiding a negative rigid bronchoscopy . Flexible versus rigid bronchoscopy for management in adults is a long - standing argument with various operators having different points of view . Rigid bronchoscopy is the preferred modality for either long - standing fb or in case of failed attempt with flexible bronchoscope . Long - standing fb is also notorious for failure of rigid bronchoscopy due to excessive granulation, which then requires bronchotomy and/or lobectomy for retrieval . In our case rigid bronchoscopy was done in view of long - standing fb and presence of web - like stenosis that required dilatation . Long - standing fb is a challenge both to diagnose and manage, needs a high index of suspicion and low threshold for detailed evaluation . Management requires personnel with adequate experience and availability of appropriate instruments both flexible as well as rigid . There should be seamless switch over to rigid if flexible is not successful in recovery of fb.
Postoperative pulmonary complications are found to be associated with increased morbidity and mortality following abdominal surgeries . They also lead to additional health cost and prolonged length of hospital stay . According to the findings reported in an australian study, postoperative pulmonary complications are 13% prevalent and significantly prolong length of hospital stay . However, various rates of pulmonary complications had been reported in the literature due to lack of proper criteria for pulmonary complications . Available evidences suggest that early postoperative mobilization following abdominal surgery contributes to improved lung volume which eventually reduces incidences of postoperative pulmonary complications [5, 6]. Preoperative counseling regarding hospital stay and patient's role in recovery has proven to reduce anxiety, reduce length of stay, and have better compliance with postoperative care plan including early mobilization . Eventually, preoperative counseling may contribute towards early mobilization that can reduce postoperative pulmonary complications following abdominal surgery . Counseling regarding surgical procedures is commonly employed at every setup but less importance is given to additional counseling regarding postoperative management . This study aims at evaluating the effect of preoperative counseling regarding postoperative mobilization and its impact on reducing pulmonary complications in a developing world . The randomized control trial was conducted at the department of general surgery of a tertiary care hospital of karachi, pakistan, from september 2012 to march 2013 . Participants were recruited from outpatient clinic as well as from emergency department of the hospital . Minimally invasive surgeries and patients whose score was> 2 on the american society of anesthesiologist (asa) scale were excluded . Moreover, patients who were smokers and had abnormal findings on x - ray were also excluded . Every second patient who visited selected study setting was recruited in group i, whereas others were kept in group ii . Group i received informed consent regarding surgical procedure as well as counseling related to early postoperative mobilization and its impact on surgical outcome, whereas group ii received information regarding surgical procedure only . To reduce biasness, senior residents who were not part of the study conducted these counseling sessions . Explanation was given about nature of study, rights of study participants, privacy and confidentiality of participants, and rights of withdrawal from study . In addition, history of previous illness, comorbidity, and any barrier to early postoperative mobilization were assessed . Both groups received counseling regarding nature of surgery and its complications, what to expect during hospitalization, postoperative pain management, and possible complications associated with surgery and anesthesia, whereas group i received additional information regarding postoperative mobilization and its impact . Patients were encouraged and assisted to mobilize once they were fully awake, with stable blood pressure and pulse, no dyspnea on rest, and pain score of <8 on visual analogue scale . The time at which surgery ended and the time when patient first got out of the bed (bed to chair) were recorded . In addition, time from end of surgery to first mobilization of> 10 minutes was also recorded . Patients who had prolonged duration of surgery and who were smokers underwent chest physiotherapy and incentive spirometry with the help of physiotherapy staff . Postoperative pulmonary complications following abdominal surgery were assessed via criteria of scholes et al . Postoperative pulmonary complications are as follows.chest x - ray showing collapsed lung or consolidation.increased body temperature> 38c for more than one consecutive postoperative day.sputum culture providing evidence of infection.productive yellow or greenish sputum.unexplained increased white blood cell count.abnormal breath sound on auscultation.diagnosis of pulmonary complication by physician . The criteria for postoperative pulmonary complications were reviewed from preoperative health status . In the current study, 2 participants in group i and 5 participants in group ii were excluded from study because of poor surgical outcomes . 1 participant from group i declined to continue further as part of the study because of low pain threshold . Data from 113 participants from group i and 111 participants from group ii were analyzed . Mean age of participants in group i was 36.70 8.69 years (median: 37 years, range: 38 years) with male to female ratio of 49: 64, whereas in group ii mean age of participants was 37.01 8.43 years (median: 38 years, range 33 years) with male to female ratio of 38: 73 . There was no significant difference noted in mode of admission among these two groups (p = 0.43). Diagnosis of the patients and procedure performed in both groups were almost the same as shown in table 1 . Similarly, there was no significant difference in the duration of surgery (p = 0.51) and pain score (p = 0.32) among both groups . Mean duration of surgery for group i was 64.91 mins (median: 65 mins, range: 75 mins), whereas for group ii it was 63.3 mins (median: 60 mins, range: 80 mins). Similarly, participants in group i reported mean pain score on 3.8 (median: 5, range: 3) on given visual analogue scale (vas); however, mean pain score for participants in group ii was 3.9 (median: 4, range 5). On evaluating postoperative status of patients, significant difference was observed in participants of both groups in terms of early mobilization to bed to chair and upright mobilization for more than 10 minutes (p <0.001). Patients in group i were mobilized earlier from bed to chair (mean: 342.9 mins, median: 340 mins, and range: 105 mins) in comparison to patients in group ii (mean: 1511.1 mins, median: 1500 mins, and range: 680 mins). Likewise, patients in group i had earlier mobilization for more than 10 minutes (mean: 360.7 mins, median: 360 mins, and range: 125 mins) in contrast to patients in group ii (mean: 1570.5 mins, median: 1570 mins, and range: 680 mins). Participants in group i who were early mobilized had fewer pulmonary complications (7.1%) compared to group ii who had 29.7% participants suffering from pulmonary complications . As shown in table 2, whoever fulfilled any three of the scholes et al . On exploring the impact of counseling and support from staff for physiotherapy from group i participants, the majority of them (68.14%) reported that counseling was very effective in providing them with motivation for early mobilization, as shown in table 3 . The primary aim of this study was to evaluate effect of preoperative counseling along with physiotherapy support on facilitating early mobilization among patients undergoing abdominal surgery . The findings of current study revealed that early mobilization is not associated with type of abdominal surgery and its duration . Likewise, previous study has also indicated no significant difference in length of anesthesia and mobility . Postoperative early mobilization in combination with physiotherapy serves as a prophylaxis to reduce postoperative pulmonary complications . It has also been reported that change of position from supine to fowlers increases minute ventilation significantly . Similarly, findings of current study revealed that delayed mobilization increases the risk of postoperative pulmonary complications as indicated by presence of fever, abnormal breath sounds, and cough . This finding supports that early mobilization can prevent postoperative complications associated with surgery . In line with findings of current study . Moderate level of mobility also improves muscle strength and alleviates adverse effects of immobility . Hence, optimal level of mobilization is desirable among surgical patients to prevent morbidity associated with inappropriate mobilization . In the current study, patients who were mobilized earlier reported that preoperative counseling and support of physiotherapy staff were effective . In line with the current study findings, the literature revealed that increase in physical activity can be achieved among preoperative patients via continuous support . Postoperative physical activity interventions have also proved to be effective in providing better surgical outcome [14, 15]. One of the study findings revealed that preoperative instructions about exercise impact postoperative compliance with exercise . Such preoperative cognition interventions have proved to be effective in increasing postoperative physical activity . Moreover, in developing countries where literacy level is low such interventions can significantly affect outcome of abdominal surgeries . Thus, preoperative counseling and support of physiotherapy staff can improve compliance with early mobilization which is proved to be effective in reducing postoperative pulmonary complications . Early postoperative mobilization following abdominal surgery is proved to be effective in reducing pulmonary complications . In addition, preoperative counseling along with physiotherapy support can foster early mobilization among patients undergoing abdominal surgery . Hence, counseling regarding early postoperative mobilization should be promoted among patients undergoing abdominal surgery to improve surgical outcome.
The majority of patients diagnosed with incompetent cervix can be treated successfully with a transvaginal cerclage . A select group of patients who have failed the vaginal approach, or have extremely short cervices, anatomically deformed cervix, deeply lacerated cervices, or severely scarred from previous failed vaginal cerclages may benefit from the transabdominal approach . The patient is a 36-year - old african - american woman (gravida 2, para 2, aborta 0, last menstrual period 4/1/03) referred from our maternal fetal medicine division for consideration for laparoscopic cerclage . The patient had a previous laparoscopy at age 20 with normal findings . On physical examination, the cervix was normal in appearance, the vagina was normal, and on bimanual examination the uterus was midposition and normal size, shape and contour with some uterine descensus . The patient was taken to the operating room after extensive counseling as to possible laparotomy and bleeding and underwent laparoscopic placement of an abdominal cerclage using a 5-mm mersilene band as is the usual suture used by our maternal fetal medicine (mfm) division . This included placing the 5-mm mersilene band around the internal os of the cervix, tying the knots anteriorly, and suturing 2 0 silk suture to the cut mersilene to prevent any unraveling (figure 1). (a) placing suture; (b) tying the suture; (c) completed suture: mersilene and silk; (d) showing posterior placement; (e) end of case after irrigation . She had some first trimester bleeding at 8 weeks in which the vaginal ultrasound confirmed cardiac activity . The patient's prenatal course was significant for chronic hypertension, an abnormal glucose tolerance test that was diet controlled with fastings less than 100 and 2-hour postprandials consistently less than 120 . She began kick counting at 28 weeks and non stress tests were begun at 33 weeks . An elevated creatinine level was noted at 33 weeks and decreasing creatinine clearance was noted, for a diagnosis of preeclampsia . The patient was brought to the medical university of south carolina for bedrest and evaluation at 34 weeks . She underwent a low transverse cesarean delivery after lung maturity was confirmed, that day delivering a 5 pound 12 ounce female infant, apgar 8/9 . The patient tolerated the surgery well, and the infant and mother went home on postoperative day 3, doing well . Certainly, the usual treatment for women at risk for cervical incompetence is a cerclage placed transvaginally . When this approach has failed, or when this approach is not possible because of anatomic deformities, a transabdominal cerclage is a viable option . Data clearly show an improved fetal survival rate compared with fetal survival in untreated pregnancies . The advantage of the abdominal approach is placement of the suture at the internal os with decreased movement . The obvious disadvantage is the need for 2 or even 3 laparotomies (although some skillful nonlaparoscopic surgeons have managed to remove these sutures through a colpotomy, most cannot) should the fetus succumb in the second trimester . One must always keep the patient and fetus' health first, and if unable to succeed laparoscopically, must be prepared to perform the abdominal cerclage via laparotomy to complete the procedure.
Cancer is universally recognized as the century s major health concern, and its mounting escalation during the past few decades and detrimental impact on all physical, emotional, spiritual, social, and economic aspects of human life have rendered experts concerned more than ever . Of all types of cancer breasts are symbols of femininity and as such the majority of women find the prospect of losing them unthinkable . A woman s reaction to any kind of actual or suspected disease may include fear of deformity, loss of attraction, and death; consequently, breast cancer is indubitably horrifying to any woman . Breast cancer treatments such as radiotherapy, chemotherapy, and surgery could cause serious physical and psychological side effects, making treatment programs and rules more difficult to follow . Patients may, therefore, find it harder to adhere to the treatment protocol and inadvertently undermine the efficacy of the treatment, which could negatively impact their own life expectancy . At this stage, patients suffering from breast cancer are liable to complain of various kinds of problems such as sleeping disorders, high levels of anxiety, and reduced quality of life sometimes even 2 years after the initial diagnosis . Since modern treatment methods have turned cancer on many occasions into an acute and often curable disease out of an incurable one, various aspects of cancer psychiatry such as reaction toward diagnosis and also treatment have become increasingly prominent . One dimension of human life is spirituality, which enables individuals to communicate and integrate with the universe . Communication and integration endow hope and meaning to human life and elevate it beyond the confines of time and place . Religious / spiritual group therapy is a form of psychotherapy drawing upon special principles and religious / spiritual techniques to empower patients to attain a nonmaterial understanding of self, universe, incidents and phenomena, and ultimately health and growth . The results of a research carried out by meraviglia under the title of effects of spirituality in breast cancer survivors on 84 women aged between 34 and 80 years suffering from breast cancer whose disease had been diagnosed 5 years earlier, along with his another study conducted on 60 patients aged between 33 and 83 years suffering from lung cancer, showed that patients should be encouraged to seek spirituality as an effective tool in dealing with physical and psychological responses to cancer . Given the reach and influence of religious culture in iranian society, drawing upon religion as an important source of compatibility is anticipated . Due to the lack of research evidence in this domain in our country, the present study was conducted to investigate the efficiency of spiritual group therapy in enhancing patients well - being and spiritual health . The present research was a quasi - experimental project of pretest - posttest type with a control group carried out between march and june 2011, in collaboration with shiraz university of medical sciences . The study population was selected from among patients referring to amir hospital and omid hospital . For the purpose of this research, among a large number of patients suffering from breast cancer and aged between 18 to 65 years, 24 individuals were selected after clinical interviews through the available sampling method . All the 24 participants were tested using the research tools, comprising structured clinical interview for dsm - iv (scid - i), quality - of - life questionnaire (whoqol-26), and spiritual health scale (swb-20). The test group members thereafter received 12 sessions of group spiritual treatment (table 1), whereas the control group members did not receive any kind of treatment until the test group members were fully treated and the second group of questionnaires was collected . Treatment sessions in brief the inclusion criteria for the present research were as follows: having elementary education and literacy levelbeing at least 18 and at most 60 years of agenot having the diagnostic criteria for clear psychiatric disorders such as psychosis, major depression, obsessive - compulsive disorder, and personality disorders based on the scid - i conducted by the researcher having elementary education and literacy level being at least 18 and at most 60 years of age not having the diagnostic criteria for clear psychiatric disorders such as psychosis, major depression, obsessive - compulsive disorder, and personality disorders based on the scid - i conducted by the researcher subsequently, all the participants under test completed the research questionnaire in 2 rounds . The test group participated in the 12 group - treatment sessions in the form of a 120-minute session in a week . From the 24 participants, 43% were 50 and 57% under 50 years old, while 21% were single and 79% were married . Apropos education, 37.5% of the study population were below the high school diploma, 50% had a high school diploma, and 12.5% had college education . Also, 65% of the participants in each group underwent chemotherapy or there were significant differences in quality of life and some of its dimensions (psychological and social dimensions) between the 2 groups following the spirituality group - therapy sessions among the experimental subjects . However, as regards the physical dimension, no significant difference was observed between the 2 groups after the therapy sessions . Comparison of the results of the statistical analysis of covariance at pretest and posttest in the experimental and control groups the eta - squared in this table shows that 39%, 5%, 26%, and 2% of the changes in the scores of quality of life, physical, psychological, and social aspects were created by the implementation of our treatment method . With respect to the spiritual health dimension additionally, 36%, 2%, and 38% of the changes in these variables were caused by the implementation of our treatment method . As is demonstrated in table 3, there was no significant difference in the social aspect of quality of life between the 2 groups . In parallel with the findings of the present research, it has been previously observed that religiosity and spirituality can play a significant role in enhancing quality of life among patients with cancer . Abedi et al . Suggested that prayers and religious practices could affect not only emotional moods but also physical quality and that such practices could sometimes improve a patient with physical disease in a few moments or in a few days . Quing, mccola, and larson also reported that many of their patients acknowledged the positive effects of religion on their mental and physical health . Concluded that spiritual / religious group therapy could generally be effective in mental improvement in patients with schizophrenia . Rocha and falek concluded that spirituality and religion could have no impact on the social dimensions of quality of life . Prayer reduces anxiety, promotes spirituality, and is an appropriate method for coping with diseases . In a research conducted by hojjati et al ., a direct relationship was reported between prayer and well - being: more prayer was correlated with better health.one study probed into well - being, religious adaptation, and quality of life among african - american women who had undergone treatment for breast cancer and reported that the women who probed into well - being and religious adaptation had more positive adaptation and that there was a meaningful relationship between spiritual well - being, physical and emotional aspects of quality of life, and performance health . Askari et al . Posited that religious beliefs and optimism were predictors of spiritual health . Spiritual and religious beliefs and practices are effective in promoting adaption to cancer by affecting existential concerns such as the search for the meaning of life and hope . Today, faith and spirituality are regarded as some of the most significant sources of physical health and quality of life . Evidence shows that spiritual interventions could be helpful in preventing or improving an extensive range of physical problems and coping with acute pains, diseases, and death . Various studies have confirmed a meaningful relationship between spirituality and religion and quality of life, spiritual well - being, and meaning of life . Our results revealed that spiritual group therapy enhanced quality of life and its psychological and social dimensions as well as spiritual well - being and its religious and existential aspects . Furthermore, there is a great deal of evidence indicating that religion is a protective factor against depression and that it facilitates recovery . Prominent among the salient points of spiritual group therapy is that it can improve the patient s attitude toward life or disease . The importance of stressors is determined through cognitive evaluations under the influence of beliefs and personal values such as self - control and existential and spiritual beliefs . Individuals make use of available resources and various coping strategies in order to manage their stress . Based on this standpoint, it can be argued that values affect significant cognitive evaluations in the process of dealing with a problem; thus, spirituality can help individuals assess negative events in different ways . Hence, spirituality offers a stronger sense of control and herewith leads to more psychological compatibility . The second factor that should be taken into account is the coordination of therapy sessions in groups . In addition, when surrounded by others afflicted with the same problem, the individual does not consider the problem as something exclusive and tends to become more hopeful . The third factor of note is the particular characteristics of patients suffering from cancer and some national and cultural features of our society . Conflicts, diseases, and severe traumas usually drive individuals away from their routine course of life and make them aware of temporary values and goals . Individuals in such situations need some tool to seek more long - lasting goals and values . Experts believe that spirituality is described and formed by acceptable actions and beliefs in a certain culture . The fourth noteworthy factor in regard to spiritual group therapy is related to some procedures and techniques and also the impact of prayer, benediction, and communication with god . Essa zadegan reported that therapeutic metaphor could be an innovative method whereby patients utilize their power of imagination to achieve better insight . The therapist had inadequate experience in treating patients suffering from cancer via group therapy and spiritual therapy . According to our patients statements as well as the results of our statistical analyses, spiritual group therapy could be deemed a suitable method for treating disorders such as depression and promoting the quality of life as well as the religious and existential dimensions of spiritual health in patients suffering from breast cancer.
Breast cancer, as the most common malignancy, is the major cause of cancer - related deaths of women worldwide [1 - 3]. Age plays a critical role in the incidence of this type of cancer, as it has been found that young breast cancer patients have worse outcomes than older premenopausal or postmenopausal patients . A large number of studies point out the fact that the survival rates in patients aged up to 34 years is very poor . Data suggest that hormonal mechanisms may play key roles in this age prognosis relationship, as the difference in survival patterns between age groups were seen only in patients with hormone receptor positive tumors and not in those with hormone receptor negative tumors . Epidemiological data have shown that the incidence of breast cancer in women is closely related to a high fatty diet . Furthermore, breast cancer cells have significant lipogenic capacity, and inhibition of fat metabolism in these cells is associated with their growth arrest and apoptosis . Breast cancer treatment involves surgery, chemotherapy, radiation therapy, hormonal therapy, or combination therapy . Breast cancer tumors, which are estrogen / progesterone receptor (er / pr)-positive, are 60% more likely to respond to hormonal therapy, whereas er / pr - negative tumors show only 5% to 10% response to hormonal therapy . Hormonal therapies for breast cancer are usually done after surgery, chemotherapy, and/or radiotherapy . This therapy is designed to help prevent the recurrence of the disease by blocking the effects of estrogen . Tamoxifen, a drug taken by some women for up to 5 years after the initial treatment of breast cancer, helps in preventing the recurrence of tumor by blocking the ers on breast cancer cells . The role of hormonal therapy drugs is to slow down the growth rate of cancer cells, which are growing in response to the presence of estrogen and its receptor . Nearly 60% of all cancer patients are treated with radiation, either alone or in combination with surgery and chemotherapy [10 - 12]. Unfortunately, the efficacy of conventional radiotherapy is limited by 1) the presence of hypoxic, intrinsically radio - resistant, and repair - proficient tumor cells; 2) genetic, metabolic, and microenvironmental heterogeneity of tumors; and 3) undesirable damage to the normal healthy tissues . Therefore, significant improvement in therapeutic efficacy can be achieved only by developing effective approaches based on a comprehensive understanding of the radiobiology of the tumor and normal tissues, to selectively enhance the radiation damage in tumors while reducing the damage to normal tissues . However, some cancer cells are intrinsically resistant to ionizing radiation induced damages, and such a treatment can actually induce tumor cell proliferation and repopulation, resulting in a diminished response to radiation and poor tumor local control . More important, hypoxia has been associated with drug resistance and reduced sensitivity to radiation therapy, partly because of the upregulation of hypoxia inducible factor 1 (hif-1) and activation of survival molecules such as akt and nuclear factor kappa - light - chain - enhancer of activated b cells (nuclear factor-b). Therapeutic resistance associated with hypoxia is a significant problem in the clinical treatment of cancer, and inhibition of glycolysis may provide a novel approach to overcoming such a resistance . In fact, some studies showed that, under hypoxic conditions, cells exhibited increased sensitivity to the glycolytic inhibitor, 2-deoxy - d - glucose (2-dg). Hexokinase, the first enzyme in the glycolytic reaction, may be the key regulator in 2-dg induced apoptosis, as it causes glucose to undergo metabolism (figure 1). Recently published data support the role of hexokinase activity in the prevention of apoptosis mediated by akt . It is also unregulated by hif and, therefore, the cell may become more resistant as there are more enzymes to be inhibited by a given amount of 2-dg . Accelerated glucose uptake during anaerobic glycolysis (warburg effect) [14 - 17,20 - 26], and loss of regulation between glycolytic metabolism and respiration, are the major metabolic changes found in malignant cells . In general, cancer cells have increased rates of glycolysis as well as pentose - phosphate cycle activity and slightly reduced rates of respiration . Enhanced glucose uptake and glycolysis in tumors arise as a result of multiple reasons including oncogenic transformation - linked alterations in gene expression, mitochondrial mutations, and hypoxia in the case of solid tumors, which result in enhanced levels and activities of glucose transporters and glycolytic enzymes . Studies have shown that glucose deprivation can induce cytotoxicity in transformed human cell types via metabolic oxidative stress . In addition, transformed human cell types appear to be more sensitive to glucose deprivation induced cytotoxicity and metabolic oxidative stress than non - transformed human cell types . Glucose analogues have been found to profoundly inhibit glucose metabolism in cancer cells in vitro and in vivo . Of the many glucose analogues that have been investigated, 2-dg has been proven to be the most effective in inhibition of cell metabolism and adenosine triphosphate (atp) production . 2-dg is a structural analogue of glucose differing at the second carbon atom by the substitution of hydrogen for a hydroxyl group (figure 2a) and appears to selectively accumulate in cancer cells by metabolic trapping because of increased uptake, high intracellular levels of hexokinase or phosphorylating activity, and low intracellular levels of phosphatase (figure 2b). Once inside the cell, 2-dg is phosphorylated by hexokinase to 2-deoxy - d - glucose-6-phosphate (2-dg-6-p). Therefore, once formed, 2-dg-6-p is not further metabolized, and, therefore, the output from glycolysis and the pentose phosphate pathway gets reduced, and 2-dg-6-p will accumulate in the cell until dephosphorylated by phosphorylase [16 - 18,23]. Cellular processes leading to the error - free repair and fixation of dna lesions require a continuous flow of metabolic energy, which is frequently supplied by enhanced glycolysis in cancer cells . However, in normal cells, the respiratory pathway is the major contributor to energy (atp) production . Two properties of 2-dg, namely, the inhibition of glycolysis and the preferential accumulation in cancer cells, have formed the basis for further investigating the mechanism of 2-dg for its use as an antitumor agent . It has been speculated that, cancer cells, which are initially treated with 2-dg, exhibit a stress response caused by a depletion of intracellular energy . The stress response results in increased levels of glucose transporter expression and increased glucose uptake, which allow more 2-dg to enter the cell . As a consequence of high intracellular 2-dg concentrations, hexokinase and hexose phosphate isomerase are inhibited; energy stores such as atp are further depleted; and finally, the cell activates the cell death pathway . In addition, increased pro - oxidant production and profound disruptions in thiol metabolism consistent with metabolic oxidative stress were also noted in cancer cells during glucose deprivation or when treated with the glucose analogue 2-dg . However, malignant transformation of cultured cells with oncogenes or oncoviruses results in an absolute increase in the amount of glucose transported into the cell . This is mediated by transcriptional activation of the glut1 glucose transporter gene resulting in increased levels of glucose transporter mrna and protein . Glut1 protein expression is increased in cancer cells and has been reported to increase during cellular stress and also during glucose deprivation . Studies have shown that the cytotoxic effect of 2-dg is heterogeneous among different tumor cell lines . While profound growth inhibition and cell death have been found in some cells, a marginal effect on growth and clonogenicity a number of factors contribute to these two diversified responses, which includes the extent of glucose dependence and glycolysis, energy deprivation in the form of atp depletion and imbalance in the oxidative stress (mitochondrial metabolism), levels of glucose transporters, c - myc status, p53, and p21 status, and the levels of apoptosis regulating b - cell lymphoma (bcl) family of proteins, particularly the bcl2/bcl-2-associated x protein (bax) ratio . The cytotoxic effects of 2-dg are found to be higher under hypoxic conditions and the knockdown of hif-1 significantly enhances the sensitivity of cells under hypoxia to 2-dg, suggesting that inhibition of hif-1 may improve the clinical efficacy of glycolytic inhibitors such as 2-dg . 2-dg has been found to be more toxic to tumor cells grown as spheroids (which develop microregions of hypoxia) when compared to monolayer cultures (mlcs). Cell death, induced by 2-dg, could be either apoptotic or necrotic depending on the cell type and environmental factors . While the induction of apoptosis has been found in c - myc overexpressed cells, enhanced apoptotic death has been reported in drug - resistant human carcinoma cells (kb - dr) that could be linked to overexpression of glut receptors induced by 2-dg . It has been shown that induction of apoptosis by 2-dg has been independent of bcl2, and cytotoxic effects of 2-dg do not correlate with p53 status . Susceptibility of p53 overexpressing cells to 2-dg is reduced by higher levels of catalase or glutathione peroxidase suggesting that the mechanism underlying enhanced cell killing by 2-dg in p53 overexpressing cells involves oxidative stress . Glucose and oxygen are potent regulators of glycolytic enzyme gene transcripts and, therefore, genetic alterations other than c - myc activation are also expected to sensitize transformed cells to glucose deprivation . Furthermore, glucose by itself stimulates transcription of gene encoding glycolytic enzymes through the carbohydrate response element (chore), a cacgtg motif, which has the same sequence as the core binding site for c - myc . Analyzing the radiomodifying effects of 2-dg observed in several tumor cell lines reveal that the time of administration of 2-dg with respect to irradiation plays a critical role in determining the effects . Sensitization is generally found to be higher when 2-dg is added either just before (<5 minutes) or immediately after (<5 minutes) irradiation, is present in the incubating medium for 2 to 4 hours . It has also been shown that the presence of the glycolytic inhibitor, 2-dg, for a few hours after irradiation can selectively inhibit the post irradiation repair processes in cells with high rates of glycolysis, such as cancer cells, thereby enhancing the damage caused by radiation . Alterations in the expression of many genes involved in damage response pathway including dna repair and apoptosis, transcriptional regulators, cell signaling, besides energy metabolism have been reported, which can significantly influence the radiosensitization of tumor cells . A great degree of heterogeneity in the 2-dg - induced modifications in radiation responses has been observed among the various human tumor cell lines that does not correlate well with the extent of decrease in the energy status (atp levels), suggesting thereby that other disturbances caused by 2-dg also play important roles in the modifications of cellular responses to damage caused by radiation and chemotherapeutic drugs . These include (but are not restricted to) level of glucose transporters (glut1 and glut2), prosurvival and prodeath regulators, namely, c - myc, ras, p53, p21, bcl2/bax ratio, and so on, and imbalances in the oxidative stress . The degree of radiosensitization by 2-dg in multicellular tumor spheroids (mts) generated from human glioma cell line (bmg-1) was found to be nearly 2.5-fold higher than in the mlcs, which correlated with the enhanced glycolysis in mts, and with the role of synergy between endogenous oxidative stress related to tumors and induced metabolic oxidative stress . Many studies suggested that 2-dg enhances the damage caused by chemotherapeutic drugs and ionizing radiation selectively in cancer cells while reducing the damage to normal cells . 2-dg sensitizes cancer cells to radiation through mechanisms such as inhibiting dna repair processes and recovery from potentially lethal damage . However, despite of several past attempts to test the role of 2-dg in radiation therapy, only one clinical trial study on human cerebral gliomas has demonstrated that 2-dg improves the efficacy of radiotherapy . Radiosensitization has also been suggested to be due to disruption of thiol metabolism resulting in oxidative stress - related cell death in the form of apoptosis . It is pertinent to mention here that an inappropriate design of protocols may in fact reduce the efficacy of primary therapeutic agents by 2-dg as has been reported for a combination of radioimmunotherapies . Treatment of human breast cancer cell lines with 2-dg results in the cessation of cell growth in a dose dependent manner . However, evaluation of glucose usage, lactate production, and energy status could be useful for predicting the responses of tumors to the combined treatment of radiation and 2-dg . 2-dg acts synergistically with specific chemotherapeutic agents in causing cell death, and the class of chemicals that are most sensitive appears to be those that cause dna damage [19 - 21,23]. Furthermore, 2-dg has been shown to inhibit the transcription of human papilloma virus, suggesting it to be an ideal adjuvant for enhancing the efficacy of chemotherapy in the treatment of drug - resistant cervical cancers . 2-dg also enhanced the cytotoxicity of cisplatin and doxorubicin . According to the results of some studies, it has been proposed that 2-dg may be a good chemosensitizer for chemoresistant patients as it alters reactive oxygen species (ros) or redox state and sensitizes the cells to further damage caused by chemo agents . It was found that the combination of 2-dg and doxorubicin have a significant cell killing capability in rapidly dividing cells (such as t47d breast cancer cell line) compared with 2-dg or doxorubicin alone, whereas no effect was seen in slowly growing cells (such as mcf-7 breast cancer cell line). 2-dg has shown promising results as an adjuvant of radiation therapy and chemotherapy both in vitro and in vivo . Cancer cells, in contrast, have lost responsiveness to most external growth signal, and as a consequence, nutrient supply in the form of glucose likely plays a unique role in maintaining cancer cell viability . Thus, normal and transformed cells respond to nutrient depletion or glucose deprivation in opposing manners . Whereas normal cells compensate by increased glucose transporter expression or modification, transformed cells are stressed by glucose - deprivation leading to the expression of an array of stress related genes, which is subsequently followed by cell death . In many normal cell types, glucose deprivation results in an increase in the maximum velocity of glucose transport this has been attributed to one of several mechanisms; translocation of transporter from an intracellular compartment to the plasma membrane, changes in the glycosylation pattern of the glut1 transporter with decreased turnover of the protein, or by increased synthesis of mrna and protein . When glycolysis is inhibited, the intact mitochondria in normal cells enable them to use alternative energy sources such as fatty acids and amino acids to produce metabolic intermediates channeled to the tricarboxylic acid cycle for atp production through respiration . As such, cells with normal mitochondria 2-dg produced a four to five fold greater effect in anaerobically growing cells than in aerobically growing cells . Consequences of glycolysis blocking is different in aerobic versus hypoxic cells . In the aerobic cell, if glycolysis is inhibited by 2-dg, atp cannot be generated by this pathway . However, since o2 is available to the mitochondria, amino and/or fatty acids can act as energy - providing carbon sources for oxidative phosphorylation (oxphos) to take place, producing atp . In contrast, when glycolysis is blocked in the hypoxic cell the other carbon sources cannot be used by mitochondria as o2 is unavailable and consequently oxphos cannot take place . Thus, when glycolysis is blocked in the hypoxic cell, it has no alternative means for generating atp and, therefore, will eventually succumb to this treatment . In general, cancer cells exhibit increased glycolysis and pentose - phosphate cycle activity, while demonstrating only slightly reduced rates of respiration . Initially these metabolic differences were thought to arise as a result of " damage " to the respiratory mechanism, and tumor cells were thought to compensate for this defect by increasing glycolysis . However, if cancer cells increase glucose metabolism to form pyruvate and nicotinamide adenine dinucleotide phosphate (nadph) as a compensatory mechanism, in response to ros formed as byproducts of oxidative energy metabolism, then inhibition of glucose metabolism would be expected to sensitize cancer cells to agents that increase levels of hydroperoxides (i.e., ionizing radiation and chemotherapy agents such as quinones that are known to the redox cycle and produce ros). Although it is not possible to deprive cells of glucose in vivo, it is possible to treat tumor - bearing animals and humans with 2-dg, a relatively non - toxic analogy of glucose that competes with glucose for uptake via the glucose transporters as well as being phosphorylated by hexokinase at the entry point to glycolysis . Competition between 2-dg and glucose is thought to cause inhibition of glucose metabolism, thereby creating a chemically induced state of glucose deprivation . Although there are reports that the phosphorylated form of 2-dg (2-dg-6-p) can proceed through the first step in the pentose cycle (glucose-6-phosphate dehydrogenase) leading to the regeneration of one molecule of nadph, 2-dg-6-p appears to be incapable of further metabolizing in the pentose cycle as well as incapable of metabolism to pyruvate . Ahmad et al . Have shown that administration of 2-dg to mice could be an effective way to inhibit glucose metabolism without causing toxicity until very high levels are achieved (lethal dose 50 2 g / kg body weight) and could be tolerable in humans when administered up to 200 mg / kg . Therefore, using 2-dg as an inhibitor of glucose metabolism in vivo may provide a very effective addition to multi modality cancer therapies designed to limit hydroperoxide metabolism for the purpose of enhancing radio- and chemosensitivity in human cancers . Singh et al . Have shown that the growth rate of rapidly dividing du145 prostate cancer cells depend on high levels of glucose consumption, whereas the growth rate of relatively slow - growing lncap cells are much less dependent on glucose . They found a direct correlation between glycolytic capacity and degree of growth inhibition in response to glucose deprivation for these two cell lines . Their results are also consistent with earlier studies that showed a direct relationship between glycolytic capacity and growth rate for several rat hepatoma tumors, and lend further support to the hypothesis that high glucose consumption is required for rapid proliferation of most cancer cells . Have also showed that increased aerobic glycolysis is a hallmark of cancer and that inhibition of glycolysis may offer a promising strategy to preferentially kill cancer cells . They proposed that trastuzumab to have remarkable efficacy in treatment of avian erythroblastosis oncogene b2 (erbb2)-positive breast cancers when used alone or in combination with other chemotherapeutics . In their study, it is suggested that trastuzumab has antitumor effects in combination with glycolysis inhibitors in erbb2-positive breast cancer by inhibiting glycolysis via downregulation of heat shock factor 1 (hsf1) and lactate dehydrogenase a (ldha) in erbb2-positive cancer cells, resulting in tumor growth inhibition it is understood that glucose metabolism appears to be involved in the detoxification of intracellular hydroperoxides, and other authors have suggested that tumor cells demonstrate increased intracellular hydroperoxide production . It is proposed that the extent to which tumor cells increase their metabolism of glucose is predictive of tumor susceptibility to glucose deprivation induced cytotoxicity and oxidative stress . Therefore, when deprived of glucose using inhibitors of glycolytic metabolism (i.e., 2-dg), tumor cells with high glucose utilization will be more sensitive to cell death resulting from respiratory dependent metabolic oxidative stress than tumor cells with low glucose utilization and normal cells . It was hypothesized that the reason for this is because cancer cells with high glucose utilization generate more o2 and h2o2 from their mitochondrial electron transport chains . 2-dg is clinically a relevant competitor for glucose, thereby creating a chemically induced state of glucose deprivation . 2-dg inhibits glucose metabolism in animals, and it is not toxic to them except at very high levels (> 2 g / kg body weight). It is tolerable in humans up to 200 mg / kg of body weight . Zhang and aft, on analyzing the effect of 2-dg with / without some other chemodrugs (figure 3), have reported that there was a greater additive effect on cell cytotoxicity of 2-dg in combination with doxorubicin, 5-fluorouracil, trastuzumab, and cyclophosphamide . On one hand, they did not observe enhanced cytotoxicity of 2-dg with cisplatin in breast cancer cells, which exists in head and neck cancers . On the other hand, in vivo obtained data have shown radio - sensitization effects of 2-dg . In this study, treatment with 2-dg or with radiation significantly inhibits tumor growth compared to the control group . While high doses of radiation almost completely suppressed tumor growth in the radiation - treated group, addition of 2-dg further enhanced the efficacy of radiation . More importantly, the radiation enhancement effect is stable long after the combined treatments of 2-dg and radiation . Some previous studies also showed that 2-dg increases the effect of radiation in pancreatic cancer and in head and neck cancers in mice . Thus, with p53-positive cancer, a lower dose of radiation could be effective when used in combination with 2-dg . The precise molecular mechanisms underlying the cellular responses to metabolic stress induced by 2-dg alone and in combination with other cytotoxic agents such as ionizing radiation and chemotherapeutic agents appear to be complex and remain to be completely elucidated . Elucidation of various mechanisms underlying radiosensitization and chemosensitization by 2-dg using established tumor cell lines will be very useful in designing effective protocols using 2-dg in cancer therapy.
Encephalitis is one cause of epilepsy in the united states, as the central nervous system (cns) trauma; however, there are 1.4 million cases of head injury in comparison with less than 50000 cases of cns infection per year . The exact etiology of this disease is unknown and might be due to infective or noninfective causes, but viruses have been mostly implicated . The most common viruses involved are human herpesviruses, flaviviruses, enteroviruses, and alphaviruses . Less common viral agents include influenza viruses, adenoviruses, rabies virus, lymphocytic choriomeningitis virus, measles, rubella and mumps . Vaccinations have dramatically decreased encephalitis because of childhood diseases such as mumps, measles and rubella . Between herpesviruses, human herpesvirus-6 (hhv-6) is found in cerebrospinal fluid (csf) of 10% of patients with suspected viral cns diseases . Viral encephalitis symptoms could be fever, headache, altered level of consciousness, and seizures (2). With production of new antiviral drugs, correct and timely diagnosis of the disease would be important for patients management (2). It has been linked to different cns diseases such as meningitis, encephalitis, and multiple sclerosis, as well as psychological disorders . Hhv-6 primary infection manifests itself as roseola infantum with common symptoms of fever and rash in children between six months and two years old . This disease itself is usually benign, but some major complications such as seizures, bulging of the anterior fontanel, and encephalitis have been reported after this disease (3). The question is that whether hhv-6 could cause encephalitis in the absence of roseola infantum . The diagnosis could be obtained by detection of viral nucleic acid as well as antibody or virus isolation from csf or brain tissue . Because of limitations in virus isolation and serological tests, polymerase chain reaction (pcr) has been widely used in clinical diagnosis of viruses . Even with this sensitive and specific technique, 30 - 60% of patients with encephalitis remain undiagnosed (4). The aim of this study was detection of hhv-6 dna in csf of patients with symptoms of possible acute encephalitis, using real - time pcr . In this cross - sectional study, all children aged 2 years with encephalitis - like symptoms (temperature> 38c, convulsion, and some with altered levels of consciousness), admitted to the emergency ward of children medical center of tehran university of medical sciences between march 2010 and march 2011 were enrolled . Special forms were filled to record the history and demographic information (age and sex) as well as clinical and laboratory findings (symptoms, csf cell counts, and glucose and protein levels). Lumbar puncture was performed on the first day of admission and csf specimens were collected from all patients; then, they were sent to the virology department, school of public health, tehran university of medical sciences, and stored at -70c . Dna was extracted from 140 l of each sample with high pure viral nucleic acid kit containing proteinase k (roche, germany), according to the manufacturer s instruction . When extracting the viral dna, proteinase k was added to the sample before adding to the column . The csf specimens were tested for hhv-6 dna, using taq man real - time pcr . The primers and the probe were directed against the u22 open reading frame of both hhv-6a and b; forward primer: 5- tcg aaa taa gca tta ata ggc aca ct-3, reverse primer: 5-cgg agt taa ggc att ggt tga -3, and taq man probe: fam - cca agc agt tcc gtt tct ctg agc ca - tamra, which amplified a 99-bp fragment . The probe was labeled at the 5 end with 6-carboxyfluorescein as the reporter dye and at the 3 end with 6-carboxytetramethylrhodamine as the quencher . An adenine - to - guanine substitution at position 11 of the hhv6b sequence in the reverse primer and in the probe, as well as an ac - to - gt substitution at positions 13 and 14, were accepted for designing the primer - probe (5). The dna extract (7 l) was amplified by real - time pcr in a 25-l reaction mixture, containing 12.5 l of quanti fast probe pcr master mix (qiagen, germany), 4 l of forward and reverse primers (10 pmol), 1 l of probe (10 pmol), and 0.5 l ddh2o in abi step one plus (applied biosystems, u.s.a) machine . The thermocycling process consisted of pcr initial heat activation for three minutes at 95c, followed by 40 cycles of denaturation at 95c for 15seconds, annealing at 56c for 30seconds, and extension at 60c for 30 seconds . The concentration of hhv-6 control dna was 104 copies/l; after dilution, we had 10 copies/l, which was positive in cycle threshold (ct): 20 . In this cross - sectional study, all children aged 2 years with encephalitis - like symptoms (temperature> 38c, convulsion, and some with altered levels of consciousness), admitted to the emergency ward of children medical center of tehran university of medical sciences between march 2010 and march 2011 were enrolled . Special forms were filled to record the history and demographic information (age and sex) as well as clinical and laboratory findings (symptoms, csf cell counts, and glucose and protein levels). Lumbar puncture was performed on the first day of admission and csf specimens were collected from all patients; then, they were sent to the virology department, school of public health, tehran university of medical sciences, and stored at -70c . Dna was extracted from 140 l of each sample with high pure viral nucleic acid kit containing proteinase k (roche, germany), according to the manufacturer s instruction . When extracting the viral dna, proteinase k was added to the sample before adding to the column . The csf specimens were tested for hhv-6 dna, using taq man real - time pcr . The primers and the probe were directed against the u22 open reading frame of both hhv-6a and b; forward primer: 5- tcg aaa taa gca tta ata ggc aca ct-3, reverse primer: 5-cgg agt taa ggc att ggt tga -3, and taq man probe: fam - cca agc agt tcc gtt tct ctg agc ca - tamra, which amplified a 99-bp fragment . The probe was labeled at the 5 end with 6-carboxyfluorescein as the reporter dye and at the 3 end with 6-carboxytetramethylrhodamine as the quencher . An adenine - to - guanine substitution at position 11 of the hhv6b sequence in the reverse primer and in the probe, as well as an ac - to - gt substitution at positions 13 and 14, were accepted for designing the primer - probe (5). The dna extract (7 l) was amplified by real - time pcr in a 25-l reaction mixture, containing 12.5 l of quanti fast probe pcr master mix (qiagen, germany), 4 l of forward and reverse primers (10 pmol), 1 l of probe (10 pmol), and 0.5 l ddh2o in abi step one plus (applied biosystems, u.s.a) machine . The thermocycling process consisted of pcr initial heat activation for three minutes at 95c, followed by 40 cycles of denaturation at 95c for 15seconds, annealing at 56c for 30seconds, and extension at 60c for 30 seconds . The concentration of hhv-6 control dna was 104 copies/l; after dilution, we had 10 copies/l, which was positive in cycle threshold (ct): 20 . One hundred and fourteen children, two years old or younger, with symptoms of possible encephalitis, were enrolled in this study . Of the total patients, 68 were male and 46 were female, of which, 39 were older and 75 younger than 12 months old . Eleven patients had history of vaccination in the past two days, six of which were mmr, four were dpt, and one was influenza vaccine . The disease incidence was 42.1% in autumn, 35.08% in winter, 17.54% in spring, and 5.26% in summer . In three of the children rash was identified, which was not specific for roseola infantum . In 10 (8.8%) these children were younger than 13 months old (the youngest one was two and the oldest 13 months old) and 90% of them were boys . Their average temperature (38.9c) at the time of admission was not significantly different from the temperature in the children with negative hhv-6 . In hhv-6-positive patients, the incidence was 70% in winter, 20% in autumn, and 10% in summer . Two patients had fever two days before the convulsion and eight had fever at the day of convulsion . Of the 114 children, febrile convulsion (fc) was the first episode in 95 (83.33%) and the second in 19 (16.66%). Dna was found in eight of 95 patients with first fc episode and two of 19 with second episode . Cell / mm and for the hhv-6-positive children it was 11986 8842 cell / mm . All the 114 patients had fc, 10 had loss of consciousness, 16 coryza, 20 cough, 15 diarrhea, and eight vomiting . Among hhv-6-positive patients, one had loss of consciousness, two coryza, two cough, and one diarrhea . Abbreviations: csf: cerebrospinal fluid; esr: erythrocyte sedimentation rate; hhv-6: human herpesvirus 6; pmn: polymorphonuclear leukocytes; rbc: red blood cell; wbc: white blood cell . Encephalitis is an acute inflammation of brain; it is a crucial cause of acute symptomatic seizures and the subsequent epilepsy . Annually, 7.3 per 100000 people are hospitalized in the united states because of encephalitis (2). Clinical syndromes of acute childhood encephalitis may range from mild illness including fever, convulsion and varying degree of consciousness, to a devastating disease resulting in death (4). Having information about the disease etiology may be helpful in determining the therapeutic regimens as well as preventive advises . Certain virus families, especially herpes viruses such as hhv-6, can cause encephalitis (5). After exclusion of noninfectious, bacterial, and fungal causes of encephalitis, viral diagnosis could be commonly achieved by pcr of csf samples . Seroepidemiological surveys have shown that hhv-6 can infect almost all children up to two years of age . This virus causes roseola infantum as the primary infection, but it can cause some neurological disorders too (6). Seizures, meningoencephalitis, bulging of the anterior fontanel, and encephalopathy are the most common manifestations . In one third of children younger than two years old with fcs, hhv-6 was detected . The mechanism through which this virus causes cns complications is unclear, but it seems to be the result of direct invasion of cns . Its multiple manifestations as well as lack of routine diagnostic tests resulted in costly and lengthy evaluations and hospitalizations; thus, understanding of the frequency and consequences of hhv-6 infection could be helpful in diagnosis and management of patients (7). Molecular methods of detection, especially pcr, have been established for diagnosis of cns infections . Even with the best and most specific methods, 30 - 60% of patients with suspected viral encephalitis will be undiagnosed (4). In this research, hhv-6 was identified by real - time pcr in 10 of 114 csf specimens from children who showed symptoms of possible encephalitis (incidence: 8.8%).encephalitis due to hhv-6 infection has been reported by several studies . In some of them, patients completely recovered, and in some others, neurologic sequela and death were reported . The hhv-6 dna was identified in csf of several patients with pcr, revealing the direct viral invasion to cns (8, 9). In a study by yoshikawa et al . In 2009 (10), 86 cases of exanthema subitum with encephalopathy were evaluated, among which, the hhv-6 dna was detected in 21 patients with two deaths . In our research, all the patients survived and there was no confirmed encephalitis and death . In another study by suga (11) on 21 patients with exanthema subitum and cns complications, nine cases were hhv-6-positive for csf test, four had encephalitis, 17 had complete recovery, one case with encephalitis developed epilepsy, and one case died . (12) on csf samples of 150 children with meningoencephalitis in tehran showed that 9 (6%) patients were positive for the hhv-6 dna . Encephalitis is important, both in the acute phase and the long term neurologic sequels . This is obviously an area of high clinical importance, requiring further investigations for diagnosis and treatment.hhv-6 is sensitive to ganciclovir and foscarnet and insensitive to acyclovir, same as cytomegalovirus (13). Yoshida et al . (14) showed that hhv-6 was highly sensitive to cidofovir . This lack of information might be due to the fact that studies on hhv-6 have been retrospective and there is not a routine laboratory test for identifying the virus in suspected patients . This was a cross - sectional descriptive study on immunocompetent children, revealing the prevalence of hhv-6 in children less than two years old with possible encephalitis . No significant differences could be found in clinical presentations and laboratory findings between the ten patients with and the 104 patients without hhv-6 infection . All the patients had complete recovery without neurological deficit or death; thus, we can conclude that all the patients were fc cases, some of which had post - ictal drowsiness . Further prospective studies on immunocompromised children are recommended for comparing the results between immunocompetent and immunocompromised children . Another issue is recognizing the common viruses such as herpes simplex virus, enteroviruses, etc . In follow up studies, to find the coinfection and other possible factors involved in this disease . According to this study, evaluation of csf (detecting the hhv-6 dna by pcr) is recommended in children younger than 13 months old with possible encephalitis, for initiating the antiviral treatment . We should follow up for identifying the type of viruses (hhv-6 a or b) as well as the prevalence of hhv-6 dna integration into the germline, which can permanently turn the individual into hhv-6-positive.
Activation of mast cell degranulation has been demonstrated to be an important mediator of allergic disease and more recently, as an initiator or contributor to autoimmune disease [1 - 4]. Mast cells are granulocytes that emanate from myeloid progenitors in bone marrow and play a critical role in innate immunity as vital sentinel cells that combat invading microorganisms at tissue / environment interfaces [1 - 4]. Mast cells are phagocytic and can directly destroy pathogens; they also release inflammatory mediators which promote inflammation by recruiting and activating other leukocytes . As regulators of adaptive immunity, mast cells promote antigen presentation, naive t cell differentiation into helper t cells, and induction of acquired immunity towards parasites via ige / fcr binding [1 - 4]. The major contribution of mast cells to both immune function and dysfunction results from the release of a plethora of inflammatory mediators through a process known as regulated exocytosis [1 - 5]. This process occurs in many cell types and involves the storage of intracellular pools of inflammatory mediators, hormones or neurotransmitters in pre - formed granules / vesicles . Upon activation of the cell, fusion can be activated through receptor stimulation or by membrane depolarization via 2 messengers, for example ca . The transport, fusion and release of vesicle contents through exocytosis is mediated by a family of proteins known as the snares [7 - 11]. Soluble n - ethylmaleimide - sensitive factor attachment protein receptors have been demonstrated to play a pivotal role in regulated exocytosis (degranulation) in mast cells [12 - 22] and represent a mechanical step involved in inflammatory mediators release that can be targeted for the design and development of therapeutics . We review the expression, localization and operation of various functional snare complexes in both murine and human mast cells . We evaluate the published functional data that has been used to implicate specific snares and snare complexes as indispensable mediators of mast cell degranulation . Vesicular trafficking of essential molecules between cellular compartments and into and out of cells is required for cell function and survival . In neurons, neurotransmitter release is widely acknowledged as critical for the development and function of the nervous system in all higher organisms . The snare family of proteins mediates the highly regulated processes of vesicular assembly and disassembly [6, 810]. Numerous proteins are involved in the formation and disassembly of active snare complexes during membrane fusion . Each set of snare proteins act as a vesicle loading signal, a mechanical address (delivering the vesicle to the correct target membrane), and in the mechanical process of fusing two opposing membranes . The neuronal and immunological snare proteins have a another layer of complexity added to this paradigm, the vesicles are loaded with cargo, but dock and await a chemical fusion signal . The snare family of evolutionarily conserved proteins was first identified in the 1980s in yeast and a decade later in mammalian cells . Snares are found in most eukaryotic cells; 25 members have been identified in saccharomyces cerevisiae, 54 members in arabidopsis thaliana and> 36 members in humans . The proteins are composed of a simple domain structure highlighted by a snare motif, a stretch of 6070 amino acids arranged in a heptad repeat [6 - 11]. Core complexes form stable structures, which are composed of four intertwined parallel -helices contributed by three to four different snare members [6 - 11]. These complexes consist of a central core of three glutamine residues and one arginine residue bordered by hydrophobic stacked layers of side chains . Soluble n - ethylmaleimide sensitive factor attachment protein receptors can be classified on the basis of whether they contain a q or r residue in their motif and are referred to as either a qa, qb, qc, qbc, or r - snares based on the position of their contributing motif in the assembled snare complex . The vesicle - associated membrane protein (vamp) family of snares are examples of the r - snare sub - type and are characterized by a single transmembrane domain, a snare motif and a n - terminal domain containing profilin - like folds [8, 10]. The syntaxin family of snares is an example of the qa or qc sub - type and are characterized by a single transmembrane domain, a snare motif and a n - terminal domain made up of anti - parallel three - helix bundles [8, 10]. The synaptosome - associated protein (snap) family of snares is an example of the qbc subtype and contain two snare motifs joined by a flexible linker and that is palmitoylated and therefore lacks a transmembrane domain [8, 10]. The snap family is unique in that they contribute two snare motifs to the snare complex . Soluble n - ethylmaleimide - sensitive factor attachment protein receptors were previously classified based on whether they localized to the vesicle membrane (v - snares; e.g. Vamps) or to the target plasma membrane (t - snares; e.g. Syntaxins and the snap families) but these classifications have subsequently been shown to have a number of exceptions . Soluble n - ethylmaleimide - sensitive factor attachment protein receptors localized on opposing membranes [vesicle: vesicle or vesicle: plasma membrane] drive fusion of membranes using the free energy released during the formation of the stable four - helix bundle . Post - fusion snare proteins end up on the interior surface of the target membrane . These bundles are recycled via dissociation mediated by n - ethylmaleimide - sensitive factor (nsf) and other co - factors such as snap (soluble nsf attachment protein). Mechanical models [6 - 11] all predict that snares function to bring opposing membranes into close proximity initiating fusion events . The presence of ca is indispensable, acting to bridge the opposing membranes, which leads to the exclusion of water allowing lipid mixing, fusion and subsequent exocytosis . Ca - regulated snare complexes are involved in neurotransmitter release [8, 23]. The neuronal snare complex was the first snare complex identified and the most vigorously dissected . Docked vesicles containing snare complexes composed of syntaxin 1a and snap-25 on the plasma membrane and vamp-2 on the vesicular membrane allow for the rapid (millisecond) release of neurotransmitters upon ca influx . Free, uncomplexed membrane snares form cis - snare acceptor complexes on the plasma membrane in response to the actions of regulatory proteins . These acceptor complexes on the plasma membranes interact with snares on opposing vesicular membranes and form trans - snare complexes that are fusion ready. These docked vesicles persist for a substantial period of time until ca influx triggers the final step of fusion and cargo (neurotransmitter) release through the actions of ca sensors such as synaptotagmin and complexins . Various investigators have reported the expression of multiple snares in murine and human mast cells [12, 13, 15, 17, 1922, 2431]. Composite rt - pcr data identifying snare mrna in murine and human mast cells are presented in table 1 . The neuronal snare snap-25 showed weak mrna expression in human mast cells, but was not detected via western blot in the same study . Multiple studies report the expression of several vamp family representatives mrna [vamp-1, 2, 3, 7, 8 (r snares)] and several members of the syntaxin family [syntaxin 1, 2, 3, 4 (qa snares)] as well . Snare family mrna expression in murine and human mast cells immunoblotting studies confirm that snap-23 is the consensus representative of the qb, c family in both murine and human mast cells (see composite of protein expression data presented in table 2). Interestingly, two groups have reported the expression of the neuronal snap-25 qb, c snare protein in primary murine mast cells via immunoblot and immunohistochemistry [25, 27]. These data could not be recapitulated in published work by several groups in primary murine mast cells [12, 22] and the rat cell line rbl-2h3 [13, 22, 24]. The reason[s] behind this discrepancy is not clear, but may involve specificity of antibodies and/or limits of detection of signal . Protein expression of vamp and syntaxin family members correlate well with mrna studies, as the majority of snares detected via rt - pcr were also detected via immunoblot . Snare family protein expression (via immunoblotting) in murine and human mast cells immunohistochemistry studies in primary murine mast cells [12, 18, 21] have demonstrated that snap-23 and syntaxin 4 localize to the plasma membrane, while syntaxin 3, vamp-2 and vamp-8 appear to localize to secretory granules . Detected snap-25 expression in the secretory granules of rat primary mast cells (rpmc). Similar immunohistochemistry results in rbl-2h3 cells [13, 14, 24, 29, 31] have been reported demonstrating plasma membrane localization of snap-23, syntaxin 4 and syntaxin 3; and secretory granule localization of syntaxin 3, vamp-2, 3, 7 and 8 . In human mast cells, sander et al . Demonstrated that snap-23 and syntaxin 4 localize in the plasma membrane while vamp-3, vamp-7 and vamp-8 are dispersed throughout the cytoplasm, suggesting granule localization . However, upon activation of the mast cell, only vamp-7 and vamp-8 appear to redistribute to the periphery of the cell, suggesting fusion and degranulation . Immunoprecipitation (ip) pull - down studies in primary murine mast cells, rbl-2h3 cells, and human mast cells have identified snare complexes composed of snap-23 and syntaxin 4 in complex with the r - snares, vamp-2 [13, 18, 28, 29], vamp-8 [13, 15, 17, 18, 22]; vamp-7 and vamp-3 . In addition, complexes composed of snap-23, syntaxin 3 and vamp-8 also co - precipitated . . Demonstrated that ip with anti - snap-23 antibody in rbl-2h3 cells pulled down syntaxin 2, 3, 4 and vamp-2, 3, 8 . Interestingly, n - ethylmaleimide (nem) treatment was required to observe vamp-8 co - precipitation . It was also demonstrated that ip with anti - syntaxin 4 resulted in the co - precipitation of snap-23, vamp-2, vamp-3 and vamp-8, while ip with anti - syntaxin 2 or syntaxin 3 only pulled down snap-23 . These data suggest that ternary complexes in rbl-2h3 cells consist of snap-23, syntaxin 4 and a member of the r - snares family, presumably vamp-2, 3 or 8 . Showed that in rbl-2h3 cell lysates; syntaxin 4 co - precipitated with snap-23 and vamp-8 within and outside of lipid rafts; however, syntaxin 3, snap-23 and vamp-8 co - precipitates were found to be complexed only within lipid rafts . The implication of these two different complexes and their unequal distribution in the membrane remains unclear . Additional studies by hepp et al . Demonstrated co - precipitated complexes of snap-23, vamp-2 and syntaxin 4 in rbl-2h3 cells and also showed that most of the snap-23 associated with vamp-2 and syntaxin 4 in these complexes is phosphorylated . An elegant study by puri et al . Demonstrated that snap-23, syntaxin 4, vamp-2 complexes are present in lipid rafts and showed that snap-23 functions to recruit non - lipid raft - associated syntaxin 4 into a functional complex . Once again it was demonstrated that a predominant proportion of the snap-23 in complexes was phosphorylated, implicating snap-23 phosphorylation as a key prerequisite to complex formation . Our group has demonstrated that in rbl-2h3 cells, snap-23 co - precipitates with syntaxin 4 and vamp-8; however, nem treatment was needed to observe vamp-8 association . In human mast cells isolated from surgical tissues, sander et al . Demonstrated that snap-23 co - precipitated with syntaxin 4, vamp-7 and vamp-8, but not vamp-2 and vamp-3 . In derived mast cells, vamp-8 was shown to associate preferentially with syntaxin 4 and snap-23, and to a lesser degree, vamp-2 . However, it appears that vamp-2 and vamp-3 may act to substitute for vamp-8 in vamp-8-deficient cells, perhaps due to an unusual compensatory mechanism . Isolation of ternary complexes of snare proteins after cellular activation has proven anything but trivial . Previous data have demonstrated that only 5% of the snap-23 present in rbl-2h3 cells is actually capable of forming a complex after activation . Furthermore, it is suggested that snare complexes have limited lifespans after activation - induced formation [35, 36]. Using recombinant snare proteins, foster et al . Demonstrated the in vitro association of the recombinant snares, snap-23, vamp-2 and syntaxin 4 and further demonstrated that deletion of the amino terminus and the second coiled - coil domain of snap-23 inhibited binding to both vamp-2 and syntaxin 4 . Although immunolocalization and ip studies identify the individual snare proteins and their complexes associated with mast cell function, functional studies aimed at disrupting snare complex formation / action provide a practical method to dissect the role of these complexes in mast cell degranulation . Snare proteins also function to mediate constitutive trafficking events through both endocytic and secretory pathways; reviewed in hong et al . Previously published functional data have implicated the snares snap-23, syntaxin 4, vamp-2, vamp-3, vamp-7 and vamp-8 in mast cell degranulation in studies using streptolysin - o - permeabilized cells and inhibitory recombinant snare proteins, snare neutralizing antibodies [12, 17, 19]; overexpression studies [13, 14, 22, 29, 38], rna interference methods [20, 22, 39] and snare - deficient mice [18, 21]. A compilation of functional data implicating the various snare proteins is presented in table 3 . Functional data implicating snare proteins in mast cell degranulation the most compelling evidence for the role of snare proteins in mast cell degranulation is presented in data describing vamp-8-deficient mice [18, 21]. . Demonstrated that mast cells derived from the bone marrow of these mice [bmmc] had a 50% decrease in their ability to release -hexosaminidase and serotonin but had normal histamine and tnf- release . Tiwari et al . Showed that bmmc from vamp-8-deficient mice resulted in a 50% decrease in -hexosaminidase and histamine, but no changes in cytokine / chemokine release . Our group has shown via sirna that we could demonstrate about a 50% knockdown in rbl-2h3 degranulation after targeting vamp-8 mrna / protein . Interestingly, puri et al . Also showed that vamp-2 and vamp-3 do not play a role in mast cell degranulation as bmmc derived from vamp-3-deficient animals and mast cells derived from vamp-2-deficient stem cells showed normal degranulation . These data are confirmed by studies with tetanus toxins [17, 40], which are known to cleave and inactivate vamp-2 but do not have any effect on mast cell degranulation . Supporting evidence for the role of vamp-8 in mast cell degranulation comes from sander et al ., who demonstrated that neutralizing anti - vamp-8 antibodies inhibit degranulation in streptolysin - permeabilized human mast cells by 60% . Data from this report also demonstrated a role for vamp-7 (50% inhibition) but not vamp-2 and vamp-3 . Similarly, lippert et al . Demonstrated that recombinant vamp-8 inhibited ca-/gtps - mediated degranulation in permeabilized rbl-2h3 cells by 30% . Our group's sirna studies also implicate snap-23 and syntaxin 4 as essential for rbl-2h3 degranulation, as knockdown of these snares resulted in 30% inhibition of degranulation when compared to control sirna treatment . In support of our data, salinas et al . Demonstrated that in permeabilized rpmc, neutralizing antibodies to snap-23 and syntaxin 4 resulted in 25% and 65% inhibition of histamine release . In addition, sander et al . Demonstrated that neutralizing antibodies to snap-23 and syntaxin 4 inhibited histamine release from permeabilized human mast cells with inhibition reaching 90% and 40%, respectively . Earlier studies by guo et al . Demonstrated that anti - snap-23 neutralizing antibody decreased rpmc degranulation, although this inhibition required high antibody concentrations (500 g / ml). Recently, suzuki et al . Demonstrated that a shrna to snap-23 knocked down degranulation in stimulated rbl-2h3 cells by 30%, similar to the maximal inhibition we have observed for snap-23 . In addition, liu et al . Demonstrated that treatment of rbl-2h3 cells with syntaxin 4 sirna resulted in a decrease in antigen - induced histamine and -hexosaminidase release . Interestingly, various groups [13, 14, 29, 37] have implicated syntaxin 4, vamp-7 and snap-23 in mast cell degranulation via overexpression studies . Overexpression of syntaxin 4, vamp-7 and snap-23 all had an effect on degranulation in rbl-2h3 cells, although the effects were manifested as either an augmentation or inhibition of degranulation . The exact mechanism leading to augmentation or inhibition has yet to be elucidated but may involve competition for free snare proteins or competition for regulatory proteins . Because many of the snare - deficient transgenic mice are embryonic lethal (table 4), sirna methods may represent the only efficient way to characterize degranulation pathways in both in vitro and in vivo models of anaphylaxis and autoimmune disease . Mast cell phenotype of snare knockout animals / cells these reports provide evidence that these snares do not participate in the mast cell degranulation process . There are a number of studies published recently that utilize sirna to validate the role of individual snares or snare complexes mediating trafficking events in various cell types [46 - 54]. However, an interesting report published recently eloquently suggests that the abundance of snare - member isoforms and therefore the overall increase in snare redundancy may play a major role in the lack of snare sirna cellular efficacy . In addition, the authors describe the phenomenon that many cell types appear to express a sizeable reserve of snare proteins not required for normal physiological cellular processes (a so - called snare reserve). Interestingly, the literature is scant with respect to sirna studies characterizing snare - protein function in mast cells . In addition, as snares are intracellular targets, the use of biotherapeutics such as recombinant proteins or neutralizing antibodies is not possible as these large proteins cannot as of yet be targeted to the inside of the cell . Therefore, interfering rna offers an exciting new approach for the development of a snare - directed therapy . To date, several sirna - based therapies have initiated clinical trials for the treatment of viral diseases, cancer and macular degeneration . In addition, our sirna data identifies snap-23 and syntaxin 4 as essential for rbl-2h3 degranulation, and knockdown of these snares resulted in 30% inhibition of degranulation when compared to control sirna treatment . These studies reflect the effect that a snare sirna therapeutic could have as we utilized whole cells stimulated with physiologic stimuli . However, additional studies focused on in vivo delivery of these sirna and testing in animal models of disease are warranted . Sec1/munc18 (sm) proteins are arch - shaped cytosolic proteins that have been demonstrated to bind syntaxins and regulate intracellular trafficking [57, 58]. Specifically, munc182 has been demonstrated to play a role in mast cell degranulation [15, 26, 31]. Sm proteins appear to regulate snare activity in several ways [57 - 60]. They can bind non - complexed syntaxins and act as negative regulators of snare assembly and interestingly, can also bind to trans - complexes and promote fusion . Members of the munc13 family of accessory proteins also have been demonstrated to act as positive regulators of mast cell degranulation . Complexins are cytosolic snare regulatory proteins that bind snare complexes and lock the snare machinery into a primed state awaiting a final trigger of fusion events [57, 60]. Specifically, complexin ii has been demonstrated to function as a positive regulator of mast cell degranulation as sirna to complexin ii attenuates ige - induced degranulation . Synaptotagmins are type i membrane calcium binding proteins that facilitate the formation of the snare calcium phospholipid complex that triggers final fusion and release of mediators from the cell [57, 60]. In mast cells, the rab family of gtpases has been implicated in the control of degranulation in mast cells . Secretory carrier membrane proteins (scamps) are accessory proteins that play a role in the regulation of mast cell degranulation . Scamp-1 and scamp-2 are postulated to function at the later stages of membrane fusion, in concert with phospholipase d, to form functional fusion pores . Finally, as previously mentioned vide supra, snare disassembly is mediated by the proteins snap and the atpase nsf [60, 64]. Snap functions to capture the snare complex and allow the binding of nsf and the subsequent disassembly of the snare complex . The important qb, c and qa snares on the plasma membrane unequivocally appear to be snap-23 and syntaxin 4, while the most likely r - snare partners on the vesicle membranes appear to be both vamp-7 and vamp-8 (fig . 1). Functionally, there is growing evidence that ternary complexes of the above snares are critically involved in the mast cell degranulation process . Disruption of these complex's formation or interactions with regulators may offer a window for therapeutic intervention and the development of novel small molecules for the treatment of allergic and autoimmune disease . Model of the mast cell snare complex mediating degranulation based on functional findings [1214, 1622, 29, 3738]. (a) snap-23 and syntaxin 4 represent the consensus plasma membrane snares involved in mast cell degranulation . Under normal physiological conditions, vamp-7 and/or vamp-8 represent the secretory granule (vesicle) snare that interacts with snap-23 and syntaxin 4 to form a functional ternary complex . (b) in the absence of vamp-8, it appears that a compensatory mechanism may allow vamp-2 and/or vamp-3 to associate with snap-23 and syntaxin 4 to mediate ternary complex formation and possible function.
Genetic factors significantly influence late - onset alzheimer's disease (ad) though by some estimates 3065% of the genetic variance remains unexplained by the four established ad genes (tanzi, 2012; mahley and rall, 2000). Polymorphisms of the apoe gene, specifically the epsilon 4 (4) allele, account for most of the known heritability of late - onset ad (tanzi, 2012). A positive family history is a risk factor for late - onset ad (tanzi, 2012; cupples, 2004; silverman, 1994), with studies indicating a 24-fold larger risk in first - degree relatives . Some of this risk is additive to the known risk conferred by the apoe gene suggesting a missing heritability . No measure of self - reported fh status to evaluate subjects at risk hence, studies examining the effect of fh on biomarker phenotypes may improve the interpretation of biomarker tests and the counseling of at risk subjects . Several studies have examined the effect of fh on biomarkers (lampert, 2013; honea, 2011; xiong, 2011; andrawis, 2012; okonkwo, 2012). For example, several cross - sectional studies in mild cognitive impairment or normal subjects report that first - degree relatives have a higher prevalence of abnormal cerebrospinal fluid beta - amyloid and/or tau phenotypes, even after accounting for the known effects of age and apoe4 (lampert, 2013; xiong, 2011). One of these studies also estimated that the unexplained genetic heritability in fh (for an effect on beta - amyloid in mci) was about half the size of the apoe4 effect (lampert, 2013). Prior studies have also examined the effect of fh on hippocampal volume (lampert, 2013; honea, 2011; andrawis, 2012; okonkwo, 2012). In a prior cross - sectional study of normal, mci, and ad subjects, we failed to find an effect of fh on hippocampal volume (lampert, 2013). However, in another study of normal subjects derived from the ku brain aging project, maternal fh was reported to influence 2-year volume loss in the precuneus, parahippocampal and hippocampus independent of apoe4 (honea, 2011). Supporting this was another 1-year multisite study, which found that maternal (but not paternal family history) was associated with increased hippocampal atrophy in mci subjects but not in normal or ad subjects (andrawis, 2012). However, another 4-year study of middle aged normals, in the wisconsin aging study, found that fh status predicted greater atrophy only within a posterior sub - region of the hippocampus but not in other gray matter regions, and that there was no effect of maternal versus paternal history (okonkwo, 2012). Reasons for discrepancy may be differences in inclusion criteria, sample size, follow - up duration, image analyses, and covariates used . The alzheimer's disease neuroimaging initiative (adni) is a highly successful national longitudinal biomarker research study (weiner, 2010) and as such it is ideal for more definitive testing of preliminary results generated by single site studies . Stringent subject selection criteria, serial mri scans using qualified scanners and phantoms, and standardized central mr image analyses are some of the many strengths of adni . The goal of this present analysis was to use adni data to test the effect of fh on longitudinal atrophy rates (up to 48 months) of 20 brain regions in subjects with mci . We decided to focus on subjects with mild cognitive impairment for three reasons: adni included twice as many mci subjects as controls; mci subjects are at greater risk for progression to ad than normal controls; mci subjects have a greater rate of atrophy than normal controls . Hence, the mci group offered greater power for testing our hypotheses and was also more relevant to the type of subject seen in routine clinical practice . Our primary hypothesis was that a positive fh would be associated with greater rate of atrophy in brain regions known to degenerate early in ad such as the hippocampus, amygdala, entorhinal cortex, and cortical gray matter . Data used in the preparation of this article were obtained from the alzheimer's disease neuroimaging initiative (adni-1) database (http://adni.loni.usc.edu) (weiner, 2010). The adni was launched in 2003 by the national institute on aging (nia), the national institute of biomedical imaging and bioengineering (nibib), the food and drug administration (fda), private pharmaceutical companies, and nonprofit organizations, as a 5-year public private partnership . The primary goal of adni has been to test whether serial magnetic resonance imaging (mri), positron emission tomography (pet), other biological markers, and clinical and neuropsychological assessment can be combined to measure the progression of mild cognitive impairment and early alzheimer's disease (ad). Determination of sensitive and specific markers of very early ad progression is intended to aid researchers and clinicians to develop new treatments and monitor their effectiveness, as well as lessen the time and cost of clinical trials . The principal investigator of this initiative is michael w. weiner, md, va medical center and university of california san francisco . Adni is the result of efforts of many co - investigators from a broad range of academic institutions and private corporations, and subjects have been recruited from over 50 sites across the u.s . And . The initial goal of adni was to recruit 800 subjects but adni has been followed by adni - go and adni-2 . To date these three protocols have recruited over 1500 adults, ages 5590, to participate in the research, consisting of cognitively normal older individuals, people with early or late mci, and people with early ad . The follow - up duration of each group is specified in the protocols for adni-1, adni-2 and adni - go . Subjects originally recruited for adni-1 and adni - go had the option to be followed in adni-2 . For up - to - date information, for additional details readers can also refer to the adni-1 procedures manual (adni, 2013; alzheimer's disease neuroimaging initiative, 2013). Only subjects with a baseline diagnosis of mci were eligible for this study . Additionally, subjects selected for analysis were required to have data for all of the following parameters: baseline age, race, gender, and years of education; baseline mini - mental state examination (mmse) score; apoe genotyping results; and family history status of ad . Subjects also needed initial visit 1.5 t mr scans analyzed centrally by freesurfer software (v.4.4) to derive cortical thickness and sub - cortical volume data; and a minimum of two other follow - up mri time points (6, 12, 18, 24, 36, or 48 months from baseline) with centrally freesurfer analyzed mri data . To be classified as mci in adni a subject needed an inclusive mmse score between 24 and 30, subjective memory complaint, objective evidence of impaired memory calculated by scores of the wechsler memory scale logical memory ii adjusted for education, a score of 0.5 on the global cdr, absence of significant confounding conditions such as current major depression, normal or near normal daily activities, and absence of clinical dementia . For a detailed list of all selection criteria readers fh data was collected by an interview with the subject and their study partner regarding the presence of ad in the subject's parents and siblings . A control typically self - reported while the study partner was the main source of information for memory - impaired subjects . A positive family history (fh+) was characterized as having a parent or sibling, living or deceased, who had been reported as diagnosed with ad . A negative family history (fh) meant having no reported parents or siblings with a history of ad . Apoe allele genotyping of all subjects was executed using dna extracted from peripheral blood cells with details given elsewhere (adni, 2013). Adni used 1.5 t mp - rage t1-weighted mr images that were later pre - processed and corrected for nonlinearity via gradwarp . The scans were implemented using a standardized adni protocol adjusted for use at each specific collection site and then underwent scaling and vetting to meet quality control criteria . For more detailed information regarding the specific mr acquisition protocols and control methods used we selected 20 brain regions of interest, including 4 regions known to atrophy in early ad (hippocampus, amygdala, cortical gray matter volume, and entorhinal cortex) as well as other regions of exploratory interest . Specific details about these techniques have been previously described in publications (sgonne, 2004; fischl, 2002; sled et al ., 1998; fischl et al ., 2001; fischl et al ., 1999; fischl and dale, 2000; han, 2006; hostage et al ., 2014). For more information please see http://adni.loni.usc.edu . For each region of the brain, the longitudinal variation in thickness / volume was modeled as a log - linear function of time and other subject information . The response vij(t) is the thickness / volume in the jth region of the brain, j = 1, 2,, 20 for the ith subject, i = 1,, 184, measured at the tth time point, t = 0, 6, 12, 18, 24, 36, or 48 months . The terms in the model include j, the baseline thickness volume, measured at time 0, for a 75 year old male subject with no family history of alzheimer's . The baseline subject represents the most common subject characteristics in the study, and the reference age represents the first quartile of ages in the study . There is also a subject specific random effect, ai, assumed to have a gaussian distribution with 0 mean and sd a . This term accounts for subject specific variation in the baseline brain volume, due to factors such as difference in intra - cranial brain volume . In addition, we have a linear effect of age (centered at 75), with coefficient aj, an additional effect for females, fj, as well as an effect of positive family history, fhj . The aforementioned effects are all at t = 0 and specific to region j. next, we model atrophy (or volume increase) as a linear function in time, decomposed into effects of the demographic variables: firstly, j is the baseline rate of atrophy, corresponding to the baseline subject described above . There is also a subject specific random rate of atrophy, bi, assumed to have a gaussian distribution with 0 mean and sd b . This term allows the rate of atrophy to vary across subjects, as a proxy for terms not explicitly included in the model, such as genetic and lifestyle factors . We also have an additional atrophy effect for females, fj, as well as an atrophy effect of positive family history, fhj . Finally, ijt is a random measurement error, assumed to have a zero mean gaussian distribution with sd . The brain volumes vij(t) were log transformed to ensure that the distribution of the estimated error terms (residuals) of the model better conformed to the assumption of gaussianity . We also used a second model, where additional genetic information was incorporated:(1.2)log(vij(t))=j+aij+ajage+fj+fhj+e4j+jt+bijt+fjt+fhjt++e4jt+ijt . In model (1.2), the common terms represent the same things as in model (1.1), except that the baseline subject additionally possesses the apoe 3/3 allele . The term e4j denotes the additional baseline effect of the apoe 4 + allele, while e4j denotes the additional atrophy effect of the apoe 4 + allele . Both models were fit separately to data from each region of the brain, using restricted maximum likelihood (reml), as implemented in the nmle package [pinheiro et al . Linear and nonlinear mixed effects models . R package version 3.1 - 113, 2013] in the r computing platform (http://www.r-project.org). Our a priori primary hypothesis regions included those well known to atrophy in early ad such as the hippocampus, amygdala, entorhinal cortex and cortical gray matter . There were no significant differences by fh for gender, years of education, or mmse score . There was a difference in age (p = 0.05), and as expected there was an overrepresentation of the apoe4 allele in fh+ subjects (p = 0.002). Total follow - up was up to 48 months, and the mean follow - up time for the fh group (27.8 months) was not significantly different from the fh+ group (29.5 months, p <0.25). As shown in the first three columns in table 2, most brain regions showed a significant atrophy over time (i.e. Base rate). Age and gender, subjects with a positive fh had greater atrophy of the cerebral cortex (p <0.009), amygdala (p <0.01), entorhinal cortex (p <0.01) and hippocampus (p <0.053). Table 3 depicts the estimated effects and significance of apoe 4 + and fh on longitudinal atrophy rates . In this model, some 15 regions showed a significant apoe4 + effect including all the predicted primary regions (such as the hippocampus, amygdala, entorhinal cortex and cerebral cortex). However, none of the primary predicted regions showed a significant fh effect in this model and the atrophy rate attributable to fh was considerably smaller than that attributable to apoe4 . 1 compares atrophy rates due to apoe4 + versus those due to fh+ it shows that most fh effects are small relative to apoe4 + effects, as evidenced by the wider spread of apoe4 + effects while most fh+ rates remained close to zero . Table 4 summarizes the model when fit to only 3 homozygotes there was no significant fh effect on any predicted region and effect sizes (cohen's d) ranged from 0.05 to 0.22 . For example, the fh effect size on the amygdala atrophy rate was 0.17 (p <0.14). Exploratory analyses comparing the effect of fh in apoe 4 + versus 3/3 subjects showed that some regions exhibit a slightly greater fh effect on atrophy in the 3/3 group (e.g. Amygdala) whereas some other regions have a greater fh effect in the 4 + group (e.g. Hippocampus) but none of these were statistically different . Duration of follow - up available for cognition was longer than that available for mri scans and we examined the baseline and last available time point within the 4 year window . Duration of follow - up tended to be longer in fh+ subjects (mean 43.7 months) than fh subjects (mean 38.5 months) (p = 0.02). Fh+ subjects (57%) had numerically higher rate of conversion from mci to dementia than fh subjects (45%) but the difference was not statistically significant . Fh+ subjects (mean 7 points 10) had numerically greater decline in cognition (adas - cog) than fh subjects (mean 5.7 points 9) but the fh effect was not statistically significant in a multivariate model with age, gender, education, baseline cognition, e4 and time . Gender and apoe4 genotype (p = 0.313) were significant in this model . To our knowledge, this is the first national long - term (up to 48 months) examination of the effects of fh on atrophy rates of multiple regions in mci subjects at risk for future ad . We found that a positive fh was associated with accelerated atrophy rates for three key structures (amygdala, hippocampus, and entorhinal cortex) plus cortical gray volume in mci but that the residual fh effect on atrophy rate, after covarying for apoe e4, was no longer significant for any brain structure . We also found that in the subset of apoe3 homozygotes, there was no significant fh effect on any key structure . These data suggest that any missing heritability within fh (other than apoe4) for explaining atrophy rate in mci subjects is likely to be quite small and nonsignificant . Lastly, given the large size of the main e4 effect relative to the main fh effect in mci subjects, our data suggests that much of the e4 effect may not be contained wholly in the fh effect . There appeared to be a weak interaction between apoe status and fh in that the effect of fh on amygdala atrophy rates seemed larger in e3 homozygotes than e4 carriers, but this too was not significant . Prior studies of fh effects on csf [reviewed in lampert, 2013] and fdg - pet [reviewed in mosconi, 2007] biomarkers have generally found consistent changes . However, prior studies of fh effects on longitudinal hippocampal atrophy rates have yielded potentially conflicting findings (honea, 2011; andrawis, 2012; okonkwo, 2012). Honea (2011) found a positive effect for maternal fh, independent of e4 status, on 2-year hippocampal atrophy rate in normal controls and proposed that this supported the mitochondrial hypothesis of ad . Andrawis (2012) did not find a significant effect of fh on 1-year atrophy rates in normal controls or ad patients but did find an effect for maternal fh in mci subjects . Yet another study of normal middle - aged adults, by okonkwo (2012), found a fh effect on atrophy only in a posterior subregion of the hippocampus and only in e4 subjects there was no fh effect in e4 + subjects . In addition, okonkwo et al . Found no significant difference between maternal and paternal fh on atrophy rate (okonkwo, 2012). The follow - up in okonkwo's study was 4-years and longer than prior studies but their controls were younger . These studies relied on just 2 mri scans (baseline and follow - up) to extract atrophy rates . Our study extends these data by examining mci subjects over a longer follow - up period (3 mri scans and up to 48 month follow - up) and by examining multiple brain regions . The use of 3 mri scans over this period may have allowed for a more accurate estimate of the slope of change than in prior studies . Further, our examination of 20 different brain regions allowed us to examine changes in regions associated with cognitive brain circuits known to be affected early in ad . Overall, our data do not support a significant residual (after covarying for apoe status) fh effect on rates of atrophy of any key brain region . Since we did not examine maternal versus paternal fh a strength of this current study is the use of a relatively large sample of carefully selected mci subjects, data collected in a standardized manner from many sites across the country, multiple imaging time points, and relatively long duration of follow - up . Fh status was ascertained via interviews with the subjects and their study partners, so it is possible that there may have been a reporter bias (for example, some respondents may not know the difference between ad and dementia). That said, our findings are still relevant because fh is collected by simple history in most clinics and biomarker research studies . We studied only mci subjects and did not examine interactions of fh with amyloid or tau phenotypes . Prior studies have shown that amyloid positivity may be linked to e4 status [reviewed in lampert, 2013] and accelerated atrophy [reviewed in honea, 2011], and so it is conceivable that there may also be an interaction of amyloid status with fh . We also did not analyze subregions of the hippocampus and hence could not directly test findings that fh might affect only specific subregions (okonkwo, 2012). We also did not examine the effect of fh on glucose metabolic status, another marker that has been linked to fh (mosconi, 2007). Thus, our findings cannot be generalized to other biomarkers or other diagnostic groups . As stated earlier, we did not test maternal versus paternal fh since we did not collect that data . Likewise, we were unable to test parental versus sibling fh as there is a vast majority of patients with an affected parent (n = 51 parental, n = 9 both, n = 18 sibling; 77% parental) and therefore not enough power to separate the two . Future directions of this study should include further analysis to determine if there are other genetic factors (e.g. Whole genome data) in addition to apoe4 that predict atrophy rates in brain regions susceptible to ad as well as studies examining the effect of fh on multiple biomarkers (mri, csf, pet) over longer periods of time . Since fh has been linked to beta - amyloid positivity and amyloid deposition in turn has been linked to atrophy, future studies should examine fh effects in healthy controls who are amyloid positive (i.e., preclinical ad). Only a subset of adni-1 subjects had csf or amyloid pet data . Adni2, where every subject underwent florbetapir pet, will allow for a better test of this theory in the near future . Such information may serve to further improve personalized testing and drug development for at - risk patients . Experimental regionsabbreviationhippocampus total volumehippocampus.total.volamygdala total volumeamygdala.total.volentorhinal cortexentorhinal.cortex.taparahippocampal taparahippocampal.taposterior cingulate taposterior.cingulate.taprecuneus taprecuneus.tasuperior.parietal tasuperior.parietal.tasuperior.temporal tasuperior.temporal.tatemporal.pole tatemporal.pole.tatransverse.temporal tatransverse.temporal.tacerebral cortex total volcerebral.cortex.total.volfusiform gyrus tafusiform.gyrus.tainferior parietal tainferior.parietal.tainferior temporal tainferior.temporal.tamiddle temporal tamiddle.temporal.tacerebellar cortex (total volume)cerebellar.cortex.total.volcerebellar white mater (total volume)cerebellar.wm.total.volumepericalcarine cortexpericalcarine.tapostcentral gyruspostcentral.taprecentral gyrusprecentral.ta
Aneurysms of the internal carotid artery (ica) in the middle ear are uncommon vascular anomalies and are difficult to detect and treat the causes of aneurysms are multiple and include atherosclerosis and dysplastic, traumatic, and infectious lesions . Differential diagnosis should include a glomus tumor (tympanic, jugular or both), or other vascular temporal bone lesions such as a dehiscent jugular bulb, cholesterol granuloma, petrous carotid aneurysm, pseudoaneurysm, arteriovenous malformations or hemangioma . Otoscopy may reveal a normal tympanic membrane with a mass in the middle ear that, in some cases, is pulsating . Imaging studies are fundamental for diagnosis and can define the nature and origin of these lesions . High resolution computed tomography angiography (cta) is the technique of choice and, in some cases, can be complemented with a magnetic resonance angiography (mra). In this article we describe an asymptomatic case of aneurysm of ica treated successfully by middle ear surgery . A 50-year - old female was referred to the emergency room of ent department of cluj- napoca for massive left otorrhagia started a few hours before presentation . There was no medical history of tinnitus, vertigo, otalgia, or otorrhea, or any history of trauma or surgery of the head and neck . Recent psychological trauma (death of her father) with high blood pressure of 210/100 mm\hg was revealed at presentation . Fresh blood flowed out from the left ear during a short period and hemostasis was accomplished with difficulty using compressive cotton balls . Release of the compress resulted in relapse of the bleeding . A micro - otoscopic examination of the left ear showed a perforation at the level of the antero - inferior quadrant of the tympanic membrane with a red pulsatile mass . An audiogram revealed a left - sided conductive hearing loss of up to 30 db, whereas tympanometry showed a type c tympanogram with a low amplitude . Computed tomography angiography (cta) showed an aneurysm of the internal carotid artery protruding into the middle ear and a massive hematoma of the mastoid cells . After the patient had been given a thorough explanation about the risks of ica injury during surgery, she provided an informed consent, and middle ear surgery was performed . A partial mastoidectomy canal wall down with evacuation of the left middle ear hematoma was performed (figure 1). A complete package of the middle ear and the mastoid cavity with merocel, surgicel, gelfoam and temporalis muscle fascia and a left anterior and posterior nasal package was also performed during surgery . After three days the patient underwent another computed tomography angiography . A complete obstruction by a massive thrombus of the left internal carotid artery at 1.2 cm from the bifurcation to clinoid area was revealed without any focal neurological deficits or stroke (figure 2). The anterior and posterior nasal package was suppressed two days after surgery . The follow - up magnetic resonance angiography (mra) 6 months later revealed the thrombosis of the left ica with new collateral vascularization in the left cerebral territory of ica by circle of willis (figures 3 and 4). The preponderance of men is clear in the literature, with a male / female ratio of 2:1.3 . The different causes and especially the traumatic lesions explain the relatively young age of this population, 56 years old . Aneurysms of the extracranial carotid artery can be partially or completely thrombosed, can cause distal embolization, or compression of adjacent structures, and can be ruptured . Before the introduction of antibiotics, dysplastic lesions appeared to be the main cause of aneurysms of the ica . In the experience of lotina et al . Depending on the size and location of the aneurysm, the direction of its growth, and the specific adjacent structures involved, patients may or may not present signs and symptoms . Our patient direct compression or anterior and posterior nasal package may not be able to stop the bleeding . In that situation a patient may enter a critical condition following hemorrhagic shock or respiratory failure . In our case, the appropriate management strategy for these rare lesions is unclear . In the cases reported until now most patients were treated with revascularization of the carotid artery using vein bypass grafts to reduce the risk of acute ischemic complications, but there are also cases treated without vascularization . Successful treatment usually involves selective aneurysm embolization or carotid closure with detachable balloons . In our case middle ear surgery was effective in resolving bleeding and did not cause any permanent neurological deficit . Because of the high blood pressure and the thrombosis of the left ica after surgery an antihypertensive (enalapril 10 mg) and antithrombotic (aspirin cardio 100 mg) chronic medication was mandatory in this case . Aneurysms of the ica in the middle ear are rare and difficult to treat because the anatomy of the region and life threatening complications after surgery . Otologists should be aware that symptoms and signs such as pulsatile tinnitus, conductive hearing loss, and a pulsatile retrotympanic mass in the anteroinferior part may be related to an ica aneurysm . Thus, ica aneurysm, which is asymptomatic most of the time, will be diagnosed during middle ear surgery or a routine otoscopy or complications like otorrhagia . Misdiagnosis of the ica aneurysm may lead to serious morbidity because of bleeding or vascular occlusion . Long - term follow - up is necessary to look out for delayed post treatment complications.
Is there a formula for turning young people from diverse backgrounds into scientists? As our country s demographics change, and as so - called minorities become majorities in many locations, it might be argued that our cultural differences make a one - size - fits - all educational strategy sound nave and even insensitive . Yet there are some similarities among successful youth programs that might serve as good examples to follow . One program that is showing great promise in engaging urban teens of various ethnicities in meaningful science activities, including some citizen - science work, and steering them into science, technology, engineering, and mathematics (stem) careers is the science career continuum (scc) at the chicago botanic garden . The scc is an extracurricular program that strives to prepare a new generation of scientists, representing all ethnic backgrounds, and provide them with the education and training needed to address the environmental and conservation challenges of our time . For 20 years, this grant - funded program for students attending chicago public schools has offered an opportunity to explore science - related programs at the chicago botanic garden (the garden). Participant selection has targeted african - american and latin american youth who have expressed an interest in science and nature, with preference given to students from lower - income households and who are the first in their families to attend college . Most of these students do not have family members who could help them make college selection and course choices for science majors because they are unfamiliar with the field . The scc includes three programs that a student may participate in for five or more years . It begins with science first, a four - week summer day camp for 40 students who are entering grades 8, 9, or 10 in the fall . Students engage in the content and practices of science while also studying environmental issues in their lives such as the impact of climate change or the availability of quality grocery stores and health care services in urban neighborhoods . Recent projects have included measuring the effectiveness of different insulating materials, testing and comparing the effectiveness of different weed - control practices, and studying the pollinator - attraction properties of flowers . Twenty students in total are selected to continue with an eight - week program, college first . They may be those who showed the most enthusiasm and promise while participating in science first, similar qualified students from comparable programs at other institutions, or a mix of the two . Selection is based on the work students contributed to the science first research project or city science fair, class participation during the summer, and other behaviors that demonstrate a commitment to returning to the garden for a summer of engagement with a summer science research project before their junior and senior years of high school . College first combines a college environmental field study course with an extended research project working alongside garden professionals . Some students may perform dna tests and analyze results to assist researchers in measuring the genetic diversity of a jackfruit tree population in bangladesh, which is a concern of the agricultural community there, while other students may assist with ongoing research on the impact of the invasive asian buckthorn tree and its ability to alter soil and air conditions and harm native species . Still other students might help their mentors assess the conditions of local ravines in order to recommend remedial work, or sprout seed samples from the seed bank collection in order to measure the viability of seeds exposed to long - term extreme cold storage . College first students also attend monthly meetings during the school year to learn about college selection, application, and the financial aid that they will need to pursue their passion for doing this kind of work . The third formal program in the scc is a ten - week research for undergraduates (reu) program . Three students who have successfully completed college first, are declaring a science major, and have demonstrated academic achievement in college are selected for the program . Students work with scientists and graduate students to do independent research on topics related to their mentors research, such as plant pathology, genetic diversity, or soil quality . Garden educators have used a variety of methods and indicators to determine student progress and program effectiveness, including content knowledge assessment, attitude surveys, and science grades in school . 100% of scc students graduate high school, as compared with the chicago public school rate of 66% in 2014 (1). Furthermore, 94% of scc alumni enrolled in college within a year after high school graduation, with 66% choosing to major in a stem field . To understand what makes the scc and similar programs successful, the garden gathered together 32 institutions with stem - focused youth programs to compare successes and identify best practices for encouraging students to pursue stem careers . The hive chicago - funded pathways to stem success (2) wrapped up in early 2015 with a list of recommendations for successful recruitment, retention, and release of students from our programs . First, scc identifies individuals who demonstrate interest and aptitude in science while they are in middle school, when they are beginning to understand their own interests . Students at this age may be influenced by peers who do not share the same interests and may discourage science - minded students from participating in science at school . The scc pools students from different schools into an affinity group of diverse students that will encourage each other s passion for the subject matter . Students are introduced to stem careers early in the program so they have time to acclimate to the idea that this may be an exciting and attainable career choice . Being able to do the work alongside science professionals and college students enables participants to imagine working as professionals in these fields one day . The scc makes science learning accessible by providing transportation and financial support so that there is no cost to the students . Moreover, it conquers emotional barriers by establishing a safe community of like - minded students who come from different backgrounds and feel comfortable sharing their interests with each other . College first students get to work with scientists, professionals, and older students, participating in science research, horticulture, and interpretation programs that are happening every day at the garden . A second critical element in any stem pathway program is retention of students . The scc achieves continuity through the multi - year format and by providing challenging educational experiences with increased expectations each year . Students receive mentoring from professional staff as well as students who are at the next level of the program their near peersreinforcing the continuity, accessibility, and nurturing aspects of the program . This support extends to the group of students within their own cadre . A recent youth program quality assessment (ypqa) the ypqa is a self - assessment tool used to measure a program s strengths and weaknesses based on a set of established metrics for successful youth programs . The ypqa examines student engagement, safety, rapport with instructors, personal interaction, and other factors that prove significant in youth programs . The study is used internally by the institution to improve the program and, as such, is not published . The scc ypqa revealed that students form a bond of friendship and stay in touch with each other outside of the program . This is despite coming from different ethnic backgrounds, attending different schools, and living in distant neighborhoods, and demonstrated for garden staff that the program is building support between program participants it is not enough to offer a program and turn students loose without any further support . Best practices tell us that how we release students is as important to their success as how we recruit them . Scc staff members remain in contact with alumni and help connect these former students to internships and other opportunities as appropriate . Best practices also dictate that programs should be flexible to various outcomes of success for participants . Scc staff members recognize that not all students will become scientists, but all of them leave the program more confident in their abilities, more scientifically literate, and motivated to pursue their interests . The scc has shown that when students from diverse backgrounds are given an opportunity to participate in real scientific research under the mentorship of a caring professional over multiple years, they are better able to envision themselves pursuing stem careers . By establishing a community of learners who share a passion for science and support each other s personal achievement, the scc expands participants notions of what is possible and brightens their futures, regardless of career choices they make.
Calcium - dependent potassium (kca) channels are known to form complexes with voltage - gated calcium (ca) sources . These interactions are important in linking the voltage - dependent and temporal properties of ca influx to kca channel activation, allowing the kca channel to respond rapidly and effectively to ca channel activity . Big conductance kca (kca1.1) channels are both voltage- and ca - dependent and were known to complex with high voltage - activated (hva) ca channels . Recently, we showed that kca1.1 channels also form a physical complex with low voltage - activated (lva) cav3 t - type ca channels, as shown through coimmunoprecipitation . Interaction with cav3 ca channels was shown to allow kca1.1 channels to be activated at voltages as low as -70 mv, 3040 mv lower than the activation threshold seen for kca1.1-cav2.1 complexes . This low - voltage kca1.1 activity, which extended into the subthreshold region, was seen in both a heterologous expression system and neurons of the medial vestibular nucleus (mvn). While determining the properties of the kca1.1-cav3.2 complex, we compared the effectiveness of 2 different ca chelators, egta and bapta, at disrupting ca - dependent activation to help distinguish between a nanodomain and microdomain interactions . It is understood that the ability to block a ca - dependent process by internal perfusion of bapta, but not egta, indicates an interaction between partners at the nanodomain level (2050 nm). If, instead, the interaction is blocked by internal egta, it suggests an interaction with the ca source at the level of a microdomain (> 50 nm). Coimmunoprecipitation between kca1.1 and cav3 channels even from lysates of tsa-201 cells expressing only the subunits revealed a close physical association expected for a nanodomain interaction . Yet internal egta was found to block ca - dependent activation of kca1.1 current in either tsa-201 cells or mvn neurons, raising an apparent contradiction in the data set . Activation of kca1.1 channels requires an increase in the concentration of internal ca [ca]i of 110 m . We considered that the chelator test results might reflect the relative strength of cav3 channels as a ca source, such that the transient ca current and relatively low conductance of cav3 channels may reduce the ability to activate kca1.1 channels . To test this we constructed a model of the kca1.1-cav3 interaction and found that multiple cav3 channels are required to provide reliable activation of kca1.1 channels, perhaps acting cooperatively over larger distances . Here, we expand on the model briefly presented in rehak et al . (2013) to compare the properties of a kca1.1-cav3.2 complex to that of a model for kca1.1 activation by the hva cav2.2 (n - type) ca channel . The kca1.1-cav complexes were modeled using systems of differential equations describing the activation and inactivation of the included ion channels, as well as diffusion of ca from the ca source . For all simulations, eca = 40 mv and currents were calculated according to the hodgkin huxley formulism . Simulations were constructed in matlab r2007b using a fourth - order runge - kutta algorithm with a time step (dt) of 0.0001 ms . The maximum open probability (pmax) for cav3 channels was set to 0.25 and cav2.2 channels to 0.8 . To calculate calcium influx, single channel conductance was set to 1.7 ps for cav3 channels (cat = 1.7 ps) and 2.8 ps for cav2.2 channels (can = 2.8 ps). To simulate multiple cav channels, was multiplied by the number of desired channels . The number of incoming calcium ions (nca) was determined by: nca = g^mhpmax(veca)2fwhere f is the faraday constant (9.649 10 coulombs / mol). The following explicit equation was used to calculate diffusion: d[ca2+]ndt = dcaan, n+1vnn, n+1([ca2+]n[ca2+]n+1)where dca is the diffusion coefficient for ca (0.220 mms), an, n+1 is the surface area between the adjacent compartments, vi is the volume of the first compartment, n, n+1 is the distance between compartments, and the term in the brackets represents the concentration gradient . The radius of the smallest compartment was 20 nm and the radius of each consecutive compartment was increased by 20 nm . The kca1.1 channel was placed in a compartment n and its activation calculated based on [ca]n, as described below . Therefore, the effect of ca on kca1.1 channels could be observed for distances of up to 200 nm from the ca source by changing the compartment in which the kca1.1 channel was located . The parameters for voltage- and ca - dependence of kca1.1 channels previously described for purkinje cells were used to develop a model of the kca1.1 channel . The equation for was adapted from a previous model of a kca1.1 channel . The ca - dependence for v1/2 the relationship between the v1/2 of activation and ca concentration (in m) can be described by the equation: the maximum value of popen for a given voltage over all concentrations of ca is given by the equation: using pmax and the dissociation constant of ca at a given voltage, kd, the maximum popen for a given [ca] is: finally, the activation rates and time constant,, are: the differential equation to describe the activation variable of kca1.1 channels, m, is therefore: this model generates a complex voltage- and ca - dependent relationship for kca1.1 activation, as seen in figure 1a . In particular, increasing [ca]i causes a hyperpolarized shift in kca1.1 half - activation and increase in pmax consistent with physiological recordings of kca1.1 channel properties . (a) the voltage- and ca - dependence of the kca1.1 model is shown . Increasing [ca]i results in a left - shift in voltage - dependence of kca1.1 activation with maximal shift between 10 and 100 m . (b) a diagram of the kca1.1-cav model showing the diffusion of ca through multiple hemispherical compartments . The kca1.1 channel is placed in a compartment and its activation calculated according to the local [ca]. Ca diffusion away from the cav ca source was modeled through 10 hemispherical compartments . The following explicit equation was used to calculate diffusion: d[ca2+]ndt = dcaan, n+1vnn, n+1([ca2+]n[ca2+]n+1)where dca is the diffusion coefficient for ca (0.220 mms), an, n+1 is the surface area between the adjacent compartments, vi is the volume of the first compartment, n, n+1 is the distance between compartments, and the term in the brackets represents the concentration gradient . The radius of the smallest compartment was 20 nm and the radius of each consecutive compartment was increased by 20 nm . The kca1.1 channel was placed in a compartment n and its activation calculated based on [ca]n, as described below . Therefore, the effect of ca on kca1.1 channels could be observed for distances of up to 200 nm from the ca source by changing the compartment in which the kca1.1 channel was located . The parameters for voltage- and ca - dependence of kca1.1 channels previously described for purkinje cells were used to develop a model of the kca1.1 channel . The equation for was adapted from a previous model of a kca1.1 channel . The ca - dependence for v1/2 the relationship between the v1/2 of activation and ca concentration (in m) can be described by the equation: the maximum value of popen for a given voltage over all concentrations of ca is given by the equation: using pmax and the dissociation constant of ca at a given voltage, kd, the maximum popen for a given [ca] is: finally, the activation rates and time constant,, are: the differential equation to describe the activation variable of kca1.1 channels, m, is therefore: this model generates a complex voltage- and ca - dependent relationship for kca1.1 activation, as seen in figure 1a . In particular, increasing [ca]i causes a hyperpolarized shift in kca1.1 half - activation and increase in pmax consistent with physiological recordings of kca1.1 channel properties . Figure 1 . (a) the voltage- and ca - dependence of the kca1.1 model is shown . Increasing [ca]i results in a left - shift in voltage - dependence of kca1.1 activation with maximal shift between 10 and 100 m . (b) a diagram of the kca1.1-cav model showing the diffusion of ca through multiple hemispherical compartments . The kca1.1 channel is placed in a compartment and its activation calculated according to the local [ca]. The distance between hva cav channels and kca1.1 channels required to generate kca1.1 activation and effects of ca chelators has been solved analytically in previous studies . Here, we were interested in modeling the effects of varying the interchannel distance between either hva (cav2.2) or lva (cav3.2) ca channels and kca1.1 channels . In this way, we could determine how the properties of a ca source affect the voltage - dependence and temporal properties of kca1.1 channel activation . The cav - mediated ca source was modeled using 10 hemispherical compartments of increasing radii (20200 nm; fig . 1) and kca1.1 channel activation was calculated based on [ca]i in a compartment . While this model did not include ca buffers, it provides an estimation of the minimum distances and number of channels required to produce kca1.1 activation . The parameters for cav2.2 channels were drawn from the studies of references 8, 9, and 11, and cav3.2 channels from experiments (data not shown) and reference 10, and kca1.1 channels from references 6 and 7 . We first compared the activation properties of kca1.1 by a single cav3.2 or cav2.2 channel as a ca source at a fixed distance of 20 nm, which would correspond to direct juxtaposition of a cav and kca1.1 channel . Cav3.2 channels have a small single channel conductance (1.7 ps) and exhibit rapid and complete inactivation . At a distance of 20 nm from kca1.1 in the model, a single cav3.2 channel only caused a slight increase in the open probability (po) of the kca1.1 channel, reaching just 0.06 of maximal conductance (fig . Cav2.2 channels have a much higher single channel conductance, maximal po, and inactivate slowly . A single cav2.2 channel at 20 nm distance from a kca1.1 channel was thus able to increase the kca1.1 po to 0.14, or twice that of a single cav3.2 channel (fig . Kca1.1-cav3.2 complexes (18 channels at 20 nm, left) show significant activation in low voltage ranges . Kca1.1-cav2.2 complexes (18 channels at 20 nm, right) only show activation for voltages more positive than -40 mv . Kca1.1-ca2.2(8; 20 nm) has a greater maximal activation than the kca1.1-cav3.2(8, 20 nm) model . (b) increasing the distance between the kca1.1 and cav3.2 or cav2.2 channels to 40 nm significantly decreases the maximal activation of kca1.1 channels over all voltages . (c) plots of the maximal po for cav3.2 (left) or cav2.2 (right) channels when different numbers of channels are included in the complex . Kca1.1-cav2.2 complexes generate greater kca1.1 activation when compared with kca1.1-cav3.2 complexes with the same number of channels . It has been proposed that multiple cav channels may complex with kca1.1 channels, as much as 1 cav channel per kca1.1 -subunit . Indeed, increasing the number of cav3.2 and cav2.2 channels in the model (see methods) resulted in a significant increase in kca1.1 activation . Thus, a kca1.1-cav3.2 complex with 4 cav3.2 channels at 20 nm distance (kca1.1-cav3.2[4; 20 nm]) reached a peak of only 0.49, while a model of 4 cav2.2 channels complexed with the kca1.1 channel at 20 nm (kca1.1-cav2.2[4; 20 nm]) reached a maximum of 0.69 . However, multiple cav3.2 channels generated significant kca1.1 activation at voltages as low as -50 mv (fig . Kca1.1-cav2.2 complexes, on the other hand, only showed activation for voltages positive to -30 mv (fig . Overall, these results show that the higher single channel conductance of a cav2.2 channel allows a single channel to be much more effective at activating a nearby kca1.1 channel than does a cav3 channel . In fact, multiple cav3 ca channels are required to provide significant activation of kca1.1 channels . The voltage - dependence of the ca channel is also reflected in kca1.1 activation, such that cav3 channels are capable at activating kca1.1 channels from lower voltage than cav2.2 channels . The distance between the kca1.1 channel and its ca source is an important factor determining kca1.1 activation . Therefore, we tested the effects of increasing the distance between cav and kca1.1 channels . At a distance of 40 nm (within a nanodomain), both the kca1.1-cav3.2 and kca1.1-cav2.2 models showed much weaker activation of kca1.1 than for a 20 nm separation (fig . The kca1.1-cav3.2(4; 40 nm) complex reached a peak of only 0.12, or 23% of the maximal activation of the kca1.1-cav3.2(4; 20 nm) complex (fig . Likewise, the kca1.1-cav2.2(4; 40 nm) complex reached a maximum of 0.24 compared with 0.69 at 20 nm separation (fig . Therefore, ca - dependent activation of a kca1.1-cav complex depends strongly on interchannel distance and is sensitive to even small differences in separation, with the largest effect on cav3 as compared with cav2.2 containing complexes (fig . Cav3.2 channels show fast activation and a short time constant of inactivation while cav2.2 channels show inactivation, but to a lesser extent and over a greater timeframe . A series of voltage steps provided to the kca1.1-cav3.2(4; 20 nm) model revealed a kca1.1 channel current that also showed fast activation followed by rapid inactivation within 100 ms . This is important in confirming that the properties of the cav3 channel were conferred to the kca1.1 channel (fig . 3a), as found in mvn neuron and tsa-210 cell recordings . On the other hand, the kca1.1-cav2.2(1; 20 nm) model showed slower inactivation of k current with significant activation still observed after 300 ms (fig . As previously reported, no significant activation was detected below -30 mv for the kca1.1-cav2.2(1; 20 nm) complex, again confirming direct recordings . Increasing the number of cav2.2 channels resulted in a slowing of inactivation for the kca1.1-cav2.2 complex, which was not seen for an increased number of cav3.2 channels (fig . This is due to the larger conductance of cav2.2 channels and build - up of [ca]i with a large number of cav2.2 channels . (a) a kca1.1-cav3.2(4; 20 nm) complex generates a transient current which inactivates within 100 ms . (b and c) kca1.1-cav2.2 complexes (1 or 4 channels; 20 nm) generate long - lasting kca1.1 activation with slow inactivation kinetics . When 4 channels are included in the model, the rate of inactivation of kca1.1 is slowed for depolarized voltages . Significant kca1.1 activation can only be seen beyond -40 mv, as expected for a k current that follows the voltage - dependence of the hva ca source . The results shown in rehak et al . Demonstrated a coupling of kca1.1-cav3.2 channels in a complex as determined by coimmunoprecipitation of -subunits, suggesting a nanodomain interaction . This was further supported by a cav3-dependent activation of kca1.1 current in the form of a low voltage - activated and fast inactivating kca1.1 current . The model is also consistent with these results and shows that, when sufficient ca influx is present, the voltage - dependence and kinetics of kca1.1 channel activation resembles that of an lva cav3 ca channel . A similar conferring of voltage - dependence by different hva ca channels upon kca1.1 channel activation was previously reported . Paradoxically, the cav3 activation of kca1.1 current could be blocked with as little as 5 mm egta, a result usually interpreted as reflecting a microdomain interaction between subunits (reviewed in ref . The modeling results in rehak et al . And the current study support experimental results in predicting that multiple cav3 channels are necessary to cause significant kca1.1 activation . However, this model simulates an optimal solution where up to 8 ca channels provide ca influx to the intracellular volume immediately surrounding the kca1.1 channel, which may not be physically feasible (in fact, a 4:1 cav - kca1.1 stoichiometry is likely the limit). Furthermore, increasing the distance significantly diminished kca1.1 activation, suggesting that an even greater number of cav3 channels may be required if the cav - kca1.1 distance is increased . Based on the effect of egta and the modeling results, we theorize that the ca domains of multiple kca1.1-cav3.2 complexes cooperate to provide sufficient increases in [ca]i to cause kca1.1 activation . This cooperation of ca microdomains would be sensitive to slower ca chelators like egta, yet still allow for physical association between kca1.1 and cav3 channels . Consistent with published results, models of cav3 and cav2.2 channels showed differences in their activation of kca1.1 channels, reflecting the predicted amount of the ca influx generated by either channel subtype . The relatively high conductance of the hva cav2.2 channel and slow rate of inactivation compared with the low conductance, fast inactivating cav3 channel allows cav2.2 channels to interact with kca1.1 channels from a farther distance than a cav3 channel source . In fact, a similar conclusion was drawn for the importance of the conductive properties of a specific ca source capable of activating sk channels when comparing the large conductance nmda or 9/10 nicotinic acetylcholine receptors to that of hva ca channels . In the case of cav3 ca channels, we interpret this to indicate that the relatively weak and transient t - type ca conductance must increase its effectiveness by creating cooperative microdomains, an association more liable to block by egta . The potential for kca1.1-cav complexes to cooperate to generate sufficient activation requires further examination and opens the possibility for kca1.1 regulation by other ca sources which have previously been thought insufficient.
Ligamentous stabilizers of the knee mainly include anterior cruciate ligament (acl); posterior cruciate ligament (pcl); posterolateral complex (plc) composed of lateral collateral ligament (lcl), popliteal tendon and popliteofibular ligament; posteromedial complex (pmc) comprised of superficial medial collateral ligament (smcl), deep medial collateral ligament (dmcl) and posterior oblique ligament (pol).1234 multiple ligament injuries typically involve more than 2 of the main 4 ligamentous structure, arising from an acute knee dislocation caused by violent trauma . However, the ligaments injured vary greatly from one patient to another due to discrepancy in the magnitude of trauma, direction of the violent forces and position of the affected limb at the time of injury.56 additionally, each patient who suffers from multiple ligament injured knee has his own individual character, including socioeconomic state and general health condition, associated with the distinctive requirement of lower extremity function for daily activity . Surgical strategies could be divided into 3 major categories as follows: (1) all injured structures were repaired or reconstructed in a single stage of operation (the one - stage) (2) involved ligaments were repaired or reconstructed, respectively, in two stages of surgery (the staged) and (3) only extraarticular (ea) ligaments were repaired or reconstructed (the ea). We conjectured that personalized surgical treatment for multiple ligament injured knee should attain a rational clinical consequence . 32 consecutive patients with multiple ligament injured knee without concomitant neurovascular injuries were surgically treated based on personalized protocols from october 2001 to february 2011 . The actual surgical procedure for each patient was selected according to the result of comprehensive surgeon patient discussion . Of them, 12 patients, who were in good general health condition, excluded local severe contusion of soft tissue, infection and injuries to other parts of the body, associated with a high level of requirement in daily activity, were assigned to the one - stage group . Eleven patients who could not endure a single stage of surgical treatment due to systemic diseases in three cases such as diabetes and hypertension, multiple injuries of the body in three cases and social or financial problems in 5 patients, were enrolled into the staged group . Nine patients who had been planned to the staged surgeries, however, refused the further operation due to satisfaction with the outcome of the primary stage of operation were included into the ea repair group . Information of the patients in each group, including age, gender, interval from injury to the primary surgery, knee laxity and functional scores are documented in detail in tables 13 . The quantitative data of 32 patients and comparison among groups the enumeration data of 32 patients and comparison among groups the ranked data of knee laxity in 32 patients and comparison among groups first, a thorough arthroscopic examination of the affected knee was conducted to confirm the exact position and extent of the ligamentous rupture [figures 1a, b and 2a]. The structures involved and surgical procedures performed in the 32 patients are listed in table 4 . Nonetheless, none of them had concomitant full damage of the 4 major ligaments . (a) both anterior cruciate ligament and posterior cruciate ligament were completely torn, associated with subluxation of the knee . (b) abnormal widening of the posteromedial compartment with the normal attachment of the medial meniscus on the tibial plateau was shown under arthroscopy . (c) after creating femoral and tibial tunnels for both anterior cruciate ligament and posterior cruciate ligament with preservation of proper remnant, two steel wire loops were individually placed for the introduction of the grafts . (d) after a posteromedial incision on the femoral side was made according to arthroscopic findings, avulsion of superficial medial collateral ligament, posterior oblique ligament, and posterior capsule near to femoral insertion was identified, then, individually repaired by anchor sutures and continuous sutures at knee flexion . (e) grafts of posterior cruciate ligament and anterior cruciate ligament were introduced, tensioned, and secured in normal femorotibial alignment . (f) after accomplishment of all repairs and reconstructions, the medial compartment regained normal space under valgus stress posterolateral complex injuries and reconstruction with biceps tenodesis . (a) arthroscopic examination revealed abnormal widening of the posterolateral compartment with an elevation of the lateral meniscus and torn popliteal tendon . (b) a posterolateral incision was made to expose the biceps femoris; subsequently, the tendon was free with an intact attachment on the fibula head . (c) a bone tunnel was made at the lateral epicondyle, then, the free end of the tendon was introduced into the bone tunnel . Subsequently, the tendon was fixed with an interference screw under continuous tensioning at knee flexion and valgus position . (d) after finishing all repairs and reconstruction, the lateral compartment recovered normal space under varus stress involved structures and surgical methods in 32 patients with multiligament injured knee for ligamentous reconstruction, bilateral hamstring tendon autografts in 9 patients and achilles tendon allograft in 3 patients were used in the one - stage group, while bilateral hamstring tendon in 7, ipsilateral bone patellar tendon bone in 1, ipsilateral hamstring tendon in 1 and achilles allograft in 2 patients were utilized in the staged group . In the one - stage group, all ruptured ligaments, including acl, pcl, pmc, or plc and posterior capsule were repaired or reconstructed at a single stage of operation . After intraarticular debridement with preserving proper remnants of acl and pcl near attachment sites, bone tunnels for acl and pcl on both femoral and tibial sides were, respectively, created outside - in aiming the anatomic insertions [figure 1c]. The grafts were inserted and routed the bone tunnels individually, pcl first, followed by acl . Femoral ends of both acl and pcl grafts were individually fixed with interference screws, whereas the tibial ends of them left unfixed temporarily . Subsequently, a corresponding incision was made to expose injured pmc, or plc and posterior capsule according to the arthroscopic finding [figures 1b and 2a]. For posteromedial injuries, the dmcl, smcland pol were reattached by transosseous sutures, anchor sutures, or washer screws on their femoral or tibial insertions if avulsed from or ruptured near the insertion [figure 1d], or repaired by interrupted sutures combined with tensioning suture if midsubstance tear under physiological tension at 30 of knee flexion . For treatment of plc injuries, plc reconstruction using free tendon graft or by femoral biceps tenodesis was conducted for midsubstance tear of lcl and popliteofibular ligament [figure 2b and c], whereas reattachment was performed for the avulsion from the femoral or fibular attachments . At last, the tibial ends of both the acl and pcl grafts were, respectively, secured with interference screws under constant tension on both of them simultaneously at 10 of knee flexion . After finishing all repairs and reconstructions, a check on femorotibial alignment, passive range of motion (rom) and knee stabilities, including grafts tension and joint space opening under stress [figures 1e, f and 2d], was performed with caution . In the staged group, pmc or plc repair or reconstruction was conducted in the first stage of operation in the same way in the one - stage group . After operation, the affected knee was immobilized with a hinge brace locked at 10 of flexion to avoid tension on repaired structures for 4 weeks, subsequently, rom and other rehabilitative exercises with protection were applied for another 46 weeks . At 810 weeks after the primary operation, rom more than 120 of flexion without deficiency of extension was regained in all of the 11 patients . At the second stage of operation, both acl and pcl were reconstructed under arthroscopy in 9 of the 11 patients, while only the deficient acl in a patient and the pcl in another patient were reconstructed, because the other corresponding cruciate ligament had well healed with proper tension [table 4]. In the ea ligament repair group, just the torn ea ligament was repaired in accordance with the primary operation in the staged group . A power analysis was performed using ncss pass version 11.0 software (ncss, llc, kaysville, ut, usa). As = 0.05 and = 0.2, the sample size in each group was <8 for keeping the power of test more than 0.8 . Preoperative data were compared with those at the latest followup within each group using paired student's t - test for the quantitative data and paired wilcoxon signed ranks test for the ranked data . Furthermore, comparing data among three groups, anova and lsd mean comparison were applied to the quantitative data, while kruskal wallis test and mann first, a thorough arthroscopic examination of the affected knee was conducted to confirm the exact position and extent of the ligamentous rupture [figures 1a, b and 2a]. The structures involved and surgical procedures performed in the 32 patients are listed in table 4 . Nonetheless, none of them had concomitant full damage of the 4 major ligaments . (a) both anterior cruciate ligament and posterior cruciate ligament were completely torn, associated with subluxation of the knee . (b) abnormal widening of the posteromedial compartment with the normal attachment of the medial meniscus on the tibial plateau was shown under arthroscopy . (c) after creating femoral and tibial tunnels for both anterior cruciate ligament and posterior cruciate ligament with preservation of proper remnant, two steel wire loops were individually placed for the introduction of the grafts . (d) after a posteromedial incision on the femoral side was made according to arthroscopic findings, avulsion of superficial medial collateral ligament, posterior oblique ligament, and posterior capsule near to femoral insertion was identified, then, individually repaired by anchor sutures and continuous sutures at knee flexion . (e) grafts of posterior cruciate ligament and anterior cruciate ligament were introduced, tensioned, and secured in normal femorotibial alignment . (f) after accomplishment of all repairs and reconstructions, the medial compartment regained normal space under valgus stress posterolateral complex injuries and reconstruction with biceps tenodesis . (a) arthroscopic examination revealed abnormal widening of the posterolateral compartment with an elevation of the lateral meniscus and torn popliteal tendon . (b) a posterolateral incision was made to expose the biceps femoris; subsequently, the tendon was free with an intact attachment on the fibula head . (c) a bone tunnel was made at the lateral epicondyle, then, the free end of the tendon was introduced into the bone tunnel . Subsequently, the tendon was fixed with an interference screw under continuous tensioning at knee flexion and valgus position . (d) after finishing all repairs and reconstruction, the lateral compartment recovered normal space under varus stress involved structures and surgical methods in 32 patients with multiligament injured knee for ligamentous reconstruction, bilateral hamstring tendon autografts in 9 patients and achilles tendon allograft in 3 patients were used in the one - stage group, while bilateral hamstring tendon in 7, ipsilateral bone patellar tendon bone in 1, ipsilateral hamstring tendon in 1 and achilles allograft in 2 patients were utilized in the staged group . In the one - stage group, all ruptured ligaments, including acl, pcl, pmc, or plc and posterior capsule were repaired or reconstructed at a single stage of operation . After intraarticular debridement with preserving proper remnants of acl and pcl near attachment sites, bone tunnels for acl and pcl on both femoral and tibial sides were, respectively, created outside - in aiming the anatomic insertions [figure 1c]. The grafts were inserted and routed the bone tunnels individually, pcl first, followed by acl . Femoral ends of both acl and pcl grafts were individually fixed with interference screws, whereas the tibial ends of them left unfixed temporarily . Subsequently, a corresponding incision was made to expose injured pmc, or plc and posterior capsule according to the arthroscopic finding [figures 1b and 2a]. For posteromedial injuries, the dmcl, smcland pol were reattached by transosseous sutures, anchor sutures, or washer screws on their femoral or tibial insertions if avulsed from or ruptured near the insertion [figure 1d], or repaired by interrupted sutures combined with tensioning suture if midsubstance tear under physiological tension at 30 of knee flexion . For treatment of plc injuries, plc reconstruction using free tendon graft or by femoral biceps tenodesis was conducted for midsubstance tear of lcl and popliteofibular ligament [figure 2b and c], whereas reattachment was performed for the avulsion from the femoral or fibular attachments . At last, the tibial ends of both the acl and pcl grafts were, respectively, secured with interference screws under constant tension on both of them simultaneously at 10 of knee flexion . After finishing all repairs and reconstructions, a check on femorotibial alignment, passive range of motion (rom) and knee stabilities, including grafts tension and joint space opening under stress [figures 1e, f and 2d], was performed with caution . In the staged group, pmc or plc repair or reconstruction was conducted in the first stage of operation in the same way in the one - stage group . After operation, the affected knee was immobilized with a hinge brace locked at 10 of flexion to avoid tension on repaired structures for 4 weeks, subsequently, rom and other rehabilitative exercises with protection were applied for another 46 weeks . At 810 weeks after the primary operation, rom more than 120 of flexion without deficiency of extension was regained in all of the 11 patients . At the second stage of operation, both acl and pcl were reconstructed under arthroscopy in 9 of the 11 patients, while only the deficient acl in a patient and the pcl in another patient were reconstructed, because the other corresponding cruciate ligament had well healed with proper tension [table 4]. In the ea ligament repair group, just the torn ea ligament was repaired in accordance with the primary operation in the staged group . A power analysis was performed using ncss pass version 11.0 software (ncss, llc, kaysville, ut, usa). As = 0.05 and = 0.2, the sample size in each group was <8 for keeping the power of test more than 0.8 . Preoperative data were compared with those at the latest followup within each group using paired student's t - test for the quantitative data and paired wilcoxon signed ranks test for the ranked data . Furthermore, comparing data among three groups, anova and lsd mean comparison were applied to the quantitative data, while kruskal wallis test and mann no severe complication such as neurovascular damage, compartment syndrome and infection occurred in any one of the 32 patients . The patients were followed up from 18 to 91 months, with an average of 34.7 12.1 months . At the latest followup, no patients had gross mal - alignment or gait abnormalities such as limp, varus thrust, or valgus thrust . Comparing preoperative data versus those at the latest followup, significant improvements in knee stabilities (p <0.01), lysholm score (p <0.01) and international knee documentation committee (ikdc) grade (p <0.01) were noted in all groups . Overall comparisons among 3 groups are shown in tables 13 and 5 . At the latest followup, no statistical difference was found by overall comparison among the three groups in rom, lysholm score, ikdc grade and knee laxity . However, a significant difference in lysholm score was shown between the one - stage group and the ea repair group by multiple mean comparison (p = 0.040). Moreover, comparing knee injury and osteoarthritis outcome score (koos), there were significant differences in subscales of sports and knee symptoms among three groups . Multiple mean comparison showed a significant differences in the subscale of sports between the one - stage group and the ea ligament repair group (p = 0.002), a meaningful difference in the subscale of knee symptom between the one - stage group and the ea ligament repair group (p = 0.005). Various treatments for multiple ligament injured knee have been reported in the literature.7891011 nevertheless, no one of them is universally suitable for every patient.12 we accentuate personalized treatment based on the specific circumstances of the patients . In the present study, significant improvements in knee function and stability were achieved in all of the three groups . However, subscales in koos, including sports and knee symptoms, were markedly different among the three groups at the latest followup, which implied a tendency that the one - stage group was superior to the merely ea repair group in term of knee function . In our opinion, the staged operation with high safety is proper for the patients in relative poor condition, merely ea ligament repair with high cost efficient meets need of the sedentary patients, by contrast, one stage of surgical treatment with the best chance of regaining ligamentous stability is suitable for the young and active patients in the definitive condition . Compared with ea ligament repair or reconstruction, acl / pcl reconstruction had continuously been a hotter topic in the literature for the past decade,131415161718 which might lead to a misunderstanding that the intraarticular ligaments were more essential stabilizers than the ea ligaments for the knee . However, biomechanical studies have confirmed that pmc, plc and posterior capsule are the primary restraints to varus - valgus and rotational displacement near to knee extension, whereas acl / pcl becomes the primary restraint to anterior - posterior displacement and secondary restraint to rotational stability.123419 additionally, 030 of knee flexion meets the need for standing and walking, which mean the ea ligaments might be crucial static stabilizer of the knee for daily activity . As an important finding of our study, 9 patients in the ea repair group got reasonable outcomes without statistical differences in ikdc rates and knee laxity compared with the one - stage and the staged groups . This phenomenon indicates that more attention should be paid to ea ligament repair or reconstruction in the surgical treatment of multiple ligament injured knee . Repair and reconstruction of all injured ligaments in a single stage of operation are complex and time consuming . The key points of the operative techniques include accurate location of the insertions of the reconstructed ligament, restoration of the normal femorotibial alignment, proper tension on the reconstructed ligament and reliable fixation of the grafts . Several authors recommended that acl / pcl should be firstly tensioned at 7090 of knee flexion under fluorographic monitoring for maintaining femorotibial alignment, followed by the tautness of ea ligament at 30 of knee flexion.152021 we also used similar technique in the early treated patients,22 latterly, modified the manipulation as follows: the ea ligaments, including pmc and plc, were firstly tensioned and secured at 30 of knee flexion where it was easy to repair or reconstruct under proper tension . Subsequently, grafts of acl / pcl are simultaneously tensioned and fixed at 10 of flexion, where repaired ea ligaments were tight, associated with interaction of simultaneous tension on both acl and pcl graft during cycles of 1090 of knee motion, to pull the corresponding bone ends to normal femorotibial alignment spontaneously . In the present study, all of 12 patients in the one - stage group regained normal femorotibial alignment and satisfactory stability of the knee . The limitations of this study are: first, this study was only a retrospective analysis on the outcome of surgical treatments grossly classified into three categories . The patients were not randomly assigned to each group . Additionally, even in the same group, there were some variations in the actual structures injured, surgical intervention and individual characters among the patients . Furthermore, the 32 patients were consecutively included in the study only if he or she was definitively diagnosed as more than two ligament injuries of the knee and treated surgically . Moreover, the number of patients included in this study trended to be less for comparing among groups . Consequently, the conclusions drawn from this study need to be verified in further clinical researches . To conclude, surgical treatment based on the specific circumstance of each patient is a reliable modality for multiple ligament injured knee with a reasonable outcome . Repair or reconstruction of the ea ligaments should be paid more attention compared to intraarticular ligament reconstruction . Combined ea and intraarticular reconstruction or / and repair in stages or a single stage is a justifiable treatment for the young and active patients . There are no conflicts of interest.
The defects in maxillofacial region may result due to certain disease, pathological changes, radiation, burns, trauma or surgical intervention . The case reported in this article is a large facial defect resulted from rare severe fungal infection mucormycosis . The primary objectives in rehabilitating the maxillofacial defect patients are to restore the function of mastication, deglutition, speech, and to achieve normal orofacial appearance . Large facial defects are difficult to restore prosthetically due to lack of anatomic undercuts, limited means of retention, mobility of soft tissues, and weight of prosthesis . Various methods of auxiliary retention include eyeglasses, magnets, adhesives, combinations of the above, and implants . Although osseointegrated implants may provide the most reliable prosthesis retention; extensive size of the defect, poor mucosal quality and minimal bony supporting structures, additional surgeries, expenses would result in poor long - term prognosis, particularly for this case . Materials commonly used for fabrication of facial prostheses are acrylic resins, acrylic copolymers, vinyl polymers, polyurethane elastomers, and silicone elastomers, but none of them fulfills all the requirements for a satisfactory prosthesis . However, the advent of silicone has brought us a material that nearly meets the requirements of ideal prosthetic material as outlined by bulbulian . This clinical report describes prosthetic rehabilitation of large midfacial defect with a magnet retained combined two piece acrylic resin - silicone facial prosthesis . A 68-year - old, male patient was referred to department of prosthodontics for orofacial rehabilitation . Complete healing of the surgical wound was found after excision of left maxilla including orbit along with its contents, zygoma and soft tissues including half of the nose, cheeks, upper lip of the ipsilateral side [figure 1a and b]. Mutilation left the patient with restricted mouth opening, orofacial communication resulting in the escape of food and fluids, and thus a nasogastric feeding tube was inserted . Front (a) and lateral (b) view of healed orofacial defect after surgical excision . After precise evaluation of the case, the proposed treatment plan was to construct magnet retained two piece combination prosthesis having hollow acrylic resin framework and a silicone facial prosthesis . The rationale behind fabrication of this two piece tissue supported prosthesis was to avoid invasive techniques leading to recurrence of lesion and also to help distribute the weight of prosthesis and enhance retention with magnets and adhesive as mutual means of retention . This treatment plan also had a future perspective of replacement of silicone prosthesis without repetition of acrylic resin framework fabrication, if required . Impression of the maxillofacial defect and entire face was made first by making facial moulage . For this the face was boxed with hard baseplate wax (truwax baseplate wax, trubyte; dentsply international) and then irreversible hydrocolloid impression material (hydrogum, zhermack) was applied over the face . The impression was reinforced with fast setting dental plaster (for support during retrieval and pouring of impression) [figure 2a c] and working model was obtainedthe working model was then used for fabrication of hollow heat polymerizing polymethyl methacrylate (pmma) (trevalon; dentsply, usa) substructure, the same way as conventional heat cure pmma hollow bulb obturators are made with the lost salt technique . The technique was followed by packing salt in orbit and malar region in substructure and after curing, salt was removed by making holes in resin framework where magnets were planned to be placed . This led to considerable loss of weight of acrylic framework and also there is no need to fabricate the whole prosthesis again in case of discoloration or damage of the silicone layer as the outer silicone layer can be removed and repacked with the new silicon on the acrylic resin framework if the mold is preservedthe resin framework obtained was trimmed, finished, and was then adjusted clinically with the aid of pressure indicating paste to allow complete seating on the face . Facial moulage was then made again to pick up the resin framework in alginate impression material (so as to allow maximum adaptation of prosthesis to tissues for retention and to restore facial features in correct alignment during sculpting in wax and later on in final silicone prosthesis) and was poured to obtain a new working model [figure 3a and b]the three cobalt - samarium magnets, 2.5 mm in thickness (jobmasters, randallstown, md, usa) were embedded in acrylic framework [figure 4]. The counter magnets and modified stock eye prosthesis were then securely positioned with wax on resin framework . The ocular prosthesis was placed into a position that matches the gaze of another normal eye when the patient was directly staring at a point at eye level at least 6 feet away . Patient's previous photographs and the references from his first circle relatives were taken as a guide for shaping the wax pattern . The contour of final surface and skin texture was fabricated by carving in lines and wrinkles and was evaluated clinically [figure 5]. After final contouring, acrylic rod was placed on modified stock eye (to prevent its displacement during investing and dewaxing procedures)the silicone prosthesis was then fabricated following conventional technique of investing, dewaxing and packing mdx4 - 4210-base silicone (dow corning corp, michigan, usa). The wax pattern was flasked using die stone (ernst hinrichs gmbh, goslar, germany) to form a mold for packing the silicone . Laminar intrinsic staining was used in packing according to the patient's skin color, using intrinsic stains (kt-699, silicone coloring kit; factor ii, usa) [figure 6a and b]. The silicone was heat processed for 2 h at 90c, bench cooled, deflasked, trimmed, and finished [figure 7].the silicone prosthesis obtained was then bonded to the underlying resin framework with medical adhesive type a (factor ii) under vacuum . Polyurethane lining was also applied to the margins to increase the tear resistance of the marginal silicone . The prosthesis was trial fitted and extrinsically colored with oil pigments (factor ii, lakeside, usa). A spectacle frame was adhered to the prosthesis to provide extra retention, and final result was obtained [figure 8a and b]. Impression of the maxillofacial defect and entire face was made first by making facial moulage . For this the face was boxed with hard baseplate wax (truwax baseplate wax, trubyte; dentsply international) and then irreversible hydrocolloid impression material (hydrogum, zhermack) was applied over the face . The impression was reinforced with fast setting dental plaster (for support during retrieval and pouring of impression) [figure 2a c] and working model was obtained the working model was then used for fabrication of hollow heat polymerizing polymethyl methacrylate (pmma) (trevalon; dentsply, usa) substructure, the same way as conventional heat cure pmma hollow bulb obturators are made with the lost salt technique . The technique was followed by packing salt in orbit and malar region in substructure and after curing, salt was removed by making holes in resin framework where magnets were planned to be placed . This led to considerable loss of weight of acrylic framework and also there is no need to fabricate the whole prosthesis again in case of discoloration or damage of the silicone layer as the outer silicone layer can be removed and repacked with the new silicon on the acrylic resin framework if the mold is preserved the resin framework obtained was trimmed, finished, and was then adjusted clinically with the aid of pressure indicating paste to allow complete seating on the face . Facial moulage was then made again to pick up the resin framework in alginate impression material (so as to allow maximum adaptation of prosthesis to tissues for retention and to restore facial features in correct alignment during sculpting in wax and later on in final silicone prosthesis) and was poured to obtain a new working model [figure 3a and b] the three cobalt - samarium magnets, 2.5 mm in thickness (jobmasters, randallstown, md, usa) were embedded in acrylic framework [figure 4]. The counter magnets and modified stock eye prosthesis the ocular prosthesis was placed into a position that matches the gaze of another normal eye when the patient was directly staring at a point at eye level at least 6 feet away . Patient's previous photographs and the references from his first circle relatives were taken as a guide for shaping the wax pattern . The contour of final surface and skin texture was fabricated by carving in lines and wrinkles and was evaluated clinically [figure 5]. After final contouring, acrylic rod was placed on modified stock eye (to prevent its displacement during investing and dewaxing procedures) the silicone prosthesis was then fabricated following conventional technique of investing, dewaxing and packing mdx4 - 4210-base silicone (dow corning corp, michigan, usa). The wax pattern was flasked using die stone (ernst hinrichs gmbh, goslar, germany) to form a mold for packing the silicone . Laminar intrinsic staining was used in packing according to the patient's skin color, using intrinsic stains (kt-699, silicone coloring kit; factor ii, usa) [figure 6a and b]. The silicone was heat processed for 2 h at 90c, bench cooled, deflasked, trimmed, and finished [figure 7]. The silicone prosthesis obtained was then bonded to the underlying resin framework with medical adhesive type a (factor ii) under vacuum . Polyurethane lining was also applied to the margins to increase the tear resistance of the marginal silicone . The prosthesis was trial fitted and extrinsically colored with oil pigments (factor ii, lakeside, usa). A spectacle frame was adhered to the prosthesis to provide extra retention, and final result was obtained [figure 8a and b]. (c) facial moulage obtained (a) pick up of acrylic substructure in facial moulage (b) working model obtained hollow acrylic substructure with magnets in place final sculpted wax pattern (a) mdx4 - 4210-base silicone and silicone coloring kit; factor ii, usa (b) packing of silicone in dewaxed mold front (a) and lateral (b) profile view of final prosthesis the patient was given hygiene instructions for cleaning the prosthesis and was recalled every 6 months . During these visits, the advantages of this prosthesis are that the technique is noninvasive, cost - effective, tissue tolerant, esthetic, comfortable to use, and easy to clean . Impression of the maxillofacial defect and entire face was made first by making facial moulage . For this the face was boxed with hard baseplate wax (truwax baseplate wax, trubyte; dentsply international) and then irreversible hydrocolloid impression material (hydrogum, zhermack) was applied over the face . The impression was reinforced with fast setting dental plaster (for support during retrieval and pouring of impression) [figure 2a c] and working model was obtainedthe working model was then used for fabrication of hollow heat polymerizing polymethyl methacrylate (pmma) (trevalon; dentsply, usa) substructure, the same way as conventional heat cure pmma hollow bulb obturators are made with the lost salt technique . The technique was followed by packing salt in orbit and malar region in substructure and after curing, salt was removed by making holes in resin framework where magnets were planned to be placed . This led to considerable loss of weight of acrylic framework and also there is no need to fabricate the whole prosthesis again in case of discoloration or damage of the silicone layer as the outer silicone layer can be removed and repacked with the new silicon on the acrylic resin framework if the mold is preservedthe resin framework obtained was trimmed, finished, and was then adjusted clinically with the aid of pressure indicating paste to allow complete seating on the face . Facial moulage was then made again to pick up the resin framework in alginate impression material (so as to allow maximum adaptation of prosthesis to tissues for retention and to restore facial features in correct alignment during sculpting in wax and later on in final silicone prosthesis) and was poured to obtain a new working model [figure 3a and b]the three cobalt - samarium magnets, 2.5 mm in thickness (jobmasters, randallstown, md, usa) were embedded in acrylic framework [figure 4]. The counter magnets and modified stock eye prosthesis were then securely positioned with wax on resin framework . The ocular prosthesis was placed into a position that matches the gaze of another normal eye when the patient was directly staring at a point at eye level at least 6 feet away . Patient's previous photographs and the references from his first circle relatives were taken as a guide for shaping the wax pattern . The contour of final surface and skin texture was fabricated by carving in lines and wrinkles and was evaluated clinically [figure 5]. After final contouring, acrylic rod was placed on modified stock eye (to prevent its displacement during investing and dewaxing procedures)the silicone prosthesis was then fabricated following conventional technique of investing, dewaxing and packing mdx4 - 4210-base silicone (dow corning corp, michigan, usa). The wax pattern was flasked using die stone (ernst hinrichs gmbh, goslar, germany) to form a mold for packing the silicone . Laminar intrinsic staining was used in packing according to the patient's skin color, using intrinsic stains (kt-699, silicone coloring kit; factor ii, usa) [figure 6a and b]. The silicone was heat processed for 2 h at 90c, bench cooled, deflasked, trimmed, and finished [figure 7].the silicone prosthesis obtained was then bonded to the underlying resin framework with medical adhesive type a (factor ii) under vacuum . Polyurethane lining was also applied to the margins to increase the tear resistance of the marginal silicone . The prosthesis was trial fitted and extrinsically colored with oil pigments (factor ii, lakeside, usa). A spectacle frame was adhered to the prosthesis to provide extra retention, and final result was obtained [figure 8a and b]. Impression of the maxillofacial defect and entire face was made first by making facial moulage . For this the face was boxed with hard baseplate wax (truwax baseplate wax, trubyte; dentsply international) and then irreversible hydrocolloid impression material (hydrogum, zhermack) was applied over the face . The impression was reinforced with fast setting dental plaster (for support during retrieval and pouring of impression) [figure 2a c] and working model was obtained the working model was then used for fabrication of hollow heat polymerizing polymethyl methacrylate (pmma) (trevalon; dentsply, usa) substructure, the same way as conventional heat cure pmma hollow bulb obturators are made with the lost salt technique . The technique was followed by packing salt in orbit and malar region in substructure and after curing, salt was removed by making holes in resin framework where magnets were planned to be placed . This led to considerable loss of weight of acrylic framework and also there is no need to fabricate the whole prosthesis again in case of discoloration or damage of the silicone layer as the outer silicone layer can be removed and repacked with the new silicon on the acrylic resin framework if the mold is preserved the resin framework obtained was trimmed, finished, and was then adjusted clinically with the aid of pressure indicating paste to allow complete seating on the face . Facial moulage was then made again to pick up the resin framework in alginate impression material (so as to allow maximum adaptation of prosthesis to tissues for retention and to restore facial features in correct alignment during sculpting in wax and later on in final silicone prosthesis) and was poured to obtain a new working model [figure 3a and b] the three cobalt - samarium magnets, 2.5 mm in thickness (jobmasters, randallstown, md, usa) were embedded in acrylic framework [figure 4]. The counter magnets and modified stock eye prosthesis were then securely positioned with wax on resin framework . The ocular prosthesis was placed into a position that matches the gaze of another normal eye when the patient was directly staring at a point at eye level at least 6 feet away . Patient's previous photographs and the references from his first circle relatives were taken as a guide for shaping the wax pattern . The contour of final surface and skin texture was fabricated by carving in lines and wrinkles and was evaluated clinically [figure 5]. After final contouring, acrylic rod was placed on modified stock eye (to prevent its displacement during investing and dewaxing procedures) the silicone prosthesis was then fabricated following conventional technique of investing, dewaxing and packing mdx4 - 4210-base silicone (dow corning corp, michigan, usa). The wax pattern was flasked using die stone (ernst hinrichs gmbh, goslar, germany) to form a mold for packing the silicone . Laminar intrinsic staining was used in packing according to the patient's skin color, using intrinsic stains (kt-699, silicone coloring kit; factor ii, usa) [figure 6a and b]. The silicone was heat processed for 2 h at 90c, bench cooled, deflasked, trimmed, and finished [figure 7]. The silicone prosthesis obtained was then bonded to the underlying resin framework with medical adhesive type a (factor ii) under vacuum . Polyurethane lining was also applied to the margins to increase the tear resistance of the marginal silicone . The prosthesis was trial fitted and extrinsically colored with oil pigments (factor ii, lakeside, usa). A spectacle frame was adhered to the prosthesis to provide extra retention, and final result was obtained [figure 8a and b]. (c) facial moulage obtained (a) pick up of acrylic substructure in facial moulage (b) working model obtained hollow acrylic substructure with magnets in place final sculpted wax pattern (a) mdx4 - 4210-base silicone and silicone coloring kit; factor ii, usa (b) packing of silicone in dewaxed mold front (a) and lateral (b) profile view of final prosthesis the patient was given hygiene instructions for cleaning the prosthesis and was recalled every 6 months . During these visits, the advantages of this prosthesis are that the technique is noninvasive, cost - effective, tissue tolerant, esthetic, comfortable to use, and easy to clean . Large orofacial defects result in serious functional and cosmetic deformity which often has a significant psychological impact on the patient . The patient reported in this article was left mutilated with the loss of left midfacial tissues due to severe fungal infection mucormycosis which had a chance of recurrence even after surgical removal . Thus, to avoid recurrence of lesion and financial constraint of the patient, implant supported prosthesis was not planned for this case . But, retention of such a large prosthesis is difficult, and only with ingenuity and an understanding of the remaining anatomic structures, combination prosthesis that mutually retain one another can be constructed as was done in this case . Various methods of auxiliary retention for facial prostheses which have been described in the literature were used in this case including eyeglasses, tissue undercuts, magnets, adhesives, and combinations of the above . In this case retention of prosthesis was further enhanced by making light - weight pmma hollow resin substructure along with magnets embedded in it to facilitate better mutual retention and also helped in proper alignment of silicone prosthesis without hindering the external appearance . Clinically significant vertical mobility or sinking down of the prosthesis during functional movements was also not found in this case due to the distribution of weight of prosthesis by adhering it with eye glasses and restricted mouth opening . However, several authors have reported different problems with a combination (pmma and silicone) prosthesis like degradation of the silicone, delamination, reduced marginal integrity, and poor simulation of facial expressions . Problem of degradation of silicone in this case is expected to be minimal since medical grade material and intrinsic stains with layering technique has been used, with virtually no tissue contact except at margins (due to substructure), thus allowing least contact with skin secretions like sweat . The problem of delamination was overcome by bonding processed silicone to the framework with an adhesive under vacuum and increasing marginal strength with polyurethane lining . A 6-month periodic recall appointment was advisable for assessment of the prosthesis (retention, stability, and support) and the supporting tissues . A patient who has lost his facial tissues due to trauma, infection, or tumor experiences lot of emotional and psychological breakdown similar to that experienced by an amputee . A prosthesis that is lifelike in appearance provides a sense of psychological security to the patient, and the physical wearing comfort becomes a primary prerequisite for the patient . A 68-year - old male patient was referred for facial rehabilitation after surgical excision of left maxilla due to an underlying severe fungal infection mucormycosis . Prosthetic rehabilitation was done with magnet retained two piece prosthesis having hollow acrylic resin framework and a silicone facial prosthesis . Thus, it can be concluded that prosthetic rehabilitation of large facial defects is a challenging task which requires critical understanding of available anatomic structures and prosthesis designs to achieve maximum retention, stability, and esthetics.
. The cornea acts as a shield against external dust or microbes and prevents them to enter the eye globe . Damage or disturbance to the cornea due to scar, foreign bodies, or other diseases or disorders can lead to poor visibility . Cornea is made up of six layers which are responsible for the organization of the corneal cellular matrix which in turn is important for guiding the light to the retina . The corneal layers are the epithelium, basement membrane, bowman's layer, stroma, descemet's membrane, and endothelium (figure 1). Each layer has its own specificity, but when corneal transplantation especially penetrating keratoplasty (pk)/endothelial keratoplasty (ek) is considered, the endothelium has a more important role to play as it does not have the capacity to regenerate and hence should be left viable and undisturbed . Endothelial damage or poor viable cell count is assumed to be majorly responsible for graft rejection . Corneal lamellar keratoplasty (lk) is a surgical technique that allows preserving healthy portions of the cornea while selectively replacing the dysfunctional segments . The best action to treat corneal disorder is a replacement of the damaged recipient cornea (complete / partial) with a healthy donor corneal tissue . Deep anterior lamellar keratoplasty (dalk) is a surgical technique that is considered the best for treating the patients with anterior layer (epithelium, bowman's layer, and stroma) disorders . Descemet's membrane endothelial keratoplasty (dmek) is currently pursued to treat the patients with endothelial dysfunction . With time, descemet's stripping automated endothelial keratoplasty (dsaek) has evolved drastically with an instrument such as a microkeratome, which is more standardized, efficient, and safe to create corneal grafts or lenticules . New tools and advanced machineries like ultrasonic pachymetry, microkeratomes, excimer laser, and more recently femtosecond (fs) lasers have enhanced the ability to work with more safety and accuracy in tedious microsurgical environments . Viscoelastics and artificial chambers have proved beneficial to maintain the cellular viability . The above mentioned surgeries have enlarged the view of corneal surgery by achieving higher visual outcomes as compared to pk while limiting the rate of rejection and increasing the long - term graft stability . Further research is showing promising results with ek using thinner tissues and an expected long - term visual outcomes and graft stability [35]. Alk targets the replacement of the damaged anterior segment (epithelium and part of stroma) of the recipient's cornea with the anterior part of the healthy donor tissue . The deeper layers (posterior) of the recipient cornea, specifically the endothelium and the descemet's membrane, are left intact which reduces the risk of rejection and therefore has a distinct advantage over pk . Deep anterior lamellar keratoplasty (dalk) replaces both, the epithelium and most of the stroma with the donor tissue . This is favorable for those disorders which affect the anterior segment of the cornea [69]. According to the literature, with new instruments, dalk has now shown equal results as pk, if not better than pk, that are also based on best spectacle corrected visual acuity (bscva) [6, 10]. Smoothness of the stromal interface is ultimately related to better visual outcome; however, scarring of the stroma is still an issue with dalk . It has been found that instruments like fs lasers have been successfully used to cut the lamellar flaps, and it is believed that they could also be used for dalk in order to reduce the irregular scarring . Thus, with less compromise to the endothelium, dalk is considered as the primary choice of treatment for most anterior corneal disorders . Ek selectively replaces the diseased corneal endothelium with healthy donor tissue through a small limbal incision while retaining the healthy anterior part of the patient's cornea . This surgical technique has multiple advantages over pk as the recipient cornea remains structurally intact and resistant to injury . In addition, since it is a suture - less surgery, the results lead to quick rehabilitation and better visual outcomes . In general this procedure is the first hand / primary technique with excision of the posterior recipient stroma and endothelium with small curved scissors and trephine . The donor tissue is folded for insertion through a small incision near the limbus region . The posterior membrane which includes the descemet's membrane and the endothelial cells is excised and transplanted . The thinnest possible lamellar graft is transplanted with the intention of better and faster visual recovery and outcomes . The cellular mortality after the preparation of the graft can be a major concern if the dmek is created by stripping it off manually . A recent study described by dapena et al . Showed a no - touch technique for dmek surgery . As per this study, the technique could provide best corrected visual acuity (bcva) of 20/25 or more with a good endothelial cell density after 6 months from surgery . The steps include incision and descemetorhexis (excision of descemet's membrane from the recipient cornea), preparation and implantation of dmek graft followed by orienting, unfolding, centering, positioning, and fixing the dmek graft . This technique claims to be more standardized with near complete visual recovery and minimal endothelial cell loss . It further explains that approximately 95%of the cases may gain a bcva of 20/40 or better and 75% may attain 20/25 within 6 months post - op . Another report cited a combination of two procedures, that is, preparation of no - touch dalk and dmek grafts from the same donor . The rolled tissue was placed on a soft contact lens which was used for trephination of the endothelial graft using a custom - made trephination system . This technique claims to produce undamaged grafts with better handling of the tissues especially for thin descemet's membrane . As the undamaged anterior cornea could also be used after separating the descemet's membrane, this method increases the availability of the donor tissue by using two different grafts from the same donor . No clinical signs of graft dysfunction, primary / secondary graft failures, or graft detachments were observed . The endothelial cell density and the relative mortality showed no significance in terms of cell loss before and after technique . Descemet endothelial graft (deg) can be isolated as in the studies described above or isolated after pneumatic dissection (inserting pressurized gas for creating mechanical motion) using air bubble technique and preserving the lenticules for 7 days in organ culture . In the latter studies, the anterior stroma was removed using the microkeratome followed by air injection to separate the descemet's membrane and the stroma and then attached to a silicone weight using a scleral ring . This technique showed that the dmek tissues can be pre - prepared in the eye banks and can be preserved with a minimum endothelial cell loss . However, a similar study showed that although using air as a medium to create the bubble could be useful, the lenticule demonstrated the presence of residual stroma in all the tissues that were harvested (n = 5; average stromal residue = 12.45 micrometers). This concludes that although with a possibility of creating a thin lenticule, the presence of stroma indicates that the technique should not be termed as dmek but a very thin dsek . Similarly, microkeratome and barraquer sweep assisted lamellar preparation was another technique for harvesting donor dm and endothelium which also showed minimal stromal interference with higher endothelial cell integrity and minimal cell loss . The anterior stroma was removed using moria one microkeratome, whereas the residual stromal bed over the central cornea was removed by blunt dissection using a barraquer sweep . This technique explains that a thin rim of posterior residual stroma permits easy donor button trephination and tissue manipulation . This technique also shows the presence of residual stroma; therefore, although with a very thin lenticule preparation, could this technique be termed as dmek? A corneoscleral disc was mounted on a barron artificial anterior chamber with endothelial side facing up . This technique showed less endothelial cell loss and claimed to be a potential method as it required no special surgical instruments . Although the endothelial cell density was noted, the mortality after the lenticule preparation was not recorded . Therefore, the hypothesis could be (a) the cell loss was due to the recipient acclimatization post - op or (b) the transplanted cells were damaged or dead after graft preparation . The mortality checks therefore become an important parameter and an issue that needs to be highlighted for the dmek surgeries . There are several methods that have been introduced which have different approaches to retrieve the deg, preserve and supply as either precut tissue from the eye banks or preprepare at the surgical theatre . However, there is a lack of a standardized method which can repeatedly prove the reduction of risk or complications that are usually seen due to unidentified parameters like mortality and other risks or complications such as graft failure due to detachment or poor endothelial cell count post - op . Even with its limitations, ek has succeeded pk as the first choice of treatment for endothelial dysfunction due to its advantages like quick and efficient surgery with reduced manipulation, low surgical risk, and better visual outcome . Innovations in ek with modification in donor preparations have broadened its use and improved intraoperative ease, and reduced postoperative complications have therefore been responsible for its emerging popularity as shown in figure 2 . A mechanical microkeratome is used to simplify the donor tissue dissection, thus, making the procedure more standardized and easy with lesser damages to the prepared graft . Furthermore, as the anterior corneal surface is not manipulated, it does not result in any of those refractive errors that is usually seen after pk . However, it might show a slight hyperopic shift due to changes in the curvature or astigmatism . This method includes a little stromal interference and therefore is not a specific deg preparation - based technique . Where laser - assisted in situ keratomileusis (lasik) helps to correct the refractive errors, improved fs laser engines are proving to be useful for lamellar and cataract surgeries . Earlier settings for lk used microkeratome which is less expensive, standardized, and provided smoother surfaces for lenticules . However, microkeratome had certain limitations related to poor depth adjustments, poor thickness reproducibility due to microkeratome head sizes, and irregularity of the lenticule interface . Fs lasers reduced the complication rate due to flap creation and improved the predictability of flap dimensions and quality of the optical surfaces as compared to the flaps that were obtained by microkeratome [1924]. Other advantages of the fs laser include (a) precise cuts at specific sites; (b) higher reproducibility; (c) reduced dissection issues; (d) standardized procedures with specific thickness; (e) establishing safe and reliable procedure due to satisfactory outcomes with smoother stromal surfaces which is important for long - term visual outcomes . Both safety and reliability of corneal lamellar cuts using intralase fs laser (ifs) have been demonstrated extensively for lasik and recently for ek . Lenticules created with ifs are more planar shaped and thinner, which is essential for better visual outcomes . Nevertheless, the smoothness and regularity of the stromal interface could still be improved . The quality of the surfaces obtained is determined by programmable parameters like the laser spot and line separation and the energy delivered per pulse . The new fs laser machines are well equipped with higher engine speed and closer spot and line separation to create smoother cuts . As described earlier, studies have reported the use of fs lasers to create donor tissues for ek [2629], whereas others showed better results with alk [30, 31]. Rousseau et al . Showed that the issues arise with the donor corneas when determining the optimal amount of energy for a lamellar cut . The optimal setting should be enough to penetrate deep into the posterior stroma, overcome diffraction, and prevent any keratocyte activation or inflammatory reactions . Posterior collagen lamellae are less interweaved and distributed systematically which impairs the regularity of lamellar cuts performed in the posterior stroma . As the corneal anatomy becomes more compact as we go more posterior, cuts made with laser below 220 m become more rough and irregular due to reduced laser beam focus . It is believed that setting the spots closer together with more focal energy and adjusting the spot and line separation can help to create a smoother dissection even while creating deeper cuts . The interface gets rough when the laser reaches deep towards the corneal stroma for full lamellar cut . It has already been studied that ifs lasers can create endothelial lenticules with a good quality of stromal interface which is comparable to refractive surgery . The use of the fs laser to perform lamellar keratoplasty was thus evaluated in several in vitro and animal models [35, 36]. In 2007, cheng et al . Reported the first fs laser - assisted endothelial keratoplasty by preparing the donor cornea using the fs laser . The 60 khz fs laser allows closer spot and line separation with lower energy levels and results in smooth stromal interface also in deeper cuts which states that higher frequency with lower energy and closer spot and line separation can create smoother stromal bed surfaces [19, 20]. Bethke noted that enhancements to 150 khz fs laser can show better outcomes considering important features like (a) speed, (b) flap creation, and (c) angle variation . It is observed that increasing speed helps to place the laser ablations close together individually, simplifies flap lifts, and smoothens the surface with an overall faster procedure . The speed allows the user to place the laser ablations closer together individually and row by row . Thus, increased laser speed of 150 khz over 60 khz allows the surgeon to perform the procedure in a shorter period of time with a tighter spot and line separation . Microkeratome is a manual procedure and therefore standardization is less feasible as compared to fs lasers which are software - based programs . Therefore, fs lasers with higher engine speed and closer spot and line separation units can be a good rescue for preparing the donor grafts for dmek . Dsaek is a standardized method to perform ek, unlike dmek . As it reduces the risk of complications and allows a better and faster recovery and visual outcomes, it has become a goldstandard amongst the eye bankers and surgeons . Although good results have been achieved against pk, many surgeons have speculated that dsaek can perform even better in terms of visual acuity . However, the reason for poor performance is mostly based on a hypothesis related to the presence of a stromal interface . Therefore, the next challenge was to completely remove the stromal interface and create a deg . In 2006, melles introduced dmek procedure where only the donor's deg was stripped off, thus, removing most of the stromal interface . This procedure reported a number of patients with 20/20 or better, but did not exceed 40% . It was therefore concluded primarily that the stromal interference during the ek could not be the only reason of poor visual outcome post - op . Moreover, dmek requires high surgical skills, tissue preparation followed by surgical time, unlike dsaek . In addition, a high rate of tissue loss and detachment rate with a huge amount of graft failures have discouraged most surgeons to adopt this technique [2, 4]. Another argument for the graft failure or high rejection rate could be the presurgery mortality checks . Again, the majority of surgeons who prepare the grafts before surgery do not check the endothelial mortality after preparation of the graft and therefore it is difficult to determine the accuracy of the procedure, viability of the transplanted graft and endothelial cell density post - op . Therefore, we highly recommend taking this point into consideration as the surgery success depends not only on the acceptance of the graft but also on the recovery and long - term visual outcomes which is also based on viable endothelial cells . Recent studies have demonstrated that dsaek grafts that are thinner than 131 micrometers have shown 20/20 vision post - op . Dsaek graft thickness has not been validated or standardized at various places and therefore, it is very difficult to relate the visual outcomes to dsaek graft thickness . To reduce this complication, a new approach to the conventional dsaek surgery was introduced in 2009 and named ultrathin (ut) dsaek by busin . The preparation procedure, manipulation, and the transportation of the grafts have completely been customized . Ut - dsaek uses a modified conventional microkeratome, which can cut the cornea twice . The first cut is to debulk the donor tissue and the second one to cut the final thickness up to 100 micrometers . This procedure claims to reproduce results with optimal smoothness of the stromal interface and thickness . Other benefits include creating a thin tissue which reduces the wastage of donor tissue significantly . The microkeratome - assisted ut dsaek preparation showed that double cuts can create lenticules with <100 m of thickness . The endothelial cell density before and after preparation showed an average loss of approximately 3 - 4%, although the difference was not found significant . If it is proved that the residual stroma does not interfere with the visual outcome post - op, ut dsaek could be the future due to its benefits that include standardization, lesser manipulation, or manual error . With the current studies, dmek, which makes use only of the descemet's membrane and the endothelium for transplantation, is not a standardized procedure and due to the requirement of high surgical skills only a small number of surgeons are capable of performing it . Moreover, the major drawbacks include the preparation, manipulation of donor material, unpredictable complications, and graft failure rates . Although it has a <40% success rate, up to 16% of graft failure before surgery, approximately 63% of cases with detachments and 8% with primary graft failure, it is still used by some surgeons due to lack of a better option . Mortality of the cells is another crucial issue in dmek, but many surgeons prefer to eliminate the mortality checks once the tissue has been prepared as they mainly target post - op visual outcomes . Dsaek, an alternative surgical option for corneal endothelial disorder, has shown better postoperative results . Ultrathin dsaek can cut the tissue to the minimum by removing the majority of the stroma (depending on corneal thickness) using 2 cuts which is not the case in conventional dsaek . Some studies have shown that the best visual outcome can be influenced by graft thickness . According to the hypothesis, if the endothelium is left untouched, then minimum manipulation will result in reduced mortality . Ease of transportation and quick surgery to reduce the overall expenses should be the next goal . As we speculate, the eye banks will play an important role in the near future for the development of new surgical techniques in collaboration with the clinicians . One of the issues for eye bankers today is that there is no standard or threshold limit for the requirement of the viable endothelial cell count for critical surgeries like dmek . This creates a lot of confusion, when a surgeon demands a precut tissue for dmek or when a surgeon is preparing the graft before surgery . Moreover, as mentioned earlier, the majority of surgeons do not calculate the mortality or the endothelial cell density after the tissue preparation, which addresses a challenge to the eye bankers to standardize the mortality issue . This also results in a false positive post - op endothelial cell survival study although the results for surgical success and visual recovery are documented to be positive . Thus, in general, the possible future challenges and the key issues which need to be identified and demonstrated for the standardization of the ek procedures could be the following.thickness: can thinning the tissues to the minimum (deg) be really useful in terms of visual outcome?viable endothelial cell density: should the surgeons evaluate the mortality or the viable endothelial cell density after dmek graft preparations before surgery?standardization: can a standardized and validated pre - cut, preloaded tissue help to reduce the risk, time, and cost of the surgery? Thinning the tissues using ut dsaek has provided better results, but needs to undergo a strong confirmation to practically prove the repeatability and long - term beneficial effects of this procedure . If thinning the tissues can create a more suitable visual outcome, then the amount of thickness and the detachment or other associated risks should be justified . Moreover, thinning the tissue can result in unwanted effect of rolling the deg on itself which can decrease the cell viability . A perfect dmek / deg usually has a thickness of 1530 micrometers which is not enough to hold the lenticule without getting damaged . Therefore, it is very important to understand and validate the mortality threshold for the deg . This will help to prepare a pre - cut dmek / deg in the eye banks and increase the quality control levels, save time, cost, and risks associated with the graft failure due to surgeon preparatory mistakes . Therefore, we believe that a more standardized, validated and ready to transplant tissue should be the future of dmek surgery . Moreover, the recent advances in the use of fs lasers for donor graft preparation could be advantageous in terms of increasing the stromal interface smoothness and cuting it with more ease; however, it might be more expensive than the conventional techniques . Furthermore, it is also important to validate the procedure for dmek graft preparation using fs lasers in terms of energy / frequency levels and thickness of the required graft . In the future, use of fibrin glue could prove beneficial for sampling, handling, and transporting the dmek tissues with ease of surgery, although the pros and cons need to be identified if used in vivo . Thickness: can thinning the tissues to the minimum (deg) be really useful in terms of visual outcome? Viable endothelial cell density: should the surgeons evaluate the mortality or the viable endothelial cell density after dmek graft preparations before surgery? Standardization: can a standardized and validated pre - cut, preloaded tissue help to reduce the risk, time, and cost of the surgery? According to a study, if the cost analysis of surgeon - cut and the eye - bank cut donor corneal tissue for ek is valued, then the cost per surgeon - cut donor corneal tissue decreases if the number of cases performed increases per year . Excluding other factors such as opportunity costs, the eye bank processing charge is almost equal to the expenses associated with a surgeon - cut cornea if the surgeon was to perform approximately 15 cases / year . The microfinance study was based on costs of equipments, consumable supplies, labor charges, building space, and risk of attempted damage . Even if the cost is low, the risk associated with the graft preparation during the surgery is of major concern . Therefore, we believe that a prevalidated tissue could be a better option for surgeons to reduce the presurgery time, effort, and risks associated with graft failure . Thus, we envision that standardizing the posterior lamellar graft preparation methods will reduce unnecessary manipulation of the tissue in the operating theatre and reduce the high surgical skill or risk quotient . In the near future, the deg could be supplied as pre - cut tissues which would reduce the overall intervention costs and save time . A recent study has shown a moderate decrease in endothelial cell density if the deg is left in storage under organ culture, which concludes that a pre - cut dmek preservation is possible for future transportation . The final graft would reduce the severe efforts of manipulation by the surgeons thus providing better quality tissue for patients . Hence, the intention should be to achieve an easy, efficient, and a validated procedure for dmek surgery.
Mandibular third molars are found in 90% of the general population while 33% of them having at least one impacted third molar . Mandibular third molar surgery is one of the most frequent surgical procedures carried out by oral surgeons . There are various reasons for m3 surgery such as caries and their outcomes, germination disorders, orthodontic problems, infection, trauma, and prevention or improvement of periodontal defects in the adjacent second molars . Surgical procedures for extraction of impacted third molars are associated with the significant morbidity including pain, swelling, trismus, and potential complications such as nerve injury and injury to adjacent teeth . An important question to address is the risk of persistent or developing new periodontal defects on the distal aspect of the mandibular second molars following extraction of third molars . There is controversy about the incidence of periodontal defect at the distal aspect of the second molars after surgical extraction of the third molars . Some authors have shown improvement of periodontal health distal to the adjacent second molar, whilst others have demonstrated loss of al and reduction of alveolar bone height . Hence, the aim of our study was an evaluation of the periodontal parameters; pd, and al, on the distobuccal aspect of the second molar after surgical extraction of the impacted third molar . The sample was derived from the cohort of subjects enrolled in the clinical trial . To be included in the cohort, the subjects must be healthy young patients with a mesioangular impacted mandibular third molar that categorized at c1 class based on the pell and gregory classification [figure 1]. Class c mandible third molar impaction; the occlusal plane of the impacted tooth is apical to the cervical line of the adjacent tooth the original cohort was composed of 50 subjects, with the mean age of 20.9 (range from 18 years to 25) years, of which 42 completed the study regular follow - up . All lower third molars were extracted by one surgeon under local anesthesia, generally with lidocaine in a 2% solution with epinephrine at 1:100,000 . The surgeon raised a full - thickness triangular flap, which was protected by a minnesota retractor . Sterile moderate speed (30,000 rpm) handpieces and sterile saline solution were used for ostectomy and tooth sectioning when necessary . To close the wound, no . 3 - 0 vicryle suture was used and after 7 days the suture was removed [figure 2]. Pre - operative panoramic view of a class c impacted mandibular third molar (a), post - operative panoramic view of the same tooth (b) periodontal pd was measured on the distobuccal aspect of adjacent second molars with using a customized occlusal stent as a guide for the path of insertion of periodontal probe and michigan o periodontal probe (hu - friedy, chicago, il) before surgery (pd1) and 6 months after surgery (pd2). Al also was measured from cementoenamel junction (cej) with using occlusal stent, before surgery (al1) and 6 months after surgery (al2) on the distobuccal aspect of the second molars . One sample t - test was used to examine the mean difference of the pd1 between the sample and the known value of the normal pd . This comparison showed that the mean of sample's pd1s was not statistically different from normal values . Indeed, samples before surgery were similar in term of this parameter to the right standard . Data analyses were conducted by using spss software (version 19) and a probability level of 0.05 was used throughout . The results were analyzed statistically using one sample t - test and paired - sample t - test . During the study interval, 50 patients enrolled in the study; 42 of them completed the study . Seven patients were excluded from analyses because they failed to complete regular follow - up . The pre - operative baseline pd (pd1) and 26 weeks post - operative (pd2) were measured; they ranged from a mean sd of 2.71 0.59 mm to 3.60 0.88 mm respectively . The al measurements ranged from a mean sd of 3.62 0.69 mm pre - operative (al1) to 3.48 0.74 mm 26 weeks post - operative (al2). For the periodontal pd measures, there was a statistically significant increase between the pre - operative baseline pds (pd1) and 26 weeks post - operative (pd2) measurements . Furthermore, there were a statistically significant decrease between the pre - operative als (al1) and 26 weeks post - operative (al2) measures (p <0.05) [table 1]. Pre - operative and 26 weeks post - operative results and evaluation of them by the t - test when managing impacted mandibular third molar in the adult population, the risk for developing or having persistent periodontal defects on the distal aspect of the mandibular second molar should be considered . The results of this study showed that routine surgical management of full impacted mesioangular third molars resulted in statistically significant increased pd on the distal aspect of the mandibular second molars and the decrease in al were also statistically significant 6 months after surgery . Three important factors were found to influence periodontal status at the distal aspect of the second molar: patient's age, third molar impaction type and depth and pre - surgical periodontal defects . Because of importance of above mentioned factors, two of the primary competency requirements for entrance to the study were the state and type of impaction . Only asymptomatic fully impacted mesioangular third molars were evaluated to avoid confounding factors related to exposure to the oral cavity and prior inflammatory / infectious processes . Patient's age is another important risk factor commonly referenced in the literature . For this reason, the sample analyzed in our study represented a group of young patients with the mean age of 20.9 (range from 18 to 25) years . A small, specific sample group was selected (42 mandibular third molars from 50 patients) and given the statistically significant findings, by definition, the sample size was adequate . As in almost all longitudinal studies, the duration of follow - up was 6 months because there is a higher risk of patient dropout after 6 months . In nearly all peer - reviewed studies, as in our study, only one specific pd site was noted but some reported the average measurements of two to three sites . Because the entire distal aspect of the second molar is at risk from the presence of pre - operative infrabony defects and iatrogenic injury during third molar surgery, it is more valuable that, the periodontal parameters be measured at three sites at the distal aspect of the second molar to provide a more detailed visualization of this area . Previous studies showed that extraction of impacted mandibular third molar had no negative effects on the periodontal status of the adjacent second molar and in many patients it has resulted in improvement of the pd of second molars . Other studies revealed the formation of periodontal defects at the distal aspect of second molars after surgical extraction of the mandibular third molars . These studies did not classify the types of impaction, but our study concentrated on the mesioangular impacted third molars categorized in the c1 class based on the pell and gregory classification . In this study, a period of at least 6 months following surgery had been elapsed prior to clinical examination for sufficient hard and soft - tissue healing to have occurred . As localized periodontal lesions may remain symptomless until the periodontal attachment loss is very advanced, these may easily escape detection by the patient and an attending dentist . One study showed a greater reduction of deep intrabony defects persisting post - extraction in the 20-years - old age group versus the 30-years - old age group . Another study found no correlation between age and increase pd at the distal aspect of the second molars after extraction of the third molars . In our study, all patients were in the same age group (18 - 25 years), so the influence of age on the periodontal parameters of the second molar after surgical extraction of the third molar was not shown . Pre - operative condition of periodontal tissue at the distal aspect of the second molars may affect post - operative pd . The effect of different flap designs on post - operative periodontal pocket formation at the distal aspect of the second molar and other squeals has been reported . We used sulcular incision with the releasing incision at the mesial aspect of second molars due to the necessity for wider access to the fully impacted third molars . Some other studies suggest reconstruction of bone defects after surgical removal of the impacted third molar . First, the change of pd was evaluated in the target population after 6 months and second, the change of al at the distal aspect of the second molar was evaluated after surgical removal of the third molar . We concluded that the extraction of deeply impacted third molars causes increased pd at the distal aspect of the second molars, but al decreased . Further studies using reconstructive procedures are recommended for preventing or resolving persistent periodontal defects on the distal aspect of the second molar after surgical removal of the impacted mandibular third molar.
Autologous peripheral blood hematopoietic cell transplantation (auto - pbhct) is a well - established therapeutic option for patients with a variety of hematologic malignancies . Mobilization of peripheral blood progenitor cells (pbpc) for auto - pbhct can be accomplished by using cytokines, most commonly granulocyte - colony stimulating factor (g - csf), either alone or in combination with chemotherapy (e.g., cyclophosphamide, etoposide, cytarabine, etc .) Or plerixafor [1, 2]. Recently reported phase iii studies have also shown superiority of the combination of g - csf with plerixafor over g - csf alone for mobilizing pbpc in patients with non - hodgkin lymphoma (nhl) and multiple myeloma (mm) [3, 4]. Plerixafor acts by selective and reversible antagonism of cxcr4 on cd34 + hematopoietic stem cells (hsc). This results in disruption of its interaction with cxcl12 (formally sdf1) on bone marrow stromal cells, that cause a rapid release of stem and progenitor cells from bone marrow into peripheral blood . While plerixafor - based pbpc mobilization can circumvent the need for chemotherapy to mobilize cd34 + pbpcs, to our knowledge no prospective trials comparing plerixafor plus g - csf to chemomobilization have been published to date . Limited data on murine models suggest that a combination of plerixafor and chemotherapy may be more effective than the use of plerixafor alone for pbpc mobilization . Despite the promising results of plerixafor and g - csf for pbpc mobilization in patients with mm and nhl [3, 4, 68], the use of chemotherapy and g - csf - based regimens to mobilize pbpc remains standard practice in many transplant centers . This decision is often influenced by a desire to improve collection yield, reduce mobilization failures especially in patients who are elderly, heavily pre - treated, and have poor bone marrow cellularity, and/or as an attempt to provide disease control [911]. Limited data are available on the preemptive use of plerixafor salvage in patients failing to collect adequate numbers of pbpc with chemotherapy and g - csf - based mobilization [1214], and this topic has been reviewed recently . Herein we report our experience from two north american transplant centers in a series of patients who received plerixafor salvage while failing chemotherapy and g - csf mobilization . For patients undergoing chemotherapy and g - csf - based mobilization, it is standard operating procedure at both transplant centers to measure peripheral blood cd34 + cell count daily when the patient's white blood cell (wbc) count recovers to 4,000/l or from day + 12 (after chemotherapy) onwards (whichever occurs first). Patients destined to fail pbpc chemomobilization were defined as (i) those with a peak peripheral blood cd34 + cell count of <10/l following wbc count recovery (wbc count of 4,000/l) after chemotherapy - induced nadir or (ii) those who failed to collect at least 1 10 cd34 + cells / kg after two apheresis sessions . In these patients failing chemomobilization, we administrated plerixafor at a dose of 0.24 mg / kg subcutaneously 10 hours prior to apheresis in conjunction with g - csf (10 g / kg), as a preemptive salvage strategy . All collections were performed with a cobe spectra apheresis system (caridianbct, lakewood, co), by processing three to four blood volumes . It is the institutional policy at both transplant centers to routinely target collection of 5 10 cd34 + cells / kg . Determination of peripheral blood cd34 + cell count and cd34 + cell content of the apheresis product was performed at the georgia health sciences university hla laboratory and west virginia university hospitals flow cytometry laboratory . The bd facscanto ii flow cytometer, (becton dickinson, san jose, ca) was used for all analyses . After red blood cell lysis, washed samples were used for cd34 + enumeration with pe - labeled, 8g12 clone, immunoglobulin g1 (becton dickinson, san jose, ca) based on international society of hematotherapy and graft engineering (ishage) guidelines . The final products were cryopreserved in 10% dmso using a controlled rate freezer and stored in liquid nitrogen . Successful mobilization was defined as a total of 2 10 cd34 + cells / kg patients body weight in the final product . Data was collected on mobilization and transplant outcomes through an electronic data base, prospectively maintained at each participating institution and analyzed utilizing spss version 13.0 . Patient characteristics and transplantation outcomes of 16 patients who were failing chemomobilization (as defined above) and received preemptive plerixafor are summarized in table 1 . Patients had received a median of two lines of therapies (range 13) prior to pbpc mobilization . After recovering from chemotherapy - induced count nadir (i.e., wbc 4000/l), 15 patients had a peak peripheral blood cd34 + cell count of <10 l . Five patients underwent at least 2 sessions of apheresis but were unable to collect 1 million cd34 + cells / kg . These patients subsequently received a median of two doses of plerixafor salvage (range 18). The median number of apheresis sessions was 3.5 (range 27), and the median number of cd34 + cells collected was 3.9 10 cells / kg (range 2.47.8). Utilizing a cutoff of 2 10 cd34 + cells / kg, all patients who received plerixafor had a successful collection . Nineteen percent of the patients were able to collect 5 10 cd34 + cells / kg . Three patients (one with hodgkin lymphoma and two with nhl) required more than four doses of plerixafor, but all eventually collected 2 10 cd34 + cells / kg . The median peak peripheral blood cd34 + cell count prior to plerixafor administration was 3.5/l (range 015) and increased to 6/l (range 247) after the first dose of plerixafor (p = 0.03). 93% of the patients had a peak peripheral blood cd34 + cell count of <10/l before plerixafor salvage . Four patients had a peak peripheral blood cd34 + cell count of 1/l before plerixafor salvage . Kinetics of peripheral blood cd34 + cell and wbc count changes after each dose of plerixafor for these 4 patients is shown in table 2 . After transplantation, the median time to neutrophil and platelet engraftment was 10 days (range 915) and 20 days (range 929), respectively . In order to identify predictors of response to plerixafor salvage, as expected, patients with a higher peripheral blood cd34 + cell count at the time of the first plerixafor dose had a higher magnitude of change in their peripheral blood cd34 + cell counts (r = 0.58, p = 0.01). Only three patients had a cd34 + cell count of 10/l before the first dose of plerixafor, and their median increase was 18/l compared to 6/l for patients who had peripheral blood cd34 + cell counts of <10/l however, this difference was not statistically significant (p = 0.3). We did observe a positive correlation between peak peripheral blood cd34 + cell count before the first dose of plerixafor and the total number of cd34 + cells collected at apheresis (r = 0.62; p = 0.01). Of the 41 collections with plerixafor, the mean cd34 + cell dose collected was 0.79 10 cd34 + cells / kg from 25 collections in patients with a peripheral blood cd34 + cell count <10/l versus 2.09 10 cd34 + cells / kg from 16 collections in patients with a cd34 + cell count greater than 10/l (p = 0.001). Correlation analyses were performed in order to define an optimal cutoff of wbc count that can be used as a marker for the initiation of plerixafor salvage, which showed that wbc count had no correlation with a change in cd34 + cell count after the first dose of plerixafor (r = 0.21, p = 0.41). Utilizing the median wbc count of 32/l at the time of administration of plerixafor in our patients, we found that we were able to collect a higher number of cd34 + cells in patients who had a wbc count 32/l as compared to those with a wbc count> 32/l (1.67 10/kg versus 0.8 10/kg, p = 0.02 resp . ). Our limited multicenter outcomes data suggest that the addition of plerixafor as a preemptive salvage may rescue patients who are destined to fail chemotherapy and g - csf - based pbpc mobilization . In our series we used plerixafor salvage to rescue an otherwise failed attempt for chemomobilization, which contrasts with prior studies where plerixafor was used to remobilize patients who had failed prior mobilization attempts . This is also in contrast to studies where plerixafor was routinely given to patients undergoing chemomobilization . In our series plerixafor was given after recovery from chemotherapy - induced count nadir (median of 11.5 days after chemotherapy) and resulted in successful cd34 + cell collection in all patients, who were otherwise likely to fail chemomobilization . Interestingly patients with a wbc count of 32/l were able to collect a higher number of cd34 + cells . This is in contrast to earlier data [1215] that indicated limited efficacy of plerixafor in patients with a lower wbc count . This discrepancy can be a reflection of the decreased efficiency of the collection process in patients with a higher wbc count or possibly a reflection of timing of plerixafor administration . Generally a cd34 + cell count of 1013/l is used as a cutoff for initiating apheresis following cytokine only, cytokine plus plerixafor, or chemomobilization in majority of transplant centers in the country . The median cd34 + cell count of our patients was only 3.5/l with 82% less than 10/l at the time of the first plerixafor dose, and all patients were able to collect a minimum of 2 10 cells / kg . However, a valid cutoff for peripheral blood cd34 + cell count to initiate apheresis when plerixafor is used as a salvage for failed chemomobilization is unknown . Patient characteristics and institutional preference will likely continue to influence the choice for mobilization strategy in patients undergoing an auto - pbhct . While no prospective data are available to demonstrate better efficacy or cost effectiveness of plerixafor - based mobilization over chemotherapy - based mobilization, our preliminary data provide safety and efficacy data for plerixafor salvage to rescue patients failing chemotherapy - based pbpc mobilization.
Many studies on unruptured aneurysms have reported a prevalence of approximately 3.6 to 6% and a bleeding rate of approximately 2.3 to 0.3%/year.1)18) for the giant aneurysm (25 mm), a rupture rate of 6% has been reported for one year since the first diagnosis, and based on the natural history, it was considered bad due to high lethality.1)15)20) however, with technological developments in the fields of surgery and anesthetics since the 1970s-1980s, the mortality and morbidity associated with the operation have shown a rapid decrease . In addition, advances in diagnostic technology have made it possible to find and treat an unruptured aneurysm that has already been diagnosed prior to the rupture.8 - 10) accordingly, most studies on unruptured aneurysms have reported symptoms that appear prior to the rupture of an aneurysm, and have discussed correct diagnostic procedures, various treatments and results . The last path of the natural history of an unruptured aneurysm concerns death or disability caused by the rupture . However, few studies on unruptured aneurysms that have disappeared by spontaneous cure have been reported . Due to medical ethics, conduct of such clinical studies we report on a large right middle cerebral artery (mca) aneurysm, which induced subarachnoid hemorrhage (sah) after rupture and showed spontaneous occlusion after a wrapping operation . The characteristics and causes of the aneurysm and possible spontaneous cure no abnormal findings were observed on the first neurologic examination, while other medical examinations also showed normal findings . Findings on brain computed tomography (ct) examination showed a slightly high - density intra axial mass lesion measuring approximately 2.5 cm lateral sides on the right sylvian fissure . It showed no edema around the mass, iso - density and strong enhancement without calcification inside (fig . According to findings on a three - dimensional ct angiogram (3-d cta) examination, the mass was diagnosed as a saccular aneurysm in the right mca bifurcation (fig . T2 weighted images from a brain magnetic resonance image (mri) examination showed a high signal in the aneurysm and a heterogeneous peripheral low signal . At the back of the aneurysm sac, a t1 weighted image showed a low signal in a part close to the circle of willis and an iso signal far from it . Like the ct image, it showed a slightly low signal with dense contrast enhancement and difference in filling in the aneurysm sac (fig . In addition, sah was not found on the ct examination; however, a small amount of sah was noted around the aneurysm and along the sylvian fissure . In the right internal carotid artery (ica) angiogram (three - dimension subtraction image) posterior to anterior view, an aneurysm measuring 21.6 20.9 mm in the right mca bifurcation was observed in a lateral direction . It formed a broad neck along an inferior branch of m2 and several perforating branches were observed around the neck (fig . It is specific in the angiogram that the filling of the aneurysm in the early arterial phage was not partially performed . Filling of the aneurysm in the later arterial phage was completed, without excretion up to the capillary phage . Direct clipping in the operation field was difficult; therefore, the operation was completed after wrapping the ruptured portion using surgical glue . The patient was discharged from the hospital without complications . According to findings on the mri examination performed approximately months after discharge, a target sign that appeared as a high signal, and a low signal in a slightly inner portion and a high signal again in a central portion, an examination after 19 months showed that the size of the aneurysm had decreased considerably (fig . 5b). Finally, according to findings on the angiogram and mri examination (which were performed after three years and eight months), there was no trace of the mass in the sylvian fissure due to the considerable reduction in the size of the aneurysm and almost everything in the m2 branch was intact (fig . Occlusion of an aneurysm due to spontaneous thrombosis was first reported in 1955.2) the risk of a ruptured aneurysm became known in the mid 1970s, however, due to high mortality and morbidity associated with the operation, administration of an active treatment for ruptured aneurysm was difficult . They have been widely spread by yasargil since the mid-1970s, which led to an increase in the success rate of operation and a decrease in complications from anesthesia . It also led to a rapid decrease in mortality and morbidity from the operation.21) however, according to the development of diagnostic technologies, including ct, mri, and other methods, the number of cases of diagnosed unruptured aneurysm has shown a continuous increase, and treatment of unruptured aneurysm has recently become a controversial issue . In addition, questions arose regarding the bleeding rate in the natural history of an unruptured aneurysm, or whether to treat the aneurysm or monitor its progress by comparing the bleeding rate, and mortality and morbidity of the operation . Likewise, a randomized controlled study is the most ideal approach to understanding the natural history of a ruptured aneurysm . Many papers have reported a high bleeding rate in the natural history of an unruptured giant aneurysm, while several case reports on spontaneously cured aneurysms have been published . Loevnet et al.12) reported a large basilar artery aneurysm found nine months after a seven - year - old boy received a trauma, which showed complete disappearance after six years . Morn et al.14) reported on a traumatic posterior cerebral artery aneurysm of a six - year - old boy, which disappeared completely after five years . Other cases of spontaneous occlusion of a traumatic aneurysm have been reported, insisting that less than 15% of traumatic aneurysms were cured spontaneously.15) krapt et al.11) suggested that a congenital, unruptured giant aneurysm in a nine - month - old female infant was completely occluded and absorbed, based on three - year examination . There have also been papers on infants who could not undergo an operation or spontaneous occlusion of a traumatic aneurysm, however, few reports on the natural history of an un - ruptured aneurysm have been published . Vasconcellos et al.3) proposed that 25% (five cases) of 20 cases showed courses of spontaneous occlusion during observation of giant carotid cavernous aneurysms of the internal carotid artery with a relatively low risk of bleeding . The possibility of spontaneous occlusion was relatively high in cases of improvement of initial symptoms, such as retrobulbar pain or migraine during courses of carotid cavernous giant aneurysms . A factor to analogize spontaneous occlusion of an unruptured aneurysm is the volume - to - orifice ratio.20)29) through analysis of the results for the ratio of the size (mm) of the aneurysm neck to the aneurysm volume (mm) from studies on 21 aneurysms, a value greater than 25 mm indicates the potential for thrombosis, and a value greater than 28 mm indicates a strong possibility of thrombosis . Thus, it is assumed that as the volume - to - orifice ratio grows larger, thrombosis appears more frequently by inducement of red blood cell aggregation thrombosis due to blood stasis in the aneurysm . Accordingly, the pathophysiology of thrombosis is not clear, however, it has received the most support . The volume - to - orifice ratio calculated in our case was 28 mm, and the results of angiography showed partial dye filling in the aneurysm in the early arterial phage, maximum filling in the late arterial phage, and slow filling delayed excretion in the capillary phage . The other study insisted on the possibility that thrombosis could cause intermittent vasospasm or dehydration caused by non - ionic contrast media while reporting cases of aneurysm that has caused thrombosis after angiography . However, it was impossible to demonstrate the correct mechanism.7) partial thrombosis of a giant aneurysm from 48 to 76% has been reported, however, sources demonstrating complete thrombosis are scarce.6) through observation reports on 22 cases of giant intracranial aneurysms, whittle and et al.19) overthrew the conventional assumption that partial thrombosis in an aneurysm can reduce hemorrhage risk, by demonstrating that there was no difference in incidence of sah in 12 cases of thrombosis and non - thrombosis . They also insisted that mortality generated after sah, and mortality and morbidity before and after surgery did not differ . As a result, they reported that partial thrombosis of the aneurysm did not reduce the risk of sah and only aneurysms with total thrombosis reducing the risk of sah . They also argued that partial thrombosis did not influence procedures or methods for treatment of giant aneurysms . Due to the dynamic and reversible courses of thrombosis of aneurysms, observation of a course over a long period of time is necessary . In addition, its generation and resorption are performed repeatedly, and complications such as thromboembolic infarct can occur.13) whittle et al . Insisted that wrapping of a ruptured aneurysm had an effect on small aneurysms, but that wide - based, large, or giant types of mca aneurysms are associated with a high risk of rebleeding and fatal outcomes . Wrapping was generally known as an inadequate method of treating an aneurysm.5)16) accordingly, it is impossible for wrapping to stop rebleeding of the aneurysm.5)17) deshmukh et al.4) reported that according to angiographic follow - up studies on 34 patients who underwent wrapping of an aneurysm for an average of 3.4 years, there was no change in the size and shape of the aneurysm . Despite reports on rupture caused by wrapping or a change in size, there was no basis for occlusion of the aneurysm after wrapping, as manifested in our case . The authors report on a case of spontaneous occlusion and absorption of a saccular aneurysm of mca bifurcation . It was assumed that in the pathophysiology of spontaneous occlusion of an aneurysm, sluggish flow in the aneurysm may be the cause and the volume - to - orifice ratio of the angiography, slow filling, and delayed excretion through prediction of slow flow may manifest . In cases of inoperable aneurysm, however, long - term observation is more critical for an aneurysm that does not involve a stationary lesion and one that has dynamic courses . Conduct of further studies on the characteristics and types of aneurysms that will undergo spontaneous occlusion is needed.
Noninvasive mechanical ventilation (niv), including noninvasive positive pressure ventilation (nippv), is a well - accepted treatment for chronic neuromuscular respiratory failure associated with conditions such as amyotrophic lateral sclerosis, and niv prolongs survival . Clinicians are often pressed for an immediate decision as to whether niv or invasive ventilation should be used in patients with various neuromuscular diseases who suddenly present with potentially fatal arf . If invasive ventilation can be avoided by performing niv in patients with arf, the severity of disease can be effectively managed, and the outcomes of neuromuscular diseases can be improved because invasive ventilation requires endotracheal intubation or tracheotomy, which can cause serious complications, especially in patients with respiratory infection . In contrast, niv carries a lower risk of respiratory infection . It is important to clarify the characteristics of patients with neuromuscular diseases in whom initial niv is likely to be unsuccessful, leading to the need for invasive ventilation . We studied 27 patients in stable neuromuscular condition who initially received niv to manage fatal arf to identify differences in factors immediately before the onset of arf among patients who receive continuous niv support, patients who are switched from niv to invasive ventilation, and patients in whom niv is discontinued . We retrospectively studied 27 medically stable patients with neuromuscular diseases who presented with arf that required mechanical ventilation to save their lives and to relieve respiratory distress despite oxygen administration . Patients with other causes of pre - ventilatory respiratory failure, such as chronic obstructive pulmonary disease or lung cancer, were excluded . None of the patients had a history of niv, endotracheal intubation, tracheotomy, or invasive ventilation, and all patients initially received niv after the onset of arf . All patients other than those with coma had severe respiratory distress . A decrease in consciousness level was evident in 16 patients, and coma status as defined as a score of 100 on the japan coma scale was seen in 6 patients . Twenty - one patients were urgently admitted to our hospital, and the condition of 4 other medically stable patients suddenly worsened during hospitalization . Two other patients were admitted to our hospital within 23 hours from presentation . Before the initiation of niv, 26 patients were given the following diagnoses: probable multiple systemic atrophy (msa) according to the gilman criteria in 5 patients, clinically definitive parkinson s disease (pd) according to the uk parkinson s disease society brain bank criteria in 2 patients, clinically probable or definite amyotrophic lateral sclerosis (als) fulfilling the el escorial revised criteria in 8 patients, myotonic dystrophy (myd) in 6 patients, polymyositis (pm) in 1 patient, both myositis and myasthenia gravis in 1 patient, mg in 2 patients, and chronic inflammatory demyelinating polyneuropathy in 1 patient . Human herpes virus-6 encephalitis was diagnosed on the basis of polymerase chain reaction after starting niv in 1 patient . Arterial blood gas (abg) analysis was performed within a short period before starting niv (median 68 minutes). At the same time, the presence of coexistent pulmonary disease such as aspiration pneumonia, the japan coma scale score, and the need for oxygen administration were evaluated . The modified ranking scale score or bulbar symptoms were evaluated when the patient was in medically stable condition within 1 month before the initiation of niv . Each endpoint was judged as three states (persistent niv support, transition from niv to invasive ventilation, and free of mechanical ventilation). Variables that were not normally distributed were transformed to natural logarithms or categorical quartile groups . Normally distributed variables are presented as means sd, and asymmetrically distributed variables are presented as medians with interquartile ranges (iqr). The statistical significance of differences in pre - ventilation clinical factors among these three groups was analyzed by linear regression analysis . We obtained their informed consents of all patients as well as from their families about the clinical procedure including niv . As for the patients with compromised cognitive functions, we obtained the informed consent from their families . The protocol of this study was approved by the medical ethics committee of nara medical university . Arterial blood gas (abg) analysis was performed within a short period before starting niv (median 68 minutes). At the same time, the presence of coexistent pulmonary disease such as aspiration pneumonia, the japan coma scale score, and the need for oxygen administration were evaluated . The modified ranking scale score or bulbar symptoms were evaluated when the patient was in medically stable condition within 1 month before the initiation of niv . Each endpoint was judged as three states (persistent niv support, transition from niv to invasive ventilation, and free of mechanical ventilation). Variables that were not normally distributed were transformed to natural logarithms or categorical quartile groups . Normally distributed variables are presented as means sd, and asymmetrically distributed variables are presented as medians with interquartile ranges (iqr). The statistical significance of differences in pre - ventilation clinical factors among these three groups was analyzed by linear regression analysis . We obtained their informed consents of all patients as well as from their families about the clinical procedure including niv . As for the patients with compromised cognitive functions, we obtained the informed consent from their families . The protocol of this study was approved by the medical ethics committee of nara medical university . Detailed clinical information, including the results of abg analysis in each patient, is shown in supplementary table 1 . Seventytwo hours later, 5 patients were switched from niv to invasive ventilation, and 5 patients continued to receive niv support (figure 1). Seventy - two hours after the initiation of niv, the proportion of patients with a diagnosis of als differed significantly among the three groups (p=0.039), and other variables, including abg, did not differ (table 1). One week later, two patients (1 with pd and 1 with myd) died, 5 patients received invasive ventilation, and 4 patients were free of ventilation . One month later, 8 patients underwent invasive ventilation or died, and 6 patients were free of ventilation . As for 8 patients with als, 3 patients received invasive mechanical ventilation after 72 hours . Although statistical significance was not reached, hypercapnia before starting niv was frequent among als patients with unsuccessful niv (figure 2). The present study found that medically stable patients with als who initially received niv tended to require invasive ventilation after niv . One retrospective study that evaluated 76 patients who had various neuromuscular diseases associated with arf, including 10 patients with als (13.1%), reported that 12 patients (15.7%) received continuous niv and 47 patients (61.8%) required invasive ventilation or died . In the present study, including 8 patients with als (29.6%), 12 patients (44.4%) received continuous niv support and 7 patients (25.9%) required invasive ventilation or died . These results are inconsistent with the findings of previous studies, possibly because of different proportions of patients with als, much longer endpoints than those in the present study, or different definitions of endpoints . However, the proportion of patients who required invasive ventilation or died increased after 1 month (figure), similar to the results of a previous study . We found no prognostically significant pre - ventilation values on abg analysis . In a previous study, lower ph and po2 values and higher pco2 values before ventilation were associated with poor functional outcomes at discharge, and bicarbonate> 30 mg / dl, pco2> 50 mmhg, and ph <7.30 were associated with an increased risk of death in survivors with neuromuscular diseases . Seventy - two hours after starting niv, all patients with unsuccessful niv had a value of pco2> 50 mmhg, and bicarbonate> 30 mg / dl and ph <7.30 were seen in 4 patients and 3 patients with unsuccessful niv, respectively . However, mechanical ventilation was needed in a heterogeneous cohort of 22 patients with neuromuscular diseases.
Hardware removal is indicated for infection, nonunion, failure of fixation, pain, soft tissue irritation, and anticipated strenuous activity after fracture healing [14]. During removal cases subsequent removal of broken hardware increases surgical time, and retained metalwork potentially complicates future surgeries (figure 1). Although there have been several articles that have discussed titanium implant failure, most have discussed this issue within the context of hardware failure during fracture healing, and not particularly during removal of hardware [69]. To our knowledge, none have been specific to the elbow, which merits its own discussion due to its unique anatomy . The distal humerus of the elbow is unique in that is has a high ratio of cortical to cancellous bone . Therefore, in this study we set out to investigate incidence of bone screw failure during hardware removal procedures and we were interested in comparing titanium and stainless steel bone screws because these are the most common types of metallic fracture implants in circulation . In addition, we set out to determine whether the duration of implantation and the anatomic location of the bone screws about the elbow were associated with bone screw failure during removal procedures . A better understanding of metallic hardware failure during removal procedures may help surgeons in the preoperative planning stages of these cases, in terms of surgical tool selection and staff availability . After institutional review board (irb) approval, all cases performed by orthopaedic trauma or upper extremity surgeons between 1/1/2000 and 10/1/2009 at our level 1 trauma center were reviewed . Inclusion criteria were (1) deep implant removal cases, (2) hardware removed from the distal humerus or the proximal ulna, and (3) isolated elbow injuries . The exclusion criteria were (1) cases that did not have relevant or inaccessible elbow x - rays, (2) single screw fragment extraction cases (because in these cases the hardware had previously broke and was small in size, which we believe was not representative of the other screws being removed), (3) patients younger than 17 years, and (4) cases that were originally performed at an outside institution (unavailable medical records). The factors considered were (1) whether or not the bone screws broke during removal and the type of implant metal used (titanium alloy, ti6al4v or stainless steel), (2) the length of time between initial implantation and removal, where cases were divided into two groups based on a conservative estimate of the time period required for osseointegration of titanium implants [10, 11]: one group was for cases where the duration of time between implantation and removal was less than 12 months and the second group was for cases where the duration between implantation and removal was 12 months or more; and (3) anatomic location about the elbow (distal humerus or proximal ulna). The data was extracted from the medical record . Due to the small sample size, fisher's exact test was used to determine statistical differences between two sets of categorical data . An independent t - test was used to compare the means of two independent groups . Differences that had less than 0.05 probability of occurring from chance were considered statistically significant . We identified a total of 47 cases, of which 21 met the inclusion criteria . We carried out an independent t - test to determine if there were any differences between the ages of patients that had broken screws and those that did not, and no statistical significance was found, p = 0.740 . Out of 21 cases, screws broke during removal in 5 cases (23.8%). In 16 out of 21 cases, the reasons for hardware removal were infection in 7/21 cases, symptomatic, prominent hardware in 7/21 cases, nonunion in 6/21 cases, and contracture in 1/21 cases . 14 involved titanium alloy and 7 involved stainless steel implants . Within the titanium hardware group, in 10 cases removal was uneventful, and in 4 cases, fracture of at least one screw occurred . In comparison, out of the 7 stainless steel hardware removal cases, there was one case that resulted in one or more broken screws . Overall, compared to stainless steel, failure of titanium alloy screws during removal was not found to be statistically significant (p = 0.61). In order to determine whether there were any association between the duration of implantation and hardware failure during removal, cases were divided into two groups: group (1) duration of hardware implantation was 12 months or less (mean 7.7, range two to 12 months), and group (2): duration of implantation was more than 12 months (mean 41.6, range 16 to 74 months). Twelve cases had hardware removed within 12 months of implantation and nine cases had hardware removed after 12 months of initial implantation . Bone screws that were removed after 12 months of surgery were more likely to break during removal (p = 0.046). When titanium screws were analyzed separately, those removed within 12 months of surgery were more likely to be removed intact as compared to those removed more than 12 months after implantation (p = 0.003). The small number of stainless steel cases (seven) did not warrant statistical calculations . With respect to anatomic location, there were 12 distal humerus and 15 proximal ulna cases (table 1). Six cases involved the distal humerus only, nine cases involved the proximal ulna only, and six cases had simultaneous proximal ulna and distal humerus involvement . In one case where titanium screws broke and in one case where stainless steel screws broke, it was unclear where the location was and these cases were discarded from the analysis . In general, bone screw failure was equally likely to occur when removed from the distal humerus and the proximal ulna (p = 0.28). Hardware failure during removal cases is a commonly seen problem in orthopaedics (figure 1). Currently, there is no single hardware removal technique that is uniformly successful, and several different methods may be employed during the same case . Such techniques include the use of screw extractors, trephines, extraction bolts, pliers, and various other devices . The purpose of this article was to determine the incidence of bone screw failure during hardware removal procedures, and we were interested in comparing titanium and stainless steel bone screws . In addition, we set out to determine whether the duration of implantation and the anatomic location of the bone screws about the elbow had any association with bone screw failure during removal procedures . We believe that prior knowledge of the type of metal implanted (mainly titanium) and the duration of implantation to be useful information that can help in the preoperative planning of hardware removal procedures . Firstly, this may allow surgeons to request hardware removal kits, thus saving precious operative time . Second, it is our experience that hardware removal procedures are often considered not technically demanding and are often delegated to less experienced surgical staff such as junior residents who may be more likely to break the hardware . Therefore, we believe that experienced staff surgeons should be available during procedures where titanium is being removed . Having broken hardware in the elbow may complicate future surgeries in the same region of the limb . With regards to orthopaedic implants, it is known that both titanium alloy and commercially pure titanium hardware are more predisposed to in situ fracture relative to stainless steel [69]. As compared to stainless steel, titanium alloy is lighter, has a lower modulus of elasticity, and has superior corrosion resistance and biocompatibility, but inferior ductility and notch sensitivity . The literature search performed for this review did not reveal any previous studies that compare hardware removal from the elbow in vivo for titanium and stainless steel fracture implants . In contrast to titanium implants remaining in situ for less than 12 months, we observed that the titanium implants remaining in situ for more than 12 months had a tendency to fail during extraction . In this series, it is likely that a combination of titanium alloy's fatigue properties secondary to notch sensitivity and osseointegration were responsible for this observation . The fatigue strength of titanium alloy is generally comparable to stainless steel 316l, but notch sensitivity in both commercially pure titanium and titanium alloy has been shown to significantly shorten the fatigue life of these implants in comparison to stainless steel [1214]. Osseointegration has been observed to occur within 310 months in titanium alloy [10, 11]. The degree of bone ingrowth and on - growth, however, continues to increase for years after initial implantation (figure 2). Although there have been studies showing evidence of stainless steel osseointegration, it is generally accepted that commercially pure titanium and titanium alloy are more biocompatible and more likely to osseointegrate than stainless steel . In our series, it is likely that as osseointegrataion became more complete, greater removal torques contributed to the failure of titanium alloy screws in this series . Given these properties, we postulate that over longer periods and increased loading cycles, the development of micofractures and osseointegration contributed to screw breakage during implant removal . Secondly, the cases studied were not uniform; there were a wide variety fractures and hardware systems involved . In addition, due to the small number of cases it was necessary to include multiple surgeons . In addition, not all x - rays were available for review; therefore we were not able to account for the type of hardware, such as locking or non locking plate technology . In this study, there appears to be a time - related association for bone screw failure during removal cases, and for titanium alloy in particular . This is likely due to the increased bone ingrowth and the adverse effect of notch sensitivity on titanium alloy's fatigue properties.
Nineteen isolates were multidrug - resistant (mdr), eight isolates were only resistant to inh and the remaining isolates were sensitive to both inh and rif . The bactec 460 tb system was used as the reference method for testing of the mdr isolates and the bactec mgit 960 system was used as the reference method for testing the remaining isolates . The concentrations of inh and rif for the bactec 460 tb / bactec mgit 960 systems were 0.1/0.1 and 2.0/1.0 g / ml, respectively . The h37rv - atcc 25618 (susceptible to all drugs), atcc 35822 (resistant to inh), atcc 35838 (resistant to rif) and atcc 35820 (resistant to str) strains were used for quality control . Preparation of antibiotics and malachite green (mg) - the inh and rif antibiotics used in this study were purchased from sigma and the mg dye was from merck (germany). Inh and mg were dissolved in sterile distilled water and rif was prepared in methanol . Stock solutions were prepared as 1,000 g / ml, 1,000 g / ml and 50 g / ml for inh, rif and mg, respectively . Preparation of bacterial inocula - bacterial colonies were freshly grown on lwenstein - jensen media, transferred into tubes containing physiologic saline and 15 - 20 glass beads and vortexed for 30 sec . The tubes were kept in a vertical position for 30 min at room temperature to allow for the sedimentation of aerosols and large particles . The turbidity of the supernatant was adjusted to that of the mcfarland 1 standard . Preparation of media - all m. tuberculosis isolates were tested in middlebrook 7h9s broth (containing 0.1% casitone, 0.5% glycerol and 10% oadc). Inh and rif were tested at the critical concentrations of 0.25 g / ml and 0.5 g / ml, respectively (martin et al . 2011). An antibiotic - free growth control tube was also used for each bacterium . Performing the mgda test - three tubes containing inh, rif or antibiotic - free control growth medium were used for each bacterium . Fifty microlitres of inoculum adjusted to the mcfarland 1 standard was added to each tube and the tubes were incubated at 37c . Following a seven - day incubation period, 150 l of mg (50 g / ml stock solution) was added into each test tube and the tubes were incubated for an additional 24 - 48 h. once the mg decolourised in the growth control tube, the test tubes containing antibiotic were evaluated for colour change . If the mg decolourised as a result of bacterial growth in the tubes containing antibiotic, the bacterial sample was reported as resistant (figure). The sensitivity, specificity, positive predictive value (ppv), negative predictive value (npv) and agreement of the mgda test for inh were 92.5%, 91.3%, 92.5%, 91.3% and 92%, respectively . Two isolates were sensitive to inh by the mgda test, but resistant by the reference method . Two additional isolates were sensitive to inh by the reference method, but resistant by the mgda test . For rif, the sensitivity, specificity, ppv, npv and agreement of the mgda test were 94.7%, 100%, 100%, 96.8% and 98%, respectively . One isolate was resistant to rif by the reference method, but susceptible by the mgda test (table). Phenotypic methods that are inexpensive, rapid and reliable make susceptibility testing of m. tuberculosis easier and more efficient . Studies have shown that colourimetric tests are promising methods for drug susceptibility testing, particularly the resazurin microplate method, the resazurin tube method, the nitrate reductase test, the mtt and the xtt (angeby et al . In contrast to most bacteria and fungi, mycobacteria are resistant to mg . Media for the cultivation of mycobacteria (lwenstein - jensen) contain mg to reduce overgrowth by contaminating microorganisms . Mycobacterial resistance to mg may be due to dye reduction and sequestration in the lipid fraction of the cells (jones & falkinham 2003). (2012) reported that mg interfered with the recovery of mycobacteria on solid culture media following exposure to certain antibiotics, including inh and ethionamide (etm), that target cell wall biogenesis . This interference did not affect the test results for inh sensitivity because mg was used to determine the viability of bacteria in this test . (2008) reported that mgda could be used for the rapid detection of drug susceptibilities of m. tuberculosis clinical isolates; the sensitivity, specificity and agreement of the mgda test were found to be 100% for both rif and inh and the results were obtained within six-17 days (average of 12 days). In our study, the inh - rif sensitivities, specificities, ppvs, npvs and agreements of the mgda test were 92.5 - 94.7%, 91.3 - 100%, 92.5 - 100%, 91.3 - 96.8% and 92 - 98%, respectively and the results were obtained within eight - nine days . There was a major discrepancy in the tests of two isolates that were sensitive to inh by the mgda test, but resistant by the reference method . In addition, there was a minor discrepancy in the tests of two additional isolates that were sensitive to inh by the reference method, but resistant by the mgda test . The group reported that 50 l of a 0.02 g / ml mg stock solution was used for the direct susceptibility test, whereas 50 l of a 0.02 mg / ml mg stock solution was used for the indirect susceptibility test . Therefore, the concentration of the stock solution used in the study is not clear . Our preliminary studies indicated that using a 0.02 g / ml stock solution was not suitable for the mgda test; an mg titration showed that 150 l of a 150 g / ml stock solution was suitable for the susceptibility testing using 1 ml test tubes (figure). 2010) reported that mgda could be used for the rapid detection of pyrazinamide resistance . They used 50 l of a 50 g / ml mg solution in their study . No additional studies using mgda were found in searches of medline, pubmed, isi web, web of science and google academic databases . In conclusion, the mgda test for the rapid detection of inh and rif resistance is an inexpensive, easy to perform and interpretable method that can be used in laboratories for routine drug susceptibility testing . Inh: isoniazid; npv: negative predictive value; ppv: positive predictive value; r: resistant; rif: rifampicin; s: susceptible.
During storage of animal feed many different processes may occur which alter their initial natural proprieties . First of all, lipids undergo peroxidation, the process during which they are deteriorated in a free radical autocatalytic oxidation chain reaction with atmospheric oxygen . Lipid autooxidation is a cascade phenomenon ensuring continuous delivery of free radicals, which initiate continuous peroxidation . This process results in food rancidity which manifests itself as the change of taste, scent, and color as well as decrease in shelf life of the product . Natural or synthetic antioxidants are usually used to slow down or stop lipid peroxidation and in consequence to preserve freshness of the product . Many natural antioxidants, such as tocopherols, vitamin c, flavonoids, for a short period, may be effective in food preserving, but in many cases such protection is not sufficient . Therefore synthetic antioxidants are widely used, among which bht (butylated hydroxytoluene), bha (butylated hydroxyanisole), and eq (ethoxyquin) are the most frequent . However, some effects of synthetic antioxidants are not always beneficial for our health . Antioxidants such as bha or bht have been widely used for many years to preserve freshness, flavor, and colour of foods and animal feeds as well as to improve the stability of pharmaceuticals and cosmetics . Some experimental studies have reported that both bht and bha have tumour - promoting activity [1, 2]. On the other hand, there were reports on anticarcinogenic properties of these antioxidants when they are used at low concentrations . Human exposures are at least 1000-fold below those associated with any neoplastic actions in laboratory animals thus it is assumed that they are not harmful for human beings [3, 4]. The third compound, eq, is one of the best known feed antioxidants for domestic animal and fish . However, some of the authors have suggested that it is responsible for a wide range of health - related problems in dogs as well as in humans [59]. Due to the increased use of this antioxidant it was nominated by fda (us food and drug administration) for carcinogenicity testing . The tests were carried out by monsanto company (usa), eq producer, and after that in 1977 fda requested for optional lowering of the maximum level of eq in complete dog foods from allowed 150 ppm (0.015%) to 75 ppm (0.0075%). At the same time new studies were started by the pet food institute to determine whether even lower eq levels (between 30 and 60 ppm) would provide antioxidant protection for dog food . It was originally developed in rubber industry to prevent rubber from cracking due to oxidation of isoprene . The monsanto company (usa) taking into account its high antioxidant efficiency and stability as well as low costs of synthesis refined it later for use as a preservative in animal feeds because it protects against lipid peroxidation and stabilizes fat soluble vitamins (a, e). Presently, ethoxyquin is used primarily as an antioxidant in canned pet food and in feed intended for farmed fish or poultry . The use of ethoxyquin is not permitted in foods intended for human, except preserving powdered paprika and chili colour and using it as an antiscald agent in pears and apples (inhibition of brown spots development). However, because eq is used as a feed antioxidant it can be also found in other products intended for human consumption like fish meal, fish oils, and other oils, fats, and meat (table 1). An acceptable daily intake (adi) of eq for human (00.005 mg kg bw) based on the results obtained from studies on dogs this paper presents characteristics of ethoxyquin with regard to its properties, metabolism, toxicity, possible carcinogenicity, and antioxidant activity . For the first time eq was synthesized in 1921 by knoevenagel . The synthesis was based on condensation of aniline with molecules of acetone or its analogues [15, 16]. Synthesized eq from p - phenetidine (4-ethoxyaniline) and diacetone alcohol in the presence of p - toluenesulfonic acid or iodine . Pure ethoxyquin (eq; 6-ethoxy-1,2-dihydro-2,2,4-trimethylquinoline; cas number 91 - 53 - 2; figure 1) is a light yellow liquid, but it changes color to brown if it is exposed to oxygen the scent of eq is described as mercaptan like . As a nonpolar substance eq is soluble only in organic solvents . Peak blood concentration of the compound is observed within 1 h. distribution of eq in animal body is similar when it is administered orally and intravenously . Small amounts of parent eq were detected in liver, kidney, and adipose tissue and fish muscles [2024]. Metabolism of eq was studied in rats, mice, dogs, chickens, and fish, as well as in plants [13, 21, 25]. The most important eq metabolites observed in rat urine and bile result from o - deethylation at position 6-c, and then conjugation with sulphate or glucuronide residues . The other metabolic pathways include hydroxylation and glucuronidation at position 8-c, deethylation at 6-c and epoxidation between positions 3-c and 4-c . Mainly glucuronide metabolites were detected while in rats those result from conjugation of eq with sulfate . In the studies of bohne et al . [23, 26] parent eq, dem - ethylated eq (deq), quinone imine (qi), and eq dimer (eqdm) were observed in salmonid fish after long - term dietary exposure to eq . Eq is considered as a model inducer of phase ii enzymes involved in the metabolism of xenobiotics, but influence of eq on phase i enzyme gene transcript levels was also observed [28, 29]. The key role in mediating phase i reactions (e.g., oxidation or reduction) producing more hydrophilic compounds is played by the cyp (cytochrome p450) enzyme family . [28, 29] observed the alteration of cyp3a gene expression; an increase in the amount of cyp3a transcripts was detected in salmon after feeding them with the diet containing eq at the highest dose used (1800 mg kg). The authors speculate that eq may regulate cyp3 gene expression by interaction, for example, with pregnane x nuclear receptor (pxr) whose function is to sense the presence of toxic xenobiotics and in response enhance the expression of proteins involved in their detoxification . On the other hand, cyp1a1 gene expression, which was described as an exposure biomarker to both endogenous and exogenous compounds, was not increased after dietary exposure of salmonid fish to eq and during the depuration period a trend toward downregulation was noted [28, 29]. Such an effect was observed despite the increase in the expression of ahr mrna (ahr, cytosolic transcription factor responsible for changes in gene transcription). For example, the parent eq may bind cyp1a1 protein and as a result may inhibit the gene expression and activity of protein . Hepatic antioxidant response elements (are) or ahr repressor (ahrr) together with basic - helix - loop - helix - pas (per - ahr / arnt - sim homology sequence) of transcription factor usually associated with each other to form heterodimers (ahr / arnt or ahrr / arnt) may be also involved in the cyp1a1 downregulation process . These heterodimers can influence gene expression by binding are sequences in the gene promoter regions . However, eq as other phenolic antioxidants, first of all causes induction of phase ii xenobiotic - metabolizing enzymes . [28, 29] observed elevated dose - related uridine diphosphate glucuronosyl - transferase (udpgt) mrna expression after dietary exposure to eq . As udpgt reacts with the compounds that have the hydroxyl group (-oh) parent eq cannot be the potential substrate for glucuronidation, only its metabolites, for example deq (6-hydroxy-2,2,4-trimethyl-1,2-dihydroquinoline; table 3), the metabolite identified by berdikova bohne et al . In atlantic salmon changes in the expression of glutathione s - transferase (gst) gene were also observed after feeding animals with eq containing feed . The alterations in gst activity caused by eq were documented in atlantic salmon [28, 29], in rodents [33, 34], and in nonhuman primates . In addition to udpgt and gst, some other enzymes are involved in phase ii metabolism of eq, for example, nadp(h): quinone oxidoreductase and epoxide hydrolase . The expression pattern of both phase i and ii enzymes involved in eq metabolism may vary in different animals and should be considered in relation to the ratio of parent eq and its metabolites (first of all deq, qi, and eqdm) in the liver [29, 37]. The research concerning this issue is currently in progress . Ethoxyquin is also registered as an antioxidant to control scald (browning) in apples and pears . The eq plant metabolites / degradation products were detected, and it was shown that in general they are different from those observed in animals (table 3). In pears treated with ring - labeled [c]ethoxyquin the following compounds were detected: n n and c n dimers, demethylethoxyquin (dmeq), dehydrodemethylethoxyquin (dhmeq), and dihydroethoxyquin (dheq) [14, 25]. It was shown that ethoxyquin was rapidly degradated or metabolized but itself it was not translocated into the pulp of fruit where the residues were detected (less than 0.5% of total radioactive residue was eq). Toxicity of eq metabolites, meq, dhmeq, and dheq was studied in dogs (oral administration, single doses of 50 to 200 mg kg bw), and it was found that they did not show any significant toxicity . In the report of gupta and boobis the rank order of toxic potency for the plant metabolites and eq is meq <eq <dheq <dhmeq (the least toxic first). Meq, dhmeq, and dheq were also evaluated for genotoxicity in in vitro and in vivo tests . The compounds did not cause gene mutations in salmonella typhimurium and escherichia coli strains, but they induced chromosomal aberrations or / and endoreduplication in chinese hamster ovary cells . On the other hand, plant metabolites / degradation products did not exhibit genotoxic potential in vivo . Adi intake for humans for meq, dhmeq, and dheq was estimated at the same level as for eq (00.005 mg kg bw). It is very efficient in protecting lipids which are present in food against oxidization [38, 39]. Specifically it is used to retard oxidation of carotene, xanthophylls, and vitamins (like vitamins a or e). In animals treated with ethoxyquin three times higher level of vitamins a and e in blood plasma was observed . High efficiency of this antioxidant results not only from chemical features of eq itself but also from the fact that products of its oxidation also possess antioxidative properties [12, 39, 41]. Studies on eq antioxidant properties were performed by taimr with the use of alkylperoxyls, and it was shown that the reaction rate of eq with them is very high . In the presence of high oxygen concentrations eq reacts with alkylperoxyl molecule to form aminyl radical (6-ethoxy-2,2,4-trimethyl-1,2-dihydroquinolin-1-yl) which subsequently may enter various pathways . In nonoxidizing conditions it can be stabilized both by the loss of methyl group and aromatization of heterocycle to form 2,4-dimethyl-1,2-dihydroquinoline (dehydrodemethylethoxyquin (dhmeq)) and through dimerization to form eq dimer (eqdm) [39, 42]. On the other hand, in an oxidizing medium other molecules can be formed, for example, 2,6-dihydro-2,2,4-trimethyl-6-quinolone (qi) or nitroxide radical (6-ethoxy-2,2,4-trimethyl-1,2-dihydroquinolin - n - oxyl) which is also a strong antioxidant [39, 42]. Products of eq oxidation were detected by different authors in fish oil and meal [22, 4345]. According to he and ackman the following oxidization products of eq dominate in fish meal and fish feed: 2,6-dihydro-2,2,4-trimethyl-6-quinolone (qi) and 1,8-di(1,2-dihydro-6-ethoxy-2,2,4-trimethylquinoline) (eqdm). At high storage temperature neither qi nor eqdm accumulates; however, another product of eq oxidation, 2,4-dimethyl-6-ethoxyquinoline, is stable . The eqdm and qi show 69% and 80% of eq efficacy, respectively (studies on fish meal). On the other hand, in the studies of thorisson et al . Quinone imine (qi) and eq nitroxide were also powerful antioxidants, while eqdm, the main product of eq oxidation, showed little or no antioxidant behavior . Antioxidant activity of eq was also demonstrated in experiments performed both in vivo and in vitro . Antimutagenic effect of this antioxidant was observed in mice, rats, and chinese hamsters treated with cyclophosphamide, an agent widely used in cancer chemotherapy [4749]. During cyclophosphamide bioactivation reactive oxygen species eq reduced the number of chromosome aberrations, micronuclei, and dominant lethal mutations induced by the anticancer drug [4749]. There were also some reports that eq can modify carcinogenic response to different carcinogens [35, 52, 53]. Eq given to fischer 344 rats in diet completely prevented the formation of aflatoxin b1-induced preneoplastic liver lesions [52, 53]. In in vitro experiments with human lymphocytes, antioxidant activity of eq was observed in the comet assay (the method used to detect single- and double - strand dna breaks, cross - links, and alkaline labile sites) and in micronucleus test (the method for the detection of micronuclei induced by clastogens or aneugens). Eq used at the concentrations ranging from 1 m to 10 m protected human lymphocytes against dna damage caused by hydrogen peroxide (h2o2, 10 m). This antioxidant also reduced the number of micronuclei caused by h2o2 used at concentration of 75 m . However, the significant reduction was evident only in the case of lower eq concentrations (5 m, 10 m) with no effect at higher concentration . Different phenolic antioxidants may be used in animal feed, such as bha (butylated hydroxyanisole), bht (butylated hydroxytoluene), and the most efficacious eq . The levels of the antioxidants in finished feed should not be higher than 150 ppm for eq and 200 ppm for bht and bha (u.s . The fact that efficient antioxidants work optimally when they are used at low concentrations is their remarkable characteristic . On the other hand, when antioxidants are used at high concentrations they act as prooxidants . The impact of these compounds depends on their concentration as well as on other factors such as metal - reducing potential, chelating behaviour, solubility, and ph . The effect of antioxidants on living organisms also depends on their bioavailability and stability in tissues [54, 55]. It was shown that dissolved eq may exist partly in the free radical form which it was also detected in the compound itself . Therefore, ethoxyquin nitroxide which is produced by eq oxidation similarly as other nitroxide molecules (e.g., tempol) may also show prooxidative properties . Formation of free oxygen species as a result of using too high eq concentrations can cause adverse health effects in animals fed with eq containing feed or in people consuming meat from farmed animals, for example, different fishes . The studies on eq prooxidant activity and toxicity associated with it were performed both in vivo and in vitro . Dogs are most susceptible to the harmful effects of eq, and first reports of such effects were received by fda in 1988 . The symptoms observed by dog owners and veterinarians were liver, kidney, thyroid and reproductive dysfunction, teratogenic and carcinogenic effects, allergic reactions, and a host of skin and hair abnormalities . According to the studies on dogs and laboratory animals it was shown that ethoxyquin had little acute toxicity, except when it is administered parenterally . Values of ld50 for eq are 1700 mg kg bw (rats, oral gavage),> 2000 mg kg bw (rats, dermal treatment, 24 h), ~900 mg kg bw (mice, intraperitoneal administration), and ~180 mg kg bw (mice, intravenous administration). Despite species differences in the majority of animals treated with eq at the concentrations higher than those permitted in animal feed, the same characteristic symptoms and pathologies appeared such as weight loss, liver, and kidney damage, alterations of alimentary duct (table 4). The concentration of 100 ppm (equivalent to 2.5 mg kg bw per day) was considered to be a minimal - effect level for clinical signs of toxicity and liver effects in dogs, the most susceptible animals [13, 14]. Detrimental effects of eq were also seen when the experiments were performed at the cell metabolism level . Analysed the impact of eq on the metabolic pathways of rat renal and hepatic cells, as well as on mitochondria and submitochondrial particles obtained from bovine heart and kidney . The authors suggested that eq interacted with site i of the mitochondrial respiratory chain, and it resulted in inhibition of oxygen consumption in the mitochondria of kidney and liver cells when glucose was a respiratory substrate . More than 30 years ago when eq began to be more commonly used in animal feed research started to assess its mutagenicity with the use of ames test which is performed on different salmonella typhimurium strains . The results were equivocal as some results were negative [6668], but the positive effects were also observed [69, 70]. It was also shown that eq enhanced the mutagenic activity of dmba (3,2-dimethyl-4aminobiphenyl), a compound having carcinogenic properties . Ethoxyquin was reported to both enhance and inhibit genetic changes induced by known carcinogens; on the other hand it can also lead to cancer in exposed animals . Manson et al . Observed in fischer 344 rats that eq caused severe damage in kidney . Many hyperplastic and putative preneoplastic tubules were found which suggested that eq may be exerting a carcinogenic effect . Similar effects were observed earlier by ito et al . In relation not only to the kidney but also to the urinary bladder . Possible carcinogenicity of eq is probably connected with its prooxidant activity and induction of reactive oxygen radicals which cause dna damage . Dna damage is usually repaired by cellular repair system, but if it is severe or there are too many lesions, this leads to programmed cell death (apoptosis). Sometimes, however, the programmed cell death pathway is damaged so when the defense mechanisms fail there is no way to stop a cell from becoming a cancer cell . Some in vitro studies showed both cytotoxic effects of eq leading to cell apoptosis or necrosis and damage of genetic material at dna or chromosome levels . Cytotoxic effects of pure eq (purity> 97%) were studied in vitro with the use of human lymphocytes . The ic50 value (the concentration causing 50% growth inhibition) for eq determined after 72-hour treatment of the cells in the mtt assay was 0.09 mm . This antioxidant significantly reduced viability of lymphocytes detected with trypan blue exclusion method after 24-hour treatment at the concentrations of 0.25 and 0.5 mm (cell divisions were stimulated by phytohemagglutinin, (pha)) or of 0.05 mm and higher when 1-hour treatment was performed . Eq - induced apoptosis by observed in in vitro cultured human lymphocytes starting from 0.05 mm concentration and the detected number of apoptotic cells depended on the treatment time . Ethoxyquin caused also dna damage in the comet assay however, most lesions could be repaired by cellular dna repair systems . On the other hand, the results obtained with the use of chromosome aberration test showed that unrepaired dna damage induced by eq could lead to permanent changes in genetic material [16, 74]. . Showed that this antioxidant induced chromosome aberrations such as breaks, dicentrics, atypical translocated chromosomes, or chromatid exchanges in human lymphocytes and chinese hamster ovary cells . Because of adverse health effects caused by eq it is reasonable to search for new antioxidants as effective in scavenging free radicals as eq which produce no such problems . In the paper of de koning nine analogues of eq prepared to compare their antioxidant efficacy with that of the parent chemical are presented . The compounds have been tested in a refined fish oil and subsequently some of the most promising ones have been also tested in fish meal . It was noted that the results obtained in fish oil were not always the same as in fish meal, for example, hydroxyquin (1,2-dihydro-6-hydroxy-2,2,4-trimethylquinoline; figure 1) was 3.5 times as effective as eq in fish oil, while only 3/4 of its efficacy was observed in fish meal . In the case of another compound 1) antioxidant efficacy in relation to eq was 101% in fish oil and 52% in fish meal . Despite the lower efficiency of this compound in fish meal the reason is that preparation of hydroquin based on aniline and acetone is more cost - effective than that of eq whose production requires p - phenetidine (more expensive than aniline). The 2-year dermal research with the use of f344/n rats and b6c3f1 mice conducted under the national toxicology program showed that the compound was not carcinogenic, but the studies performed by sitarek and sapota showed its teratogenic properties . In 2000 dorey et al . Presented the report concerning the synthesis and biological properties of a new class of antioxidants based on the eq backbone . The studies were performed to search for new quinolinic derivatives with radical scavenging activity, potential candidates for central nervous system protection . Eq is not suitable for that as it has been shown to exhibit significant hypothermic effect, probably as a result of an inhibition of electron transport in the mitochondrial respiratory chain . Dorey et al . Synthesized and studied many 1,2-dihydro and 1,2,3,4-tetrahydroquinolines and then selected for further evaluation a group of antioxidants (5 compounds) with high radical scavenging capacities, relatively low toxicity, and moderate hypothermia . The compounds belonging to the group of 1,2,3,4-tetrahydroquinolines (e.g., 6-ethoxy-2,2,5,7-tetramethyl-1,2,3,4-tetrahydroquinoline, characterized with the lowest toxicity and high radical scavenger capacity) are structurally similar to 2,2,4,7-tetramethyl-1,2,3,4-tetrahydroquinoline synthesized and tested in our laboratory (figure 1). The latter compound also had promising features: its antioxidant activity was comparable to that of eq, but its cytotoxicity and genotoxicity studied with the use of human lymphocytes in vitro were significantly lower . We believe that this chemical is worth of detailed studies to confirm its usefulness as a food preservative . Some other eq derivatives and salts were also studied for cytotoxicity, genotoxicity, and antioxidant activity, namely, the complexes of ethoxyquin with flavonoids (rutin or quercetin), ethoxyquin hydrochloride, ethoxyquin phosphate, ethoxyquin l - ascorbate, ethoxyquin n - hexanoate, ethoxyquin salicylate, and ethoxyquin salt of trolox c [19, 7982]. The biological properties of the compounds were analysed with the use of mtt, tunel, and trypan blue staining methods (cytotoxicity testing), comet assay (genotoxicity testing), and micronucleus test (mutagenicity testing). From among the compounds tested ethoxyquin phosphate (eq - f) was the least toxic (table 5)its cytotoxic and genotoxic activities in comparison with those of eq were reduced positively (ic50 = 0.8 mm versus 0.09 mm for eq). On the other hand, antioxidant activity of eq - f was observed, but it was the lowest of the tested compounds . The studies showed that all the tested compounds were less toxic to human lymphocytes than eq, and the antioxidant activity of four of them (ethoxyquin n - hexanoate, ethoxyquin complex with quercetin, ethoxyquin l - ascorbate, and ethoxyquin salicylate) was comparable with that of eq [7982]. . The level of this antioxidant in animal feeds should not be higher than 150 ppm (u.s . The approved uses of ethoxyquin in animal feeds are addressed in the code of federal regulations (cfr), title 21, parts 573.380 and 573.400, and established tolerances are in part 172.140 . On the one hand, the observed adverse health effects (firstly in dogs) could be caused by the fact that the animals ate a lot of feed containing eq, but on the other hand, it could also be the result of its excessive amounts in the feed . Ethoxyquin is added to animal feed either directly or indirectly as a component of an ingredient . From time to time fda reminds industry about labeling and safe use requirements for ethoxyquin, but if it is added at the ingredient level this is not always indicated . Another important safety issue is the presence of eq oxidation and eq metabolism products in animal feed or in foods prepared from farmed animal meat . De koning described main products of eq oxidation which can be observed in stored feeds or in fish meal: eq dimer (eqdm, 1,8-di(1,2-dihydro-6-ethoxy-2,2,4-trimethylquinoline) and quinone imine (qi, 2,6-dihydro-2,2,4-trimethyl-6-quinolone). Both compounds were shown to be potent antioxidants, but they can also have detrimental effect, especially so because the half - life of the dimer was considerably greater than that of eq [26, 28]. In the recent studies no adverse toxicological effects of eqdm, in terms of kidney and liver function, were observed in in vivo experiments with f344 rats exposed for 90 days to the compound . On the other hand, augustyniak et al . Showed that eqdm, similarly as eq, was cytotoxic and genotoxic to human lymphocytes . Toxicity of qi has not been studied yet, but the results obtained by the authors indirectly indicated that the compound could be cytotoxic to human cells . The levels of the parent compound (eq) in meat of farmed animals are usually lower than mrl (maximum residue level) [20, 84], but eq oxidation products are usually not controlled . It was shown that eqdm and other eq residues can be present in different animal tissues [23, 24, 26, 28, 37]. In the studies of bohne et al . In which atlantic salmons were fed for 12 weeks with the feed containing this antioxidant, four compounds were identified in their muscles: parent eq (6-ethoxy-1,2-dihydro-2,2,4-trimethylquinoline), deethylated eq (6-hydroxy-2,2,4-trimethyl-1,2-dihydroquinoline), quinone imine (2,6-dihydro-2,2,4-trimethyl-6-quinolone, qi), and eq dimer (1,8-di(1,2-dihydro-6-ethoxy-2,2,4-trimethylquinoline, eqdm). It was also shown that the concentration of eq in fish muscle was proportional to the duration of exposure and the level of eq in the feed . The same linear increase was seen for eqdm, the main metabolite of eq, and the sum of eq and eqdm . . Found that the level of eq and its metabolites in fish muscle could be predicted from the level of dietary eq and then controlled, but because it is not the only factor which may affect the levels of eq and its metabolites in the salmon tissue (others for example are fish size and age), the concentration of eq and eqdm in fish ready for consumption may be higher than that observed in their studies . In their experiments it was shown that the elimination of eq from salmon was concurrent with significant increase in the level of eqdm, and they concluded that mandatory 14 days of depuration were not sufficient for elimination of eq residues it is mainly because eqdm is characterized by the considerably longer half - life than that of eq . Moreover, eqdm accounted for 99% of the sum of the two compounds (eq and eqdm), and its toxicological effects in animals and humans are unknown . Eq and eq dimer were also detected in similar amounts not only in atlantic salmon, but also in other commercially important species of farmed fishes (halibut, rainbow trout) by lundebye et al . . They found that in atlantic salmon, halibut, and rainbow trout the concentration of eqdm was more than 10-fold higher than that of eq . The authors estimated that consumer exposure to eq from a single portion (300 g) of skinned - fillets of different species of farmed fish could amount up to 15% of the adi . In the light of data concerning the presence of eqdm in the body of farmed fishesand providing that eq dimer was included in the adi, the eq and eqdm intake from a single portion of atlantic salmon would be close to adi . Farmed fish is probably the major source of eq and its residues for european consumers (its use as a food additive is forbidden). In our opinion, however, both fish and other farmed animals, for example, chickens, should be controlled for the presence of not only eq, but also eqdm, its main oxidation product . Ethoxyquin has been used as an antioxidant in animal feed for several decades and despite the search for new compounds that could be used as free radical scavengers, it is still the most effective antioxidant . The negative health effects in domestic animals fed with eq containing feed were observed some years ago, but the presence of its approved doses should not be hazardous . Toxicity and mutagenicity of eq were observed in in vivo and in vitro studies showing its potential harmful effects . This makes it very important to label all products and ingredients to which eq is added and to comply with the recommended doses . Additionally, the results of the studies on products of eq oxidation, especially eqdm, detected in farmed animal tissues indicate that it should be under control and some regulations should be introduced.
Seizures are the most common neurological events of childhood with approximately 35% of children experiencing a seizure at some point in their lives 25% of whom subsequently go on to develop epilepsy . The prevalence of epilepsy in india is 4.9 to 6.2 per 1000 population . Of these patients with epilepsy, 43% comprises of children and adolescents . Intractable epilepsy is defined as a failure to respond to at least two antiepileptic drugs (aeds) given over at least a two - year period . A single definition for intractable epilepsy cannot suit all situations as definitions of intractability are individualized to the patient . Of these patients deemed to be intractable, approximately 50% are estimated to have surgically remediable epilepsy [4, 5]. Hemispheric epilepsy (he) refers to epileptiform activity in all four lobes of one hemisphere, and when it involves more than two lobes of the brain, it is termed subhemispheric epilepsy (she) [4, 6, 7]. These hemispheric brain lesions are commonly associated with early onset of catastrophic epilepsies and multiple seizure types that inhibit brain development . These respond well to early hemispheric / subhemispheric disconnective / resective surgeries [69]. An analysis was done of the pre- and postsurgical data of 34 children who underwent disconnective epilepsy surgeries, that is, a peri - insular hemispherotomy (pih) or a peri - insular posterior quadrantectomy (pipq) for hemispheric / subhemispheric epilepsy from april 2000 to march 2011 . The hemisphere contralateral to the hemiparesis was shown by radiological (mri / computerised tomography (ct)) and functional (scalp eeg / eeg video telemetry) imaging to have a unilateral diffuse abnormality and the remaining hemisphere was normal . When the epileptogenic zone encompassed large areas of the temporal, parietal and occipital lobes with sparing of the frontal lobe the decision was dependant on good concordance between the imaging (mri, ct, nuclear studies), eeg, clinical and neuropsychological evaluations, and a clear localization of the lesion to the unilateral - affected region . The indications for pipq were the same as for hemispheric epilepsy, the pathology being localized to involve the temporal, parietal, and occipital lobes . The presence of residual voluntary motor function of the contralateral distal musculature, that is, finger opposition and foot tapping, was the indication for pipq preserving eloquent uninvolved sensorimotor cortex . All patients went through a presurgical evaluation including a study of the seizure semiology, neurological examination, multiple electroencephalogram (eeg) examinations (video telemetry), magnetic resonance imaging (mri), and neuropsychological evaluation . The focus of the evaluation was to identify a surgically remediable epilepsy syndrome with good electro - clinico - radiological concordance . If the structural lesion responsible for epilepsy could be safely removed without causing deterioration in the functional status, the patient was considered for epilepsy surgery . However, if there was no concordance in investigations in the phase i evaluation, the patient would enter a phase ii evaluation which would include prolonged invasive eeg monitoring, nuclear medicine studies (positron emission tomography (pet) and single photon emission computerized tomography (spect)), and a wada (sodium amylobarbital) test . However, none of our patients required a phase ii evaluation . (figure 1) this is a surgical method of functional hemispherectomy that enables disconnection of the hemisphere through peri - insular windows requiring limited removal of the fronto - parieto - temporal opercular cortices . Following the surgical principles of anatomical subtotal removal of the hemisphere and complete disconnection, the pih is a radical hemispheric tractotomy based on the concept of maximum disconnection with minimal excision . It resulted from the demonstration that the hemisphere could be disconnected, made nonfunctional, through very small removal of brain tissue [9, 14, 15]. A pipq was performed in all cases of subhemispheric epilepsy and the surgery tailored to encompass the whole epileptogenic lesion yet preserving the central region, which is still functional . (figure 2) in this technical variant, there is a minimal removal of brain tissue but complete disconnection of the remaining major part of the abnormal cortex, which is left anatomically intact and viable by preservation of the arteries and veins irrigating these lobes . The primary motor and sensory cortices are identified and recognized from the study of the mri and correlation with intraoperative surface anatomy, based on gyral pattern, arteries, and veins [6, 7]. The identification of the functional cortex is also aided by electrophysiological means under general anaesthesia before the disconnection . This identification maximizes both the extent of resection and the safety of surgery [6, 7]. In this variant, the mesial temporal structures are resected, but the temporal neocortex is disconnected and not resected followed by a parieto - occipital disconnection [6, 7]. The data was analyzed with nonparametric tests because of the small sample size among the children with poor outcome following surgery (engel's class ii nonparametric square test and mann - whitney u test was were to compare the categorical and continuous variables between the groups . P <0.05 (two tailed) was considered significant and data was analyzed using spss (version 19). The mean age of seizure onset was 3.8 years (range: from neonates to 12 years). The mean duration of epilepsy was 4 years (range: from 3 months to 14 years). 28 children (82.3%) had a seizure frequency of 2 episodes / day, while 11 (32.3%) had at least one episode of status epilepticus prior to surgery . Epilepsy was due to rasmussen's encephalitis (re; n = 11) (figure 3), infantile hemiplegia seizure syndrome (ihss; n = 12) (figure 4), hemimegalencephaly (hm; n = 3) (figure 5), sturge weber syndrome (sws; n = 4) (figure 6), and postencephalitic sequelae (pes; n twenty - seven (79.4%) patients underwent pih for lesions causing hemispheric epilepsy, and seven (20.6%) underwent pipq for lesions causing subhemispheric epilepsy . The seizure outcome after surgery was assessed by engel's classification and is described along with followup in table 1 . We recorded 11 variables and analyzed them to arrive at predictive variables of a complete seizure freedom . We found that age of seizure onset (p = 0.03) and the etiology of the disease causing epilepsy (p = 0.007) were predictive variables for the same . Patients who had re, sws, pes, and ihss had good seizure outcomes following surgery . The results of our cognitive outcomes that have been published before show that the mental and social age showed a steady increase after surgery . However, in the long term, intelligence quotient (iq) showed only a gradual gain on followup . Older age of onset of seizures and a shorter duration of seizures prior to surgery were predictive of positive cognitive gains following surgery . Complications in this series included pseudomeningocele in 2 (5.8%) and low pressure hydrocephalus in 1 (2.9%) who required a low pressure ventriculoperitoneal shunt . This is quite low as compared to other published series (table 4) [911]. We also had 15 patients who developed postoperative fever, but csf cultures were sterile . This could have been due to an aseptic meningitis due to the presence of blood products in the disconnected cavity . Our series documents 91.1% seizure freedom, which is similar to other published studies [9, 12, 1621]. Following functional hemispherectomy, seizure free outcomes have ranged from 52 to 90% [9, 1621]. This range could be explained by differences in patient selection or technical pitfalls such as incomplete removal in anatomical hemispherectomy and incomplete disconnection in functional hemispherotomy [14, 19]. We found the age of seizure onset to be a strong predictor of seizure freedom (table 2). This finding is also supported by other studies [3, 22, 23]. A younger age of seizure onset is usually seen in children with developmental cortical malformations and multifocal epilepsy, which are proven to have poor seizure control . The etiology of the disease producing epilepsy is also a strong predictor of seizure freedom (table 3). The best results in our series were obtained in children suffering from re, sws, pes, and ihss (table 3). Ihss and sws are seen in the perinatal age group, and they are generally unilateral with complete sparing of the opposite side . There has been evidence to support that in such cases, early surgical intervention facilitates good seizure control and helps the uninvolved hemisphere to develop and take over the functions of both sides . However, in one patient with ihss, we had a class ii seizure outcome and this was in the initial part of the series, which could be attributed to incomplete disconnection, and this patient was lost to follow up . All patients with re had a class i seizure outcome as this disease also strictly affects only one hemisphere . However, the seizure outcome in patients with hm was not satisfactory as described in literature, and this has been reported in other series too [9, 1721]. The likely explanation could be the presence of migrational abnormalities in the so - called preserved hemisphere or early development of an epileptic encephalopathy, already in utero . We found a significant gain in the mental and social age in the immediate postsurgical period which continued into the second and third years of followup . Our study also showed that older age of onset of seizures showed positive mental and social age gains at followup . Onset of intractable epilepsy within the first 24 months of life is a significant risk factor for mental retardation, especially if seizures occur daily [12, 24]. Most of these children have a low dq / iq to begin with and the improvement in cognitive skills after surgery is poorer in these children . Furthermore, our study also showed that a shorter duration of seizures prior to surgery is predictive of positive mental and social age gains, a finding that is in keeping with those of freitag and tuxhorn and basheer et al . . In general, children with ie in our country are not exposed adequately to environmental stimuli as schooling is discontinued in the presence of seizures . With good postoperative seizure control, the child's attention capacities increase and they engage in social interaction with their family and peers . An improved school attendance due to seizure freedom improves their adaptive skills that in turn helps the child improve his performance in activities of daily living . In our experience, over 90% of children with hemispheric and subhemispheric epilepsy syndromes achieve an excellent seizure outcome with less morbidity following epilepsy surgery . Age of seizure onset and etiology of the disease causing epilepsy are independent predictive variables of a good seizure outcome . Following seizure freedom, improvement of function in the residual brain occurs that in turn leads to improvement in adaptive and social functions and quality of life.
Mutations in codons 12 and 13 of kirsten rat sarcoma viral oncogene homolog (kras) and b - raf murine sarcoma viral oncogene homolog b1 (braf) genes are frequently present in tumors of patients with metastatic colorectal cancer (crc); they are observed in 30 - 45% and 5 - 20% of cases respectively 1 . Less commonly detected crc tumor mutations are codon 61, 146 of the kras oncogene, and at other sites in the braf gene . Kras and braf mutations have been frequently described as mutually exclusive in crc, in that tumors usually have neither, or only one, of these specific mutations . Rarely patients may have crc with coincident kras and braf mutations; herein we report three such cases and review of the literature . Although highly uncommon, identification of this dual tumor genotype is important, as current clinical trials are being designed enriching for patients whose tumors harbor either a kras or braf mutation, but haven't addressed those patients with coincident kras and braf mutations . Due to the infrequent rate of coincident mutation, it is not known if these patients have a tumor biology distinct from kras or braf mutant tumors . Under an institutional review board approved retrospective chart review protocol (dr-11 - 0113), we reviewed samples tested at a clinical laboratory for tumor kras and/or braf mutations from 2008 - 2011 . Dna was extracted from microdissected paraffin - embedded tumor and analyzed by a polymerase chain reaction (pcr)-based dna sequencing method to examine codons 12, 13 and 61 of the kras proto - oncogene . The sensitivity of detection of this assay is approximately 1 in 10 mutation - bearing cells in microdissected area . Dna was also analyzed by pcr and a pyrosequencing method for codons 595 to 600 of exon 16 of braf oncogene; the methods for these assays have been described elsewhere 2 . A total 6,633 crc patient tumors were screened for mutation analyses and of those 1,483 case were tested for both kras and braf mutations . 644 were kras - mutant (43%) and 3 (0.2%) of these were bearing a concomitant braf (v600e) mutation . The first patient is a 65 year - old woman who presented with small bowel obstruction . The patient underwent a biopsy of the metastatic liver lesion that was sent for kras mutation and braf mutation analysis; a tumor mutation was detected in codon 12 (ggt to gat) of the kras gene that would change the encoding amino acid from glycine to aspartic acid (g12d) and codon 600 (gtg to gag) in exon 15 of the braf gene that would change the encoding amino acid from valine to glutamine (v600e). The second case identified was a 72 year - old woman with rectal cancer metastatic to the lungs; similar tumor mutations were detected in kras (g12d) and braf (v600e) proto - oncogenes . In both cases the tumors were microsatellite stable; concomitant braf and kras mutations were not identified among patients samples' whose tumors were microsatellite instable . The third case is 51 year - old man who presented with abdominal pain and was found to have a descending colon cancer with liver metastasis . In specimen from liver lesion, coincident kras and braf mutations appear to be rare entity (present in 3 out of over 1,928 samples tested). Due to the infrequent observation of this phenomena, it is not clear whether or not these tumors have a different biology and natural history than kras or braf mutant tumors, or which of the two mutations is the dominant oncogene driving tumor proliferation . A prior study has demonstrated that concomitant tumor mutations have been relatively frequently observed human crc cell line; in this study, of 24 human crc cell lines, one cell line (gp2d) demonstrated mutations in both kras and braf oncogenes (however the braf mutation was in the less frequently observed at the codon 529 site) 3 . In an analysis of 250 patients tumor specimens with microsatellite stable disease, kras mutations were identified in 45.2% of primary tumors, and that concomitant kras and braf mutations were found in 10 lymph nodes (35.7%) from a total 28 samples whereas only 3 of primary tumor with negative lymph nodes were positive for coincident mutation (2.3%)4 . There was also noted to be a higher proportion of concomitant mutations based on the degree of transmural penetration of the tumor; 1/36 (2.8%) for t2 tumors and 3/32 (9.4%) for t4 tumors, suggesting activation of both genes is associated with progression of disease . Since kras mutation testing became standard - of - care for determining lack of treatment efficacy with antibody anti - epidermal growth factor (egfr) monoclonal antibody therapy in patients with advanced crc, large studies involving kras and braf mutation analysis crc screenings have been undertaken; the results of studies with over 200 patients is demonstrated in table 1 . Unlike study by olivera et al 4, all of these large data sets demonstrated that in crc kras and braf mutations were mutually exclusive, except in one case 5 . In one other series, two patients had tumors with two distinct kras mutations 6 . Molecular profiling demonstrates that kras and braf mutant tumors have very different gene signatures suggesting different signaling pathways are activated 12 . In addition early data suggest outcomes with the use of anti - egfr monoclonal antibody therapy appear to be different depending on the site of kras mutation 13 . At this time it is not known which gene expression profile pattern of concomitant kras and braf tumors is, and whether it more represents a kras tumor gene signature or braf signature . Given fact of tumor heterogeneity and the large variety of mutations observed in this disease, as well as epigenetic changes observed, it is likely that in the future, tumor gene expression profiling will provide a better indication of the activation of tumor signaling, and be a better biomarker of treatment efficacy . Strengths of our study are screened large patient population and available detailed clinical and pathological information . The main limitation, however, were retrospective nature of study and possible artefactual mutation detection . Further multi - center prospective studies are necessary to understand true frequency and the role concomitant kras and braf mutations . Concomitant kras and braf tumor mutations are rare enough to be considered virtually (albeit not entirely) mutually exclusive . Since kras and microsatellite instability analysis are the only validated negative biomarkers of therapy efficacy in crc, routine analysis for braf mutations in kras wild type tumors is not recommended . However if patients are being considered for clinical trial, especially those in which the eligibility require the presence of a kras mutation, braf mutation analysis would be highly advisable . Future enriched clinical trials for kras or braf should specifically address eligibility of patients whose tumors harbor a concomitant kras and braf mutation.
Apolipoprotein (apo) a - v - is an enigmatic modulator of plasma triacylglycerol (tg) homeostasis . Apoa - v is expressed solely in the liver and, following secretion, circulates at extremely low concentrations (~150400 ng / ml plasma). This value is approximately 10,000 fold lower than that of apoa - i, the major apo of high density lipoprotein (hdl). Given the paucity of circulating apoa - v, it is logical to consider that it does not function as a typical member of the apolipoprotein class . Despite this supposition, apoa - v possesses sequence homology with other apo s, is recovered in association with plasma lipoproteins and displays high lipid - surface seeking activity . Using recombinant protein, it has been demonstrated that apoa - v binds heparan sulfate proteoglycans (hspg), members of the low - density lipoprotein receptor (ldlr) family and the endothelial cell surface protein, glycosylphosphatidylinositol-anchored - high - density lipoprotein binding protein 1 (gpih - bp1). This latter function has been invoked to explain the ability of apoa - v to enhance lipoprotein lipase (lpl) mediated hydrolysis of lipoprotein associated tg . What is not explained, however, is how this can be achieved at such low circulating apoa - v concentrations . For example, it has been estimated that, in the postprandial state, there is only enough apoa - v present to associate with ~1 in 24 apob containing lipoproteins . Thus, it would appear that apoa - v is either an exceptionally potent apolipoprotein or it possesses additional functionality that has yet to be revealed . Genome wide association studies (gwas) have identified apoa5 as a determinant of plasma tg concentrations . There is also strong evidence that abnormally high concentrations of tg are associated with atherosclerosis . Given this connection, it is important to consider whether apoa5 may be a risk factor for disease processes that develop from chronic elevation of plasma tg . The fact that ~ 40 million adults in the united states have high tg (200 mg / dl) and ~4 million of these have hypertriglyceridemia (htg; 500 mg / dl) indicates the scale of this health problem . In the prospective cardiovascular munster study, a six - fold increase in coronary heart disease (chd) risk was measured in subjects with tg values> 200 mg / dl . Likewise, in the scandinavian simvastatin survival study, the authors reported increased risk of coronary events as tg levels increased above 220 mg / dl . In this study the 5- year event rate was significantly increased in untreated patients with mixed dyslipidemia (including those with htg) compared to those with elevated ldl - cholesterol alone . Finally, the bezafibrate infarction prevention study found that, in men and women with established chd, elevated plasma tg increased the risk of cardiovascular mortality, stroke and transient ischemic attacks . It is widely recognized that numerous genes play a role in determining plasma tg levels . In addition to apoa5, well - studied modulators of plasma tg homeostasis include lpl, apoc2, apoc3, gpihbp1 and others . According to prevailing models, plasma apoa - v functions to facilitate lipoprotein binding to gpihbp1 . As a component of tg - rich lipoproteins, apoa - v binding to gpihbp1 coordinates lpl and apoc - ii interactions in a manner that promotes efficient tg hydrolysis . Indeed, when any one of these proteins is missing or defective, htg ensues . Further complexity is introduced when the effect of apoa - v on plasma tg is examined in different physiological settings . In mice, for example, an inverse correlation between apoa - v and tg is well documented . These authors showed that gene disruption of apoa5 leads to a marked increase in plasma tg while transgenic overexpression of apoa5 induces a significant decline . By contrast, in human populations with htg, plasma apoa - v and tg are oftentimes positively correlated! Thus, it is likely that, depending on the genetic background / physiological conditions that lead to htg, apoa - v may actually accumulate along with tg . In a recent study, do et al . Investigated the correlation between rare apoa5 variants and early onset myocardial infarction (mi). In this tour de force study, the authors conducted exome sequencing on over 9,700 human subjects with premature mi (50 years of age in males and 60 years in females) along with mi - free controls . They sought to identify genes in which rare mutations contribute to the risk of early-onset mi in the population . Two genes (ldlr and apoa5) were identified in which rare coding mutations were more frequent in mi cases compared to controls . Likewise, in apoa5, those subjects with rare non - synonymous mutations were at 2.2-fold increased risk for mi . When compared to non - carriers, ldlr mutation carriers had higher plasma ldl cholesterol while apoa5 mutation carriers had higher plasma tg . It may be anticipated that subjects identified to be at risk for premature mi as a result of harboring these rare apoa5 mutations could improve or normalize their plasma tg concentration, and reduce the risk of mi, by augmentation with wild type (wt) apoa - v . A basic question emerging from the above investigation relates to the underlying mechanism whereby elevated plasma tg increases the risk of heart disease . Certainly the correlation between chronic elevated plasma tg and atherosclerosis is less clear than that for cholesterol . While the tg content of plaque is far less prominent, evidence suggests that, in cells located in and around plaque deposits, tg - rich lipoproteins induce inflammation and related atherogenic processes . Elevated tg also correlates with the formation of small dense ldl, lipoprotein particles that are positively associated with chd risk and inflammation . Given the very low concentration of apoa - v in plasma under normal circumstances, any decrease will likely impact lipoprotein - associated tg hydrolysis by lpl, thereby interfering with tg - rich lipoprotein clearance . The resulting increase in circulating tg - rich lipoproteins will promote inflammatory cytokine release, contributing to endothelial injury . Studies in mouse models of dyslipidemia have provided evidence that apoa - v is athero - protective . Crossed apoa5 transgenic mice with apoe2 knock in (ki) mice (deficient in apoe and transgenic for apoe2). Compared to control apoe2 ki mice, plasma tg levels were lower and atherosclerotic lesion size was reduced when apoa - v levels were increased . Subsequently, grosskopf et al . Crossed apoa5 transgenic mice with apoe (-/-) mice . In this study a significant decrease in vldl and remnant lipoproteins, together with a 70% reduction in aortic lesion area, was noted . In both of these studies, the apoa - v concentration in plasma was increased by expression of the transgene . Of interest, however, a dysfunctional apoe protein is present while in apoe (-/-) mice no apoe is present . It is conceivable that, since apoa - v and apoe share the ability to bind hspgs and members of the ldl receptor family, augmenting apoa - v levels in the absence of functional apoe compensates for the missing or defective apoe . These mice manifest delayed catabolism of vldl and chylomicrons owing to an abundance of apoc - iii bound to the surface of these particles . To study the effect of apoa - v augmentation on apoc - iii overexpression - dependent htg, qu et al . Used adenovirus mediated gene transfer to increase apoa - v production in apoc3 transgenic mice . Apoa - v gene transfer into apoc3 transgenic mice caused a reduction in apoc - iii content on vldl that, in turn, led to an increase in lpl - mediated tg hydrolysis . As discussed above, and previously by sharma et al ., relatively common apoa5 snps are associated with increased plasma tg . For example, individuals homozygous for the c.553 g> t apoa5 snp (rs2075291) have extremely elevated plasma tg levels . Recent studies have shown that htg in these subjects is due, at least in part, to production of a dysfunctional apoa - v protein . It may be anticipated that an increase in circulating levels of wt apoa - v in homozygous carriers of this snp will induce tg lowering, thereby reducing the risk of related disease processes . Another coding snp strongly associated with elevated plasma tg is c.56c> g apoa5 (rs3135506). This snp, which introduces an amino acid substitution (ser19trp) in the signal sequence of apoa - v, is thought to impede processing / secretion of the mature protein . Along the same lines, a rare homozygous apoa5 deletion mutation has been identified in the signal sequence (c.16_39del; p.ala6_ala13del), generating a variant apoa - v protein that is not secreted . The missing amino acids are required for translocation of nascent apoa - v to the endoplasmic reticulum and, as a result, this protein accumulates in the cytoplasm in association with lipid droplets . In both c.56c> g and c.16_39del, the mature protein is predicted to be identical to wt apoa - v . Mutation- and snp - induced effects on signal sequence function or cleavage decrease secretion efficiency resulting in diminished, or complete lack of, circulating apoa - v . However, despite the fact that individuals harboring the c.56c> g snp may secrete less apoa - v, if this polymorphism is not the sole or primary underlying cause of htg, then apoa - v levels will likely accumulate in plasma along with tg and it is doubtful augmentation with apoa - v will induce tg lowering . Non - coding snps located within the apoa5 gene locus are also associated with elevated plasma tg, most likely due to effects on apoa5 gene expression . For example, the -1131t> c snp (rs662799), located upstream of the transcription start site, has been proposed to reduce transcription efficiency . Likewise, an ivs3 + 3 g> c mutation causes a frameshift in the donor splice site of intron 3 creating a premature stop codon that results in a nonsense protein . Other rare mutations in apoa5 result in severe truncation of apoa - v and abolish function altogether . Given this, it may be anticipated that individuals with htg caused by deleterious apoa5 snps or mutations would benefit from increased circulating levels of wt apoa - v (table1). Likewise, as seen above, if htg is caused by enhanced apoc - iii production, it may be anticipated that increased circulating levels of apoa - v would be beneficial . On the other hand, if htg is associated with a diagnosis of metabolic syndrome, for example, simply adding to the pool of apoa - v is not expected to improve the tg profile owing to the multifactorial causation of this disorder . From a practical standpoint, if htg is observed, then the apoa5 gene should be examined for the presence of deleterious snps or loss of function mutations . If present, then wt apoa - v augmentation may induce tg lowering . On the other hand, subjects with htg unrelated to apoa5 or from a combination of apoa5 variation and other genes, this predicted differential response provides a plausible explanation for the conundrum emerging from analysis of apoa - v genetically engineered mouse models (wherein a clear inverse correlation between apoa - v and plasma tg exists) and human population studies that reveal a positive correlation between apoa - v and tg . The importance of discriminating between predicted responders and non- responders is illustrated below . For subjects harboring apoa5 mutations, specific criteria must be met prior to consideration for supplementation with wt apoa - v . These include persistent elevated plasma tg, continuing low plasma apoa - v protein levels and a lack of polymorphisms / mutations in other known tg modulating genes . Based on the above discussion, it is conceivable that deleterious apoa5 snps or mutations (e.g. Interfere with apoa - v secretion efficiency or produce an apoa - v protein with compromised function) may increase the risk of atherosclerosis due to chronically elevated plasma tg levels . To investigate the potential benefit of direct addition of apoa - v, shu et al . Administration of apoa - v containing reconstituted hdl induced a 60% decline in plasma tg after 4 h that was attributed to enhanced catabolism and clearance of vldl . Despite the reduction in plasma tg observed in this experiment, the effect was short - lived, suggesting that this approach may not represent a feasible therapeutic strategy . In an effort to increase the duration of tg - lowering induced by apoa - v, aav2/8-mediated gene transfer of wt apoa - v was performed in apoa5 (-/-) mice . In this study, apoa - v expression lasted at least 8 weeks and induced a 50% decline in plasma tg levels, suggesting that gene therapy may be beneficial in some instances . It is noteworthy that recent advances suggest gene transfer technology may constitute a feasible therapeutic option for a subset of individuals with chronic htg . For this purpose, vectors most commonly used for treatment of metabolic disorders are adeno - associated virus (aav) and lenti - virus . Among these furthermore, compared to other viral vectors, aav induces a minimal host immune response . In fact, aav vectors have been used to deliver genes to over 500 study subjects by various routes of administration for potential treatment of genetic disorders including cystic fibrosis, hemophilia and canavan, batten, parkinson's and alzheimer's diseases, without significant safety concerns . Among approved aav - based therapies, glybera (uniqure) long- term gene expression (> 1.5 years) has been demonstrated after aav transduction in animal models including canine, murine and hamster . Moreover, it has been demonstrated that aav can successfully be transduced into a variety of cell and tissue types, including brain, liver and muscle . An advantage of the aav serotype 2/8 is that it efficiently targets liver . Given that apoa - v is expressed solely in liver, aav2/8 is a strong candidate vector for studies involving apoa - v gene transfer . Given the role of apoa5 in modulation of plasma tg documented in studies of genetically engineered mice, gwas, human population loss of function studies and large - scale exome sequencing, therapies designed to promote its athero - protective effects are very attractive . Whereas it may be possible to develop a small molecule therapeutic capable of inducing endogenous apoa - v expression, individuals harboring common snps or rare mutations in apoa5 may not benefit from this approach . On the other hand, gene therapy represents a safe, robust and efficient means to achieve sustained expression of wt apoa - v . By controlling plasma tg homeostasis in this manner
Mr images of the liver were retrospectively reviewed alongside clinical findings in 50 children and young adults with wilson's disease (m: f = 33:17; age range, 5 - 26 years; median age, 14 years). The database of the computed hospital information system was cross - referenced with the mr imaging database to identify all patients with wilson's disease who had undergone mr imaging of the liver at the institution over the course of a 10-year period from january 1997 to january 2007 . The institutional review board approved the review of the radiological and clinical data for this study and waived the requirement for patient informed consent . Wilson's disease was diagnosed based on a combination of low serum ceruloplasmin levels accompanied with elevated 24-hour urinary copper excretion (n = 50), as well as the presence of a kayser - fleischer (k - f) ring (n = 28), and a liver biopsy (n = 12). Patients were classified at the time of diagnosis as having neurological (either current clinical or historical evidence of neurological dysfunction which was not associated with symptomatic liver disease) and non - neurological presentation, including hepatic (an increase in serum transaminase levels, acute / chronic hepatitis or cirrhosis) and asymptomatic presentation (siblings of index cases with no disease - related symptoms) (6). The hepatic function of the each patient was categorized into three groups (class a, b and c) according to the child - turcotte - pugh score (5 to 15-point scale) (15). Twenty - two patients had been treated with copper chelators, d - penicillamine (n = 16), or trientine (n = 6) (median duration of treatment: 6 years, range: 0.5 - 12 years) at the time of mr imaging . Another 28 patients were diagnosed with wilson's disease at the time of mr imaging and was administered any copper chelating agents . All patients were followed at the pediatric outpatient clinic, and follow - up mr images were available for 17 patients . All examinations were obtained using 1.0 or 1.5 tesla mr scanners (siemens medical systems, erlangen, germany). This retrospective data collection was preceded by the various mr imaging protocols for the liver . However, the studies included the following mr sequences: an axial t2-weighted fast spin - echo sequence (repetition time msec / echo time msec, 3500 - 5000/96 - 144) and an axial t1-weighted spin echo sequence (repetition time msec / echo time msec, 410 - 530/1.5 - 2.2) with a 7 mm thickness, 1 - 2-mm gap, 256 256 matrix size and field - of - view, 240 320 . Two radiologists, each with more than seven years of experience in mr body imaging, retrospectively evaluated the mr images . The two readers evaluated the mr images for (a) the presence and pattern of intrahepatic nodules, (b) the contour abnormalities of the liver and (c) additional findings such as a gallbladder abnormality, splenomegaly, venous collateral formation, or ascites . A three - point scoring system was used to evaluate the pattern of intrahepatic nodules as follows: 0 for none, 1 for granular (3 mm in diameter), and 2 for macronodular (> 3 mm in diameter) (fig . 1). We evaluated the signal intensity of the nodules on t1-weighted images in comparison to the underlying liver parenchyma . The various contour abnormalities of the liver identified included surface nodularity, gallbladder fossa widening, and caudate hypertrophy . Surface nodularity of the liver and the gallbladder fossa widening were assessed subjectively by the evaluation of irregularities along the liver surface and enlargement of the pericholecystic space (i.e., the gallbladder fossa), respectively . Caudate hypertrophy was evaluated using a modified caudate - right lobe ratio (16). Twenty follow - up mr examinations obtained from 17 patients over a 10-year period (mean interval 28 months, range, 8 - 130 months) were also evaluated with the same mr interpretation protocols . Nine patients underwent mr imaging, before and after treatment, using copper chelating agents . In the eight remaining patients, both initial and follow - up mr examinations were obtained during treatment with copper chelating agents . The prevalence of the mr imaging findings was estimated as a percentage of the patients displaying each abnormality . The overall association between the mr findings and clinical presentations (neurological or non - neurological), or severity of hepatic dysfunction (child - pugh classification a, b, c), was assessed with a contingency table, employing the chi - squared and fisher's exact tests . The association of clinical features for both clinical presentations was also evaluated by chi - squared and fisher's exact probability tests . Differences in age and duration of treatment were compared for both groups of clinical presentation, three groups of hepatic dysfunction, and type of mr finding using non - parametric probability tests (mann - whitney or kruskal - wallis). All p - values were based on two tailed comparisons and a 5% confidence - level was considered to indicate a statistically significant difference . Statistical analyses were performed with spss 7.5 for windows (spss, chicago, il). Mr images of the liver were retrospectively reviewed alongside clinical findings in 50 children and young adults with wilson's disease (m: f = 33:17; age range, 5 - 26 years; median age, 14 years). The database of the computed hospital information system was cross - referenced with the mr imaging database to identify all patients with wilson's disease who had undergone mr imaging of the liver at the institution over the course of a 10-year period from january 1997 to january 2007 . The institutional review board approved the review of the radiological and clinical data for this study and waived the requirement for patient informed consent . Wilson's disease was diagnosed based on a combination of low serum ceruloplasmin levels accompanied with elevated 24-hour urinary copper excretion (n = 50), as well as the presence of a kayser - fleischer (k - f) ring (n = 28), and a liver biopsy (n = 12). Patients were classified at the time of diagnosis as having neurological (either current clinical or historical evidence of neurological dysfunction which was not associated with symptomatic liver disease) and non - neurological presentation, including hepatic (an increase in serum transaminase levels, acute / chronic hepatitis or cirrhosis) and asymptomatic presentation (siblings of index cases with no disease - related symptoms) (6). The hepatic function of the each patient was categorized into three groups (class a, b and c) according to the child - turcotte - pugh score (5 to 15-point scale) (15). Twenty - two patients had been treated with copper chelators, d - penicillamine (n = 16), or trientine (n = 6) (median duration of treatment: 6 years, range: 0.5 - 12 years) at the time of mr imaging . Another 28 patients were diagnosed with wilson's disease at the time of mr imaging and was administered any copper chelating agents . All patients were followed at the pediatric outpatient clinic, and follow - up mr images were available for 17 patients . All examinations were obtained using 1.0 or 1.5 tesla mr scanners (siemens medical systems, erlangen, germany). This retrospective data collection was preceded by the various mr imaging protocols for the liver . However, the studies included the following mr sequences: an axial t2-weighted fast spin - echo sequence (repetition time msec / echo time msec, 3500 - 5000/96 - 144) and an axial t1-weighted spin echo sequence (repetition time msec / echo time msec, 410 - 530/1.5 - 2.2) with a 7 mm thickness, 1 - 2-mm gap, 256 256 matrix size and field - of - view, 240 320 . Two radiologists, each with more than seven years of experience in mr body imaging, retrospectively evaluated the mr images . The two readers evaluated the mr images for (a) the presence and pattern of intrahepatic nodules, (b) the contour abnormalities of the liver and (c) additional findings such as a gallbladder abnormality, splenomegaly, venous collateral formation, or ascites . A three - point scoring system was used to evaluate the pattern of intrahepatic nodules as follows: 0 for none, 1 for granular (3 mm in diameter), and 2 for macronodular (> 3 mm in diameter) (fig . 1). We evaluated the signal intensity of the nodules on t1-weighted images in comparison to the underlying liver parenchyma . The various contour abnormalities of the liver identified included surface nodularity, gallbladder fossa widening, and caudate hypertrophy . Surface nodularity of the liver and the gallbladder fossa widening were assessed subjectively by the evaluation of irregularities along the liver surface and enlargement of the pericholecystic space (i.e., the gallbladder fossa), respectively . Caudate hypertrophy was evaluated using a modified caudate - right lobe ratio (16). Twenty follow - up mr examinations obtained from 17 patients over a 10-year period (mean interval 28 months, range, 8 - 130 months) were also evaluated with the same mr interpretation protocols . Nine patients underwent mr imaging, before and after treatment, using copper chelating agents . In the eight remaining patients, both initial and follow - up mr examinations were obtained during treatment with copper chelating agents . The prevalence of the mr imaging findings was estimated as a percentage of the patients displaying each abnormality . The overall association between the mr findings and clinical presentations (neurological or non - neurological), or severity of hepatic dysfunction (child - pugh classification a, b, c), was assessed with a contingency table, employing the chi - squared and fisher's exact tests . The association of clinical features for both clinical presentations was also evaluated by chi - squared and fisher's exact probability tests . Differences in age and duration of treatment were compared for both groups of clinical presentation, three groups of hepatic dysfunction, and type of mr finding using non - parametric probability tests (mann - whitney or kruskal - wallis). All p - values were based on two tailed comparisons and a 5% confidence - level was considered to indicate a statistically significant difference . Statistical analyses were performed with spss 7.5 for windows (spss, chicago, il). At the time of diagnosis, 12 patients presented with neurological dysfunction, compared to 38 patients who presented with non - neurological manifestations (33 patients with hepatic dysfunction and five asymptomatic siblings of index cases). The k - f ring was most common in the neurological presentation (92%, 11 of 12) relative to non - neurological presentation (45%; 17 of 38; p = 0.006). There were no statistically significant differences between sex, age, presence of medical treatment, and duration of treatment among both clinical presentations (table 1). Patient hepatic function was categorized as child - pugh class a in 36 patients, child - pugh class b in five patients, and child - pugh class c in nine patients . Mean age at diagnosis was 11.1 years in class a, 13.4 years in class b, and 17.0 years in class c. a statistically significant difference was noted for age at mr imaging among the three groups of child - pugh classification (p = 0.036). All of the patients with a neurological presentation were categorized as class a. another 38 patients with non - neurological presentation were categorized as class a (n = 24, 63%), class b (n = 5, 13%), and class c (n = 9, 24%). There was a statistically significant difference for child - pugh classification between neurological and non - neurological presentations (p = 0.048). The nodules were granular (grade 1, 3 mm in diameter) in 13 patients (figs . These nodules were hyperintense (n = 14) or isointense, or slightly hypointense (n = 11) as seen on t1-weighted images (figs . Thirty - one patients (62%) showed contour abnormalities such as surface nodularity (n = 25), caudate hypertrophy (n = 10), or gallbladder fossa widening (n = 29) (figs . 3, 4). Ascites, venous collaterals, and splenomegaly were observed in seven patients, 10 patients, and 40 patients, respectively . Edematous wall thickening of the gallbladder was observed in 12 patients, and a gallbladder stone or sludge in three patients (fig . A, hypointense nodules as seen on t2-weighted images, were detected in 12 patients (33%) (grade 1 [n = 9, 25%] and grade 2 [n = 3, 8%]). Contour abnormalities of the liver were noted in 17 patients (47%). In the five patients categorized as child - pugh class b, hypointense nodules as seen on t2-weighted images, and contour abnormalities of the liver macronodular lesions (grade 2,> 3 mm in diameter) were observed in three patients (60%) (fig . 3). In the nine patients categorized as child - pugh class c, hypointense nodules as seen on t2-weighted images and contour abnormalities of the liver 4). Each mr imaging finding demonstrated a statistically significant difference among the three groups of child - pugh classification except for splenomegaly (p = 0.243). A summary of the mr findings and association of mr findings with the severity of hepatic dysfunction are listed in table 2 . For each mr imaging finding, mean age at mr examination was greater in patients with a positive finding than those with negative findings, and were statistically significant except in hyperintense nodules on t1-weighted images (p = 0.113) (table 3). In the patients belonging to child - pugh class a (n = 36), mr findings such as intrahepatic nodules (p = 0.007), surface nodularity (p = 0.011), and gallbladder fossa widening (p <0.001) demonstrated a statistically significant difference between patients with neurological presentation and non - neurological presentation . Other mr findings did not present a statistically significant difference between neurological presentation and non - neurological presentation (table 4). Twenty follow - up mr examinations obtained from 17 patients demonstrated improved hepatic nodular infiltrations for eight patients, aggravated intrahepatic nodules and/or cirrhosis for four patients, and a stationary state of imaging features for five patients (fig . In the eight patients with improved nodular lesions, all of them showed improved hepatic dysfunction (normalized serum transaminase level, n = 5; improved hyperbilirubinemia, n = 1; improved coagulation abnormality, n = 2). In four patients with aggravated nodular lesions and/or cirrhosis, newly appeared intrahepatic nodules were detected in two patients, whereas aggravated intrahepatic nodules and cirrhosis were observed in two patients . Among these four patients, two patients underwent liver transplantation (fig . At the time of diagnosis, 12 patients presented with neurological dysfunction, compared to 38 patients who presented with non - neurological manifestations (33 patients with hepatic dysfunction and five asymptomatic siblings of index cases). The k - f ring was most common in the neurological presentation (92%, 11 of 12) relative to non - neurological presentation (45%; 17 of 38; p = 0.006). There were no statistically significant differences between sex, age, presence of medical treatment, and duration of treatment among both clinical presentations (table 1). Patient hepatic function was categorized as child - pugh class a in 36 patients, child - pugh class b in five patients, and child - pugh class c in nine patients . Mean age at diagnosis was 11.1 years in class a, 13.4 years in class b, and 17.0 years in class c. a statistically significant difference was noted for age at mr imaging among the three groups of child - pugh classification (p = 0.036). All of the patients with a neurological presentation were categorized as class a. another 38 patients with non - neurological presentation were categorized as class a (n = 24, 63%), class b (n = 5, 13%), and class c (n = 9, 24%). There was a statistically significant difference for child - pugh classification between neurological and non - neurological presentations (p = 0.048). The nodules were granular (grade 1, 3 mm in diameter) in 13 patients (figs . 1a, 2a), or macronodular (grade 2,> 3 mm in diameter) in 12 patients (figs . These nodules were hyperintense (n = 14) or isointense, or slightly hypointense (n = 11) as seen on t1-weighted images (figs . Thirty - one patients (62%) showed contour abnormalities such as surface nodularity (n = 25), caudate hypertrophy (n = 10), or gallbladder fossa widening (n = 29) (figs . 3, 4). Ascites, venous collaterals, and splenomegaly were observed in seven patients, 10 patients, and 40 patients, respectively . Edematous wall thickening of the gallbladder was observed in 12 patients, and a gallbladder stone or sludge in three patients (fig . In the 36 patients belonging to child - pugh class a, hypointense nodules as seen on t2-weighted images, were detected in 12 patients (33%) (grade 1 [n = 9, 25%] and grade 2 [n = 3, 8%]). Contour abnormalities of the liver were noted in 17 patients (47%). In the five patients categorized as child - pugh class b, hypointense nodules as seen on t2-weighted images, and contour abnormalities of the liver macronodular lesions (grade 2,> 3 mm in diameter) were observed in three patients (60%) (fig . 3). In the nine patients categorized as child - pugh class c, hypointense nodules as seen on t2-weighted images and contour abnormalities of the liver 4). Each mr imaging finding demonstrated a statistically significant difference among the three groups of child - pugh classification except for splenomegaly (p = 0.243). A summary of the mr findings and association of mr findings with the severity of hepatic dysfunction are listed in table 2 . For each mr imaging finding, mean age at mr examination was greater in patients with a positive finding than those with negative findings, and were statistically significant except in hyperintense nodules on t1-weighted images (p = 0.113) (table 3). In the patients belonging to child - pugh class a (n = 36), mr findings such as intrahepatic nodules (p = 0.007), surface nodularity (p = 0.011), and gallbladder fossa widening (p <0.001) demonstrated a statistically significant difference between patients with neurological presentation and non - neurological presentation . Other mr findings did not present a statistically significant difference between neurological presentation and non - neurological presentation (table 4). Twenty follow - up mr examinations obtained from 17 patients demonstrated improved hepatic nodular infiltrations for eight patients, aggravated intrahepatic nodules and/or cirrhosis for four patients, and a stationary state of imaging features for five patients (fig . In the eight patients with improved nodular lesions, all of them showed improved hepatic dysfunction (normalized serum transaminase level, n = 5; improved hyperbilirubinemia, n = 1; improved coagulation abnormality, n = 2). In four patients with aggravated nodular lesions and/or cirrhosis, newly appeared intrahepatic nodules were detected in two patients, whereas aggravated intrahepatic nodules and cirrhosis were observed in two patients . Among these four patients, in wilson's disease, asymptomatic hepatic copper deposition in liver cells occurs early in the disease's progression, predominantly in the periportal regions and along the hepatic sinusoids (17, 18). After episodes of acute hepatitis, which may be reflected by elevated plasma levels of liver enzymes, a fatty change and periportal inflammation can develop . Finally, after several years, insidious development of irreversible cirrhosis occurs (19). In a large cohort study of patients with wilson's disease, liver biopsies revealed variable hepatic involvement in 37% of patients presenting cirrhosis, 36% at an unspecified stage of fibrosis, and 54% with steatosis (20). Considering the variable hepatic involvement, various imaging findings of the liver in wilson's disease are demonstrated (8 - 13). Recently, akhan et al . (14) reported that wilson's disease should be considered as one of the leading diagnoses of young patients with a perihepatic fat layer, parenchymal heterogeneity with multiple nodules, and the absence of caudate lobe hypertrophy . It also suggested that us seemed to be the best imaging modality for the demonstration of early parenchymal alteration . In this study, hypointense nodules on t2-weighted images, surface nodularity of the liver, and gallbladder fossa widening were common mr imaging findings in patients with wilson's disease, and these correlated with severity of hepatic dysfunction . Among the patients with normal or mild hepatic dysfunction (child - pugh class a), the mr findings were more common in patients with the neurological manifestations than the non - neurological manifestations of wilson's disease . Therefore, it is postulated that neurological dysfunction, which was not associated with symptomatic liver disease, might be related with hepatic copper accumulation and subsequent hepatic parenchymal changes . Hepatic nodules in wilson's disease are considered as a result of copper deposition . On mr imaging, these lesions typically appear as hypointense on t2-weighted images and hyperintense on t1-weigthed images (9, 14). In this study, the paramagnetic effect of ionic copper has been implicated as a cause of hypointensity, as was observed on t2-weighted images and hyperintensity as observed on t1-weighted images . However, the t1-shortening and t2-shortening effect of copper deposition may be nullified by elevated t1 and t2 values in advanced cirrhosis (17). Multiple hypoinstense nodules of the liver were noted in 33% of patients with early stage of hepatic dysfunction (child - pugh class a) before advanced cirrhosis . In patients with advanced hepatic dysfunction (child - pugh classes b and c), hypointense nodules of the liver were noted in 93% (13 of 14) of the patients and 50% of the nodules were macronodular (> 3 mm in diameter) and were observed as hyperintense on t1-weighted images . Contour abnormalities of the liver due to parenchymal necrosis, regeneration, and scarring that suggest cirrhosis were correlated with hepatic dysfunction in this study . The expanded gallbladder fossa sign has been reported to be a highly specific mr sign for the diagnosis of cirrhosis, and consists of the enlargement of the pericholecystic space (i.e., the gallbladder fossa) (21). This is comparable to the finding of a thickened perihepatic fat layer as described by akhan et al . Right lobe ratio has been reported as a unique feature of cirrhosis in wilson's disease (14). In this study, caudate hypertrophy was less common (20% of patients) relative to other imaging features that were suggestive of cirrhosis . However, an explanation is not postulated for the mechanism of lobar dysmorphism of the liver in these patients . (22) reported that mr imaging of the brain depicts the reversible changes of the involved brain parenchyma after copper chelating therapy . Reversible changes of copper deposition in the liver have been rarely reported (12, 14, 23). In this study, follow - up mr images of the liver demonstrated improved intrahepatic nodules in 47% (8 of 17) of patients after copper chelating therapy with clinical improvement of liver function . Follow - up mr examinations also demonstrated aggravated nodular infiltrations and progressed contour abnormalities of cirrhosis in four patients with rapidly progressive hepatic dysfunction . From this point of view, mr imaging may be used as an indicator of therapeutic response in wilson's disease . The child - pugh classification was used in the evaluation of clinical status of wilson's disease, which only reflects hepatic dysfunction . Serum ceruloplasmin and copper levels, as well as the 24-hour urinary copper level were not considered . Although 50 patients with wilson's disease were included in the study, most of the patients were child - pugh class a, and only 25% of the patients were child - pugh class b or c. therefore, an error in the statistical analysis was inevitable . Second, the mr protocol could not be uniformly assumed, as the study included retrospective data collection for a 10-year span . Third, interobserver or intraobserver variance analyses were not performed for the mr imaging interpretation . In conclusion, mr imaging of the liver in wilson's disease demonstrated multiple, hypointense nodules on t2-weighted images, as well as contour abnormalities of the liver suggestive of cirrhosis.
The truth is that most medical breakthroughs have ultimately come from basic research, and i think that we as scientists need to do a better job of telling these success stories . My favorite example is that antibiotics came out of finding a random contaminant on a plate . And remember that we have crispr [clustered regularly interspaced short palindromic repeats] tools only because people were studying some bizarro antipathogen mechanism in bacteria . It s a beautiful example of something entirely unanticipated coming out of left field . That s why it s important to maintain funding for a very diverse program of basic research; history tells us you ca nt predict where the next advance will come from . Right now it seems like funding agencies and the public have an engineering mentality, and they believe that, as long as we think hard enough about a problem, we can solve it . That s an admirable attitude, but in the life sciences it s not always the right path to discovery . I would argue that under some circumstances, studying yeast cells is a better idea than studying highly transformed human cells in a dish . For many years, we used to write in the significance section of grant applications that the reason that it is important to understand chromosome segregation is because, when it fails, cells become aneuploid and cancerous . Why should aneuploidy cause cells to proliferate? When you do yeast crosses and by chance get an aneuploid strain, invariably the cells do poorly . And one explanation is that building an organism is a complicated procedure, so if you change the gene dosage of certain genes, you mess everything up . That s probably true you could then further argue that, at the cellular level, maybe it does nt really matter how many chromosomes you have, as long as you have at least one of each . Perhaps extra chromosomes are actually good for an individual cell and allow it to keep proliferating when they should not and this gives you cancer . However, we never thought this was very likely, given that aneuploid yeast often proliferate poorly . You can very agnostically ask: what happens to a cell if you change the chromosome number? Yeast was the right organism for this because we have genetic tricks and selection methods to generate aneuploids that are stable enough to study . Because this allowed us to examine many different types of aneuploidies at the same time, we could look for broad patterns . We could nt have done it in any other organism . Actually, we do all our discovery work in yeast . And when we find something interesting, we move it into the mouse or human cell lines and ask whether we see the same thing . Sometimes the answer is no, but more often the answer is yes . It s just harder to discover fundamentally new things in very complex organisms where the repertoire of tools is limited . And i would argue that, under some circumstances, studying yeast cells is a better idea than studying highly transformed human cells in a dish . Angelika amon s work over the past 15 years has guided all of us who think about mitotic and meiotic cell division ., we wondered whether there was a systematic way the cell avoids losing or gaining chromosomes . To be honest, i was hoping there would be some kind of cute mechanism that counts chromosomes . That turned out to be completely wrong . Or at least we havent been able to find anything of this sort . Once we realized that, we had to step back and let the genetics lead the way . We did a lot of phenotypic characterization and then developed hypotheses to explain the patterns we saw . If complex subunits are not expressed in the correct ratios, often unassembled subunits need chaperones to maintain their soluble state and eventually need to be degraded if they cannot find a binding partner . Cancer cells do nt only lose or gain whole chromosomes, they also have translocations and deletions and point mutations . We know that making and repairing dna requires a lot of nifty multi - subunit complexes, so our hypothesis was that whole - chromosome abnormalities cause stoichiometric imbalances in these complexes and this leads to defects in their formation and function . So we re testing the idea that aneuploidy contributes to cancer because it s a mutator, rather than because it s a promoter of growth and proliferation, and we re doing more and more mouse work to answer those kinds of questions . But we still use yeast to discover new properties of aneuploidy and to look at the cellular effects of changing the dosage of specific genes . We started a new project on mitochondria a few years ago that i m really excited about . One big question is: how did these two organisms start talking to each other? Did one learn english or the other learn french? Or did they resort to a more primitive sign language metabolites to talk to each other? The other thing i m fascinated by is that a large fraction of uncharacterized yeast genes localize to mitochondria . That tells you there s a lot of biology in the mitochondria still to be learned . What i think is even more important is that many of these genes are not at all conserved, not even in fungi . So here are all these very new, very fast - evolving genes and nobody knows what they do! Usually when people hear that a gene is not conserved, they run! Arrgh! It s something yeast specific! But in this particular instance i think it s important and suggests mitochondria are still battling it out with the nucleus . One way to look at it is to say the nucleus and mitochondria are not really symbiotic . If mitochondria do nt get anything out of the relationship, they are really just slaves to the nucleus . So the mitochondria are trying to escape the reign of the nucleus and the nucleus is fighting back in an arms race . And if we can understand what all these nonconserved mitochondrial genes are doing, we can begin to find the frictions that still exist between the interests of the nucleus and the mitochondria . I m totally fascinated by understanding how these different entities interact with each other inside a single cell.
Systemic chemotherapy is the main treatment modality in the management of patients with metastatic disease . After chemotherapy, oncologists evaluate tumor response by observing tumor behavior, i.e. Growth, reduction or stability in its dimensions [2, 3]. Nowadays, tumor response to therapy as determined by imaging methods is generally used to inform decisions regarding either maintenance or interruption of treatment . In the late 1970s the world health organization (who) introduced a standard assessment of tumor response, proposed by miller et al . And adopted internationally, defining objective responses of lesions measurable in two dimensions, such as pulmonary metastasis assessed by x - rays . This evaluation is performed by comparison of tumor area, the sum of all lesions greater perpendicular diameter products, measured in a planar image . More recently a new set of guidelines has been introduced by the response evaluation criteria in solid tumors (recist) group with the purpose of reviewing the former criteria and better standardizing response evaluation . This model uses a unidimensional approach taking the sum of the longest diameters instead of the sum of the areas . With the introduction of cross - sectional imaging methods, the number of measurable metastatic lesions detected in a single patient has increased dramatically, and most oncologists (as well as study protocols) recommend the use of one lesion or a few representative lesions to evaluate response in individual patients with multiple lesions . Metastatic nodules are not uniform and consist of a heterogeneous cell population with diverse biological behavior that could account for differences in chemotherapy response . A wide range of growth patterns in pulmonary metastases of patients not previously submitted to treatment has been observed . This variation in behavior, if observed in patients being evaluated for chemotherapy response, could influence the response perception . The selection of one or a few nodules, instead of including all identifiable nodules in the response evaluation, could lead to misevaluation and consequently to the continuity of ineffective treatment or the interruption of potentially effective therapy . The present study used ct to quantify the variation in tumor response of pulmonary metastases of solid tumors of varied histology in individual consecutive patients that were submitted to ct studies in order to evaluate response to chemotherapy . We submitted each pulmonary nodule individually, as if it were a solitary metastasis, as well as all the nodules of the same patient combined, to both the who and the recist criteria and compared the response evaluations in each setting . We prospectively evaluated two consecutive chest ct scans of patients with the diagnosis of solid tumor and pulmonary metastases receiving systemic chemotherapy and being routinely evaluated for tumor response . We included in this study 41 chemotherapy response evaluations in 33 patients (20 women and 13 men), with ages ranging from 14 to 81 years (median 46 years). In eight patients the attending physician (department of clinical oncology) established the diagnosis of pulmonary metastases usually by the presence of new pulmonary nodules and progression of metastatic disease and the type of chemotherapy used . The interval between the ct evaluations varied from 1.25 to 8.8 months (median: 3.9; mean (sd) 3.8 (1.6) months) and the number of cycles varied from 2.0 to 6.0 cycles (median: 4; mean sd: 3.7 1.2 cycles). Helical scan techniques were performed on ct prospeed and ct hispeed scanners (general electric). The slices obtained were contiguous with 7 mm thickness and a pitch of 1.5 or less . The two larger perpendicular diameters on the axial plane were measured in images printed in lung windows . The number of nodules in an individual patient varied from 2 to 69 (median: 7; mean sd: 13.8 15.0 nodules). The nodules initial larger diameter ranged from 2 to 82 mm (median: 10; mean sd: 11.6 8.5 mm). In each set of ct scan examinations performed to assess tumor response to chemotherapy, who and recist criteria classified each nodule individually . For the patient s response evaluation a modified version of the who and recist criteria was used by considering the sum of measurements of all pulmonary nodules in each patient to better represent the total tumor volume change for each patient . The bidimensional who criteria of tumor response categories are: (a) partial response when area reduction is 50% or more; (b) stable disease for a reduction of less than 50% or an increase less than 25%; and (c) disease progression for an increase of 25% or more . The unidimensional recist criteria of tumor response categories are: (a) partial response if linear larger dimension reduction is 30% or more; (b) stable disease for a reduction less than 30% or an increase less than 20%; and (c) disease progression for an increase of 20% or more . The disappearance of the lesion(s) is considered a complete response by both assessment criteria and both consider the presence of any new nodule as progression of disease, independent of the behavior of any other nodule . The following parameters were determined: (a) individual nodule response rate evaluation; (b) response evaluation for each patient, as a whole, according to the who and the recist criteria; (c) intra - individual distribution of response for every patient s nodule; and (d) the proportion of nodules evaluated differently from the patient s response, taking the sum of all nodules into consideration . The nodules response category distributions for different types of cancer, chemotherapy, and initial number of nodules were compared by chi - square test . The agreement between both response evaluation criteria was calculated by the kappa - interrater agreement index . Half (n=283) of the nodules showed a reduction in size considering only the larger measured diameter, while 126 (22%) remained unaltered comparing both ct scan studies and 157 (28%) increased in size . According to the who criteria, 113 (20%) had a complete response, 66 (12%) had a partial response, 258 (46%) were stable and 129 (23%) progressed . Using the recist criteria, 134 nodules were considered measurable as having a diameter twice the size of the slice thickness utilized (> 14 mm). Of these, 22 (16%) nodules had a complete response, 17 (13%) a partial response, 67 (50%) were stable and 28 (21%) progressed . Classification was different by the two criteria in 13 (10%) of the 134 measurable nodules . The kappa interrater agreement for both criteria evaluations was 0.85 (table 2). Evaluating the patients response, taking into account the sum of all nodules, by the who criteria, one patient was classified as having complete response, five partial response, 15 stable disease and 20 progressive disease; and by the recist criteria one patient was classified as having complete response, five partial response, 16 stable disease and 19 progressive disease . The kappa interrater agreement for both criteria evaluations was 0.90 (table 3). The intra - individual variation for metastases response evaluation was quite diverse by both criteria, with no relation to type of cancer, chemotherapy or number of nodules . By the who criteria: from the total of 41 response evaluations, all the patients nodules had the same response classification in four; in 16 evaluations there were nodules in two distinct classifications; in 12 three different classifications; and in seven, nodules in the four possible categories (fig . 1). By the recist criteria: measurable nodules were present in 33 of the 41 response evaluations; in seven there was only one nodule; in 11 all the patients nodules had the same response classification; in 12 evaluations there were nodules in two distinct classifications; and in three evaluations there were nodules in three different classifications (fig . Eighteen patients presented 82 new nodules observed at the second ct scan, varying from 1 to 21 per patient (median 2, mean 4.8), in a proportion of the initial total number of nodules ranging from 5% to 525% (median 25%, mean 75%). By the recist criteria, in one of the 19 patient evaluations resulting in disease progression no new nodule was present and in 14 a new nodule was the sole criterion for disease progression classification (table 4). By the recist criteria, the proportion of measurable nodules classified differently from the patient evaluation, taking the sum of all measurable nodules into consideration, varied from 0% to 100% (median: 25%; mean sd: 30% 33%). In a patient with three lung metastases, the patient evaluation by comparison of the sum of diameters of the three nodules resulted in partial response . In 15 evaluations there were measurable lesions and there were no new nodules; when the measurable response was the only considered factor, the proportion of measurable nodules classified differently from the patient evaluation, taking the sum of all measurable nodules into consideration, varied from 0% to 100% (median: 33%; mean sd: 35% 35%). After chemotherapy, evaluation of tumor response is obtained by observing the progress of lesion size . Difficulties arose when the number of lesions per patient that could be evaluated increased, mainly after the introduction of cross - sectional imaging methods . Nowadays most radiologists and oncologists use only one lesion or a few representative lesions to evaluate tumor response in patients presenting with multiple nodules . Thus, it is important to know the intra - individual variability of response rate evaluation for different tumors in the same patient . Clinically, the response rate of solid tumors has been calculated by taking the tumor diameters in observations separated by the treatment, and by determining tumor shrinkage, stability or growth . For many years the world health organization criteria for treatment response evaluation have been the criteria used by most oncologists and in most clinical trials . More recently, several organizations involved in clinical research have reviewed these criteria on the basis of experience acquired since they were introduced and a new set of guidelines has been developed with a model by which response rates could be derived from unidimensional measurement lesions instead of the former bidimensional approach . According to this model, the use of only one lesion dimension simplifies the task of evaluating tumor response and correlates well with the lesion s area, previously used . The recist group tested their criteria in several historical study protocols and obtained good correlation with the who criteria . More recently, studies have shown both good and poor correlation between the unidimensional and bidimensional response evaluations [8, 9]. In this present study a high correlation between the who and the recist criteria in the evaluation of individual nodules and patients was achieved . The advantage of using the recist criteria is the simplicity of taking only one measurement per lesion . Nowadays, the best method of assessing tumor response in most clinical situations is ct scan, leading to detection of a larger number of lesions, with smaller diameters, and more precision on measuring when compared to other methods [10, 11]. Even though pulmonary metastases evaluated by ct scan should be one of the best scenarios in terms of measurement of lesions, since the low - density lung provides natural contrast for the dense pulmonary nodule, variability in the application of response criteria could compromise the reproducibility of results . Major potential sources of response evaluation variation are imaging techniques, inter - observer variability, and the selection of target lesions [12, 13]. In order to minimize observer variation, this study applied helical ct scanning and had the lesions measured by the same radiologist to evaluate response of the multiple metastases in the same patient, as routinely done in the clinical setting and in study protocols . The presence of a new nodule was the main factor for determining disease progression, and the proportion of these new nodules in some cases was as low as 5% . The systematic evaluation of all the patients nodules is then necessary to guarantee the identification of a new nodule . The individual nodules in the same patient have individual and unpredictable behavior and can be evaluated as independent lesions . By using the who and the recist criteria of tumor response to therapy we verified that there were nodules labeled as disease progression in patients classified as stable, and unaltered nodules in patients evaluated as having progressive disease . In our patient population the proportion of nodules in a patient with response evaluation different from that obtained taking the sum of all nodules together amounted to 35% . The results confirmed our previous impression that the application of the who or the recist method to one or some nodules in a patient, as frequently utilized by protocols, could also be misleading . In the same patient, one could select a stable nodule, a nodule with growth or a nodule in regression, and this could result in a decision error regarding the treatment regimen . The use of the sum of the evaluation of all nodules together maximizes the reproducibility of response evaluations . In this study we tried to reproduce what seem to be the usual conditions for tumor response evaluation in most protocols and institutions; some of these conditions are limitations for the best possible response evaluation accuracy, but are close to clinical practice standard conditions . There was no histological proof of the metastatic nature of the lung nodules, and some could have been infectious or inflammatory; in clinical practice, however, histological proof is rarely required and the presence of new pulmonary nodules and overall oncologic disease progression are the criteria adopted by the oncologist for a diagnosis of lung metastases . When this study was conducted nowadays many institutions with faster and multiple detector cts adopt 5 mm or less in the evaluation of lung metastases . However, the recommendation of the authors of the recist group criteria was followed in measuring lesions no smaller than twice the size of the slice thickness . Hard copy measurements were taken, despite having been shown to be less reproducible than computer display methods, as computer measurement is not always available, especially to the oncologist . In conclusion, there is a high correlation between the world health organization criteria and the recist group criteria . Intra - individual variation in tumor response of pulmonary metastases is elevated in some patients, and chemotherapy response evaluation utilizing only one or some of the patient s nodules could lead to inappropriate reproducibility in therapeutic response perception . Intra - individual distribution of response evaluation of pulmonary metastases by world health organization criteria . Intra - individual distribution of response evaluation of pulmonary metastases by the response evaluation criteria in solid tumors (recist) group criteria . Distribution of primary types of metastatic solid tumor response evaluation of measurable nodules (> 14 mm) assessed by the who and the recist criteria response evaluation of patients assessed by the who and the recist criteria impact of the presence of new nodules in the patient s global response evaluation assessed by the recist criteria bold type indicates evaluations in which a new nodule was the sole criterion for disease progression.
Lumbar degenerative kyphosis (ldk) is a common cause of lumbar spinal deformity in asian women aged 40 years and older . It is characterized by sagittal imbalance, a stooped posture and chronic low back pain (lbp). Associated with ldk is a loss of the normal lumbar spinal lordosis1,2,3 . Marked atrophy of lumbar extensors and degenerative changes in the lumbar spine are hallmarks of this condition . It is postulated that endemic lifestyles such as prolonged crouching, often required of agricultural workers, may be a factor in the development of ldk1,2,3 . In studies utilizing computed tomography (ct) and magnetic resonance imaging (mri), extensive degenerative atrophy and fatty infiltration of lumbar extensor muscles have been reported1,2,3 . Moreover, in a state of sagittal imbalance, kyphosis or loss of lordosis of the lumbar spine can lead to lbp and various spinal disorders4,5,6,7 . Lbp is known to arise from multiple factors, including the loss of lumbar spinal stability8,9,10,11 . If a state of lumbar instability is not appropriately resolved, chronic recurrent lbp might occur12 . Patients with lbp do not sufficiently activate the deep lumbar stabilizing muscles, such as, the lumbar multifidus (lm), transversus abdominis (tra), and obliquus internus (oi) muscles, which are essential for lumbar spinal stability13,14,15 . Therefore, specific exercises for lumbar stabilizing muscles are essential in the rehabilitative strategy for patients with lbp16,17,18,19,20 . However, traditional exercises for deep lumbar stabilizing muscles tend to be laborious and time intensive for therapists and patients . Since deep lumbar stabilizing muscles are smaller in patients with chronic lbp and contain a higher proportion of fat3, affected individuals find it more difficult to sufficiently activate these muscles . Neuromuscular electrical stimulation (nmes) is a form of lumbopelvic stabilizing rehabilitation that is being increasingly used to reinforce muscle strength and prevent muscle atrophy18,19,20,21,22,23,24,25 . This technique has also shown promise in training of the deep lumbar stabilizing muscles22,23,24,25 . In addition, muscle activation by nmes has been reported to be significantly related to clinical improvements in patients with lbp24, 26 . However, no report to date has been issued on the effects of nmes on the deep lumbar stabilizing muscles of ldk patients, and few studies have attempted to define the optimal protocol for the stimulation of deep lumbar stabilizing muscles by nmes . In this study, the ability of nmes to stimulate the deep lumbar stabilizing muscles of ldk patients was investigated, using real - time ultrasound imaging (rusi). Twenty patients with symptomatic sagittal imbalance due to ldk, who visited the rehabilitation department of yeungnam university hospital, were recruited (19 females, 1 male, overall mean age 66.22 6.55 years, range 5474 years). The selected patients exhibited the characteristic clinical features of ldk, that is, a stoop with walking difficulties, an inability to lift heavy objects, difficulty walking on an inclined plane, and the need for elbow support when standing for any length of time . Whole - spine lateral views showed loss of lower lumbar lordosis resulting in retroversion of the pelvis with thoracolumbar lordosis compensating for sagittal imbalance . Patients with a history of osteoporotic compression fracture, spine surgery, spinal disease (trauma, tumor, scoliosis, scheuermann s kyphosis, or stenosis), hip joint disease, or contraindications for nmes (pacemaker, edema, paresthesia, thromboembolism etc .) Were excluded . The participants were provided with comprehensive oral and written information about all aspects of this study, and all provided their written consent to participation . This study was conducted prospectively and the institutional review board of our hospital approved the study protocol . Abdominal electrical stimulation was delivered through a set of 4 hydrogel surface electrodes (5 cm 5 cm) located on both sides of the anterolateral abdominal wall . Two surface electrodes were placed on the right and two on the left sides . The reference points were located 1 cm superior to the iliac crests on the mid axillary lines . Abdominal stimulation points were located 2 cm superior and 2 cm medial to the anterior superior iliac spines (fig . 1.sites of stimulation used on the abdominal wall and lumbar paraspinal region(a) abdominal wall (frontal view), (b) abdominal wall (lateral view), (c) lumbar paraspinal regions: stimulation electrode, r: reference electrode7 . Lumbar electrical stimulation was also delivered through a set of 4 hydrogel surface electrodes (5 cm 5 cm) positioned bilaterally at an inter - electrode spacing of ~2 cm on a cross line drawn on the l45 interspinous process (fig . Stimulation pulses were generated using a portable research - stimulator (cmmx-001a; cybermedic corp ., republic of korea), which delivered a constant current and a symmetrical biphasic waveform . Bi - phasic symmetrical pulses of 200 s with an interpulse delay of 100 s were employed . These pulses were delivered via the four surface electrodes at a frequency that produced tetanic isometric contractions of the targeted muscles (50 hz). The overall contraction - relaxation cycle used was as follows: ramp up for 1 second, contraction for 8 seconds, and ramp down for 1 second followed by relaxation for 10 seconds . The subjects were instructed to use the unit at an intensity that elicited maximum muscle contraction without discomfort, that is, no burning sensation or severe tetanic pain . The mean current intensity was 45.39 10.24 ma for the abdominal muscles, and 58.34 12.97 ma for the lumbar muscles . Each muscle was evaluated during three different nmes protocols: protocol a, stimulation of abdominal muscles, protocol b, stimulation of lumbar muscles; and protocol a+b, concurrent stimulation of abdominal and lumbar muscles . Sites of stimulation used on the abdominal wall and lumbar paraspinal region (a) abdominal wall (frontal view), (b) abdominal wall (lateral view), (c) lumbar paraspinal region s: stimulation electrode, r: reference electrode a rusi (logiq 6 expert, ge healthcare, uk) unit was used to measure changes in the abdominal and lumbar muscle [tra, oi, obliquus externus (oe), and lm] thicknesses during nmes of each protocol . To assess abdominal muscles, with subjects comfortably positioned supine with a pillow placed under the knees, a 5 mhz curvilinear ultrasound probe was placed transversely across the abdominal wall along the line midway between the inferior angle of the rib cage and the iliac crest . The medial edge of the probe was placed approximately 10 cm from the midline, and, its position was adjusted to ensure that the medial edge of the tra was ~2 cm from the medial edge of the ultrasound image when the subject was relaxed (fig . 2.thicknesses of abdominal muscles during nmesthree vertical lines were drawn: one at the midline of the image and two 1 cm (adjusted for scale) either side of the midline.oe: obliquus externus muscle, oi: obliquus internus muscle, tra: transversus abdominis muscle)29 . The location of the probe was marked to ensure its identical placement for all measurements . Static ultrasound images were captured at rest and again when maximum nmes stimulation had been reached . During image capture at rest, the subjects were instructed to breathe normally and evenly and an image was captured at the end of exhalation . During stimulation image capture, preliminary analysis of the results indicated that the right and left sides contracted in similar ways, and thus, further analysis was carried out using right side images . To evaluate the lm, the subjects were placed prone, with the abdomen supported as needed to ensure no more than 10 of lumbar lordosis, and then instructed to breathe normally and evenly . Static rest images were captured at the end of exhalation (fig . 3fig . 3.thickness of the lumbar multifidus muscle during nmesthe lumbar multifidus muscle thickness was measured at the distance between the posterior - most portion of the l4/l5 facet joint and the fascial plane between the muscle and subcutaneous tissue.sm: superficial lumbar multifidus muscle, dm: deep lumbar multifidus muscle), and static ultrasonic images of the lm muscle were taken during each nmes stimulation protocol . All the above tasks were performed three times, and the average of the three measurements was used in the analysis . Thicknesses of abdominal muscles during nmes three vertical lines were drawn: one at the midline of the image and two 1 cm (adjusted for scale) either side of the midline . Oe: obliquus externus muscle, oi: obliquus internus muscle, tra: transversus abdominis muscle thickness of the lumbar multifidus muscle during nmes the lumbar multifidus muscle thickness was measured at the distance between the posterior - most portion of the l4/l5 facet joint and the fascial plane between the muscle and subcutaneous tissue . Sm: superficial lumbar multifidus muscle, dm: deep lumbar multifidus muscle stored images were analyzed using ultrasound image measurement software . On abdominal images, a grid was placed over the images and the thicknesses of oe, oi, and tra muscles were measured at three sites, that is, at the image midline and at 1 cm either side of the midline . Cursors were placed on the superficial and deep boundaries of the muscles at the edges of the hypoechoic regions representing the locations of fascial separations between muscles29 . On lumbar images, the thickness of the lm muscle was measured between the posterior - most portion of l4/l5 facet joints and the fascial planes between the muscles and subcutaneous tissues30 . The average of the three measurements was used in the analysis and the effects of nmes were investigated using the changes in thickness between rest and during nmes (figs . 4.comparison of the thicknesses of lumbar multifidus muscles(a) at rest, (b) during protocol b; stimulation of lumbar muscles, (c) during protocol a+b; concurrent stimulation of abdominal and lumbar muscles, and (d) during protocol a; stimulation of abdominal musclessm: superficial lumbar multifidus muscle, dm: deep lumbar multifidus muscle and 5fig . (a) at rest, (b) protocol a; stimulation of abdominal muscles, (c) protocol a+b; concurrent stimulation of abdominal and lumbar muscles, (d) protocol b; stimulation of lumbar muscles . Oe: obliquus externus muscle, oi: obliquus internus muscle, tra: transversus abdominis muscle). (b) during protocol b; stimulation of lumbar muscles, (c) during protocol a+b; concurrent stimulation of abdominal and lumbar muscles, and (d) during protocol a; stimulation of abdominal muscles sm: superficial lumbar multifidus muscle, dm: deep lumbar multifidus muscle comparison of the thicknesses of three abdominal muscles . (a) at rest, (b) protocol a; stimulation of abdominal muscles, (c) protocol a+b; concurrent stimulation of abdominal and lumbar muscles, (d) protocol b; stimulation of lumbar muscles . Oe: obliquus externus muscle, oi: obliquus internus muscle, tra: transversus abdominis muscle statistical analysis was performed using the statistical package for the social sciences (spss) version 18.0 (spss, chicago, il, usa). The paired t - test was used to determine the significances of thickness differences at rest and during nmes for each muscle (lm, oe, oi and tra), and one - way analysis of variance (anova) and the kruskal - wallis test were used to analyze differences between the a, b and a+b protocols for each muscle . When a significant difference was found between groups, tukey s post - hoc test was used for assess pair - wise comparisons . The mean age, height, weight, and body mass index (bmi) of the twenty participants were 66.22 6.55 years, 157.92 8.66 cm, 57.94 6.75 kg, and 23.27 2.42 significant thickness changes in the superficial and deep lms were observed during nmes during all three protocols (p <0.05). Significant thickness changes in abdominal muscles (oe, oi, and tra) were also observed during nmes during protocols a and a+b (p <0.05), but not during protocol b (table 1table 1.thicknesses (mm) at rest and during nmesmusclerestnmes protocolaba+bsm12.7 (2.1)13.1 (1.6)13.9 (2.0)13.9 (1.8)dm11.2 (1.6)11.4 (2.1)12.2 (2.0)12.3 (2.3)oe5.2 (2.1)7.3 (2.9)5.5 (2.1)7.1 (3.0)oi7.8 (1.8)9.1 (2.1)7.7 (1.5)8.8 (2.1)tra3.0 (0.8)3.7 (1.1)3.2 (0.7)3.7 (1.0)values are means (standard deviations). Nmes: neuromuscular electrical stimulation . A: stimulation of abdominal muscles, b: stimulation of lumbar muscles, a+b: simultaneous stimulation of abdominal and lumbar muscles . Sm: superficial lumbar mutifidus muscle, dm: deep lumbar mutifidus muscle, oe: obliquus externus muscle, oi: obliquus internus muscle, tra: transversus abdominis musclesignificantly increased compared to the resting state, p <0.05 and fig . A: stimulation of abdominal muscles, b: stimulation of lumbar muscles, a+b: simultaneous stimulation of abdominal and lumbar muscles . Sm: superficial lumbar mutifidus muscle, dm: deep lumbar mutifidus muscle, oe: obliquus externus muscle, oi: obliquus internus muscle, tra: transversus abdominis muscle significantly increased compared to the resting state, p <0.05 increases in the thicknesses of the superficial and deep lms during protocol b and a+b were significantly larger than during protocol a (p <0.05), but no significant difference was found between protocols b and a+b . Increases in the thicknesses of oe, oi, and tra were significantly greater during protocols a and a+b than during b protocol (p <0.05), but no significant difference was found between protocols a and a+b (table 2table 2.thickness (mm) changes from rest induced by nmesmusclenmes protocolstimulation effecta (a)b (b)a+b (c)pabpacpbcsm0.5 (1.1)1.2 (1.0)1.3 (1.1)0.0340.0360.499dm0.3 (0.8)1.0 (0.9)1.1 (1.3)0.0380.0280.494oe2.1 (1.7)0.1 (0.8)1.9 (1.9)0.0020.4690.005oi1.3 (1.1)0.2 (0.4)1.0 (1.2)0.0000.2970.002tra0.7 (0.7)0.7 (0.7)0.6 (0.7)0.0180.4750.034values are means (standard deviations). Nmes: neuromuscular electrical stimulation . A: stimulation of abdominal muscles, b: stimulation of lumbar muscles, a+b: simultaneous stimulation of abdominal and lumbar muscles . Sm: superficial lumbar mutifidus muscle, dm: deep lumbar mutifidus muscle, oe: obliquus externus muscle, oi: obliquus internus muscle, tra: transversus abdominis musclesignificant difference among the a, b and a+b protocols (p <0.05)p <0.05 and fig . 5). Values are means (standard deviations). A: stimulation of abdominal muscles, b: stimulation of lumbar muscles, a+b: simultaneous stimulation of abdominal and lumbar muscles . Sm: superficial lumbar mutifidus muscle, dm: deep lumbar mutifidus muscle, oe: obliquus externus muscle, oi: obliquus internus muscle, tra: transversus abdominis muscle significant difference among the a, b and a+b protocols (p <0.05) this study showed that the deep lumbar stabilizing muscles of patients with ldk were significantly activated by nmes . Furthermore, our results show the protocols b and a+b maximally stimulated the superficial and deep lm muscles, and that protocols a and a+b maximally stimulated the abdominal (tra, oi and oe) muscles . These observations show that the deep lumbar stabilizing muscles (lm, tra and oi) were significantly and maximally stimulated by protocol a+b . Previous studies have reported that nmes effectively activates the deep lumbar stabilizing muscles22,23,24,25, and the results of this study confirm these findings . All studied lumbar and abdominal muscles, including the deep and superficial muscles, contracted simultaneously during nmes . These findings suggest that nmes may provide a means of strengthening the deep lumbar stabilizing muscles of patients with ldk . The possibility of contracting and thereby training the smaller poorly conditioned lumbar stabilizing muscles of patients with ldk is encouraging and may provided an additional avenue for rehabilitation . Several studies have reported that nmes effectively activates the deep lumbar stabilizing muscles23, 24, 27, 28 . Coghlan et al.23 demonstrated a significant increase in tra thickness during belt - type nmes of healthy subjects . In another study by the same authors24, patients with chronic lbp were found to show significant increases in the thicknesses of tra, oi, and lm during loading tasks after 6 weeks of nmes intervention . Baek et al.28 reported that 20 healthy subjects showed significant thickness increases in lm, tra and oi during nmes of the lumbar paraspinal region, and baek et al.27 reported 20 healthy subjects showed significant tra and oi thickness increases during nmes applied to the abdominal wall . Our results are in agreement with these results and suggest that nmes could be used to train the deep lumbar stabilizing muscles of patients with ldk . Surgical treatment may be considered for ldk patients having difficulties performing activities of daily living due to severe sagittal imbalance . However, as the proportion of elderly individuals in the population has increased, the average age at the time of surgery has also increased, increasing surgical risks and complications . In addition, some patients complain of recurrent chronic lbp and sagittal decompensation related to posture even after surgical correction of kyphotic spinal deformities2, 31 . Exercises that help train lumbar stabilizing muscles are typically adopted for conservative treatments of chronic lbp and the correction of kyphotic postures16,17,18,19,20, 32 . Patients with lbp cannot sufficiently activate the deep lumbar stabilizers13,14,15, and thus, extensive lm muscle atrophy is a characteristic of ldk patients33 . For these reasons, strengthening of the deep lumbar stabilizers of ldk patients is an essential component of treatment . However, specific exercises for the deep lumbar stabilizers are labor - intensive, are often difficult to maintain, and require repeated patient education sessions by skilled physical therapists . Stevens et al.34 assessed the effects of stabilization exercises on lm muscle activation using surface electromyography, and found there was no change in lm muscle activation levels . Koumantakis et al.35 investigated the effects of stabilization and general exercises on the lm muscle of lbp patients and also found they had no effect on the lm muscle . They concluded that isolated lm muscle contraction is difficult to achieve and maintain during exercises34, 35 . Bilgin et al.22 investigated the effect of an abdominal hollowing exercise on the lm muscle and dound it had no effect on lm muscle activation . They also reported that patients had difficulty learning and maintaining abdominal hollowing, and concluded that insufficient contraction of the lm muscle probably contributed to their negative result . They suggested nmes while performing lumbar stabilizing exercises might help the re - education of lm and tra muscles . Therefore, active utilization of nmes is recommended for the patients with ldk in order to compensate for the limitations of deep lumbar stabilizing exercises in the enhancement of muscle - strengthening effects . The optimal stimulation protocol for the activation of deep lumbar stabilizing muscles has not been determined . In this study, significant thickness changes in lm muscles were found during abdominal wall stimulation (protocol a). This thickness change may be the result of an indirect tensile effect of the lumbar fascia straining during contraction of the abdominal muscles27, 28 . Baek et al.27 reported lm muscle activation without lumbar region activation during nmes applied to the abdominal wall of healthy subjects . Baek et al.28 also reported tra and oi activations during nmes applied to the lumbar region without abdominal wall stimulation in healthy subjects . Therefore, it was our initial expectation that thickness changes in the lm and abdominal (tra and oi) muscles during protocol a+b would be greater than during protocols a or b. however, no significant difference was observed between protocols b and a+b, or between a and a+b . We reason these findings were due to the indirect tensile effect of the lumbar fascia as mentioned above . The results of this study demonstrate that protocol a+b was effective at activating all the studied deep lumbar stabilizing muscles (lm, tra and oi). Therefore, placing nmes electrodes on the 4 abdominal wall and 4 lumbar regions is suggested for the training of deep lumbar stabilizing muscles of patients with ldk . To our knowledge, no previous report has mentioned the concurrent stimulation of abdominal and back muscles to achieve contractions of the deep lumbar stabilizing muscles first, the sample size was relatively small, and thus, further larger - scale clinical studies should be conducted to quantify deep lumbar stabilizing muscle responses in nmes training . Second, rusi is a powerful anatomic imaging tool that can demonstrate gross architecture, but the power generated by both the abdominal wall and lumbar region stimulation might be greater than the maximal voluntary contraction (mvc) detectable by rusi . Studies using fine wire emg may provide a more detailed view of the contributions of each stimulation protocol . Clinical studies, such as, gait analysis, are required to assess dynamic sagittal imbalance improvements before, during and after nmes of deep lumbar stabilizing muscles of patients with ldk . In conclusion, protocol a+b maximally stimulated all the studied deep spinal stabilizing muscles (lm, tra and oi) as evidenced by rusi . The protocol a+b may aid the development of practical nmes systems for ldk patients who suffer from postural deformity and lbp.
Prostate cancer (pca) is the second most common neoplasia in men worldwide, and the sixth cause of cancer - specific death worldwide . In the last 20 years, there has been a progressive increase in the global incidence of this disease . In asian countries, the incidence and mortality of pca are low and are reported to be about 1/8 of that in western countries . However, some epidemiological investigations suggest the incidence of pca in asian men who migrant to the usa rapidly approaches that in western men within two generations . Interestingly, asian - american men retaining at least one genetic or lifestyle characteristic of asian residents make their risk of pca less than that of white residents of the usa . Recent studies have reported that asian men consume large quantities of isoflavones - based foods . By contrast, western diets mainly comprise red meat - based foods with bare isoflavones . Isoflavone is one of the phytoestrogens with similar molecular structures to animal estrogen and has weak estrogenic effects . The major isoflavones include genistin, daidzin, glycitin, equol, and biochanin a and, in particular, genistein is the most widely investigated isoflavon [figure 1]. Isoflavones are highly concentrated in soy products such as beans and tofu . A food frequency questionnaire used in the japan collaborative cohort study (jacc study) for the evaluation of cancer risk sponsored by the ministry of education, science, sports and culture of japan (monbusho) in 2005 showed that serum levels of genistein and daidzein are significantly associated with the dietary intake of tofu, and slightly associated with the intake of miso soup while the consumption of fat, meat, and coffee may be associated with equol production from genistein and daidzein by intestinal microflora in this sample set . The average daily intake of genistein in the oriental population is 2080 mg / d compared with 13 mg / d in the usa . In addition, soy consumption is different across europe . Nmol / l in a region with many vegetarians are much higher than mean levels of 2.622.6 pca is a hormone - dependent malignancy that develops from an androgen - dependent tissue that contains androgen receptors (ars). Further in vitro and in vivo studies have demonstrated that estrogens may be implicated as potential agents in the development and progression of pca . This was supported by current epidemiological evidence showing that the higher incidence of pca among african - american men is partly due to in utero exposure to maternal estrogens since african - american women have higher circulating estrogen concentrations during pregnancy than caucasian women . In addition, estradiol and sex hormone binding globulin (shbg) have been found to be higher in african - american men . Moreover, the correlation of increasing estrogen levels with the high incidence of pca was observed in african - american men . Estrogen may contribute to pca through multiple mechanisms involving estrogen receptor (er)-mediated actions, estrogenic imprinting, epigenetic modifications, direct genotoxicity, hyperprolactinemia, and inflammation and immunologic changes . A growing body of epidemiological studies has revealed that the incidence of pca is reduced in population with food rich in isoflavones . Many studies have demonstrated that isoflavones exert hormone - like effects and nonhormone - like effects involving inhibiting tyrosine kinases, modulation of cell proliferation, regulation of cell cycle, apoptosis, angiogenesis, and tumor cell metastasis, and our recent study found isoflavones induced autophagy cell death by up - regulation of ulk1 level, especially increasing evidence has indicated that isoflavones may be protective against the development of pca . The main mechanisms involve binding competitively er- and er-, regulation of sex steroid hormonal synthesis and secretion, down - regulation of ar gene expression, and inhibition of prostate - specific antigen (psa) secretion . These possible mechanisms include antioxidant defense, dna repair, inhibition of angiogenesis and metastasis, potentiation of radio- and chemo - therapeutic agents, and antagonism of estrogen- and androgen - mediated signaling pathways . In addition, other cells in the cancer milieu, such as the fibroblastic stromal cells, endothelial cells, and immune cells, may be targeted by soy isoflavones, which may contribute to soy - mediated pca prevention . Many randomized controlled trials (rcts) about the role of isoflavones in men with pca have been developed; however, these results are inconsistent . In this study, we review some critical issues involving the effects of isoflavones on psa, sex steroid hormone levels and risk of pca, and the difference in concentrations of isoflavones in vitro and human body . Whether isoflavones can lead to pca progression current results of clinical studies did not show soy isoflavones produce significant effects on psa levels . Messina et al . Analyzed the results of 11 trials for examining the effects of isoflavones on serum psa levels in pca patients and healthy subjects . In 4 of 8 trials involving pca patients, a delayed psa progression was observed although, in no studies, there was an absolute decrease in psa levels . Another meta - analysis from eight rcts whose subjects include pca patients and men with clinically identified risk of pca suggested soy isoflavones produced no effects on psa levels . In a randomized, double - blind, placebo - controlled trial, 86 men with pca were randomized to treatment with isoflavones or placebo for up to 6 weeks before scheduled prostatectomy . The results showed changes in serum psa in the isoflavone - treated group compared to men receiving placebo were not statistically significant . Similarly, no psa levels reduction was observed when a 12-month 83 mg / d isoflavone treatment was administered in 112 healthy men aged 5080 years . The relationship between serum psa level and urine phytoestrogen concentration was further analyzed in 824 men of over 40 years old without pca . It seems that isoflavons may not play an important role on psa levels reduction in pca patients or men with clinically identified risk of pca or healthy men . Some in vitro and in vivo studies demonstrated that isoflavones might increase estrogen synthesis through inducing aromatase activity and decreased the secretion of androgens . Similarly, some clinical studies have demonstrated that isoflavons can affect sex hormone excretion in men . Soy protein isolates have been found to increase urinary estradiol (e2) excretion and 2-hydroxy estrogens to 16-hydroxyestrone (2:16 oh - e1) ratio in men at high risk of progressing to advanced pca . Lower excretion of urinary e2 and lower ratio of 2:16 oh - e1 have been reported in pca cases compared to controls . Another study found that serum estradiol and androstenedione concentrations are increased, and ar expression is suppressed after soy protein isolate supplementation in men at high risk for developing advanced pca . When healthy men aged 3059 years are administered 60 mg of soy isoflavones for 3 months, serum free testosterone and dihydrotestosterone levels however, no changes in the serum levels of estradiol and total testosterone are detected . By contrary, there are some other studies suggesting isoflavones may not produce an effect on sex hormone level . A meta - analysis from hamilton - reeves et al . Found soy protein or isoflavone intake produced no significant effect on testosterone, free testosterone levels, shbg, and free androgen index (fai) in adult men . The result is consistent with another meta - analysis from van die et al . Who found no significant changes in shbg, testosterone, and free testosterone levels after isoflavone supplementation in men with pca or with clinically identified risk of pca . In a randomized, double - blind, placebo - controlled trial, 86 men were randomized to treatment with isoflavones or placebo for up to 6 weeks before scheduled prostatectomy . The results showed that changes in serum total testosterone, free testosterone, total estrogen, and estradiol in the isoflavone - treated group compared to men receiving placebo were not statistically significant . Most of the current studies support the opinion that pca risk is decreased by isoflavons . One meta - analysis including men with identified risk of pca has suggested soy / soy isoflavones supplementation significantly reduce incidence of pca of men with clinically identified risk . The other meta - analyses of 15 epidemiological publications on soy consumption and nine on isoflavones found that soy / isoflavones can significantly delay progression to pca . Moreover, the subjects were not restricted to men with pca or identified risk of developing pca . Control study nested in a community - based cohort in japan (jacc study) demonstrated that serum genistein, daidzein, and equol dose - dependent reduce pca risk . The other case control study nested in the european prospective investigation into cancer and nutrition also reported that higher plasma concentrations of genistein were associated with lower risk of pca; however, the relation between plasma concentrations of daidzein, equol, enterolactone or enterodiol, and pca risk was not observed . Control study on diet, inherited susceptibility, and pca supported the opinions that soy foods protected against pca in older scottish men . They found a significant association of isoflavones with a decreased risk of pca, and equol - producing intestinal flora carry a significantly reduced risk of pca . On contrary, there are still some other studies suggested that isoflavones may not reduce pca risk . In a case control study nested in the european prospective investigation into cancer and nutrition, concentrations of the genistein were measured in prediagnostic plasma samples for 1605 pca cases and 1697 matched control participants in european . Ganry analyzed epidemiological data to evaluate the effect of isoflavones on pca risk and found no statistically significant risk reductions of pca by isoflavones . First, it is hypothesized that isoflavones, particularly equol, are key factors in the difference in incidence rate between asia and the west . Therefore, it is suggested that having or not having equol converting bacteria in the intestine can determine the function of isoflavones on pca . Second, specific polymorphic variation in the er- gene may determine the functions of phytoestrogens . A previous study showed that high intake of phytoestrogens substantially reduces pca risk among men with specific polymorphic variation in the promoter region of the er- gene . However, no association between phytoestrogens and pca risk among carriers homozygous for the wild - type allele (tt) was found . Third, polymorphisms in the cyp19 gene may affect the positive correlations between phytoestrogen levels and sex hormone levels in men . Both urinary and serum equol are associated with plasma testosterone and fai among men with the tt genotype but not in men with the cc or ct genotypes for the cyp19 3-untranslated region t - c polymorphism while urinary and serum enterolactone showed similar genotype - dependent associations with testosterone but not with fai . The combination of the ttta long repeats and the minor alleles of rs10046 in cyp19a1 and rs2077647 in estrogen receptor (esr)-alpha was a high risk for pca despite isoflavones intakes . The combination of the ttta short repeat and those homozygous for the major allele of rs10046 in cyp19a1 was low risk when isoflavones given . In addition, the concentrations of isoflavones in serum and prostate tissue may be associated with the protective effect of pca . Reported that only> 5 ng / ml to 10 ng / ml plasma s - equol is associated with the reduced risk of pca . Although most of organ systems in the fetus and neonate are highly sensitive to phytoestrogens for organogenesis, rapid growth, and extensive tissue differentiation occurring during these developmental periods, the sensitivity persists until adolescence in reproductive organ systems which continue to develop after birth . Therefore, low - dose intakes of phytoestrogens during these developmental periods may have important protective consequences for carcinogenesis . However, current clinical trials are short - term intervention studies in adult males, and the study duration is always <1 year . Therefore, long - term studies in males beginning from the developmental periods such as fetus, neonate, and adolescence may be necessary to determine the effects of phytoestrogens on pca . In addition, progression from prostatic intraepithelial neoplasia to high - grade prostatic intraepithelial neoplasia and early latent cancer may take 10 or more years, and clinically significant carcinoma may not occur for another 315 years . As most studies are of short duration, therefore, clinical trials with long duration are necessary to confirm the effects of phytoestrogens on pca . Current results of clinical studies did not show soy isoflavones produce significant effects on psa levels . Messina et al . Analyzed the results of 11 trials for examining the effects of isoflavones on serum psa levels in pca patients and healthy subjects . In 4 of 8 trials involving pca patients, a delayed psa progression was observed although, in no studies, there was an absolute decrease in psa levels . Another meta - analysis from eight rcts whose subjects include pca patients and men with clinically identified risk of pca suggested soy isoflavones produced no effects on psa levels . In a randomized, double - blind, placebo - controlled trial, 86 men with pca were randomized to treatment with isoflavones or placebo for up to 6 weeks before scheduled prostatectomy . The results showed changes in serum psa in the isoflavone - treated group compared to men receiving placebo were not statistically significant . Similarly, no psa levels reduction was observed when a 12-month 83 mg / d isoflavone treatment was administered in 112 healthy men aged 5080 years . The relationship between serum psa level and urine phytoestrogen concentration was further analyzed in 824 men of over 40 years old without pca . It seems that isoflavons may not play an important role on psa levels reduction in pca patients or men with clinically identified risk of pca or healthy men . Some in vitro and in vivo studies demonstrated that isoflavones might increase estrogen synthesis through inducing aromatase activity and decreased the secretion of androgens . Similarly, some clinical studies have demonstrated that isoflavons can affect sex hormone excretion in men . Soy protein isolates have been found to increase urinary estradiol (e2) excretion and 2-hydroxy estrogens to 16-hydroxyestrone (2:16 oh - e1) ratio in men at high risk of progressing to advanced pca . Lower excretion of urinary e2 and lower ratio of 2:16 oh - e1 have been reported in pca cases compared to controls . Another study found that serum estradiol and androstenedione concentrations are increased, and ar expression is suppressed after soy protein isolate supplementation in men at high risk for developing advanced pca . When healthy men aged 3059 years are administered 60 mg of soy isoflavones for 3 months, serum free testosterone and dihydrotestosterone levels however, no changes in the serum levels of estradiol and total testosterone are detected . By contrary, there are some other studies suggesting isoflavones may not produce an effect on sex hormone level . A meta - analysis from hamilton - reeves et al . Found soy protein or isoflavone intake produced no significant effect on testosterone, free testosterone levels, shbg, and free androgen index (fai) in adult men . The result is consistent with another meta - analysis from van die et al . Who found no significant changes in shbg, testosterone, and free testosterone levels after isoflavone supplementation in men with pca or with clinically identified risk of pca . In a randomized, double - blind, placebo - controlled trial, 86 men were randomized to treatment with isoflavones or placebo for up to 6 weeks before scheduled prostatectomy . The results showed that changes in serum total testosterone, free testosterone, total estrogen, and estradiol in the isoflavone - treated group compared to men receiving placebo were not statistically significant . Most of the current studies support the opinion that pca risk is decreased by isoflavons . One meta - analysis including men with identified risk of pca has suggested soy / soy isoflavones supplementation significantly reduce incidence of pca of men with clinically identified risk . The other meta - analyses of 15 epidemiological publications on soy consumption and nine on isoflavones found that soy / isoflavones can significantly delay progression to pca . Moreover, the subjects were not restricted to men with pca or identified risk of developing pca . Control study nested in a community - based cohort in japan (jacc study) demonstrated that serum genistein, daidzein, and equol dose - dependent reduce pca risk . The other case control study nested in the european prospective investigation into cancer and nutrition also reported that higher plasma concentrations of genistein were associated with lower risk of pca; however, the relation between plasma concentrations of daidzein, equol, enterolactone or enterodiol, and pca risk was not observed . In addition, the result from a population - based case control study on diet, inherited susceptibility, and pca supported the opinions that soy foods protected against pca in older scottish men . They found a significant association of isoflavones with a decreased risk of pca, and equol - producing intestinal flora carry a significantly reduced risk of pca . On contrary, there are still some other studies suggested that isoflavones may not reduce pca risk . In a case control study nested in the european prospective investigation into cancer and nutrition, concentrations of the genistein were measured in prediagnostic plasma samples for 1605 pca cases and 1697 matched control participants in european . Ganry analyzed epidemiological data to evaluate the effect of isoflavones on pca risk and found no statistically significant risk reductions of pca by isoflavones . First, it is hypothesized that isoflavones, particularly equol, are key factors in the difference in incidence rate between asia and the west . Therefore, it is suggested that having or not having equol converting bacteria in the intestine can determine the function of isoflavones on pca . Second, specific polymorphic variation in the er- gene may determine the functions of phytoestrogens . A previous study showed that high intake of phytoestrogens substantially reduces pca risk among men with specific polymorphic variation in the promoter region of the er- gene . However, no association between phytoestrogens and pca risk among carriers homozygous for the wild - type allele (tt) was found . Third, polymorphisms in the cyp19 gene may affect the positive correlations between phytoestrogen levels and sex hormone levels in men . Both urinary and serum equol are associated with plasma testosterone and fai among men with the tt genotype but not in men with the cc or ct genotypes for the cyp19 3-untranslated region t - c polymorphism while urinary and serum enterolactone showed similar genotype - dependent associations with testosterone but not with fai . The combination of the ttta long repeats and the minor alleles of rs10046 in cyp19a1 and rs2077647 in estrogen receptor (esr)-alpha was a high risk for pca despite isoflavones intakes . The combination of the ttta short repeat and those homozygous for the major allele of rs10046 in cyp19a1 was low risk when isoflavones given . In addition, the concentrations of isoflavones in serum and prostate tissue may be associated with the protective effect of pca . Reported that only> 5 ng / ml to 10 ng / ml plasma s - equol is associated with the reduced risk of pca . Although most of organ systems in the fetus and neonate are highly sensitive to phytoestrogens for organogenesis, rapid growth, and extensive tissue differentiation occurring during these developmental periods, the sensitivity persists until adolescence in reproductive organ systems which continue to develop after birth . Therefore, low - dose intakes of phytoestrogens during these developmental periods may have important protective consequences for carcinogenesis . However, current clinical trials are short - term intervention studies in adult males, and the study duration is always <1 year . Therefore, long - term studies in males beginning from the developmental periods such as fetus, neonate, and adolescence may be necessary to determine the effects of phytoestrogens on pca . In addition, progression from prostatic intraepithelial neoplasia to high - grade prostatic intraepithelial neoplasia and early latent cancer may take 10 or more years, and clinically significant carcinoma may not occur for another 315 years . As most studies are of short duration, therefore, clinical trials with long duration are necessary to confirm the effects of phytoestrogens on pca . Although a growing body of evidence has indicated that isoflavones may delay pca progression, only a few studies have emphasized on the relationship between isoflavones concentration in vitro and the serum of the human body . Isoflavone concentrations of 10 mol / l or even as high as 50 mol / l to 100 mol / l in vitro studies have never been achieved in the human body with common diet . A phase i study provided 20 pca patients with 300 mg / d genistein for 28 days and then with 600 mg / d for another 56 days . The peak plasma total genistein concentrations during the study were 7.3 0.8 mol / l on day 1 and 8.1 1.2 mol / l on day 84 of treatment . The intake doses used in this study cannot be achieved in humans by natural dietary sources . Although effective serum concentrations cannot be achieved by natural diet, prostate tissue may concentrate isoflavones to potentially anti - carcinogenic levels . Short - term soy isoflavones supplementation may lead to significant elevation of intraprostatic isoflavones concentration compared to serum . One placebo - controlled study provided 40 pca men with 240 mg of clover phytoestrogens or placebo daily for 2 weeks before their operation, and oral supplementation with phytoestrogens induced 23- and 7-fold increase in prostate tissue concentrations of genistein and daidzein, respectively . Even though the placebo group did not receive phytoestrogen challenge, they also demonstrated 2-fold prostate tissue genistein and daidzein concentrations compared to their plasma values . Nineteen men with pca received either 82 mg / d total isoflavone or placebo for 2 weeks before surgery, the results showed that isoflavone concentrations in isoflavones supplement group were an average of approximately 6-fold higher in prostate tissue compared to serum . The intake of various types of phytoestrogens in the daily diet of men may produce synergistic effects . Observed the combination effects of genistein, biochanin a, and quercetin on pca cell lines in vitro . The results showed that the combination of three phytoestrogens with low concentration (8.33 mol / l of each) is more potent in inhibiting the growth of prostate cells than either alone (25 mol / l) or double combinations (12.5 mol / l of each). The study suggests that the effects are synergistic in low concentrations of various phytoestrogens, and the combination of various phytoestrogens may elicit preventive effects against pca at their physiologically achievable concentrations . Dong et al . Observed that combination of 25 mol / l or 50 mol / l of genistein and daidzein has synergistic effects on inhibiting cell proliferation and inducing apoptosis in androgen - dependent pca cells . A in vitro study demonstrated that soy extracts containing total isoflavones induced a significantly higher percentage of cells undergoing apopotosis than genistein or daidzein alone at equal concentrations of 25 mol / l . However, a phase ii clinical trial investigated the efficacy of soy isoflavones alone or in combination with lycopene in men with pca . The results showed that no additive or synergistic effects were observed when two phytochemicals were administered together . As the intake doses of phytoestrogens in asian men with dairy food are lower compared with that in clinical trials, various types of phytoestrogens may produce synergistic effects on the human body for decades . Therefore, more long - term invention studies will be necessary to determine the suitable dose and combination strategy of various types of phytoestrogens against pca . In addition, for less side effects are observed in dietotherapy, instead of medication, dietotherapy of suitable dose phytoestrogens may be beneficial for pca prevention in men . Although many in vitro and in vivo studies as well as clinical trials have demonstrated that isoflavones can significantly delay pca progression, a few studies suggested that isoflavones may act as an agonist in pca . One recent study showed daidzein can exert androgenic effects by modulating ar coactivators in pca cells . Some animal experiments further confirmed the opinion that isoflavones may lead to the progression of pca . A study reported that genistein treatment alone increased the incidence of lymph nodes metastasis in mice orthotopic xenografts of pca cells . Another study found that physiologically achievable concentrations of genistein can increase pca growth in the transgenic adenocarcinoma mouse prostate model . The mechanisms were associated with activated signal transducers, activation of transcription 3 (stat3), enhanced telomerase activity, and increased stat3 binding to the telomerase reverse transcriptase promoter . In orchidectomized middle - aged rats, genistein can cause the shunting of metabolic pathways in the adrenals, supporting dehydroepiandrosterone (dhea) secretion and inhibiting corticosterone and aldosterone secretion . The function of isoflavones on pca may be biphasic . Davis et al . Observed low concentrations of genistein enhanced 17-estradiol - mediated psa expression whereas high concentrations of genistein inhibited estrogen - mediated psa expression in pca cells . A similar result from mahmoud et al they found that physiological dose (0.55.0 mol / l) of genistein stimulated cell growth, increased ar expression, and transcriptional activity whereas higher doses induced inhibitory effects . Observed that genistein is anti - androgenic in the testis, prostate, and brain, and it attenuates reporter gene activity in intact male mice . By contrast, in castrated male mice, genistein exhibits significant androgen agonistic activity in the prostate and brain by increasing reporter gene activity in both tissues . Infant exposure to these substances may lead to carcinogenesis and several anomalies of the reproductive systems . Therefore, careful consideration should be given when phytoestrogens are used in the prevention and treatment of pca . Most of the clinical trials suggest isoflavones do not play an important role on psa levels reduction in pca patients or healthy men . The effect of isoflavones on sex hormone levels and pca risk may be determined by some factors involving having or not having equol converting bacteria in the intestine, specific polymorphic variation in the region of the associated gene, the concentrations of isoflavones . As most studies are of short duration in adult males, therefore, long - term studies in males beginning from the developmental periods such as fetus, neonate, and adolescence may be necessary to determine the effects of phytoestrogens on pca . The concentrations of isoflavones in vitro studies have never been achieved in the serum of human body of common diet . Moreover, the intake of various types of phytoestrogens with lower concentrations in the daily diet may produce synergistic effects against pca . It is noteworthy that isoflavones may act as an agonist in pca and lead to several anomalies of the reproductive systems for infant exposure . Therefore, careful consideration should be given when isoflavones are used in the prevention and treatment of pca.
The spinal dural arteriovenous fistula (sdavf) is the most common type of spinal vascular malformation, but it is rare condition in overall incidence561013171820). It is characterized by progressive, insidious, and non - specific symptoms that are similar to those of more common etiology, such as degenerative spinal disorder and peripheral neuropathy5131920). The fistulas of sdavf are located intradurally at the sleeve of the nerve root, and the obliteration of fistulas is the treatment goal for sdavf513182223). Sdavf can be treated by surgical interruption and endovascular embolization . To help ensure successful treatment, we present a patient with sdavf and a history of paraparesis during spinal angiography who was treated successfully using stereotactic radiosurgery (srs) using novalis system . A 43-year - old man presented with slow progression of back pain, voiding difficulty, and boring pain on both lower extremities during 5 months . Neurological examination showed 420motor weakness of grade iv in both legs and his anal tone was grade zero . About 14 years ago, he had pain in the left leg and was diagnosed with spinal arteriovenous malformation . At that time, magnetic resonance imaging (mri) of the thoracolumbar spine revealed a vascular anomaly at the thoracolumbar level, and physicians performed spinal angiography for definite treatment . However, spinal angiography had failed three times in two other hospitals due to vasospasm and paraparesis . He recovered from these symptoms spontaneously, and he had not undergone any treatment thereafter . Mri in our hospital showed a vascular anomaly with enhancement at the t12, l1, and l2 levels (fig . Axial images of the l1 level revealed a mass lesion, located on the left side of the intraspinal canal (fig . We recommended selective spinal angiography, but the patient refused because of his experience, requesting a non - invasive technique for diagnosis and treatment . However, we required an alternative modality to selective spinal angiography for obtaining accurate information on diagnosis, level of the lesion, and follow - up after treatment . Thus, a three - dimensional volumetric sagittal time - resolved imaging of contrast kinetics (tricks) abdominal magnetic resonance angiography (mra) using 1.5 t mri system were performed in quiet respiration (tr / te / flip=4.2/1.1/45, fov 330330, equivalent slice thickness of 3 mm, matrix 256160). Contrast medium (15 ml gadolinium) the study was post - processed into maximum - intensity projection (mip) images (fig . The target, involving the dura margin, was constructed to include the fistula during structural segmentation under spinal computed tomography (ct) images (fig . We used 10 conformal beams and a total irradiation of 18 gy with three fractions (fig . We checked the three - dimensional sagittal tricks abdominal mra using 1.5 t for follow - up 7 months after srs, and three - dimensional sagittal tricks abdominal mra using 3.0 t mri system (tr / te / flip=10.0/1.5/30, fov 380380, equivalent slice thickness of 4 mm, matrix 384160) was performed 3 years after radiosurgery . The size of the spinal lesion was decreased and the flow through the fistula was diminished on the 7-month post - treatment images (fig . 4a), and the sequelae of the previous lesion was presented on follow - up mri and mra images (fig . Sdavf represent a rare pathological condition, but they account for 6080% of all spinal vascular malformation61317182023). They are acquired lesions, and usually present with insidious and progressive symptoms, such as paraparesis and sensory deficits of the bladder, bowel, and lower extremities10131718). As they present with non - specific and misleading clinical symptoms, their most common site is the thoracolumbar region, and the arteriovenous shunt is a low - flow shunt located at the dural sleeve of the spinal nerve root56101323). The pathophysiology of sdavf - induced spinal cord ischemia and myelopathy is due to increased venous pressure, venous congestion, and decreased spinal cord perfusion caused by shunting arterial blood into the venous side56121315171823). Treatment methods for these lesions are microsurgery and endovascular embolization . Because the selection of treatment method is mediated by the physician's preference, selective spinal angiography is regarded as an essential procedure to confirm and treat sdavf5). For successful surgery or endovascular coiling, selective spinal angiography is necessary to know the architectures and hemodynamics of the lesion561215181922). However, even with experienced neuro - interventionists, selective spinal angiography can sometimes cause complications from vasospasm, increased venous pressure, and spinal cord infarction6812151720). In our case, the patient experienced paraparesis three times during spinal angiography . Although it occurred 14 years previously, the patient refused the spinal angiography . Because the patient wanted a noninvasive method for diagnosis and treatment, we found an imaging technique to provide information about the lesion and be available for follow - up . There are some advanced imaging techniques for sdavf, such as contrast enhanced magnetic resonance angiography with high resolution, tricks sequence, gradient echo, and spinal angiography with a 256-slice ct23152024). Although the role of advanced imaging techniques is limited to reducing the exposure of contrast and radiation during the subsequent selective spinal angiography61215202124), it is sufficient for diagnosing sdavf and localizing the fistula235152024). Of these imaging techniques, we used the three - dimensional sagittal tricks abdominal mra to obtain information about the spinal lesion and plan the srs . Srs for sdavf is not an established method, so reports regarding sdavf treated by srs are very rare . However, in terms of radiosurgery for cranial dural arteriovenous fistulas, radiosurgery for sdavf is not an impossible treatment option22). Gao et al.7) reported that high expression state of endothelial progenitor cells (epcs) presented in the brain and spinal arteriovenous malformation (avm) tissue . Other authors have published the results from an experimental study that radiosurgery decreases angiogenic activity in avm tissue, compared to that in untreated avm tissue1). Moreover, in an experimental study by jahan et al.9), srs for an artificial animal avm model showed a reduction in the size of the lesion, compared to that in the non - radiosurgical model . Although these studies are not results for sdavf, we thought that it was possible to perform radiosurgery for sdavf . Dalyai et al.4) reported that srs for arteriovenous fistula lesions did not clearly show the mechanisms of treatment results, but they induced smooth muscle expansion, adventitial fibrosis, and an intimal response of arterial feeders, and eventually achieved obliteration of the fistula . However, it is not easy to find the exact location of fistulas with ct and mri - based image - guided structural segmentation . Thus, we planned the target area to include the dura margin, because fistulas of sdavf are located at the sleeve of the nerve root in the intradural space5131822). The planning of the radiosurgical dose was based some study, which the appearance of myelopathy from srs to spinal lesions appear rare (<1%) when the maximum spinal cord dose is limited to the equivalent of 13 gy in a single fraction or 20 gy in three fractions1114). However, these studies did not provide sufficient long - term data, and our patient had preexisting myelopathy . Thus, we treated him with a slightly lower dose than those in the references . Advanced imaging studies, including the three - dimensional sagittal tricks sequence, may be useful for obtaining information about sdavf and in performing srs and follow - up after srs when selective spinal angiography has failed . And we think that srs may be another treatment option, especially, for patients preferring non - invasive procedures . Our study has the obvious limitation of only including one treatment case, so additional cases of sdavf treated by srs are necessary to determine if it is an effective treatment for this condition.
Incompetence in locating, cleaning and shaping or obturating the complete root canal system causes primary and post - treatment infections which often lead to endodontic treatment failures . However, the most significant reason for the root canal treatment failure is insufficient knowledge about the root canal morphology and its variations . This is because such unexplored areas of root canal system remain unaffected by instruments and antimicrobial substances and form the seat for the persistent infection . Thus, it is critical to assess the numerous morphological variations of the root canal system before initiating the endodontic procedure . However, certain internal and external morphological variations in the mandibular canine like single or bifid roots with two or three canals have been reported in the literature . Till date, no case report on management of two rooted three canaled mandibular canine with a fractured instrument has been reported in the literature . In the documented case, dental operating microscope is used to bypass the fractured instrument in the middle canal of a three canaled mandibular canine with the patients consent . A 38-year - old healthy asian woman was referred to the endodontic clinic by a general dentist . The patient presented to her dentist with a severe pain in left mandibular region ten days ago . The dentist initiated the root canal treatment in left mandibular canine (tooth #22). During the cleaning and shaping procedure, an iso #10 k - file the dentist could not bypass the fractured instrument and hence the case was opted for the referral . On clinical examination, tooth #22 did not appear to have any coronal morphological variations and was identical to its right counterpart except it was mesially rotated . It was tender to percussion without any evidence of mobility, swelling or sinus tract . Careful pre - operative radiographic examination revealed a two rooted three canaled (i.e. Buccal, middle and lingual canals) mandibular canine with a fractured instrument in the middle canal [figure 1]. Buccal (a), middle (b) and lingual (c) with a fractured instrument in the middle canal prior to the initiation of root canal treatment, patient was explained about the aberrant root canal morphology and presence of a separated instrument in the middle canal . Patient was administered local anesthetic solution with adrenalin (2% lidocaine with 1: 100000 epinephrine, lox 2% neon lab, india). Under rubber dam isolation (hygienic, coltne whaledent inc ., usa), access opening was re - defined with the help of ultrasonic tips (pro ultra endo tips no . 2 and 3, dentsply maillefer, new york, usa). Careful clinical explorations of access opening with a dg-16 endodontic explorer (hu - friedy, chicago, il, usa) revealed two root canal orifices in bucco - lingual direction and were present more towards the buccal side . Moreover, a bleeding point was noted lingually at the end of a developmental fusion line indicating the location of unexplored third root canal orifice . Troughing the developmental fusion line lingually with ultrasonic tips under a dental operating microscope (carl zeiss surgical gmbh, oberkochen, germany) revealed a third root canal orifice [figure 2]. All three root canal orifices buccal (a), middle (b) and lingual (c) present alongside the developmental fusion line (d) are located with the help of ultrasonic tips and dental operating microscope all the three root canal orifices were coronally pre - flared using a nickel - titanium (niti) protaper sx rotary file (dentsply maillefer, ballaigues, switzerland) with a brushing outstroke action to improve the straight - line access . Dental operating microscope was used to visualize the fractured instrument present in the apical third of the middle canal . The maneuver to bypass the instrument was initiated in the presence of glyde (dentsply maillefer, tulsa, ok) by wedging an iso #8 k - file (dentsply maillefer, tulsa, ok) between the fractured instrument and the canal walls with frequent radiographic checks . The file was then advanced and withdrawn repeatedly in an attempt to widen the canal space and loosen the retained fragment from the root canal . So it was decided to prepare the entire root canal system, and incorporate the fragment into the obturation . The space created between the fractured instrument and the canal walls was enlarged with the larger sized files sequentially till iso #25 k - file . Working lengths for all three canals were determined with an apex locator (root zx; morita, tokyo, japan) and were confirmed radiographically [figure 3]. All three canals were prepared using protaper niti rotary instruments (dentsply maillefer, ballaigues, switzerland) according to manufacturer's recommendations . Protaper s1/s2 rotary files were used with brushing outstroke action . Finishing files f1 and f2 irrigation was performed using triple distilled water, 2.5% sodium hypochlorite solution (cmident, india) and 15% edta (largal ultra, septodont, saint maur des fosses, france). 2% chlorhexidine digluconate (r4, septodont, saint maur des fosses, france). Were used as the final irrigant . The canals were dried with sterile paper points (dentsply maillefer, tulsa, ok). The access cavity was sealed temporarily with intermediate restorative material (irm, caulk dentsply, milford, de). The root canals were again irrigated with triple distilled water to remove the intracanal dressing of calcium hydroxide . Obturation was done by a single cone technique with the use of gutta - percha cones and epoxy resin - based root canal sealer (ah plus sealer, dentsply maillefer, tulsa, ok). In the middle canal, tooth was restored using light cured composite resin (z100; 3 m dental products). Subsequent follow - up x - ray was taken at 12 months [figure 4b]. Working length radiograph with fractured instrument bypassed in the middle canal (a) post - obturation radiograph with inclusion of a fractured instrument in the obturation . Essential pre - requisites for a successful endodontic treatment are careful interpretation of pre - operative radiographs, a thorough knowledge and detailed exploration of internal root canal morphology and its divergence under the magnification and illumination . Straight radiograph provides information about the mesio - distal root canal orientation where as angled radiographs (radiographs at two different horizontal angulations) provide information about the facio - lingual canal position . Any attempt to reduce the required number of radiographs runs the risk of missing information of the complex canal morphology . Furthermore, a careful tracing of periodontal ligament space suggested the presence of two separate roots with three canals . The access cavity was extended buco - lingually with the help of ultrasonic tips in order to conserve the tooth structure while searching for an extra and elusive canal orifice . The internal and external morphological variations of the mandibular canine were clearly appreciable from the radiographic and clinical examination in the present case . Hence, cone beam computed tomography (cbct) scan was not done to reduce any extra radiation dosages . Even though the mandibular canine shows a single root and a single root canal with single apical foramen in about 92.2% of cases, clinicians should always search for any possible extra root or canal . Root canal morphological variations reported in the mandibular canine include two canals and one apical foramen in 4.9% of cases, two canals and two apical foramens in 1.2% of cases and two different roots each one with one canal in 1.7% of the cases . Also two distinct case reports of mandibular canine with three canals in one root or two roots were reported in the past . Hence, it is always prudent to consider all anatomical variations in the mandibular canine while performing a root canal treatment . Any pre - determined assumption about the root canal morphology leads to failure to locate any morphological variation, if present . It hinders the effective cleaning and shaping and creates a nidus of infection that directly compromises the long term prognosis of the tooth . In the documented case, the fractured k - file in the middle canal prevented the negotiation and thorough biomechanical preparation of the canal . However, the chances of uneventful retrieval of the fractured instrument were not predictable considering the impossibility of visibility of instrument under dental operating microscope, strategic importance of tooth, the location of the instrument and the limited thickness of the root . Success in management of fractured instrument is defined as the complete removal or complete bypass of the fragment without creating a perforation . Hence, decision was made to bypass the instrument under dental operating microscope to enhance the visualization of operating field and to conserve the maximum root structure . During the bypassing maneuver, higher magnification was used with frequent radiographic checks to avoid intra - operative complications like root perforation, ledge formation, pushing the instrument more apically etc . So, a clear understanding of pulp anatomy and its variations is essential if effective cleaning, shaping and obturation of the pulp space are to be achieved to assure the successful and predictable outcome of endodontic treatment . Mandibular canine with variations in number of roots and root canals should be treated without any pre - operative assumptions regarding its typical single rooted and single canaled anatomy . Thus the present case report highlights the endodontic management of an unusual case of mandibular canine with two roots and three canals . It also highlights the need for use of dental operating microscope and ultrasonics in locating the elusive canal orifices . So it is important to note the internal and external root canal morphological variations so that similar anatomy may be predicted and managed successfully . Sometimes retrieval of a fractured instrument is impossible or undesirable . In these cases, bypassing the instrument under magnification is a valid alternative, which can lead to a favorable outcome as presented in the given case.
One of the most serious threats dental students face during their clinical training is the possibility of exposure to blood - borne pathogens, with the attendant risk of hiv . Needlestick injuries are a hazard for people who work with hypodermic syringes and other needle equipment . These injuries can occur at any time when people use, disassemble, or dispose of needles . When not disposed of properly, needles can become concealed in linen or garbage and injure other workers who encounter them unexpectedly . Aids is making new demands on the health service and the competence of health workers . Dental students are exposed to various oral infections or lesions, which may be due to manifestations of aids . Dental students share this responsibility especially in the overcrowded hospitals, where they have to perform tooth extractions commonly and dispose / destroy the used needle or syringe . The risk of accidental needlestick injuries are more during invasive procedure such as giving injection (nerve blocks) and recapping the needle after use . There is confusion regarding correct responses to such accidents both at the administrative levels where policy decisions for institutions are to be made as well as amongst the dental staff and students themselves who are not aware the preventive aspects and of the immediate prophylactic steps to be taken in case of such accidents . There should be a well - formulated coordinated approach for the provision of information support, and referral from healthcare workers who sustain occupationally related management of occupational exposures varies between institutions and often reflects the level of staff education and previous experience in areas of infection control and transmission of blood - borne diseases . Despite published guidelines and training programs, thus the aim of the present study was to assess the knowledge, attitude and practice regarding the risk of hiv infection among dental students after an accidental needlestick injury and to make relevant suggestions . Of these 40, 40 and 40 were in third year, fourth year and interns, respectively . These students were selected as they are exposed to blood and blood - borne pathogens during their clinical training programs . A cross - sectional study was done amongst the third, fourth year and interns at ame's dental college hospital and research centre, raichur, during the academic year of 201011 from january 6, 2011 to april 17, 2011 . A semi - open self - administered questionnaire with questions pertaining to knowledge, attitude and practice of risk of hiv transmission after needlestick injury was used and the results were subjected to statistical analysis using chi - square test using spss 17.0 version software . To compare the knowledge, attitude and practice among students p <0.05 was set as statistical significance . The questionnaires were distributed to all 120 students and the rate of response was 100% . Of the 120 students, 13 (11%) were not even aware that virus could be transmitted through infected needles; among them 22.5% were third year students . In the present study, 107 (89%) students were aware of possibility of transmission of hiv through infected needles [table 1, graph 1]. Knowledge regarding transmission through infected needle knowledge regarding transmission through infected needle in all 26 (22%) said they would recap the used needles, 53 (44%) said they would destroy the needle using needle destroyer, 18 (15%) said they would destroy in puncture - resistant container with disinfectant, 15 (12.5%) said they would throw the needle directly into the dustbin and 8 (7%) said they would bend the needle and through into dustbin [table 2, graph 2]. Knowledge and awareness regarding methods of disposal of disposable needles and syringes knowledge and awareness regarding methods of disposal of disposable needles and syringes when enquired as to what they would do after an accidental needlestick injury, 37 (30%) said they would take post - exposure prophylaxis, 31 (26%) said they would wash the site of injury with surgical spirit or sterilium . Thirty one (26%) said they would promote active bleeding at the site of injury, 14 (12%) said they would wash the site of injury thoroughly with soap and running water and 7 (6%) said they would check hiv status of the patient [table 3, graph 3]. Needlestick injuries transmit infectious diseases, especially blood - borne viruses . In recent years, concern about aids (acquired immunodeficiency syndrome), hepatitis b and hepatitis c has prompted research to find out why these injuries occur and to develop measures to prevent them . Occupational exposure rates have been ex - pressed in terms of examinations for all dental care, persons per year, procedures, and other variations . Different studies may include undergraduates, postgraduates, and/or the entire team of professionals in the dental field . The rates found in the present study of 9/10 000 re - ports of percutaneous exposure in relation to the num - ber of procedures performed (83 reports for 93 892 procedures) and 12.8/10 000 consultations (eighty - three reports in 64 414 examinations for all dental care) are similar to findings in a prospective observational study carried out by cleveland et al . Divergences with other results can be attributed to the methodology employed, as well as other factors . Lower rates were observed in studies based only upon reported accidents, which did not represent the totality of occupational exposure, such as findings by ramos - gomez et al . The influ - ence of underreporting has also been demonstrated in studies by younai et al . And kotelchuck et al ., car - ried out at the same dental school in new york . Despite published guidelines and training programs, needlestick injuries remain an ongoing problem . Aids imposes on the dental students as lot of stress is associated with a sense of professional and personal inadequacy and fear of becoming infected . Studies have reported that hiv infection can be acquired through occupational injury during intervention on hiv infected patient . The hiv sequences of the doctor and patient were encoded, analyzed and compared and found to be closely related . Based on data from over 5100 exposures from 26 studies worldwide, the centre for disease control and prevention estimate that the overall risk of infection from accidental exposure is 0.3% if exposure is parental, 0.1% if via mucous membrane . In another study amongst the healthcare workers from over 300 healthcare institutions, there are many misconceptions about the risk of transmission through infected needles that need to be corrected . The risk of hiv transmission through accidental needlesticks injury does exist through the risk is low . Universal biosafety precautions if strictly adhered to while working in a healthcare setting reduces the risks further . As per who recommendations, needles should not be recapped, bent, broken, removed from disposable syringes or otherwise manipulated by hand as these procedure increase the risk of needlestick injuries . These practices should be stopped by introducing educational programs for enhancing the knowledge and skills of the dental students early in the course . As the students lack the necessary skills and training, they may be at more risks of accidental injuries . Hence making them aware of the protective steps and relevant institutional policies regarding such episodes is a necessity . In comparing reports of occupational exposure and reporting rates among dental students at a u.s . Dental school, peres et al . Stated the evident com - bination of some not - yet - fully understood factors intercede between clinical events, identification, and management in the post - exposure protocol established by the school . According to these authors, the psychological constructs that involve the fear of occupational exposure and the personal interpreta - tion of the significance of occupational exposure are probably among the factors that influence the belief in reporting . While the level of occupational risk is low, the consequences of infection with hiv are dire and should not be underrated . There is no effective vaccine available as yet . Through chemoprophylaxis for healthcare workers after accidental hiv exposure is now recommended by international aids society, they are not within the reach of many institution . Hence there is a need to improve the knowledge of dental students regarding the risks, the universal biosafety precautions and appropriate responses to accidental injuries early in their course . There was substantial improvement in compliance with universal precautions in an emergency department following institution of a policy . Healthcare workers who receive injuries need to have confidence that by immediately reporting the injury they will receive appropriate advice and treatment as well as support and encouragement . Thus it is of utmost importance that each institution should have a clear cut and uniform policy regarding prevention of such accidents and the correct steps to be taken after such an episode in the form of referral services . All healthcare workers should be made aware of these policy and necessary supportive services provided for its implementation.
Marc sprenger, director of the who s secretariat for antimicrobial resistance, recently stated that many such infections are rapidly becoming resistant to life - saving drugs;1 thus, we may be on the verge of the post - antibiotic era . Indeed, it was also proposed that many of the procedures and conditions such as simple operations or cancer immunosuppression, which we take for granted today, may become impossible due to these organisms.2 extended - spectrum beta - lactamases (esbl) have become a global scourge in the past 20 years . Initially thought to be only nosocomial problems have now become commonplace in community - acquired infections . It has been predicted that soon esbl - producing escherichia coli will be as common as methicillin - resistant staphylococcus aureus (mrsa). The dissemination of esbl mechanisms has been facilitated by the spread of plasmids, which may in fact carry other multiple resistance mechanisms . Recent surveillance programs have illustrated the frightening scale of the presence of esbls, from 55%65% in china to 67%79% in india . Perhaps most worrying is the report that 96% of klebsiella pneumoniae were esbl producers with 50% from community infections.3 although rates of these pathogens are lower in the us and most of europe, the rapid expansion of global travel leads us to realize that an infection may initiate anywhere and be manifested elsewhere . There are three definitions of resistance, which apply to more and more pathogens; these are multidrug resistant (ie, resistant to at least three different drug classes), extensively drug resistant (ie, resistant to all but one or two drug classes), and pan resistant (ie, resistant to all approved antibiotics).4 all of these infections are very challenging from a clinical perspective, besides the escalating epidemiological issues . More recently, the spread of carbapenem - resistant enterobactericeae (cre) has become a global issue . The carbapenem class of antibiotics has become the go - to group of drugs in light of esbls, which are increasing in frequency and diversity . However, in the face of carbapenem resistance, only colistin has, until recently, been a reliable last resort treatment . Moreover, a major recent development has been the emergence of colistin - resistant strains from china; this mechanism is potentially a global threat and as such is the first sign of our last therapeutic weapon becoming less effective.5 in particular, it is the recent escalation of multiple mechanisms of resistance among gram - negative species, which are causing the greatest concern . These species go beyond pseudomonas aeruginosa or acinetobacter baumannii, which are acknowledged to be major problems, but now include various members of the enterobacteriaceae notably e. coli, k. pneumoniae, and enterobacter cloacae . These species often harbor multiple mechanisms of resistance to classes of antibiotics as diverse as fluoroquinolones, aminoglycosides, tetracyclines, and -lactams . Indeed, the latter class can be rendered ineffective due to multiple methods of resistance including enzymes that can destroy many -lactams, altered cell wall porins, and increased efflux mechanisms, which adversely regulate the entry or exit of antibiotics.6 it has been the recognition of the emergence of the -lactamase enzymes, which has caused huge concerns . In response to exposure to extensive use of various penicillins and cephalosporins, bacteria have evolved and disseminated over 1,300 different hydrolyzing enzymes, most of which can be transferred from one bacterial species to another by virtue of plasmids or similar genetic methods.7 these multidrug - resistant species can then spread globally by virtue of rapid air travel across continents . A good example is the recent ndm-1-containing klebsiella strains from india to europe and beyond . Although several -lactam-lactamase combinations have been or are in development such as ceftazidime / avibactam and ceftolozane tazobactam, they do not cover all the various classes of -lactamase enzymes . There are gaps in spectra of many of the current compounds (table 1). Thus, it has been proposed that one way to avoid or, at least, reduce the damage of -lactamase enzymes outside the bacterial cell would be to ensure that the drugs are rapidly able to access the intracellular spaces and withstand internal -lactamase enzymes.8 moreover, in addition to neutralizing the destructive effects of diverse -lactamase enzymes, the outer membrane of the gram - negative cell wall poses a significant hurdle . Various species can downregulate certain outer membrane proteins to exclude certain antibiotics, including -lactams . Examples of these altered outer membrane proteins include oprd, ompk, and caro.9 in addition to prevention of cell access, efflux pumps are another significant mechanism of bacterial resistance . Bacterial efflux pumps are divided into five groups, namely, the major facilitator superfamily, the small multidrug - resistant (mdr) family, the multidrug and toxic compound extrusion family, the atp - binding cassette family, and the resistance - nodulation - cell division family . The latter is the most clinically relevant in terms of antibiotic resistance.10 it has been hypothesized that it may be possible to harness a vital bacterial survival mechanism to enable access to the bacterial cell . Bacteria secrete aggressive iron - complexing proteins known as siderophores, which scavenge iron from their environment to survive . This process could be compared to mining by solubilizing iron ions in mineral form or biologically complexed iron ions such as iron bound to transferrins . Siderophores (from the greek iron carriers) can strip iron ions out of these situations and create a complex of iron and protein; this iron - siderophore is recognized by specific bacterial uptake systems, which enable the binding of the complex to outer membrane receptors . These complexes are taken up and then released into the periplasmic space and into the cytoplasm . There are several siderophore agents that operate in the same manner, but use slightly different carrier molecules, eg, microcins, sideromycins, and natural siderophores such as ferrimycin . Human interest in this smuggling approach to conveying iron and other molecules into cells began over 50 years ago . This method of conveying compounds into other cells such as bacteria has been likened to the trojan horse legend . Legend has it that odysseus built a huge wooden horse, the emblem of the trojans; this enabled greek soldiers to be carried within the wooden horse and into the city of troy, allowing the greeks to attack troy from within . This technique became known as the trojan horse.11 it is this analogy that is used by current antibiotic developers in an effort to overcome gram - negative resistance . A major hurdle in creating effective gram - negative antibiotics is the need to cross the outer membrane into the gram - negative periplasmic space . Figure 1 illustrates the concept of coupling of iron ions to the siderophore cephalosporin complex and then transport of the complex into the periplasmic space in which the released cephalosporin attaches to the critical cell wall penicillin - binding proteins . Beyond the periplasmic space -lactam antibiotics have been the most studied class as a possible carriers for siderophore conjugates, but the concept can also be applied to other classes of antibiotic including fluoroquinolones where cellular access has been reduced or stopped due to porins or efflux mechanisms . -lactam the side chains added to the central active agent can be quite varied with catechols, which seem to be the most effective . However, there are significant technical issues with susceptibility testing of these agents in that the standardized methods, eg, committee for laboratory standards institute or european committee for antimicrobial susceptibility testing, as they require specific media, such as mueller hinton broth (mhb) supplemented with certain ions such as calcium and magnesium . However this medium, and possibly other test media, contains levels of iron, which are not representative of physiological concentrations of ferrous or ferric ions . Thus, in standard media, minimum inhibitory concentrations (mics) tend to be 432 times higher than in iron - depleted settings . There have been two approaches to removing these iron ions by using cation - binding resins, which are added to mhb . The two tested agents are apo - t (solid media)12 and chelex (broth media).13 these agents remove all ionic components but require subsequent addition of essential zinc, calcium, and magnesium ions to be supplemented to the test media after cation - binding treatment . These laboratory methods have been validated by in vivo or animal infection models, which are clearly depleted in terms of free iron ions.14 this technical approach will need to be overcome once the drugs move into late clinical development as routine approaches will yield inaccurate and inappropriate, misleading high mics . Currently, there are three such trojan horse complexes in development . Each has a different structure, but all are based on siderophore technology, thereby gaining access to the bacterial cell . These agents are mc-1, a siderophore - conjugated monocarbam, from pfizer; bal30072, a siderophore monosulfactam, from basilea; and s-649266, a catechol cephalosporin antibiotic, from shionogi pharmaceuticals . In vitro activity is the initial measure of the potential of a compound, and for the three examples of siderophore agents, in vitro data are presented in tables 2 and 3 . The reported studies focus on both routine clinical isolates and specific genetically modified species such as p. aeruginosa . To date, there have been no hea1-head in vivo comparisons reported as all three agents are in clinical development, although they are at different phases and are not readily available . Mc-1 is a novel siderophore - conjugated monocarbam antibiotic, which has shown activity against mdr p. aeruginosa and esbl - producing members of the enterobacteriaceae . Mcpherson et al15 examined the in vitro activity of mc-1 against an isogenic library of strains of e. coli, which were created by synthesizing a representative -lactamase from each class and then using that clone as a template for further mutagenesis to construct the desired genetic variants . Table 2 shows the activity of mc-1 alone and in combination with the commonly used -lactamase inhibitor tazobactam and against bal30072 (a siderophore monosulfactam), aztreonam, ceftazidime, cefepime, and meropenem against a selection of clinically relevant -lactamase enzymes . Mc-1 showed mic90 values of 0.060.25 mg / l including metallo -lactamase (mbl) strains that exhibited high mics to meropenem, cefepime, and ceftazidime . Additionally, an isogenic panel of p. aeruginosa was constructed to estimate the cellular entry of mc-1; a total of 30 mutants were examined against mc-1, bal30072, and aztreonam . Consistently, mc-1 was the most active agent tested with mics in iron - low medium in the order of 0.251 mg / l, while bal30072 showed mics of> 264 mg / l and aztreonam 4 or> 4 mg / l.15 the authors concluded that mc-1 was active against porin - mutated strains of p. aeruginosa and a wide range of gram - negative - resistant strains including those having -lactamase and porin alterations . An interesting observation that is common to siderophore studies was the discordance between in vivo murine septicemia model and in vitro mics in standard susceptibility test media mhb . This drug does not appear to be in clinical development according to clinicaltrials.gov (august, 2016), and thus, no human tolerability data are available . Bal30072 is a monosulfactam conjugated with an iron - chelating dihydroxypyridone moiety, which was developed by basilea pharmaceutica . It has been investigated in combination with a range of antibiotics commonly used against gram - negative organisms, but with the emergence of multidrug - resistant strains, they are less active . Gram - negative pathogens with -lactam - resistant phenotypes were evaluated and compared with the activities of reference drugs, including aztreonam, ceftazidime, cefepime, meropenem, imipenem, and piperacillin / tazobactam . The mic90s were 4 g / ml for mdr acinetobacter spp . And 8 g / ml for mdr p. aeruginosa, whereas the mic90 of meropenem for the same sets of isolates was> 32 g / ml.16 table 2 shows these results . P. aeruginosa, even against strains that produced metallo--lactamases that conferred resistance to all other -lactams tested, including aztreonam . The compound was also shown to trigger spheroplast formation and lysis as opposed to extensive filamentous formation . This is probably due to the points of interaction with three penicillin - binding proteins such as pbp1a, pbp1b, and pbp3 . Bal30072 was subsequently tested in combination with imipenem, meropenem, and doripenem against selected strains of enterobacteriaceae, p. aeruginosa, and a. baumannii using 1 mg / l of each combination . Broadly these showed activity against 70%80% of strains, whereas the carbapenems alone were ineffective and bal30072 was only 20%40% effective . No antibiotic combinations were antagonistic . A murine model of septicemia supported the enhanced synergy of meropenem and bal30072.17 in the direct comparison of bal30072 with mc-1, the latter agent was more active in vitro against all enzyme isogenic strains, although the difference among metallo--lactamases and oxa strains was similar having mic90s of 0.125 and 0.25 mg / l, respectively.15 this drug was not listed in current clinical trials (clinicaltrials.gov accessed august 2016); thus, no human tolerability data are available . S-649266, or cefiderocol, is a novel siderophore cephalosporin antibiotic with a catechol moiety on the 3-position side chain (fig . Two sets of recent clinical isolates were used to evaluate the antimicrobial activity of s-649266 against enterobacteriaceae . These sets included 617 global isolates collected between 2009 and 2011 and 233 -lactamase - identified isolates, including 47 kpc, 50 ndm, 12 vim, and 8 imp producers.18 the mic90 values of s-649266 against the first set of e. coli, k. pneumoniae, serratia marcescens, citrobacter freundii, enterobacter aerogenes, and e. cloacae isolates were all 1 g / ml, and there were only 8 isolates (1.3%) among these 617 clinical isolates with mic values of 8 g / ml, see table 3 . S-649266 was evaluated against gram - negative bacteria, including mdr strains and carbapenem nonsusceptible strains, and compared with cefepime, piperacillin / tazobactam, and meropenem . Mic90 values of s-649266 were 14 g / ml against mdr p. aeruginosa, mdr a. baumannii, metallo beta - lactamase - producing p. aeruginosa, and ndm-1 producers.18,19 on the other hand, mic90 values of comparators were> 16 g / ml . Mic90 values of s-649266 against carbapenemase nonproducing esbl producers of e. coli, k. pneumoniae, and e. cloacae were 0.25, 0.5, and 4 g / ml, respectively . While the mic90 values of cefepime and piperacillin / tazobactam were 32 g / ml . The antibacterial activity of s-649266 against carbapenemase producers and its stability against clinically relevant carbapenemases were also investigated . The catalytic efficiencies (kcat / km) of imp-1, vim-2, and l1 for s-649266 were 0.0048, 0.0050, and 0.024 m s, respectively, which were more than 260-fold lower than that for meropenem . Ndm-1 hydrolyzed meropenem threefold faster than s-649266 at 200 m.20 it is increasingly appreciated that adaptation is a major mechanism associated with the acquisition and evolution of antibiotic resistance . Adaptive resistance is a specific type of nonmutational resistance that is characterized by its transient nature . It occurs in response to certain environmental conditions or due to epigenetic phenomena like persistence . It has been proposed that this type of resistance could be the key to understanding the failure of some antibiotic therapy programs equally the genetics behind some of the changes involved in adaptive resistance may explain the phenomenon of baseline creep, whereby the average (mic) of a given species increases steadily but inexorably over time, making the likelihood of breakthrough resistance greater . Previous siderophore - based -lactam compounds, such as monobactam (mb-1) and the monocarbam (smc-3176), demonstrated inconsistent activity probably due to development of adaptive resistance.21,22 thus, ghazi et al23 examined s-64926, mb-1, and smc-3167 in the neutropenic mouse model to determine the relative penetration through outer membrane via iron transporter systems as well as the stability of the three molecules against serine- and metallo - carbapenemases . Using this established thigh infection model, p. aeruginosa was examined to explore the pharmacodynamic profile of these compounds with respect to efficacy and development of adaptive resistance . Mics were determined by broth microdilution in triplicate (iron deficient) and modal mic was reported . Groups of three mice were inoculated, and two hours later, they were treated with ascending doses of s-649266 or humanized doses of siderophore -lactams mb-1 and smc-3167, as determined in previous studies.21,22 after 24 hours, the animals were sacrificed for bacterial enumeration and determination of the change in bacterial density (log10 cfu) relative to the starting inoculum . Unlike the previously reported variable efficacy with siderophores mb-1 and smc-3175 against the p. aeruginosa studied, s-649266 displayed sustained antibacterial effects for all isolates over the treatment period . Enhanced bacterial kill was observed over the dose range studied, and as previously observed,% ghazi et al proposed that catechol substitution may impart improved activity compared to other siderophore - conjugated -lactams, suggesting that adaptive resistance was not observed in this model . Clearly broader clinical exposure will test these results, but based on these lower adaptive resistance results, s-649266 appears to have a lower potential for resistance selection . A pharmacokinetic model providing probability of target attainment (pta) data described the time courses of s-649266 concentrations in plasma and urine, which were used to predict efficacy for optimizing dosage regimens.24 the simulations for the subjects with normal renal function suggested that s-649266 at 2 g q8h would exhibit efficacy for the target pathogens (ie, carbapenem - resistant e. coli, k. pneumoniae, p. aeruginosa, and a. baumannii; mic90: 0.5, 2, 2, and 8 g / ml, respectively). The 3-hour infusion would provide an adequate pta, while patients on 1 g q8h dosing would probably be insufficient . This hypothesis was examined in a rat lung infection model.24 the model described plasma and urine concentration data, which yielded pta values with 2 g q8h with 1-hour or 3-hour infusion . For 2 g q8h with either infusion time, the pta was> 90% at 8 and 4 g / ml of mic for 50% and 75% of ft> mic, respectively . The pta for both ft> mic targets at 2 g q8h with 3-hour infusion was higher than that observed with 1-hour infusion . The predicted fifth percentiles of urine concentrations over 8 hours were> 100 g / ml with 2 g with 1-hour infusion . The simulations for the subjects with normal renal function confirmed that a 2 g dose every 8 hours s-649266 would provide adequate efficacy for most target pathogens while a 1-hour infusion was likely to be inadequate, especially if the mics were slightly elevated . Thus, 2 g given every 8 hours would probably achieve urinary concentrations likely to eradicate most mdr gram - negative pathogens.24 the clinical development of these three siderophore agents is less than clear . Only shionogi pharmaceuticals with s-649266 is registered on clinicaltrials.gov with their phase 2/3 program, which is comparison of s-649266 with imipenem / cilastatin for the treatment of complicated urinary tract infections in adults . This is a multicenter, double - blind international study with a focus on enrolling patients with multidrug - resistant, carbapenem - susceptible, gram - negative pathogens.25 there is no clinical trial information on either mc-1 or bal30072 . A novel (phase 3) study of s-649266 will enroll only patients with evidence of carbapenem - resistant pathogens, regardless of the primary infection site . This pathogen - focused study will rely on rapid diagnostic technologies to identify eligible patients . The onslaught of multidrug - resistant bacteria is a global problem with the emergence and geographical expansion as a major clinical threat . In the past few years, we have seen several novel approaches to combatting bacterial resistance; these include synthetic peptides, cationic antimicrobial peptides (camps), lantibiotics, lipophosphoxins, nosokomycins, and -sitosterol . The synthetic peptides have been studied as potential antibacterial agents for over 20 years, a recent focus on multidrug - resistant gram - negative species . Mcgrath et al have engineered a synthetic peptide that shreds and dissolves the double - layered membrane, which are considered to be a prime defensive mechanism of gram - negative species . This spiral peptide called klaklakklaklak acts by puncturing this unique bacterial bilayer without affecting eukaryotic cells . However, these peptides are subject to normal host enzyme destruction of some enzymes excreted by the bacterium itself . Thus, in order to combat this negative impact, increase in dosing will be needed, which may bring increased toxicity and manufacturing costs . The authors showed in vitro activity against key nosocomial pathogens with a dose - dependent killing . This synthetic peptide eliminates biofilms that may be important in settings where bacteria establish microcolonies and then seed to cause infection such as bone and joint infections . Animal models are now required to fulfill the next steps of drug development.26 camps are essential natural innate immune defense mechanisms that inhibit colonization by pathogens and aid in the clearance of infections . Gram - negative species are a major target but some evolved resistance mechanisms . Such mechanisms undoubtedly contribute to virulence and survival of pathogens . Camps destabilize the bilayer membrane by interacting with anionic head groups and hydrophobic fatty acid chains . It has been hypothesized that camps also have intracellular targets that also contribute to cell wall disruption and cell death . Two camps are in clinical use, namely, polymyxin b and colistin (polymyxin e); however, bacterial resistance has recently been reported in china27 and very recently in usa.28 bacterial resistance occurs via surface remodeling, usually lipopolysaccharide modification, capsule production, biofilms, efflux pumps, and proteolytic degradation.29 clearly with such an array of camp resistance mechanisms, this may limit the value of the class in the clinical setting . It has been proposed that establishment of some of these camp resistance mechanisms are additions to the bacterial pathogenicity . Deeper understanding of the camp resistance mechanisms may help yield further gram - negative antibiotics . In an effort to overcome some of these issues, torcato et al30 designed and characterized two new molecules, namely, r - bp100 and rw - bp100 . These analogs have two amino acids, in which tyr is replaced with a trp and/or the lys residues replaced with arg . These analogs are active against a wide range of gram - negative species as well as, unusually for peptides, all tested gram - positive bacteria . These minor, but significant, structural changes may yield potential new class of antibacterial agents for a broad range of multidrug - resistant species . Draper et al31 examined posttranslationally modified ribosomally synthesized antimicrobial peptides, lantibiotics, with a broad - spectrum antimicrobial activity . Draper et al tested the enhancement of 3147 with polymyxin b and e using synergism tests . Using low levels of a polymyxin, the lantibiotic 3147 activity against gram - positive and some gram - negative species . They hypothesized that use of 3147 may allow for use of lower, thus less, toxic concentrations of polymyxin . Panova et al32 discovered a new series of compounds termed lipophosphoxins (lppos), which showed specific activity toward gram - positive species . Lppos are bactericidal in activity and localize to the plasma membrane in bacteria but not in eukaryotic cells . . Of key concern with any new class of compound toxicity to humans is essential thus showing no genotoxicity in the ames test, do not cross monolayer of caco-2 cells and well tolerated by mice when given orally but not via the peritoneum . As the agents withstand low ph, it has been proposed that they may not be viable systemic antibiotics but may have a role as nonabsorbed antibiotics such as in clostridium difficile of helicobacter pylori agents . Mrsa is still a major nosocomial pathogen, although recent additions to the armamentarium such as modified glycopeptides and oxazolidinones have recently been approved for clinical use; it is undisputed that mrsa will find a way to resist these new agents . Tomoda33 reported on a new member of the phosphoglycolipid family, the nosokomycins from streptomyces cyslabdanicus using a silkworm model . The proposed target site is penicillin - binding proteins specific to mrsa . Although these data are very preliminary, they suggest a novel approach to inhibiting gram - positive cell wall production . Li et al34 reported the use of a phytosterol, -sitosterol, to protect against cell lysis by pneumococcal pneumolysin, a potent virulence mechanism of streptococcus pneumoniae . Mouse model studies showed the protection of cells from cholesterol - dependent toxins that contribute to pneumococcal infections . There is clearly a huge amount of research into alternative methods to combat antibiotic - resistant bacterial infections . However, many of these molecules are still in their early stages with very few having been exposed to humans . Indeed, so although there is much excitement at these innovations, we have to turn to classes we understand and have a long - standing safety record . Thus, we resort to the exploration of one of the oldest antibiotic classes, the -lactams . Most recently, extension of the -lactam/-lactamase inhibitor combinations (eg, ceftazidime / avibactam or ceftolazane / tazobactam) and modified carbapenems are clinical options . Of particular interest is the recent announcement of the initial phase 3 clinical study of meropenem vaborbactam in complicated urinary tract infections, which was compared with piperacillin / tazobactam . Notably the clinical efficacy was 98.4%; yet, the microbiological eradication was 66.7% compared with 57.7% reported with piperacillin / tazobactam.35 the second phase 3 study comparing this new combination with best available therapy may be more instructive with regard to the strains producing inhibitor - resistant tems, complex mutant tems, or ampc -lactamases, which were found to be generally resistant to older inhibitor combinations, and the presence of these enzymes is probably due to the increased use of -lactam/-lactamase inhibitor combinations, which is escalating . Importantly, novel -lactamase inhibitors do not address the multifactorial resistance mechanisms in gram - negative bacteria, particularly, p. aeruginosa and a. baumannii, which are mediated by porin mutations and efflux overproduction . Thus, with these changes, clinicians are turning to relatively toxic agents such as colistin or multiple drug combinations to manage infections such as pneumonia, bacteremia, wound, urinary tract, and other serious systemic infections . The utility of siderophore antibiotics by virtue of their activity against an array of esbls and cell access mechanisms is an encouraging development and may be one that clinicians are in need of, but we await the initial clinical findings with s-649266.
Bovine lung fragments, deep nasal swab specimens, and trans - tracheal aspiration liquids were submitted to the laboratoire dpartemental danalyses de sane - et - loire (mcon, france) and tested for classical respiratory pathogens . The unit mixte de recherche, interactions htes agents pathognes 1225 (toulouse, france), received and tested 134 samples by using real - time reverse transcription pcr for influenza d virus as previously described (3). We tested 25 archived samples per year for 20102013 and 34 samples collected during january march 2014 . Six (4.5%) were positive for influenza d virus: 1 each in 2011 and 2012 and 4 in 2014; cycle threshold (ct) values ranged from 15 to 35 (table 1). Co - infections were detected with pasteurella multocida, mannheimia haemolytica, histophilus somni, bovine respiratory syncytial virus, and/or bovine herpesvirus 1 in 4 of the influenza d positive specimens . Two samples (nos . 5831 and 5920, collected in 2014) were negative for all tested respiratory pathogens, despite reports of clinical signs in the animals (table 1). * ct, cycle threshold; bcov, bovine coronavirus; bohv-1, bovine herpesvirus i; bpiv3, bovine parainfluenzavirus 3; brsv, bovine respiratory syncytial virus; flud, influenza d virus; i d, identification; n, negative; nc, not communicated; nt, not tested; p: positive (ct<35), wp: weakly positive (35<ct<40). The specimen with the lowest ct value, d / bovine / france/2986/2012 (ct 15) was selected for further molecular characterization, and its full genome was amplified by pcr (primers in table 2) and sequenced on a 3130xl applied biosystems capillary sequencer (applied biosystems, foster city, ca, usa). The 7 gene segments of d / bovine / france/2986/2012 clearly clustered with us influenza d strains from pigs and cattle (c / ok, c / bovine / minnesota/628/2013, c / bovine / minnesota/729/2013, and c / bovine / oklahoma/660/2013) (figure), which suggests a common origin of these new influenza viruses . We found no evidence of reassortment between influenza c and d (c / ok - like) viruses . In addition, the splicing pattern of the matrix gene segment and the reduced 5-n - acetyl binding pocket in the hemagglutinin - esterase (he) protein of d / bovine / france/2986/2012 was similar to that of c / ok and different from that of human influenza c virus, confirming the similarity of d / bovine / france/2956/2012 and the newly described swine and bovine us influenza d virus strains . The estimated ranges of evolutionary distances (in number of substitutions per site using the maximum composite likelihood model) between d / bovine / france/2986/2012 and the 4 us influenza d viruses ranged from 0.8 to 5.7% and were as follows: 1.9%2.1%, 0.8%0.9%, 2.1%2.5%, 2.3%2.7%, 1.8%3.8%, 3.6%4.2%, and 5.1%5.7% for polymerase basic (pb) 2, pb1, polymerase 3/polymerase acidic, nucleoprotein, matrix, nonstructural protein, and he gene segments, respectively . Phylogenetic trees of the 7 gene segments of d / bovine / france/2986/2012 influenza virus at the nucleotide level . Maximum - likelihood analysis with 500 bootstrap replicates (bootstrap values> 75 are indicated on the tree nodes). The gene sequences of d / bovine / france/2986/2012 (in large bold underlined font) were compared with representatives of all the orthomyxoviridae genera: all the viral strains used in (1). P, polymerase, nucleoprotein, pb, polymerase basic scale bars indicate nucleotide substitutions per site . Forty unique amino acid substitutions were identified throughout the genome, but the limited available data on influenza d genomes make a functional interpretation of the substitutions difficult to determine . In addition, although the he proteins of human influenza c and c / ok viruses contain 7 and 6 potential glycosylation sites, respectively, d / bovine / france/2986/2012 has just 5: at positions 28, 54, 146, 346, and 613 (atg numbering), identical to 5 of the 6 identified for c / ok virus . For influenza a viruses, modifications of n - linked glycosylation sites in the globular head of the hemagglutinin protein have been linked to changes in virulence, antigenicity, receptor - binding preference, fusion activity, and immune evasion (4). For example, an increase in glycosylation site numbers has been associated with early stages of influenza a(h1n1) virus evolution, and changes in the positional conversion of the glycosylation sites have been associated with later evolutionary stages of the virus (5). The missing potential glycosylation site in d / bovine / france/2986/2012 is located at position 513, probably likely in the f3 = he2 fusion domain of the protein (6) and not in the globular head of the protein . Thus speculating on the putative time course of virus emergence between c / ok - like and d / bovine / france/2986/2012-like strains further studies are needed to understand the phenotype(s) associated with aa substitutions in influenza d viruses . Webster et al . Suggested the existence of a common ancestor for influenza a, b, and c viruses and a more recent common ancestor to influenza a and b viruses only considering the different genome organizations between influenza a / b and influenza c viruses (6). Recently estimated the time of divergence between influenza c and d virus gene segments at 334 years for pb1 to 1,299 years for he (7). The time of emergence and evolutionary rate of influenza d viruses need to be examined as more data become available . A puzzling question raised by our current study is the geographic origin of influenza d strains: were cattle in france contaminated by their north american counterparts or vice versa? Did co - evolution occur? Did the pathogen originate from a distinct location or from a distinct host? Retrospective studies with archived samples would help date the emergence of influenza d viruses and enable an understanding of their evolution . The pathogen may have spread to swine and cattle in recent years only; efforts should be made to find the virus host range and its reservoir species and to evaluate the public health relevance of this new pathogen . Finally, surveillance projects with larger cohorts, as well as experimental infections, need to be conducted before 1) the causality between respiratory symptoms and influenza d virus infection in cattle can be established, 2) recommendations on samples to collect can be given, and 3) prevalence can be compared in different geographic areas . Although the causative agent(s) of some respiratory infections in the field remain(s) unknown (g. meyer, pers . Comm .) And although 2 of the positive specimens in our study originated from young cattle with respiratory symptoms but no identified respiratory pathogen, further studies are also warranted to provide an understanding of the pathobiology of influenza d virus in cattle and its putative role in complex bovine respiratory disease.
Ventriculo - peritoneal (vp) shunting is the preferred and most successful method for managing congenital hydrocephalus . Abdominal complications include peritonitis, ascites, bowel obstruction, bowel and abdominal wall perforation, and inguinal herniae . An uncommon but recognized complication is formation of an abdominal pseudocyst, with cerebrospinal fluid (csf) collecting and being poorly absorbed or not absorbed across the serosa . The continuous flow of csf within a confined space leads to increased pressure within the abdominal cavity, reducing forward pressure gradient and, eventually, shunt malfunction . These pseudocysts have traditionally been treated with surgical shunt externalization, antibiotics, and a second surgical procedure for shunt reinsertion . Exploratory laparotomy with a partial excision pseudocyst and placement of a catheter in a quadrant of abdomen is also an option . We report a 20-month - old female child with a vp shunt and a gradual distension of abdomen since three months, respiratory distress, and bilious vomiting for two days . Right - sided vp shunt insertion was done on the seventh day of life and meningomyelocele repair on the 15 day of life . At the age of three months, there was shunt malfunction for which the right - sided vp shunt was removed and a vp shunt was inserted on the left side . At the time of index admission, she presented with a history of gradual distension of abdomen for 3 months and respiratory distress and bilious vomiting for 2 days ., there was a large, 15 cm 12 cm, nontender, cystic intraperitoneal lump with a smooth surface and ill - defined margins, occupying almost the entire abdomen; moreover, fingers could be insinuated between the costal margins and the lump . X - ray of the abdomen showed vp shunt in the left side of the abdominal cavity having ground glass opacity around the shunt, with the displacement of bowel loops to the periphery of the opacity [figure 1]. Abdominal ultrasonography (usg) revealed a large multiseptate pseudocyst with the presence of the shunt within . As the baby had considerable respiratory distress, an ultrasound - guided aspiration of 200 ml of a straw - colored fluid was done . However the fluid recollected immediately with increasing abdominal distension and the symptoms persisted; hence, we decided to operate on the child . X - ray abdomen showing a giant psuedocyst on the left lower abdomen with a shunt in situ we went ahead with two - port laparoscopy; one 5-mm primary epigastric camera port above the cyst placed under vision and one 5-mm port in the right iliac fossa . The placement of the second port was difficult, as there was a large csf pseudocyst predominantly on the left side of the abdomen, with multiple adhesions of bowel loops around the pseudocyst . Gentle maneuvering and dissection with the scope itself helped identify a window in the right iliac fossa where the second port could be placed . A grasper was used to gently free all adhesions of the cyst wall to parietes . The cyst was incised with a hook cautery and 1,100 ml of the csf fluid was drained . The incision in the cyst wall was extended carefully so as to avoid injury to the adherent bowel loops, and the cyst was then deroofed . The shunt was repositioned in the right subdiaphragmatic space over the liver after confirming the patency of shunt with a free flow of the csf . . On sixmonth follow - up, the child is recovering well and is asymptomatic . Insertion of a vp shunt is the preferred and most successful method for the management of congenital hydrocephalus . In the setting of a vp shunt, the time from the last shunt procedure to the development of the abdominal csf pseudocyst ranges from 3 weeks to 5 years . A chest and abdominal x - ray visualizes the position of the thoracoabdominal part of the vp shunt . Pathi reported that ultrasound and computerized tomography features of the vp shunt floating in the thickened sac wall would allow early recognition of this complication . These pseudocysts have traditionally been treated with surgical shunt externalization, antibiotics, and a second surgical procedure for shunt reinsertion . Moreover, exploratory laparotomy with partial excision and marsupialisation of pseudocyst and placement of catheter in a quadrant of abdomen has been done . An extensive review revealed increasing use of laparoscopic management of this complication . Using the technique of laparoscopy, kim et al . Excised a portion of the csf pseudocyst, removed the shunt catheter from the residual cavity, and repositioned it within the peritoneal cavity in a 12-year - old boy . (2003) found that the laparoscopic management of csf pseudocyst, accomplished through 3-mm to 5-mm ports with the help of delicate laparoscopic instruments, minimizes the risk of a laparotomy, and the formation of intraperitoneal adhesions . Furthermore, laparoscopy allows visual confirmation of the adequate flow of the csf from the end of the catheter after it is repositioned . However, the greatest advantage of laparoscopy lies in its ability to assess the entire abdominal cavity for the presence of adhesions and undertake adhesiolysis when necessary . This allows placement of the catheter in the quadrant of the abdomen with the maximum absorptive surface . Martin et al . Performed laparoscopy in ventriculoperitoneal shunt revision for pseudocyst in two cases and reported the use of extensive adhesiolysis for decreasing the risk of future adhesive obstruction and extending shunt life and thus, recommended laparoscopy for vp shunt revisions . Performed the laparoscopic drainage of a pseudocyst containing 2 liters of fluid and retrieved the catheter from the peritoneal cavity . Esposito et al . Recommended that laparoscopy is a safe procedure in patients with abdominal complications of vp shunts, especially in adhesions and pseudocyst formation . On extensive search and review of literature, we found that minimally invasive technique is a useful modality for the treatment of this complication . However, the management of this complication is generally done using three ports (one camera port and two working ports). We recommend that even giant pseudocysts can be managed by the two - port laparoscopic technique as done in another child with giant csf pseudocyst as well . To summarize, laparoscopy is a useful modality for the treatment of intra - abdominal complications of vp shunt such as adhesions and pseudocyst . It is effective, avoids multiple laparotomies, and its attendant complications and future adhesions . It is feasible to manage this complication by using only the two - port laparoscopic technique.
Multiple sclerosis (ms) is a chronic inflammatory - demyelinating disease of the central nervous system (cns). It is characterised by multifocal and disseminated in time damage to the cns with heterogeneous symptomatology and the clinical course . Depending on the studied region, the prevalence in the general population varies from 5 to 150 per 100,000 individuals . The first symptoms usually appear between the ages of 20 and 40 [2, 3] and the disease is the most frequently observed among caucasians, with a higher prevalence in females . Currently, ms is a disease of complex pathogenesis with genetic, immunopathological and environmental factors [4, 5]. The protective effect of sunlight seems to be related to the protective action of 25(oh)d3, which plays an important role in immunological processes and in the regulation of calcium phosphate metabolism . Recent studies have demonstrated that 25(oh)d3 participates in cell proliferation and differentiation, and also in immunological phenomena . The greatest 25(oh)d3 deficiency was noted in the spring and in the winter and also in the elderly . Females aged 1545 years are at a greater risk of 25(oh)d3 deficiency, especially in combination with seasonal variations . The peak of incidence is noted between the third and the fourth decades of life [8, 9]. To provide complex medical care, it is important to determine the indices of calcium phosphate metabolism in patients with ms . The study evaluated the concentration of 25(oh)d3 and the indices of calcium phosphate metabolism depending on the sex, number of relapses, degree of motor disability and the applied treatment at different stages of relapsing remitting ms (rrms). The study evaluated the concentration of 25(oh)d3 and the indices of calcium phosphate metabolism depending on the sex, number of relapses, degree of motor disability and the applied treatment at different stages of relapsing remitting ms (rrms). Patients with diagnosed rrms were enrolled in the study, according to the mcdonald criteria of 2005 . The patients were selected based on the medical documentation of the out - patient neurological clinic and the medical history of patients hospitalised between 2009 and 2011 in the clinic of neurology in zabrze, poland . The enrolment criteria were as follows: diagnosis of rrms according to the mcdonald criteria; the current degree of disability according to the expanded disability status scale (edss) from 0.0 to 3.0 points; inhabitation of the silesian agglomeration (at a latitude of 4950, n); performance of the professional work under similar environmental conditions; absence of any other chronic disease except ms, patients informed written consent for the study . Recruited patients had not followed any diet which might have influenced the calcium phosphate metabolism (e.g. Diabetic diet, weight - reduction diet, high - protein diet, etc . ). Patients had not consumed dietary supplements with vitamin d before or at the time of the study, and within 6 months prior to sample collection had not resided in other climatic zones . The exclusion criteria were as follows: cns demyelinating syndrome of different aetiology than ms; forms of ms other than rrms; duration of disease longer than 6 years and the degree of motor disability> 3.0 points according to the edss; relapse at the time of examination; treatment with immunomodulatory agents or glucocorticoids (gcs) for the mean duration of 6 or 12 weeks depending on the qualification to a study subgroup; diagnosed kidney disease, gastrointestinal tract and liver diseases, endocrine disorders, menopausal women . The results were compared to values obtained in 20 age- and sex - matched controls who did not differ in terms of place of residence or ethnicity . The study was approved by the bioethics committee of the medical university of silesia in katowice, poland . All enrolled patients were interviewed with particular attention paid to the course of rrms: onset of symptoms, year of diagnosis, additional tests, number of relapses (exacerbations of the disease manifested with new neurological symptoms), hospitalisations, previous treatment, family and occupational history and comorbidities . General and neurological examination was conducted and the degree of motor disability of patients was evaluated using the edss . In every patient, 5 ml fasting blood sample was obtained and daily (24 h) urine sample was collected . Laboratory tests evaluated the indices of calcium phosphate metabolism, the results of which were compared to the applicable standards for specific test methods . Serum concentration of 25(oh)d3 (normal range 11.142.9 ng / ml; 30.4118.5 nmol / l) and parathormone concentration (normal range 1565 pg / ml) were assessed using the cobas e 601 analyser (roche). Serum phosphorus concentration (normal range 0.811.45 mmol / l), serum calcium concentration (normal range 2.12.55 mmol / l), alkaline phosphatase concentration (normal range 3090 u / l), bone alkaline phosphatase concentration (normal range 2048 u / l), and concentration of daily urine calcium excretion (normal range 2.56.5 mmol / l/24 h) were assessed using the cobas c 501 analyser (roche). Mmol / l) was measured directly using ion - selective electrodes (rapid lab 865, siemens). Samples for laboratory analyses were collected in april and the sun exposure was similar for all the examined subjects . The results were stored in the database prepared specifically for this purpose in microsoft excel . The result of the statistical analysis was considered statistically significant if the level of significance was p 0.05 . In data description, the standard statistical parameters were provided, i.e. The number n, arithmetic mean x, the sd, median and percentages (%). Normal distribution of data was assessed by the shapiro the results were compared with the control group (table 1).table 1the characteristics of the study groupsgroup 1group 2group 3control groupnumber of subjects (n)15151520stage of diseaseimmediately after the diagnosis of rrmsin the early stage of rrms up to 6 months after the occurrence of first symptomsin the advanced stage of rrms 56 years after the occurrence of first symptomshealthy individuals, not diagnosed with any cns disease or any other systemic or metabolic disorderstreatment usednot treated with immuno - modulatory agents and gcssubjects not used immunomodulatory agents and were not treated with gcs 6 weeks prior to study enrolmentsubjects not used immuno - modulatory agents and were not treated with gcs 12 weeks prior to study enrolmentnot treated with immuno - modulatory agents or gcssex (f / m)9 (60%) /6 (40%) 10 (66.7%) /5 (33.3%) 12 (80%) /3 (20%) 14 (70%) /6 (30%) age (years)35.3 12.133.5 8.936.2 6.135.2 8.2edss (points)1.2 0.651.2 0.441.8 0.7number of relapses before the enrolment to the study1.3 1.12.4 2.13.5 2.4 rrms relapsing remitting multiple sclerosis, gcs glucocorticoids, cns central nervous system, f female, m male edss expended disability status scale data presented as n (%) * * data presented as mean sd the characteristics of the study groups rrms relapsing remitting multiple sclerosis, gcs glucocorticoids, cns central nervous system, f female, m male edss expended disability status scale * data presented as n (%) * * data presented as mean sd in the studied groups, serum ionised calcium concentrations differed significantly (p = 0.002). The most significant differences regarding the concentrations of ionised calcium were observed between group 1 and group 2 (p = 0.004), and between group 1 and the individuals in the control group who had higher concentrations compared to patients in group 1 (p = 0.003) (tables 2, 3).table 2laboratory results in the examined groupsparameterstatistical parametergroup 1 n = 15group 2 n = 15group 3 n = 15control group n = 20kruskal wallistestserum phosphorus (mmol / l) x 1.071.131.011.06ns (p = 0.130)sd0.230.20.170.16me1.051.21.031.0710% p0.870.930.880.990% p1.191.311.181.23serum calcium (mmol / l) x 2.382.372.372.32ns (p = 0.160)sd0.140.20.080.07me2.402.362.392.3110% p2.202.252.252.2590% p2.562.442.452.42serum alkaline phosphatase (u / l) x 57.263.96256.7ns (p = 0.240)sd10.716.818.722.1me5559564910% p45.443.444.838.990% p72.88588.285.4serum bone alkaline phosphatase (u / l) x 21.522.822.121.8ns (p = 0.900)sd8.17.77.29.6me22232120.510% p1212.415.41190% p26.632.231.232.2serum ionised calcium (mmol / l) x 1.11.141.091.18 p = 0.002 sd0.210.060.050.17me1.071.141.081.1410% p0.991.071.051.0690% p1.141.21.141.28serum parathormone (pg / ml) x 24.3361.0176.752.28 p = 0.00001 sd11.2534.9741.9723.68me22.5960.164.3948.9310% p7.3616.0637.1127.2490% p36.86103.221158282.88serum 25(oh)d3 (ng / ml) x 20.316.9113.8926.28 p = 0.007 sd10.388.446.488.24me17.7515.5913.428.0910% p9.57.415.7616.6990% p31.8129.2921.1138.33daily urine calcium excretion (mmol / l/24 h) x 2.362.673.133.79ns (p = 0.310)sd0.981.92.532.68me2.161.861.673.0410% p1.211.261.291.1790% p3.575.137.477.42 x mean, sd standard deviation, me median, 10% p, 90% p percentiles, ns not significant, p level of significancetable 3the comparisons between pairs of groups for serum ionised calcium, parathormone and 25(oh)d3 concentration values (mann whitney u test)comparisonionised calciumparathormone25(oh)d3 group 1group 2 p = 0.004 p <0.001 ns (p = 0.300)group 1group 3ns (p = 0.250) p <0.001 ns (p = 0.090)group 1control group p = 0.003 p <0.001 ns (p = 0.060)group 2group 3 p = 0.020 ns (p = 0.590)ns (p = 0.490)group 2control groupns (p = 0.880)ns (p = 0.230) p = 0.002 group 3control group p = 0.020 p = 0.050 p <0.001 significant values (p 0.05) are in bold laboratory results in the examined groups x mean, sd standard deviation, me median, 10% p, 90% p percentiles, ns not significant, p level of significance the comparisons between pairs of groups for serum ionised calcium, parathormone and 25(oh)d3 concentration values (mann whitney u test) significant values (p 0.05) are in bold an association was found between the mean parathormone concentrations and the disease duration . In group 3, the mean serum concentration of parathormone was the highest and was above the upper limit of the reference range . Newly diagnosed patients had the lowest serum concentration of parathormone compared to serum concentration of parathormone in patients at a more advanced stage of the disease as well as in the control group (table 2). A decrease in mean concentrations of 25(oh)d3 with the disease duration the mean serum concentration of 25(oh)d3 in the studied groups of patients was lower compared to the control group (p = 0.007). A significant difference in concentrations was demonstrated between the control group and patients with the disease duration of up to 6 months (p = 0.002) or longer (p <0.001) (tables 2, 3). Next, the indices of calcium phosphate metabolism were assessed depending on the sex . In group 3 (patients with longer disease duration), lower concentrations of 25(oh)d3 were found in females compared to males . In the group of patients with a shorter disease duration (groups 1 and 2), the mean serum concentration of 25(oh)d3 was higher in females compared to males with a similar degree of motor disability . The mean serum concentrations of parathormone in male patients at the advanced stage of the disease (group 3) were higher compared to females . Both in females in group 2 and in all patients in group 3, regardless of the sex, the mean concentrations of parathormone exceeded the upper limit of the reference range (table 4).table 4parameters of calcium phosphate metabolism in the examined groups, depending on sex (mean sd)parametersexgroup 1 (n = 15)group 2 (n = 15)group 3 (n = 15)control group (n = 20)serum phosphorus (mmol / l) m1.10 0.351.07 0.291.03 0.170.94 0.14f1.06 0.121.17 0.151.00 0.171.11 0.14serum calcium (mmol / l) m2.41 0.102.35 0.052.39 0.042.35 0.10f2.37 0.162.37 0.252.37 0.082.31 0.06serum alkaline phosphatase (u / l)m63.2 12.766.0 21.566.0 28.076.2 24.3f53.2 7.962.8 15.261.0 17.348.4 15.3serum bone alkaline phosphatase (u / l)m20.7 8.021.6 6.926.3 3.228.5 12.1f22.1 8.723.4 8.421.0 7.618.9 7.0serum ionised calcium (mmol / l)m1.03 0.041.13 0.041.06 0.011.15 0.12f1.14 0.271.15 0.081.09 0.061.19 0.19serum parathormone (pg / ml)m22.72 9.3447.03 40.5683.18 48.2251.55 19.61f25.40 12.8068.00 31.7675.07 42.4852.59 25.92serum 25(oh)d3 (ng / ml)m18.22 7.0414.61 10.3517.45 6.1124.48 9.38f21.70 12.3418.05 7.6713.00 6.5027.05 7.95daily urine calcium excretion (mmol / l/24 h) m2.24 0.994.16 2.632.66 1.344.76 1.88f2.44 1.021.92 0.843.25 2.783.37 2.92 m male, f female parameters of calcium phosphate metabolism in the examined groups, depending on sex (mean sd) the increase in serum parathormone concentration was observed with the increase in relapses (r = 0.51, p <0.001) in the conducted correlation analysis between the number of relapses, the degree of disability and the indices of calcium phosphate metabolism in all patients . The present study showed that in patients with rrms, serum concentrations of 25(oh)d3 and ionised calcium were significantly lower compared to healthy individuals and decreased with the duration of the disease, with the increase in relapses and in females compared to males . Our results concerning the concentration of 25(oh)d3 in rrms patients are compatible with those of some [10, 11], but not all [1215] prior publications (table 5). Moen et al ., kragt et al ., soilu - hanninen et al ., and barnes et al . Presented different results obtained in norway, the netherlands, finland, great britain and northern ireland . The researchers showed comparable mean 25(oh)d3 concentrations in patients with ms and healthy persons.table 5summary table with data from the past publications and the present studykubicka - baczyk et al.past publicationssmolders et al.van der mei et al.hussein et al.moen et al.pierrot-deseilligny et al.kragt et al.barnes et al.el-ghoneimy et al.place of the studypolandregion silesiamaastricht, netherlandstasmania, australiacair, egyptoslo, norwayparis, franceamsterdam, netherlandsulster, northern irelandcair, egyptlatitude4950n5051n4143s30n5955n4852n5222n5435n30nnumber of subjects (n)6543893599761012920age (years)35.0 9.034.1 10.143.5 9.341 1045.0 11.946.79 11.328.7 6.0edss (points)1.41 0.692.68 1.743.5 2.24.09 1.91.4 1.12.343.4 2.3serum 25(oh)d3 (nmol / l)54.16 26.8179.47 32.2nd51.4 20.333.65 22.768.4 24.549 22nd78.65 29.669.19 40.031.8 14.31ndserum parathormone (pmol / l)82.64 44.983.55 1.895.35 1.8561.18 26.0165.24 37.3ndserum ionised calcium (mmol / l)1.11 0.111.27 0.032.36 0.090.66 0.29nd * data presented as mean sd, results in ms patients were significantly lower than in controls, results in ms patients results in ms patients were comparable to controls; nd not defined (results in ms patients were not compared to controls), not studied summary table with data from the past publications and the present study * data presented as mean sd, results in ms patients were significantly lower than in controls, results in ms patients were comparable to controls; nd not defined (results in ms patients were not compared to controls), not studied in the present study, the relationship between 25(oh)d3 concentration and the degree of motor disability according to the edss was also analysed and no correlation was found . Contrary results were obtained by van der mei et al ., hussein et al . And smolders et al . . Patients with a higher serum concentration of 25(oh)d3 had a better motor ability . In the present study, an increase was observed in the mean concentration of parathormone with disease duration and the simultaneous decrease in the mean concentration of 25(oh)d3 . However, the study results of the soilu - hanninen et al . Were different . They showed lower serum concentrations of parathormone and ionised calcium in patients with rrms compared to healthy persons . In the present study, the concentrations of mineral metabolism indices (i.e. Phosphorus, alkaline phosphatase and bone alkaline phosphatase) were within the reference range, which is consistent with the results obtained in scandinavia and france [15, 18]. In the present study in patients with rrms diagnosed within 6 months and about 6 years prior to the study, higher concentrations of parathormone and ionised calcium were found and lower 25(oh)d3 concentrations were observed compared to patients with the shortest disease duration . A group of patients with rrms in whom an increased parathormone concentration was observed was in remission . This is contrary to the results of soilu - hanninen et al . And pierrot - deseilligny et al . Who examined the mineral metabolism in patients during an ms relapse due to the fact that ms occurs more frequently in females, in the present study the attention was paid to the concentration of the examined indices, depending on the sex of patients . According to kuchuk, the largest deficiency of 25(oh)d3 in females appears during the greatest fertility between the ages of 15 and 45 years . The peak of prevalence for ms occurs at the same time . Analysing the data from the present study, a significantly lower serum concentration of 25(oh)d3 moreover, in the group of patients with a longer disease duration a significantly lower 25(oh)d3 concentration in females was detected compared to male patients with the similar degree of motor disability . Evaluated 25(oh)d3 concentration depending on the sex of individuals inhabiting regions of different sun exposure . The authors are of the opinion that the obtained results may be determined by cultural and religious factors of the communities inhabiting arabic countries . In patients with rrms, serum concentrations of 25(oh)d3 and ionised calcium were significantly lower compared to healthy individuals and decreased with the duration of the disease, with the increase in relapses and in females compared to males . However, the concentration of parathormone increased significantly as rrsm progressed . Due to the geographical location, poland is one of the countries with a high risk of ms incidence . However, studies on calcium phosphate metabolism have not been conducted in poland as yet . The role of the deficiency of 25(oh)d3 in patients with ms immediately after the diagnosis and/or the increasing 25(oh)d3 deficiency in the course of disease progression requires further research as well as the determination of indices of mineral metabolism depending on the treatment used and in the relapse or remission . The results of the present study and the available literature show that it is appropriate to determine the indices of calcium phosphate metabolism, including 25(oh)d3 in patients immediately after diagnosing ms and in the course of disease progression . Depending on the results, the limitation of the present study is a small number of patients with rrms and healthy controls . The limitation of the present study is a small number of patients with rrms and healthy controls.
Retinopathy of prematurity (rop) is a vasoproliferative disease of the retina that affects preterm neonates and is thought to be mediated by alterations in insulin - like growth factor-1 (igf-1) and vascular endothelial growth factor (vegf). Rop is one of the major causes of avoidable childhood blindness in developed and developing countries . The increase in survival rates in extremely low birth weight (elbw) infants due to improvements in neonatal intensive care has resulted in an increased risk of developing rop . However, some studies report that improvements in neonatal intensive care have resulted in a decrease in the incidence of rop . Nonetheless, it is known that rop develops most frequently and most severely in elbw infants . Recent studies report many systemic risk factors (respiratory distress syndrome, sepsis, necrotizing enterocolitis, intraventricular hemorrhage, and blood transfusion for neonatal severe anemia) associated with rop [79]. The probable cause of the severity of rop in elbw infants could be associated with the risk factors stated above . The aim of the present study was to determine the incidence of severe rop requiring laser treatment and the overall incidence of rop, and to evaluate the risk factors for developing severe rop requiring laser treatment in elbw infants in turkey . This retrospective, case - control study included preterm infants that presented to the rop screening, treatment, and training center, department of ophthalmology, etlik zubeyde hanim maternity and women s health research hospital, turkey, between january 2010 and april 2013 . The study protocol was approved by the etlik zubeyde hanim maternity and women s health research hospital institutional review board . All infants with a gestational age of <32 week at birth were screened for rop . The first examination was at a postnatal age of 4 weeks, but in the most immature infants (gestational age <27 weeks), the first examination was postponed until a postnatal age of 31 weeks . All associated systemic findings; including blood culture - proven sepsis, respiratory distress syndrome (rds), necrotizing enterocolitis (nec), intraventricular hemorrhage (ivh), blood product transfusion, and patent ductus arteriosus (pda) were recorded . Pupils were dilated using 2 drops of cyclopentolate / tropicamide 0.5% and phenylephrine 2.5% at 10-min intervals . After pupils were dilated, ophthalmological examination was performed using a pediatric eye speculum and pediatric scleral depressor, following instillation of 0.5% proparacaine eye drops for topical anesthesia . Indirect ophthalmoscopy was performed using a binocular indirect ophthalmoscope with a 20 and/or 28 diopter lens . The rop status of each infant was classified according to the international classification of rop, including stage, zone, and extent of disease, and presence or absence of plus disease . Infants with rop were routinely re - examined every few days to 2 weeks, depending of the zone and severity of rop . Infants requiring laser photocoagulation treatment were identified based on early treatment for retinopathy of prematurity randomized trial criteria . Accordingly, patients with type 1 rop (severe rop), defined as zone 1 any stage rop with plus disease, zone 1 stage 3 rop without plus disease, and zone 2 stage 2 or 3 rop with plus disease, were referred for treatment . A wait - and - watch policy was used for type 2 rop defined as zone 1 stage 1 or 2 rop without plus disease, and zone 2 stage 3 rop without plus disease . Patients diagnosed with type 1 disease were immediately referred for laser photocoagulation (iridex oculight sl / slx 810 nm diode laser, mountain view, ca, usa) treatment the same day . The highest stage of rop during follow - up examination was recorded for each infant . The other variables recorded were birth weight (bw), gestational age (ga), sex, presence of rds, presence of blood culture - proven sepsis, presence of nec, presence of ivh, and presence of pda . These variables were recorded to compare screened infants that had rop and those that did not . The patients with rop were further divided into 2 subgroups: rop cases not requiring laser treatment and rop cases that received laser treatment . The variables were compared between the 3 groups (infants without rop, infants with rop that did not require laser treatment, and infants with rop that received laser treatment). Continuous variables are presented as mean sd; categorical variables are expressed as number and percentage . Descriptive statistics, such as frequencies of nec, pda, ivh, blood transfusion, rds, and sepsis, were analyzed . Mean gestational weight and gestational age at birth were compared between groups using kruskal - wallis analysis . The chi - square test was used to compare categorical data related to clinical outcome . Univariate analysis was conducted to assess other potential risk factors for stage 3 rop requiring laser treatment, such as sex, sepsis, blood transfusions, ivh, pda, and nec . To control for all of the variables and estimate the independent significant risk factors associated with stage 3 rop requiring laser treatment, the factors were entered into a logistic regression multivariate analysis using a stepwise model . The adjusted odds ratio (or) and 95% confidence interval (ci) for each possible risk factor were calculated . Continuous variables are presented as mean sd; categorical variables are expressed as number and percentage . Descriptive statistics, such as frequencies of nec, pda, ivh, blood transfusion, rds, and sepsis, were analyzed . Mean gestational weight and gestational age at birth were compared between groups using kruskal - wallis analysis . The chi - square test was used to compare categorical data related to clinical outcome . Univariate analysis was conducted to assess other potential risk factors for stage 3 rop requiring laser treatment, such as sex, sepsis, blood transfusions, ivh, pda, and nec . To control for all of the variables and estimate the independent significant risk factors associated with stage 3 rop requiring laser treatment, the factors were entered into a logistic regression multivariate analysis using a stepwise model . The adjusted odds ratio (or) and 95% confidence interval (ci) for each possible risk factor were calculated . Mean birth weight and mean gestational age were 858.31107.45 g (range: 5701000 g) and 27.081.99 weeks (range: 2333 weeks), respectively . In all, 129 of the infants were female (54.9%) and 106 were male (45.1%). Among the patients, 48 (20.4%) developed culture - proven sepsis, 147 (62.5%) received surfactant and/or required oxygen therapy due to rds, 12 (5.1%) developed ivh, 11 (4.7%) had nec, 54 (22.9%) developed pda, and 53 (22.5%) received blood transfusions . All baseline characteristics and associated systemic findings in the study population are summarized in table 1 . In overall, 62 (26.4%) mean birth weight and gestational age in the infants without rop were 915.5681.27 g (range: 6001000 g) and 28.341.91 weeks (range: 2533 weeks), respectively; the male - to - female ratio was 0.82 (28/34). Among the patients developing any stage of rop in total, 61 (25.9%) patients developed stage 1 rop and 26 (11.06%) developed stage 2 rop . Mean birth weight and gestational age in the rop patients that did not require laser treatment were 862.87101.24 g (range: 6001000 g) and 27.061.96 weeks (range: 2333), respectively, and the male - to - female ratio was 0.64 (34/53). There were 86 patients (36.6%) that received laser treatment due to severe rop or type 1 rop . Mean birth weight and gestational age in these patients were 816.33110.68 g (range: 5701000 g) and 26.281.65 weeks (range: 2332), respectively, and the male - to - female ratio was 1.04 (44/42). There were 21 patients with aggressive posterior rop, of which 3 had diode laser treatment and progressed to stage 4 rop . Other laser - treated eyes with signs of severe rop showed disease regression during the first week and the regression was almost complete at 1 month after the laser therapy . The differences between number of rop distributions, mean gestational weight, and mean gestational age at birth in the 3 groups were statistically significant (kruskall- wallis analysis p<0.05). The number and percentage of patients without rop, and those with rop not requiring and received laser, and their gender distribution and associated systemic findings are shown in table 2 . Table 3 summarizes the mean gestational age and mean gestational weight in the patients without rop, those with rop not requiring and requiring laser treatment, and the entire study population . According to univariate analysis, the only significant risk factor for the presence of any stage rop in elbw infants was gestational age at birth (p=0.046), but the main risk factors for rop requiring laser treatment were low gestational age at birth (p=0.008), low gestational weight at birth (p=0.011), culture - proven sepsis (p=0.017), and blood product transfusion (p=0.0001). The other associated systemic findings, including the presence of nec (p=0.38), presence of pda (p=0.33), and presence of rds (p=0.35) and any stage ivh (p=0.43), were not associated with severe rop . Univariate analysis showed that there was a significant relationship between rop requiring laser treatment, and low gestational age, low gestational weight, sepsis, and blood transfusions . These risk factors were entered into multivariate logistic regression analysis via the stepwise (likelihood ratio) method, in which these 4 variables (low gestational age, low gestational weight, sepsis, and blood transfusions) were identified as weak (according to low ors) but statistically significant (p<0.05) independent risk factors for severe rop according to the p values and correlation based on adjusted ors (table 4). A strong association was observed between blood transfusion and severity of rop (adjusted or: 2.165). Gestational age at birth (adjusted or: 1.410; 95% ci: 1.1751.694), gestational weight at birth (adjusted or: 1.115; 95% ci: 1.1121.118), culture - proven sepsis (adjusted or: 0.464; 95% ci: 0.2180.989) were weak (due to low ors) but statistically significant (p<0.05) factors predictive of severe rop (table 4). According to earlier studies, the number of extremely premature infants that survive has been increasing as neonatal care improves [1316]. It has also been reported that extremely premature infants have a higher risk of developing severe rop requiring treatment than do more mature infants [8,1719]. The early treatment for retinopathy of prematurity (etrop) study reported that the incidence of rop was 82.5% in infants with a birth weight <1000 g, and that treatment was required in 92.4% of infants that weighed <1000 g . According to the cryotherapy for retinopathy of prematurity (cryo - rop) study, 81.6% infants that weighed <1000 g at birth developed rop . Lorenz et al . Noted rop in 62.1% of infants with a birth weight <1000 g . A multicenter study by zin et al . Reported that 61.9% of infants with a birth weight <1000 g had severe rop and choo et al . Found that 58.6% of infants weighing <1000 g at birth developed rop a recent study from china reported 64% of infants with a birth weight <1000 g developed any stage rop . In the present study, 73.6% of infants had rop, which is similar to the rates reported by other turkish referral centers of 70.7% and 75.6%, but lower than that in extremely premature japanese infants (86.1%). The rate of type 1 rop requiring laser treatment among 235 elbw infants in the present study was 36.6%; only 1 study (by hiraoka et al .) Reported a higher percentage of elbw infants with severe rop requiring laser treatment (41%). The incidence of type 1 rop in elbw infants was reported as 36.4% by gharaibeh et al . And wani et al ., which is similar to the rate in the present study . An earlier turkish retrospective cohort study observed that 30.2% of elbw infants who had advanced rop required laser treatment . Reported that 48.9% of elbw infants in southern brazil developed threshold rop requiring laser treatment; however, a study conducted in china reported that the incidence of rop requiring laser treatment was 28.6%, in contrast to 28.7% in a study of elbw infants conducted in the usa . A canadian study reported that the overall incidence of stage 3 rop in elbw infants was 17.3% . The lowest incidence of rop requiring laser treatment in elbw infants was reported from brazil (12.7%). The variation in the reported incidence of severe rop in the literature is due to numerous factors such as low birth weight (bw), low gestational age (ga), sex, presence of respiratory distress syndrome (rds), presence of blood culture - proven sepsis, presence of necrotizing enterocolitis (nec), presence of intraventricular hemorrhage (ivh), and presence of patent ductus arteriosus (pda). Also, we think the high incidence of severe rop in the present study was primarily due to the fact it was conducted in a tertiary referral center that treats rop patients requiring laser treatment from all over turkey, and that most of the patients that admitted to our clinic were sick infants and at high - risk for developing severe rop . In the present study, low gestational age at birth was a significant risk factor for developing any stage of rop, according to univariate analysis . Mean gestational age at birth was 28.341.91 weeks in the infants without rop vs. 26.651.84 weeks in those with rop . When the patients in the present study were divided into 2 subgroups according to gestational age at birth (25 weeks vs. 26 weeks), 90% (45/50) of the elbw infants delivered at 25 weeks developed rop vs. 88% in a study by isaza et al . And 87% in a study by teed et al . These similar percentages are in agreement with the general knowledge that prematurity plays an important role in the pathogenesis of rop [34,3642]. In the present study, the severity of rop was inversely related to gestational age at birth (p=0.008) and gestational weight at birth (p=0.011), based on univariate and multivariate logistic regression analyses . Because gestational age at birth decreased, the duration of assisted ventilation and the likelihood of development of severe rop increased . Shah et al . Reported that extreme low birth weight (<1000 g) and extreme prematurity (<30 weeks) were the main risk factors for developing severe rop, and fortes et al . Reported that one of the main risk factors for severe rop in their retrospective elbw infant cohort was gestational age at birth; the present findings are in agreement with these earlier findings . Univariate analysis and multivariate logistic regression analysis showed that various systemic risk factors, such as the presence of culture - proven sepsis and blood transfusion, were strongly correlated with the development of severe rop in the present study . Previous reports on very low birth weight infants reported 1 of these risk factors, but the present study is the first to report the pathogenic role of these factors in elbw infants; clinicians must be aware of the importance of these risk factors in elbw infants and that they can result in severe rop . Reported that there was a strong association between the presence of rop (as well as severe rop) and sepsis . Weintraub et al . Noted that sepsis increases the risk of developing rop 12-fold; they hypothesized that sepsis might increase oxygen demand and interfere with oxygen tension, which might increase retinal ischemia, resulting in rop . In blood transfusion was the most important significant associated risk factor for developing severe rop in the present study . Earlier studies have reported that blood transfusion is a significant risk factor for the development of threshold disease . Weintraub et al . Reported that blood transfusion may be considered a clinical marker for the development of stage 3 rop; they reported that the incidence of stage 3 rop was 14-fold higher in their neonates that received blood transfusions, and posited that it might have been because the high oxygen concentration of the transfused blood may have had toxic effects on the immature peripheral retinal vessels . They also found that a reduction in blood transfusions led to a reduction the incidence of severe rop . In the present study, the severity of rop was inversely correlated with birth weight and gestational age at birth, and positively correlated with culture - proven sepsis and blood transfusion . Clinicians should be aware of the presence of these risk factors when treating premature infants . Early detection and prevention of sepsis and reducing the number of blood transfusions may decrease the incidence of severe rop requiring laser treatment . The identification of other risk factors that might be associated with the severity of rop warrants further investigation . Additional analysis of the risk factors for severe rop will improve our understanding and ability to predict the development of severe rop in extremely premature infants.
Strokes produce important physical, psychological and social consequences, in spite of advances in prevention and early care1 . Several studies highlight the importance of cognitive activities such as attention, memory and action observation on the nervous system plasticity2, 3 . The experiences and the information generated by these cognitive activities influence motor learning4, 5 . Hence, the importance of providing the patient with learning experiences and sensory stimuli enriched by the interaction with a therapist6 . After stroke, achieving patients functionality (e.g. Being able to turn a door handle) has become the focus of the therapeutic action . The emphasis of treatment has virtually always been focused on performing the task, regardless of how it was executed, whereas the qualitative aspects of the activity have not been considered to be important7, 8 . Taking into account the knowledge on motor learning which highlights not only the motor processes but also the sensory and cognitive strategies5, it is possible to direct the therapeutic performance to recovery instead of compensation . This implies focusing the intervention more on the quality of execution rather than on the final result, promoting an adequate activation of the existing patterns prior to the injury5, 9 . A therapeutic strategy that addresses these approaches is the cognitive therapeutic exercise based on the neurocognitive rehabilitation theory described by the neurologist carlo perfetti10, 11 . This theory connects the activation of cognitive processes with sensory - motor recovery by means of the patient learning new interaction patterns with their surroundings10, 11 . Although its effectiveness in orthopedic rehabilitation has been recently demonstrated12,13,14, there is a need for well - designed studies in neurological patients . A prior randomized clinical trial15 in acute stroke used a protocol with an unclear and non - specific methodology and it concluded without statistically significant evidence between the two groups . Recently, significant differences were found on upper limb functions from chronic stroke patients, regarding activities of daily living and quality of life16 . Our study has implemented a protocol based on the neurocognitive approach considering and acting on the individual s motor, sensory and cognitive characteristics . The aim was to determine its feasibility and evaluate whether subjects treated with this protocol improved qualitative upper extremity (ue) movement . We hypothesized that subjects who received the neurocognitive protocol would show greater improvements on motor, sensory and cognitive functional aspects when compared with those treated with a conventional protocol, and these positive changes would also demonstrate clinical and significant improvements on ue functionality with maintenance at follow - up . The inclusion criteria were: diagnosis of subacute ischemic stroke (from 15 days to 3 months, middle cerebral artery territory), age between 25 and 80, mini - mental test 24, motor deficits in ue caused by stroke (motricity index <99) and enough trunk control to be able to sit with dorsal support . Exclusion criteria were: global aphasia, somatoagnosia or neglect, modified ashworth scale> 2 and carrying out other types of therapies at the same time as the study with the exception of the occupational therapy treatment applied to all participants of the study . The study was approved by the hospital s clinical investigation ethics committee (register number: ac-11 - 094) and conducted according to the helsinki declaration . Following enrollment, participants were randomized consecutively for 10 months by a random number table into two groups: the control group (cg) which received conventional physical therapy and the experimental group (eg) with the neurocognitive protocol . The evaluator was a widely experienced and trained physical therapist in assessing and treating stroke patients . The percentage of adherence rate of 80 and 100% required for treatment and assessments (a), respectively, as well as the percentage of retention rate of 85% were established and controlled by both therapists . A panel of scales was applied at the beginning of the study (a1), at 5 weeks (a2), at the end of the treatment in the 10th week (a3) and at a follow - up 10 weeks later (a4). The primary outcome was the motor evaluation scale for upper extremity in stroke patients (mesupes) score to assess ue functionality . The result is obtained by adding together the points at each assessment (a1234). Each item is scored from 0 (inability to adapt muscle tone to the movement) to 5 (ability to correct and complete motion without help). Mesupes - hand consists of 9 wrist and finger items scored on a 3-pointed rating scale: no movement or incorrect=0; movement incomplete=1; movement complete=28, 17 . The minimal detectable change (mdc) for the total score with 95% confidence level was calculated and resulted in a score difference of 8 to be necessary for a genuine change of function additional outcomes included: the motricity index test, validated for the quantitative assessment of paretic ue muscle strength . In this study the arm score is the result of adding together the points for the 3 arm test + 1 at each assessment (a1234)18 . The revised nottingham sensory assessment is a standardized scale for evaluating sensory impairment in stroke patients19 . The kinesthesia subscale is applied bilaterally on the shoulder, elbow, wrist and metacarpal - phalangeal joint at each assessment (a1234). It is scored from 0 (absent sensation) to 3 (correct position). The light touch subscale displays the result of adding together every assessment score on the shoulder, elbow, wrist and palm . It is scored on a 3 point rating scale: absent sensation=0; impaired sensation=1; normal sensation=219 . The kinesthetic and visual imagery questionnaire assesses the cognitive aspect of imagining a movement in its two main dimensions, visual and kinesthetic20 . It shows the result of adding together the points of each upper extremity item at each assessment with the exception of a2 when no change was expected to be observed . Both dimensions evaluated shoulder elevation, forward shoulder flexion, elbow flexion / extension, thumb - fingers opposition on a score from 1 (no image or sensation) to 5 (image as clear as seeing or as intense as executing the action)20 . The values obtained with mesupes at a1 allowed the blinded evaluator to determine the level of motor involvement required by every participant (passive, active - assisted or active). The evaluator also recommended sensory and cognitive difficulties of the exercises, but those recommendations were only followed by the physical therapist in the eg treatment . In both groups the intervention consisted of passive, active - assisted and active mobilizations with freedom of directions . Proprioceptive joint information was provided on the shoulder, elbow, wrist and fingers segments in addition to tactile information, using different textured surfaces (rough, fine, etc . ), on palms and fingers21, 22 . Both groups performed a 30-minute treatment with 3 individual sessions / week for 10 weeks23, 24 . Fifteen minutes were dedicated to shoulder, elbow and wrist and 15 minutes to the affected hand . The participant was positioned in a supine position for the first part and in a sitting position for the second one8 . During ue mobilizations and the contact with different surfaces, eg participants received the proposal of sensory discrimination tasks organized in a hierarchy (from lower to higher difficulty)12, 13, 22, 25, 26 (table 1table 1.hierarchy of sensory tasks with cognitive activationsensory taskdifficulty level (low to high)cognitive activity requiredkinestheticjoint movement discriminationrecognition of change between presence and absence of movement: tell me when you feel the changerecognition of the presence or absence of the movement: tell me when you feel that the joint x movessimple parameter joint movement discriminationrecognition of the joint moved: which joint has been moved?recognition of the direction of movement of the joint x: in which direction is it moving?complex parameter joint movement discriminationrecognition of the distance of movement in the joint x: how far has it moved? ; in what position are you?recognition of the static position (spatial relations): where is your elbow in relation to your shoulder?copying spatial relations with the contralateral extremity: try to imitate exactly the same position with your other armtactilecontact discriminationrecognition of change between presence and absence of contact tell me when there is a changerecognition of the presence or absence of contact tell me if you feel there is an area in contact with your palm and fingerscontact location discriminationrecognition of the contact location: where do you feel the contact?tactile surface discriminationrecognition of similarities and/or differences: is this tactile surface the same or different from the one you felt before?recognition of touch (surface categorization) what does this tactile surface feel like? ; what surface do you think it is?). Resolution of these tasks involved cognitive activation of learning strategies such as observation, motor imagery, imitation, etc12, 13, 25,26,27 . Every task was proposed as a problem to be resolved with closed eyes13, 22, 25, 26 . The physical therapist began with the most suitable task for each participant and continued with the following one after the satisfactory completion of the first task5, 12, 13 . In addition, the physical therapist could constantly adapt the protocol to the individual s level based on daily observation but always under the protocol guidelines, designed by an experienced physical therapist and based on the neurocognitive theory12, 13 . No discrimination tasks were established in the cg although mobilizations and different surfaces were proposed28, 29 . Hence, cg participants received the same type of information (propioceptive and tactile) but they were not asked to resolve any problem nor to be aware of their body sensations . Individual characteristics and therapy adherence were expressed as mean standard deviation (sd). The therapy adherence rate (%) was also reported . Outcome measure data were reported as score differences between the post and pre - study (a4a1) for each participant, the a1 and a4 median (md) for each group as well as between each assessment (md of a2a1, a3a2 and a4a3). Nonparametric statistical tests were employed . The pearson test and mann - whitney u test the wilcoxon signed rank test allowed pre - post clinical evolution from the beginning to the end of the study to be determined in both groups and the mann - whitney u test was used to compare the changes between groups on a1 and a4 . A significance level of 0.05 has been used in all analyses but considered only in an exploratory sense . Seven subjects with involvement of the right middle cerebral artery and one of the left were finally considered for analysis . One subject withdrew after a2 because of personal reasons and was discarded (retention rate=89%). The average age was 53.4 9.6 years old, seven males and one woman, all of whom were right - handed . No statistically significant differences between groups were found relating to gender (p=1) and injured hemisphere (p=1) nor age (p=0.89) and time from stroke onset to treatment (p=0.89). All the participants attended at least 80% of the treatment sessions and all four assessments . This represents an adherence intervention rate of 95.8% in the 10-week treatment period and an assessment rate of 100% in the 20-week study period . Although not statistically significant, there were more relevant pre - post study improvements in the eg on mesupes arm and hand subscales . These changes appeared earlier and lasted throughout the study in the eg . Despite random assignment, significant differences between groups were found at a1 with lower hand values in the cg (p=0.03). In terms of the minimal detectable change (mdc), all the participants of the eg and 2 of the cg (participant 1 and 4) reached pre - post clinical changes . The secondary outcome measures showed neither statistically significant differences (p>0.05) between groups nor pre - post study changes for each group (table 2table 2.change of functionality, muscle strength, sensory discrimination and motor imagery abilityoutcome measurescg (n=4)eg (n=4)mesupes - armpre18 (12, 29.5)32.5 (29, 35.5)post22 (11, 34.5)38 (36, 40)45.5mesupes - handpre2 (0.5, 4.5)8.5 (8, 12.5)post6.5 (0, 15.5)17.5 (15, 18)4.59mipre39.5 (26.5, 54.5)67 (58.5, 73)post51 (32, 76)77 (77, 85)11.510rnsa - light touchpre8 (6, 8)4 (3.5, 5.5)post8 (6, 8)6.5 (5, 8)02.5rnsa - kinesthesiapre8.5 (8, 10.5)10 (8.5, 10.5)post11 (10, 12)12 (11, 12)2.52kviq - visualpre17 (14, 19.5)13.5 (10.5, 16.5)post19.5 (19, 20)20 (14.5, 20)2.56.5kviq - kinesthesiapre18 (17, 19.5)18 (15, 20)post19.5 (17.5, 20)18.5 (14, 20)1.50.5all data are expressed as medians with interquartile range: md (min, max)cg: control group; eg: experimental group; mesupes: motor evaluation scale for upper extremity in stroke patients; mi: motricity index test; rnsa: revised nottingham sensory assessment; kviq: kinesthetic and visual imagery questionnairetested by wilcoxon signed rank test . In particular, muscle strength improvements were found mainly in the first 5 weeks for both groups, the same as the kinesthetic results in the cg . The kinesthetic improvements in the eg were reached at the end of the treatment period as well as the maximum visual image results for both groups . All data are expressed as medians with interquartile range: md (min, max) cg: control group; eg: experimental group; mesupes: motor evaluation scale for upper extremity in stroke patients; mi: motricity index test; rnsa: revised nottingham sensory assessment; kviq: kinesthetic and visual imagery questionnaire tested by wilcoxon signed rank test . Significance level of 0.05 primary and secondary outcome results of each participant in both groups are shown in table 3table 3.primary and secondary outcome results of each participantoutcome measurescga1a2a3a4a4a1ega1a2a3a4a4a1mesupes - armp.1373838392p.5364040404p.214101086p.6353840405p.3101315144p.7283033368p.4222828308p.8303034366mesupes - handp.1613171812p.5816171810p.210001p.6161717182p.300000p.791114134p.436151310p.881117179mip.16477778521p.57393939320p.2342934295p.6737777774p.31924293516p.75673777721p.44567676722p.86173777716rnsa - light touchp.188880p.578881p.244640p.644484p.388880p.744451p.488880p.835652rnsa - kinesthesiap.1121212120p.510912100p.29109101p.6111012121p.381011124p.7101212122p.481111102p.87911125kviq - visualp.11920201p.5111292p.21519194p.610202010p.32020200p.71612204p.41320196p.81720203kviq - kinesthesiap.12020200p.51412113p.21720203p.62020173p.31920190p.71616204p.41720161p.82020200a: assessment; cg: control group; eg: experimental group; p: participant; mesupes: motor evaluation scale for upper extremity in stroke patients; mi: motricity index test; rnsa: revised nottingham sensory assessment; kviq: kinesthetic and visual imagery questionnaire . A: assessment; cg: control group; eg: experimental group; p: participant; mesupes: motor evaluation scale for upper extremity in stroke patients; mi: motricity index test; rnsa: revised nottingham sensory assessment; kviq: kinesthetic and visual imagery questionnaire this study aims to show the influence of motor, sensory and cognitive aspects on ue recovery in subacute stroke patients through the comparison between a neurocognitive protocol and a conventional treatment . The combined use of a panel of scales is also proposed as it allows the different components involved in motor control to be segregated and assessed . In particular, mesupes has allowed us to determine the individual s initial and successive states in terms of movement quality concerning functional tasks . The preliminary results of both groups suggest the use of mesupes to obtain stratified sampling in larger studies . Thus, by obtaining more accurate information, the adaptation of the protocol to the characteristics of each individual is facilitated . The high adherence of participants in treatment and assessments sessions could be explained by both these factors . Although the results were not statistically significant, due partially to the small sample studied, they are of important clinical relevance . Furthermore, it resulted in a considerable improvement in the functional autonomy of the ue . In particular, all the eg participants and 2 of the cg showed the score differences (mdc) needed to obtain a clinical change . The mesupes scale shows improvements in both groups indicating that neurocognitive and conventional treatments have been useful to ue functionality (table 2); but also demonstrating that the neurocognitive one (eg) promotes more benefits in all segments (shoulder, elbow, wrist and hand). This group presented superior pre - post changes on arm and hand subscales . In previous studies by lang et al.30,31,32, a higher recovery of the proximal segments is questioned and lack of differences between proximal and distal joints is reported . Our pilot study highlights a greater distal recovery, where the changes for the hands were higher, and occurred earlier in the eg, as a probable consequence of giving greater importance to their treatment . This is consistent with perfetti s concept of the hand10, 11, considered as an essential element for the interaction with the objects inside the action, in which the movements of the more proximal segments are involved and acquire their significance . To do so, it should be noted that the exercises proposed for the hands included kinesthetic and tactile information due to their importance concerning hand functionality25, 26 . The evolution of both groups supports the importance of starting treatment as soon as possible33,34,35 and maintaining it for at least 10 weeks . With exception of some studies on chronic stroke, there is little evidence on the effectiveness of rehabilitation beyond this period, because no further treatments are usually maintained 3 months after the stroke36 . In the present study, these months coincide with the period between a3 and a4, in which there was an overall stabilization of the evolution of ue functionality in the cg, while improvements in the eg were still observed . In addition, the improvements from a1 to a4 may indicate the importance of both motor learning strategies through the discrimination tasks5, 37 and also the need to extend the treatment beyond this period of time for a better recovery38 . In concordance with previous studies34, 35 that show the correlation between the individual s initial state and the prognosis, we have also found that subjects with mild or moderate severity have a better functional outcome reached in a shorter time compared to those with higher severity, despite the fact that these subjects are also expected to show an evident improvement at the end of the rehabilitation . Earlier and superior improvements in muscle strength were found in the eg . These gains obtained mainly in the first 5 weeks for both groups did not correlate with increased functionality throughout the 10 weeks of treatment . This is evidenced by the mesupes scale for all segments in the eg and for the hand in the cg . This would indicate that although muscle strength, assessed by the motricity index, is gained at the beginning in all segments, more time is needed to translate its gains into functionality improvement through training28 . Moreover, it would indicate that favorable progression in ue movement depends mainly on parameters such as accuracy, fluidity, coordination or correlation between joints7, 32, 39, 40 . All of these are qualitative aspects in which sensory discrimination has an important role25, 26 . There are still few studies about the effects of passive movement in brain areas during the processing of tactile and kinesthetic information; but van de winckel et al.25, 26 have already observed that, under both normal and stroke conditions, passive sensory discrimination causes the activation of parietal, pre - motor and motor areas in a similar way as active exploration . There are different studies about sensory treatment protocols on stroke patients for recovering sensory impairments21, 22 . On the other hand, our pilot study aims for movement recovery by sensory processing tasks . Despite the need for more homogeneous research into the impact of sensory impairments on motor and functional ue recovery41 the importance of maintaining the treatment during at least 10 weeks is also supported by sensory results . The light touch trend of improving after the treatment period could be an indicator of the learning factor which is highlighted in the neurocognitive protocol . In the eg, kinesthetic maximum values were obtained at the end of 10 weeks, unlike the cg where improvements were mainly in the first 5 weeks . Considering that kinesthesic median values at a1 in both groups were high, there was not a great deal of margin for improvement (table 2). These results lead us to highlight the role of tactile and kinesthetic discrimination in improving ue functionality . Finally, the cognitive element assessed has been the ability to imagine the ue movement . As in some studies20, 43, the values of healthy ue were higher in its two dimensions (visual and kinesthetic). These results suggest that motor and sensory deficits affect the capacity to imagine the body part involved, despite still being in the subacute phase (15 days to 3 months), but this capability changes within a short period of time (days or a few weeks). In the present study both groups evolved favorably and similarly over the 10 weeks of treatment, until almost reaching the maximum score of the visual image . We can hypothesize that, unlike the kinesthetic image, this component is altered in early stages (acute and subacute). Conversely, the constant arrival of pathological information as well as the probable difficulty in remembering the correct movement sensations would subsequently cause a kinesthetic image disorder . The recovery of motor memory needs a better and stable representation of the primary motor area achieved with guided therapeutic exercises44 . A potential limitation in the study is that other cognitive elements also activated in the discriminatory tasks, such as memory or attention, were not evaluated . Some studies45, 46 have demonstrated the facilitation of tactile processing in the primary sensory area through attention . Other limitations of this study include the lack of neuroimaging techniques to gather further data and a small sample size that resulted in unequal comparison groups with respect to mesupes outcomes despite random assignment . This study used a blinded evaluator to decrease the likelihood of biased assessment measures . In general, our results support the protocol feasibility and the use of a panel of scales in order to obtain more accurate evidence of the neurocognitive approach effectiveness by means of a larger study . Despite the fact that some clinical trials have been recently published about neurocognitive treatment using a similar approach, their results are not easily comparable to ours, because chanubol et al.15 and lee et al.16 performed protocols without establishing clearly either the selection criteria of exercises level or their progression . Sensory and cognition assessments were not applied and the other assessments were only performed before and after treatment . Despite the lack of statistical significance, this pilot study indicates that upper extremity movement deficits improve when exercises with motor, sensory and cognitive components are performed following a neurocognitive approach . A careful selection of the appropriate difficulty for each individual as well as the guidance of a therapist in the cognitive and sensory processes allow greater and prolonged improvements over time on the upper extremity, especially for the hand function . The neurocognitive approach is a safe, useful and easily applicable way to work with stroke patients in any rehabilitation center . Although further research is necessary, the feasibility of the proposed protocol facilitates the carrying out of a clinical trial to consolidate evidence of these findings.
Rats were subjected to a standard light - dark cycle and were maintained on a regular chow and had ad libitum access to distilled water . Indwelling catheters were placed in the right internal jugular vein and left carotid artery for infusion and sampling purposes . Rats were implanted with bilateral intrahypothalamic catheters placed within the mediobasal hypothalamus (mbh) as previously described (12,13). The coordinates used were 3.1 mm posterior from bregma, 0.4 mm lateral of midline, and 9.6 mm below skull surface . Recovery between surgical procedures was monitored by measuring daily food intake and body weight gain . To ensure comparable postabsorptive nutritional status, all study protocols were approved by the institutional animal care and use committee of university health network . An infusion of intrahypothalamic vehicle (0.9% wt / vol nacl) or 2 mmol / l glucose was maintained throughout the experiments . A primed - continuous infusion of [3-h]glucose (perkin elmer; 40 ci bolus; 0.4 ci / min thereafter) was initiated at 0 min and maintained through the study to assess glucose kinetics via the use of the tracer - dilution methodology . After a basal period of 90 min, a basal pancreatic insulin clamp was performed for the final 2 h (90210 min) of the study; a continuous coinfusion of insulin (0.8 mu / kg / min) along with somatostatin (3 g / kg / min) was administered, and a variable infusion of 25% glucose solution was administered as needed to clamp and maintain the plasma glucose concentration at levels similar to the basal state . Plasma samples were collected every 10 min for determination of [3-h]glucose specific activity as well as hormone levels . Mbh (1012 mg) tissues were harvested at the end of the clamp studies and frozen in liquid nitrogen . Mbh tissues were subsequently weighed and homogenized in buffer to a final volume of 15 l (2 mmol / l tris - hcl and 1 mmol / l edta, ph 7) as previously described (14). The homogenate (10 l) was pipetted into an analox glucose analyzer (analox, london, u.k . ), and glucose concentration in the homogenate was determined based on a glucose oxidase method . Readings in micromoles per liter obtained from the glucose analyzer were then converted to micromoles per gram of tissue based on the total volume of homogenate and the corresponding tissue weight (early - onset uncontrolled diabetic mode [with or without phlorizin]; whole - body and hypothalamic sustained hyperglycemic models; and construction of glial - specific adenoviruses, cell culture, and in vitro cell infection; see supplementary data). Rats received 6 l (3 l per side) of purified glial - specific adenovirus (glut1-expressing ad - gfap - glut1 or control ad - gfap - lacz) via the intrahypothalamic cannula at the time of the surgery . Tissue harvesting after 4 days revealed an overexpression of the adenovirus selectively in mbh glial cells (fig . A group of rats were administered intravenous streptozotocin (stz) (60 mg / kg) at the time of vascular catheterization 2 days after administration of intrahypothalamic ad - gfap - lacz or ad - gfap - glut1 . Rats received an additional dose of stz 20 h after the initial dose to ensure rapid development of uncontrolled diabetes . One day before the start of the 24-h infusion of 4 mmol / l glucose, ad - gfap - lacz or ad - gfap - glut1 was injected 3 l per side via the intrahypothalamic cannula . The 24-h intrahypothalamic infusion and the clamp studies were subsequently conducted as described in supplementary methods . Whole rat brains were fixed via transcardial perfusion with pbs and then 4% pfa, and brain sections containing the mbh were placed in oct - filled disposable base molds and frozen . With the use of a cryostat (leica cm1950), the slides were permeabilized for 10 min with 0.5% tween, followed by 1 pbs washes . Primary antibodies (overnight 4c) used were chicken anti- galactosidase (lacz) from abcam (1:100), mouse anti - gfap from sigma (1:200 for lacz + gfap costaining, 1:300 for glut1 + gfap costaining), rabbit anti - glut1 from alpha diagnostic (1:100), and mouse anti - neun from chemicon (1:400). Fluor 488 anti - mouse (1:500), alexa fluor 546 anti - rabbit (1:500), and alexa fluor 546 anti - chicken (1:1,000). Plasma glucose concentrations were measured via the glucose oxidase method, using an analox glucose analyzer (analox, london, u.k . ). Plasma glucose tracer ([3-h]glucose) specific activity was determined in deproteinized plasma samples with a scintillation counter (beckman coulter ls6500), and [3-h]glucose measurements were used to determine the rates of glucose kinetics using steady state formulas . Radioimmunoassays (ria) were used to determine the plasma concentrations of insulin and glucagon (kits ri-13 k and gl-32k; linco research, st . Statistical analysis was done by two - way anova to compare across the groups, followed by a tukey post hoc test to compare between groups . The presented basal values for glucose concentration and rates of glucose fluxes are averages for times 6090 min, whereas those for the clamp period are the averages for the final 30 min (180210 min) of the procedure . Rats were subjected to a standard light - dark cycle and were maintained on a regular chow and had ad libitum access to distilled water . Indwelling catheters were placed in the right internal jugular vein and left carotid artery for infusion and sampling purposes . Rats were implanted with bilateral intrahypothalamic catheters placed within the mediobasal hypothalamus (mbh) as previously described (12,13). The coordinates used were 3.1 mm posterior from bregma, 0.4 mm lateral of midline, and 9.6 mm below skull surface . Recovery between surgical procedures was monitored by measuring daily food intake and body weight gain . To ensure comparable postabsorptive nutritional status, all study protocols were approved by the institutional animal care and use committee of university health network . An infusion of intrahypothalamic vehicle (0.9% wt / vol nacl) or 2 mmol / l glucose was maintained throughout the experiments . A primed - continuous infusion of [3-h]glucose (perkin elmer; 40 ci bolus; 0.4 ci / min thereafter) was initiated at 0 min and maintained through the study to assess glucose kinetics via the use of the tracer - dilution methodology . After a basal period of 90 min, a basal pancreatic insulin clamp was performed for the final 2 h (90210 min) of the study; a continuous coinfusion of insulin (0.8 mu / kg / min) along with somatostatin (3 g / kg / min) was administered, and a variable infusion of 25% glucose solution was administered as needed to clamp and maintain the plasma glucose concentration at levels similar to the basal state . Plasma samples were collected every 10 min for determination of [3-h]glucose specific activity as well as hormone levels . Mbh (1012 mg) tissues were harvested at the end of the clamp studies and frozen in liquid nitrogen . Mbh tissues were subsequently weighed and homogenized in buffer to a final volume of 15 l (2 mmol / l tris - hcl and 1 mmol / l edta, ph 7) as previously described (14). The homogenate (10 l) was pipetted into an analox glucose analyzer (analox, london, u.k . ), and glucose concentration in the homogenate was determined based on a glucose oxidase method . Readings in micromoles per liter obtained from the glucose analyzer were then converted to micromoles per gram of tissue based on the total volume of homogenate and the corresponding tissue weight (early - onset uncontrolled diabetic mode [with or without phlorizin]; whole - body and hypothalamic sustained hyperglycemic models; and construction of glial - specific adenoviruses, cell culture, and in vitro cell infection; see supplementary data). Rats received 6 l (3 l per side) of purified glial - specific adenovirus (glut1-expressing ad - gfap - glut1 or control ad - gfap - lacz) via the intrahypothalamic cannula at the time of the surgery . Tissue harvesting after 4 days revealed an overexpression of the adenovirus selectively in mbh glial cells (fig . A group of rats were administered intravenous streptozotocin (stz) (60 mg / kg) at the time of vascular catheterization 2 days after administration of intrahypothalamic ad - gfap - lacz or ad - gfap - glut1 . Rats received an additional dose of stz 20 h after the initial dose to ensure rapid development of uncontrolled diabetes . One day before the start of the 24-h infusion of 4 mmol / l glucose, ad - gfap - lacz or ad - gfap - glut1 was injected 3 l per side via the intrahypothalamic cannula . The 24-h intrahypothalamic infusion and the clamp studies were subsequently conducted as described in supplementary methods . Whole rat brains were fixed via transcardial perfusion with pbs and then 4% pfa, and brain sections containing the mbh were placed in oct - filled disposable base molds and frozen . With the use of a cryostat (leica cm1950), the slides were permeabilized for 10 min with 0.5% tween, followed by 1 pbs washes . Primary antibodies (overnight 4c) used were chicken anti- galactosidase (lacz) from abcam (1:100), mouse anti - gfap from sigma (1:200 for lacz + gfap costaining, 1:300 for glut1 + gfap costaining), rabbit anti - glut1 from alpha diagnostic (1:100), and mouse anti - neun from chemicon (1:400). Secondary antibodies (1 h) used were alexa fluor 488 anti - mouse (1:500), alexa fluor 546 anti - rabbit (1:500), and alexa fluor 546 anti - chicken (1:1,000). Plasma glucose concentrations were measured via the glucose oxidase method, using an analox glucose analyzer (analox, london, u.k . ). Plasma glucose tracer ([3-h]glucose) specific activity was determined in deproteinized plasma samples with a scintillation counter (beckman coulter ls6500), and [3-h]glucose measurements were used to determine the rates of glucose kinetics using steady state formulas . Radioimmunoassays (ria) were used to determine the plasma concentrations of insulin and glucagon (kits ri-13 k and gl-32k; linco research, st . Statistical analysis was done by two - way anova to compare across the groups, followed by a tukey post hoc test to compare between groups . The presented basal values for glucose concentration and rates of glucose fluxes are averages for times 6090 min, whereas those for the clamp period are the averages for the final 30 min (180210 min) of the procedure . 1), basal glucose production was significantly (p <0.001) elevated in stz - induced diabetic rats receiving intrahypothalamic saline versus normal rats (fig . 1b and c). During the clamps, intrahypothalamic glucose (2 mmol / l) failed to lower glucose production (fig . 1d) in stz - induced diabetic rats as compared with intrahypothalamic glucose in normal rats, which was effective in lowering glucose production (fig . We infused intravenous phlorizin to normalize glucose in stz - injected rats for 24 h (fig . Importantly, the ability of intrahypothalamic glucose to elevate hypothalamic glucose concentration was restored in stz - induced diabetic rats that received phlorizin (fig . Mbh wedges were obtained from the stz - induced diabetic rats, and the protein levels of glial glut1 (45 kda) were significantly reduced compared with normal (fig . A nonsignificant trend toward reduction of the neuronal glut3 (fig . 1j; 27.6 7.3% reduction from control; p = 0.11) and the more heavily glycosylated bbb endothelial isoforms of glut1 (55 kda; fig . 1j; 18.5 10.8% reduction [doublet pooled in measurement] from control; p = 0.45) was observed . The significant reduction of hypothalamic glial glut1 in stz - induced diabetic rats was reversed when hyperglycemia per se is normalized in stz - induced rats that received intravenous phlorizin infusion (fig . Thus hyperglycemia disrupts cns glucose effectiveness in association with a reduction in hypothalamic glial glut1 . We infused intravenous glucose into normal rats and mimicked the hyperglycemic insult in uncontrolled diabetes (fig . The glucose infusion was stopped and the plasma glucose levels were normalized in 11.5 h. glucose intrahypothalamic failed to lower glucose production (fig . Another group of normal rats instead received intrahypothalamic glucose for 24 h to induce hypothalamic hyperglycemia . To select the glucose concentration to be used, we first performed dose - response clamps for intrahypothalamic glucose . Intrahypothalamic glucose (4 mm) for 210 min was unable to increase hypothalamic glucose concentration and lower glucose production as compared with 2 mmol / l intrahypothalamic glucose (fig . This inability of intrahypothalamic glucose (4 mmol / l) to increase hypothalamic glucose concentration was also seen in rats with either diabetes or whole - body hyperglycemia when intrahypothalamic glucose (2 consequently, we determined to infuse glucose intrahypothalamically at 4 mmol / l to induce hypothalamic hyperglycemia . Whole - body and hypothalamic sustained hyperglycemia impair cns glucose effectiveness to increase hypothalamic glucose concentration and lower glucose production . A: plasma glucose levels before clamp studies after the 24-h intravenous infusion period (whole - body glucotoxicity). Although the 24-h intrahypothalamic glucose (4 mmol / l)-infused rats did not display elevated plasma glucose levels, the intrahypothalamic glucose (4 mmol / l) infusion was still terminated 1.5 h before the start of the clamps to keep consistent with 24-h intravenous glucose infused rats . This 24-h hypothalamic glucose challenge negated the ability of intrahypothalamic glucose to lower glucose production (fig . Glut1 in the mbh glial cells regulates glucose uptake from the extracellular to the intracellular compartment . If glucotoxicity disrupts cns glucose sensing via a reduction in hypothalamic glial glut1 and consequently hypothalamic intracellular glucose concentration, then rescuing the reduction of hypothalamic glial glut1 in rats with sustained hyperglycemia could restore cns glucose effectiveness . We generated an adenovirus expressing lacz driven by a glial fibrillary acidic protein (gfap) promoter (ad - gfap - lacz). Transduction of ad - gfap - lacz in c6 glial cells, but not pc12 neuronal cells, revealed strong -galactosidase staining (supplementary fig . Direct injection of ad - gfap - lacz into the mbh expressed lacz in gfap - expression cells in the arcuate nucleus in vivo (supplementary fig . We then constructed an adenovirus expressing glut1 driven by gfap (ad - gfap - glut1). Transduction of ad - gfap - glut1 in c6 significantly increased glial isoforms of glut1 (fig . 3a), whereas ad - gfap - glut1 had no effects in pc12 (fig . Injection of ad - gfap - glut1 into the mbh increased glial glut1 (fig . 3b), which were colocalized with gfap (95.9 + 1.1% of glut1 [n = 5]), but not neun (fig . We developed a molecular approach to increase glut1 in the hypothalamic glial cells in vivo . Overexpressing glial glut1 in the hypothalamus of stz - induced rats acutely normalizes plasma glucose levels . A: c6 (glial) and pc12 (neuronal) cells were transduced with adenovirus expressing glut1 with a gfap promoter (ad - gfap - glut1). Significant glut1 overexpression was detected in c6 (* p <0.05) but not in pc12 cells relative to control cell (con). B: hypothalamic tissues were obtained from rats injected with adenovirus expressing lacz with a gfap promoter (ad - gfap - lacz) or ad - gfap - glut1 for 4 days . Glut1 expression showed a 3.5-fold increase in glut1 expression in rat brains injected with glut1 (n = 4) adenovirus vs. lacz (n = 4) adenoviral injection . C: rat hypothalamic frozen sections obtained 4 days after the injection of ad - gfap - glut1 . Sections were stained with anti - glut1, anti - gfap, and anti - neun antibodies . Coimmunostaining indicated that the glut1 signals colocalized with gfap, but not neun staining, in the arcuate nucleus (arc). D: plasma glucose levels in stz - injected rats harboring ad - gfap - lacz or ad - gfap - glut1 . * p <0.01 vs. mbh control ad - gfap - lacz injected rats . (a high - quality color representation of this figure is available in the online issue .) To evaluate whether overexpressing hypothalamic glial glut1 in stz - induced diabetic rats with reduced hypothalamic glial glut1 (fig . 1j) could rescue mbh glucose sensing, we injected mbh ad - gfap - glut1 or ad - gfap - lacz into stz - injected rats . Plasma glucose levels were elevated to 280 mg / dl in rats that received ad - gfap - lacz and a 21.5 h - prior stz injection (fig . Plasma glucose levels were normalized in rats with ad - gfap - glut1 who underwent the same stz injection protocol (fig . Next, we injected ad - gfap - glut1 or lacz into mbh of rats with hypothalamic hyperglycemia (fig . The ability of intrahypothalamic glucose to increase hypothalamic glucose concentration was restored in hypothalamic hyperglycemic rats when injected with hypothalamic ad - gfap - glut1 (fig . 4b), suggesting that overexpressing mbh glial glut1 resuscitates the elevation of hypothalamic glucose concentration in the intracellular compartment . This restoration of elevated hypothalamic glucose concentration rescued the ability of intrahypothalamic glucose (mbh glucose sensing) to lower glucose production in hypothalamic hyperglycemic rats (fig . Hypothalamic glucose concentration (0.34 0.07 mol / g) and glucose production during the clamps (9.2 0.6 mg kg min) were not altered in hypothalamic hypergylycemic rats injected with mbh ad - gfap - glut1 and that underwent intrahypothalamic saline clamp studies (n = 4). This suggests that changes in mbh glial glut1 mediate mbh glucose sensing (but not under saline - infused condition) to regulate hypothalamic glucose concentration and glucose production . Together, overexpressing hypothalamic glial glut1 in two independent hyperglycemic models restores cns glucose effectiveness . Overexpressing hypothalamic glial glut1 in the hypothalamic hyperglycemic rats rescues cns glucose sensing . A: experimental protocol . 1), basal glucose production was significantly (p <0.001) elevated in stz - induced diabetic rats receiving intrahypothalamic saline versus normal rats (fig . 1b and c). During the clamps, intrahypothalamic glucose (2 mmol / l) failed to lower glucose production (fig . 1d) in stz - induced diabetic rats as compared with intrahypothalamic glucose in normal rats, which was effective in lowering glucose production (fig . We infused intravenous phlorizin to normalize glucose in stz - injected rats for 24 h (fig . Importantly, the ability of intrahypothalamic glucose to elevate hypothalamic glucose concentration was restored in stz - induced diabetic rats that received phlorizin (fig . Mbh wedges were obtained from the stz - induced diabetic rats, and the protein levels of glial glut1 (45 kda) were significantly reduced compared with normal (fig . A nonsignificant trend toward reduction of the neuronal glut3 (fig . 1j; 27.6 7.3% reduction from control; p = 0.11) and the more heavily glycosylated bbb endothelial isoforms of glut1 (55 kda; fig . 1j; 18.5 10.8% reduction [doublet pooled in measurement] from control; p = 0.45) was observed . The significant reduction of hypothalamic glial glut1 in stz - induced diabetic rats was reversed when hyperglycemia per se is normalized in stz - induced rats that received intravenous phlorizin infusion (fig . Thus hyperglycemia disrupts cns glucose effectiveness in association with a reduction in hypothalamic glial glut1 . We infused intravenous glucose into normal rats and mimicked the hyperglycemic insult in uncontrolled diabetes (fig . The glucose infusion was stopped and the plasma glucose levels were normalized in 11.5 h. glucose intrahypothalamic failed to lower glucose production (fig . Another group of normal rats instead received intrahypothalamic glucose for 24 h to induce hypothalamic hyperglycemia . To select the glucose concentration to be used, we first performed dose - response clamps for intrahypothalamic glucose . Intrahypothalamic glucose (4 mm) for 210 min was unable to increase hypothalamic glucose concentration and lower glucose production as compared with 2 mmol / l intrahypothalamic glucose (fig . This inability of intrahypothalamic glucose (4 mmol / l) to increase hypothalamic glucose concentration was also seen in rats with either diabetes or whole - body hyperglycemia when intrahypothalamic glucose (2 mmol / l) was administered (fig . 1d and fig . 2c). Consequently, we determined to infuse glucose intrahypothalamically at 4 mmol / l to induce hypothalamic hyperglycemia . Whole - body and hypothalamic sustained hyperglycemia impair cns glucose effectiveness to increase hypothalamic glucose concentration and lower glucose production . A: plasma glucose levels before clamp studies after the 24-h intravenous infusion period (whole - body glucotoxicity). Although the 24-h intrahypothalamic glucose (4 mmol / l)-infused rats did not display elevated plasma glucose levels, the intrahypothalamic glucose (4 mmol / l) infusion was still terminated 1.5 h before the start of the clamps to keep consistent with 24-h intravenous glucose infused rats . This 24-h hypothalamic glucose challenge negated the ability of intrahypothalamic glucose to lower glucose production (fig . Glut1 in the mbh glial cells regulates glucose uptake from the extracellular to the intracellular compartment . If glucotoxicity disrupts cns glucose sensing via a reduction in hypothalamic glial glut1 and consequently hypothalamic intracellular glucose concentration, then rescuing the reduction of hypothalamic glial glut1 in rats with sustained hyperglycemia could restore cns glucose effectiveness . We generated an adenovirus expressing lacz driven by a glial fibrillary acidic protein (gfap) promoter (ad - gfap - lacz). Transduction of ad - gfap - lacz in c6 glial cells, but not pc12 neuronal cells, revealed strong -galactosidase staining (supplementary fig . Direct injection of ad - gfap - lacz into the mbh expressed lacz in gfap - expression cells in the arcuate nucleus in vivo (supplementary fig . We then constructed an adenovirus expressing glut1 driven by gfap (ad - gfap - glut1). Transduction of ad - gfap - glut1 in c6 significantly increased glial isoforms of glut1 (fig . 3a), whereas ad - gfap - glut1 had no effects in pc12 (fig . Injection of ad - gfap - glut1 into the mbh increased glial glut1 (fig . 3b), which were colocalized with gfap (95.9 + 1.1% of glut1 [n = 5]), but not neun (fig . We developed a molecular approach to increase glut1 in the hypothalamic glial cells in vivo . Overexpressing glial glut1 in the hypothalamus of stz - induced rats acutely normalizes plasma glucose levels . A: c6 (glial) and pc12 (neuronal) cells were transduced with adenovirus expressing glut1 with a gfap promoter (ad - gfap - glut1). Significant glut1 overexpression was detected in c6 (* p <0.05) but not in pc12 cells relative to control cell (con). B: hypothalamic tissues were obtained from rats injected with adenovirus expressing lacz with a gfap promoter (ad - gfap - lacz) or ad - gfap - glut1 for 4 days . Glut1 expression showed a 3.5-fold increase in glut1 expression in rat brains injected with glut1 (n = 4) adenovirus vs. lacz (n = 4) adenoviral injection . * c: rat hypothalamic frozen sections obtained 4 days after the injection of ad - gfap - glut1 . Sections were stained with anti - glut1, anti - gfap, and anti - neun antibodies . Coimmunostaining indicated that the glut1 signals colocalized with gfap, but not neun staining, in the arcuate nucleus (arc). D: plasma glucose levels in stz - injected rats harboring ad - gfap - lacz or ad - gfap - glut1 . * p <0.01 vs. mbh control ad - gfap - lacz injected rats . (a high - quality color representation of this figure is available in the online issue .) To evaluate whether overexpressing hypothalamic glial glut1 in stz - induced diabetic rats with reduced hypothalamic glial glut1 (fig . 1j) could rescue mbh glucose sensing, we injected mbh ad - gfap - glut1 or ad - gfap - lacz into stz - injected rats . Plasma glucose levels were elevated to 280 mg / dl in rats that received ad - gfap - lacz and a 21.5 h - prior stz injection (fig . Plasma glucose levels were normalized in rats with ad - gfap - glut1 who underwent the same stz injection protocol (fig . Next, we injected ad - gfap - glut1 or lacz into mbh of rats with hypothalamic hyperglycemia (fig . 4a and fig . The ability of intrahypothalamic glucose to increase hypothalamic glucose concentration was restored in hypothalamic hyperglycemic rats when injected with hypothalamic ad - gfap - glut1 (fig . 4b), suggesting that overexpressing mbh glial glut1 resuscitates the elevation of hypothalamic glucose concentration in the intracellular compartment . This restoration of elevated hypothalamic glucose concentration rescued the ability of intrahypothalamic glucose (mbh glucose sensing) to lower glucose production in hypothalamic hyperglycemic rats (fig . Hypothalamic glucose concentration (0.34 0.07 mol / g) and glucose production during the clamps (9.2 0.6 mg kg min) were not altered in hypothalamic hypergylycemic rats injected with mbh ad - gfap - glut1 and that underwent intrahypothalamic saline clamp studies (n = 4). This suggests that changes in mbh glial glut1 mediate mbh glucose sensing (but not under saline - infused condition) to regulate hypothalamic glucose concentration and glucose production . Together, overexpressing hypothalamic glial glut1 in two independent hyperglycemic models restores cns glucose effectiveness . The underlying mechanisms responsible for the deleterious effects of sustained hyperglycemia on glucose homeostasis remain unclear in both rodents and humans . The current set of data demonstrated sustained hyperglycemia as seen in uncontrolled diabetes impairs cns glucose effectiveness to increase hypothalamic glucose concentration and lower glucose production through changes in hypothalamic glial glut1 . Consistent with the working hypothesis that a reduction of hypothalamic glial glut1 is responsible for the metabolic impairments induced by hyperglycemia, hyperglycemia suppresses bbb glucose transport in stz - induced rodents (17,18), although glucose uptake into the glial cells was not determined . In addition, hyperglycemia in maternal diabetes suppresses glut1 and glucose transport in preimplantation embryos (19) and may lead to diabetic embryopathy (20). In parallel, alzheimer disease and neurodegeneration are caused by impaired glucose uptake and metabolism as well as hyperphosphorylation of in the brain (21,22). A reduction in brain glut1 is associated with these defects in a human brain with alzheimer disease (23). Together, the ability of glut1 to facilitate intracellular glucose uptake and regulate glucose metabolism plays an important role in certain disease progression, and changes in hypothalamic glial glut1, as suggested by the current study, alter peripheral glucose regulation in diabetes . A surprising aspect of our findings is that in all three hyperglycemic models, hypothalamic glucose concentration was not elevated after either mbh saline or 2 mmol / l glucose (glucose - sensing) clamps . These data indicate a potential mbh intracellular adaptive response to hyperglycemia . In light of the fact that mbh glial glut1 was reduced in uncontrolled diabetes (fig . 1j) and that hyperglycemia suppresses glut1 (supported by the current phlorizin study as well as the studies described above), it is reasonable to postulate that the lack of increase in mbh glucose concentration as observed in the hyperglycemic models represents a lack of elevation of intracellular mbh glucose concentration . In fact, when the hypothalamic hyperglycemic rats were injected with mbh ad - gfap - glut1, the ability of mbh glucose sensing to elevate mbh glucose concentration was restored . Future experiments aimed to clarify the ability of hyperglycemia to alter glut1 protein expression and glucose uptake in a glial cell culture model will strengthen this working hypothesis . Another important unanswered question in our study is how restoration of hypothalamic glucose elevation induced by cns glucose sensing lowers glucose production in hyperglycemic models . We put forward a working hypothesis that in diabetes overexpressing hypothalamic glial glut1 enhances glucose uptake into glial cells and elevates intracellular glucose and lactate concentration in response to cns glucose sensing . Lactate will be shuttled into neurons to trigger downstream biochemical / signaling pathways leading to the inhibition of glucose production . Consistent with this hypothesis, mbh lactate infusion lowers glucose production in uncontrolled diabetes (24). Since glucose sensing in pomc neurons regulates peripheral glucose homeostasis in rodents (25), it would be necessary also to evaluate whether the restoration of hypothalamic glucose elevation (or indirectly via lactate) triggers signaling events within mbh pomc neurons to lower glucose production in our current hyperglycemic models . In summary, our data highlight the critical role of hypothalamic glial glut1 in mediating hypothalamic glucose sensing to regulate glucose production in vivo.
Because double stranded (ds) dna cleavage is much harder to repair than single stranded (ss) dna cleavage, ds damage is particularly efficient in inducing self - programmed cell death or apoptosis . These compounds, often hailed as the most potent family of anticancer agents, produce cleavage of both strands of dna duplex via two hydrogen abstractions from two opposite strands of dna backbone by a reactive biradical, p - benzyne, generated from the enediyne core via a process, called the bergman cyclization [46]. However, natural enediynes not only lack selectivity towards cancer cells, but also do not cause the ds cleavage with 100% efficiency . Thus, design of compounds which are capable of more efficient ds dna cleavage and combine this efficiency with selectivity towards cancer cells remains the focal point of the anticancer therapeutic agents targeting dna . We have found that dna damaging potential of enediynes can be increased if their reactivity is tuned towards c1c5 photocyclizations, a new reaction discovered in our lab which leads to incorporation of four rather than two hydrogen atoms from the environment [8, 9]. Because c1c5 cyclization proceeds under photochemical conditions for thermal c1c5 cyclization, see [10, 11], it takes advantage of the high degree of spatial and temporal controls over reactivity inherent to the photochemical activation . The use of tissue - penetrating light allows for efficient, and selective, spatial and temporal control over prodrug activation as light can be delivered directly to the tumor when it contains a high concentration of the prodrug . Skin cancer is the most obvious target for this therapy and, in 2006, the uk national institute of health and clinical excellence (nice) recommended pdt for basal cell carcinoma . However, pdt can be also used to treat tumors on the lining of internal organs or cavities . Other tumors can be targeted with low - energy tissue penetrating photons, especially if the three - dimensional control of activation is provided by the two - photon excitation mode . For two photon excitation of enediynes, see [1214]. In addition, this radical - anionic c1c5 cyclization of enediynes is triggered by photoinduced electron transfer (pet). This mechanistic feature increases cellular selectivity because activation is possible only in the direct vicinity of a suitable electron donor such as dna to occur . In the absence of such a donor, tfp - substituted enediynes (scheme 1) we have also found that related tfp - substituted monoacetylenes are capable of photochemical alkylation of electron rich -systems [1517] and investigated whether this reaction can be also used for controlled dna - modification . A priori, efficient dna - cleavage by monoalkynes incapable of the bergman or c1c5 cyclizations can involve several possible mechanisms like base alkylation, hydrogen abstraction, generation of reactive oxygen species as well as pet . In order to increase solubility of tfp - warheads in water and their affinity to dna, we combined them with lysine via carboxyl moiety of the amino acid, figure 1 . Importantly, this mode of attachment leaves both amino groups of lysine available for an acid - base reaction which converts them into cationic ammonium groups . We found that dna - damaging ability of such hybrid molecules can be fine - tuned in the narrow range of physiological ph conditions which results in a dramatic increase in reactivity at the lower ph of hypoxic tumor cells . Less basic -amino group is protonated at the lower ph than 7 and this protonation not only prevents quenching the excited state of the chromophore but also provides tighter binding to negatively charged dna . Remarkably, the change in reactivity occurs at a relatively narrow and predefined ph point (~ph 6). These dna - photocleavers provide the dna cleavage ratios of up to the 1: 2 ds: ss at ph 5.5 at concentrations and irradiation times where almost no ds cleavage is observed at the ph of healthy cells . This dramatic increase of ds dna cleavage at the lower ph renders these molecules more efficient ds dna cleavers than calicheamicine under the conditions suitable for selective targeting of acidic cancer tissues (figure 2(a)). We also found that the c - lysine conjugates bind selectively to nicks and gaps in a dna duplex and, upon photochemical activation, transform the easily repairable ss - dna damage into much more therapeutically important ds - dna damage (figure 2(b)). The medicinal potential of these molecules has been illustrated by a> 90% lncap cancer cell death induced by photochemically activated tfp - acetylene - lysine conjugate 3 in one treatment at concentrations as low as 10 nm . Similar increases in reactivity upon activation with light were observed in parallel experiments with umrc3, umrc6, and 786-o cancer cell lines . In summary, our previous work led to the development of a family of powerful and tunable dna cleaving reagents which have been shown to cleave both plasmid dna and dna oligomers outside of cells [15, 18]. We have also proven that these reagents can induce cancer cells death at the low concentrations . However, our previous work offered no evidence for dna - damage by tfp - enediynes and acetylenes inside of cells . Such evidence is important because cell death can result from mechanisms other than dna cleavage and because dna - cleavage of intracellular dna should be more difficult since this dna is compactly organized around histone proteins . The aim of this work is to test the efficiency of our light - activated ds - dna - cleavers towards intracellular dna using single cell gel electrophoresis assay which can measure dna damage in individual eukaryote cells [2125]. This assay has been used as a standard technique for evaluation of dna damage / repair, biomonitoring, and genotoxicity testing [2633]. The cleaved dna fragments are able to migrate out of the cell under an electric field after lysis and alkali treatments while undamaged dna moves slower and remains with the confines of the nucleoid . Reagent kit for single cell gel electrophoresis assay kit, cometassay, and control cells containing different levels of dna damage, cometassay control cell, were purchased from trevigen, inc . The cc0 sample corresponds to cells with undamaged dna whereas cc1, cc2, and cc3 have different levels of dna - cleavage induced with etoposide . Olympus bx61 microscope attached with the dp71 color digital camera was used to take fluorescence images of scge assay . Tail moment, the ratio of tail length to head diameter (l / h), dna percentage in tail, and tail length were used to estimate dna damage . The tail moment has been regarded as an appropriate index of induced dna damage by computerized image analysis . It represents both the amount of damaged dna and the distance of migration by a single number . The tail moment was calculated by multiplying the percentage of dna in the tail by the tail length; see . Lncap cells (p.35) were plated in 6 (100 mm) plates at density of 250,000 cells / well and were maintained in rpmi 1640 medium supplemented with 10% fbs, sodium bicarbonate (2 g / l). When they reach 70% confluence, compound 3 was dissolved in serum - free rpmi 1640 medium supplemented with sodium bicarbonate (2 g / l). After the rpmi 1640, medium containing the compound 3 (0, 10, and 50 m) were added to the cells and the cells were placed in the incubator for 4 hours . The cells were exposed to uv with cover removed for maximum exposure for 10 minutes and were trypsinized and counted . Solutions in ice cold 1 pbs (ca and mg free), with 1 10 cells / ml, were prepared based on cometassay instruction from trevigen, inc . Lmagarose was melt in boiling water bath for 5 minutes and placed in 37c water bath for at least 20 minutes to cool . Cells at 1 10/ml were combined with molten lmagarose at a ratio of 1: 10 (v / v) and 50 l of the mixture was transferred on cometslides . The slides were placed at 4c in the dark for 30 minutes and they were immersed in prechilled lysis solution . After 30-minute immersion at 4c, the slides were immersed in alkaline solution prepared freshly with naoh (0.6 g), 200 mm edta (250 l), and dh2o (49.75 ml) for 20 minutes at room temperature, in the dark . Then, the slides were removed from alkaline solution and washed by immersing in 1 tbe buffer for 5 minutes twice . After adding 1 tbe buffer not to exceed 0.5 cm above slides in electrophoresis tank, the voltage at 1 volt per cm was applied for 10 minutes . The slides were immersed in dh2o twice for 10 minutes, then in 70% ethanol for 5 minutes . The samples were dried at 45c for 15 minutes and 100 l of diluted sybr green i was placed on the gels and the slides were stored at refrigerator . After 5 minutes, excess sybr solution was removed by gentle tapping and the slides were completely dried at room temperature in the dark . The control scge assay results for undamaged cells (cc0) and commercially obtained cells with variable amount of dna damage (cc13) are summarized in the top part of figure 3 (entries (a)(d)). As expected, while scge assay with healthy cells showed no tails indicative of dna damage, the assays with the damaged cells produced characteristic tails, the size of which correlates with the extent of dna damage in these cells . With the pretreated control cells (table 1, (b)(d)), 33, 47, and 98% of dna were detected in tails, respectively . Tail moment values are also consistent with different levels of dna damage . After confirming that assay conditions work in the control cells, we proceed to investigate dna damage induced by conjugate 3 in lncap cancer cells . To find whether uv itself or thermal reactions of compound 3 may be responsible for the dna cleavage in cancer, we included two control experiments with cells exposed to uv for 10 minutes in the absence of a dna - cleaver (figure 3(f)) and with cells treated with 50 m of compound 3 for 4 hours without photochemical activation (figure 3(g)). This result confirms that neither uv nor compound 3 in the dark can damage dna under these experimental conditions . In contrast, photochemical activation of 50 m of compound 3 produced very efficient dna damage (more than 90% dna in the tail, table 1) in individual cells (figure 3(h)). Irradiation in the presence of 10 m of compound 3 also showed significant dna damage (~40% dna in the tail, figure 3(i)). These results confirm that compound 3 can penetrate into the nucleus of the cancer cell and damage highly compacted dna photochemically . The concentrations of lysine conjugates used in our comet experiments are significantly higher than> 0.01 mm concentrations sufficient to cause significant photocytotoxicity to several cancer cells lines . This difference is not limited to the comet assay our earlier experiments with pure dna also required micromolar concentrations of the conjugate to observe the cleavage [18, 19]. First, it suggests (somewhat surprisingly) that the efficiency of cleavage for isolated plasmid dna and compacted cellular dna is not drastically different, thus indicating that our compounds should accumulate in the cell nucleus rather efficiently . Second, this observation may indicate the presence of an additional, even more efficient, mechanism for cytotoxicity which may not be based on dna cleavage . Alternatively, it may also mean that even small amount of dna cleavage (which is not detected by the conventional, relatively insensitive assays) is still sufficient for causing apoptosis . Although we cannot distinguish between these two mechanisms at this point, this mechanistic ambiguity renders important the observation that lysine - acetylene conjugate can indeed target and damage cellular dna . Interestingly, the fluorescence images of cells treated with compound 3 (figures 3(g) and 3(i)) showed blue fluorescence in the nucleus region on top of the green fluorescence from the dna - staining dye, sybr green i. because this blue fluorescence is not observed in control cells without the conjugate, the emission is likely to result either from compound 3 itself which has the maximum emission at 440 nm (figure 4) or from one of the respective photoproducts derived from the dna - photocleaver . This observation provides additional evidence that conjugate 3 can be uptaken into the nucleus of cancer cells . It is also interesting that there is no residual blue fluorescence in figure 3(h), where the dna is broken completely . Scge assays confirm the occurrence of efficient cleavage of highly compacted intracellular dna by a light - activated c - lysine acetylene conjugate . This result provides a key mechanistic link between efficient dna cleavage and significant cytotoxicity in cell proliferation assays.
The study was conducted at the drug deaddiction and treatment center (ddtc), department of psychiatry, postgraduate institute of medical education and research (pgimer), chandigarh - a multispecialty tertiary - care teaching hospital providing services to a major area of north india . Patients with any substance dependence were recruited from outpatient setting at their first contact at ddtc from 1 january, 2010 - 31 december, 2010 . A cross - sectional design was employed and written informed consent was obtained from the patients taken up for the study . Diagnoses were made by consultant psychiatrist as per international classification of diseases - classification of mental and behavioral disorders - clinical descriptions and diagnostic guidelines tenth revision (icd-10). All of our patients were males as because of lack of separate facilities in this center, we admitted female substance users in psychiatric inpatient unit under the same department . After enrolment into the study, a semistructured proforma was used to assess demographic and substance use details . Body weight was measured in kilogram (kg) and height in centimeters (cm) by a calibrated scale . Waist circumference, in centimeters (cm), was measured midway between the inferior costal margin and the superior border of the iliac crest, at the end of normal expiration in standing position . At least two readings at 5 min intervals were recorded for blood pressure (bp) using standard mercury manometer in supine position . If blood pressure was found to be high (140/90) then a third reading was taken after 30 min; the lowest of these readings was taken . Fasting venous blood sample was collected under aseptic condition to measure the blood glucose (fbs), triglycerides (tg), and high density lipoprotein (hdl) levels . Ms was diagnosed using international diabetes federation (idf) criteria . According to idf criteria a person is considered to have ms if he has high waist circumference (80 cm for females and 90 cm for males of asian origin) along with two of the following criteria: systolic blood pressure 130 mmhg and/or diastolic blood pressure 85 mmhg (or on treatment for hypertension), tg levels 150 mg / dl (or on specific treatment for this abnormality), hdl cholesterol <40 mg / dl for male and <50 mg / dl for females (or on specific treatment for this abnormality), fbs 100 mg / dl (or on treatment for diabetes mellitus). All patients and healthy controls with metabolic abnormalities were informed and educated about the need for proper diet and regular exercise, and referred for specialist care whenever required . Analysis was done using the statistical package for social sciences (spss) version 14.0 for windows (chicago, illinois, usa). Frequencies with percentages were calculated for categorical variables and mean and standard deviation (sd) were calculated for continuous variables . Chi - square test and t - test and one - way analysis of variance (anova) were used for comparisons . Body weight was measured in kilogram (kg) and height in centimeters (cm) by a calibrated scale . Waist circumference, in centimeters (cm), was measured midway between the inferior costal margin and the superior border of the iliac crest, at the end of normal expiration in standing position . At least two readings at 5 min intervals were recorded for blood pressure (bp) using standard mercury manometer in supine position . If blood pressure was found to be high (140/90) then a third reading was taken after 30 min; the lowest of these readings was taken . Fasting venous blood sample was collected under aseptic condition to measure the blood glucose (fbs), triglycerides (tg), and high density lipoprotein (hdl) levels . Ms was diagnosed using international diabetes federation (idf) criteria . According to idf criteria a person is considered to have ms if he has high waist circumference (80 cm for females and 90 cm for males of asian origin) along with two of the following criteria: systolic blood pressure 130 mmhg and/or diastolic blood pressure 85 mmhg (or on treatment for hypertension), tg levels 150 mg / dl (or on specific treatment for this abnormality), hdl cholesterol <40 mg / dl for male and <50 mg / dl for females (or on specific treatment for this abnormality), fbs 100 mg / dl (or on treatment for diabetes mellitus). All patients and healthy controls with metabolic abnormalities were informed and educated about the need for proper diet and regular exercise, and referred for specialist care whenever required . Analysis was done using the statistical package for social sciences (spss) version 14.0 for windows (chicago, illinois, usa). Frequencies with percentages were calculated for categorical variables and mean and standard deviation (sd) were calculated for continuous variables . Chi - square test and t - test and one - way analysis of variance (anova) were used for comparisons . A total of 250 subjects, all men, were included in the study . By the substance of dependence opioid (n = 52), alcohol + opioid (n = 49), and other substance, with or without alcohol or opioid (others) (n = 52). Among the groups; 68, 73.1, 87.8, and 80.8 subjects respectively were currently using tobacco in dependent or nondependent pattern . A typical study subject was aged 34.5 1.04 years, married (68.8%), working (66.8%), from urban area (60%), hindu (54.4%), educated up to matriculation (49.6%), and from nuclear family (47.2%). Compared to others, alcohol group was more often married, currently employed (p <0.001) and older (p <0.01), alcohol and others groups were more often hindu (p <0.001), and others group was more often from urban areas (p <0.05). Majority of the subjects were from urban background in all the groups except in the alcohol + opioid group, who were from rural background [table 1]. Ms criteria were met in 13.6% of the subjects and highest in alcohol group (21.6%) and the lowest in others group subjects (7.7%). Among the metabolic abnormalities, the commonest were increased tg (54%) and waist circumference (36.8%), and the least common were increased fbs level (6.4%) and low hdl (7.6%). Groups differed for hypertension by systolic or diastolic criteria (p <0.001), high systolic and diastolic blood pressures (p <0.01), duration of dependence and number of subjects with increased waist circumference (p <0.01), and the prevalence of ms (p <0.05). The groups were similar for the number of subjects with low hdl levels, high tg levels or high fbs . Nearly two - third of the subjects (62.8%) in entire sample was fulfilling one or two ms components [table 2]. Clinical profile of total sample and substance dependent groups comorbid psychiatric diagnosis present in 9.6% cases (n = 24), included depression (n = 6), and psychotic illness and bipolar affective disorder (bpad; n = 5 each). Comorbid physical diagnosis were present in 14% (n = 35), included seizure disorder (n = 12) and diabetes mellitus and alcoholic liver disease (n = 5 each), while 13 subjects have other physical diagnosis . Compared to those without ms, the subjects with ms were more often currently working (82.4 vs 55.1%; p <0.01), married (85.3 vs 66.2%; p <0.05), and older (38.2 vs 33.9 years; p <0.05); and had higher body weight (79 vs 72 kg; p <0.005), body mass index (27.7 vs 21.6; p <0.01), and obesity (bmi 25) (76.5 vs 18.5%; p <0.01). Simple binary logistic regression analysis with enter method was used to study the relationship among independent variables which were more frequently present in subjects with ms in entire sample and individual groups . As shown in table 3, significant predictors of ms were greater age, higher body weight, higher body mass index and obesity (body mass index 25) in entire group . Of all predictors, odds ratio was highest (or = 14.3) for obesity . In individual groups, significant ms predictors were body weight, bmi and obesity in alcohol group; bmi and obesity in opioid and others groups . A total of 250 subjects, all men, were included in the study . By the substance of dependence opioid (n = 52), alcohol + opioid (n = 49), and other substance, with or without alcohol or opioid (others) (n = 52). Among the groups; 68, 73.1, 87.8, and 80.8 subjects respectively were currently using tobacco in dependent or nondependent pattern . A typical study subject was aged 34.5 1.04 years, married (68.8%), working (66.8%), from urban area (60%), hindu (54.4%), educated up to matriculation (49.6%), and from nuclear family (47.2%). Compared to others, alcohol group was more often married, currently employed (p <0.001) and older (p <0.01), alcohol and others groups were more often hindu (p <0.001), and others group was more often from urban areas (p <0.05). Majority of the subjects were from urban background in all the groups except in the alcohol + opioid group, who were from rural background [table 1]. Ms criteria were met in 13.6% of the subjects and highest in alcohol group (21.6%) and the lowest in others group subjects (7.7%). Among the metabolic abnormalities, the commonest were increased tg (54%) and waist circumference (36.8%), and the least common were increased fbs level (6.4%) and low hdl (7.6%). Groups differed for hypertension by systolic or diastolic criteria (p <0.001), high systolic and diastolic blood pressures (p <0.01), duration of dependence and number of subjects with increased waist circumference (p <0.01), and the prevalence of ms (p <0.05). The groups were similar for the number of subjects with low hdl levels, high tg levels or high fbs . Nearly two - third of the subjects (62.8%) in entire sample was fulfilling one or two ms components [table 2]. Clinical profile of total sample and substance dependent groups comorbid psychiatric diagnosis present in 9.6% cases (n = 24), included depression (n = 6), and psychotic illness and bipolar affective disorder (bpad; n = 5 each). Comorbid physical diagnosis were present in 14% (n = 35), included seizure disorder (n = 12) and diabetes mellitus and alcoholic liver disease (n = 5 each), while 13 subjects have other physical diagnosis . Compared to those without ms, the subjects with ms were more often currently working (82.4 vs 55.1%; p <0.01), married (85.3 vs 66.2%; p <0.05), and older (38.2 vs 33.9 years; p <0.05); and had higher body weight (79 vs 72 kg; p <0.005), body mass index (27.7 vs 21.6; p <0.01), and obesity (bmi 25) (76.5 vs 18.5%; p <0.01). Simple binary logistic regression analysis with enter method was used to study the relationship among independent variables which were more frequently present in subjects with ms in entire sample and individual groups . As shown in table 3, significant predictors of ms were greater age, higher body weight, higher body mass index and obesity (body mass index 25) in entire group . Of all predictors, odds ratio was highest (or = 14.3) for obesity . In individual groups, significant ms predictors were body weight, bmi and obesity in alcohol group; bmi and obesity in opioid and others groups . Our typical study subject was a married, working, male in forth decade from urban area with 7.16 years of substance dependence . Study consisted of all male subjects as more than 99% of the subjects that present to us for treatment are males . The prevalence rate of ms at 13.6% in the present study was within the range of 5 - 31% reported for subjects taking alcohol by the western studies . In our study, the prevalence of ms was found to be highest in the alcohol dependent group and it was also in the range of ms reported earlier . Compared to the previous study from our center which was conducted in inpatient setting, our study is from outpatient setting with bigger sample size (250 vs 100); ms rate is similar in alcohol group (21.6 vs 24.6%), but lower in opioid group (9.6 vs 29.3%). Our finding is also consistent with the reported increase in tg and decrease in hdl with heroin use by a study from the west . The most common abnormality in the present study being increased tg (54%) was similar to previous studies . The significant difference among various groups for the number of subjects with increased waist circumference, hypertension, and prevalence of ms; signifies that the substance dependent population is a heterogeneous one and needs to be studied separately . The subjects with ms being older and more likely to be married and employed in the present study, was a finding similar to that from other studies from our center in subjects with substance dependence . Our subjects with ms was older and had more weight, higher bmi, and obesity; compared to subjects without ms and similar variables remained significant predictors of ms . These facts point to the need for physical examination and measurement of weight, waist circumference, and body mass index to be an essential part of the assessment of patients seeking deaddiction, especially for those aged> 30 years . Being a hospital based sample, it was not a true representation of the community . Besides presence of ms, a significant proportion of patients had one or two metabolic abnormality . This suggests that clinicians should not just focus on patients who have ms, but also look at this high risk population, which can convert to ms positive cases . Hence, any patient who fulfills a single criterion of ms should be considered at risk for development of ms and the preventive strategies should be in place . Older age, higher body weight, and higher body mass index are certain risk factors for development of ms . However, these findings need further validation with larger samples, prospective, and longitudinal designs.
Organizations increasingly use teams to do their work which was traditionally given to individuals (1). The reason why organizations seek teamwork is that teams can, in most cases, be more successful than individuals who work alone . More effective and better decisions can be made when people work together (2). Moreover, team works are often more efficient and more effective than individual work (3). In addition, using teams can result in increased safety (4), improved people s attitudes, and decreased number of absentees (5). There is enough evidence on the importance of people s participation in health care teams (6). Teams in health care organizations are made up of physicians, nurses and other health technicians who officially work to achieve organizational goals (7). The basic idea is that patient s health and safety is not only a function of complex treatments and advanced therapeutic technologies but also a function of a degree based on which health care professionals fulfill their duties effectively as a team (8). In addition to promoting mutual support and understanding among members of the health care teams, multidisciplinary teams have the potentials to improve relationships, increase efficiency and coordination and finally improve patient s health (9). Although there is not much documentation about the evaluation of individual s team skills in health care section (6), evaluating teams is an important tool in order to increase efficiency and productivity of teams (10). In this case, what is agreed upon is that its members must experience sufficient time and togetherness so as to rate the team s performance in terms of six scales: 1) teamwork 2) decision - making 3) leadership support 4) trust and respect 5) recognition and reward 6) focusing on customers (2). Different studies show the importance of teams and their effective roles in achieving the goals in health care organizations . Brewer and mendelson suggested that multidisciplinary teams were necessary but not enough to be effective . In addition, effective teams need both integrity and diversity (11). As well as, nancarrow et al highlighted ten basic effective features of multidisciplinary team working (12). In their research on developing and testing self - evaluation tools for cancer improvement multidisciplinary teams, taylor et al stated that self - evaluation of team performance could lead to the development of multidisciplinary teams (13). As there is scant evidence regarding the assessment of hospital teams in iran and due to researches on team performance in non - hospital sectors in other countries, we decided to conduct this research because knowing the attitudes of team members in an iranian context can have a significant effect on managing health care teams and the resultant would be better performance . Since health care teams present health care in the form of hospital committees in iran hospitals and concerning the effective roles of these teams at hospitals, the aim of this research was to determine the attitudes towards team working among hospital committee members in kerman hospitals . The study population consisted of 171 members of clinical teams in committees of 4 educational hospitals in kerman, iran . The 30 item testing team attitudes questionnaire (t - taq) was used to collect data that was jointly proposed in 2008, as team strategies & tools to enhance performance & patient safety (team stepps), by the american agency for healthcare research and quality and the american department of defense as the american national standard (14). This questionnaire has 5 domains in titled: team structure, leadership, situation monitoring, mutual support, communication, in which each domain includes 6 questions . Respondents were asked to rate the statements on a five - point scale ranging from 1 to 5 (1 strongly agree and 5 strongly disagree). The total score of all five domains determined the team work attitude of the hospital committees . External, formal and content validity and reliability of this questionnaire were determined and confirmed in a study by najafi et al in 2012 (15). The study population consisted of 220 medical personnel who were members of at least one hospital committee . All questionnaires were completed anonymously during the committee meetings and confidentiality of the data was maintained . To collect data, a written permission was obtained from hospital authorities and kerman university of medical sciences (kums). Data were analyzed using descriptive statistics, statistical tests, t - test, anova, and linear regression . Of 171 personnel who participated in this study, 111 participants (64%) were women and 144 (84%) participants were married . The average age of participants was 36 years (sd=7.9), and the average work experience was 10.5 years (sd = 7.7). 102 participants (60%) worked in the health care field and 69 participants worked (40%) in the administrative field . The total mean score of hospital committees regarding team attitude was 3.9 out of 5 (sd = 0.31). Of all sub - criteria of team attitude, leadership and mutual support had the highest and lowest scores respectively (4.9 and 3.7). The mean score of hospital committees in terms of team attitude in all five areas was as follows: leadership 4.19 (sd = 0.4); monitoring status 4 (sd = 0.5); team structure 3.8 (sd = 0.4); communication 3.8 (sd = 0.5); and mutual support 3.7 (sd = 0.5). Mean score of teamwork attitude questions the highest team attitude score was related to afzalipour hospital, while the lowest score was given to shahid beheshti hospital and shafa hospital (table 2). Teamwork attitude s mean score in kerman hospitals table 3 shows the relationship between team work attitude sub - scales and variables such as employment, work experience, age, gender, education, marital status, and responsibility . Regression analysis indicated that responsibility was the most important factor (= -0.184, p = 0.024). Among the sub - scales of team work attitude, employment, marital status, and responsibility marital status played a role in leadership; responsibility had a role in situation monitoring; and work experience had a role in domains of communication and mutual support . Positive attitudes towards behaviors related to effective teamwork and safety among nurses and surgeons were also reported by flin et al (16). Among the five teamwork attitude sub - scales, this shows that participants had a good attitude towards the role of leadership in health care teams . We can conclude that the team leader had the ability to coordinate activities appropriately, was sure that care programs were completely understood and care duties were fulfilled properly . Similarly, edmondson mentioned the proper role of cardiologists in leading health care teams . Facilitating communications among team members and developing the art of correct communication among team members, he improved their performance (17). In a study carried out by mercer et al, suitable communication i.e. Transmitting information between the members of a team or between them and the patients was reported (18). By the same token, kilner et al showed suitable communication in a team and positive attitude towards teamwork . In this study, good communication in hospital teams in emergency centers not only improved patients and employees satisfaction, but also reduced errors and improved patient s safety (19). In a study by christian et al on patient s safety in the operating rooms, lack of communication and sharing information were two main factors which risked the patient s safety (20); moreover, committee members had a moderate attitude towards communication . Campion et al reported that the aim of organizational support is to achieve goals (21). According to friedlander, organizational support is having clear objectives and a proper combination of experience, skills and sufficient resources (22). Monitoring members of a team and their knowledge of conditions of their team members and patients caused people to have more effective roles in their teams (23). According to a study by loughry et al, monitoring a team member by his teammates was considered as a benchmark for his effectiveness (24). In the present study, however, the participants had a moderate attitude in this regard . Participants attitude towards mutual support had the lowest score in the present study . However, mutual support reduced workload and increased patients safety (25). In a study by liebman and hyman, health care providers who needed more support were more willing to talk with patients about errors, to answer questions and to express their feelings (26). Poor attitude of members towards mutual support can be due to cultural aspects of personnel, lack of awareness, and inadequate training . We could also observe that gender and education level had no significant impact on the attitude of team members . This finding is not in line with a study conducted by thomas who showed that team attitude had a significant impact on physicians and nurses (27). The results of regression analysis revealed that people who had some responsibilities in health care teams (compared to those with no responsibility) had more positive attitude towards their teams . However, curran stated that work experience and age had an impact on the attitude of team members (9). The role of responsibility in increasing the team attitude in the present study might be due to in - service training courses held for officials in medical teams . Concerning attitude of members of hospital teams towards team structures, responsibility, marital status and area of employment (health / administrative) had a significant role . The positive impact of employment on the attitude towards the structure of hospital teams might be due to the attentions of administrative personnel working in teams to establish relationships with other organizations, paying attention to the organization, managing the hospital and their roles in guiding the teams . The role of work experience regarding team attitude towards communication and mutual support could be due to the work experience, having more relationships with others, and having no conflicts . One of the limitations of this study was the small study sample thus; similar studies with a larger sample size in non - governmental hospitals are recommended . Some of the benefits of this research included evaluating the attitude of hospital teams using a team tool to improve performance and patient s safety (team stepps). The efficiency of a health care team and its goals can be achieved if there is a presence of effective communication among health care staff and between members of a team and patients as well as strong team leadership and support within an organization . By training hospital personnel and paying particular attention to main elements of effectiveness in a health care team future studies can be conducted on determining the attitude of health care teams and the relationship between team attitude and productivity, job rotation and patient s safety in iran.
The receptor for advanced glycation end products (rage) is a cell surface receptor of immunoglobulin superfamily . Rage activation through ligand binding can induce chronic inflammation and oxidative stress, and it has been linked with diseases like diabetic complications, cardiovascular and neurodegenerative diseases, and cancer . A soluble form of rage (srage), which is a splice variant of full - length rage or a shedding / cleavage product of membrane - bound rage, has been found circulating in the plasma [2, 3]. The srage can bind and sequester rage ligands and thereby can reduce rage activation . Therefore, the srage is generally considered as protective against diseases originating from rage activation [13]. Rage - ligand interaction was previously claimed to be involved in the pathogenesis of autoimmune diabetes, and treatment with srage was shown to effectively prevent transfer of diabetes into nod / scid mice that receive spleen cells from a diabetic nod donor . Subsequently, blockade of high - mobility group box 1, a rage ligand, was shown to inhibit insulitis progression and diabetes development in nod mice . A minor role of genetic variation in rage was also suggested to be associated with insulin resistance (ir) in a human population . However, recent studies have suggested that low levels of circulating srage may be involved in the development of diabetes mellitus [79]. A declining level of srage at the time of seroconversion to autoantibody positivity has been suspected to be a predictor of type 1 diabetes [7, 8], and an independent association has been found between low levels of srage and development of type 2 diabetes mellitus (t2 dm). However, the relationship of srage with the underlying pathophysiological mechanisms of t2 dm has not been specifically explored . The ir and beta cell dysfunction are two core defects of t2 dm, and the prediabetes is a category of increased risk of developing t2 dm in subjects who have not yet fulfilled the criteria to be diabetic . To explore the involvement or participation of srage in the development of t2 dm, present study was designed to assess whether srage levels alter in prediabetes and correlate with ir and beta cell function in prediabetes and newly diagnosed t2 dm . A total of 158 participants were recruited from those who came for diabetes screening at the bangabandhu sheikh mujib medical university, dhaka, bangladesh, after giving written consent . This cross - sectional study was conducted according to the declaration of helsinki and was approved by the institutional ethical review committee . Participants were grouped as control (normoglycemic), prediabetes, and newly diagnosed t2 dm based on their blood glucose (fasting and 2 hrs after 75 grams glucose load) and hba1c levels . As recommended by american diabetic association (ada), diabetes was considered with a fasting glucose level 7.0 mmol / l and/or 2 hrs blood glucose 11.1 mmol / l and/or hba1c 6.5%; and prediabetes was considered with a fasting glucose level 5.66.9 mmol / l (impaired fasting glucose, ifg) and/or 2 hrs blood glucose 7.811.0 mmol / l (impaired glucose tolerance, igt) and/or hba1c 5.76.4% . Subjects with previous history of diabetes and those suffering from hypertension, chronic liver and kidney diseases, or any other acute / chronic inflammatory conditions as well as pregnant and lactating women and regular drug users were excluded . A detailed medical history was taken and clinical examination including height, weight, and blood pressure data were recorded for all subjects . A fasting blood sample was collected after an overnight fasting of> 8 hours and a second blood sample was collected 2 hours after 75 grams glucose load on the same day from all subjects . Fasting and 2 hours after glucose levels were measured by enzymatic spectrophotometric method using dimension rxl max clinical chemistry analyzer (siemens healthcare diagnostics inc ., hba1c levels were measured by ion - exchange high - performance liquid chromatography in a bio - rad d-10 instrument (bio - rad laboratories inc ., hercules, ca, usa). Fasting serum insulin levels were measured by microparticle enzyme immunoassay technique (abbott diagnostics, wiesbaden, germany) using an abbott axsym system with an interassay coefficient of variation (cv) <5% . Fasting serum srage levels were measured by elisa in triplicate, as suggested by the manufacturer (r&d systems, minneapolis, mn, usa) with an interassay cv of <7% . The ir and beta cell function were calculated as homeostasis model assessment of ir (homa - ir) [(glucose insulin)/22.5] and homeostasis model assessment of beta cell function (homa-%b) [(20 insulin)/(glucose 3.5)], respectively, where glucose was in mmol / l and insulin was in u / ml . Statistical analysis . Data are presented as mean sd . Variables with a skewed distribution are expressed as median (interquartile range) and were log transformed before statistical analysis . Comparison among multiple groups was done by one - way anova followed by bonferroni corrected t - test . Stepwise multivariate linear regression models were calculated to demonstrate independent relationships of srage and other variables with homa - ir and homa-%b . The homa - ir was used as dependent variable in one model and the homa-%b as dependent variable in another model with the following independent variables: age, sex, bmi, systolic and diastolic bp, glucose 2 hours, hba1c, srage, and homa - ir / homa-%b . A p value of 0.05 for f - values was taken as criterion for entering variables in the model and p 0.1 for f - values was taken as criterion for exclusion of variables from the model . Fasting glucose and insulin levels were not included in the models since they were directly used for calculation of homa - ir and homa-%b . A two - tailed value of p <0.05 was considered statistically significant . As shown in table 1, the age (40.2 8.7; 2058 years) and sex (m = 73, f = 85) distributions of the 158 study participants were found similar among control subjects (n = 40) and people with prediabetes (n = 52) and diabetes (n = 66). The bmi, systolic and diastolic bp, and fasting insulin levels were also found similar among the three groups . But the fasting and 2 hours blood glucose and hba1c levels were found significantly (p <0.001) elevated in people with diabetes compared to control subjects and people with prediabetes . Homa - ir was found significantly higher in people with diabetes than control subjects (p <0.001) and people with prediabetes (p = 0.005). As expected, homa-%b was found markedly decreased in people with diabetes (p <0.001) compared to control subjects and people with prediabetes . However, as shown in figure 1, serum srage levels in people with prediabetes (656, 463968; median, interquartile range in pg / ml) did not show any significant difference compared with that of control subjects (626, 413864) and people with diabetes (646, 493817). We next investigated the relationship of srage with markers of ir and beta cell function by using pearson's correlation test . The srage level did not show any significant correlation with homa - ir in all the study subjects (r = 0.007, p = 0.94), in people with diabetes (r = 0.07, p = 0.64) or prediabetes (r = 0.22, p = 0.17). Similarly, srage level did not show any significant correlation with homa-%b in all the study subjects (r = 0.02, p = 0.87), in people with diabetes (r = 0.04, p = 0.80) or prediabetes (r = 0.24, p = 0.12) (data not shown in the table). For further statistical analysis, we merged the people with prediabetes and newly diagnosed type 2 diabetes together (pd + dm group, n = 118) considering that both groups have similar underlying pathophysiological defects responsible for glucose intolerance and hyperglycemia . Characteristics of the participants of this pd + dm group as well as relationship of homa - ir and homa-%b with other variables were shown in table 2 . Of note, srage levels did not show any significant correlation with homa - ir and homa-%b even in the participants of this pd + dm group (table 2). But homa - ir showed marginal correlation with 2 hours glucose levels (r = 0.20, p = 0.05) and significant correlation with homa-%b (r = 0.27, p = 0.007), and homa-%b showed significant correlation with 2 hours glucose levels (r = 0.70, p <0.001) and hba1c (r = 0.72, p <0.001) (table 2). A stepwise multivariate linear regression model with homa - ir as dependent variable and age, sex, bmi, systolic and diastolic bp, 2 hours glucose level, hba1c, srage, and homa-%b as independent variables showed independent association of homa - ir with bmi (= 0.21, p = 0.03), 2 hours glucose levels (= 0.67, p <0.001), and homa-%b (= 0.74, p <0.001) in pd + dm group (r = 0.405) (table 2). Another model with homa-%b as dependent variable and age, sex, bmi, systolic and diastolic bp, 2 hours glucose level, hba1c, srage, and homa - ir as independent variables showed independent association of homa-%b with 2 hours glucose level (= 0.33, p = 0.028), hba1c (= 0.41, p = 0.005), and homa - ir (= 0.46, p <0.001) in pd + dm group (r = 0.629) (table 2). Furthermore, the above regression models when applied separately for the people with prediabetes (not shown in the table) showed significant association of homa - ir with bmi (= 0.33, p = 0.006) and homa-%b (= 0.62, p <0.001) (r = 0.530) and homa-%b only with homa - ir (= 0.67, p <0.001, r = 0.433). Such models when applied for the people with diabetes (not shown in the table) showed significant association of homa - ir with hba1c (= 0.43, p = 0.009) and homa-%b (= 0.92, p <0.001) (r = 0.536) and homa-%b with hba1c (= 0.52, p <0.001) and homa - ir (= 0.61, p <0.001) (r = 0.694). But none of the above models showed any significant association of srage with homa - ir and homa-%b in people with prediabetes and newly diagnosed t2 dm . The t2 dm develops insidiously with gradual impairment of glucose tolerance due to ir and beta cell dysfunction . Before development of overt diabetes mellitus people with prediabetes suffer from increased risk of developing t2 dm in near future compared with people with normal glucose tolerance . In the present study we investigated the srage levels in prediabetes and the relationship of srage with ir and beta cell function in people with prediabetes and newly diagnosed t2 dm . We found that srage levels do not alter in people with prediabetes compared with normoglycemic control subjects . Moreover, we did not observe any correlation or statistical association of srage with ir and beta cell function in people with prediabetes and newly diagnosed t2 dm . Higher, lower, and even similar levels of srage have been reported in people with t2 dm compared with control subjects without diabetes (reviewed in). The reason for this discrepancy among studies is not clear but the presence of confounding variables like the duration of diabetes, presence of hypertension and use of antihypertensive drugs, smoking habit, and chronic kidney and inflammatory diseases may contribute to this [11, 12]. It has been shown that longer duration of diabetes is associated with increased advanced glycation end products (age) generation and age - stimulated increased rage expression . The increased rage expression in turn may increase srage level by shedding of membrane - bound rage . If so, people with prediabetes and newly - diagnosed t2 dm may not show a significant alteration in srage level since they may not have experienced a heavy load of age yet . In fact, a large study recently found no difference in srage levels between children with newly diagnosed type 1 diabetes and control subjects and emphasized the importance of evaluating srage levels in children with prediabetes . But, to our knowledge, the srage status in people with prediabetes was unknown until recently . During the preparation of this paper, di pino et al . Published cardiovascular risk profile in prediabetes and type 2 diabetes, where they found similar levels of srage in control subjects and in people with prediabetes and new - onset t2 dm as we found in the present study . However, it should be noted that 68% of the people with prediabetes of the study by di pino et al . Were normal glucose tolerant (without having ifg or igt) since di pino et al . Grouped the study subjects only on the basis of hba1c . . Would be equally valid for people with prediabetes defined by standard ada criteria (ifg and/or igt and/or hba1c 5.76.4%). In the present study, we significantly added to the findings of di pino et al . By showing that srage levels do not alter in people with prediabetes, defined by standard ada criteria, compared with control subjects and people with newly diagnosed t2 dm . The ir and beta cell dysfunction are two core defects that are found in variable extent in people with t2 dm . However, the relationship of srage with ir and beta cell function was so far not clear . To our knowledge, basta et al . Previously found negative correlation between srage level and ir taken control subjects and people with diabetes together in the analysis . But this relationship disappeared when they analyzed the data in age - selected control subjects and people with diabetes separately . Furthermore, an independent negative association of srage with ir also disappeared when they performed multivariate regression analyses on control subjects and people with diabetes separately . In fact, the people with diabetes of the study by basta et al . Were significantly different from control subjects in respect to age, number of hypertensive subjects, and use of antihypertensive drugs, factors that are known to affect srage levels . Taken together, the negative relationship between srage and ir shown by basta et al . In the present study in a relatively homogenous set of study subjects we found that srage levels do not correlate and do not show any association with ir in people with prediabetes and newly diagnosed t2 dm . Furthermore we found for the first time that srage levels do not correlate and do not show any association with beta cell function in people with prediabetes and newly diagnosed t2 dm . The global prevalence of diabetes mellitus is rapidly rising and it is generally considered that sedentary but stressful life - style along with unhealthy food habits and other environmental factors may be responsible for this . It has been shown that dietary factors may contribute to excess accumulation of ages in the body, and ages have been suggested to promote beta cell dysfunction [17, 18] and dietary restriction of ages has been reported to reduce the incidence of diabetes in a mouse model of autoimmune diabetes . Moreover, ages can act through rage activation, and the exogenous srage and other inhibitors of rage ligand were shown to inhibit the development of diabetes in nod mice [4, 5]. Recently several studies have shown a decrease in circulating concentrations of srage at the time of seroconversion to autoantibody positivity in children with prediabetes before development of type 1 diabetes [7, 8]. These authors proposed that a declining level of srage with simultaneous decrease in srage / age ratio at seroconversion may represent a failing protection of beta cells against harmful ages since srage can bind excessive ages . At the same time, low circulating srage at baseline has recently been shown to be significantly and independently associated with future risk of t2 dm, coronary heart disease, and all - cause mortality during a median of 18 years of follow - up in a community - based population . However, this latter study was criticized as previous studies had shown higher, but not lower, levels of srage are independently associated with the risk of future cardiovascular disease and all - cause mortality [11, 2022]. Moreover, circulating srage levels were shown to be 1,000 times lower than needed to be efficiently capturing the circulating ages and therefore it is unlikely that the low levels of endogenous srage to counteract the detrimental effect of ages might be involved in the future risk of t2 dm or cardiovascular disease [11, 22]. Our present finding of no relationship of endogenous srage with ir and beta cell function also supports this explanation . It was previously uncertain whether srage levels alter in prediabetes and whether srage levels hold any relationship with the underlying core defects of diabetes during development of t2 dm, which in the present study we have tried to explore . However, we are fully aware of the limited sample size and the cross - sectional nature of our study . Future studies are therefore required to prospectively and serially measure srage levels in the same subjects who develop t2 dm from normoglycemia through prediabetes and to compare srage with the evolution of ir and beta cell dysfunction in those individuals . In summary, we concluded that srage levels do not change in prediabetes and do not show any relationship with ir and beta cell function in people with prediabetes and newly diagnosed t2 dm . These findings suggest that srage is unlikely to be an important predictor of insulin resistance and beta cell dysfunction during development of t2 dm . However, further studies are needed to explore the dynamics of srage during development of t2 dm.
Radicular low back pain is one of the most common medical problems that cause decreased work competence and a heavy cost . Accurate diagnosis of this radicular pain has a paramount important role in proper treatment planning . History taking and physical examination are the first steps in diagnosis of lower extremity radicular pain . In clinical examination of these patients, in addition to the radicular pain, reduced muscle strength, a sensory deficit, and decreased deep tendon reflexes are reported . The use of imaging techniques such as magnetic resonance imaging (mri) is indicated in the patients with atypical or refractory complains to confirm the clinical diagnosis or help to select the proper approach if surgery is necessary . Despite the accuracy of the history, physical examination and mri in the lower extremity radicular pain, in some cases for more accurate diagnosis, although mri has sufficient accuracy in the diagnosis of some nondiscogenic sciaticas such as spinal tumors, epidural varicosis, and infectious spinal stenosis, it is incapable of diagnosis in many far out (extraforaminal) spinal stenosis lesions . Electrodiagnostic tests can especially provide useful information about the exact location of the nerve damage . Among all the electrodiagnostic studies, electromyography (emg) technique has a very high accuracy and specificity in the diagnosis of nerve root pathologies such as denervation and dysfunction [68]. There is little research comparing the accuracy of mri with electrodiagnostic methods in the diagnosis of lower extremity radicular pain; therefore, the aim of this study was to do this in relation to history and clinical findings . At first, 165 patients with sciatica (accompanying lbp) participated in the study . These subjects have been referred to our orthopedic department from november 2008 to december 2011 . Our inclusion criteria were sciatica> 6 weeks, age> 15 years, and assignment of the informed consent, while we excluded those cases with a history of lumbar spine surgery, previous trauma, presence of associated disease (like parkinson's disease, tuberculous spondylitis or brucellosis), underlying malignancy or autoimmune disease, and those patients that medically have contraindications for mri or electrophysiologic studies . The remaining 152 patients, 96 patients (63.2%) were males and the rest (56 cases; 36.8%) females . The mean age of the patients was 43 5.8 (range from 22 to 73 years). After a complete explanation of the project was given to the patients, they signed the informed consents . Demographic individual profile was recorded in a checklist . The history obtained from patients was about the nature of pain, period of pain, patient's occupation, and other symptoms that all were recorded in the individual checklist . All the patients had lumbosacral x - ray and mri scanning that both were reported by an experienced radiologist . For electrodiagnostic study including both emg and ncv, tibial, peroneal, and femoral nerves were evaluated while for sensory study, sural, saphenus, superficial peroneal, lateral, and posterior cutaneous nerves of thigh were checked . When the nerve root irritation was founded in both mri and electrodiagnostic test, there was a concordance between mri and electrodiagnostic findings . After collection of data forms, positive findings between clinics and paraclinics were compared and analyzed by software package for statistical analysis (spss, version 11), chi - square, and independent t - tests . 67 cases (44.1%) had radicular pain in left lower limb, 46 (30.3%) in right, and 39 (25.6%) in both lower limbs . Clinical and paraclinical findings in our patients were shown in tables 1 and 2, respectively . Prevalence of abnormal findings in our paraclinical studies is as follows: 104 cases (68.4%) had shown some type of abnormalities in both mri and electrodiagnosis, 30 (19.7%) had shown this abnormality only in mri, 21 (13.8%) only in electrodiagnosis, while 10 cases (6.5%) had both normal mri and electrodiagnostic studies . When the history and physical examination are taken into account, clinical accuracy of our paraclinical studies in lower extremity radicular pain is as shown in table 3 . Coordination rate (concordant) between mri and the results obtained by the electrodiagnosis was 54%, while concordance of mri and electrodiagnosis with clinical findings was 58.6% and 89.5%, respectively . For example in a paracentral l5-s1 disc herniation, it is obvious that imaging finding would not correlate with its clinical examination or nerve conduction studies . Our study compared mri with electrodiagnosis and showed a high positive likelihood ratio for mri, and therefore this method is considered a better modality to confirm the disease, while negative likelihood ratio for electrodiagnosis was high, or this method is a better one to roll out the disease . Disc herniation in mri scanning of the asymptomatic patients is a very common finding and therefore decision for surgery based on only mri findings is not justified . As our study showed in the patients with lower extremity radicular pain the high concordance of electrodiagnosis with final clinical diagnosis (89.5% relative to 58.6% in mri scanning) indicated the high accuracy of this modality in these patients . In this study, we found that mri has a less accuracy and more false positive in patients with canal stenosis and the use of electrodiagnosis is very effective especially in cases with multilevel canal stenosis to determine the location of pain . As coster et al . Emphasized, electrodiagnosis cannot be replaced with mri scanning . In the nondiscogenic sciaticas, the main etiology of the disease (like epidural varicosis, facet joint synovial cyst, etc .) Cannot be found with this modality . There is not a gold standard method in the diagnosis of lower extremity radicular pain, and especially in deciding to select between surgical and nonsurgical planning, other methods in addition to history and physical examination are sometimes needed . Although, mri scanning is a very popular method used to confirm the clinical diagnosis of radicular limb pain, in some cases, it is not suffice to decide the proper treatment planning . In a study conducted by pfirrman et al . (2004), they showed that mri scanning has high accuracy in the diagnosis of discogenic radicular pain, but it is less accurate in the cases with nondiscogenic sciatica . Patel and lauerman in a separate study also found the same result . In our research, the highest accuracy rate was found in the patients with disc herniation and spinal stenosis . Our study showed that the accuracy of mri scanning in the diagnosis of radicular limb pain (except in discogenic sciatica) is limited and to achieve a definitive diagnosis and treatment planning, other diagnostic methods are sometimes needed . Grover in a review confirmed this result . In their study, when mri scanning failed to be helpful in diagnosis and treatment planning, other paraclinical diagnostic methods such as electrodiagnosis have been used successfully . Although electrodiagnostic studies are not used as a routine procedure in diagnosis of lower extremity radiculopathies, they may be useful as a diagnostic aid in certain cases . These studies are useful in determining the relatively exact location and extent of nerve root involvement and they may be especially helpful in selecting appropriate treatment planning in mri negative patients (cases with neuritis, diabetic neuropathy, and radiculopathy of an improved herniated disc). Clinically, neuropathic pain is sometimes too similar to the sciatic pain . To differentiate between the two, (2007) found that needle electromyography is useful in differentiating symptomatic from asymptomatic disc herniation . They noted that this modality has a lower false positive rate than mri in asymptomatic older patients that being evaluated for lower limb radicular pain . In conclusion, although electrodiagnosis is not used as a routine and standard procedure in the diagnosis of lower extremity radiculopathy, in many mri negative but symptomatic patients, this modality has an important diagnostic value.

Subsets and Splits

No community queries yet

The top public SQL queries from the community will appear here once available.