Split (1)

train · 133k rows

text stringlengths 0 868k
Pain control is a primary concern across all care settings . Though a universal care concern, pain is frequently viewed in the elderly as a normal process of aging.1 it is estimated that 49%83% of the 1.8 million residents in long - term care have acute or chronic pain, yet the recognition and treatment of pain still presents a challenge.26 recognizing a spectrum of pain behaviors beyond the traditional self - reporting methods, and increasing this knowledge among clinicians and support staff, is still a significant challenge in the provision of care to the elderly . Predominantly, pain and cognitive decline often coexist in the elderly, with approximately 47% of residents in nursing homes having a diagnosis of dementia.2 pain assessment and treatment is complex, because residents have varying degrees of cognitive function, complicating how their needs are communicated . When these symptoms do coexist, little is known about the interaction of pain and cognitive decline, beyond laboratory imaging of the brain from a pathophysiological perspective.7,8 empirical studies both support and refute poor neurocognitive performance in conjunction with increased pain intensity.913 evaluating longitudinal data to assess if a relationship exists between pain and cognitive decline may assist in addressing these ambiguous findings . The aim of this research was to examine if concomitance exists between cognition and pain in the elderly residing in long - term care . In a sample of nursing home residents, is cognitive decline a predictor of increased pain theoretical modeling using clinical data is a method used to evaluate resident characteristics and symptoms for inter - relationships between variables . Modeling whether chronic pain leads to worsening or declining cognition, thereby contributing to worsened pain, would test the theoretical constructs of this relationship . The significance and correlation of these variables creates a foundation for building additional models, with secondary needs and resident outcomes . Information of the relationship between pain and cognition adds to an understanding of how resident outcomes occur, and how quality initiatives can be approached . Evaluating cognition in conjunction with pain helps clarify if treating either symptom lessens the severity of the other, or if the symptoms are independent . Organic brain disorders cause a progressive process of cognitive decline.14 if it is not possible for patients to regain a normal level of cognitive function, then the process is degenerative understanding the relationship between cognition and pain establishes how these two variables could be included in a theoretical framework . This enables resident outcomes to be more accurately measured through symptoms and treatments, determining the most effective and cost - conscious actions . If pain and cognition were parallel to and not antecedent of each other, a symptom model would be inaccurate, making it difficult to determine where and what symptoms could be treated . Neglecting to include variables as a predictor of the other yields an incomplete clinical picture and theoretical model, making it difficult to find and measure care solutions because the root causes were not fully described . Understanding the clinical pathways and interrelationships of resident symptoms is essential to the strategic planning and prioritizing of resident care needs . Resource allocation in a struggling medicare - funded system is a difficult process to navigate . A new national institutes of health (nih) nursing home rating system incorporates pain as a quality measure, previously neglected in long - term resident care assessments.15,16 staff assessments, resident nonverbal cues, verbal complaints, facial expressions, and protective body movements were added as additional assessment items to more fully convey pain in this population . The use of federally - mandated resident assessment surveys is a cost - effective, time - efficient tool to gain insight into resident care needs, and an opportunity to increase our understanding of resident symptom pathways and the effectiveness of interventions used . Using existing clinical data to test theoretical constructs adds valuable information to the validity of the models posited against real world, resident care data . Pain is an intricate sensory experience involving physiological, pathological, social, cognitive, and emotional factors.17,18 sensory process is modulated by cognitive load.1922 cognitive load helps to describe how hard it is for the individual to make sense of a stimulus . Cognitive decline is progressive and may manifest as symptoms of aphasia (language), apraxia (perform directed acts), agnosia (recognize objects), and/or disturbances in global functioning (planning, organizing, sequencing, and abstract thoughts). Considerable issues exist in the detection of pain in residents with moderate - to - severe cognitive impairment . A lower incidence of pain is reported as cognition declines, largely due to measurement and communication issues.23,24 the detection of pain behavioral cues by both formal and informal caregivers have marked differences depending on the resident s cognitive status, especially with the interpretation of body movements.25 a case report presented by ashpole and katz17 described a patient with a lifelong history of pain (somatoform pain disorder). After the onset of dementia, the patient s self - reports of pain sharply declined . The pain symptoms were posited to be presenting as an altered mood (eg, depression or irritability) and cognitive decline . Chronic pain is attributed to increased risk of depression in the elderly.2629 depressive symptoms are linked to decreased processing and motor function, but are not directly attributable to memory impairment.30 chronic pain results in changes to the resident s personality, social interactions, lifestyle, and functional status, impacting their quality of life.27 unresolved pain may result in a decline of the resident s quality of life causing delirium, depression, weight loss, social isolation, decreased activities of daily living, impaired gait, increased incidence of falls and comorbidities . Quality of life declines with chronic untreated pain, especially as the intensity of pain increases.27 to date, the relationship between cognition and pain has been evaluated in case reports and pathophysiological studies, but not as a large - scale analysis of concomitance . The concept of need - driven behaviors31 and the framework extending this model to include the consequences of need - driven, dementia - compromised behaviors32 serves as the theoretical platform for this research study . The need - driven behavior, ie, pain, is a coexisting symptom to cognitive state, a background factor . Proximal issues, eg, a decline in physical state and social and environmental causes, precipitate improvement or exacerbation of the original need: resolving the resident s pain . The long - term consequence of unresolved, need - driven behaviors gives rise to additional behavioral symptoms and secondary unmet needs . Future theoretical constructs, including the complete model, would further evaluate the relationship of secondary needs (ie, depression, weight loss, social isolation, higher risk of falls, decreased activities of daily living, impaired gait), and how appropriate interventions mitigate the occurrence of secondary needs . Appropriate interventions to primary needs could improve resident quality of life, use healthcare resources more efficaciously, and reduce staff burden . This theoretical framework enables the clinician to translate a complex system encompassing such factors as resident, caregiver, environment, and outcomes, into a measurable tool to improve care . Data were collected from 20012003 (inclusive) on residents residing in medicare- receiving nursing homes across the united states . Minimum data set (mds) 2.033 annual assessments were used as the data source, including all residents aged 65 years . Comatose residents were excluded from the sample, because key item sections (sections b f) could not be scored . Noncompletion of the cognitive, communications / hearing, mood and behavior, and psychosocial well - being sections of mds adheres to the instructions given to assessors completing the resident assessment forms . The university of central florida institutional review board (irb) assigned an exempt status to the study . Data collection was retrospective and no interventions were tested . The mds is a nationally required assessment providing information on the quality of care provided in nursing homes.16 core items from the mds instrument are used for care planning to trigger events or symptoms requiring intervention (eg, pressure ulcers, delirium, cognitive loss, falls, and mood state). Pain is not a care - planning trigger from the resident assessment protocol (rap) however, it is a quality measure.33 mds items have demonstrated good - to - excellent validity and reliability3436 with interrater and test retest reliability from 0.400.80, depending on the item section.34 a composite score was used to detect pain from core mds items (pain items analyzed are detailed in table 1). The significance (p = 0.01) and validity of the measures used in the pain index have been established in a previous pilot study.24 pain scores could range from 034 . The pain index includes fries pain scale37 (ps) items (eg, j2a for pain frequency and item j2b, pain intensity). The ps items highly correlated with a pain sites summary score.24 additional dimensions of affective and behavioral items are also included to aid in detecting pain across cognitive states (figure 2). The cognitive performance scale (cps) was used to determine resident cognitive state . The cps instrument uses key mds items from sections b, c, and g of the resident assessment form.38,39 the cps measure correlates highly (r 0.70) with the folstein mini - mental status examination (mmse).40 the mds - derived cps scores were converted to mmse average totals . The averaged scores could range from 0.04 (severe impairment) to 24.9, an intact cognitive state . A cps score of 6 converts to an average mmse of 0.4, a 3 to 15.4, and 0 to an mmse of 24.9.38 in validation testing of the cps scores against the mmse, a sensitivity of 0.94 and specificity of 0.94 were shown,40 indicating that the utility of this instrument is viable in determining resident cognitive status from mds - derived scores . Descriptive statistics, correlations and repeated measures analyses of variance (anovas) were completed using spss software (v 14.0; spss inc, chicago, il). The spss statistical modeling program, amos (v 6.0; spss inc), was used to build the covariance model of pain and cognitive state at three different time intervals for 2001, 2002, and 2003 . Pain and cognition scores were hypothesized to be inversely related . Increasing pain score items indicated higher levels of pain . The covariance model was evaluated for integrity - of - fit statistics; however, the model is simplistic, with only six discrete measures and five residual terms, so fit statistics would indicate a recently identified model . Due to the required large sample size to run structural equation modeling, assessment of statistical power is complex.41,42 sample size requirements generally are the number of free parameters (n = 17) times five to ten, to estimate sample size . Data were collected from 20012003 (inclusive) on residents residing in medicare- receiving nursing homes across the united states . Minimum data set (mds) 2.033 annual assessments were used as the data source, including all residents aged 65 years . Comatose residents were excluded from the sample, because key item sections (sections b f) could not be scored . Noncompletion of the cognitive, communications / hearing, mood and behavior, and psychosocial well - being sections of mds adheres to the instructions given to assessors completing the resident assessment forms . The university of central florida institutional review board (irb) assigned an exempt status to the study . The mds is a nationally required assessment providing information on the quality of care provided in nursing homes.16 core items from the mds instrument are used for care planning to trigger events or symptoms requiring intervention (eg, pressure ulcers, delirium, cognitive loss, falls, and mood state). Pain is not a care - planning trigger from the resident assessment protocol (rap) however, it is a quality measure.33 mds items have demonstrated good - to - excellent validity and reliability3436 with interrater and test retest reliability from 0.400.80, depending on the item section.34 a composite score was used to detect pain from core mds items (pain items analyzed are detailed in table 1). The significance (p = 0.01) and validity of the measures used in the pain index the pain index includes fries pain scale37 (ps) items (eg, j2a for pain frequency and item j2b, pain intensity). The ps items highly correlated with a pain sites summary score.24 additional dimensions of affective and behavioral items are also included to aid in detecting pain across cognitive states (figure 2). . The cps instrument uses key mds items from sections b, c, and g of the resident assessment form.38,39 the cps measure correlates highly (r 0.70) with the folstein mini - mental status examination (mmse).40 the mds - derived cps scores were converted to mmse average totals . The averaged scores could range from 0.04 (severe impairment) to 24.9, an intact cognitive state . A cps score of 6 converts to an average mmse of 0.4, a 3 to 15.4, and 0 to an mmse of 24.9.38 in validation testing of the cps scores against the mmse, a sensitivity of 0.94 and specificity of 0.94 were shown,40 indicating that the utility of this instrument is viable in determining resident cognitive status from mds - derived scores . Descriptive statistics, correlations and repeated measures analyses of variance (anovas) were completed using spss software (v 14.0; spss inc, chicago, il). The spss statistical modeling program, amos (v 6.0; spss inc), was used to build the covariance model of pain and cognitive state at three different time intervals for 2001, 2002, and 2003 . Pain and cognition scores were hypothesized to be inversely related . Increasing pain score items indicated higher levels of pain . The covariance model was evaluated for integrity - of - fit statistics; however, the model is simplistic, with only six discrete measures and five residual terms, so fit statistics would indicate a recently identified model . Due to the required large sample size to run structural equation modeling, assessment of statistical power is complex.41,42 sample size requirements generally are the number of free parameters (n = 17) times five to ten, to estimate sample size . Select mds items were collected on 56,494 subjects with a mean age of 83 years . In total, the most prevalent diagnosis was arthritis (33.7%) with 14.2% of the sample complaining of joint pain at the first data collection (table 3). Over the 3-year period, the diagnoses of arthritis increased by 8%, and recorded joint pain dropped to 11.3% . Cognition declined slightly over the 3-year period, as did pain (table 4). The majority of the sample, 60%67%, was moderately - to - severely cognitively impaired . A one - way repeated measure anova was calculated for cognition and pain . Each variable compared subject scores at three different time intervals: 2001, 2002, and 2003 . A significant effect was found for cognition (f(2,112986) = 5949.23; p <0.01) and pain (f(2,112986) = 271.82; p <0.01). Follow - up protected t - test with repeated measures was used, because of limitations of spss software to run a post - hoc analysis for within - subject factors.43 a protected t - test between each measure inflates the risk of type i errors, so a significance level of 0.017 was used (0.05/3 measures) instead of 0.05 . The follow - up protected t - test revealed that scores decreased significantly (p <0.017) for cognition1 (mean [m] = 14.5, standard deviation [sd] = 1.80), cognition2 (m = 13.7, sd = 8.1), and cognition3 (m = 12.8, sd = 8.3), and decreased significantly (p = 0.017) for pain1 (m = 2.4, sd = 2.9), pain2 (m = 2.34, sd = 2.8), and pain3 (m = 2.18, sd = 2.8). A residual term was not attached to cognition1 (figure 3), because there was no predictor for these variables . The covariance models indicate pain (13) and cognition (13) measurements were stable over time with previous measures being a good predictor of subsequent measures . Very little association was found between cognition and pain variables, regardless of the time interval . A concomitant relationship was significant (p <0.01), but the associations were weak and ranged from absolute values of 0.03 to 0.08 (table 5). Model 1 depicts cognitive decline as a predictor of increased pain, and model 2 represents the inverse model, increasing pain as a predictor of cognitive decline . The root - mean - square residual (rmr) is the averaged squared amount by which the sample variances and covariances differ in their estimates.42 a smaller rmr is preferred with a value of 0 indicating a perfect fit (see table 6). The goodness - of - fit index (gfi), as it approaches 1 indicates a perfect fit . Lewis index, and adjusted gfi could be attributed to the simplicity of the model, even though all three were approaching 1.0 . The sample data do not confirm the presence of concomitance between pain and cognition in this long - term care population . These findings support kovach s model of consequences of need - driven, dementia- compromised behaviors (c - ndb).32 cognition (background factor) and pain (proximal factor) exist as contributing aspects of how need - driven behaviors are manifested and communicated . Kovach s c - ndb model serves as the template for understanding how symptoms and environmental factors interact . Failing to identify resident care needs is not in isolation of the resident, but is a complex system involving clinician, support staff, environmental factors, and the resident . Mds can be used as a reliable tool to track resident characteristics and outcomes over time . Reporting was consistent for cognition and pain over the 3-year period, and considerable fluctuations in recorded values of cognition and pain did not occur . Because pain assessments were recorded annually, differences in pain would be anticipated . The findings showed a gradual decline in recorded pain over the 3-year period, as cognition also declined . This raises concern, because these findings may support previous research, indicating pain is underreported and undertreated in residents with cognitive decline.4446 reductions in pain scores at the third interval may also be attributable to residents having less pain, or residents having received appropriate interventions for their pain . Differences in pain would be expected with recent events like fracture, surgery, or falls . Partitioning this group of residents into a separate cohort could evaluate the consistency of pain reporting, and pain measures specific to these acute events . Until clinicians and support staff increase their awareness of affective, cognitive, and behavioral indicators of pain, the reliability of mds for pain measures will continue to be a concern . Results suggest the importance of assessing memory function when managing physiologically distressed residents, because this information aids in determining the best methods to assess resident pain.26,47,48 over the 3-year period, declines in cognitive status occurred which were consistent with the progression of organic brain disease . Acute declines in cognition may be indicative of a change in mental status not attributable to the progression of a pre - existing disease, but the onset of infection (ie, urinary tract infection, pneumonia, or sepsis), or psychiatric illness . Further research could look at specific diagnoses and the consistency of cognitive decline and pain measures over time . Additional variables like the use of multiple medications (eg, polypharmacy), or certain classes of medications, ie, antipsychotics or hypnotics, may yield valuable information about the contributing factors to resident decline, and create an index of outcomes for pharmacoeconomic and clinical data supporting resident care guidelines and health policy reform . Supplemental theoretical modeling could evaluate latent growth models, with predictors combining pain, cognition, age, sex, and facility characteristics, enabling a greater understanding of pain and cognition in the elderly beyond this concomitance study . Additionally, research examining a growth curve model, plotting parallel points in time, would provide valuable information to trends in data distribution and would clarify if the model were polynomial . One limitation of this method that of using scores derived only from annual assessments of cognition and pain is that it measures only a single point in time, and does not fully capture the day - to - day variation in resident scores . Additional research could examine the non - linear relationship of these two variables, to determine if a nonlinear relationship exists . Additionally, composite pain scores were used to increase the ease of score totaling from individual score items, to improve the use of the pain indicators in the long - term care setting . Further research is required to examine the effect of medication use by class, and how other comorbidities influence pain measures the majority of the population assessed was not experiencing pain, and cognitive groups were also unequal . While the population demographics are representative of nursing homes, very distinct population demographics (ie, sex, race, educational background, socioeconomic factors) limit generalizability beyond this setting . Variations in the interpretation of reliability measures between those rating the mds sections for mood and behavior have been reported.49,50 the research was limited to the available items in mds, and these items might not capture, define or describe all pain symptoms . Even with the further criteria added to measure pain across cognitive states, there remain dimensions of pain still to be discovered and defined . This research sought to ascertain whether in fact a relationship exists between pain and cognition, and if so, to gain preliminary insight into the relationship . Investigating whether cognition is a predictor of pain in a concomitant relationship helped to define how secondary patient outcomes might be mediated . Further research should be used to link cognition, resident ability to communicate, and levels of pain for significance with quality of life measures like depression, disturbances in gait, weight loss, decreased activity, declines in functional status, or social isolation . In the case of most organic brain diseases, instead of returning to a normal level of cognitive functioning, a progressive decline occurs . Pain is a cycle that can be intervened upon, and symptoms can be lessened through medicinal and non - medicinal treatments, improving resident comfort . With an understanding of the role of cognition in identifying how pain is communicated, we can improve pain detection and uniformity of measures to ameliorate symptoms . The significance of confirming, theoretical frameworks with advanced multivariate analysis is an opportunity to evaluate interactions of key variables . A global assessment of concomitance between pain and cognition offers a unique insight towards a better understanding of the relationship of pain and cognition in a general nursing home population.
Peritoneal inclusion cyst (pic) is defined as an aggregate mass of variable sized, fluid - filled mesothelial - lined cysts of the pelvis, upper abdomen and retroperitoneum 1 . Benign (multi) cystic peritoneal mesothliomas, inflammatory cysts of the peritoneum, and postoperative peritoneal cysts, 1 . The pathogenesis is not well understood, yet they are thought to arise secondary to intra - abdominal inflammation and subsequent cyst formation with serous fluid derived from the ovarian stroma 3 . The most likely mechanism is that the small amount of follicular fluid extracted in the normal ovary in the ovulatory phase is mostly absorbed 4, but the injured peritoneum due to pelvic inflammatory disease or postoperative adhesion reduces the absorption capacity and the peritoneal fluid gradually accumulates 5 . It is thought that pic is formed by the accumulation of unabsorbed follicular fluid secreted by the normal ovary in the adhered peritoneum, and the latter is caused by pelvic inflammation and injury 6 . The fact that the main peak incidence of pic is the premenopausal women gives support that active ovarian tissue contributes the formation of pic . The treatment options are observation, hormonal management, imaging - guided aspiration, image - guided sclerotherapy and surgical excision 1, 7 - 10 . Although complete surgical resection is recommended by some authors 11,12, recurrence after surgical treatment has been reported in about half of the patients 1 . However, most studies have been case reports and small series, and there is a lack of long - term follow - up data the advantages of laparoscopic surgery include decreased postoperative pain, a short recovery period and improved cosmesis . However, the disadvantages include a longer operating time and the technical difficulty of laparoscopic procedures . The objective of this study is to compare the laparoscopy with laparotomy for the treatment of pic with respect to various demographic, perioperative and postoperative parameters . We conducted a retrospective study involving patients who were operated on at the saint vincent hospital, catholic medical college, during the period january 2003 - december 2009 . The preoperative diagnosis was made by transvaginal ultrasonography, computer tomography (ct) or magnetic resonance imaging (mri). The size of the cyst was defined as the mean diameter of the longitudinal and transverse dimensions and the height of the cyst . The outcome was assessed according to the operative time, the estimated blood loss, the serum ca-125 level, the number of septations of the cyst, the difference of hemoglobin between pre - operation and the one day post - operation, the length of hospital stay, the perioperative and postoperative complications, and recurrence of pic . The operating time was defined as the time from entry into the operating room to the time of the delivering the patient to the postoperative anesthesia care unit . For each patient, subsequent follow - up evaluations were performed by clinical assessment and an ultrasound examination in the outpatient clinic . The histories of previous abdominal and pelvic surgery were total hysterectomy, abdominal myomectomy, cesarean section, an operation on the ovary and fallopian tube, appendectomy and surgery of the small and large bowel . We categorized the follow - up results of the operation to complete remission, clinically successful and recurrence . If a patient's symptoms improved and the mean diameter of the longitudinal and transverse dimensions of a cyst decreased by more than 50%, then the operation was considered as clinically successful . However, if the mean diameter of a cyst increased by over 50% the operation was considered as recurrence 13 . All the data was described as means standard deviation (sd) or numbers (percentages). Recurrence was calculated from the date of diagnosis to the date of recurrence or the last follow - up . Differences in recurrence between two groups and other characteristics in terms of univariate analysis were assessed with the log - rank test . After disinfection and sterile coverage, we started with a small horizontal incision for placing the veres needle . After insufflation of co2 to a limited pressure of 12mhg, a 10 mm re - usable trocar was placed and the camera was inserted . However, when peritoneal adhesion was suspected by lifting the abdomen around the umbilicus, we tried the open method for entry of a 10 mm trocar 14 . The whole abdominal cavity, including the peritoneum, liver, gall bladder, stomach, spleen, appendix and bowels, was inspected for pathologies . Further two 5 mm trocars were placed laterally right and left . After placing the patient in a head - down position, the bowels were moved out of the pelvic and the inner genital organs were inspected . The peritoneum was incised over the cyst with scissors or monopolar cutting with low voltage . With the use of meticulous dissection close to the abdominal and pelvic structures, the delineated cyst wall was mobilized and resection was done . The cyst was placed into an endobag (sejong corporation, incheon, korea), and the sac and cyst were extracted through the 10-mm port . Somerville, nj, usa) was applied to the site of the former adhesion to prevent further adhesion . After deflating the intra - abdominal carbon dioxide gas, laparotomy was done either through a horizontal incision above the symphysis or by vertical incision depending on the size of the cyst and the previous operative scar . Opening and inspection of the abdominal cavity, and pushing the bowels out of the pelvis were done . The peritoneum was incised over the cyst with mayo scissors or metzenbaum . With the use of meticulous dissection close to abdominal structures, the barrier agent interceed (ethicon inc ., somerville, nj, usa) was applied to the site of the former adhesion to prevent further adhesion . After bleeding control, the operation was done under general anesthesia with the patients in the trendelenburg position . After disinfection and sterile coverage, we started with a small horizontal incision for placing the veres needle . After insufflation of co2 to a limited pressure of 12mhg, a 10 mm re - usable trocar was placed and the camera was inserted . However, when peritoneal adhesion was suspected by lifting the abdomen around the umbilicus, we tried the open method for entry of a 10 mm trocar 14 . The whole abdominal cavity, including the peritoneum, liver, gall bladder, stomach, spleen, appendix and bowels, was inspected for pathologies . Further two 5 mm trocars were placed laterally right and left . After placing the patient in a head - down position, the bowels were moved out of the pelvic and the inner genital organs were inspected . The peritoneum was incised over the cyst with scissors or monopolar cutting with low voltage . With the use of meticulous dissection close to the abdominal and pelvic structures, the cyst was placed into an endobag (sejong corporation, incheon, korea), and the sac and cyst were extracted through the 10-mm port . Somerville, nj, usa) was applied to the site of the former adhesion to prevent further adhesion . After deflating the intra - abdominal carbon dioxide gas, laparotomy was done either through a horizontal incision above the symphysis or by vertical incision depending on the size of the cyst and the previous operative scar . Opening and inspection of the abdominal cavity, and pushing the bowels out of the pelvis were done . The peritoneum was incised over the cyst with mayo scissors or metzenbaum . With the use of meticulous dissection close to abdominal structures, somerville, nj, usa) was applied to the site of the former adhesion to prevent further adhesion . After bleeding control, a laparoscopy was performed in 35 patients and a laparotomy was performed in 48 patients . Of the 35 patients, 4 underwent laparoscopic adhesiolysis of the pic and 31 underwent laparoscopic complete resection of the pic . Of the 48 patients in the laparotomic group, 11 underwent only adhesiolysis of the pic, and 37 underwent complete resection of the pic . One case in the laparoscopy was converted to laparotomy due to severe pelvic adhesion and excessive bleeding . No significant difference was found in the mean age, parity, the mean number of previous abdominal operations, the type of operation, and the mean cyst diameter, the duration since the last operation and the serum ca 125 level between the two groups . In both group, there were a significantly shorter mean length of hospital stay, less estimated blood loss and a lesser difference between the preoperative and the one day postoperative hemoglobin level in the laparoscopic group compared to that of the laparotomic group (p=0.037, p=0.047 and p=0.040, respectively). The mean operative time was lower in the laparoscopic group than that of the laparotomic group, but there was no statistical significance (p=0.053). The intraoperative, short - term and long - term complications are listed in table 3 . The total complication rate was lower in the laparoscopic group than that in the laparotomic group (p=0.037). In the laparoscopic group, two patients had postoperative ileus . They received conservative care without further procedures . In the laparotomic group, 4 cases of wound problems including 2 case of wound seroma, 1 case of wound disruption, and 1 case of ventral hernia, 2 cases of postoperative ileus and 2 cases of perioperative transfusion . Of the 4 patients with wound problem, 2 underwent wound revision and hernia repair . Conservative care and intravenous antibiotics therapy were done for the 2 cases of postoperative ileus . Both the intrapoerative bladder injury and small bowel injury were detected intraoperatively and primary repair was then done . Five cases recurred in the laparoscopic group and 10 cases recurred in the laparotomic group (table 4). Of the 5 cases in laparoscopic group, 2 cases underwent ultrasonography - guided aspiration and 3 cases underwent repeat laparoscopic cyst resection without further recurrence . Of the 10 recurred cases in laparotomic group, 2 cases underwent ultrasonography - guided aspiration and 1 case underwent laparoscopic cyst resection without further recurrence . Two cases had underlying pelvic endometriosis (stage iv) and 1 case had underlying pelvic inflammatory disease ., we performed a univariate analysis to determine the impact of age, the mean number of previous abdominal operations, the type of operation, the number of septations in the cyst and concurrent disease on recurrence . There was no statistical difference of the recurrence rate between two groups on the cox proportional hazards model (p=0.209; fig.1). Pic is a rare tumor of an unknown origin, and it is most frequently encountered in women of reproductive age . Some investigators have mentioned that pic may form as a result of a localized peritoneal fluid collection due to the presence of peritoneal adhesions, and these peritoneal adhesions have a relation to previous pelvic surgery, endometriosis or pelvic inflammatory disease . However, others have said that a pic has a neoplastic etiology according to its recurrence, as well as according to the gross tumor - like appearance of these lesions 11 . The current literature is mostly based on case reports and small series and a uniform treatment approach and long - term follow - up data are lack . Observation with serial imaging is a feasible management option for asymptomatic patients with an incidentally discovered pic 15 . Image - guided aspiration provides fluid for cytologic evaluation and it can lead to resolution of symptoms with minimal intervention and few complications . However, conservative management of a cystic lesion has not been effective and a tissue sample is required for making the histologic diagnosis and a biopsy is recommended if there is any suspicion of malignancy 16 . Birch et al . Reported that approximately 50% of cysts recur after aspiration, and aspiration may provide temporary relief of symptoms but not a histologic diagnosis 10 . Sclerotherapy using of an intracystic catheter to instill either ethalol or povidone - iodine is a less invasive method and it has been used for the treatment of cysts in the abdominal organs and for treating postoperative lymphoceles 9,17 . Reported that 30 cases of aspiration and sclerotherapy under ultrasonography and/or fluoroscopy guidance with absolute ethanol or 10% povidone - iodine showed a 90% of success rate and there was complete resolution 18 . However, studies with the long - term data, follow - up and complication rate of sclerotherapy are lack . Complications of sclerotherapy may occur such as viscus perforation, infection, bleeding, or the spillage of cystic fluid and/or sclerosant into the peritoneal cavity . Long - term data regarding the procedural complications or effects of sclerotherapy are also not available 9,13 . Although not a pic, takayasu et al . Reported a case of a hepatic benign cyst that developed into adenocarcinoma after sclerotherapy with ethanol 19 . The recommended treatment is complete resection and the importance of surgery for making the diagnosis and treatment is supported by most authors 10,12 . The advantage of surgical management is that a definitive diagnosis is possible by obtaining a histologic specimen . Reported that successful laparoscopic removal of a well - differentiated papillary mesothlioma of the peritoneum in a 46-year - old woman 20 . Nezhat et al . Reported successful treatments of 3 cases of peritoneal mesothlioma associated with pelvic endometriosis 21 . Pic is associated with severe adhesion to the adjacent visceral organ and peritoneal wall . For resection of pic, abdominal and pelvic adhesiolysis adhesiolysis by laparoscopy and laparotomy can be very time - consuming and technically difficult and it is best performed by an expert surgeon . However, laparoscopy has some advantages compared to laparotomy in our experience . First, despite lengthy laparoscopy, most patients are discharged earlier than when undergoing a laparotomy, they experience minimal complications and they return to full activity within one and two weeks of surgery 22 . Second, in laparoscopy, the port wound and the wound at the target of dissection are far away from each other, so the chances of adhesion to the peritoneum are less because for adhesion, both layers, which tend to adhere to each other, should be in contact 23 . Third, in laparoscopy there is less chance of drying of tissue because the inside environment is cut off from the outside . Fourth, the excellent visualization and magnification of laparoscopy allowed better access and exposure for further adhesiolysis 22 . Our study showed that laparoscopy was superior to laparotomy for the mean estimated blood loss, the mean difference of hemoglobin, the mean length of hospital stay, and the complication rate . However, there is no significant statistical difference for the recurrence rate of pic between two groups . First, the surgical procedure was performed by several gynecologists with different levels of experience, and the participation of multiple operators may have affected the results . We preferred laparoscopy for the direct inspection of pathology and to make the differential diagnosis of malignancy . A comparative study between laparoscopy and sclerotherapy as a minimal invasive technique may be necessary . However, our study is the first study that has compared laparoscopy with laparotomy for the treatment of pic, and we showed that the laparoscopy is superior to the laparotomy . Laparoscopy by well - skilled surgeons may decrease the mean operative time, the rate of conversion to laparotomy and the surgical complication . In conclusion, laparoscopic surgery is a safe, effective and reliable method for the treatments of pic . Laparoscopic surgery may reduce the perioperative and postoperative complications and hasten the recovery and return to routine activity . However, for the evaluation of recurrence rate, it is necessary to perform a long - term, larger - scale study.
Obesity is currently considered to be one of the major public health problems worldwide; consequently, the number of obese women who become pregnant increases each year . This condition is related with several diseases, such as hypertension, type-2 diabetes mellitus, dyslipidemia, metabolic syndrome, cardiovascular disease, and hepatic steatosis [35]. Obesity is also associated with adverse pregnancy outcomes such as pre - eclampsia, gestational diabetes mellitus (gdm), caesarean delivery, macrosomia, neural tube defect, thromboembolism, postpartum hemorrhage, puerperal infection, and increased risk of maternal and perinatal mortality [615]. According to the national health and nutrition examination survey, in the united states, more than half of pregnant women are overweight or obese . The risks of most of these complications are amplified by excessive weight gain during pregnancy, which proportionally increases the degree of obesity . Changes in the metabolism of carbohydrates and lipids occur during normal pregnancy to ensure a continuous supply of nutrients to the fetus despite non - continuous food intake by pregnant women . These changes are progressive and promote the growth of adipose tissue during early pregnancy, which is followed by the induction of insulin resistance (ir) and lipolysis during late pregnancy [1719]. In humans, leptin is the protein product of the ob gene and is primarily synthesized in adipose tissue . It sends an afferent signal to the central nervous system, where it acts to control food intake, insulin secretion, glucose utilization, glycogen synthesis, fatty acid metabolism, and in the regulation of adipose tissue, energy expenditure, body weight, and appetite . During pregnancy, leptin is also synthesized by the placenta and plays an important role in regulating maternal energy metabolism and the induction of physiological insulin resistance . Elevated levels of this adipocytokine are also associated with gdm [22,2426], pre - eclampsia, and intrauterine growth restriction (iugr). Leptin levels increase progressively during pregnancy, and this increase is related to body fat and to the regulation of placental growth, transfer of nutrients, angiogenesis, and trophoblastic invasion . However, these relationships are complex and have yet to be fully clarified . In this study, we evaluated changes in serum leptin levels during pregnancy in overweight / obese and normal - weight pregnant women . In addition, we evaluated the percent and total body weight gain as possible factors influencing the levels of this adipocytokine in obese and non - obese pregnant women . We conducted a prospective, longitudinal study in which included 42 pregnant women in low - risk prenatal care between september 2010 and june 2011 at the teaching hospital and maternity in juiz de fora, minas gerais, brazil . In total, thirty of them were excluded during the study for various reasons, including voluntary withdrawal from prenatal care in the institution (n=11), withdrawal of consent to participate in the study (n=3), referral to high - risk prenatal care (n=8), preterm delivery (n=4), and spontaneous abortion (n=4). Inclusion criteria were: age greater than or equal to 20 years, gestational age less than 12 weeks at the beginning of prenatal confirmed by ultrasonography, and singleton pregnancy . Exclusion criteria were: hypertension, type 1 or 2 diabetes, drug addiction, smoking, and chronic systemic diseases . At the first prenatal visit, all participants read and signed the consent form according to resolution 196/96 of the brazilian national health council and the helsinki declaration of 1975, revised in 1983 . The study was approved by the ethics committee of the federal university of juiz de fora ufjf, opinion n 0240/2010 . All data collection was conducted exclusively by the physician responsible for the study . Apart from routine visits, the pregnant women underwent clinical and laboratory evaluations 3 times during pregnancy (gestational weeks 912, 2528, and 3437). Socio - demographic and clinical / obstetric characteristics were obtained by data collection form and included age, race, marital status, level of education, number of pregnancies, number of births, number of abortions, history of pre - eclampsia, gdm, fetal macrosomia, and any stillbirths from previous pregnancies . We also collected patients family histories of hypertension, pre - eclampsia, diabetes, dyslipidemia, and obesity . Weight was measured in kilograms (within 100 grams) using a filizola calibrated electronic balance (personal line 200; filizola s.a . Pre - pregnancy weight was obtained by patient records, and was collected during the first prenatal visit . Pre - pregnancy bmi was calculated from the ratio of body mass (kg) to squared height (m) and classified into 2 groups non - overweight (bmi <25 kg / m) and overweight / obese (bmi 25kg / m) based on criteria from the world health organization . Gestational ages were verified using the parameters collected from ultrasounds performed between weeks 11 and 13 of pregnancy . If necessary, the results were used to retrospectively correct the calculations made on the first visit, which were based on last menstrual period as determined by the patient . Total weight gain was calculated by subtracting the weight measured at the last prenatal visit before birth, performed between weeks 37 and 40, from the pre - pregnancy weight reported at the first visit . Based on the total weight gain and pre - pregnancy weight of the patient, we calculated the percent weight gain . During each study visit for prenatal care, we obtained a maternal serum sample, which was preserved in triplicate in labeled 2-ml cryogenic tubes (cral, sp, brazil) and stored in a thermo scientific freezer (model 902; thermo electric scientific, winchester, va, usa) at 80c for subsequent analysis . Serum leptin levels (ng / ml) were analyzed with enzyme - linked immune sorbent assays (elisa) using a human leptin elisa kit (kac2281; invitrogen corporation, carlsbad, ca, usa) according to the manufacturer s instructions . The inter - assay coefficient of variation was 3.9% for 150.6 pg / ml and 5.3% for 240.7 the readings were taken using an elisa microplate reader (expert plus; asys hitech, eugendorf, austria) at 450 nm . These measurements were performed by researchers in the clinical immunology and immunopathology laboratory at the center for reproductive biology, federal university of juiz de fora . For the statistical analyses, pregnant women were divided into 2 groups according to their bmis (<25 kg / m or 25 kg / m). Next, linear regression analyses were performed using maternal weight vs. gestational age, and leptin levels vs. gestational age . To compare leptin levels across the 3 time periods defined in this study, a 1-sided anova was performed on the 2 groups, which was followed by a post hoc bonferroni test . Subsequently, we used the t test to compare absolute weight gain and percent weight gain between the 2 groups . All of the statistical analyses were performed using graphpad prism 5.0 (graphpad software, inc ., la jolla, ca, usa). The anthropometric characteristics collected for the study group included the patients weights and heights . Weight was measured in kilograms (within 100 grams) using a filizola calibrated electronic balance (personal line 200; filizola s.a . Pre - pregnancy weight was obtained by patient records, and was collected during the first prenatal visit . Pre - pregnancy bmi was calculated from the ratio of body mass (kg) to squared height (m) and classified into 2 groups non - overweight (bmi <25 kg / m) and overweight / obese (bmi 25kg / m) based on criteria from the world health organization . Gestational ages were verified using the parameters collected from ultrasounds performed between weeks 11 and 13 of pregnancy . If necessary, the results were used to retrospectively correct the calculations made on the first visit, which were based on last menstrual period as determined by the patient . Total weight gain was calculated by subtracting the weight measured at the last prenatal visit before birth, performed between weeks 37 and 40, from the pre - pregnancy weight reported at the first visit . Based on the total weight gain and pre - pregnancy weight of the patient, we calculated the percent weight gain . During each study visit for prenatal care, we obtained a maternal serum sample, which was preserved in triplicate in labeled 2-ml cryogenic tubes (cral, sp, brazil) and stored in a thermo scientific freezer (model 902; thermo electric scientific, winchester, va, usa) at 80c for subsequent analysis . Serum leptin levels (ng / ml) were analyzed with enzyme - linked immune sorbent assays (elisa) using a human leptin elisa kit (kac2281; invitrogen corporation, carlsbad, ca, usa) according to the manufacturer s instructions . The inter - assay coefficient of variation was 3.9% for 150.6 pg / ml and 5.3% for 240.7 the readings were taken using an elisa microplate reader (expert plus; asys hitech, eugendorf, austria) at 450 nm . These measurements were performed by researchers in the clinical immunology and immunopathology laboratory at the center for reproductive biology, federal university of juiz de fora . For the statistical analyses, pregnant women were divided into 2 groups according to their bmis (<25 kg / m or 25 kg / m). Next, linear regression analyses were performed using maternal weight vs. gestational age, and leptin levels vs. gestational age . To compare leptin levels across the 3 time periods defined in this study, a 1-sided anova was performed on the 2 groups, which was followed by a post hoc bonferroni test . Subsequently, we used the t test to compare absolute weight gain and percent weight gain between the 2 groups . All of the statistical analyses were performed using graphpad prism 5.0 (graphpad software, inc ., la jolla, ca, usa). The socio - demographic and clinical / obstetric characteristics of the cohort are described in table 1 . We found that 95.2% (40/42) of the women were between 20 and 30 years of age, 66.7% (28/42) were nulliparous, 95.2% (40/42) had no history of pre - eclampsia during previous pregnancies, and 100% had no previous history of gdm, macrosomia, or stillbirths . As for family history (fh), 83.3% (35/42) did not have a fh of pre - eclampsia, 76.2% (32/42) did not have a fh of dyslipidemia, and 78.6% (33/42) did not have a fh of obesity . Figure 1 shows that, in the course of gestation, there was a progressive increase in maternal weight gain in both the non - overweight (bmi <25 kg / m) and the overweight / obese (bmi 25 kg / m) groups of pregnant women . There was a progressive increase in maternal serum levels of this adipocytokine in both groups . However, this increase was significantly greater in the non - overweight group (bmi <25 kg / m) (figure 2). Additionally, when the mean serum leptin levels were compared during the first (t1), second (t2), and third (t3) trimesters of pregnancy, we concluded that there were significant increases (t1 vs. t2, p<0.01 and t1 vs. t3, p<0.001) in leptin levels in group 1 (non - overweight or g1), as seen in figure 3 . However, we did not observe a significant increase in leptin levels (p>0.05) during the 3 trimesters in group 2 (overweight / obese or g2). When we analyzed the total weight gain during pregnancy in the 2 groups, we found that g1 had a greater total weight gain than g2, although the difference between the 2 groups was not significant (p>0.05) (figure 4a). However, when we compared the percent weight gain during pregnancy between g1 and g2, there was a significantly higher percent weight gain in g1 compared to g2 (p<0.001) (figure 4b). This study contributes to the body of knowledge available on the topic of evaluation of obesity in pregnancy and its association with serum leptin levels . Recently, obesity and leptin have been the subject of many studies [3032], but there is still a significant gap in knowledge about the behavior of this hormone in women who were not overweight and those who were overweight / obese during pregnancy . From a methodological standpoint, this study provides adequate control of many intervening variables, such as the monitoring of all volunteers by a single physician, which minimizes the possible variations in data collection . The changes in serum leptin levels during pregnancy have been well established through many studies for nearly 2 decades [3234]. However, there are still many gaps in knowledge about the levels of this adipocytokine in pregnant women in relation to bmi and gestational weight gain . We found that serum leptin levels in non - overweight (bmi <25 kg / m) and overweight / obese (bmi 25 kg / m) pregnant women increased progressively throughout pregnancy and the mean leptin concentrations were significantly higher in overweight / obese compared to normal - weight pregnant women . Similar findings were also reported by some recent studies that directly related leptin levels with groups of obese and non - obese pregnant women [25,3538]. Our results also suggest that the leptin levels in non - overweight women were significantly higher (p<0.001) during pregnancy compared to overweight / obese women (figures 2 and 3). This seems paradoxical, considering that probably the largest increase in leptin should have been detected in patients with overweight / obesity . Similar data were also observed by misra in the analysis of the serum leptin levels in non - overweight and in overweight / obese pregnant women . The authors concluded that the overweight / obese group had significantly higher serum leptin concentrations than the non - overweight group during pregnancy (p<0.01) and, although these concentrations increased significantly across gestation for both groups, the rate of increase was significantly smaller in overweight / obese women (p<0.05). They also concluded that factors other than fat mass alone can influence leptin concentrations in overweight / obese women compared to non - overweight women during pregnancy . This study suggests a hypothesis to explain this increase in leptin levels in the non - overweight group . Analyzing the total weight gain and percent weight gain in both groups of pregnant women in our cohort, the results suggest that g1 had a greater total weight gain than g2, although the difference between the 2 groups was not significant (p>0.05) (figure 4a). Furthermore, when we analyzed both groups for their percent weight gain during pregnancy compared to their pre - pregnancy weight, the non - overweight patients had a significantly greater percent weight gain (p<0.001) compared to the overweight / obese women (figure 4b). Our finding suggests that the adipose tissue in women with a bmi <25 kg / m exhibits a higher percent increase during pregnancy compared to women with a bmi 25 kg / m . This increase in adipose tissue can directly influence the production of adipocytokines and other inflammatory mediators by adipocytes . These findings suggest a hypothesis to explain the increase in leptin levels in non - overweight group a limitation of this study was that the pre - pregnancy bmi was calculated using the pregnant woman s self - reported weight at the first prenatal visit, and this information was subjective and prone to error . Another limitation is the small sample size, which may reduce the external validity of the research . In summary, our results indicate that the significantly greater increase in serum leptin levels in non - overweight pregnant women may be explained by the significantly higher percent weight gain in this group compared to overweight / obese women . This study suggests that controlling both weight gain and the percent weight gain during the prenatal period may be an important preventive measure to control leptin levels during pregnancy and its subsequent medical complications.
Extracellular superoxide dismutase (sod3) is an enzyme known to catalyze dismutation of the highly reactive, superoxide anion into longer - lived and more stable hydrogen peroxide . The consequences of sod3 action in the cells reach beyond the antioxidative functions, as it has been shown to downregulate inflammation, stimulate cell proliferation during tissue injury recovery, and to counteract apoptosis [4, 5] by affecting cytokine production, cell signal transduction, and expression of survival - related genes . The anti - inflammatory properties of sod3 have been studied in models of pulmonary disease and peritonitis [2, 6]. Previous work with collagen - induced arthritis (cia) suggests that both genetic transfer of the sod3 gene as well as a small molecular sod mimetic have the ability to ameliorate arthritis . The arthritis ameliorating effect of sod3 was later confirmed using sod3 knock - out mice . These results were explained on the basis that sod3 acts as an antioxidant and catalyses dismutation of superoxide into hydrogen peroxide, thus reducing inflammation - induced oxidative stress and restoring the oxidant balance in the arthritic joints [10, 11]. This explanation, however, is difficult to reconcile with the finding that animals naturally deficient in the induced oxidative burst in fact develop more severe arthritis [12, 13]. The most potent producer of superoxide, the substrate for sod3, is the well - characterized phagocytic nox2 complex . In inflamed tissues nox2 complex produces massive amounts of superoxide upon activation in a process called phagocyte oxidative burst . In addition to nox2, superoxide is produced from various other cellular sources, such as from the mitochondria during cellular respiration and by other members of the nox enzyme family . However, it should be noted that during inflammation these superoxide producers are not nearly as efficient superoxide producers as the nox2 complex . In the current work we studied the role of sod3 in collagen - induced arthritis (cia) to understand whether the therapeutic effect of sod3 on arthritis operates through attenuating the biological effects of the induced oxidative burst produced by the nox2 complex . To avoid artifacts introduced by chemical inhibitors of nox2 complex [1416] thus we used wild - type (ncf1) and ncf1 mutated (ncf1) mice on b10.q background . These strains differ at only one snp in the ncf1 gene, which makes the ncf1 strain unable to produce oxidative burst . The mutated mouse is more susceptible to induced arthritis due to hyperactivated t cells, and also increased susceptibility to thioglycollate peritonitis has been reported in the ncf1 knockout mouse . Our results confirm the previously documented anti - inflammatory role of sod3 and additionally, for the first time, we show that it can downregulate both cia and peritonitis even in the absence of functional nox2 complex and phagocyte oxidative burst . The previously described ncf1 (protein also called p47phox) mouse, which carries a point mutation globally and completely abolishing nox2 complex derived ros production, has been backcrossed onto the b10.q background and shown to contain only the causative mutation using a 10 k snp typing chip . The mice were housed under specific pathogen - free conditions in climate - controlled environment and fed standard rodent chow and water ad libitum at turku university central animal facility . All experimental mice were sex- and age - matched, treatment groups were blinded, and experimental groups were mixed in cages in all experiments . The experiments were performed in accordance with the national and eu guidelines and the study was approved by the oulu section of the national animal experiment board (elinkoelautakunta, ella) with ethical approval numbers eslh-2008 - 02873, eslh-2008 - 07941, and esavi-0000497/041003/2011 . Replication deficient adenoviral e1-partially - e3-deleted adbglii vectors (developed from serotype ad5) expressing rabbit sod3 (ade - sod3) or bacterial -galactosidase lacz (ade - lacz) were used in both in vitro and in vivo experiments . Collagen - induced arthritis (cia) was induced under isoflurane anesthesia by injecting 100 g rat type ii collagen (purified from chondrosarcoma) emulsified in complete freund's adjuvant intradermally at the base of the tail . Arthritis was boosted day 19 with 50 g rat type ii collagen emulsified in incomplete freund's adjuvant intradermally at the base of the tail . Disease development was evaluated macroscopically three times a week before the booster immunization and daily after the boost . One point was given for each swollen toe or joint and five points for a swollen ankle, each paw having the maximum of fifteen points . In the arthritis experiments ade - sod3, ade - lacz (vector control), and pbs (injection control) were injected locally in the left front paw in 25 l injection volume containing 2,5 10 pfu virus . Injections were performed right after the booster immunization during the same anesthesia at day 19, before the onset of clinically apparent arthritis . Briefly, mice were pretreated i.p . With 0.5 10 pfu ade - sod3, ade - lacz, or pbs three days before peritonitis induction with 5% proteose peptone (bd difco, sparks, md, usa) and 10 ng il-1 (r&d systems, minneapolis, mn, usa) in 1 ml pbs . After 18 hours peritoneal infiltrating cells were collected with 10 ml ice - cold rpmi cell culture medium . Cells from the peritoneal lavage were counted and cytocentrifuged, slides were stained with reastain diff - quick (reagena, toivala, finland), and differential counting was performed under a standard light microscope . Experiments were pooled and the total cell numbers are presented as percentual increase from the pbs injection control . All peritonitis results were normalized to adjust the vector control group (ade - lacz) mean to 100 . Cos-7 cells stably expressing all the essential components of the nox2 complex, namely, cybb (gp91phox), cyba (p22phox), ncf2 (p67phox), and ncf1 (p47phox) were provided by dr . Cells were cultured in dulbecco's complete medium (gibco), 10% fetal calf serum, and penicillin - streptomycin (invitrogen, paisley uk). Extracellular superoxide production was quantified two days after transduction (moi 4) with adenoviral constructs (ade - sod3 and ade - lacz) or medium control directly on the 96-well cell culture plate using an isoluminol - enhanced chemiluminescence method [22, 23]. Briefly, the cells were washed with pbs, and 100 l of isoluminol buffer was added in each well . Isoluminol buffer contained isoluminol (10 g / ml, sigma - aldrich) and horse radish peroxidase - type ii (4 u / ml, sigma - aldrich) dissolved in pbs with pma (200 ng / ml, dissolved in dmso, sigma - aldrich) and data collection was initiated immediately and followed at 37c as produced luminescence signal (tecan infinite m200, tecan, mnnedorf, switzerland) for 30 minutes . Red blood cells were lysed from heparinized whole blood with hypotonic lysis buffer and leukocytes were surface stained with apc conjugated anti - gr-1 (rb6 - 8c5) and efluor 450 conjugated anti - cd11b (m1/70) antibodies (ebioscience). Cells were suspended in high - glucose d - mem (gibco) with antibiotics without fcs and incubated for 10 min at 37c with 3 m dihydro - rhodamine 123 (dhr-123; molecular probes and invitrogen life technologies) followed by 20 min activation at 37c with 200 ng / ml pma (sigma - aldrich). The cells were washed into pbs and acquired on lsr ii flow cytometer equipped with facs diva software (bd biosciences). Live cells were gated on the cell type, and geometric means of respective populations were analyzed with flowing software (cell imaging core, university of turku). Isoflurane anesthetized animals with equal arthritis scores were injected intraperitoneally with 20 mg / kg l-012 probe (wako chemicals, germany) dissolved in pbs . The luminescent signal was detected with ivis 50 bioluminescent system (xenogen, usa) that consists of an anesthesia unit built in a light tight chamber equipped with a ccd camera . Rna was isolated from the treated paws collected d25 according to the manufacturer's instructions with tri reagent (sigma - aldrich). The isolated rna was dnase treated with deoxyribonuclease i (fermentas) in the presence of ribolock rnase inhibitor (fermentas). The rna was used for reverse transcription reaction performed with revert - aid m - mulv (fermentas). The acquired cdna was subjected to q - pcr with ade - sod3 (fw: gtg tgc tcc tgc ctg ctc, rev: ctg ctc cac cgt gtc tga g) and -actin specific primers (fw: cta agg cca acc gtg aaa ag, rev: acc aga ggc ata cag gga ca), and the gene expression level was analyzed using sybr green pcr master mix (applied biosystems), icycler iq multicolor real - time pcr detection system (bio - rad), and the icycler (version 3.1) software . Ade - sod signal was normalized against -actin expression levels and the results are reported as fold change from the ade - lacz group mean denoted as 1 . Statistical significance was analyzed by using two - tailed student's t - test or if more than two groups were analyzed one - way anova with lsd post hoc analysis was run using ibm spss statistics 19 software (spss inc . ), p <0.05 is considered as statistically significant . Adenoviral sod3 gene delivery reduced the superoxide predominant ros signal 37% compared to the ade - lacz control virus when investigated two days after transduction with ade - sod3 and ade - lacz viruses (figure 1). Mice started to develop mild, clinically apparent arthritis at day 20 and made a full response, mean arthritis scores reaching 7 (out of the maximum of 15) in ade - laz treated and 3 points in ade - sod3-treated mice some days later . The mean disease score in the treated paws was lower in the ade - sod3-treated group when compared to the ade - lacz - injected control group, and the difference reached statistical significance at d26 (figure 2(a)). The treatment effect was only seen in the treated paw, while there were no differences between the treatment groups in sum scores of the three untreated paws (see supplementary figure 1(a) in supplementary material available online at doi: 10.1155/2012/730469) highlighting the local character of the used gene therapy vector expressing sod3 . Both virus vector treated groups showed elevated arthritis scores in the treated paws when compared to the pbs - injected control paws in the injection control group . This difference is illustrated in figure 2(b), where ade - lacz - treated paws are shown to have larger increase in arthritis score than the ade - sod3-treated paws . Starting from d20 the ncf1 mice started to develop arthritis with significantly higher mean score than the wild - type mice . Interestingly, the mutated mice without functional nox2 complex derived superoxide production also responded to ade - sod3 treatment . Ade - sod3-treated paws of the ncf1 mice had significantly lower mean disease score than the ade - lacz - treated vector control paws at days 24 and 25 after arthritis induction . Similarly to the wild - type mice, the difference in the mean arthritis score in nox2 complex deficient mice was observed when sod3 was highly expressed from the adenoviral vector (figure 3(a)). No differences were observed between the treatment groups in the sum scores of the untreated paws (supplementary figure 1(b)) again supporting the local character of the immunomodulatory effect of ade - sod3 treatment . Similarly to the wild - type mice, ade - sod3 treatment in ncf1 paws induced significantly smaller difference between the virus - treated and pbs - injected paws than ade - lacz virus injection (significant d24 and d25 after immunization), again confirming the arthritis limiting effect of sod3 (figure 3(b)). The experiment was repeated and as the experiments were well reproduced, data from both experiments was combined for analysis . Sod3 expression significantly reduced the number of peritoneal infiltrating cells in proteose peptone and il-1 induced peritonitis in wild type mice (figure 4(a)). The decrease in infiltrating leukocytes was mainly due to a lowered number of infiltrating macrophages (figure 4(b)), which well corresponds with the macrophage phase of peritonitis taking place three days after virus injection and 18 hours after peritonitis induction . Both virus - treated groups had more infiltrating cells than the pbs - injected control mice . Similarly as in the wild - type mice ade - sod3 was shown to reduce the number of infiltrating cells in the peritoneal cavity of ncf1 mice when compared to ade - lacz - treated mice . The difference was due to a significantly lowered number of infiltrating macrophages in the ade - sod3-treated mice (figures 5(a) and 5(b)). In the wild - type mouse both severely inflamed paws (right hind leg and right front paw) emitted strong ros - induced l-012 luminescence signal, while in spite of the severe inflammation, no luminescent signal was detected from the ncf1 mice (severe arthritis with arthritis score of 15 in both front paws and milder symptoms in the left hind leg) (figure 6(a)). Monocytes (cd11b - pos, gr-1-lo, or gr-1-neg) and granulocytes (gr-1-hi, cd11b - pos) from ncf1 mice were unable to generate efficient ros production upon pma stimulation, while phagocytes from the wild - type animals responded to pma stimulation and induced significant increase in dhr-123 derived fluorescence signal detected by flow cytometry (figures 6(c) and 6(d)). Quantitative rt - pcr revealed a a 5.5-fold (fc, fold change) expression of adenovirally produced sod3 mrna in the ade - sod3-treated joints collected at d25 when compared to the ade - lacz - treated vector control paws (figure 6(b)). Sod3 is an enzyme that has been shown to give rise to therapeutic responses in damaged tissues such as reduced ischemia - reperfusion injury, arthritis, peritonitis, hind limb injury, and lung injury models . These tissue healing promoting and anti - inflammatory effects induced by sod3 are accompanied by reduced macrophage infiltration, inhibition of oxidative fragmentation of the extracellular matrix matrix, decreased apoptosis [4, 5], and enhanced cell proliferation . The beneficial effects of sod3 are mostly explained by its antioxidant properties and reduction of oxidative stress in the injured tissues . However, in this report we show that overexpression of sod3 downregulated inflammation even in the absence of phagocyte oxidative burst, thus highlighting the capacity of sod3 to affect cellular processes independently of nox2 complex' superoxide production . The adenoviral gene expression system used in this work reaches its maximal expression around three days after the injection, after which the vector is eliminated by the immune system and the expression of the transgene slowly decreases to undetectable levels 14 days after the initial injection . We confirmed the presence of virally delivered sod3 mrna in the paws d25 and thus confirmed that the decrease in arthritis severity coincided with substantial adenovirus driven sod3 expression . Similarly, pretreating the mice three days before induction of peritonitis allowed us to analyze the effect of sod3 during substantial sod3 expression in the peritoneal cavity . The percentual treatment effect in both inflammation models was comparable with the effect previously obtained with transgenic sod3 overexpression in pulmonary emphysema . Similarly, the degree of sod3-induced macrophage infiltration inhibition in peritonitis was similar as reported previously . Even though sod3 is an important local regulator of the acute inflammatory reaction, it is obvious that there are a number of other factors affecting inflammation severity in vivo . When the nox2 complex is not functional, there are still a number of other enzymes and enzyme complexes producing superoxide in the inflamed tissue . Nox1 has been reported to worsen hyperoxia - induced acute lung injury in mice, and nox4 has been suggested to stimulate microglial il-6 expression and to hamper neurodegeneration after poststroke ischemia reperfusion injury . However, only nox2 is abundantly expressed on phagocytes and thus recruited to inflammatory foci . Other nox family members are expressed on other cell types than phagocytes and their ros production is not upregulated during inflammation . In addition to the nox family enzymes, superoxide is also produced during mitochondrial respiration at levels corresponding to the general metabolic rate in the tissue . Mitochondrial superoxide has also been linked to tlr2/4 signaling and is also suggested as a pathologic mechanism in tissue injury . All these superoxide generating processes, however, cannot compensate for the massive production of ros by the nox2 complex during inflammation as the arthritic paws of ncf1 mice emitted no detectable luminescence signal when probed with l-012 dye (figure 6(a)). L-012 reacts with any radical to produce light and cannot be used to distinguish between superoxide and hydrogen peroxide in vivo . As a tool to study the nox2 complex dependency of sod3, we used ncf1 mutated mice, in which a splice site point mutation abolishes the production of ncf1 protein leading to complete loss of nox2 complex derived oxidative burst . In line with previous reports, arthritis severity was significantly higher in ncf1 animals when compared to b10.q wild - type mice . Mutated mice also developed arthritis quicker after the booster allowing us to work with a more homogenous and extremely well reproducible disease model . Better arthritis synchronization in the mutated mouse model together with larger treatment groups resulted in less variability and increased statistical power in data analysis . In proteose the use of ncf1 mutant mice allowed us to avoid pit falls associated with the use of chemical nox2 complex inhibitors such as dpi and apocynin, which are not specific for the nox2 complex, do not provide full suppression of superoxide production and additionally profoundly affect various other cellular processes [1416]. In both arthritis and peritonitis, adenoviral gene expression vectors locally enhanced inflammation . The arthritis enhancing effect was restricted to the treated paw, as the virus - injected groups did not differ from the pbs - injected control group when their nontreated paws were analyzed . This is in line with previous reports where intra - articular injections of adenoviral gene expression vectors have been shown to induce increased paw swelling and elevated levels of inflammation mediators [33, 34]. Intravenous injection route has not given rise to enhanced arthritis [3537], but has triggered liver inflammation; liver being the primary target of systemically administered adenoviral vectors . The immunogenicity of the adenoviral gene expression systems is well documented in the literature [3840]. Sod3 polymorphisms are associated with copd, coronary artery disease, myocardial infarction as well as acute lung injury and related mortality . We report that sod3 limits inflammation in cia and peritonitis both in the presence and in the absence of phagocyte oxidative burst . The anti - inflammatory function of sod3 is not compromised by the lack of functionality of the nox2 complex as both ncf1 and ncf1 mice develop milder inflammation when treated with sod3 . Thus, we conclude that the anti - inflammatory effect of sod3 is not dependent on superoxide produced by the nox2 complex derived phagocyte oxidative burst and thus acts via other signaling pathways.
Traumatic arterial occlusion following major or minor blunt trauma, especially in the absence of any other bony injury, is a rare phenomenon . Motor - scooter handlebar syndrome is one such type of arterial occlusion affecting vascular structures following direct blow by a handlebar of a motorbike or bicycle to the groin . Given their superficial course at this location, femoral vessels are the most common vascular structures affected . In all instances, injury to iliac vessels remains exceedingly rare, given its posterior position within the pelvis, representing only 0.4% of vascular injuries . In this case, we highlight a delayed presentation of external iliac artery occlusion secondary to motor - scooter handlebar syndrome, in a paediatric patient . Pathophysiology and management of vascular injuries in the paediatric population vary significantly compared with the adult population . Additional factors which need to be considered include: smaller vessel size or vessel spasm, higher risk of infection, tendency for re - stenosis and continuing growth . We review previous paediatric cases of this unusual vascular injury to highlight the pathology and most appropriate management option . A 15-year - old male presented to the emergency department following a direct blow from his bicycle handlebars to his groin . His abdominal examination was unremarkable, except for a small abrasion and visible mass in his right groin . After exclusion of other abdominal or chest injuries, he was discharged on the same day with a diagnosis of right groin haematoma and follow - up in 68 weeks . His symptoms included pain and paraesthesia in his right buttocks on mobilization> 100 m. he was found to have absent peripheral pulses in his right leg, although it appeared well perfused with a normal capillary refill . An arterial doppler ultrasound showed a right external iliac artery thrombus occluding the proximal two - thirds of the vessel . A computed tomography scan of the abdomen and pelvis with intravenous contrast identified complete occlusion of the right external iliac artery 1 cm beyond its origin . However, the common femoral artery and profunda femoris remained patent via collaterals (fig . 1). He underwent a right external iliac thromboendarterectomy with patch repair using a saphenous vein graft . A suprainguinal incision was initially made in attempt to expose the proximal external iliac artery . Due to its extent, retrieval of the entire thrombus was incomplete and a second groin incision near the junction of the common femoral with external iliac (at the inguinal ligament level) was required . The patient subsequently underwent a proximal and distal thrombectomy, and the arteriotomy was extended between the two incisions identifying an intimal stricture with significant fibrosis (fig . 2). An intimal flap was identified in the distal region and tacked down with a 7 - 0 prolene suture . The long saphenous vein was harvested and the defect closed with patch repair extending from proximal iliac to proximal femoral vessel . At the initial 2-week follow - up, the vessels remained patent and patient was progressing well . Subsequently, regular biannual follow - up was planned to monitor for any longer - term complications . Figure 2:occlusion of right external iliac artery 1 cm below its origin (white arrow). Occlusion of right external iliac artery 1 cm below its origin (white arrow). Motor - scooter handlebar syndrome is an uncommon form of arterial blunt injury following a direct blow by the handlebar of motorbikes or bicycles . Only a handful of paediatric cases have been reported [1, 2, 47]. The common femoral vessel is the most commonly affected vascular structure . A common site for these injuries is at the inguinal ligament, where the femoral artery is superficial and courses anterior to the superior pubic ramus and femoral head . As such, it is prone to compression between the handlebar and posterior osseous structures . In addition, it is a relatively immobile structure, tethered by arterial branches, periadventitial connective tissue and the femoral sheath . They proposed that a circumferential tear of the intima leads to dissection and prolapse of the inner aortic layers, causing complete luminal occlusion ., patients may remain asymptomatic until a period of growth spurt or they resume more rigorous physical activity . This can lead to delay in the diagnosis, and a high index of suspicion needs to be maintained to avoid ischaemic complications such as limb length discrepancy [8, 9]. In such instances, it is important to rule out any secondary occlusion of the femoral artery and vein that may predispose to the development of thrombosis within these vessels . Duplex sonography should be carried out to assess flow velocities and waveform characteristics in these patients, and is especially suited to the paediatric population as they have reduced abdominal fat, and there is no radiation . Identified ultrasound, in the right hands, to be highly sensitive (100%) and specific (97.5%) for the detection of arterial injuries when compared with surgical findings . Open arterial thromboendarterectomy with graft or patch repair is the standard of care for such cases in trauma centres . Previously documented cases include patch repair or bypass using saphenous vein, bovine pericardium and synthetic material [13, 5, 6]. One case was successfully treated with iv heparinzation alone . However, in most injuries, the presence of significant groin haematoma may limit anticoagulation, requiring more urgent operative re - vascularization . In our patient, delayed presentation and presence of significant collaterals meant definitive operative management could be planned as a semi - elective procedure . The role of endovascular intervention in this paediatric population has previously been documented mainly as a temporizing measure for revascularization [4, 5]. Used a nitinol stent in the distal superficial femoral artery of a 13-year - old patient whose arterial and venous calibre at the time of injury were of inappropriate size for reconstruction . The main disadvantage of endovascular interventions in paediatric patients is the constantly enlarging calibre of the vessel with a fixed stent diameter . This can predispose to complications such as restenosis, stent fracture, stent dislocation and acute on chronic ischaemia . As a result, future vascular reconstruction may be compromised and in extreme cases, this may progress to significant ischaemia and even limb loss . We provide an unusual cause of external iliac occlusion secondary to bicycle handlebar injury to the groin . All patients presenting with groin injury from this mechanism should be carefully investigated with duplex sonography and monitored for risk of vascular injury . The presence of collaterals, particularly in the paediatric population, can lead to delay in diagnosis . Literature seems to advocate open primary surgery for management of these injuries; however, endovascular and conservative medical management have also been used successfully . The latter two were contraindicated in our patient and open surgery was the most appropriate option . Long - term follow - up, beyond the 12-month period, is needed, particularly in relation to known vascular complications including pseudoaneurysms, arteriovenous fistula formation and restenosis.
The advent of antihypertensive therapy has substantially reduced the occurrence of cardiovascular events . However, antihypertensive therapy failed to achieve blood pressure control in all patients, with hypertension control rates remaining in general disappointingly low . Blood pressure goals are not attained in some patients despite the simultaneous use of several antihypertensive medications . Several terms have been used to define this condition: refractory hypertension, difficult - to - treat hypertension, difficult - to - control hypertension; however, the term resistant hypertension seems to prevail . Resistant hypertension is currently defined as uncontrolled blood pressure despite the use of optimal doses of three antihypertensive medications, of which one is a diuretic . Poor patient adherence, physician inertia, inadequate doses or inappropriate combinations of antihypertensive drugs, excess alcohol intake, and volume overload are some of the most common causes of resistance [210]. The list of secondary forms of hypertension is long and covers a large variety of conditions (table 1). The management of patients with resistant hypertension requires a gratifying combination of clinical acumen and common sense . An extensive workup of all patients with uncontrolled hypertension is scientifically unsound, is very costly and requires immense human and technical resources . Therefore, practicing physicians need to implement evidence - based medicine . The effective management of patients with resistant hypertension requires an appropriate combination of physiology and pharmacology, taking into account the unique characteristics of each case in order to tailor the therapeutic approach to the individual patient . This paper will address the most common secondary causes of resistant hypertension (drug - induced, obstructive sleep apnea, primary aldosteronism, and chronic kidney disease), which are frequently encountered in hypertensive patients and are, therefore, the most interesting from the clinical point of view . In addition, this paper will attempt to provide a rational for the workup and treatment of patients with resistant hypertension . Data from small observational studies show a wide variation (from 5% to 50%) according to the studied populations [210]. Data from large clinical trials point towards a relatively high prevalence of resistant hypertension (2035%). It has to be noted, however, that atypical drug combinations have been used in most of these studies as required by study protocols . Therefore, the evaluation of the prevalence of resistant hypertension requires a large, prospective, population - based study, specially designed for this aim . Available evidence addressing the prognosis of resistant hypertension is scarce, since virtually no longitudinal study has addressed this topic . Data from small clinical studies point towards an increased cardiovascular risk in patients with resistant hypertension . In addition, patients with resistant hypertension frequently have comorbidities that are known to increase cardiovascular morbidity and mortality, such as chronic kidney disease, diabetes, and obesity . Moreover, patients with resistant hypertension have higher rates of target organ damage than the general hypertensive population and are thus at increased cardiovascular risk . Excessive dietary salt intake is common in patients with resistant hypertension and contributes to treatment resistance by blunting the blood pressure reduction of most antihypertensive drugs, including diuretics and inhibitors of the renin - angiotensin axis [210]. It has been shown that blood - pressure control is more difficult to be achieved in obese than lean hypertensive patients . Several lines of evidence indicate a graded positive correlation between body mass index and blood pressure levels, while weight loss results in blood pressure reduction . Insulin resistance, sympathetic nervous system overactivity, sodium retention, and activation of the renin - angiotensin system have been implicated in the pathogenesis of obesity - induced hypertension . Alcohol consumption is another important factor [210]. Large alcohol consumption (> 3 drinks per day) has been shown to result in blood pressure elevation . In addition, blood pressure control might be achieved more difficult in heavy drinkers due to poor adherence in antihypertensive therapy . The role of physical inactivity in patients with resistant hypertension has not been adequately studied . A variety of prescription or over the counter medicines as well as other exogenous substances may induce hypertension or contribute to treatment resistance . Drug - induced hypertension is among the most common causes of secondary hypertension and is frequently encountered in everyday clinical practice . However, despite the frequent occurrence of drug - induced hypertension, primary care physicians frequently miss the opportunity to detect and appropriately manage this iatrogenic form of secondary hypertension . Therefore, a detailed and meticulous medical history is of utmost importance in patients with resistant hypertension, since the identification and subsequent withdrawal of the offending drug may alleviate treatment resistance . However, withdrawal of the responsible agent is not always possible; in such cases, dose reduction and/or search for alternate treatment may substantially improve or even control blood pressure levels . Another very important aspect relates to the great variability of the effects of administered drugs on blood pressure . The administration of offending drugs can result in excessive blood pressure elevation in some individuals, while most individuals will experience little or no increases of blood pressure . Therefore, it would be very important to identify predictors of blood pressure elevation, in order to individualize drug treatment . A descriptive list of all exogenous agents capable of inducing or exaggerating hypertension is presented in table 2 . However, this paper will focus on the drugs that are widely used, represent the most common causes of drug - induced hypertension, and are thus of major clinical importance: nonsteroidal anti - inflammatory drugs (nsaids) and oral contraceptives . In addition, a brief comment regarding specific antineoplastic agents (anti - vegf) that have emerged as inducers of hypertension is presented at the end of this chapter, since many clinicians are not aware of this condition . By far, the most common cause of drug - induced hypertension is the use of nsaids . In 265 patients with resistant hypertension identified during a one - year period, treatment resistance was drug - related in 36% of the cases, with nsaids being responsible in 88% (personal unpublished data). Osteoarthritis is highly prevalent in the general population, and its prevalence would be even greater due to population aging and the obesity epidemic [11, 12]. Although lifestyle modification, exercise, and weight loss are considered as first - line therapeutic measures for patients with osteoarthritis, the vast majority of such patients require the systematic or intermittent use of either acetaminophen or nsaids for pain relief . Two large prospective cohort studies in normotensive women reported higher risks of subsequent hypertension among nsaids users than in women without regular nsaids administration [14, 15]. In the first study, the risk of developing hypertension was increased about two times in women using acetaminophen or nsaids . Acetaminophen consumption for 14 days per month and nsaids consumption for 514 days per month was necessary for the risk to be apparent . In the second study, women with frequent use of nonnarcotic analgesics (> 22 days / month) had statistically significant higher risk for developing hypertension; in particular, the hazard ratios were 1.20 for acetaminophen, 1.21 for aspirin, and 1.35 for nsaids . It has to be noted that although acetaminophen is considered to have a better safety profile than nsaids [16, 17], its use was associated with a moderate increase in the risk for incident hypertension in both males and females [18, 19]. Another large, case - control study revealed a 66% increased risk for initiating antihypertensive drugs in nsaids users compared to nonusers . These detrimental effects of nsaids on blood pressure have been also observed in two older meta - analyses of randomized trials with nsaids [21, 22]. In the first meta - analysis, mean arterial pressure was increased by 3.3 mmhg in hypertensive patients whereas the increase in normotensive subjects was negligible (1.1 mmhg). In the second meta - analysis, nsaids resulted in a significant mean arterial pressure elevation of 5.0 mmhg; blood pressure elevation was apparent in hypertensive patients with controlled blood pressure, whereas normotensive individuals did not experience such an effect . On the contrary, data reporting no or little effect of nsaids on blood pressure exist in the literature as well . In two cross - sectional studies, no association between use of nsaids and hypertension was found [23, 24]. Similar findings were observed in two small randomized studies regarding the effects of acetaminophen on blood pressure [25, 26], as well as in studies evaluating the effects of aspirin on blood pressure in hypertensive patients [27, 28]. In addition, in a large prospective cohort of 8,229 male normotensive physicians, analgesic use was not associated with increased risk of developing hypertension (hazard ratio: 1.12; 95% ci: 0.971.31). The corresponding hazard ratios were 1.08 (95% ci: 0.871.34) for acetaminophen, 1.16 (95% ci: 0.921.48) for aspirin, and 1.05 (95% ci: 0.891.24) for nsaids . This apparent heterogeneity of available data on the effects of traditional nsaids on blood pressure becomes even more complicated when recent data with selective cox-2 inhibitors are taken in account . In a meta - analysis of randomized trials, use of cox-2 inhibitors was associated with a significant increase in blood pressure compared to placebo (3.85/1.06 mmhg) and nonselective nsaids (2.83/1.34 mmhg). However, it was shown that a great part of blood pressure elevation could be attributed to rofecoxib . Indeed, rofecoxib use is associated with greater blood pressure elevations than celecoxib in both hypertensive and normotensive individuals . The above - mentioned study highlights another important aspect: the potential differences on blood pressure effects between the various nsaids . In a meta - analysis of randomized trials, conducted mainly in hypertensive patients, naproxen and indomethacin were associated with the largest blood pressure elevations, while piroxicam, sulindac, ibuprofen, and aspirin exhibited little if any effect on blood pressure . On the contrary, a randomized study in patients with controlled hypertension showed that the blood pressure was significantly higher with ibuprofen than with lumiracoxib . Moreover, in 34,701 participants at the medal (multinational etoricoxib and diclofenac arthritis long term) program, patients assigned to etoricoxib discontinued the study due to hypertension more frequently than patients randomized to diclofenac . Finally, the potential differences of the effects of nsaids on blood pressure according to the various antihypertensive agents coadministered are of great clinical importance . In a study of elderly hypertensives with osteoarthritis, indomethacin had no effect on blood pressure in patients taking calcium antagonists whereas significant blood pressure elevations were detected in patients taking ace - inhibitors . On the contrary, celecoxib exerted similar to placebo effects in patients taking ace - inhibitors . Another study among hypertensive patients with osteoarthritis, comparing the effects of rofecoxib and celecoxib, revealed no differences on blood pressure between the two drugs in patients taking diuretics or calcium antagonists, whereas larger blood pressure elevations were observed with rofecoxib than with celecoxib in patients taking ace - inhibitors or beta blockers . The above presented information clearly indicates that available data on the effects of nsaids on blood pressure are sometimes contradictory and in total far from conclusive . Convincing data coming from carefully designed randomized studies are necessary to: (a) detect potential differences between the various nsaids on blood pressure, (b) clarify the effects of coadministering each nsaid with each one of the various antihypertensive drug categories, and (c) identify predictors of blood pressure response to nsaids use . Withdrawal of nsaids is indicated in patients with resistant hypertension, exacerbation of prior hypertension, or incident hypertension . Substituting nsaids with acetaminophen pain relief is more likely in patients with osteoarthritis and pain of muscular skeletal origin . However, this is not always possible in everyday clinical practice, since patients with chronic inflammatory arthritic diseases (rheumatoid arthritis) respond better to anti - inflammatory agents . In such cases, hydrocodone, tramadol, or nerve blocking might be of help, constituting effective alternatives to nsaids . In cases, however, where nsaids are still necessary, the lower effective dose should be administered, since existing data point towards dose - related effects of nsaids on blood pressure . Nsaids affect blood pressure levels via different mechanisms: activation of the renin - angiotensin - aldosterone system, sodium and water retention, induction of vasoconstriction through endothelin-1 and arachidonic acid metabolites, and mainly inhibition of renal vasodilatory prostaglandins (e2 and i2) [3743]. These detrimental effects of nsaids may lead to deterioration of renal function and acute kidney injury, especially in patients of older age, preexisting hypertension, chronic kidney disease, or diabetes . In such patients, calcium antagonists seem to be more suitable than drugs inhibiting the renin - angiotensin system, since the concomitant administration of nsaids and calcium antagonists is not accompanied by blood pressure elevation [36, 39]. The development of nsaids that apart from cyclo - oxygenase inhibition possess nitric oxide promoting properties might significantly ameliorate current situation and alleviate the effects of nsaids on blood pressure . Cinods (cyclo - oxygenase inhibiting nitric oxide donating drugs) represent a new class of nsaids; cinod molecules consist of a traditional nsaid and a nitric oxide - donating chemical group connected by a linker . Naproxcinod is the first cinod in clinical trials with very promising preliminary results [4447]. Oral contraceptives represent another class of drugs that are widely used and are capable of inducing hypertension [48, 49]. The larger study evaluating the effects of oral contraceptives on blood pressure was the nurses' health study, in which more than 60,000 normotensive women were prospectively followed for 4 years . Women using oral contraceptives had an 80% higher risk of developing hypertension compared to women that were not using such drugs . However, withdrawal of oral contraceptives abolished this increased risk, underlining the need for close monitoring in women taking oral contraceptives . A study in hypertensive women revealed that those taking oral contraceptives had more severe hypertension and lower blood - pressure control rates than women using other contraceptive methods . Combined oral contraceptives (progestin and estradiol), which were widely used in the past, were associated with blood pressure elevations more frequently than progestin - only oral contraceptives . On the contrary, therefore, current guidelines recommend the use of progestin - only oral contraceptives in women with established cardiovascular disease, or major cardiovascular risk factors (such as hypertension) [53, 54]. It can, therefore, be summarized that oral contraceptives may contribute to resistance in hypertensive women, but the type of oral contraceptive is important . Close monitoring of women and withdrawal of oral contraceptives may alleviate the effects on blood pressure . Another class of agents that emerged as inducers of hypertension are the antineoplastic drugs that target the vegf pathway . A monoclonal antibody (bevacizumab) binding to the vegf - a isoform, as well as small molecules inhibiting the intracellular tyrosine kinase domains of all three vegf receptors, is used or is under clinical testing for the treatment of various malignancies [5557]. Hypertension was encountered very frequently in patients receiving treatment with vegf - inhibitors . In particular, 2030% of patients treated with bevacizumab, and 1560% of patients treated with vegf kinase inhibitors developed hypertension . Three meta - analyses with drugs inhibiting the vegf pathway uncovered a high relative risk for incident hypertension with these agents: 7.5 (95% ci: 4.213.4) with bevacizumab, 6.11 (95% ci: 2.4415.32) with sorafenib, and 21.6 (95% ci: 18.724.8) with sunitinib [6062]. Interestingly enough, the development of hypertension has been correlated with the efficacy of these drugs [6365], suggesting that hypertension could be used as a surrogate marker of anti - vegf efficacy . A phase iii trial evaluates this concept in patients with pancreatic cancer receiving anti - vegf agents . Clearly, more data are needed to clarify the blood pressure effects of the various drugs acting on the vegf pathway . Experimental studies have shown that vegf upregulates endothelial nitric oxide synthase [66, 67], enhances nitric oxide production, and induces nitric oxide - dependent vasorelaxation . Moreover, vegf was shown to result in enhanced prostacyclin production and release [70, 71]. It can be therefore anticipated that vegf inhibition may lead to reduction of nitric oxide and prostacyclin bioavailability, a subsequent increase of systemic vascular resistance, and finally blood pressure elevation . In addition, arteriolar rarefaction has been observed in animals treated with vegf kinase inhibitors, proposing another pathogenetic mechanism of hypertension with these drugs [7274]; preliminary studies in humans reported similar findings [75, 76]. Finally, enhanced arterial stiffness has been suggested as another contributing factor in the development of hypertension . The recognition of the pathogenetic mechanisms that contribute to blood pressure elevation with vegf - inhibitors might be helpful in identifying the most appropriate drugs for the management of these patients . Reliable data evaluating the efficacy of the various antihypertensive drug categories in anti - vegf - induced hypertension are missing . Preliminary reports point towards restricted efficacy of diuretics and beneficial effects of calcium antagonists; however, appropriate prospective studies are needed in this topic . A vast amount of evidence demonstrates an association between obstructive sleep apnea (osa) and hypertension . Such an association has been shown in epidemiological, longitudinal, and cross - sectional studies, as well as in studies from specialized clinics [8083]. In addition, it has been shown that osa in normotensive subjects predicts future development of hypertension . Sympathetic nervous system activation plays a crucial role in the pathogenesis of hypertension in patients with osa . Enhanced upper airway resistance and intermittent hypoxia are considered to stimulate the sympathetic system, while the subsequent sympathetic overactivity may result in blood pressure elevation via vasoconstriction and increased systemic vascular resistance, increased cardiac output, and enhanced fluid retention . The exact nature of the association between osa and aldosterone excess remains to be elucidated . Whether osa results in aldosterone excess or aldosterone excess contributes to osa, or another underlying factor (like obesity) promoting both aldosterone excess and osa has not been clarified . Several studies have reported an extremely high prevalence of osa in patients with resistant hypertension . Two decades ago, a swedish study of 16 patients with resistant hypertension reported a 56% prevalence of osa in these patients compared to 19% in patients with controlled hypertension . In a study of 41 consecutive resistant hypertensives, an 83% prevalence of unsuspected osa was found; osa was defined as an apnea / hypopnea index (ahi) of more than 10 events per hour . Another study of 71 patients with resistant hypertension revealed an 85% prevalence of osa (ahi 5 events / h). A study from spain in 62 resistant hypertensives reported a 90% prevalence of osa (ahi 5 events / h). However, when the diagnosis of osa was based on 30 or more episodes of apnea / hypopnea per hour, the prevalence was reduced to 70%, underlining the importance of accurate and homogeneous definition of osa . Moreover, all the above - mentioned recent studies did not have a control group in order to exclude the potential effects of confounding factors . A recent study from brazil evaluated 63 patients with resistant hypertension and an equal number of patients with controlled hypertension, matched for baseline parameters apart from blood pressure . A strong and independent association between osa and resistant hypertension has been described (odds ratio: 4.8; 95% ci: 2.011.7); osa (ahi 10 events / h) in 71% of resistant hypertensives and in 38% of responders . Continuous positive airway pressure (cpap) represents the treatment of choice for patients with osa . It has been shown that cpap decreases the incidence of cardiovascular events in patients with osa [89, 90].the acute application of cpap attenuates blood pressure elevations during sleep . However, the long - term effects of cpap on blood pressure are controversial, from studies reporting a significant decrease in blood pressure to studies reporting small or no effects [92106]. Three meta - analyses have tried to overcome these discrepancies and revealed that the beneficial effect is modest, with reductions in systolic blood pressure ranging from 1.38 mmhg to 2.46 mmhg [107109]. It is, therefore, not surprising that in a recent randomized study, valsartan was more effective than cpap in hypertensive patients with osa . It has to be noted, however, that most of the above - mentioned studies have not been performed exclusively in hypertensive patients, usually evaluating both normotensive and hypertensive subjects . In addition, larger blood pressure reductions were observed in osa patients with higher baseline blood pressure levels [107, 111], as expected with any antihypertensive approach; the motto the higher the blood pressure, the larger the reduction has been verified over the years . Indeed, two small studies in osa patients with resistant hypertension revealed significant blood pressure reductions (over 10 mmhg) [112, 113]. On the contrary, a study in 42 patients with resistant hypertension showed a smaller mean arterial pressure reduction (5.6 mmhg; 95% ci: 2.08.7 mmhg; p <.03). Interestingly enough, the benefits of cpap were evident only at 1-year after cpap application, suggesting that longer followup periods might be necessary for the benefits of cpap treatment to become apparent in osa patients with resistant hypertension . Another important factor is that cpap treatment allowed de - escalation of antihypertensive treatment in the majority of participating patients (71%). A recent study in 96 patients with osa and resistant hypertension showed a slight decrease in systolic blood pressure (1.3 mmhg). However, the reduction was significantly larger in patients with abpm - confirmed resistant hypertension (7.6 mmhg). In addition, the reduction was even larger in cpap users for more than 5.8 hours per day . The above - mentioned data delineate the complexity in identifying patients with resistant hypertension and osa that will have the greater benefits with cpap treatment . An important issue challenging the efficacy of cpap relates to patient adherence . Among patients prescribed cpap therapy up to 50% failed to initiate it or did not use it at 3 years [116, 117]. Another important aspect of treatment is the choice of antihypertensive drugs in patients with osa . The crucial role of sns activation and the increased levels of aldosterone in patients with osa, point towards potential advantages of drugs inhibiting these pathways on reducing blood pressure . Indeed, beta blockers were found to be more effective than other antihypertensive drugs in osa patients; however, relevant data is still far from conclusive . Even more interestingly, however, spironolactone was shown not only to significantly lower blood pressure in 12 patients with osa and resistant hypertension, but to reduce the severity of osa as well . Further, larger studies are needed, however, to confirm these beneficial effects of spironolactone in patients with osa . Pa is characterized by autonomous production of aldosterone by adrenal glands and the subsequent decrease in renin levels though negative feedback . Aldosterone excess leads to hypertension, metabolic alkalosis, hypernatremia, and potassium loss resulting in hypokalemia; the latter is currently considered a late manifestation of pa . Pa can result from an aldosterone producing adenoma, bilateral adrenal hyperplasia, glucocorticoid - remediable aldosteronism, or rare familial syndromes . Although the diagnosis of adrenal adenomas prevailed during the older times, recent reports reveal that hyperplasia is more frequent than adrenal adenomas . The prevalence of pa in the general hypertensive population remains an unresolved issue [122, 123]. Historically, pa has been considered a rare disease, affecting about 1% of hypertensive patients [124127]. However, several studies performed in the last decade report a much higher prevalence of pa (> 10%), suggesting an epidemic of this condition [128133]. These studies, however, were carried out in specialized referral centers, raising concerns of selection bias . Indeed, a study of more than 600 unselected patients with hypertension conducted in chile, revealed a 6.1% prevalence of pa, suggesting that the true prevalence is somewhere in the middle . However, irrespective of its exact prevalence, pa has become fashionable again, with leading specialized centers appearing all over the world, from alabama (d. calhoun) to italy (g. rossi) and from australia (m. stowasser) to united kingdom (m. brown). The prevalence of hypertension relates to the severity of hypertension . In the study from chile, pa was found in 1.99% of patients with stage i hypertension and in 13.2% of patients with stage iii hypertension . In another study of more than 400 czech patients with moderate - to - severe hypertension, data from clinical practice indicates that resistant hypertension represents the condition with the highest probability of detecting pa [136, 137]. Indeed, the prevalence of pa ranged from 1423% in 5 studies conducted in resistant hypertensives [138142]. A study of 88 patients with resistant hypertension in alabama showed that 18 patients (20%) suffered from pa; pa prevalence was race independent . The prevalence of pa was quite similar in two other studies, one from seattle (17%) and one from norway (23%) [139, 140]. A study from spain reported a 14% prevalence of primary hyperaldosteronism in patients with refractory hypertension; however, patients with hypokalemia were excluded from the study suggesting that the true prevalence of primary aldosteronism could be up to two times higher than the one reported . Finally, a similar prevalence of 14% has been reported in diabetic subjects with resistant hypertension . The above - mentioned studies have reported a pa prevalence of 1423% in patients with resistant hypertension, suggesting that the true prevalence would be around 20% . However, it has to be recognized that all these studies included a small number of patients . In total, only 418 patients participated in these studies, underlining the need for larger studies . A recent study from greece evaluated 2,032 patients with resistant hypertension, with 1,616 of them having true resistant hypertension . It was found that about 21% of studied patients had a high aldosterone to renin ratio combined with high aldosterone levels, which were suggestive of primary aldosteronism . However, only half of them (11.3%) were suffering for primary aldosteronism, confirmed by salt suppression tests and response to spironolactone . Another very interesting finding is the coexistence of pa and osa in patients with resistant hypertension . In one study of 109 patients with resistant hypertension, osa however, in another study, pa was found in only 34% of patients with osa . . The other forms of endocrine hypertension, presented in table 3, are less frequently encountered in hypertensive patients and, therefore, represent rare causes of resistant hypertension . In addition, the clinical presentation of these endocrine forms of secondary hypertension is usually so characteristic that is really hard to be missed . Since this paper addresses the most common secondary causes of resistant hypertension, readers interested in endocrine hypertension may refer to other recently published reviews [146, 147]. Hypertension is commonly found in patients with chronic kidney disease (ckd), with 75% of ckd patients taking antihypertensive drugs . On the other hand, it seems that the relationship between hypertension and ckd is bidirectional; the kidney is both the victim and the culprit in this relationship . All recent guidelines recommend lower blood pressure goals in patients with ckd, especially when frank albuminuria is present [149151]. It has been shown, however, that the vast majority (> 85%) of patients with ckd fail to achieve these goals; blood pressure control rates in ckd patients are lower than in other hypertensive patients despite the use of 3 antihypertensive drugs in average [152, 153]. It is, therefore, not surprising that the prevalence of resistant hypertension in patients with ckd is over 50% . However, ckd is usually underappreciated as a cause of resistant hypertension, mainly because these patients are being followed at specialized nephrology clinics . Sodium and fluid retention plays a cardinal role, while the increased activity of both the sympathetic and the renin - angiotensin - aldosterone systems greatly contribute to treatment resistance . Moreover, vascular alterations both at a structural and functional (increased endothelin-1, decreased nitric oxide bioavailability) level, combined with the consequences of renal ischemia play an additional role . Another significant contributor to treatment resistance in patients with ckd it has been observed that restrictions in diuretic use were the primary cause of resistant hypertension in patients with ckd . Restricted diuretic use includes either lower doses or inappropriate drug selection; thiazides are usually not effective when gfr is lower than 40 and should, therefore, be replaced by loop diuretics in such patients . In the case that furosemide is chosen, it has to be given at least twice daily due to its limited half - life . Finally, dietary salt reduction may effectively attenuate volume expansion and offer significant benefits in these patients . Another important key aspect in patients with ckd is the assessment of urinary albumin excretion . Drugs inhibiting the rennin - angiotensin axis (ace - inhibitors, angiotensin receptor blockers, and direct rennin inhibitors) should be included in the therapeutic regime, since their use is associated with reduction of albuminuria and end - stage renal disease . The combination of ace - inhibitors with angiotensin receptor blockers has not proven any benefits in high - risk patients at the ontarget study and was even associated with more adverse effects [158, 159]. However, this combination might still be beneficial in patients with ckd and overt albuminuria . Renovascular hypertension is of atherosclerotic origin in the vast majority of cases, thus being more frequent in older individuals, diabetics, smokers, and in patients with atherosclerotic lesions at other vascular beds [161, 162]. Indeed, about 25% of patients undergoing cardiac catheterization are found to have renal artery stenosis (ras) higher than 70%, which could be of clinical significance [163, 164]. On the other hand, fibromuscular dysplasia is a much less frequent cause of ras (approximately 10%) than atherosclerosis, and is more frequently encountered in younger females . Older studies suggested that 1 out of 3 patients with secondary hypertension has renovascular hypertension [165, 166]. Unfortunately, recent studies in patients with resistant hypertension usually focus on osa and pa and do not even mention ras . It seems that ras came out of fashion, mainly because its diagnosis with noninvasive methods remains tricky . Although several methods are used for the detection of ras (duplex ultrasound, renal scintigraphy, ands ct and mr angiography) with rather good sensitivity and specificity, the diagnosis of renovascular hypertension represents an unfulfilled challenge for primary care physicians and remains mainly restrained in specialized centers . Three choices are available nowadays: surgical treatment, balloon angioplasty (with or without stenting), and conservative drug treatment . The surgical approach has subsided during the last decades and is now reserved for specific indications . Balloon angioplasty was not found superior to optimal drug treatment in the recently published astral study; several drawbacks, however, limit the interpretation of study findings . Another ongoing trial, the coral study, will provide hard - endpoint data with the two different approaches . Although it seems rational for patients with resistant hypertension to be referred to specialized hypertension clinics, the initial evaluation can be performed by primary care physicians . We will, therefore, attempt to provide a step - by - step approach for the evaluation and treatment of patients with resistant hypertension . The first steps may take place at the primary care level, in the attempt to substantially reduce the number of referred patients and prevent unnecessary costs and patient discomfort . In summary, (i) verification of true resistant hypertensionpatients with pseudoresistance should be identified and excluded from further evaluation . Three main problems require special attention at this step: patient - related problems, physician - related problems, and blood - pressure technique - related problems . Patient - related problems . Adherence to antihypertensive treatment is of utmost importance for the effective management of arterial hypertension . Both epidemiological and clinical data strongly indicate that patient adherence to antihypertensive therapy is poor [170175]. Almost half of treated hypertensive patients discontinue drug administration during the first year of treatment whereas long - term adherence rates are even lower . In addition, small studies in patients with resistant hypertension suggest that poor patient adherence represents one of the most common causes of treatment resistance [176, 177]. Detailed medical history, information by relatives, and use of specific questionnaires might help in identifying patients with poor adherence; these methods can be easily applied by primary care physicians with obvious benefits . Modern technology is used with good results (electronic pill boxes, internet monitoring) but is not widely applied yet . Special programmes using close contact of health care professionals (doctors, nurses, and pharmacists) with patients seem also effective but lack wide application as well . Finally, simplification of dosing schedule and use of drugs with superior safety profile may be of benefit . It has been shown that doctors are frequently reluctant to maximize drug therapy, either by adding antihypertensive drugs or by switching drug category, in order to achieve blood pressure goals [178181]. Indeed, a gap between guideline recommendations and their implementation in everyday clinical practice has been recognized and represents a significant obstacle in achieving satisfying blood pressure control rates [149, 150]. Another contributor to treatment resistance is the use of inappropriate drug combinations or suboptimal doses of antihypertensive drugs . Indeed, a study of patients with resistant hypertension revealed that simple measures, such as increasing diuretic dosing or switching to appropriate diuretics, can result in significant blood pressure reductions . In our opinion, however, the most important line of evidence suggesting physician inertia on treatment resistance, comes from recent studies reporting significantly higher control rates of hypertension [182185]. In these studies, various measures have been used to motivate physicians in achieving blood pressure goals, resulting in improved control rates . Therefore, physicians need to be the focus of future efforts for the effective management of resistant hypertension . Blood pressure technique - related problems . The requirements for proper blood pressure measurement have been standardized and incorporated in the guidelines for the management of arterial hypertension [149, 150]. However, the measurement of office blood pressure in clinical practice frequently deviates from the recommendations . Therefore, falsely elevated blood pressure levels may be recorded due to several reasons: inappropriate cuff size, failure to comply with the recommendations regarding sufficient time before blood - pressure measurement, arm support at the heart level, assessment in a quiet room, triplicate recordings, and coffee intake or smoking before blood pressure measurement [187189]. The above mentioned factors may contribute to overestimation of blood pressure and pseudoresistance . Similarly, false elevations may be encountered in older patients, in whom adequate artery compression may not be achieved due to marked arterial calcification . Therefore, it is essential to assure proper techniques of blood pressure measurement in order to limit the rates of pseudoresistance . Another important aspect of resistance is recognition of white coat hypertension . It has been noted that in 2030% of patients with resistant hypertension, treatment resistance may be attributed to the white coat effect [143, 190192]. Target organ damage therefore, either ambulatory or home blood - pressure monitoring should be performed in every patient with resistant hypertension, in order to exclude the three main problems require special attention at this step: patient - related problems, physician - related problems, and blood - pressure technique - related problems . Patient - related problems . Adherence to antihypertensive treatment is of utmost importance for the effective management of arterial hypertension . Both epidemiological and clinical data strongly indicate that patient adherence to antihypertensive therapy is poor [170175]. Almost half of treated hypertensive patients discontinue drug administration during the first year of treatment whereas long - term adherence rates are even lower . In addition, small studies in patients with resistant hypertension suggest that poor patient adherence represents one of the most common causes of treatment resistance [176, 177]. Detailed medical history, information by relatives, and use of specific questionnaires might help in identifying patients with poor adherence; these methods can be easily applied by primary care physicians with obvious benefits . Modern technology is used with good results (electronic pill boxes, internet monitoring) but is not widely applied yet . Special programmes using close contact of health care professionals (doctors, nurses, and pharmacists) with patients seem also effective but lack wide application as well . Finally, simplification of dosing schedule and use of drugs with superior safety profile may be of benefit . It has been shown that doctors are frequently reluctant to maximize drug therapy, either by adding antihypertensive drugs or by switching drug category, in order to achieve blood pressure goals [178181]. Indeed, a gap between guideline recommendations and their implementation in everyday clinical practice has been recognized and represents a significant obstacle in achieving satisfying blood pressure control rates [149, 150]. Another contributor to treatment resistance is the use of inappropriate drug combinations or suboptimal doses of antihypertensive drugs . Indeed, a study of patients with resistant hypertension revealed that simple measures, such as increasing diuretic dosing or switching to appropriate diuretics, can result in significant blood pressure reductions . In our opinion, however, the most important line of evidence suggesting physician inertia on treatment resistance, comes from recent studies reporting significantly higher control rates of hypertension [182185]. In these studies, various measures have been used to motivate physicians in achieving blood pressure goals, resulting in improved control rates . Therefore, physicians need to be the focus of future efforts for the effective management of resistant hypertension . Blood pressure technique - related problems . The requirements for proper blood pressure measurement have been standardized and incorporated in the guidelines for the management of arterial hypertension [149, 150]. However, the measurement of office blood pressure in clinical practice frequently deviates from the recommendations . Therefore, falsely elevated blood pressure levels may be recorded due to several reasons: inappropriate cuff size, failure to comply with the recommendations regarding sufficient time before blood - pressure measurement, arm support at the heart level, assessment in a quiet room, triplicate recordings, and coffee intake or smoking before blood pressure measurement [187189]. The above mentioned factors may contribute to overestimation of blood pressure and pseudoresistance . Similarly, false elevations may be encountered in older patients, in whom adequate artery compression may not be achieved due to marked arterial calcification . Therefore, it is essential to assure proper techniques of blood pressure measurement in order to limit the rates of pseudoresistance . Another important aspect of resistance is recognition of white coat hypertension . It has been noted that in 2030% of patients with resistant hypertension, treatment resistance may be attributed to the white coat effect [143, 190192]. Target organ damage therefore, either ambulatory or home blood - pressure monitoring should be performed in every patient with resistant hypertension, in order to exclude the patient - related problems . Adherence to antihypertensive treatment is of utmost importance for the effective management of arterial hypertension . Both epidemiological and clinical data strongly indicate that patient adherence to antihypertensive therapy is poor [170175]. Almost half of treated hypertensive patients discontinue drug administration during the first year of treatment whereas long - term adherence rates are even lower . In addition, small studies in patients with resistant hypertension suggest that poor patient adherence represents one of the most common causes of treatment resistance [176, 177]. Detailed medical history, information by relatives, and use of specific questionnaires might help in identifying patients with poor adherence; these methods can be easily applied by primary care physicians with obvious benefits . Modern technology is used with good results (electronic pill boxes, internet monitoring) but is not widely applied yet . Special programmes using close contact of health care professionals (doctors, nurses, and pharmacists) with patients seem also effective but lack wide application as well . Finally, simplification of dosing schedule and use of drugs with superior safety profile may be of benefit . It has been shown that doctors are frequently reluctant to maximize drug therapy, either by adding antihypertensive drugs or by switching drug category, in order to achieve blood pressure goals [178181]. Indeed, a gap between guideline recommendations and their implementation in everyday clinical practice has been recognized and represents a significant obstacle in achieving satisfying blood pressure control rates [149, 150]. Another contributor to treatment resistance is the use of inappropriate drug combinations or suboptimal doses of antihypertensive drugs . Indeed, a study of patients with resistant hypertension revealed that simple measures, such as increasing diuretic dosing or switching to appropriate diuretics, can result in significant blood pressure reductions . In our opinion, however, the most important line of evidence suggesting physician inertia on treatment resistance, comes from recent studies reporting significantly higher control rates of hypertension [182185]. In these studies, various measures have been used to motivate physicians in achieving blood pressure goals, resulting in improved control rates . Therefore, physicians need to be the focus of future efforts for the effective management of resistant hypertension . Blood pressure technique - related problems . The requirements for proper blood pressure measurement have been standardized and incorporated in the guidelines for the management of arterial hypertension [149, 150]. However, the measurement of office blood pressure in clinical practice frequently deviates from the recommendations . Therefore, falsely elevated blood pressure levels may be recorded due to several reasons: inappropriate cuff size, failure to comply with the recommendations regarding sufficient time before blood - pressure measurement, arm support at the heart level, assessment in a quiet room, triplicate recordings, and coffee intake or smoking before blood pressure measurement [187189]. The above mentioned factors may contribute to overestimation of blood pressure and pseudoresistance . Similarly, false elevations may be encountered in older patients, in whom adequate artery compression may not be achieved due to marked arterial calcification . Therefore, it is essential to assure proper techniques of blood pressure measurement in order to limit the rates of pseudoresistance . Another important aspect of resistance is recognition of white coat hypertension . It has been noted that in 2030% of patients with resistant hypertension, treatment resistance may be attributed to the white coat effect [143, 190192]. Target organ damage therefore, either ambulatory or home blood - pressure monitoring should be performed in every patient with resistant hypertension, in order to exclude the (ii) exclusion of drug - induced hypertensionas discussed in the first section of this paper, several drugs may induce blood pressure elevations, with nsaids and oral contraceptives being the most common . Therefore, practicing physicians need to be very meticulous during medical history taking, in order to uncover the use of drugs inducing hypertension . The withdrawal of offended drugs usually results to the return of blood pressure at previous levels . In the case, however, that the drug is considered essential for the treatment of comorbidities, the substitution to another drug with a more friendly profile or the reduction of dose might be beneficial . As discussed in the first section of this paper, several drugs may induce blood pressure elevations, with nsaids and oral contraceptives being the most common . Therefore, practicing physicians need to be very meticulous during medical history taking, in order to uncover the use of drugs inducing hypertension . The withdrawal of offended drugs usually results to the return of blood pressure at previous levels . In the case, however, that the drug is considered essential for the treatment of comorbidities, the substitution to another drug with a more friendly profile or the reduction of dose might be beneficial . (iii) reduction of dietary sodium intakesodium intake is excessive in the western world, mainly due to the hidden salt in processed foods . The average sodium intake is far higher than the recommended 2.4 grams per day, reaching even 10 g / day in patients with resistant hypertension . The important role of sodium restriction in patients with resistant hypertension is highlighted by the findings of a recent study . It was found that reductions in sodium intake are accompanied by significant reductions in blood pressure levels in resistant hypertensives . Sodium intake is excessive in the western world, mainly due to the hidden salt in processed foods . The average sodium intake is far higher than the recommended 2.4 grams per day, reaching even 10 g / day in patients with resistant hypertension . The important role of sodium restriction in patients with resistant hypertension is highlighted by the findings of a recent study . It was found that reductions in sodium intake are accompanied by significant reductions in blood pressure levels in resistant hypertensives . (iv) evaluation for secondary causes of hypertensionas previously discussed, obstructive sleep apnea, primary aldosteronism, and chronic kidney disease represent the most common secondary causes of resistant hypertension whereas several other conditions may be responsible for treatment resistance as well . The diagnostic workup for secondary hypertension is demanding, requires special knowledge and technology, and should be performed in specialized referral centers, which are familiar with secondary hypertension . Although a detailed description of the diagnostic workup is beyond the scope of this paper, some signs and/or findings raising the suspicion of secondary hypertension need to be mentioned . In particular: obesity, snoring, daytime sleepiness, and increased neck diameter raise the suspicion of obstructive sleep apnea; hypokalemia (either spontaneous or diuretic induced) is present in about half of cases with primary aldosteronism; active urine sediment, small kidneys, and impaired renal function point towards chronic kidney disease; abdominal bruit, difference in renal size raise the suspicion of renal artery stenosis .. as previously discussed, obstructive sleep apnea, primary aldosteronism, and chronic kidney disease represent the most common secondary causes of resistant hypertension whereas several other conditions may be responsible for treatment resistance as well . The diagnostic workup for secondary hypertension is demanding, requires special knowledge and technology, and should be performed in specialized referral centers, which are familiar with secondary hypertension . Although a detailed description of the diagnostic workup is beyond the scope of this paper, some signs and/or findings raising the suspicion of secondary hypertension need to be mentioned . In particular: obesity, snoring, daytime sleepiness, and increased neck diameter raise the suspicion of obstructive sleep apnea; hypokalemia (either spontaneous or diuretic induced) is present in about half of cases with primary aldosteronism; active urine sediment, small kidneys, and impaired renal function point towards chronic kidney disease; abdominal bruit, difference in renal size raise the suspicion of renal artery stenosis .. (v) pharmacologic management of resistant hypertensionthe pathophysiology of resistant hypertension provides the rational for the effective management of this clinical entity . The combination of increased systemic vascular resistance with marked volume expansion in many cases, renders the triple combination of a drug inhibiting the renin - angiotensin axis (ace - inhibitors or angiotensin receptor blockers) with a calcium antagonist and a diuretic a very attractive combination for the majority of patients (unless these drugs are contraindicated or not tolerated, or other drugs are indicated due to comorbidities). However, reliable data verifying the superiority of this combination over other combinations is not available . Special attention has to be drawn in maximizing the dose of diuretics or switching to loop diuretics in patients with low gfr . The overactivation of the sympathetic nervous system renders beta blockers, alpha blockers, and centrally acting antihypertensive drugs (clonidine, alpha methyldopa) of potential benefit in many patients when added in previous therapy . Direct vasodilators, such as hydralazine and minoxidil, can be very effective for blood pressure management, especially in african americans and patients with chronic kidney disease . A vast amount of evidence indicates that spironolactone is a drug of choice in the treatment of resistant hypertension . Several studies revealed impressive blood pressure reductions in patients with resistant hypertension when spironolactone was added in the therapeutic regime [195205]. Administration of one antihypertensive drug at bedtime has been shown to improve blood pressure control in patients with resistant hypertension [206208]. The pathophysiology of resistant hypertension provides the rational for the effective management of this clinical entity . The combination of increased systemic vascular resistance with marked volume expansion in many cases, renders the triple combination of a drug inhibiting the renin - angiotensin axis (ace - inhibitors or angiotensin receptor blockers) with a calcium antagonist and a diuretic a very attractive combination for the majority of patients (unless these drugs are contraindicated or not tolerated, or other drugs are indicated due to comorbidities). However, reliable data verifying the superiority of this combination over other combinations is not available . Special attention has to be drawn in maximizing the dose of diuretics or switching to loop diuretics in patients with low gfr . The overactivation of the sympathetic nervous system renders beta blockers, alpha blockers, and centrally acting antihypertensive drugs (clonidine, alpha methyldopa) of potential benefit in many patients when added in previous therapy . Direct vasodilators, such as hydralazine and minoxidil, can be very effective for blood pressure management, especially in african americans and patients with chronic kidney disease . A vast amount of evidence indicates that spironolactone is a drug of choice in the treatment of resistant hypertension . Several studies revealed impressive blood pressure reductions in patients with resistant hypertension when spironolactone was added in the therapeutic regime [195205]. Administration of one antihypertensive drug at bedtime has been shown to improve blood pressure control in patients with resistant hypertension [206208]. (vi) newer drugs for the management of resistant hypertension endothelin antagonists exhibited promising results in preliminary studies . The future of darusentan remains unclear, however, since in another study in patients with resistant hypertension, darusentan failed to be more effective than placebo regarding office blood pressure reductions . It has to be mentioned, however, that in the latter study, significant differences were detected in ambulatory blood pressure between darusentan and placebo, indicating that further studies are needed with this drug category . Another interesting approach for the management of resistant hypertension is the administration of nitric oxide donors . In a recent small clinical study of six patients with resistant hypertension, however, this finding has to be interpreted with caution, since the concomitant use of these medications is contraindicated due to the possibility of severe hypotension . The future of darusentan remains unclear, however, since in another study in patients with resistant hypertension, darusentan failed to be more effective than placebo regarding office blood pressure reductions . It has to be mentioned, however, that in the latter study, significant differences were detected in ambulatory blood pressure between darusentan and placebo, indicating that further studies are needed with this drug category . Another interesting approach for the management of resistant hypertension is the administration of nitric oxide donors . In a recent small clinical study of six patients with resistant hypertension, however, this finding has to be interpreted with caution, since the concomitant use of these medications is contraindicated due to the possibility of severe hypotension . (vii) interventional management of resistant hypertensiondespite the wide application of antihypertensive therapy, a substantial portion of the hypertensive population remains uncontrolled although taking more than three drugs . This situation calls for testing alternative approaches in patients with resistant hypertension . Carotid baroreceptors and renal sympathetic overdrive play a significant role in blood pressure regulation [212, 213]. During the last decade, two new approaches have revived the use of interventional techniques for the management of resistant hypertension . Carotid baroreceptor stimulation and renal sympathetic denervation have shown promising preliminary results in patients with resistant hypertension [214, 215]. However, further studies are needed to establish their role in the management of resistant hypertension . Despite the wide application of antihypertensive therapy, a substantial portion of the hypertensive population remains uncontrolled although taking more than three drugs . This situation calls for testing alternative approaches in patients with resistant hypertension . Carotid baroreceptors and renal sympathetic overdrive play a significant role in blood pressure regulation [212, 213]. During the last decade, two new approaches have revived the use of interventional techniques for the management of resistant hypertension . Carotid baroreceptor stimulation and renal sympathetic denervation have shown promising preliminary results in patients with resistant hypertension [214, 215]. However, further studies are needed to establish their role in the management of resistant hypertension.
The use of transradial coronary angiography and intervention (tri) is increasing because of its low rates of major vascular access - related complications and the potential for early mobilization.1)2) a large - bore guiding catheter (gc) with a large - bore introducer sheath is needed in patients with complex lesions, but they cannot be used in patients with a small radial artery (ra) because they can cause forearm discomfort and ra spasm and occlusion,3) which are significant limitations to the transradial approach . To conquer this limitation, gc that does not require the sheathless gc system (sheathless eaucath, asahi intecc, japan) consists of a hydrophilic gc and a central dilator . This system can be used to insert the gc into the ra without the use of an introducer sheath . The outer diameter of the 6.5 french (fr .) Sheathless gc (2.16 mm) is smaller than a 5 fr . Sheathless gc (2.49 mm) is also less than that of a 6 fr . 1). With this feature, the sheathless gc system enables performance of tri even in patients with small ras . Furthermore, the hydrophilic coating that is present along the entire length of the gc may be helpful in reducing radial pain and ra spasm . Here, we evaluated the feasibility of coronary intervention using the sheathless gc in patients with small ras . All patients underwent diagnostic coronary angiography using a 5 fr . Conventional catheter through a 5 fr . Patients who required primary percutaneous coronary intervention (pci) were excluded because preparation of a sheathless gc that is composed of two pieces (a catheter and a central dilator) requires more time than a conventional one - piece gc . All procedures were performed in the left ra unless the patient had a history of previous angiography through the right ra . A loading dose of 600 mg clopidogrel and 300 mg aspirin was given to all patients at least three hours before the procedure . We administered 5,000 units of heparin through the ra after insertion of the 5 fr . Introducer sheath . An additional dose of 5,000 units heparin was given through the same route before pci the ra was punctured using a 20-g venous needle at a point 5 - 10 mm proximal to the styloid process after subcutaneous infiltration with 0.6 ml of 2% lidocaine . A 5 fr . Normal saline (10 ml) with 200 g of nitroglycerine was injected into the ra through the introducer sheath to prevent ra spasm . Angiography of the ra was performed after injection of normal saline (10 ml) with 200 g of nitroglycerine . A 30- to 40-mm long segment of ra from the tip of the introducer sheath was selected for the determination of the mean diameter . The mean of the maximal and minimal diameter of the selected segment of ra was used to determine the size of the ra using a computer - assisted quantification method (ge, us). Because the outer diameter of the 5 fr . Introducer sheath was approximately 2.3 mm in diameter, a small ra was defined as a diameter 2.3 mm . After the diagnostic angiography, the sheath was exchanged for the sheathless catheter over a standard 150 cm j - tipped 0.035-inch (terumo, japan) wire . The shape and size of the sheathless gc the sheathless gc was composed of two parts: a hydrophilic catheter and a central dilator . The sheathless gc with the central dilator was advanced along the 0.035-inch wire to the proximal ascending thoracic aorta . The ostium of the selected coronary artery was engaged by the gc and pci was performed . We defined procedural success as the successful implantation of stent(s) with final thrombolysis in myocardial infarction flow grade 3 and residual stenosis <30%, despite the selection of the gc . All patients underwent diagnostic coronary angiography using a 5 fr . Conventional catheter through a 5 fr . Patients who required primary percutaneous coronary intervention (pci) were excluded because preparation of a sheathless gc that is composed of two pieces (a catheter and a central dilator) requires more time than a conventional one - piece gc . All procedures were performed in the left ra unless the patient had a history of previous angiography through the right ra . A loading dose of 600 mg clopidogrel and 300 mg aspirin was given to all patients at least three hours before the procedure . We administered 5,000 units of heparin through the ra after insertion of the 5 fr . Introducer sheath . An additional dose of 5,000 units heparin was given through the same route before pci . The ra was punctured using a 20-g venous needle at a point 5 - 10 mm proximal to the styloid process after subcutaneous infiltration with 0.6 ml of 2% lidocaine . A 5 fr . Normal saline (10 ml) with 200 g of nitroglycerine was injected into the ra through the introducer sheath to prevent ra spasm . Angiography of the ra was performed after injection of normal saline (10 ml) with 200 g of nitroglycerine . A 30- to 40-mm long segment of ra from the tip of the introducer sheath was selected for the determination of the mean diameter . The mean of the maximal and minimal diameter of the selected segment of ra was used to determine the size of the ra using a computer - assisted quantification method (ge, us). Because the outer diameter of the 5 fr . Introducer sheath was approximately 2.3 mm in diameter, a small ra was defined as a diameter 2.3 mm . After the diagnostic angiography, the sheath was exchanged for the sheathless catheter over a standard 150 cm j - tipped 0.035-inch (terumo, japan) wire . The shape and size of the sheathless gc the sheathless gc was composed of two parts: a hydrophilic catheter and a central dilator . The sheathless gc with the central dilator was advanced along the 0.035-inch wire to the proximal ascending thoracic aorta . The ostium of the selected coronary artery was engaged by the gc and pci was performed . We defined procedural success as the successful implantation of stent(s) with final thrombolysis in myocardial infarction flow grade 3 and residual stenosis <30%, despite the selection of the gc . A total of 25 patients (29 lesions) with a small ra who underwent pci using a sheathless gc were included in this study . The mean age was 66.110.2 years, and nine (36.0%) patients were men . Approximately half of the patients had a history of hypertension (52.0%) and diabetes mellitus (52.0%). Eleven (44.0%) patients had stable angina, 12 (48.0%) had acute coronary syndrome, and two (8.0%) had ischemic heart failure . Twenty (69.0%) lesions were located in the left anterior descending (lad) coronary artery . According to the modified american college of cardiology / american heart association criteria, most of the lesions were type b2 (27.6%) or c (37.9%). A 6.5 fr . Power backup (pb) 3 cm sheathless gc was used in approximately half of the cases (51.7%). Most of the lesions were implanted with a zotarolimus - eluting stent(s) (48.2%) or everolimus - eluting stent(s) (37.9%). One lesion consisting of restenosis of a previously implanted drug - eluting stent was treated using balloon angioplasty with a cutting balloon . The mean total length of the stents was 36.819.9 mm and the mean diameter was 2.960.43 mm . Two of three bifurcated lesions were treated with a kissing balloon technique and one lesion was treated with two stents by using a modified t - stenting technique . Two of the successfully treated lesions required conversion to a conventional gc after insertion of the 6 fr . Amplatz left (al) 0.75 sheathless gc in the right coronary artery (rca) was treated by conversion to 6 fr . These two sheathless gcs did not engage the coronary arteries and provided poor guiding support; however, the main reason for conversion to a conventional gc was a limitation in gc shape selection . The two failed lesions were chronic total occlusions (cto) in the lad that could not be crossed with a guidewire supported by a microcatheter . Only one patient, who developed ra spasm during coronary angiography using a conventional 5 fr catheter, complained of forearm pain during pci . Although there was no immediate access site complication including hematoma and bleeding, two patients lost pulse in the ra used as the access site without hand ischemia during a median 357 (140 - 432) days of follow - up . Our study shows the feasibility of tri using a sheathless gc in 25 consecutive patients (29 lesions) with small ras (diameter 2.3 mm). The procedural success rate of tri is comparable to that of transfemoral coronary intervention with the benefit of lower rates of bleeding and fewer vascular complications.1)2) however, a larger gc and introducer sheath cannot be used in some patients because of the small diameter of their ra . Saito et al.3) demonstrated that the ras were smaller than the outer diameter of a 6 fr . They also reported that when the ratio of the ra inner diameter to the cannulated sheath outer diameter was less than 1.0, the incidence of flow reduction was increased . They therefore suggested that smaller catheters should be considered to prevent ra occlusions or narrowing . With the sheathless gc system, one can use the larger - bore gc in patients with a small ra without using an introducer sheath and thereby minimizing radial discomfort.4) yoo et al.5) have shown that the mean ra diameter measured by ultrasound was 2.660.44 mm (male: 2.690.40 mm, female: 2.430.38 mm) in korean patients . Although direct comparison is difficult because we did not use ultrasound to measure ra diameter, the mean diameter of the ra in our study was 1.820.27 mm, which is smaller than the mean ra diameter in korean patients and smaller than the outer diameter of the sheathless gc . Despite this finding this patient developed severe ra spasm before using the sheathless gc and the operator has difficulty in performing diagnostic coronary angiography with the conventional 5 fr . However, the operator did not experience any difficulty in manipulating the catheter during pci . Despite the above - mentioned results, a disadvantage in using a sheathless gc was noted . Because sheathless gcs slide easily within vessels due to the hydrophilic coating, disengagement of the catheter could happen in cases requiring good guiding support . In our study, the sheathless gc frequently slipped away from the ostium in two cases of rca intervention, despite the small size of the ra . Mamas et al.6) fixed the sheathless gc to the forearm at the point of entry to the ra using a tegaderm adhesive dressing to avoid slippage during the procedure . Even if this solution could be helpful in preventing the slippage of gc, it could also be very dangerous if the patient were to move unconsciously as it may result in an aortic or coronary dissection . Two studies have reported successful use of a sheathless gc in complex interventions with large bore catheters including rotablation, crush stent bifurcation lesions, 7 fr . Proximal protection, thrombectomy devices, and simultaneous kissing stenting.7)8) in our study, we successfully performed three complex procedures including two in which the kissing balloon technique was used and one in which the modified t - stenting technique was used . Most recently, mamas et al.6) reported a 100% procedural success using the sheathless gc in 100 patients . The primary difference in our study is that we enrolled only patients with small radial arteries, because the use of a sheathless gc is more beneficial for these patients . Although we failed to treat two cases of cto lesions which required catheter conversion from sheathless to conventional, these results were not due to the gc itself but to limitations in gc selection with different shapes . Only al, pb, hotkey stick, and judkins left gcs were available at our institute, and the shapes of catheters were slightly different from those of conventional catheters . During a median 357 days of follow - up, two patients (8%) developed ra occlusion, and this is consistent with a previous report of an asymptomatic ra occlusion rate of 5 - 10%.9) because the outer diameter of the sheathless gc is smaller than that of the conventional gc, we expected a lower incidence of ra occlusion, and our results may be related to the fact that we included only patients with small ras and some of the patients had a ra with a diameter smaller than the outer diameter of sheathless gcs . Even though the sheathless gc could be beneficial in forearm pain, the risk of ra occlusion should be considered in treating patients with small ras . Although the use of the sheathless gc is feasible in cases of primary pci, this system requires more time to assemble because it is composed of two parts, and the introducer sheath must be removed before inserting it . First, although we measured the diameter of the ra by angiography after using a vasodilator, this intervention could not completely prevent vasospasm . This fact could result in a smaller ra diameter than the diameter measured by non - invasive methods such as ultrasound . Second, we documented the presence of forearm pain only when the patient complained of forearm pain and did not use a pain scale such as the visual analogue scale or the 4-category verbal rating scale . Finally, this was not a randomized trial to compare the sheathless gc with the conventional gc . The use of a sheathless gc was feasible in almost clinical settings for patients with small ras regardless of complexity or severity of the lesion . However, disengagement of the gc and limitations in the setting of primary pci should be taken into account . The use of a sheathless gc was feasible in almost clinical settings for patients with small ras regardless of complexity or severity of the lesion . However, disengagement of the gc and limitations in the setting of primary pci should be taken into account.
As most of the human genes with multiple exons express more than one transcript, alternative splicing is considered to be a major mechanism for producing a complex proteome from a limited number of genes (1). The different transcripts of one gene can be translated into functionally different protein isoforms (2) or can be degraded by nonsense - mediated mrna decay (3). The regulation of alternative splicing plays a role in several important processes such as the formation and function of synapses (4), axon guidance in drosophila (5,6) and t - cell activation (7). Furthermore, defects in alternative splicing are causative for a number of human diseases (8,9) and thought to contribute to cancer development (10). While much research focused on larger alternative splice events such as exon skipping, it recently became clear that numerous alternative splice events result in only subtle changes of the mrna and of the protein (1214). The most widespread type is the alternative splicing at acceptor sites with the pattern nagnag (n stands for a, c, g, or t, throughout the paper we write t instead of u also when referring to an rna sequence) (12,15,16). In such a motif, both ags represent potential alternative acceptor sites which result in transcripts that differ by only 3 nt (the nag). (est)/mrna data 16% of all nagnags and noteworthy 39% of the tandem acceptors with a haghag pattern (also denoted plausible nagnags, h stands for a, c, or t) are currently known to be alternatively spliced . Furthermore, we recently found evidence for alternative splicing at donor splice sites with the motifs gtngtn, gcngtn and gtngcn (denoted as gyngyn donors, y stands for c or t) where both gt / gc donors are used (17). We denote a tandem splice site as confirmed if the usage of both splice sites is represented by at least one est / mrna and unconfirmed otherwise . Although the term tandem splice site refers to any pair of neighboring splice sites, in our database we collected data about nagnag acceptors and gyngyn donors . Apart from their frequency, subtle alternative splice events are of interest since several cases are known to result in functionally different protein isoforms (16,1822) and alternative nagnag splicing in the untranslated region (utr) can affect the translational efficiency (23). Moreover, the effect for the protein might be drastic since a premature stop codon can be created (12,17). Many nagnag acceptors are conserved between human and mouse and the ratio of the two splice forms can be highly controlled in a tissue - specific manner (12,16,24). Furthermore, snps that affect a nagnag acceptor can be relevant for human disease as demonstrated for the abca4 gene (25) and suggested for many other genes (26). While previous databases on alternative splicing do not store such subtle splice events (2729), recent databases contain confirmed tandem splice sites (3032). However, they do not contain unconfirmed tandem splice sites and do not allow to search for tandem splice sites with specific features . To facilitate further experimental studies as well as large - scale bioinformatics analyses of tandem splice sites, we have developed a relational database, tassdb (tandem splice site database), which provides large collections of gyngyn donors and nagnag acceptors in eight species . Since these subtle splice events can easily be overlooked in experimental systems (a 3 nt difference between two bands is barely visible on an agarose gel) and additional alternative splice events are likely to be missed in current est data, tassdb also stores unconfirmed tandem splice sites . A user interface allows to search for genes of interest and to get all relevant information about the respective tandem splice sites . It is also possible to search for genes harboring gyngyns / nagnags with specific features . Finally, tassdb annotates nagnags that are affected by a snp and also contains 51 tandem acceptors whose nagnag pattern can only be observed in another snp - allele and not in the human genome reference sequence . As alternatively spliced nagnag acceptors and gyngyn donors occur in a large number of lineages including vertebrates, flies and nematodes, tassdb stores information about the tandem splice sites of eight species: homo sapiens, canis familiaris, mus musculus, rattus norvegicus, gallus gallus, danio rerio, drosophila melanogaster and caenorhabditis elegans . Our annotation pipeline is based on transcript - to - genome mappings taken from the ucsc genome browser (33). Apart from the refseq annotation that was used for all species, we additionally used ensembl transcripts for human, rat, chicken, zebrafish, the ucsc knowngene set for human, mouse, rat (34), flybase transcripts for drosophila and wormbase transcripts for c.elegans . Intron structure as well as the annotation of the open reading frame was taken from the ucsc annotation . To identify alternatively spliced nagnags and gyngyns, we used blast against all ests and mrnas from the respective species as described in refs (12,17). The primary aim of tassdb is to provide information that is specific for the tandem splice site and the putative alternative splice event . Thus, we collected the following data: the splice site motif, its genomic locus, its location in the transcript (5/3-utr or cds with intron phase 0/1/2), the impact of the splice event on the protein, the sequences and length of the up-/downstream exon and the intron, and information about the ests / mrnas that indicate usage of one of the two splice sites . As the degree of similarity of a splice site to the overall consensus is an important criterion to distinguish alternatively from non - alternatively spliced nagnag acceptors (15), we also computed the maximum entropy scores for both splice sites in a tandem (35). The basic design of tassdb was driven by the idea to separate splice site specific data from transcript specific data . For example, the gyngyn / nagnag motif, the genomic locus and the splice site scores are independent of transcript annotation . However, features such as intron phase, protein impact and est confirmation depend on the annotation and the exon for example, the intron 13 of the phf1 gene that contains a cagcag acceptor is in intron phase 2 according to the annotation of nm_024165 . Due to skipping of the upstream 95 nt exon, thus, the protein impact of the cagcag is the insertion / deletion (indel) of a ser in nm_024165 but indel ala in nm_002636 (figure 1a). Another example is the cagcag acceptor of intron 1 of the cbx1 gene having two alternative first exons (represented by the transcripts enst00000225603 and nm_006807). We found est evidences for alternative cagcag splicing if the upstream first exon is used (enst00000225603) but not if the downstream first exon is used (nm_006807) (figure 1b). Whether this is a biological phenomenon or simply the consequence of a lack of sufficient est data, deserves further research . (a) example of a nagnag acceptor whose protein impact differs in the annotation of two transcripts . (b) example of a nagnag acceptor that is only confirmed according the exon - intron structure of one but not a second transcript . The most frequent use of tassdb might be a search for tandem splice sites of a given gene . To this end, tassdb provides a quick search interface where a user only specifies a gene symbol or a transcript accession and gets the entire information of both confirmed and unconfirmed gyngyns and nagnags for this gene . A more advanced task is to select tandem splice sites with specific features for further experimental or computational analysis . To this end, tassdb provides an advanced search interface where the user can restrict the search to gyngyns or nagnags with the following features: (i) pattern of the splice site, (ii) number of ests / mrnas that match both splice forms, (iii) location in the utr or in the coding sequence (cds) (as well as specific intron phases), and (iv) protein impact (figure 2). Thus, it is easy to formulate queries such as: (i) show all confirmed nagnags that result in single amino acid events . (ii) show all tandem splice sites where both splice forms are represented by at least three ests / mrnas and that are located in the 5-utr . The result of the search consists of two parts: (i) summary table of affected genes and their number of tandem splice sites and (ii) detailed tables with information about the tandem splice sites . The detailed result tables also provide links to the ests / mrnas for both splice forms as well as links to the ucsc genome browser . If the transcript specific data differ between transcripts, tassdb will show detailed result tables with more than two columns (figure 1). Features that differ between transcripts are shown in black while those that are equal in all transcripts are shown in grey colour . Screenshot of the advanced search interface: one can search for genes harboring tandem splice sites with a specific pattern [such as gtngcn for tandem donors or haghag (plausible) for tandem acceptors], a certain number of ests / mrnas matching both splice forms, a location in the utr or cds and a specific protein impact . As snps that affect nagnag acceptors are predictive for variation in alternative splicing, tassdb also annotates the snp data found in our previous study (26) including 51 polymorphic tandem acceptors whose nagnag pattern is not visible in the genome reference sequence . Such an example is the appbp1 gene where acceptor pattern of intron 6 is aaacag in the human reference genome sequence . The snp rs363209 leads to a second allele with an aagcag pattern, thus this g - allele creates a novel tandem acceptor . Tassdb always contains the sequence with the nagnag acceptor (in this case the g - allele). Finally, tassdb provides an interface where the user can send an arbitrary sql select query to the database . The relational database schema with table and thus, tassdb can be used to retrieve large datasets for further computational analysis of tandem splice sites . It is evident that tandem splice sites are widespread in all eight species and that with the exception of c.elegans for nagnags numerous of them are already known to be alternatively spliced . Summary of the current content of tassdb total number of transcripts used for detecting tandem splice sites . As alternatively spliced nagnag acceptors and gyngyn donors occur in a large number of lineages including vertebrates, flies and nematodes, tassdb stores information about the tandem splice sites of eight species: homo sapiens, canis familiaris, mus musculus, rattus norvegicus, gallus gallus, danio rerio, drosophila melanogaster and caenorhabditis elegans . Our annotation pipeline is based on transcript - to - genome mappings taken from the ucsc genome browser (33). Apart from the refseq annotation that was used for all species, we additionally used ensembl transcripts for human, rat, chicken, zebrafish, the ucsc knowngene set for human, mouse, rat (34), flybase transcripts for drosophila and wormbase transcripts for c.elegans . Intron structure as well as the annotation of the open reading frame was taken from the ucsc annotation . To identify alternatively spliced nagnags and gyngyns, we used blast against all ests and mrnas from the respective species as described in refs (12,17). The primary aim of tassdb is to provide information that is specific for the tandem splice site and the putative alternative splice event . Thus, we collected the following data: the splice site motif, its genomic locus, its location in the transcript (5/3-utr or cds with intron phase 0/1/2), the impact of the splice event on the protein, the sequences and length of the up-/downstream exon and the intron, and information about the ests / mrnas that indicate usage of one of the two splice sites . As the degree of similarity of a splice site to the overall consensus is an important criterion to distinguish alternatively from non - alternatively spliced nagnag acceptors (15), we also computed the maximum entropy scores for both splice sites in a tandem (35). The basic design of tassdb was driven by the idea to separate splice site specific data from transcript specific data . For example, the gyngyn / nagnag motif, the genomic locus and the splice site scores are independent of transcript annotation . However, features such as intron phase, protein impact and est confirmation depend on the annotation and the exon for example, the intron 13 of the phf1 gene that contains a cagcag acceptor is in intron phase 2 according to the annotation of nm_024165 . Due to skipping of the upstream 95 nt exon, thus, the protein impact of the cagcag is the insertion / deletion (indel) of a ser in nm_024165 but indel ala in nm_002636 (figure 1a). Another example is the cagcag acceptor of intron 1 of the cbx1 gene having two alternative first exons (represented by the transcripts enst00000225603 and nm_006807). We found est evidences for alternative cagcag splicing if the upstream first exon is used (enst00000225603) but not if the downstream first exon is used (nm_006807) (figure 1b). Whether this is a biological phenomenon or simply the consequence of a lack of sufficient est data, deserves further research . (a) example of a nagnag acceptor whose protein impact differs in the annotation of two transcripts . (b) example of a nagnag acceptor that is only confirmed according the exon - intron structure of one but not a second transcript . The most frequent use of tassdb might be a search for tandem splice sites of a given gene . To this end, tassdb provides a quick search interface where a user only specifies a gene symbol or a transcript accession and gets the entire information of both confirmed and unconfirmed gyngyns and nagnags for this gene . A more advanced task is to select tandem splice sites with specific features for further experimental or computational analysis . To this end, tassdb provides an advanced search interface where the user can restrict the search to gyngyns or nagnags with the following features: (i) pattern of the splice site, (ii) number of ests / mrnas that match both splice forms, (iii) location in the utr or in the coding sequence (cds) (as well as specific intron phases), and (iv) protein impact (figure 2). Thus, it is easy to formulate queries such as: (i) show all confirmed nagnags that result in single amino acid events . (ii) show all tandem splice sites where both splice forms are represented by at least three ests / mrnas and that are located in the 5-utr . The result of the search consists of two parts: (i) summary table of affected genes and their number of tandem splice sites and (ii) detailed tables with information about the tandem splice sites . The detailed result tables also provide links to the ests / mrnas for both splice forms as well as links to the ucsc genome browser . If the transcript specific data differ between transcripts, tassdb will show detailed result tables with more than two columns (figure 1). Features that differ between transcripts are shown in black while those that are equal in all transcripts are shown in grey colour . Screenshot of the advanced search interface: one can search for genes harboring tandem splice sites with a specific pattern [such as gtngcn for tandem donors or haghag (plausible) for tandem acceptors], a certain number of ests / mrnas matching both splice forms, a location in the utr or cds and a specific protein impact . As snps that affect nagnag acceptors are predictive for variation in alternative splicing, tassdb also annotates the snp data found in our previous study (26) including 51 polymorphic tandem acceptors whose nagnag pattern is not visible in the genome reference sequence . Such an example is the appbp1 gene where acceptor pattern of intron 6 is aaacag in the human reference genome sequence . The snp rs363209 leads to a second allele with an aagcag pattern, thus this g - allele creates a novel tandem acceptor . Tassdb always contains the sequence with the nagnag acceptor (in this case the g - allele). Finally, tassdb provides an interface where the user can send an arbitrary sql select query to the database . The relational database schema with table and thus, tassdb can be used to retrieve large datasets for further computational analysis of tandem splice sites . It is evident that tandem splice sites are widespread in all eight species and that with the exception of c.elegans for nagnags numerous of them are already known to be alternatively spliced . Summary of the current content of tassdb total number of transcripts used for detecting tandem splice sites . As tandem splice sites seem to occur in all species allowing alternative splicing, it would be desirable to include information for other species . In the future, we plan to include bos taurus, xenopus tropicalis, takifugu rubripes and anopheles gambiae as more ests and annotated genes become available . Furthermore, information about conservation of these splice events in other species as well as more data about the protein impact may be included . Since the database was designed to store information about any tandem splice site, an extension to tandem splice sites that are more than 3 nt apart is conceivable.
Congenital heart defects / diseases contribute substantially to morbidity and mortality in childhood, especially in the third - world countries where facilities for management are often deficient.1 about 35,000 infants (1 out of every 125) are born with heart defects every year in the united states.2 the incidence in the tropics is not expected to differ from the 8 - 10 per 1000 live - births documented in the developed world.3 the defect may be so slight that the baby may be asymptomatic for many years after birth, or so severe that it is life threatening . Heart defects are the leading cause of birth defect - related deaths.4 however; the use of echocardiography has improved description of congenital heart diseases and their early diagnosis.5 this, has led to dramatic increases in survival of children with serious heart defects . Cor triatriatum is a rare congenital cardiac anomaly, in which a fibromuscular membrane divides the atrium in two . It was first reported in 1868.6 cor triatriatum, a heart with 3 atria (triatrial heart), is a congenital anomaly in which the left atrium (cor triatriatum sinistrum) or right atrium (cor triatriatum dextrum) is divided into 2 parts by a fold of tissue, a membrane, or a fibromuscular band.7 however, variable types of subtotal cor triatriatum are also noted, with only the right or left pulmonary veins draining into the upper chamber.8 cor triatriatum represents 0.1% of all congenital cardiac malformations and may be associated with other cardiac defects in as many as 50% of cases . Examples of associated cardiac defects include atrial septal defect, persistent left superior vena cava with an unroofed coronary sinus, partial anomalous pulmonary venous connection, ventricular septal defect and more complex cardiac lesions such as tetralogy of fallot, atrioventricular canal and double outlet right ventricle . Associated bicuspid pulmonary valve, aortic valve atresia and heterotaxy have also been described.9 congenital pulmonary vein stenosis is a very rare association with cor triatriatum.10 the morbidity and mortality of cor triatriatum sinistrum is high in those who are symptomatic in infancy . This is due to the severely restrictive opening in the accessory membrane and the association with major cyanotic or acyanotic congenital heart lesions . Significant sequel is unusual with cor triatriatum dextrum as it is not commonly associated with life - threatening symptoms or major congenital cardiac defects . A female baby seen on the second day of life was delivered by a 25-year - old primiparous youth corper . The mother attended antenatal clinic in federal medical centre owerri from the 16 week of gestation . However, during the 8 week of pregnancy, the mother had threatened abortion for which some drugs were given (injections and tablets names unknown) at a hospital in lagos . She also had some liquid herbal preparation at 8 months of gestation; other drugs she took were essentially haematinics . She gave birth to a 3.6-kg baby girl who cried immediately after, and breastfeeding commenced . The child was transferred to the special care baby unit from the postnatal ward on account of history of fever on day 2 of life . Examination revealed a full - term newborn, febrile (38.1) with a respiratory rate of 100 cycles per minute, acyanotic, heart rate of 110 beats / min heart however, the child completed a course of antibiotics (ampicillin sulbactam and gentacin) and, with clinical improvement, was discharged home . At follow - up at the 2 week of life, the child weighed 3.5 kg, heart rate was 130 beat / min and a grade 3 pansystolic murmur was heard, following which a chest radiograph and electrocardiograph (ecg) was requested . At 1 month of life, a review of ecg showed: heart rate: 128 beats / min, t-18, which suggested supraventricular arrhythmia, abnormal right superior axis deviation . Murmur was still grade 3/6, pansystolic maximal at the left - lower sternal edge . Echocardiograph was subsequently requested and the result showed that a 2d echocardiogram was done [figure 1] with the following results: echocardiogram showing the distal chamber (x) and the left atrium; the right atrium (ra), left ventricle (lv), and right ventricle (rv) separate left atrium with dividing membranous running in the direction of long axis of left atrium close to the lateral wall . Mitral valve draining the larger, more medial chamber, normal atrio - ventriculo - arterial connection . High velocity turbulent flow in the main artery noted (pa vmax = 335 cm / s pg = 45 mm). Secundum atrial septal defect [figure 1] the child is presently being followed - up regularly . During her last visit, at 7 months of age, she weighed 9.6 kg, length was 73 cm, occipito - frontal circumference was 47 cm and mid - upper - arm circumference was 15 cm (all within normal for age). Cardiovascular examination revealed a child with heart rate of 120 beats / min, apex beat located at the 4 left intercostals space, with a grade 3/6 systolic murmur heard loudest at the upper left sternal edge . The respiratory rate was 42 cycles / min and no organs palpably enlarged on digestive system examination . This was the first case of a five - chambered heart seen and managed in the federal medical centre owerri . The case demonstrates the need for comprehensive evaluation of patients and provision of cardiac investigative facilities (x - ray, ecg and echocardiograph machines) in health facilities . In our patient, it was an incidental finding at a routine follow - up clinic . Subsequent investigative evaluations led to the confirmation of the diagnosis of a five - chambered heart in a child who has remained asymptomatic . The dearth of facilities in our hospital is obvious here, where the patient had to be referred to the university of nigeria teaching hospital enugu for echocardiograph . Clinical manifestations are often delayed due to the presence of a large opening; and include an asymptomatic murmur . Finding is mostly incidental on routine cardiac imaging; it therefore highlights the need for exhaustive evaluation and management because such conditions, although rare, can still be found here . In conclusion, we reported a case of an asymptomatic congenital - heart defect a five - chambered heart - cor triatriatum, an extremely rare condition.
Colorectal cancer (crc) is the second leading cause of cancer related death worldwide, making it a fine and attractive area for oncologists to study (1, 2). In numerous cancers including crc, it has been documented that aberration of the growth factor signaling pathways specifically transforming growth factor- (tgf-) pathway play a vital role in tumor initiation, progression and metastasis (3 - 7). Therefore, it has become a proper target for cancer therapy (8 - 13). It is has been accepted that a major growth factor such as tgf-, which has a wide range of effects on key physiological events, must be under extended regulation to control its expression and function . This regulation should include mechanisms that allow a variety of effects depending on special cellular and tissue contexts (14 - 16). Recently, a new layer of cellular mechanisms as microrna (mirna)-mediated gene expression has been identified that is implicated in the post transcriptional negative regulation (17 - 20). The mirnas were well - known to interact with signaling pathway components and to involve in multiple cellular processes as well as initiation, progression and metastasis of human cancers (21 - 25). Increasing evidences have revealed that cancer - associated mirnas can function as oncogenes or tumor suppressors (18, 20). The mirnas - mediated regulation networks can strictly influence the growth factors signaling pathways (24, 25). There are several studies showing relationship of tgf- with diverse micrornas (26 - 29). In addition, it has been shown that basic cell signaling pathways adjust the activity of the related components in mirnas biogenesis pathway to achieve a fine mirnas expression pattern (28). Recent emerging evidence suggests manipulation of growth factors signaling by special inhibitors can alter mirnas expression in cancer cells in vivo and in vitro (30 - 35). Several strategies based on either restoration of silenced mirnas or inhibition of overexpressed mirnas has opened a new area of research in cancer therapy including crc . It has been proposed that restoration of normal equilibrium for cancer - related mirnas can inhibit colon tumor progression (36, 37). On the other hand, several reports imply that targeting of tgf- signaling pathway at late stages of carcinogenesis could be a helpful tool for treatment of human cancers such as crc, glioblastoma and breast cancer (4, 8). These studies show that a series of tgri kinase inhibitors such as sd-208 could be influential in treatment of a range of cancers (12). Our aim was to investigate the mirnas (oncogene or tumor suppressor), whose expression might be altered due to inhibition of tgf- signaling pathway . Sw-48 cell line, a human colon adenocarcinoma cell line (pasteur institute, tehran, iran) was grown in 25 cm flask (spl life sciences; south korea) containing rpmi-1640 medium (gibco; germany) supplemented with 5% fetal bovine serum (fbs) (gibco; germany) and 100 units / ml penicillin (gibco; germany). Briefly, the cells were trypsinized in exponential growth phase and were seeded in 6-well flat - bottom plates (spl life sciences; south korea) at a density of 510 cells / well (2000 l media / well). 48 hr after treatment with 0.5, 1 and 2 m concentrations of sd-208, the cells were harvested for total rna extraction . The protocol for establishing the xenograft model of colon cancer was approved by the committee on the ethics of animal experiments of tehran university of medical sciences (ethical code number; erc / s/277) as previously described (6). 6-week - old female athymic c56bl/6 nude mice (n= 8 per group) were obtained from omid institute for advanced biomodels (tehran, iran). After cell inoculation, xenograft tumors were allowed to achieve a size of 80 mm . Then, the animals were randomly divided into two groups of 8 to receive either sd-208 (50 mg / kg / d) or vehicle (dmso - containing deionized water) orally for three weeks . Obtained tumors after isolating from animals, were fixed in formalin or frozen for histological staining and rna extraction, respectively . To confirm colon adenocarcinoma, tumor tissues tissues were excised and subjected to hematoxylin and eosin (h&e) staining (dako, denmark) as previously described (6). Either sw-48 cells or tumor tissues at the mentioned time points after treatment with sd-208, were subjected for total rna extraction using trizol reagent (invitrogen; germany) according to the manufacturer s instructions . Extracted total rna four mirnas as potential onco - mirs (mir-21, 31, 20a, 135b) and four mirnas as potential suppressor - mirs (let7-g, mir-133b, 145, 200c) involved in colon cancer, were selected from the sanger center mirna registry at http://www.sanger.ac.uk/software/rfam/mirna/index.shtml . Microrna expression was analyzed by real - time quantitative polymerase chain reactions (qpcr) using the sybr green method (parsgenom, iran). After polyadenylation of total rna and cdna synthesis, mirnas were expanded by the specific primers for mature forms according to the manufacturer s instructions . Real - time pcr was performed on a bio rad cfx96 real - time pcr system . Rnu6b was used as an endogenous (internal) control, and the data were normalized compared to this housekeeping gene . All reactions were performed in triplicate and the absence of contamination was verified using non - template controls . The standard error of means was computed and analysis of variance (anova, tukey s post tests) completed via graphpad prism 5.0 software . P - values less than 0.05 were considered to indicate statistically significant differences between data sets . Sw-48 cell line, a human colon adenocarcinoma cell line (pasteur institute, tehran, iran) was grown in 25 cm flask (spl life sciences; south korea) containing rpmi-1640 medium (gibco; germany) supplemented with 5% fetal bovine serum (fbs) (gibco; germany) and 100 units / ml penicillin (gibco; germany). Briefly, the cells were trypsinized in exponential growth phase and were seeded in 6-well flat - bottom plates (spl life sciences; south korea) at a density of 510 cells / well (2000 l media / well). 48 hr after treatment with 0.5, 1 and 2 m concentrations of sd-208, the cells were harvested for total rna extraction . The protocol for establishing the xenograft model of colon cancer was approved by the committee on the ethics of animal experiments of tehran university of medical sciences (ethical code number; erc / s/277) as previously described (6). 6-week - old female athymic c56bl/6 nude mice (n= 8 per group) were obtained from omid institute for advanced biomodels (tehran, iran). After cell inoculation, xenograft tumors were allowed to achieve a size of 80 mm . Then, the animals were randomly divided into two groups of 8 to receive either sd-208 (50 mg / kg / d) or vehicle (dmso - containing deionized water) orally for three weeks . Obtained tumors after isolating from animals, were fixed in formalin or frozen for histological staining and rna extraction, respectively . To confirm colon adenocarcinoma, tumor tissues tissues were excised and subjected to hematoxylin and eosin (h&e) staining (dako, denmark) as previously described (6). Either sw-48 cells or tumor tissues at the mentioned time points after treatment with sd-208, were subjected for total rna extraction using trizol reagent (invitrogen; germany) according to the manufacturer s instructions . Extracted total rna was stored at -80 c until use . Four mirnas as potential onco - mirs (mir-21, 31, 20a, 135b) and four mirnas as potential suppressor - mirs (let7-g, mir-133b, 145, 200c) involved in colon cancer, were selected from the sanger center mirna registry at http://www.sanger.ac.uk/software/rfam/mirna/index.shtml . Microrna expression was analyzed by real - time quantitative polymerase chain reactions (qpcr) using the sybr green method (parsgenom, iran). After polyadenylation of total rna and cdna synthesis, mirnas were expanded by the specific primers for mature forms according to the manufacturer s instructions . Real - time pcr was performed on a bio rad cfx96 real - time pcr system . Rnu6b was used as an endogenous (internal) control, and the data were normalized compared to this housekeeping gene . All reactions were performed in triplicate and the absence of contamination was verified using non - template controls . Data analysis was performed using the 2-cct method . The standard error of means was computed and analysis of variance (anova, tukey s post tests) completed via graphpad prism 5.0 software . P - values less than 0.05 were considered to indicate statistically significant differences between data sets . To assess the potential toxicity effects of sd-208, the expression levels of mirnas was examined by real time rt - pcr (table 1). Then the appropriate numbers of sw-48 cells were injected into 8 mice to develop tumors . Following sd-208 treatment period, we could not observe any changes in animal behavior, body weight or lifespan compared to controls . These data suggest that sd-208 lacks toxic effects on animals (data not shown). Mirnas differentially expressed in sw-48 cells after 48 hr treatment with sd-208 colon adenocarcinoma confirmation the h&e staining confirmed marked cellularity with significant hyperchromatism and pleomorphism (figure 1). The pattern of adenocarcinoma was alike to the human origin (figure 1 a, b). Nude mice bearing developed sw-48 tumors were divided into two groups: sd-208 treatment (a) and vehicle (b). Hematoxylin and eosin staining of tumor tissues confirmed colon adenocarcinoma in both treated (a) and non - treated (b) tumor - bearing mice . The staining demonstrates marked cellularity with profound hyperchromatism and pleomorphism (arrows) and low differentiated tumor cells similar to human colon cancer expression pattern of selected onco / suppressor mirnas in colon adenocarcinoma sw-48 cell line real - time pcr analysis detected differentially expression of all selected mirnas in sw-48 cell line (table 2). Among the studied mirnas, mirna-135b and let7-g expressed at the highest and lowest levels, respectively (figure 2). Mirnas differentially expressed in sw-48-derived tumors after treatment with sd-208 electrophoresis of mirnas genes pattern expressed in sw-48 cell line . As shown, all selected onco / suppressor mirnas express differentially in sw-48 cell line alteration of the mirnas expression resulted by sd-208 treatment evaluation of mirnas expression by q - pcr showed that the expression of mir-135b significantly down - regulated after treatment by sd-208 (p=0.006, figure 3a). In the tumors treated with sd-208, mir-135b expression also was down - regulated significantly (p=0.018), compared to control tumors (figure 3b). Our results showed that all the treated tumors express a lower number of mir-135b, but not other mirnas, compared to the control tumors . However, there was no change in cell proliferation or tumor size (data not shown). The expression of mir-135b significantly was down - regulated either in cell culture (a) or developed tumors (b) in sd-208 groups compared to controls prediction of the target genes of mir-135b using bioinformatics analysis in order to determine the biological function of the down - regulated mirna, mir-135b, we further predicted the putative downstream targets of this mirna . We focused our attention on mir-135b because it was the only mirna affected by sd-208 either in vitro or in vivo . In silico analysis using targetscan (http://www.targetscan.org/) showed that mir-135b potentially targets transcripts encoding known tumor - suppressor factors, such as apc (adenomatosis polyposis coli), foxo1 (forkhead transcription box1), runx1 (runt - related transcription factor 1) and esrra (estrogen - related receptor alpha). To assess the potential toxicity effects of sd-208, the expression levels of mirnas was examined by real time rt - pcr (table 1). Then the appropriate numbers of sw-48 cells were injected into 8 mice to develop tumors . Following sd-208 treatment period, we could not observe any changes in animal behavior, body weight or lifespan compared to controls . These data suggest that sd-208 lacks toxic effects on animals (data not shown). Mirnas differentially expressed in sw-48 cells after 48 hr treatment with sd-208 colon adenocarcinoma confirmation the h&e staining confirmed marked cellularity with significant hyperchromatism and pleomorphism (figure 1). The pattern of adenocarcinoma was alike to the human origin (figure 1 a, b). Nude mice bearing developed sw-48 tumors were divided into two groups: sd-208 treatment (a) and vehicle (b). Hematoxylin and eosin staining of tumor tissues confirmed colon adenocarcinoma in both treated (a) and non - treated (b) tumor - bearing mice . The staining demonstrates marked cellularity with profound hyperchromatism and pleomorphism (arrows) and low differentiated tumor cells similar to human colon cancer expression pattern of selected onco / suppressor mirnas in colon adenocarcinoma sw-48 cell line real - time pcr analysis detected differentially expression of all selected mirnas in sw-48 cell line (table 2). Among the studied mirnas, mirna-135b and let7-g expressed at the highest and lowest levels, respectively (figure 2). Mirnas differentially expressed in sw-48-derived tumors after treatment with sd-208 electrophoresis of mirnas genes pattern expressed in sw-48 cell line . As shown, all selected onco / suppressor mirnas express differentially in sw-48 cell line alteration of the mirnas expression resulted by sd-208 treatment evaluation of mirnas expression by q - pcr showed that the expression of mir-135b significantly down - regulated after treatment by sd-208 (p=0.006, figure 3a). In the tumors treated with sd-208, mir-135b expression also was down - regulated significantly (p=0.018), compared to control tumors (figure 3b). Our results showed that all the treated tumors express a lower number of mir-135b, but not other mirnas, compared to the control tumors . However, there was no change in cell proliferation or tumor size (data not shown). The expression of mir-135b significantly was down - regulated either in cell culture (a) or developed tumors (b) in sd-208 groups compared to controls prediction of the target genes of mir-135b using bioinformatics analysis in order to determine the biological function of the down - regulated mirna, mir-135b, we further predicted the putative downstream targets of this mirna . We focused our attention on mir-135b because it was the only mirna affected by sd-208 either in vitro or in vivo . In silico analysis using targetscan (http://www.targetscan.org/) showed that mir-135b potentially targets transcripts encoding known tumor - suppressor factors, such as apc (adenomatosis polyposis coli), foxo1 (forkhead transcription box1), runx1 (runt - related transcription factor 1) and esrra (estrogen - related receptor alpha). In this study, we evaluated the effect of a tgf- receptor kinase inhibitor, sd-208, on some potential onco / suppressor - mirnas expression in crc . Sd-208 is a tgf- signaling pathway inhibitor that could exert anticancer effects on several tumor cells by reduction of growth rate or modification of other cell functions (6, 9, 12). Some investigators revealed sd-208 reduces tumor growth and metastasis in different cancers (9, 12), whereas, others showed this agent regulates the growth of tumors without changes in proliferation, apoptosis or angiogenesis and cannot reduce proliferation of cells (8). Another study reported that sd-093 (as an sd-208 analog) failed to alter morphology and growth rate of pancreatic carcinoma cells (38). Also it has been reported that sd-208 has no effect on the growth of primary and metastatic r3 t mammary tumors in athymic nude mice (9). These findings indicate that anti - cancer effect of sd-208 may be not due to suppression of cell growth and proliferation (36). Since efficacy of this inhibitor is a controversial issue in cancer treatment, we hypothesized the unknown mechanism(s) including alteration of cancer - related mirnas might be involved . Several chemopreventive agents have been shown to modulate the expression of numerous mirnas in cancer cells that lead to sensitization of cancer cells to chemotherapeutic agents (39, 40), suggesting the potential of mirnas as targets for anti - cancer drugs (18, 20). Hence, evaluation of the possible effects of chemotherapeutic drugs on the expression profile of mirnas may have an important outcome for cancer therapy strategies (21, 33). Although a number of studies have shown that chemotherapy drugs alter mirnas expression in many cancer cells, there is no report on the effect of tgf- receptor kinase inhibitors on mirnas in human crc . We selected some mirnas that have already been confirmed to function as onco - mir (mir-21, mir-31, mir-20a, and mir-135b) or suppressor mir (mir-133b, mir-145, mir-200 and let7-g) in crc (36 - 39). The present study focused on the alteration of these mirnas in colon cancer treated by sd-208 . Expression analysis of mirnas by a q - pcr revealed that expression of mir-135b significantly down - regulated after in vitro treatment with sd-208 (p=0.006). In the tumor tissues treated with sd-208, mir-135b expression significantly the results showed that all the treated tumors significantly expressed a lower number of mir-135b, but not other oncogenic - mirnas, compared to controls (p=0.018). Interestingly, the mir-135b has been documented as a tumor promoting factor and to play a role in migration and metastasis in different cancers as well as crc (37 - 39). In order to address the question of how can the possible molecular mechanisms of the mir-135b on crc cell signaling pathways be defined, we performed an in - silico study . In silico analysis using targetscan (http://www.targetscan.org/) showed that mir-135b potentially targets key tumor - suppressor genes involved in crc: apc and foxo1 . Apc and foxo1 genes have also been validated as targets of mir-135b using luciferase reporter assay (41), hence, we would like to discuss these genes whose functions could potentially affect the cell signaling in crc . Apc gene acts a tumor suppressor the inactivation of which is the key initiating event in colorectal carcinogenesis (42). Recently, one study demonstrated that up - regulation of mir-135b in crc is associated with low apc mrna levels (42). In the present study, we advocate a novel molecular mechanism: a kinase inhibitor molecule can reduce mir-135b expression, by which apc activation could be mediated . Moreover, it has been reported that mir-135b affects foxo1 as an endogenous target and suppresses protein expression . Several lines of evidence indicate that foxo transcription factors might play an important role in tumor development (41, 43). On the other hand, foxo1 alteration by mir-135b can affect sensitivity to chemotherapeutic drugs, such that tumor cells overexpressing mir-135b were more resistant to specific anticancer drugs . These results suggest the possibility that mir-135b may confer chemoresistance to tumor cells through foxo1 modulation (41). Therefore, it is rational to hypothesize that the properties of anti - cancer drugs may be related to their alteration of mirna profiles (43, 44). For example, suppression of mir-21 has been shown to sensitize mcf-7 cells to topotecan (44). As well, 5-fu was reported to be able to modify the expression of several mirnas in human colon cancer cells (44). Overall, we primarily predicted that combination of sd-208 and one anticancer drug such as 5-fu, may show stronger inhibition of colon tumor cell growth by modification of onco - mirs . Additionally, as a novel approach in crc therapy, pre - treatment by sd-208 could improve chemosensitivity in resistant cancerous cells . However, the mechanism by which these agents alter mirna expression may be dependent on genomic context . The receptor kinase inhibitor sd-208 may partially inhibit colon tumorigenesis as well as chemoresistance by alteration of mirnas . Hence, the tgri kinase inhibitor - based treatment may possibly uphold chemosensitivity in resistant colon cancer cells.
Nanotechnology deals with the production and stabilization of various types of nanoparticles (1). Plants or natural resources have been found to be a good alternative method for nanoparticles synthesis, since this method does not use any toxic chemicals and does not require the use of high pressure, energy, and temperature . This green chemistry process has numerous benefits, including environmental friendliness, cost - effectiveness, and suitability for pharmaceutical and biomedical applications . At present, several groups of researchers concentrate on biomimetic approaches such as plant or plant leaf extracts, nuts, microorganisms and yeast to synthesize the metal nanoparticles called " green chemical or phytochemical " approach (2 - 5). Antibacterial activity of the silver ion has been well established (6) and ag is currently used to control bacterial growth in a variety of applications, including dental work, catheters, and burn wounds (7,8). In fact, ag ions and ag - based compounds are highly toxic to microorganisms, showing strong biocidal effects on as many as 12 species of bacteria including e. coli (9). Apart from these antimicrobial activities, ag - nps are also known to possess antifungal, anti - inflammatory, antiviral, anti - angiogenesis and antiplatelet properties (10, 11). The betel (piper betle) is the leaf belonging to the family piperaceae . The p. betle leaves possess antifungal, antiseptic, antihelmintic, antihypertensive etc ., 2011 claim that ethanolic extract of p. betle leaves show antibacterial activity against some food borne pathogens (13). The aim of this study was to synthesize agnps using aqueous leaves extract of p. betle, characterized the agnps and evaluated the antibacterial activity of ag - extract nanoparticles against some gram positive and gram negative bacteria . Collection of materials fresh young leaves of p. betle were collected from the local market of noakhali, bangladesh . Silver nitrate (agno3), nabh4 and aniline were collected from the laboratory of department of pharmacy, noakhali science and technology university (nstu). Preparation of p. betle leaf extract about 30 g of freshly, taxonomically authenticated healthy leaves of p. betle were collected in january 2014 from noakhali district of bangladesh . The leaves were washed thoroughly with double distilled water, cut into fine pieces and boiled with 150 ml double distilled water for 8 - 10 min . Finally, extract of leaves was stored at refrigerator at 4 c till further use . Biosynthesis of silver nanoparticles ag nanoparticles were made according to the recipe described in the literature (creighton, 1979; suh js et al . ; briefly, a 100-ml aqueous solution of 1.0 x 10 m silver nitrate was mixed with a 300-ml aqueous solution of 2.0 x 10 m sodium borohydride . Triply distilled water was used for solutions, and both solutions were chilled to ice temperature before mixing . By mixing both solutions, ag ions were reduced and clustered together to form monodispersed nanoparticles as a transparent solution in aqueous medium . The solution was stirred repeatedly whenever some dark color appeared for approximately an hour until it became stabilized . At this point this solution of ag nanoparticles was so stable that it did not change color for as long as several months without any stabilizing agent . Because the particle concentration of the solution is only 3.3 nm, it was concentrated 10 times using a rotary vacuum evaporator . Preparation of ag - extracts nanoparticles these above two solutions were mixed continuously for 30 min by magnetic stirrer and then stood for 2 h. after that uncoated ag - extract nanoparticles were prepared . Coating of ag - extract nanoparticles with polyaniline coating on the extract - agnps were done according to the k. gopalakrishnan, 2012 (14). After that 68 ml (6%) of h2o2 was added slowly at room temperature . The final product was filtered, washed with distilled water and then dried at room temperature . Finally, samples were ready for further analysis (antimicrobial activity). The reaction mixture turned into dark brown color from its initial brownish - yellow color within 20 min of mixing . The reduction of pure silver ions was monitored by measuring uv - vis spectra of the reaction mixture . The absorption spectra of the samples were taken 240 to 540 nm using a uv vis spectrophotometer (hitachi, model u-2800 spectrophotometer). Water was used as the blank . Again, spectrum was recorded in ftir (ir prestige-21, shimadzu) in the range of 4000500 cm at a resolution of 4 cm . Tem observations were carried out on an h-7100 electron microscope (hitachi, tokyo, japan). Test microorganisms authentic pure cultures of staphylococcus aureus atcc 25923, salmonella typhi atcc 14028, escherichia coli atcc 25922 and pseudomonas aeruginosa atcc 27853 were obtained from the department of microbiology, nstu, bangladesh . Antimicrobial activity using kirby - bauer s disc diffusion method antibacterial activities of the ag - extract nanoparticles were determined according to kirby - bauer s disc diffusion method (2006) with slight modifications . The petri dishes were flooded with mueller hinton agar and after solidification of agar 0.1 ml of diluted inoculums were spread over mueller hinton agar in the dishes using sterile l spreader to achieve confluent growth of test organisms and allowed to dry for 10 min . The sterile readymade discs loaded with p. betle extract, agnps solution, uncoated agnps, coated ag - extract nps . The plates were then incubated at 37 c for 36 h. the plates were observed for the zone of inhibition . After incubation at 35 c for 18 h, the different levels of zone of inhibition were measured . Characterization of the synthesized ag nanoparticles evaluation of ag - nps by visual assessment the formations of silver nanoparticles were confirmed through visual assessment . Within 20 min of the reaction, color of the mixture turned into dark brown from its initial brownish yellow color . The appearance of dark brown color may be due to the reduction of agno3 (17). (a)agnps solution (b)aqueous extract of p. betle (c) ag - extract nps evaluation of ag - nps by uv spectrum uv vis spectrum of reaction mixture at different wavelengths ranging from 300 to 700 nm showed strong absorption peak with centering at approx . 400 nm (figure 2) indicated the formation of aqueous extract coated ag - nps . Uv visible spectrum of agnps evaluation of ag - nps through ft - ir spectra the ft - ir spectra were used to identify the possible biomolecules (including functional group) responsible for the reduction of the agions and capping of the p. betle formed ag - nps . Figure 3, showed the ftir spectra of p. betle aqueous extract and bio - synthesized ag - nps . Ft - ir spectrum for curve (a) red color- p. betle aqueous extract; and curve (b) ag - extract nanoparticles the possible functional groups of leaf extract involved in coating nanoparticle are identified by ftir analysis . The intense absorption peaks at 3400 cm (curve - a, red color) and 3291.67 cm (curve - b, black color) correspond to n - h stretching of primary amine . The band observed at 3059.23 cm (curve - b) represents = c - h stretching . The weak band observed at 2917.46 cm and 2848.98 cm (both in curve - b) indicates the h - c - h asymmetric and symmetric stretching of alkanes . The band observed at 2340.72 cm and 2369.65 cm (both in curve - a), which are nearly the same band in curve - b, denotes the presence of hydrogen bonded oh stretching of carboxylic acids in leaf extract which may be a reducing / coating agent for silver nanoparticles . The band at 1617.38 cm (curve - a) and 1600.02 cm (curve - b) represents n - h bending vibration of primary amine . The peak occurs at 1496.83 cm (curve - b) for n - h bending vibration of sec . Amine and at 1447.64 cm (curve - b) c - h bending vibration of alkane (ch3). The band observed at 1387.84 cm and 1379.16 cm (both in curve - b) represent n = o stretching of nitro groups of leaf extract coated on nanoparticles . The arising of functional groups in ftir spectrum indicates proper coating of leaf extract on silver nanoparticles . The bands at 1296.22, 1249.93, 1175.66, 1155.41 cm (curve - b), which are nearly the same in curve a, denotes c - h stretching vibration of ester . Beside, c - o stretch occurs at 1072.47, 1026.17 (curve - b) where first is stronger and broader than the second . The band at 843.89, 829.43, 602.78, 668.36 cm shows c - h bending vibration of alkynes . The band at 751.31 cm and 691.51 cm represents the ortho substituted and mono substituted aromatic stretching respectively . The ft - ir results imply that the ag - nps were successfully synthesized and capped with bio - compounds present in the p. betle extract by using a green method . The tem image in figure 4 shows that ag - nps were well dispersed with a spherical structures and particle size ranging from 10 to 30 nm with some deviations . Of the total particles, approximately 20% particles were of 10 nm, 50% were of 20 nm and remaining 30% particles tem image of bio functionalized agnps assessment of antibacterial activities antibacterial activity of p. betle formed ag - nps on s. aureus atcc 25923, e. coli atcc 25922, s. typhi atcc 14028, p. aeruginosa atcc 27853 values are the mean of three replicates sd (standard error). Antibacterial activity of p. betle formed ag - nps on (a) s. aureus atcc 25923 (b) e. coli atcc 25922 (c) s. typhi atcc 14028 (d) p. aeruginosa atcc 27853 graphical representation of the antibacterial activity of p. betle formed ag - nps on s. aureus atcc 25923, e. coli atcc 25922, s. typhi atcc 14028, p. aeruginosa atcc 27853 the antibacterial activity of the aqueous extracts of p. betle leaves were analyzed against both gram - positive and gram - negative bacteria, which are presented in (figure 6, table 1). After analyzing the above results, it is clear that gram positive bacteria s. aureus is more susceptible than other experimental species of gram negative bacteria - e. coli, s. typhi, p. aeruginosa . Maximum zone of inhibition 32.780.64 mm was found for s. aureus, whereas norfloxacin showed maximum 32.150.40 mm zone of inhibition for s. aureus . Again, maximum zone of inhibition 29.550.45 mm was found for s. typhi, 27.120.38 mm for e. coli and 21.950.45 mm for p. aeruginosa . We have demonstrated a good method for developing a simple, safe, cost - effective, and ecofriendly preparation of agnps using aqueous extract of p. betle . The biosynthesized silver nanoparticles have spherical shapes and the particle size ranges from 10 to 30 nm approximately . The ftir spectra revealed the involvement of hydroxyl moieties and n - h bonding in the formation of ag - nps . They showed potential antibacterial activity against both gram - positive and gram negative bacteria . In our study we also found, gram positive bacteria are more susceptible on ag - extract nps rather than gram negative bacteria . Application of these synthesized agnps based on our findings may lead to valuable discoveries in various fields, including medical devices and in the pharmaceutical and biomedical industries . The results obtained by this study cannot be directly extrapolated to human; further studies should be undertaken to elucidate the exact mechanism of action by which agnps - extracts exert their antimicrobial effect which can be used in drug development program for safe health care services.
Registration details of all 2,431 horses registered with the british palomino society were collected for the period 19832007 inclusive . Of these animals, a further 207 animals were removed from the analysis as the true coat colour described for one or more parents was impossible to identify from the colour supplied . A further 39 animals (shaded in grey in table 1table 1.colour combinations which have produced a registered palomino in the society within the last 25 years) were removed from the analysis since parents with these combinations of details cannot produce palomino offspring (e.g. Chestnut chestnut). However animals where there was ambiguity regarding the exact colouration (e.g. Grey which could be represented by one or more recognised coat colour), were kept in the analysis, provided they could be explained by one of the possible sources of palomino offspring listed in . Details of the animal s name and the coat colour of both parents were collated . Throughout the year the society hold shows varying from small county shows to a large annual national championship . Many classes at local shows may only have one or two horses exhibited . To ensure that the results were comparing like with like, the data analysed focused entirely on the british palomino national championship show, where each class generally has more animals exhibited than would be the case in local shows . At this show there are two major categories (ridden and in - hand) with in - hand classes placing more emphasis on colouration of horses (80% of available marks). Since the national championship has the greatest number of exhibitors and the emphasis on colour is greatest for in - hand classes, the investigation into show success was restricted to animals placed in the in - hand classes at the national championships in the following nine categories: under 148 cm stallion, mare, yearling, 2 & 3 year old; over 148 cm stallion, mare, yearling, 2 & 3 year old and geldings 4 years and over . Registration details for all animals placed (i.e. Top four prizes) in any of these classes were consulted from the database . In the first instance, this analysis took no account of which prize an animal won and also took no account of how many times an animal won a prize (e.g. In consecutive years). It also meant that any animal which had been placed but did not fall into the group of 801 (e.g. One of the 1,630 animals where both parents could not be identified) were not included in the analysis of prize winners . The relative distribution of parental coat colours between all 801 animals registered and the 90 which had been placed at shows was calculated . Analysis was performed to compare relative values of parental coat colour between those animals registered with the society, and those placed at the national show . Those combinations for which the expected value was less than 5 were treated as a single group in analysis, meaning that five groups were used: chestnut cremello; chestnut dun; chestnut palomino; palomino palomino; and all others . Due to certain factors having expected values which were low, this analysis was repeated using fisher s exact probability test . Table 1 shows that the largest number of registered palominos in this work, where the coat colour of both parents could be identified, came from a chestnut cremello mating, which is the only parental cross which guarantees a palomino offspring . Since 356 of the animals (i.e. 44%) in this study were this type of cross, these data are supportive of the hypothesis that a large proportion of palominos registered with the society were intentionally bred for their colouring . Table 2table 2.colour combinations which have produced a prize - winning palomino at the society s show within the last 25 years shows that the largest number of the palominos placed at least once at the national championships also came from a chestnut cremello mating . Hence of the 90 (following removal of 1 animal shaded in grey) animals placed during this time, 60 (i.e. 67%) resulted from the only mating type guaranteed to give palomino offspring . Both tables show that a large number of animals either registered with the society or placed at the national championship are the result of a chestnut cremello mating . Moreover, the percentage of horses resulting from a chestnut cremello mating is higher for animals placed at the show than it is for the list of animals registered . Given this observation a calculation was performed to determine if the number of chestnut cremello animals which were placed at the national championship was significantly higher than the figure based on that expected from registration details . Since the expected number of some parental combinations was low (i.e. Less than 5) the only pair - wise combinations which could be used to derive an expected value were: chestnut cremello; chestnut dun; chestnut palomino; and palomino palomino . All other combinations where an animal had been registered with the society (e.g. Bay palomino) were treated as a single expected value . This resulted in the two datasets being different (p=2.8 10) with proportionally more of the chestnut cremello matings being successfully exhibited relative to those registered . When the analysis was repeated using fisher s exact probability test to compensate for the fact that certain expected values were low, this also suggested that the differences between the populations was significantly different (p=4.5 10). It is also interesting to note from table 2 that every single animal which was placed at the show over the last 25 years whose parents coat colours could be identified had at least one parent which was a palomino, a chestnut or a cremello, and 77 of the 90 had both parents falling into one of these colourings . When the analysis was restricted to only those horses which won first prize in a particular class at the national championships, only 35 horses could be identified where the colouration of both parents had been recorded (table 3table 3.colour combinations which have produced a palomino which won first prize in its class at the society s show within the last 25 years). Of these animals 22 (63%) the remaining animals were chestnut bay (4); palomino palomino (3); chestnut palomino (2) and 1 each of black palomino, chestnut dun, chestnut skewbald and cremello grey . Thus the values for considering chestnut cremello animals winning first prize versus those for any of the four places, are relatively similar (67% versus 63%). The second category investigated was one which extended beyond the national championship, and looked at a points scheme, whereby horses are awarded a certain number of points every time that they are placed at any show at which points are available . Here analysis was restricted to horses which finished in the top eight for their cumulative score for any particular year . This allowed only 22 horses to be studied where the colouration of both parents could be identified . Of these horses, 13 (59%) were the product of a chestnut cremello mating with the remaining horses being palomino palomino (5); chestnut palomino (2); and cremello bay (2). However, interestingly of the 7 horses which won the annual points scheme (with one of the horses winning it in two consecutive years), only one horse (a chestnut palomino) was not the result of a chestnut cremello mating . This work is constrained by some potential limitations in terms of conclusions which may be drawn . For example, judging of animals always has a degree of human subjectivity associated with it . Moreover, many animals which are registered with the society may never be exhibited . Hence it is possible that some of the animals which could have been prize - winning stock were not given the opportunity to fulfil their potential . In addition, due to restricted information being provided to the society by owners at the time of registration, only around a third of horses registered with the society met the criteria regarding parental information needed for inclusion in these analyses . Despite these possible limitations, one observation is very interesting, that the showing success achieved by the only possible parental combination which guarantees a palomino foal is disproportionally larger than that seen for registration of foals with the society . This is true for all definitions of success investigated: horses winning any prize at the national championship; horses winning first prize at the national championship; horses which finished in the top 8 of the annual points scheme; and horses which won the annual point scheme . The reasons for this are uncertain, as there are a range of shades which are acceptable for society membership and a range of parental combinations which can achieve a palomino offspring . This is true for both the initial inspection at the time of society registration, and also for horses being exhibited at shows . Part of the reason for this is that the colour of the horse can vary (e.g. Bleaching of hair colour following periods in the sun). However, it appears that the possible shade, or shades, of coat colour resulting from chestnut cremello matings are also those which are most likely to appeal to judges at shows . This in turn poses an additional question; has the society s ideal colour definition been influenced in favour of matings which are most likely (or even guaranteed) to produce a palomino foal?
Vascular complications are the most frequent adverse outcomes associated with percutaneous coronary intervention (pci) via the femoral artery . They contribute to in - hospital morbidity, mortality, and costs; and furthermore, are associated with increased long - term risk of myocardial infarction and death . Vascular complications include bleeding, pseudoaneurysm formation, hematoma, arterio - venous fistula, retroperitoneal bleeding, and other femoral arterial injuries requiring procedural or surgical intervention . Abdominal wall hematoma is a rare condition that can give rise to an acute abdomen . In this report, we describe a case of a 73-year - old woman who developed an abdominal wall hematoma, which is a rare but serious complication of a pci via the femoral approach . A 73-year - old woman, with a past medical history of hypertension, diabetes mellitus for 40 years, and chronic kidney disease stage 5, because of diabetic nephropathy, presented to the emergency department with dyspnea (nyha iv). The patient had the following vital signs: blood pressure: 155/63 mmhg; pulse: 93 beats per minute; respiratory rate: 28 breaths per minute; and her body temperature was 36.0. on physical examination, the patient had no notable findings, other than bilateral expiratory rales and neck vein distention . An electrocardiogram was within normal limits . A chest x - ray revealed marked cardiomegaly and pulmonary edema . Laboratory tests showed the following: white blood cell count: 10300/mm, hemoglobin: 8.3 g / dl, platelet count: 250000/mm, blood urea nitrogen: 63 mg / dl, creatinine: 4.4 mg / dl, brain natriuretic peptide: 483 pg / ml, creatine kinase isoenzyme mb: 2.0 ng / ml, and troponin - i: 0.10 ng / ml . The patient received emergency hemodialysis because of pulmonary edema refractory to medical therapy, including high - dose furosemide infusion . After stabilizing the patient s volume status by regular hemodialysis, she received coronary angiography for the evaluation of ischemic heart disease on the 19th day of admission . The patient took aspirin (300 mg) and clopidogrel (300 mg) loading dose 12 hours before the procedure . When the 0.025-inch straight guidewire (45 cm, terumo, tokyo, japan) for a 4 french sheath was advanced, some resistance was felt . We then checked the fluoroscopy and found that the guidewire was introduced into the circumflex iliac artery (fig . 1a). We promptly pulled the guidewire back from the circumflex iliac artery and advanced it into the abdominal aorta under fluoroscopic guidance . The external iliac artery and circumflex iliac arteries were intact, there were no changes in the patient s vital signs, and no abdominal symptoms were found, therefore, we continued the coronary angiography without incident . (a) hydrophilic guidewire is unintentionally introduced into the circumflex iliac artery (arrow). The circumflex iliac artery is intact and there is no evidence of perforation (arrow). Coronary angiography revealed significant stenosis in the middle and distal segments of the right coronary artery and the middle segment of the left anterior descending artery . After 7000 iu of heparin was administered intravenously, we performed a pci at the middle and distal right coronary artery and the mid - left anterior descending artery with an activated clotting time (act) of more than 300 seconds, without any immediate complications . Because the act remained prolonged fourteen hours after pci, the patient complained of a right abdominal pain, with mild swelling of her right abdomen . We started hydration with normal saline and performed a transfusion of 2 pints of packed red blood cell because of an abrupt drop of hemoglobin from 9.3 to 7.3 g / dl over 12 hours . The sheath site was clear with no evidence of bleeding, hence, we performed an abdominal computed tomography angiography to identify other causes of the bleeding, which revealed a right lateral abdominal wall hematoma about 5 cm in diameter (fig . The right circumflex iliac artery was located in the hematoma, but there was no evidence of active extravasation of contrast media . The patient s vital signs remained stable after hydration and transfusion, so we decided to closely observe her . However, the patient still complained of abdominal pain and ecchymotic patches appeared on her abdomen 3 days after the procedure (fig ., the patient underwent intermittent hemodialysis with minimal use of heparin and had her hemoglobin checked daily . The patient was discharged uneventfully after 26 days of hospitalization (7 days after pci). She was discharged on aspirin (100 mg), clopidogrel (75 mg), rosuvastatin (10 mg), losartan (50 mg), and carvedilol (6.25 mg). Transverse (a) and coronal (b) section show right - sided abdominal hematoma and circumflex iliac artery (arrows). Abdominal wall hematoma is a rare but potentially serious vascular complication that may develop after cardiac and peripheral angiographic procedures.1) predisposing factors include increased sheath size, repeat or multiple punctures of the artery, concomitant use of anticoagulants, advanced age, being female, and hypertension.2)3) there are two types of abdominal wall hematomas: spontaneous and iatrogenic . Iatrogenic hematomas often occur when the circumflex iliac artery is perforated during the insertion of the guidewires, although this is a rare complication.4) these hematomas are distinguished from retroperitoneal hematomas, which occur when a physician unintentionally punctures the inferior epigastric artery or cannulates the femoral artery too superiorly . There have been cases of spontaneous abdominal wall hematomas in patients with some predisposing factors, although the incidence is very low.5)6) the common symptoms of abdominal wall hematoma are the sudden onset of abdominal pain and swelling, which usually occurs several hours after the procedure . Because of its rarity, abdominal wall hematoma can be mistaken for several common acute abdominal conditions, such as appendicitis, sigmoid diverticulitis, perforated ulcers, ovarian cyst torsion, tumors, and incarcerated inguinal hernias.7) diagnosis can be made clinically by the appearance of an obvious swelling or bruising, or may include non - specific findings, such as anemia and fever . Imaging studies help to confirm the diagnosis and exclude intra - abdominal hemorrhage.8) contrast - enhanced ct can detect and evaluate active bleeding from a rupture site . Even in patients without contrast extravasation at the bleeding site as observed on a ct, angiography could be a useful imaging technique to identify an active bleeding point.9) conservative management, including bed rest and analgesics, is appropriate for most stable patients . However, when a patient has evidence of sustained bleeding, angiographic interventions or surgery should be considered.10) in order to prevent vascular complications, such as abdominal wall hematomas or pseudoaneurysms, puncturing the femoral artery under fluoroscopy guidance may be considered.11) after the artery has been successfully punctured, the guidewire must be smoothly advanced through the cannula . The cornerstone of safe sheath engagement is to stop when resistance is encountered during the insertion of the guidewire . Difficulty in advancing the guidewire may occur when the wire enters a small branch vessel . After confirming the location of a wire by fluoroscopy, one can then retract the wire, spin it gently, and try advancing it again . In this situation, one must consider angiography to assess for the occurrence of complications, such as vessel perforation and dissection . When vascular complications are suspected, pci should be delayed with a discontinuation of antithrombotic agents, as well as close observation of the patient . Because hydrophilic guidewires tend to unintentionally engage small vessels, replacing the straight hydrophilic guidewire with a j - tipped wire can be one strategy for preventing the perforation of small vessels . In general, it cannot be overemphasized that it is important to closely observe patients who have undergone pci, especially with those with predisposing factors for bleeding, even without any evidence of immediate vascular complications . In the present case, there was an unusual development of an abdominal wall hematoma after a pci, in the absence of immediate vascular complications . Thus, we suggest that the following may be causative factors of a delayed abdominal wall hematoma following a pci: injury to the circumflex artery during guidewire insertion and the subsequent prolonged act associated with the use of periprocedural heparin in patients with chronic kidney disease . This case reminds medical professionals of the importance of close observation and proper evaluation of complications after percutaneous coronary intervention, even if the rates of these complications are very low . Fluoroscopy - guided femoral artery puncture and guidewire insertion may reduce the rate pci - related vascular complications . When vascular complications are suspected during the procedure, a staged pci should be considered to prevent periprocedural vascular complications and ensure a patient s safety . With more coronary angiographic procedures being performed, it is important for clinicians to consider the possibility of abdominal wall hematoma in this situation, especially when the patient has many predisposing factors.
For the invasive treatment of symptomatic aortic stenosis several attractive options became available beyond conventional cardiosurgical implantation of stented bioprostheses or mechanical valves . Besides stentless prostheses, in particular transcatheter procedures are of growing importance . Nevertheless the number of implanted stented bioprostheses in germany expanded or at least remained stable over the last years . Thus, 9.704 bioprostheses were implanted in germany in 2010, according to 84% of all implanted prostheses in aortic position . Implantation of bioprostheses was associated with a 30-day - mortality of 3,3%, which is higher than for mechanical valves (1,5%) due to the fact that patients for bioprostheses are significantly older or suffer from more complex co - morbidities . The purpose of this review is to summarize the features of the currently available bioprostheses in the light of competing procedures . There has been a continuous development to improve the design of stented bioprostheses with respect to hemodynamic profile, biological durability and ease of implantation . Various designs are available, allowing a valve selection according to individual patient factors or anatomical criteria including techniques for intra - annular and supra - annular positioning [3, 4]. It would have the same biological and hemodynamic properties as a normal valve and would not undergo degeneration . Stented bioprostheses have proven to be effective even in small aortic roots regarding hemodynamic improvement, left ventricular mass reduction and improvement of the patient s quality of life . In vitro examinations showed pericardial valves to be slightly superior to porcine valves with regard to gradient and orifice area . Associated with the scalloped designs of stented bioprostheses a tension - free implantation with avoidance of paravalvular leaks can be expected . Implantation techniques evolved over the last decades which resulted in short cross - clamp times in normal findings . Surgeons learned that meticulous care in decalcifying the aortic annulus and sizing helps to prevent paravalvular leaks . Additionally, accurate sizing prevents a patients - prosthesis - mismatch which could result in poor postoperative clinical performance . Avoiding the use of running suture for stented valve implantation the evolvement of low profile valves reduces the risk of coronary occlusion in patients with a small distance between annulus and coronary ostia . The currently available and established bioprostheses show rates of degeneration at 20 years around 15% in patients aged 65 or higher . The freedom from repeat aortic valve replacement reaches over 85% after 20 years in patients older than 60 years and 65% in all age groups . Along with these convincing results of durability and freedom of re - implantation stented bioprostheses became also attractive for younger patients . If a repeated valve replacement is necessary due to functional deterioration the operative mortality is acceptable with 4 to 6% and is mainly due to active endocarditis and comorbidities . Lately transcatheter aortic valve implantation (tavi) with valve - in - valve implantation into the degenerated xenograft showed to be an additional option in high risk patients with the need for redo valve replacement . Stentless porcine valves were initially believed to have superior hemodynamic properties resulting in more effective reduction of left ventricular mass and better clinical performance according to nyha class . These findings could nt be yet approved by long - term follow up investigations [15, 16]. Bearing this in mind calls the more demanding implantation technique of stentless prostheses in question . Stented bioprostheses are still used more commonly than stentless ones because of their relative ease of implantation, their extensively documented long - term results, and the low risk associated with reoperation . Another biological approach is the use of an autograft like the ross procedure, where the patient s pulmonic valve is transferred to the aortic position . These pulmonic autografts have excellent hemodynamic properties as well as low rates of thrombosis, degeneration, and endocarditis . The ross procedure is suitable for children and young adults because it is compatible with further growth of the aortic root . Nevertheless since the pulmonary valve has to been replaced by a bioprosthesis it is a demanding two valve procedure with prolonged cross clamping times . Aside from this, special means are necessary for pulmonary autograft stabilization to prevent its degeneration . There are only a few current randomized trials comparing the long - term results of biological and mechanical valves . A large - scale review revealed no difference in survival rates at 10 years and a slightly higher survival rate at 15 years for patients with mechanical prostheses . The reoperation rate for mechanical valves in the aortic position is less than 5% at 10 years and less than 10% at 15 years, while the corresponding figures for bioprostheses are 10% and 30%, respectively . Hemorrhagic complications are significantly more common in patients with mechanical valves because of anticoagulation . Chronic atrial fibrillation is no longer a contraindication to bioprostheses since permanent oral anticoagulation can be avoided if concomitant ablative surgery results in permanent conversion to sinus rhythm . End stage renal failure was also defined a contraindication to bioprostheses since a rapid degeneration was feared due to altered metabolism in these patients . It has been found that life expectancy is already curtailed to such an extent that bioprosthesis degeneration often does not occur in the remaining lifetime . The supposed advantage of the longer durability of a mechanical valve is also offset by the potential complications of oral anticoagulation, especially because anticoagulation is more difficult to manage in dialysis patients than in others . Nevertheless aortic valve replacement using a tissue valve remains controversial for patients younger than 60 years since there are studies reporting reduced mid - term results . Some younger patients are averse to oral anticoagulation and therefore prefer a biological valvular prosthesis . Thus, younger patients opting for a bioprosthesis can enjoy a normal quality of life without anticoagulation for many years but may need to undergo a second valve replacement procedure with an acceptable degree of risk . Implantation of conventional prostheses can be performed through a limited direct access like a hemi - sternotomy or a lateral access . Reported large series show that aortic valve operations can be safely performed in experienced centers . Substantial progress in valve technology led to the development of self - expanding valves . Since a few years a number of bioprostheses are available for suture - less implantation which is usually combined with a limited surgical access . . Future will show the benefits of this procedure characterized by short cross clamping times and whether it can coexist with tavi procedures . After its clinical inauguration by cribier in 2002 the transcatheter aortic valve implantation gained widespread use in high risk patients with aortic stenosis . In germany a massive increase of its application can be observed; in 2010 nearly every fourth aortic valve replacement was performed as a tavi procedure . The partner trial was a randomized trial comparing tavi with standard - of - care therapies in high risk patients . A 2-year follow - up of patients in the partner trial supports lately tavi as an alternative to surgery in high - risk patients . The two treatments were similar with respect to mortality, reduction in symptoms, and improved valve hemodynamics, but paravalvular regurgitation was more frequent after tavi and was associated with increased late mortality . There are a growing number of publications reporting promising short term results in high risk patients . Nevertheless there is still a lack of evidence that tavi is superior to open valvular replacement as the gold standard regarding long - term results . Current guidelines recommend the use of tavi restricted to patients with contraindications for open surgery or inacceptable perioperative risks . Current studies reveal that bioprostheses of the most recent generation last longer than earlier types . Because life expectancies in general have risen, more and more elderly patients are presenting for valve replacement and for these patients a bioprosthesis is usually chosen . In addition the cost effectiveness of stented bioprostheses appears unbeatable and the surgical ease of implantation allows for cross - clamp times between 30 and 60 minutes . Overall, even in face of more innovative biological alternatives the implantation of stented bioprostheses is still a very interesting option and represents actually the most frequent valve implantation technique for aortic stenosis . Especially in the light of growing use of interventional valve replacement there is the urgent need for complete nationwide registry with adequate long term follow up, quality of life information and relevant subgroup analysis to define new standards in the treatment of patients with aortic stenosis.
If you can measure the problem than half of the problem is solved . The psychological dependence is seen in cases of use of illegal drugs, alcohol and tobacco . The use of tobacco in india has witnessed varied patterns, which include smoking, chewing, applying, sucking and gargling, and so on . Each of these patterns of consumption is governed by the geographic area, economic status, sociocultural, and religious influences . Forms of tobacco chewing include, pan (piper betel leaf filled with sliced areca nut, lime, catechu, and other spices chewed with or without tobacco), pan - masala or gutakha (a chewable tobacco containing areca nut), and mishri (a powdered tobacco rubbed on the gums as toothpaste). Despite the growing societal and legal restrictions on tobacco consumption, people are consuming tobacco in various forms . Alcohol is known to be a potentially dangerous drug, and society still accepts it as such . On the other hand interestingly, diagnostic and statistical manual of mental disorders, 4 edition, text revision (dsm - iv - tr) has included nicotine related disorders in its list of mental disorders since 2000 . According to chadda and sengupta, the harmful effects of tobacco had been recognized historically in 16 century by king james i of england, shah abbas of persia and the mughal emperor jahangir of india, who tried to ban the consumption of tobacco among public . Chattopadhayya has mentioned in his study that the famous indian sikh guru gobind singh also prohibited smoking for the members of the sikh community . He said, wine is bad, indian hemp (bhang) destroys one generation, but tobacco destroys all generations . Tobacco use has been considered a religious taboo by the sikhs since then . However, despite historical attempts to ban tobacco, its use has continued to grow in popularity as a non - productive time - pass . Mentioned that tobacco smoking or chewing and associated nicotine dependence is a complex syndrome involving physiological, psychological and behavioral processes . Ashley et al . Have stated, although nicotine is blamed for chemical causing high level of dependence, but certain byproducts and additives in tobacco are also responsible for dependence . A survey was conducted by subramanian et al . To study pattern of distribution of tobacco consumption in india . Almost 35 million tobacco users attempt to quit every year, but only about 6% are successful for more than just a month . Many quitting programmes need to measure how much an individual is psychologically dependent on tobacco . Keeping in mind the above reasons and need, our study was directed to measure the psychological dependence, which is the root cause of high tobacco consumption among the rural population . It aimed at identifying which form of tobacco consumption (smoking or smokeless) is causing psychological dependence and which particular age group in rural population is psychologically more dependent on tobacco . The motive was to draw the attention of the tobacco cessation centers so that they can target at specific age group in rural population, with a particular tobacco consumption habit . This study will help and simplify the job of tobacco cessation centers by high - lighting the risk group in relation to high psychological dependence for tobacco consumption . Subjects with the habit of tobacco smoking or tobacco chewing were selected from a rural area and catchment area of dental college, with a population of nearly 2000 people . The study was approved by ethical review board of pravara institute of medical sciences (pims) deemed university . The procedures followed were in accordance with the ethical standards of the responsible committee of pims university on human experimentation . Inclusion and exclusion criteria: subjects with the psychologically sound mind and willing to participate in this study after explanation about study the survey was conducted during the regular dental health checkup camp, which was organized for villagers . During this health checkup camp, the tobacco consumption habit was assessed by direct questioning and by clinical examination . For clinical assessment presence of stains of tobacco chewing and tobacco smoking over teeth, and oral mucosa the assessment of habit of tobacco consumption continued for enrolled subjects during dental health check up until 25 subjects with each 20 - 30 years, 31 - 40 years, 41 - 50 years, and 51 and above years of age for tobacco chewing and tobacco smoking separately were included in the survey . Hence, overall all these 200 subjects were divided into following groups as: group i-100 subjects with tobacco smoking habit group ii-100 subjects with the use of smokeless tobacco both groups were further subdivided into following subgroups based on age: group a - with age ranging between 20 years to 30 years group b - with age ranging between 31 years to 40 years group c - with age ranging between 41 years to 50 years group d - with age including 51 years and above a standard questionnaire format of fagerstrom test for nicotine dependence (ftnd revised version) for smoking [table 1] given by heatherton et al . And smokeless form of tobacco [table 2] given by ebbert et al . The subjects were asked to answer the questions as per their experience of tobacco consumption and calculate the total point score . Questionnaire form of ftnd revised version for smoking form of tobacco questionnaire form of ftnd revised version for smokeless form of tobacco 7 - 10: person is highly dependent on nicotine and may benefit from a smoking cessation program based on treatment for nicotine addiction . 4 - 6: person has low to moderate dependence on nicotine; however, this does not rule out a smoking cessation program based on treatment for nicotine addiction . Below 4: person has low to moderate addiction, but is not likely to need nicotine replacement therapy . The calculated scores for all subjects were then statistically analyzed by using the karl pearson correlation (r) test and student's t - test for the distribution of psychological dependence among the rural population . The data was analyzed by using the statistical software systat by cranes software private limited, bangalore, india (www.systat.org). 7 - 10: person is highly dependent on nicotine and may benefit from a smoking cessation program based on treatment for nicotine addiction . 4 - 6: person has low to moderate dependence on nicotine; however, this does not rule out a smoking cessation program based on treatment for nicotine addiction . Below 4: person has low to moderate addiction, but is not likely to need nicotine replacement therapy . The calculated scores for all subjects were then statistically analyzed by using the karl pearson correlation (r) test and student's t - test for the distribution of psychological dependence among the rural population . The data was analyzed by using the statistical software systat by cranes software private limited, bangalore, india (www.systat.org). The statistical analysis of the study data revealed that tobacco chewing habit is more common and for a long duration in the subjects below the age of 40 years in rural population . Subjects above 50 years of age were more indulged with the tobacco smoking habit as compared to tobacco chewing habit [table 3]. Distribution of mean and sd values of the duration of habit and ftnd score (points) in all groups under study when we compared group i with group ii for psychological dependence for tobacco use, statistical analysis revealed that people are highly dependent on tobacco smoking after age of 40 years (5.24 2.31; [table 3]). Study data revealed that, form of tobacco consumption (either smoking or smokeless form) does not have any influence over psychological dependence for age groups of 20 - 30 years and 31 - 40 years . A positive correlation [table 4] was observed between duration of habit and ftnd score in all age groups, irrespective of the type of habit of tobacco consumption . This positive correlation indicates that, as the duration of habit increases, psychological dependence also increases [figure 1]. This correlation found to be stronger in group ic that is in the age range of 41 - 50 years where correlation coefficient (r) is 0.4278 [table 5]. After applying student t - test, this correlation in all the groups karl pearson correlation (r) between duration of habit and ftnd score in all groups comparison of the mean value of duration of habit and fagerstrom test for nicotine dependence score in all groups comparison of mean values of duration of habits and ftnd score in group ic and iic the comparison of ftnd scores for older adults (40- 50 years; [table 5]) and those above 50 years [table 6] in rural population revealed that, though there was no significant difference in duration of habit between group ic and iic, there was highly significant difference observed in relation to psychological dependence among these individuals . By applying student's unpaired test there was a highly significant difference observed between the proportions of duration of habit and ftnd score in group i d and iid (p <0.01). So after the age of 40 years, the rural population seemed to be highly dependent on tobacco smoking as compared to tobacco chewing . Comparison of mean values of duration of habits and ftnd score in group i d and ii d every year, millions of tobacco users try to quit the habit, but only few succeed in their attempt what might happen in tobacco addicts is probably that, in an effort to adjust and feel normal, the brain does actually alter its physical neuro - circuitry to meet the changed chemical onslaughts of nicotine, dopamine, adrenaline, acetaldehyde etc . The number of neuro - receptors and transporters available to receive nicotine will diminish . At the same time, extra acetylcholine receptors develop . Withdrawal from nicotine upsets this delicate balance . The dopamine and adrenaline levels are all wrong, and the brain signals a feeling of depression and anxiety . Studies have been conducted by surekha and thorat et al . To see the level of consumption of tobacco among the rural population . These studies are descriptive in nature, mainly focusing on the percentage distribution of tobacco consumption among the rural population . The present study, mainly focused on measuring the nicotine dependence among the rural population, hence that the particular age group and the type of tobacco consumption habit associated with the psychological dependence can be targeted for cessation . Epidemiological surveys conducted earlier in relation to habit of tobacco consumption showed that, mean age of addiction for male smokers was 27.2 years and for chewers it was 22.8 years . The corresponding ages for the surveys conducted later they were 32.0 years and 25.3 years respectively . Looking at these statistical values, the present study was designed to enroll even a lesser age of 20 years, for measurement of psychological dependence . Younger age groups of rural areas showed a higher psychological dependence for tobacco chewing as compared to tobacco smoking [table 3]. The high frequency of tobacco chewing in young people could be attributed to some of following reasons: younger age group of the rural population is not so familiar with the trend of tobacco smoking especially cigarette smoking due to cost factormanually made cheaper tobacco chewing products such as mawa, gutakha, tobacco quid etc ., are more preferredpeer pressurein rural population bidi smoking has become a definite trend for older ones and not much accepted by younger populationyounger individuals can hide their habit of tobacco consumption by preferring tobacco chewing rather than tobacco smoking . Younger age group of the rural population is not so familiar with the trend of tobacco smoking especially cigarette smoking due to cost factor manually made cheaper tobacco chewing products such as mawa, gutakha, tobacco quid etc ., are more preferred in rural population bidi smoking has become a definite trend for older ones and not much accepted by younger population younger individuals can hide their habit of tobacco consumption by preferring tobacco chewing rather than tobacco smoking . The above observations are correlating with the study conducted by kishore et al ., in rural population of district wardha . They found that the majority of the boys were engaged in tobacco chewing (69.74%) type of tobacco consumption . The exposure of the habit of tobacco use in adolescents was influenced by various factors such as peer pressure, friends, elders, boys trying to follow hero images, feeling strong and powerful when using tobacco and last but not the least, for fun . The present study has revealed that tobacco smoking habit, especially, bidi smoking is more common after the age of 40 years among the rural population . The mean duration of habit and ftnd score is high [table 3, figure 1] for tobacco smoking as compared to tobacco chewing after the age of 40 years . The reasons for such a shift of pattern of tobacco consumption could be as follows: bidi is known as the poor man's cigar and is also very well accepted as a trend among older individuals in the rural population.since most of the old individuals lose their teeth, and are unable to chew hard tobacco, this physical disability could be a cause for a shift of habit pattern . Bidi is known as the poor man's cigar and is also very well accepted as a trend among older individuals in the rural population . Since most of the old individuals lose their teeth, and are unable to chew hard tobacco, this physical disability could be a cause for a shift of habit pattern . The literature search for high dependence on bidi smoking revealed that the nicotine concentration in the tobacco of bidi was significantly greater (21.2 mg / g), than the tobacco from the commercially filtered (13.5 mg / g) and unfiltered cigarettes (16.3 mg / g). Therefore, it is logical to presume that bidi smokers are at a risk of becoming nicotine dependent . Based on these findings malsona et al . Deter a popular belief among us teens that bidis are a safe alternative to commercial cigarettes . The literature states that tobacco associated oral cancer is commonly seen in people above 40 years of age . Subsequently, as per the present study findings, a hypothesis can be derived that, in rural areas, people above 40 years of age with tobacco smoking habit are at a higher risk for developing oral cancer due their high psychological dependence . Present study highlights tobacco chewing habit is more prevalent among young individuals of the rural population.the type of habit either tobacco chewing or tobacco smoking does nt have any effect over psychological dependence among individuals below 40 years of age . Hence, the young individuals should be targeted for tobacco cessation therapy irrespective of type of habit of tobacco consumption.individuals above 40 years of age show a high psychological dependence for tobacco smoking as compared to tobacco chewing, and these individuals are at a risk for developing oral cancer due to higher tobacco consumption.hence, it is of prime importance to target such individuals for quitting tobacco consumption habit . The type of habit either tobacco chewing or tobacco smoking does nt have any effect over psychological dependence among individuals below 40 years of age . Hence, the young individuals should be targeted for tobacco cessation therapy irrespective of type of habit of tobacco consumption . Individuals above 40 years of age show a high psychological dependence for tobacco smoking as compared to tobacco chewing, and these individuals are at a risk for developing oral cancer due to higher tobacco consumption . Hence, it is of prime importance to target such individuals for quitting tobacco consumption habit . Present study is a grass root level based questionnaire survey to measure the psychological dependence of the rural population for tobacco consumption habit . The first step towards tobacco cessation is to know how much an individual is psychologically dependent on tobacco . Based on the dependence level, the programme of tobacco cessation should be adequately implemented . Among the rural population tobacco smoking habit these findings could be a stepping stone for opening of tobacco cessation centers in rural area, which can target the rural population to put an end to the habit and hereafter reduce the incidence of oral cancer . The good news about the psychological part of addiction is that the mind can actually over - ride the brain and body . Right at the time, a tobacco user decides to quit smoking, he / she has there itself begun to gain some control over the addiction.
While decreases in both breast cancer incidence and mortality have been apparent in recent years, the societal and economic impact of this malignancy continues to be enormous . Positive associations between environmental and individual factors and increased risk of breast cancer development have been alleged for at least a century . Several progresses were made in understanding the underlying mechanisms of cancer development and some drugs were recently approved for the preventive approach of this disease . Thus, the current thinking is that prevention is a highly feasible approach to breast cancer control . Despite several factors which increase the woman' risk (gender, age, and family history) are not changeable, other modified risk factors such as alcohol intake, dietary fat, obesity in postmenopausal age, and hormonal stimulations have been identified and for these reasons interest in strategies to prevent breast cancer remains strong and intriguing . Cancer chemoprevention is defined as the use of natural, synthetic, or biochemical agents to reverse, suppress or prevent carcinogenic process to neoplastic disease . The epithelial carcinogenesis is a multistep, multipath, and multiyear disease of progressive genetic and associated tissue damage (figure 2). In detail, the carcinogenetic process starts with unspecified accumulations of genetics events which lead to a progressive dysplastic cellular appearance with genotypic and phenotypic alterations, deregulated cell growth, and finally cancer . This process is similar in every epithelial cancer, and the ability to arrest one or the several of these steps may impede or delay the development of cancer . Although the precise mechanism that causes breast cancer is not fully established itis recognized that hormones play a significant role in almost 70% of cases and current chemopreventive strategies have targeted hormonally responsive breast cancers . Estrogen is well established as a promoter of cell division in the breast, where it causes proliferation of both normal and malignant cells . The two major classes of antiestrogenic drugs, the selective estrogen receptor modulators (serms) and the aromatase inhibitors (ais), have been recently used for their activity in breast cancer prevention . This class of drugs includes in particular tamoxifen (tam) and raloxifene, acting as both estrogen agonist and antagonists . Tamoxifen citrate is the first generation of serms that competes with circulating estrogen for binding the estrogen receptor (er). Like tamoxifen, also raloxifene, a second generation of serms, has both estrogen agonist and antagonist properties . Tam has been in clinical use for breast cancer treatment for more than 30 years to reduce the risk of both recurrence and contralateral neoplasia, 42% and 47%, respectively . These data lead to choose tam as a potential chemopreventive agent, and several studies were conducted in last decades in this particular setting . The bcpt nsabp-1 was a placebo - controlled trial of tam in more than 13000 women at high risk of breast cancer . Women were randomized to receive tamoxifen 20 mg / die or placebo for 5 years . This trial was closed early after the interim analysis showed a 49% reduction in incidence of invasive breast cancer in the treatment arm . Moreover, the highest level of benefits was observed in patients with precancerous lesions as lcis (relative risk = 0.44) and atypical ductal hyperplasia (relative risk = 0.14). Tamoxifen appeared able to reduce breast cancer incidence also in healthy brca2 carriers by 62% but not in brca1 . The study showed also an increased risk of endometrial cancer and thrombotic events, and these conclusions suggested that despite its extraordinary preventive efficacy the utilization of tam in this particular setting should be extremely individualized . The results of this study were the first to show the benefit of tam in breast cancer prevention . In addition, 3 european tamoxifen prevention trials have been completed and have reported long - term follow - up data of the effect of this agent in bc incidence: the italian tamoxifen prevention study, the royal marsden hospital tamoxifen randomized chemoprevention trial, and the international breast cancer intervention study (ibis)-1 . Although they differ in many details in study design and other, these trials were similar enough to be evaluated together in an overview of their main outcomes . Their combined data indicate an overall 30 to 40% reduction in breast cancer er - positive incidence following 5 years of tam versus placebo (figures 3 and 4), and these effects remains also after more than ten years of followup . The serious adverse events that occurred with tam were as anticipated from previous adjuvant trials, an increase of endometrial cancers and venous thromboembolic events (vtes). Other expected tam - associated toxicities were observed as cataracts, hot flushes, and vaginal discharge . The data from the nsabp p-1 trial, which showed a reduction in both invasive and noninvasive breast cancers, led to the 1998 us food and drug administration (fda) approval of tam for reduction of breast cancer incidence in high - risk women . However, the adverse effects of this drug have hampered its uptake by women at increased risk . When tam's benefits are balanced against its major toxicities, younger women at very high risk and possibly hysterectomized postmenopausal women appear to be the best candidates for preventive tam . A simple and economic approach to retain tamoxifen efficacy while reducing the risks may be a dose reduction . In a study conducted by our group, standard dose of tamoxifen (20 mg / die) and two differ lower doses (10 mg / die and 10 mg on alternate days) were administered for 2 months in a cohort of more than 120 healthy women, and changes in serum biomarkers regulated by the er were evaluated . No evidence for a concentration - response relationship was observed for most of these biomarkers . The concept of dose reduction was further supported by the observation of tamoxifen as very high tissue distribution (560 times its blood concentrations) and a prolonged half - life . Moreover, the low - dose concept has been confirmed in a preoperative trial in which 120 breast cancer women were treated with either 20, 5, or 1 mg / die of tam for 4 weeks before surgery . The effects of these different doses of tam on proliferation were analyzed using the ki67 expression as the main surrogate endpoint marker . Interestingly, the change in ki67 expression induced by lower doses of tamoxifen was comparable to that achieved with the standard dose, implying that low - dose tam retains its antiproliferative activity . Moreover, several blood biomarkers of tam estrogenicity associated with the risk of breast cancer, cardiovascular disease and bone fracture showed a dose - response relationship, and suggesting that this approach may be associated with reduced, positive and negative oestrogenic effects of tam . These fundamental data provide a strong rationale for the formal assessment of low - dose tam in preventive setting, and for these reasons we started two phase iii randomized placebo trials (actually ongoing in our institute) in order to assess the efficacy of 5 mg / die of tam in high - risk women as current hrt (hot study) and with breast intraepithelial neoplasia (ien). Raloxifene, a second generation of serms has reduced the incidence of breast cancer in preclinical models and several clinical trials evaluated it for the prevention of osteoporosis and heart disease [2022]. Raloxifene, which has a well - established and favourable effect on bone metabolism, was in fact initially approved (by fda) for the prevention and treatment of osteoporosis in postmenopausal women . In the multiple outcomes of raloxifene evaluation (more) trial, raloxifene (60 mg or 120 mg compared to placebo) shows a 30% reduction in the risk of vertebral fracture in postmenopausal women with osteoporosis . One of the secondary endpoints of the study was the incidence of breast cancer in this target of population, and in raloxifene - treated group the risk of invasive breast cancer was significantly reduced by 72% (rr = 28; 95% ci 0.170.46) that becomes 62% after 4 years of followup in the continuing outcomes relevant to evista (core) trial . As was noted in the tamoxifen trials, the benefits appeared to be specific only to receptor - positive invasive breast cancer . An increasing risk in thromboembolic events included dvt (deep venous thrombosis) and pulmonary embolism as observed in a raloxifene study (rr = 3.1; 95% ci 1.56.2), but unlike what occurs in tamoxifen there was no difference in the incidence of endometrial carcinoma compared with placebo arm [23, 24]. Results of more and core trials led researchers to conduct a comparative, randomized phase iii study of raloxifene versus tamoxifen in more than 19000 postmenopausal women at increased risk for breast cancer . The study of tamoxifen and raloxifene (star) trial or nsabp - p2 compared 20 mg of tamoxifen daily to 60 mg of raloxifene daily for 5 years with the incidence of breast cancer as a primary endpoint . The secondary end points included noninvasive breast cancer, uterine malignancies, thromboembolic events, fractures, cataracts, quality of life, and death from any cause . Interestingly, although no untreated control group was included, there was no difference in the incidence of the disease between the two groups (rr: 1.02; 95% ci: 0.8281.28). Furthermore, while there was a difference between the two treatment groups for the rate of in situ(ductal and lobular) breast cancer, this was not shown to be statistically significant (rr: 1.40; 95% ci: 0.9892.00). Conclusive results based on the risk reduction seen in the bcpt for tamoxifen show that both drugs reduced the risk of developing invasive breast cancer by about 50% . While tamoxifen reduced the incidence of lcis and dcis, raloxifene did not have an effect on these diagnoses . A mechanism to explain the difference in noninvasive breast cancer incidence is unknown, but long - term follow - up results for the star trial may result in additional information regarding this issue . Regarding the side effects, more uterine malignancies occurred in the tamoxifen arm and no statistically significant differences were noted between the 2 groups relative to the incidence of any cardiovascular events . More recently, results from the raloxifene use for the heart (ruth) study affirmed the benefit of raloxifene with regard to reduced risk of breast cancer . This trial, designed to focus on heart disease, randomized more than 10,000 postmenopausal women with coronary health disease or multiple coronary health disease risk factors to receive either raloxifene 60 mg per day or placebo . Data from the star trial and the other raloxifene / placebo trial resulted in the approval of raloxifene by the us food and drug administration for a reduction in the risk of invasive breast cancer in postmenopausal women with osteoporosis and reduction in the risk of invasive breast cancer in postmenopausal women at high risk of invasive breast cancer . No data are currently available on the use of raloxifene in patients with brca1 or brca2 mutations, nor was raloxifene approved for women with a previous invasive breast cancer or for the treatment of invasive breast cancer . However, the approval of raloxifene gives an important new option to postmenopausal women beyond that of tamoxifen, one that avoids an excess of endometrial cancers and reduces the risk of thromboembolic events . High circulatory estrogen levels, as well as high aromatase levels in breast tissue, have been known to increase breast cancer risk . Thus, inhibition of aromatase would be expected to decrease estrogen production and ultimately estrogen - related breast carcinogenesis . In adjuvant setting, third generation of ais (anastrozole, letrozole, and exemestane) has been found to superior to tamoxifen and be able to reduce the incidence of contralateral breast cancers by 37 to 55% [2833]. These agents have resulted in improved disease - free survival and are associated with fewer life - threatening side effects than serms . Thus, the third - generation aromatase inhibitors (ais) have been introduced into the treatment of breast cancer, and their greater efficacy compared to tamoxifen, along with a more favorable side - effect profile, makes them attractive agents for use in breast cancer prevention [35, 36]. The international breast cancer intervention (ibis)-ii prevention trial, direct consequence of atac trial, is actually ongoing and is comparing anastrazole (ana) to placebo in 6000 postmenopausal women at increased risk to breast cancer . A second complimentary study (ibis - ii) will look at the role of ana in affected postmenopausal women who underwent a locally excised (or mastectomy) hormone receptor - positive intraductal neoplasia with clear margins . In this second group, both arms address the ability of ana to reduce the incidence of first primary invasive breast cancers . Another prevention trial with ais (map3) is actually underway with exemestane (exe). Authors are comparing placebo or exe, or exe plus celecoxib for 5 years in more than 5000 high - risk postmenopausal women . In september 2004 the disclosure of an excess of adverse cardiovascular events in the cox-2 inhibitor arm has recommended authors to revised the study design . They modified it in two different arms (exemestane vs placebo) and a new simple size of 4.560 . Despite this, the map3 study was reopened to accrual in march 2005 with a revised sample size of 4,560 and two arms, exe 25 mg / d alone and placebo . The primary endpoint is the incidence of breast cancer specifically to determine if exe is able to reduce invasive breast cancer by 65% compared to placebo . These data obtained by adjuvant trial provide a rational for exploring ais in prevention setting . They are superior to tamoxifen, and we hypothesized that the major of er - positive breast cancer (but not for er negative) can be prevented by these drugs . Moreover, they are also well tolerated than tamoxifen without uterine and thrombotic effects, but they do lead to bone mineral loss . These effects should be contrasted by the use of bisphosphonates . Although a number of antiestrogenic agents are being extensively tested in clinical trials, all these agents affect the endocrine pathway and suppress only the development, of estrogen receptor (er)-positive breast cancer . They have no effect in reducing the risk of er - negative breast cancer, which accounts for 2030% of breast cancers and has a poor prognosis . Thus, it is worth identifying new pathways, biomarkers, and agents that are effective in the treatment and prevention of these subtypes . With the accumulating knowledge in understanding the biology of cancer development several classes of a new generation of chemopreventive agents modulating the nonendocrine biochemical pathways have been developed and many of these are still currently under investigation . These agents include retinoids, epidermal growth factor receptor (egfr), tyrosine kinase inhibitors (tkis), cyclooxygenase-2 (cox-2) inhibitors, bisphosphonates, vitamin d receptor (vdr), statins, peroxisome proliferator- activated receptor (ppar), and others . A complete summary of involved agents, with their specific pathways, is shown in table 1 and a brief state of the art of the more compounds involved are analyzed below . Retinoids are natural and synthetic derivative of vitamin a (retinol) that have profound effects on development, metabolism, differentiation, and cell growth . The retinoid, the most widely studied in chemoprevention clinical trials, is the synthetic amide of retinoic acid n-(4-hydroxyphenyl) retinamide (4-hpr), or fenretinide . Fenretinide has been found to exert significant chemopreventive activity in various in vitro and in vivo studies [3942]. A phase iii clinical trial, using 4-hpr to reduce the incidence of secondary breast cancer in almost 3000 patients, was published in 1999 and showed no difference in contralateral and ipsilateral breast cancers; however, a posthoc analysis suggested a significant treatment interaction with menopausal status . In particular, it showed a 35% reduction in premenopausal women and an opposite trend in postmenopausal women . Moreover, the 15-year follow - up of this trial substantially confirmed these results, and the risk reduction is of the order of 50% in women aged 40 years or younger and persists for 10 years after retinoid cessation . Moreover, 4-hpr was observed to reduce secondary tumours in premenopausal women irrespective of the hormone receptor status of the primary cancer, suggesting that retinoids have a potential chemopreventive effect on er - negative and er - positive breast cancers . Recently, also a new rxr - selective retinoid, commonly named as rexinoids, has been studied as cancer preventative agent . Preclinical studies in fact have demonstrated that this compound is able to maintain the chemopreventive efficacy of the retinoids, also in er - negative setting, but with substantial minor toxicity [45, 46]. The egfr is one of a family of four closely related receptors (egfr or erbb-1, her-2/neu or erbb-2, her-3 or erbb-3, and her-4 or erbb-4) that uses tyrosine kinase activity and contributes to a large number of processes involved in tumour survival and growth, including cell proliferation and inhibition of apoptosis, angiogenesis, and metastasis, thus making it an attractive target for cancer prevention and treatment, because agents that are able to block the erbb - signaling pathways are promising in the treatment and prevention of breast cancer . In particular, the researchers focused their attention to egfr - her-1 and her-2 pathways, because the mechanism of resistance to antioestrogen therapy is usually associated with an increased expression of her-1 and her-2 receptors . Inhibition of tyrosine kinase activity, with tkis, involved in the egfr signaling cascade could be the right pathway for the treatment and prevention of er - independent breast . One involves blockade of this activity with monoclonal antibodies (trastuzumab), whereas the second involves the tkis . Amplification of the her2 gene and overexpression of it's related protein have been found in almost 30% of human breast cancer and it is generally correlated with poorer outcomes compared with tumors her2 negative [49, 50]. Moreover, there is substantial evidence of an inverse correlation between her2 expression and hormone receptor . In an effort to improve the prognosis of these her2 + cancers, research has focused therapies directly against this pathway and in particular included the monoclonal antibodies trastuzumab (herceptin). Trastuzumab has largely showed its benefit in adjuvant therapy; in particular, it is able to increase the clinical benefit of first - line chemotherapy in metastatic her-2 breast cancer, and this benefit seems to be irrespective of the er status . The drug is generally well tolerated, but its possible cardiotoxicity and its route of administration (intravenously) make it difficult to propose it to healthy women as chemoprevention . Apart from the monoclonal antibodies directed against the extracellular receptor domain of her-2, there is another way to contest erbb activity . As previously explained, the use of small molecules inhibit intracellular tyrosine kinase activity, named tkis . Tkis have several advantages over monoclonal antibodies such as oral bioavailability, potentially less toxicity, and ability to inhibit truncated forms of egf receptors . Lapatinib (tykerb) is a reversible small - molecule tki that targets both her-2 and egfr tyrosine kinase . It is able to interrupt signal transduction from both egfr and her-2 receptors, and because of its dual - receptor activity it has been evaluated in several phase ii and iii trials in various forms of breast cancer [5860]. Moreover, in the prevention setting, it showed a significant delay in the er - negative mammary tumors development . This preventive action was seen in premalignant mammary lesions, and this suggests a drug efficacy also in initiation and progression of breast carcinogenesis . Gefitinib (iressa), another egfr tyrosine kinase inhibitor that suppressed er - negative mammary tumor formation in mmtv - erbb2 transgenic mice . Its mechanism of action is complex and involves cell cycle, angiogenesis, and growth factors [62, 63]. Moreover, results of preclinical and clinical studies about breast cancer treatment remain controversial [64, 65], but in preventive setting, the ability of gefitinib to inhibit the proliferation at the early stages of breast cancer and also in the normal adjacent epithelium could be the rationale for using this compound in prevention trial . The inducible isoenzyme cox-2 is expressed in invasive and in situ breast cancers cells, and several epidemiological studies have shown the inverse relationship between nonsteroidal, anti - inflammatory drugs (nsaids) and cancer incidence [68, 69]. Cox-2 is the main target of nsaids, and despite the mechanism by which it contributes to tumor formation is not fully understood, it is possible to hypothesize an involvement of a multidisciplinary process which involves proliferative stimulation, mutagen production, and apoptosis inhibition . The cox-1 and cox-2 pathway, which converts arachidonic acid to prostaglandin, is involved in the development and growth of several different neoplastic lesions, and it is frequently overexpressed not only in invasive breast cancer but also in adjacent intraductal neoplasia; therefore, it might be an early event in mammary tumorigenesis . A meta - analysis, published in 2001, demonstrated that nsaids were associated with a 20% reduction of breast cancer risk, and the same results were confirmed in a more recent publication [72, 73]. These data suggested the chemopreventive potential (including breast cancer) of anti - inflammatory drugs . Celecoxib, a selective cox-2 inhibitor, reduced the incidence and multiplicity of dmba - induced mammary tumors in rat models by 68 and 86%, respectively . Nimesulide, another selective cox-2 inhibitor, significantly reduced the incidence and multiplicity of phip and nmu - induced rat mammary tumors . Similar effects were observed with aspirin, but the level of evidence for both of agents on breast cancer incidence is, at present, too small to justify their use solely as a preventive therapy and insufficient to make any recommendations . Bisphosphonates, the drugs of choice for the treatment of osteoporosis, act on the mevalonate pathway and for this reason are currently of considerable interest in the treatment and prevention of breast cancer . Their mechanism of action involved osteoclasts, and in particular, they are able to inhibit their activity . Thus they have proven efficacy in control of breast cancer bone metastases and also in bone loss induced by other treatment as ais . Moreover, interestingly recent two cohort studies showed a reduction of 30% in breast cancer incidence in bisphosphonates users [80, 81], irrespective of hormonal status . Bisphosphonates are generally well tolerated, but randomised prevention trials with composite endpoints in women with osteopenia and increased risk of a new breast cancer are required to fully investigate the risk - benefit profile of these drugs . Poly(adp - ribose) polymerases (parps) are a family of enzymes that play a key role in the repair of dna damage . In particular, the most important seems to be parp enzymes (parp-1 and parp-2) [83, 84]. A key role for parp-1 and parp-2 is maintaining genomic integrity, in particular, repair of single strand dna lesions and breaks using the base excision repair (ber) pathway . The inhibition of these enzymes leads to accumulation of dna single - strand breaks, which can lead to dna double - strand breaks at replication forks [85, 86]. Normally, these breaks are repaired and a key component of this mechanism comprises the tumour - suppressor proteins brca1 and brca2 . In brca mutated cells, this dna repair ability is lost and the aberrations drive to carcinogenesis . Consequently, the requirement for a brca mutation to be present for a parp inhibitor to be effective constitutes a synthetic lethal strategy selectively affecting mutant tumour cells comprising brca1-brca2, which are 1000-fold more sensitive than others [8789]. Recent preclinical studies have shown encouraging results, and at present parp inhibitors are usually studied in combination with other cytotoxic agents [90, 91]. The only published study with a parp inhibitor as a single - agent treatment is a phase i trial with olaparib in patient with brca - associated cancer, which showed a good efficacy to inhibit parp activity and that it has few side effects compared conventional chemotherapy . The efficacy of a particular risk group as the mutation carriers and the relative good tolerability make these agents well suited for cancer prevention . Further investigations should be proposed in brca mutation carriers to assess the ability of this class of agents to prevent cancer, evaluate the safety profile, and reduce the incidence of breast cancer . There is increasing evidence that presence of hyperinsulinemia and insulin resistance increased breast cancer risk, worsen, the prognosised and partly explained the obesity - breast cancer risk association in postmenopausal women [9398]. Several epidemiological and observational studies have confirmed the relationship between insulin levels and cancer induction [99, 100]. Insulin may promote tumorigenesis via a direct effect on epithelial tissues, or indirectly by affecting other modulators, such as insulin - like growth factors, sex hormones, and adipokines [101, 102]. Thus, there is a great interest in exploring the possibility that antidiabetic therapies, which lower insulin levels, could decrease breast cancer incidence or its related mortality . Metformin, a biguanide derivative, is the most commonly used drug worldwide to treat type ii diabetes . Epidemiological studies have shown a significant risk reduction in cancer incidence and mortality in diabetic patients on metformin, relative to other antidiabetic drugs, including positive results specifically in breast cancer [103105]. It may impact cancer through a direct (insulin - independent) activation of ampk - mtor pathway mechanism or indirect effect (insulin - dependent) reducing hepatic gluconeogenesis obtaining lower circulating insulin levels with inhibition of proliferation cells and protein synthesis over increase apoptosis (figure 5). Several preclinical studies have confirmed these effects of metformin in vitro and in vivo and showed a significant reduction of both breast epithelial cell proliferation and protein synthesis [106, 107]. In particular, it is confirmed that metformin produces a significant repression of cell proliferation, and moreover, they also found that this effect was different in human breast cancer cell lines if related to either positive or negative ers . They in fact detected a complete cell growth repression in er - positive cell lines, although only a partial inhibition was detected in er - negative phenotypes . These data suggest that, although er - negative cells are not as sensitive as er - positive ones, both of them show a reduction in cell growth under metformin treatment . Several important phase ii and iii studies are actually ongoing in the world in order to confirm and clarify these promising settings . Many molecularly pathways and the correlated targeted drugs are actually in development for advanced cancer therapy, and they have potential activity and tolerability also in cancer chemoprevention setting . The identification of new potential molecular targets and the development of agents aimed at these targets within cancer have already had a significant impact on advanced cancer therapy and provide a wealth of opportunities for chemoprevention . There is substantial evidence that together with the epithelial cells alterations the microenvironment dysfunction is crucial for carcinogenesis, and this makes the microenvironment an interesting target for breast cancer chemoprevention . In particular, there are many excellent publications which consider microenvironment as a good target for cancer therapy, but the application of chemoprevention to control the tumour microenvironment during the early stages of carcinogenesis is not yet adequately analyzed . We will briefly explain a recent progress that indicates that the effects of chemopreventive agents on the microenvironment are an important aspect of their preventive action and that many classes of agents, which showed to have significant chemopreventive actions on epithelia, also have similar useful actions on the microenvironment . Many molecular targets inside the microenvironment with the correlated drugs are summarized in the table 2 . These transcription factors and their associated regulatory proteins are an ideal target of chemoprevention, and in particular three attractive pathways as the nuclear factor b (nfb), hypoxia - inducible factor 1 (hif-1), and pi3-mtor are analyzed in this section . Nuclear factor-b pathway plays important roles in the control of cell proliferation, differentiation, apoptosis, inflammation, stress response, cell signaling transduction, and other physiological processes, but it is also critically involved in the processes of development and progression of cancers [110113]. Oxidative stress is defined as an increase in intracellular reactive oxygen species (ros) such as h2o2, superoxide, and hydroxyl radical and . These findings suggest that oxidative stress activates nf - kappab activity in the cells [114, 115]. Moreover, nfb is activated not only by the ros but also by various carcinogen and tumor promoters, and these are the reasons why nfb is overexpressed and activated in various cancers, especially in the poorly differentiated . Experimental studies have shown that natural antioxidant compounds including isoflavones, indole-3-carbinol (i3c), 3,3-diindolylmethane (dim), curcumin, epigallocatechin-3-gallate (egcg), rosveratrol, curcumin and others seems to be able to inhibit the activity of nf - kappab and the growth of cancer cells and also to induce apoptosis, suggesting that nf - kappab could be a target for cancer prevention [117121]. Similarly, hif-1a master regulator in the control of tissue homeostasis, crucial in adaptive responses to tissue oxygenation including energy status, glucose, and iron metabolism as well as growth factor signaling [122, 123]is a key target for the prevention and treatment of cancer . Interest in the role of hif-1 in cancer has grown exponentially over the last two decades, as this factor activates the transcription of many genes that code for proteins involved in several pathways intimately related to cancer [124126]. Hypoxia - inducible factor-1 (hif-1) plays a central role in the adaptation of tumor cells to hypoxia by activating the transcription of genes, which regulate several biological processes . For these reasons, hif-1 is considered a potential target for cancer therapy, and, recently, many efforts to develop new hif-1-targeting agents have been made [127130]. Interestingly, they are recently identified by increased hif-1 expression (relative to adjacent normal tissue) in 13 tumor types, including lung, prostate, breast, and colon carcinoma . Moreover, hif-1 was also overexpressed in preneoplastic and premalignant lesions, such as colonic adenoma, breast ductal carcinoma in situ, and prostate intraepithelial neoplasia . These data show that overexpression of hif-1 may occur very early in carcinogenesis, before histologic evidence of angiogenesis or invasion, and suggest that hif-1 might be a biomarker of carcinogenesis and a suitable target for cancer chemoprevention . Because hif-1 seems to have an important function in carcinogenesis several, approved anticancer drugs (e.g., topotecan, imatinib mesylate, trastuzumab, ns398, celecoxib, and ibuprofen) inhibit hif-1 activity . Moreover, also several natural products (e.g., resveratrol, genistein, apigenin, and berberin) have also been found to inhibit the activity of this transcription . In this setting it is important to say that: however, the use of hif-1 inhibitors in cancer chemoprevention might be associated with toxicity . An excessive inhibition of hif-1 may produce adverse effects, as hif-1 regulates many cellular processes under physiologic conditions [125, 132]. Therefore, although hif-1 inhibitors may represent a useful source of chemopreventive agents, the potential toxicity associated with these agents should be considered carefully, especially when chemopreventive interventions are aimed at preventing cancer in healthy populations . The mammalian target of rapamycin (mtor) is a signaling kinase of the phosphatidylinositol 3-kinase / protein kinase b or pi3k pathway that mediates cell growth and metabolism and coordinates cell cycle progression in response to genetic, epigenetic, and environmental conditions . Pathways involved in mtor signaling are dysregulated in precancerous human tissues, including breast cancer, and is associated with the development of resistance to endocrine therapy [133135] and to the anti - human epidermal growth factor receptor-2 (her2) monoclonal antibody trastuzumab [136, 137]. Phase i trials have demonstrated that mtor inhibitors are fairly well tolerated with the most frequent drug - related toxic effects being acne - like maculopapular rash, mucositis, and stomatitis, all of which were reversible on discontinuation of treatment . Rapamycin and its analogues, the rapalogues, decrease tumor growth in many xenograft models, including those with breast cancer cell lines [139, 140]. Thus, preclinical data have confirmed the antitumor activity of rapamycin and the rapalogues and have suggested that patients with breast cancer may especially respond to mtor inhibitors . Phase i - ii clinical trials have demonstrated that everolimus (rad-001), an mtor inhibitor with demonstrated preclinical activity against breast cancer cell lines, has been shown to reverse akt - induced resistance to hormonal therapy and trastuzumab . It has promising clinical activity in women with her2-positive, her2-negative, and estrogen receptor - positive breast cancer when combined with her2-targeted therapy, cytotoxic chemotherapy, and hormonal therapy, respectively . The involvement of mtor pathways in precancerous lesions makes the mtor signaling an intriguing target for chemopreventive intervention . Thus, several recent preclinical studies explored also the possibility of a chemopreventive action through the mtor inhibition . In one of this, rapamycin showed chemopreventive activity against mammary gland tumors in transgenic mice, bearing activated erbb2 (her-2/neu) receptor either alone (neuyd) or with vegf expression, where it dramatically inhibited tumor formation in neuyd mice . These results seem to suggest the mtor inhibition as a possible chemopreventive strategy against metachronous tumors or recurrence in high - risk patients, whose primary tumors overexpressed erbb-2, or in patients showing dysregulation of the pi3k / akt / mtor signaling pathway . Another recent preclinical study evaluated chemopreventive effects of rapamycin in a transgenic mouse model of human breast carcinogenesis, where it significantly inhibited growth of mammary intraepithelial neoplasia outgrowths, invasive tumor incidence, and tumor burden . Finally, some natural products, such as epigallocatechin gallate (egcg), caffeine, curcumin, and resveratrol, have been found to inhibit mtor as well and are actually under investigations in this setting . In conclusion, the success of chemopreventive approach depends on a tumor - specific risk model for identifying high - risk subjects, increasing preclinical drug test over the development novel and more safety chemopreventative agents, and identifying new surrogate endpoint using molecular pathways and new targets of drugs activity . Safety is a very important point to take into account, because several large randomized prevention trials in several cancers have shown that major adverse events can prevent widespread public acceptance of active chemoprevention agents . Despite the success of action showed for example in endocrine intervention is a promising starting point in order to continue to evolve with the rapid integration of molecular approaches into research and clinical practice . It is urgent to find active agents in other fields as nonhormone - responsive lesions . The personalized approaches in advanced cancer therapy and the evolution of molecularly targeted will streamline chemoprevention research and facilitate the development of rational, effective, and safe preventive drugs, involving different pathways and with the ability to modify carcinogenesis in early phases.
We included 3,615 french men and women, aged 3065 years, with baseline fasting glycemia (fg) <6.1 mmol / l, who participated in the 9-year follow - up d.e.s.i.r . Participants provided written informed consent, and the protocol was approved by the ethics committee of bictre hospital, kremlin - bictre, france . Incident hyperglycemia was identified by an fg 6.1 mmol / l or treatment for diabetes, and incident diabetes was identified by an fg 7.0 mmol / l or treatment of diabetes during at least one of the three follow - up examinations (years 3, 6, and 9). Smoking, dietary habits, degree of physical activity, and alcohol consumption were assessed using a self - administered questionnaire . Mean daily intake of water, wine, beer or cider, and sweet beverages was categorized in the questionnaire into six mutually exclusive levels: none, <0.5, 0.5 to 1, 1 to 1.5, 1.5 to 2.0, and> 2 l. in the present analyses, the levels were grouped into three classes: <0.5, 0.5 to 1, and> 1 l. other clinical and biological measurements are presented in the supplementary methods . Results are presented as means (sd) or median (25th75th percentiles) for quantitative variables and as percentages for qualitative variables . Baseline means and percentages were compared between the three w - intake classes using anova or tests . Logistic regression models were used to determine odds ratios (ors) and 95% cis corresponding to the comparison of incident hyperglycemia in middle and high classes of w - intake in comparison with the lowest class . Adjustment variables were either known risk factors for type 2 diabetes or factors associated (p <0.10) with hyperglycemia and w - intake in our population . We included 3,615 french men and women, aged 3065 years, with baseline fasting glycemia (fg) <6.1 mmol / l, who participated in the 9-year follow - up d.e.s.i.r . Participants provided written informed consent, and the protocol was approved by the ethics committee of bictre hospital, kremlin - bictre, france . Incident hyperglycemia was identified by an fg 6.1 mmol / l or treatment for diabetes, and incident diabetes was identified by an fg 7.0 mmol / l or treatment of diabetes during at least one of the three follow - up examinations (years 3, 6, and 9). Smoking, dietary habits, degree of physical activity, and alcohol consumption were assessed using a self - administered questionnaire . Mean daily intake of water, wine, beer or cider, and sweet beverages was categorized in the questionnaire into six mutually exclusive levels: none, <0.5, 0.5 to 1, 1 to 1.5, 1.5 to 2.0, and> 2 l. in the present analyses, the levels were grouped into three classes: <0.5, 0.5 to 1, and> 1 l. other clinical and biological measurements are presented in the supplementary methods . Results are presented as means (sd) or median (25th75th percentiles) for quantitative variables and as percentages for qualitative variables . Baseline means and percentages were compared between the three w - intake classes using anova or tests . Logistic regression models were used to determine odds ratios (ors) and 95% cis corresponding to the comparison of incident hyperglycemia in middle and high classes of w - intake in comparison with the lowest class . Adjustment variables were either known risk factors for type 2 diabetes or factors associated (p <0.10) with hyperglycemia and w - intake in our population . Baseline characteristics of the 3,615 normoglycemic participants are presented according to their class of w - intake (table 1). Among them, during follow - up, 565 subjects became hyperglycemic and 202 developed diabetes . The daily w - intake was negatively associated with the risk of new - onset hyperglycemia, even after adjustment for multiple metabolic risk factors . Compared with daily w - intake of <0.5 l, ors were 0.64 (95% ci 0.490.83) and 0.73 (0.550.97) for classes of 0.51.0 l and> 1.0 l, respectively (p = 0.003). After further adjustments for intake of other beverages, the ors were slightly attenuated: 0.68 (0.520.89) and 0.79 (0.591.05) for classes of 0.51.0 l and> 1.0 l, respectively (p = 0.016) (table 1). With the two upper classes combined, the or was 0.72 (0.560.92) (supplementary fig . 1). There was no interaction with several important characteristics, including those related to self - reported alcohol or tobacco consumption (supplementary table 1). Baseline characteristics of the study population and risk for new - onset hyperglycemia during follow - up, by classes of mean daily w - intake data are means (sd) or medians (25th75th percentiles) for continuous variables and percentages of patients for categorical variables . Thzd, thiazidic diuretics; furo, furosemide; homa - ir, homeostatic model assessment index of insulin resistance; homa - b, homeostatic model assessment index of insulin secretion . Hypertension was defined as systolic or diastolic blood pressure> 140 or 90, respectively, or treated with antihypertensive drugs . Ors (95% cis) for the association between daily w - intake at baseline and the risk of incident hyperglycemia (fasting plasma glucose 6.1 mmol / l or treatment for diabetes) are presented according to two statistical models; variables for adjustment were either known risk factors for type 2 diabetes or factors associated (p <0.10) with hyperglycemia and w - intake in our population . Model 1: adjusted for age, sex, bmi, baseline fg, physical activity, smoking status, triglycerides, homa - ir, and total cholesterol . Model 2: further adjusted on self - reported intake of other fluids (i.e., volumes of beer or cider, sweet drinks, and wine consumed per day). The c - reactive protein was available for only 181, 466, and 333 subjects in the three classes of w - intake, respectively . * * hdl cholesterol and ldl cholesterol were not available for 28 and 26 subjects, respectively . The same trend, although nonsignificant, was observed for the association with new - onset diabetes: compared with participants with a daily w - intake <0.5 l, ors for those drinking 0.51.0 l and> 1.0 l water per day were 0.68 (95% ci 0.411.15) and 0.75 (0.431.32), respectively, p = 0.36 . Risk for hyperglycemia was negatively and independently related with self - reported w - intake in normoglycemic middle - aged individuals from the french general population however, the association was moderately attenuated when important metabolic risk factors and potential confounders were introduced as covariables in the analysis, including intake of other classes of beverages with known adverse long - term effects (sweet and alcohol - containing drinks). Our data support the novel idea that vasopressin, besides its role in urine concentration, is also an important actor in glucose homeostasis (1). The negative association of w - intake and risk for hyperglycemia was relevant among many subsets of participants, and those reporting a low w - intake (<0.5 l) had a higher risk for hyperglycemia (for example, participants in the high physical activity group) (supplementary table 1). This indicates that identification of individuals with a w - intake of <0.5 l may be widely relevant to target preventive interventions regarding the metabolic risk . Diabetes incidence was low and statistical power was thus limited; 24-h urine volume was not measured, but the urinary density was inversely associated with self - reported w - intake, arguing for the validity of the questionnaire (table 1). In addition, we cannot exclude residual confounding: healthier behaviors correlating with higher water drinking could account for the observed association . Finally, only volunteers were included and the results may not be extrapolated to the general population . Knowing the rise of vasopressin in diabetes, its effect on glycemia, gluconeogenesis, and glucagon release, it is surprising that no attention had been given to vasopressin as a possible risk factor for hyperglycemia and diabetes until a recent report of an association between copeptin and the incidence of diabetes (1,4,5,14). Our study extends this observation, drawing attention to a low w - intake as a possible new risk factor for impaired glycemia . It suggests that an increase in w - intake, an easy and costless intervention, could prevent or delay the onset of hyperglycemia and subsequent diabetes . Hopefully, our study will serve as a benchmark to design appropriate clinical trials testing the efficacy of this intervention in people who report drinking <0.5 l of water per day, as did almost 20% of the participants in this cohort.
Although patients who undergo dialysis suffer from a complex illness, there are compelling reasons to believe that the inadequate removal of organic waste is an important contributing factor to the illness itself . Nevertheless, randomized trials examining the impact of increased clearance of traditional uraemic solutes have yielded disappointing results . The haemodialysis study (hemo) failed to show any significant reduction in mortality with an increased dialysis dose . In contrast, in a post hoc analysis, the level of 2-microglobulin (representative of middle molecules) was found to be predictive of the relative mortality risk . Furthermore, the results from a recent prospective, randomized and controlled study comparing online haemofiltration (hf) and haemodialysis (hd) have shown a significant difference in mortality in favour of hf, in spite of a very low kt / v in the convective procedure (1.07 0.06 with hf vs 1.42 0.06 with hd). This further confirms a series of observational studies that had already demonstrated that, in terms of patient survival, techniques capable of increasing middle - molecule clearance, such as haemodiafiltration (hdf), hold an advantage over the conventional hd . In recent years, scientists have been increasingly convinced that a large number of high - molecular - weight toxins increase their plasma concentration during uraemia and are responsible for a number of dialysis co - morbidities, such as an immune system imbalance, itching and so on . Hence, the interest of clinicians, followed by that of industry, in a new class of dialysis membranes aimed at enhancing the transport capabilities (clearance) of middle, large and even protein - bound molecules by using all the available membrane separation phenomena: diffusion, convection and adsorption, by designing and developing both high - performance protein - leaking dialyser, we mean the dialyser capable of removing large molecules on the basis of convection enhancement (super - flux) or adsorption capabilities . The main aim of a dialysis filter is to better reproduce the physiological process of glomerular ultrafiltration . Dialysis membrane clearance, however, is based on concentration differences rather than the convective separation of solutes and low - molecular - weight proteins from large serum proteins and blood elements . In an attempt to replicate glomerular ultrafiltration and the removal of middle molecules in high - flux dialysers, a significant increase in porosity has been obtained in order to remove large - molecular - weight solutes . Hand in hand with the increase in porosity and the efficiency of mass transfer, there is a concomitant increase in the membrane ultrafiltration coefficient . The optimization of these properties has produced dialysers that allow for rapid solute fluxes and clearance profiles akin to those achieved across human glomeruli . The other significant feature of high - flux membranes, particularly the synthetic membranes, is that they tend to be more biocompatible . The properties of a dialyser, on the physical or biocompatible level, are related to its microstructural and macrostructural characteristics . Microstructural aspects refer to the characteristics acting on the molecular scale (i.e. The chemical modification of the side chains, thickness of the hollow fibre wall, membrane porosity). Macrostructural properties refer to the properties acting on a length scale greater than molecular dimensions (i.e. Surface area, packing density, boundary layers adjacent to the membrane solution interfaces, shape and configuration of the hollow fibres, spacing and sterilization techniques). The so - called high - flux membranes are prepared with hydrophobic base materials, including polyacrylonitrile, polysulphone, polyaryethersulphone, polyamide and polymethylmethacrylate with various hydrophilic components . Nevertheless, there are some examples of cellulose - based high - flux membranes, such as cellulose triacetate . In view of the large hydraulic permeability of synthetic membranes, the bidirectional water flux across the dialysis membranes is maximized (figure 1). Under conditions of diffusive hd, at the proximal end of the dialyser, the sum of hydrostatic osmotic and oncotic pressure results in a large water movement from the blood to the dialysate . At the distal end of the hollow fibres, hence, the large volume of water leaving the blood and crossing into the dialysate at the proximal side is offset by the water backfiltration from the dialysate to the blood on the distal side . However, a larger and more important amount of small- and middle - molecule removal can be obtained in hdf . In hdf, with the further use of dialysate, a relatively free ultrafiltration is allowed, and there is a large volume of ultrafiltrate with no significant backfiltration from the dialysate . The amount of ultrafiltrate that offsets the fluid loss that the patient has to shed must be replaced by the direct intravenous substitution fluid infusion . In hf, all the water movements are from the blood to the dialysate compartment, and solute clearance is by convection alone . Moreover, the removal with large - pore (i.e. High - flux) membranes is related to diffusion, convection and, in some cases, as discussed in the following, adsorption . This mechanism adds capacity to remove components with a pathophysiological potential, such as 2-microglobulin, cytokines and protein - bound uraemic toxins (pbut). Diagram of the internal backfiltration (a) and backdiffusion (b) phenomenon in a high - flux dialyser . A schematic description of the pressure plays that leads to the onset of the backfiltration phenomenon . At the filter blood inlet, there is a water movement from the blood to the dialysate, due to the interplay of the hydrostatic, osmotic and oncotic pressures, as well as the dialysate pressure . At the outlet, the equilibria are inverted: the dialysate pressure and oncotic pressure grow, while the blood hydrostatic pressure is reduced . The latter is reflected in the lower activated serum complement levels, a lower intradialytic reduction in white cell counts, a lower oxygen radical production, and a reduction in the release of interleukin-1 and tumour necrosis factor in the course of dialysis . On the other hand, this reduced cytokine production along with decreased bioincompatibility has been used to account for the fewer dialysis - related symptoms, in particular less intradialytic hypotension observed with high - flux techniques . Preliminary studies with high - flux dialysers have shown varying results upon the haemoglobin response, the increased 2-microglobulin clearance, and a reduction in advanced glycation end products, peroxidation products and homocysteine levels . However, only a few of these studies are randomized, none of them is blind and the comparison is often made with older - generation low - flux membranes . Moreover, there are no clear and unequivocal data showing that improved biocompatibility and excellent larger - molecule clearance translate into improved patient symptoms and better survival . The same can be said of techniques such as hf or hdf based on the use of high fluxes attainable with high - flux dialysers . On the latter issues, however, a whole strand of literature is coming out in favour of the convective techniques, which is not only based on observational studies, as in the past, but on randomized controlled trials . The recent membrane permeability outcome (mpo), a study in which 647 incident dialysis patients were randomly allocated to high - flux or low - flux dialysis membranes, demonstrated that the improved 2-microglobulin clearance led to an improved survival in those with albumin <4 g / dl, with a 37% reduction in the mortality risk with the high - flux membrane . The european acetate - free biofiltration (afb) study has shown better survival in patients with mild hypertension treated for 4 years by means of an acetate - free biofiltration as compared with conventional dialysis . Even the online hf performed by a high - flux dialyser does not only appear to have a superior cardiovascular stability but also a better survival as compared with hd . Recently, the idea that the removal of a distinct class of uraemic toxins, such as 2-microglobulin, factor d, leptin and adrenomedullin, while minimizing albumin loss, could improve treatment outcome in end - stage renal disease (esrd) patients has led to the development of a series of dialysers known by the name of super - flux. Super - flux dialysers have been designed to maximize convective transport by increasing the pressure drop along the membrane fibres . The same toxic substances directly bind with protein (pbut), originating from high - weight complexes (50200 kda) potentially involved in important uraemia co - morbidities such as itching and altered immune response [1821]. Removing pbut from the blood by means of diffusion and convection (containing the albumin loss) is virtually impracticable; however, pbut can be removed by using the adsorptive properties of particular biomaterials . A number of adsorption techniques are well known in the world of blood purification: with selectivity or without selectivity, working with plasma or whole blood, consisting of fibres or solid spheres . In this context, only dialysers made with a synthetic membrane having adsorption capabilities should be taken into account . Synthetic membranes, such as polysulphone, are usually asymmetric (figure 2left); this means that, on a membrane thickness of 30 microns, just a 1-micron layer is responsible for the separation process, while 29 microns have structural functions alone . Synthetic membranes such as polysulphone are usually asymmetrics, which means that, on a membrane thickness of 30 microns, a layer of 1 micron only is responsible for the separation process, while 29 microns have structural functions only . Pmma, conversely, is a symmetric membrane, in which the whole thickness is involved in the separation process allowing middle - molecule adsorption . Another class of synthetic membranes, i.e. Polymethylmethacrylate (pmma), is characterized by a symmetric structure (figure 2right). In this case, the pores are larger, longer and winding, designed to trap different substances . Moreover, in some cases, an ionic treatment of the inner surface may enhance this adsorption mechanism . Pmma adsorption capabilities have been demonstrated both in vivo and in vitro . Among others, campistol and co - workers have shown that pmma bk removes 2-microglobulin by adsorption, while high - flux polysulphone does so by filtration, using radiolabelled 2-microglobulin and scintigraphic analysis (figure 3). Kawanishi measured interleukin (il)-6 removal from different membrane mini - modules isolating convection and adsorption contributions . Scintigraphic image (from campistol et al .) Of the dialyser (pmma vs polysulphone) after the end of the dialysis session, using 131i - labelled 2-microglobulin . Super - flux dialysers based on enhanced convection or adsorption, at least on the theoretical plane, could be widely used in clinical situations in which, apart from toxins of small molecular size, large quantities of mediators and toxic products are also produced, with a negative biological effect at a middle high molecular weight, or which are rapidly bound to the proteins . These filters make it possible to treat septic patients with acute renal failure and simultaneously provide the control of uraemia and fluid status as along with cytokine removal . In the field of haematological diseases, particularly in myeloma, early yet encouraging results have already been obtained in the light chain removal . Hd with super - flux dialysers has been shown to be more effective than high - flux dialysis in reducing plasma homocysteine . However, an important side effect of super - flux dialysers, or at least some of them, might be plasma protein loss, and not only that of albumin but also coagulation factors, growth factors and hormones . Hence, before opening the door to these new filters, it will be necessary to develop strategies in use to achieve a good clearance of waste and harmful products, while minimizing the risk of a huge loss of substances, such as proteins, useful for our organism's biochemical homeostasis.
The genes doublesex in drosophila and mab-3 in caenorhabditie elegans were first identified as transcription factors containing a conserved zinc finger - like dna binding domain (dm domain), which plays a key role in sexual development 1 - 3 . Many organisms have multiple dmrt (doublesex and mab-3 related transcriptional factor) genes, the number of which varies between species . For example drosophila, caenorhabditis elegans, fish, mice and human have four, eleven, six, seven and eight copies respectively 4 - 9 . From arthropods to nematodes to vertebrates, most dmrt genes are expressed in gonads and play roles in sex determination, which serves as a rare example of conserved mechanisms underlying sex regulation during evolution . Previous research with dmrt1-deficient mice strongly demonstrated that this gene was required for testis differentiation after determination, but dispensable for ovary development 11 . In birds, dmrt1 is sex - linked 12, 13 on chromosome z and there is higher dosage of the gene in males (zz) as compared with females (zw) 10, 13 - 15 . The expression of dmrt1 in turtles and alligators was found to be related to sexual differentiation and was higher in developing male gonads than in female ones as well 16 . Furthermore, the dmrt1y / dmy gene, which is the homolog of dmrt1 in medaka, transposed to chromosome y and became a master gene in male differentiation 17, 18 . However, evidence is being accumulated that some proteins in the dmrt family are involved in non - gonadal development . A null mutation for the gene dmrt1, an ancient conserved gene common to sex - determining pathways, resulted in profound abnormalities in the development of anterior neural plate derivatives in ciona 19 . Both dmrt2a and dmrt2b are expressed in presomitic mesoderm and developing somites and contribute to somitogenesis and the creation of left - right asymmetry in the lateral - plate mesoderm 20 - 23 . In chicken and mice, dmrt3 is expressed similarly in the forebrain, spinal cord, and nasal placode 24, while dmrt3 in zebrafish is expressed in the olfactory placode and the neural tube 25 . Xenopus dmrt4 is expressed in the developing olfactory system and is required for neurogenesis 26 . In addition to dmrt1, dmrt7 expression is restricted to embryonic gonads and adult testis 9 . Dmrt7 deficient mice show male infertility with spermatogenic arrest at the pachytene stage and defects in regulation of sex chromatin 28, 29 . Kawamata m, et al . Reported a possible post transcriptional role of poly - adenylation in dmrt7 expression 30 . However, the transcriptional mechanisms regulating dmrt7 need to be studied further, which will contribute substantially to our understanding of the pathway of sex differentiation and spermatogenesis . Here deletion and site - directed mutagenesis were used to identify regions of the promoter that are required for transcriptional activity . Emsa and chip analysis was employed to determine the binding relationship between transcription factor nf - y and the dmrt7 promoter . Finally, our study showed that nf - y up - regulated the expression of dmrt7 by binding to two tandem ccaat - boxes in the proximal promoter region of the gene . In silico sequence analysis . Transcription factor binding sites were predicted using matinspector (www.genomatrix.de) and tfsearch (www.cbrc.jp/research/db/tfsearch.html). Six deletion mutants of the mouse dmrt7 promoter were constructed using pcr cloning from mouse genomic dna and primers: forward primer, 5'tatacgcgtctagaggtcacacacaaaatcagaag3' for construct -948/+116, 5'tgcacgcgtaaaggcaggctaaaaagcctgcc3' for construct -407/+116, 5'gggacgcgtcagcctcgctctggctgaggt3' for construct -245/+116, 5'ttgacgcgtcggagaagcgggtaggcaagaaa3' for construct -104/+116, 5'cggacgcgtattgcaaaccctattggctgcgc3' for construct -60/+116, 5'ctcacgcgtccttgtgtgaaggagcgagcgg3' for construct + 1/+116, and a common reverse primer, 5'cacaagcttcacagcctcgagccgaatcacag3' . Pcr products were double - digested with mlui and hindiii and cloned into the mlui - hindiii site of the pgl3-basic vector (promega, madison, wi). Site - directed mutagenesis for two ccaat boxes was performed using the following primers as follows: mut1 for ccaat box1 mutant: 5'tgcaaaccctctgatctgcgcggcgccg3' and 5'cggcgccgcgcagatcagagggtttgca3'; mut2 for ccaat box2 mutant, 5'gtgcttggagctcctgattccttgtgtg3' and 5'cacacaaggaatcaggagctccaagcac3'; mut1/2 for both ccaat box 1 and 2 mutants using mut1 as a template: 5'gtgcttggagctcctgattccttgtgtg3' and 5'cacacaaggaatcaggagctccaagcac3' . All constructs were sequenced . For the construction of expression plasmids, the full - length cdnas of mouse wild - type nf - ya, nf - yb and nf - yc were pcr - amplified from mouse testis cdnas and cloned into ecori site of the pcx - egfp vector by replacing the egfp fragment to generate expression plasmids (pcx - nfya, pcx - nfyb and pcx - nfyc) using primers:, 5cgtgaattcgccatggagcagtata3 and 5ctcgaattcttaggaaactcggatga3 for nf - ya; 5atagaattcatcatgacaatggacgg3 and 5 tccgaattctcatgaaaactgaatttg3 for nf - yb; 5gccgaattcaaaatgtccacagaag3 and 5ctcgaattctcagtctccagtcacct3 for nf - yc . The mouse dominant negative plasmid for nf - ya (nf - yam29) was a generous gift from dr . Gc-1 (a cell line from type b spermatogonia of mouse and show characteristics of a stage between type b spermatogonia and primary spermatocytes) and cos 7 cells (a cell line was obtained by immortalizing a cv-1 cell line derived from kidney cells of the african green monkey) were maintained in high glucose dulbeccos modified eagles medium supplemented with 10% fetal bovine serum, plated in 48-well plates and transfected using lipofectamine2000 (invitrogen, carlsbad, ca, usa). The cells were transfected with 0.4 g of each deletion construct (-948/+116, -407/+116, -245/+116, -104/+116, -60/+116, or + 1/+116) along with 10 ng / well prt - tk (an internal control). For luciferase assays, 0.2 g of construct -60/+116 or mutated constructs, and 0.2 g nf - y expression vectors (nf - ya, nf - yb and nf - yc) or the dominant negative nf - y plasmid (nf - yam29) were co - transfected into the cells . Empty vector pgl3-basic or pcx (pcx - egfp without the egfp coding sequence between two ecori sites) was added to equalize the final dna content in each well . Luciferase activity was measured 24 hours after transfection using the dual - luciferase reporter assay system (promega, madison, wi, usa) and a modulus single tube multimode reader (turner biosystems, sunnyvale, ca, usa) following the manufacturer's protocol . Oligonucleotides corresponding to the ccaat box1 and box2 of the dmrt7 promoter were synthesized and annealed into double strands . Their sequences are as follows: 5tgcaaaccctattggctgcgcggcgccg3 and 5cggcgccgcgcagccaatagggtttgca3 for oligo1; 5tgcaaaccctctgatctgcgcggcgccg3 and 5cggcgccgcgcagatcagagggtttgca3 for oligo1-ccaat mut; 5gtgcttggagctcattggtccttgtgtg3 and, 5cacacaaggaccaatgagctccaagcac3 for oligo2; 5gtgcttggagctcctgattccttgtgtg3 and 5cacacaaggaatcaggagctccaagcac3 for oligo2-ccaat mut . Radiolabeled probes were generated by incubation of 250 ng annealed oligonucleotides with 20 ci [p] datp in the presence of t4 polynucleotide kinase (promega, madison, wi, usa) for 1 h at 37c, and were subsequently separated from free nucleotides for purification using a g-50 column (amersham biosciences, uppsala, sweden). Mouse testis nuclear extract used for electrophoretic mobility shift assays was prepared as described previously 31 . Then incubated at room temperature for 30 min with a 100,000 dpm radiolabeled probe and 1 g poly (di - dc) in a buffer of 10 mmol / l tris - hcl, ph 7.5, 50 mmol / l nacl, 1 mmol / l dithiothreitol, 1 mmol / l edta, and 5% glycerol . For supershift experiments, binding reactions were subsequently incubated with anti - nf - ya (abcam inc ., cambridge, ca, usa) for 30 min at room temperature . For competition experiments, the unlabeled competitor oligos (in 50-fold molar excess) samples were resolved in 5% polyacrylamide gels in 0.5% tbe running buffer at 10 v / cm for 2 h. the dried gel was exposed to a phosphorimager cassette and scanned with typhoon 9200 instrument (ge - healthcare, amersham bioscience, uppsala, sweden). (chip) and quantitative real - time pcr . Samples of mouse testis and liver were chopped into small pieces with a scalpel in cold phosphate - buffered saline (pbs) and cross - linked in 1% formaldehyde - pbs for 15 min with constant shaking . The tissues were rinsed in cold pbs and homogenized with a dounce homogenizer in 1 ml cold cell lysis buffer (10 mm tris - cl, ph 8.0, 10 mm nacl, 3 mm mgcl2, 0.5% np-40) supplemented with protease inhibitors (roche diagnostics ltd, mannheim, germany). The cells were incubated at 4c for 5 min to allow the release of the nuclei . After lysis in the buffer (1% sodium dodecyl sulfate [sds], 5 mm edta, 50 mm tris - cl, ph 8.1), sonication was performed with a sonic dismembrator model 100 sonicator (fisher scientific, inc ., the supernatant chromatin after centrifugation was immunoprecipitated with no antibody (beads only), preimmuno igg (igg) and anti - nf - ya (abcam inc ., cambridge, ca, usa), together with protein g plus - agarose (santa cruz, biotech, ca, usa) respectively . Dna isolated from the immunoprecipitated complex was amplified by pcr with primers flanking both ccaat boxes . The primer sequences are: 5agaagcgggtaggcaaga3 and 5cagtggcgaagaggaacg3. The amplified pcr fragments were analyzed on a 2% agarose gel . A region of 257 bp around 10 kb downstream of the first exon of the dmrt7 was amplified as a control with primers: 5aataagtttccaaccgtgaagt3 and 5tatccaaggagatgggtaagtg3. The pcr products were cloned into t - easy vector (promega, madison, wi, usa) and sequenced for confirmation . Precipitated dna in the chip assay was amplified by quantitative real - time pcr using the multichannel rotorgene 3000 (corbett research, australia). The cycling conditions were: 5 min at 94c; 45 cycles of 94c, 20 s; 60c, 20 s and 72c, 15 s in a 25 l reaction mix containing sybr green i. the p1 region primers were 5agaagcgggtaggcaaga3; and 5cagtggcgaagaggaacg3. The p2 region primers were 5aataagtttccaaccgtgaagt3; and 5tatccaaggagatgggtaagtg3. Each sample was performed in triplicate at least . Data were analyzed by the software rotor - gene version 4.6 and then plotted in microsoft excel . Aliquots of tissue extracts (50 mg) were separated by electrophoresis in 10% sds - polyacrylamide gel (page) and transferred onto a 0.45 m membrane (hybond - p; amersham pharmacia biotech)., san diego, ca) and -actin was used as an internal control (1:1000, santa cruz biotech, ca, usa). Membranes were incubated with primary antibody for 1 h at room temperature, washed in tbst and probed with hrp conjugated secondary antibody (1:10000, santa cruz biotech, ca, usa). After several washes in tbst, detection of the secondary antibody was performed using the supersignal chemiluminescent substrate system (pierce, rockford, usa). Aliquots of tissue extracts (50 mg) were separated by electrophoresis in 10% sds - polyacrylamide gel (page) and transferred onto a 0.45 m membrane (hybond - p; amersham pharmacia biotech). Dmrt7 was detected by dmrt7 antibody (1:500, genway biotech, inc ., san diego, ca) and -actin was used as an internal control (1:1000, santa cruz biotech, ca, usa). Membranes were incubated with primary antibody for 1 h at room temperature, washed in tbst and probed with hrp conjugated secondary antibody (1:10000, santa cruz biotech, ca, usa). After several washes in tbst, detection of the secondary antibody was performed using the supersignal chemiluminescent substrate system (pierce, rockford, usa). To characterize functional elements in the dmrt7 promoter, the sequence from -407 to + 116 of dmrt7 was run in matinspector and tfsearch to find putative transcriptional elements . Several possible transcription - factor binding sites, which included ap-1, sp1, gata1, e2f and ccaat box, were identified (figure 1a). Blast alignment of the promoter region of mouse, rat, and human dmrt7 genes revealed two highly conserved ccaat boxes: the ccaat box1 (-48/-44) and the ccaat box2 (-7/-3) (figure 1b). To determine the functional elements required for promoter activity, six 5'-deletion mutants (-948/+116, -407/+116, -245/+116, -104/+116, -60/+116 and + 1/+116) were constructed and analyzed for promoter activity using luciferase reporter in gc-1 and cos 7 cells (figure 1c). The deletion of the region between -245 and -104 appears to increase promoter activity in gc-1 cells, whereas the opposite result was obtained in cos 7 cells . To explain this discrepancy, we speculate that there could be other gc-1 specific transcription factors that could bind to this region and play a negative role in dmrt7 promoter activity . Deletion of the -60 to + 1 sequence markedly decreased the activity, indicating the region of the -60 to + 1 is essential for promoter function (figure 1c). Two highly conserved ccaat boxes were located in this region . To confirm the role of both ccaat boxes, the mutation of ccaat box1 in -60/+116 construct resulted in a decrease of approx.60 - 70% compared to the promoter activity of -60/+116 construct, the ccaat box2 mutation in -60/+116 construct approx.70 - 80% . Nearly no activity was observed in the double mutations of both boxes in -60/+116 construct . However, the double mutations of both ccaat boxes in the -948/+116 region resulted in only a decrease of approx.40 - 50% compared to the promoter activity of -60/+116 construct . Although there may be other important cis - regulatory sites upstream of the -60/+116, which may compensate the loss of these ccaat boxes (figure 1d), the region of the -60/+116 including two highly conserved ccaat boxes is important for the promoter function . These results showed that both ccaat box1 and ccaat box2 are important for transcriptional activation of the mouse dmrt7 gene . Transcription factor prediction using the matinspector and tfsearch showed that potential transcription factor nf - y may bind to the ccaat boxes . To determine if nf - y binds to the ccaat boxes, electrophoretic mobility shift assays were carried out using nuclear extracts prepared from mouse testis and double stranded oligonucleotides . Incubation of probe1 spanning from -58 to -31 (containing ccaat box1) with the extract gave rise to the formation of a dna - protein complex (figure 2 lane1), which could be competed by the addition of an excessive amount of unlabelled oligo1 dna (figure 2 lane5), but not by the oligo1 dna with mutated ccaat box (figure 2 lane7). Furthermore, addition of nfya antibody to the binding reaction caused the disappearance of the specific dna / protein complex and the appearance of the super - shift band (figure 2 lane3). These results indicate that the ccaat box1 within the promoter region is capable of binding with transcription factor nf - ya in vitro . A similar result was also observed in incubation of probe2 spanning from -20 to + 8 (containing ccaat box2) with mouse testis nuclear extract (figure 2). These results indicate that transcription factor nf - ya can bind to dmrt7 promoter in vitro . To further determine whether nf - y binds to the mouse dmrt7 promoter in vivo, we performed chromatin immunoprecipitation analysis . Because dmrt7 protein was only detected in testis (figure 3a), we chose the testis for chip analysis . As shown in figure 3b, a 160 bp of dna fragment was amplified from the precipitate by nf - ya antibody from testis, but not from control tissue liver or negative control immunoprecipitations using no antibody (beads only) or normal rabbit igg . The amplified fragment was confirmed by sequencing . To rule out the possibility of non - specific binding of the nf - ya antibody, an additional pcr amplification of a distinct genomic region was performed on all of the precipitated chromatin dnas, which showed no amplification out of the nf - ya - binding region (figure 3b, d). A quantitative chip pcr was also performed to quantify the binding extent of nf - ya on the dmrt7 promoter (figure 3c). These results indicate that nf - y specifically binds to the dmrt7 promoter in vivo . To investigate the role of transcription factor nf - y in the activation of the dmrt7 promoter, both gc-1 and cos 7 cells were co - transfected with luciferase reporter driving by wild - type dmrt7 promoter (-60/+116 construct) or its mutants for ccaat sites, and nf - ya / b / c expression plasmids . The luciferase activity increased obviously when a wild - type promoter construct (-60/+116) was co - transfected with nf - ya / b / c (figure 4a). However, the luciferase activity was not upregulated obviously when co - transfected with mutants for ccaat box1 or box2 and was not upregulated absolutely when co - transfected with double mutants for ccaat box1 and box2 (figure 4a). This result indicated tandem arrangement of the ccaat box1 and box2 may ensure maximum promoter activity of the dmrt7 . In addition, replacing the nf - ya / b / c expression plasmid with the dominant - negative construct (nf - yam29) resulted in a marked reduction of luciferase activity in a dosage - dependent manner (figure 4b). Nf - yam29 has three amino acid substitutions at the c - terminal region of the nf - ya, which impairs its dna binding and acts as a dominant - negative mutant by sequestering the nf - yb / yc subunits into a defective complex 32 . To characterize functional elements in the dmrt7 promoter, the sequence from -407 to + 116 of dmrt7 was run in matinspector and tfsearch to find putative transcriptional elements . Several possible transcription - factor binding sites, which included ap-1, sp1, gata1, e2f and ccaat box, were identified (figure 1a). Blast alignment of the promoter region of mouse, rat, and human dmrt7 genes revealed two highly conserved ccaat boxes: the ccaat box1 (-48/-44) and the ccaat box2 (-7/-3) (figure 1b). To determine the functional elements required for promoter activity, six 5'-deletion mutants (-948/+116, -407/+116, -245/+116, -104/+116, -60/+116 and + 1/+116) were constructed and analyzed for promoter activity using luciferase reporter in gc-1 and cos 7 cells (figure 1c). The deletion of the region between -245 and -104 appears to increase promoter activity in gc-1 cells, whereas the opposite result was obtained in cos 7 cells . To explain this discrepancy, we speculate that there could be other gc-1 specific transcription factors that could bind to this region and play a negative role in dmrt7 promoter activity . Deletion of the -60 to + 1 sequence markedly decreased the activity, indicating the region of the -60 to + 1 is essential for promoter function (figure 1c). Two highly conserved ccaat boxes were located in this region . To confirm the role of both ccaat boxes, the mutation of ccaat box1 in -60/+116 construct resulted in a decrease of approx.60 - 70% compared to the promoter activity of -60/+116 construct, the ccaat box2 mutation in -60/+116 construct approx.70 - 80% . Nearly no activity was observed in the double mutations of both boxes in -60/+116 construct . However, the double mutations of both ccaat boxes in the -948/+116 region resulted in only a decrease of approx.40 - 50% compared to the promoter activity of -60/+116 construct . Although there may be other important cis - regulatory sites upstream of the -60/+116, which may compensate the loss of these ccaat boxes (figure 1d), the region of the -60/+116 including two highly conserved ccaat boxes is important for the promoter function . These results showed that both ccaat box1 and ccaat box2 are important for transcriptional activation of the mouse dmrt7 gene . Transcription factor prediction using the matinspector and tfsearch showed that potential transcription factor nf - y may bind to the ccaat boxes . To determine if nf - y binds to the ccaat boxes, electrophoretic mobility shift assays were carried out using nuclear extracts prepared from mouse testis and double stranded oligonucleotides . Incubation of probe1 spanning from -58 to -31 (containing ccaat box1) with the extract gave rise to the formation of a dna - protein complex (figure 2 lane1), which could be competed by the addition of an excessive amount of unlabelled oligo1 dna (figure 2 lane5), but not by the oligo1 dna with mutated ccaat box (figure 2 lane7). Furthermore, addition of nfya antibody to the binding reaction caused the disappearance of the specific dna / protein complex and the appearance of the super - shift band (figure 2 lane3). These results indicate that the ccaat box1 within the promoter region is capable of binding with transcription factor nf - ya in vitro . A similar result was also observed in incubation of probe2 spanning from -20 to + 8 (containing ccaat box2) with mouse testis nuclear extract (figure 2). These results indicate that transcription factor nf - ya can bind to dmrt7 promoter in vitro . To further determine whether nf - y binds to the mouse dmrt7 promoter in vivo, we performed chromatin immunoprecipitation analysis . Because dmrt7 protein was only detected in testis (figure 3a), we chose the testis for chip analysis . As shown in figure 3b, a 160 bp of dna fragment was amplified from the precipitate by nf - ya antibody from testis, but not from control tissue liver or negative control immunoprecipitations using no antibody (beads only) or normal rabbit igg . The amplified fragment was confirmed by sequencing . To rule out the possibility of non - specific binding of the nf - ya antibody, an additional pcr amplification of a distinct genomic region was performed on all of the precipitated chromatin dnas, which showed no amplification out of the nf - ya - binding region (figure 3b, d). A quantitative chip pcr was also performed to quantify the binding extent of nf - ya on the dmrt7 promoter (figure 3c). These results indicate that nf - y specifically binds to the dmrt7 promoter in vivo . To investigate the role of transcription factor nf - y in the activation of the dmrt7 promoter, both gc-1 and cos 7 cells were co - transfected with luciferase reporter driving by wild - type dmrt7 promoter (-60/+116 construct) or its mutants for ccaat sites, and nf - ya / b / c expression plasmids . The luciferase activity increased obviously when a wild - type promoter construct (-60/+116) was co - transfected with nf - ya / b / c (figure 4a). However, the luciferase activity was not upregulated obviously when co - transfected with mutants for ccaat box1 or box2 and was not upregulated absolutely when co - transfected with double mutants for ccaat box1 and box2 (figure 4a). This result indicated tandem arrangement of the ccaat box1 and box2 may ensure maximum promoter activity of the dmrt7 . In addition, replacing the nf - ya / b / c expression plasmid with the dominant - negative construct (nf - yam29) resulted in a marked reduction of luciferase activity in a dosage - dependent manner (figure 4b). Nf - yam29 has three amino acid substitutions at the c - terminal region of the nf - ya, which impairs its dna binding and acts as a dominant - negative mutant by sequestering the nf - yb / yc subunits into a defective complex 32 . Dmrt7 is a member of the dm domain family of genes, which encodes proteins with a conserved dna binding dm domain . In addition to dmrt1, some dm domain proteins such as dmrt3, dmrt4 and dmrt7 may be involved in sexual development . Dmrt7 mrna could be detected in testis and fetal ovary but not in other tissues 9 . The expression of dmrt7 protein was detected in testis 29, but not in the fetal ovary . Dmrt7 mutants were infertile with spermatogenic arrest at the pachytene stage, while the mutant females showed normal fertility 28, 29 . Possible post transcriptional role of poly - adenylation in dmrt7 expression regulation was previously proposed 30 . Because transcriptional regulation of the gene dmrt7 during spermatogenesis is an important process, in this study, we have explored promoter function of the gene and found that nuclear factor - y (nf - y) regulates transcription of mouse dmrt7 gene through binding to two conserved ccaat boxes in its proximal promoter region . Deletion analysis of the 5' flanking region of the mouse dmrt7 revealed crucial positive elements between -60 and + 1, in which two evolutionarily conserved ccaat boxes (the ccaat box1 and box2) were identified . The conservation of transcription factor binding sites between orthologue gene promoters may indicate their highly significant roles in maintaining transcriptional regulation of dmrt7 gene . Further site - directed mutagenesis and functional analysis were performed to confirm their role in maintenance of promoter function of dmrt7 . The results suggest that binding by nf - y to these two tandem ccaat boxes is important for regulation of the basal transcription of the dmrt7 gene in the mouse testis . Nf - y protein (also known as cbf) binds with high specificity to the ccaat sequence and is a ubiquitous heteromeric transcription factor 33 . Nf - y is a complex composed of three subunits: nf - ya (cbf - b, hap2 in yeast), nf - yb (cbf - a, hap3) and nf - yc (cbf - c, hap5), which are all required for dna - binding 34 - 36 . Both nf - yb and nf - yc have conserved histone folding motifs resembling h2b - h2a and their heterodimerization is essential for nf - ya association 33, 37 . Nf - ya is a regulatory subunit of the trimeric complex, whose levels vary in different cell types and/or growth conditions 38 . It has been suggested that nf - y can gain access to its genomic locations even in the absence of methyl histone marks and then leads the positioning of methyl histone marks typical of active chromatin independently 39 . A number of mammalian promoters have been shown to contain ccaat boxes and have been regulated by nf - y alone or together with other transcriptional factors 41 - 44 . In accordance with these results, the transcription factor nf - y may activate the mouse dmrt7 gene and play an important role in the regulation of dmrt7 expression in testis . This, therefore, suggests that nf - y regulation of dmrt7 plays a functional role in spermatogenesis . In summary, we have found two important ccaat boxes in the 5' flanking region of the mouse dmrt7 promoter . Nf - y is a major transcriptional activator of the dmrt7 gene through binding to these two ccaat boxes . These results provide evidence of the regulatory mechanisms that control the expression in testis of the mouse dmrt7 gene and will form the basis for understanding mammalian spermatogenesis.
Primary retroperitoneal germ cell tumors account for approximately 30% of extragonadal germ cell tumors (egcts) and for about 10% of all primary malignant retroperitoneal tumors . Many studies have demonstrated an association between diffuse bilateral testicular microlithiasis (tm) and gonadal germ cell tumors and egcts [2, 3]. Nevertheless, it is still uncertain whether ultrasound surveillance is really necessary in patients with tm in the absence of other risk factors such as previous testicular cancer, a history of cryptorchidism or testicular atrophy . We report the cases of a 33- and a 39-year - old man presenting with a retroperitoneal extragonadal tumor and bilateral tm without a focal testicular mass . A 39-year - old man with a 6-month history of lumbar pain came to our hospital to perform an mri examination in order to rule out a lumbosacral hernia . The mri images showed no slipped disks, but we unfortunately detected a voluminous retroperitoneal solid mass . Therefore, we decided to perform a total body ct to better characterize the mass and its relationship to adjacent structures . Ct images showed a large heterogeneous retroperitoneal mass with curvilinear calcifications and a marked inhomogeneous enhancement after intravenous contrast medium injection due to the presence of necrotic - colliquative areas . This lesion displaced the left renal vein cranially, the abdominal aorta anteriorly and towards the right, and infiltrated the inferior vena cava, the left renal vein, and the left psoas muscle (fig . 1). The patient's -fetoprotein, lactate dehydrogenase, and beta subunit of human chorionic gonadotropin levels were 2.680 iu / l (normal, 90180 iu / l), 279 ng / ml (normal, 07.5 ng / ml), and 4 miu / ml (normal, <5 miu / ml). We performed a scrotal ultrasonography (us) to rule out that this mass was a retroperitoneal metastasis of a primary testicular tumor: us showed bilateral classic tm (defined as more than 5 calcifications scattered throughout the testicle), without a focal lesion (fig . 2). Comparing the current ultrasound images with previous us testicular images (the patient underwent a scrotal us when he was 25 years old because of a testicular trauma) the patient underwent a ct - guided biopsy and at histology, an immature teratoma was diagnosed . A 33-year - old man came to our emergency department complaining of abdominal pain, vomiting, weight loss and mild jaundice . The patient's serum -fetoprotein, lactate dehydrogenase, and beta subunit of human chorionic gonadotropin levels were 2.470 iu / l (normal, 90180 iu / l), 232 ng / ml (normal, 07.5 ng / ml) and 3 miu / ml (normal, <5 miu / ml). Besides, the serum markers of cholestasis were high: conjugated bilirubin was 2 mg/100 ml (normal, <0.2 mg/100 ml), -glutamyl transpeptidase 70 iu / l (normal, 130 iu / l) and alkaline phosphates 300 iu / l (normal, <170 iu / l). Ct and mri examinations showed a giant retroperitoneal mass made up by multiple necrotic - colliquative fluid areas with a multilocular aspect, which dislocated the inferior vena cava anteriorly and with possible infiltrating signs; it also compressed the portal vein and the common bile duct with moderate dilatation of the intrahepatic ducts (fig . 3). The patient was sent to do an us to rule out the presence of a primary testicular tumor, which revealed bilateral tm without a focal hypoechoic lesion; the microcalcification pattern was quite similar to that of a past ultrasound exam that was performed when the patient was 22 years old because of a suspected varicocele . The patient underwent a ct - guided biopsy and at histology, a yolk sac tumor was diagnosed . An egct is by definition a germ cell neoplasm, displaying one of the histologic types associated with gonadal origin, but located outside the gonads . The most widely accepted theory suggests that egcts arise from primordial germ cells misplaced during their migration to the gonads . It remains uncertain, however, whether such tumors develop primarily at extragonadal sites or represent metastases of a primary testicular tumor . Regarding the latter case, egct may have developed from burned out testicular tumors or they may just be metastatic lesions from primary testicular tumors that were not detected at the time of the diagnosis . A burned out gonadal primary tumor is a regressed tumor which is seen as an echogenic scar or a hypoechoic tissue on testicular ultrasound and which clinically presents with metastasis . Histologically, egcts comprise seminomas (3040%) and nonseminomatous tumors (6070%) in men and dysgerminomas and nondysgerminomas in women . Nonseminomatous germ cell tumors (nsgcts) include teratoma, embryonal carcinoma, endodermal sinus tumor (yolk sac tumor), choriocarcinoma, and tumors with mixed histology . -fetoprotein is produced by endodermal sinus tumors, either alone or in association with other types of germ cell tumors . These are useful serum markers in the diagnosis, prognosis, and follow - up of patients with germ cell tumors . The majority of the egcts occur in men, except benign mature teratoma, which occurs with equal frequency in men and women . Egcts are usually seen in children or young adults, and typically arise in midline locations . In adults, the most common sites of primary egcts are, in descending order, the mediastinum, the retroperitoneum and the cranium . In children, primary retroperitoneal germ cell tumors account for about 10% of all primary malignant retroperitoneal tumors and about 3040% of egcts . Egcts are often seen in or near the midline, especially between the t6 and s2 vertebrae . Patients may present with metastases: brain, liver, lungs and bones are the common sites of metastases . Seminoma is rare in the retroperitoneum and is seen as a large, lobulated, well - defined homogeneous solid mass with fibrous septa and ring - like or speckled calcifications . Nsgcts are depicted as heterogeneous tumors with areas of hemorrhage, necrosis, and heterogeneous enhancement . Flow voids as well as invasion of adjacent structures that are due to hypervascularity may be seen . Primary testicular malignancy and egcts are often associated with tm [2, 8]. This is an uncommon pathologic condition that is detected by scrotal us and is defined as the presence within the substance of the testis of 5 or more speckled bright foci, 12 mm in diameter, with little or no acoustic shadowing; the microcalcifications usually affect both testes, but may be unilateral and can be focal or diffuse [3, 4]. J. richenberg and n. brejt affirm that ultrasound surveillance is unlikely to benefit patients with tm in the absence of other risk factors; on the contrary, in the presence of additional risk factors (previous testicular cancer, a history of maldescent or testicular atrophy), patients are likely to be under clinical and ultrasound surveillance . Nevertheless, it is still controversial whether performing sonographic surveillance is better than regular testicular self - examination in adult patients with classic tm and the absence of any known testicular tumor . In this setting, on the basis of our direct experience, we highlight the importance of annual ultrasonographic surveillance of the testis and retroperitoneal space in patients with occasionally detected tm . Besides, taking into account the increased risk of metachronous testicular malignancy in patients with previous egct [6, 9], we recommend yearly testicular ultrasound follow - up after surgical removal of retroperitoneal gonadic tumor.
Central nervous system (cns) lymphoma can present as either secondary, representing 1 to 7% of lymphomas, or primary, representing 0.2 to 2% of lymphomas.1 secondary cns lymphoma (scnsl)is currently defined as lymphoma not originating from within the cns, and may be an isolated recurrence within the cns or may be part of the systemic progressive disease.2 additionally, scnsl may be further categorized as leptomeningeal, parenchymal, or as a combination of the two.3 in particular, an isolated relapse within the cns is rare, with retrospective cohorts typically numbering between 10 and 30 patients.4 5 6 7 furthermore, due to a lack of clinical data on isolated scnsl recurrence, features of the disease, a standard treatment regiment, and overall prognosis have yet to be elucidated.4 8 once the diagnosis has been established, treatment options for cns lymphoma can be broadly divided into chemotherapy, radiation, and surgery . Surgical resection of cns lymphoma is generally a last resort and only offered in cases when the lesion is causing extreme mass effect and herniation syndromes . Unfortunately, the standard chemotherapy regimens used in the treatment of systemic lymphomas have shown only little effect in prophylaxis or direct treatment of cns lymphomas.9 these drugs (anthracyclines, vinca alkaloids, and some alkylating agents) have poor blood brain penetration, and their toxicity profiles limit the dose at which they can be delivered to overcome this . Methotrexate and cytarabine, in contrast, have poor blood brain barrier penetration but can be delivered at sufficient concentrations to overcome this and provide adequate concentration to the cns.10 initial studies showed improved overall survival from treatment with high - dose methotrexate and radiation at time of diagnosis, with response rates of up to 80 to 90% and 5-year median survival times in primary cns lymphoma.11 subsequent studies comparing high - dose methotrexate alone and combination high - dose methotrexate and radiation failed to prove robust survival benefit with combination therapy, especially in patients> 60 years of age, a growing segment of the disease.11 12 13 in addition, responses to radiation treatment have been found to be short lived and have failed to increase overall survival.14 the role of radiation therapy for cns lymphoma has shifted from initial treatment to salvage therapy over the past several decades.9 15 treatment paradigms established for primary cns lymphoma have been used in the treatment of scnsl; however, the failure rate remains high, with overall survival typically on the order of 2 months.16 more recently, more aggressive regimens have been suggested . These include surgical resection that has been shown to provide survival benefit in a single trial within a subset of patients who had a single cns lesion in a noneloquent, surgically accessible region.17 although there is no standard dosing for methotrexate, cns concentration and response rates have been shown to be related to infusion rate.18 more specifically, methotrexate area under the curve has been shown to be an independent predictor of clinical outcome.19 personalized dosing based on age, gender, and creatinine clearance has been proposed.10 blood brain barrier disruption methods in combination with chemotherapeutic agents that have been used successfully in systemic lymphomas has shown promise in early pilot studies and are currently being tested in larger centers.20 21 similarly, intrathecal administration of methotrexate, cytarabine, or rituximab has shown some early promise, but further data are still required . Administration of intrathecal chemotherapy is generally reserved for patients with leptomeningeal disease and positivity on cerebrospinal fluid (csf) testing, although large retrospective series have been equivocal on this topic.22 23 once the diagnosis has been established, treatment options for cns lymphoma can be broadly divided into chemotherapy, radiation, and surgery . Surgical resection of cns lymphoma is generally a last resort and only offered in cases when the lesion is causing extreme mass effect and herniation syndromes . Unfortunately, the standard chemotherapy regimens used in the treatment of systemic lymphomas have shown only little effect in prophylaxis or direct treatment of cns lymphomas.9 these drugs (anthracyclines, vinca alkaloids, and some alkylating agents) have poor blood brain penetration, and their toxicity profiles limit the dose at which they can be delivered to overcome this . Methotrexate and cytarabine, in contrast, have poor blood brain barrier penetration but can be delivered at sufficient concentrations to overcome this and provide adequate concentration to the cns.10 initial studies showed improved overall survival from treatment with high - dose methotrexate and radiation at time of diagnosis, with response rates of up to 80 to 90% and 5-year median survival times in primary cns lymphoma.11 subsequent studies comparing high - dose methotrexate alone and combination high - dose methotrexate and radiation failed to prove robust survival benefit with combination therapy, especially in patients> 60 years of age, a growing segment of the disease.11 12 13 in addition, responses to radiation treatment have been found to be short lived and have failed to increase overall survival.14 the role of radiation therapy for cns lymphoma has shifted from initial treatment to salvage therapy over the past several decades.9 15 treatment paradigms established for primary cns lymphoma have been used in the treatment of scnsl; however, the failure rate remains high, with overall survival typically on the order of 2 months.16 more recently, more aggressive regimens have been suggested . These include surgical resection that has been shown to provide survival benefit in a single trial within a subset of patients who had a single cns lesion in a noneloquent, surgically accessible region.17 although there is no standard dosing for methotrexate, cns concentration and response rates have been shown to be related to infusion rate.18 more specifically, methotrexate area under the curve has been shown to be an independent predictor of clinical outcome.19 personalized dosing based on age, gender, and creatinine clearance has been proposed.10 blood brain barrier disruption methods in combination with chemotherapeutic agents that have been used successfully in systemic lymphomas has shown promise in early pilot studies and are currently being tested in larger centers.20 21 similarly, intrathecal administration of methotrexate, cytarabine, or rituximab has shown some early promise, but further data are still required . Administration of intrathecal chemotherapy is generally reserved for patients with leptomeningeal disease and positivity on cerebrospinal fluid (csf) testing, although large retrospective series have been equivocal on this topic.22 23 a 36-year - old man presented to his primary care physician with complaint of a soft nontender mass on the left side of his neck . The patient reported that he noticed this mass enlarging for the past year but had attributed it to an infectious process . An initial chest x - ray identified a left supraclavicular mass compressing the trachea and causing a rightward deviation . Additionally, a computed tomography (ct) scan of the chest and neck, with and without contrast, was performed for follow - up, with evidence of diffuse lymphadenopathy (fig . 1a), specifically, the supraclavicular, paratracheal, prevascular, lesser sac, left axilla, parasternal, and mesenteric chain nodes . A head ct scan with contrast performed at the same time was negative for any intracranial involvement . (a) pretreatment axial chest computed tomography (ct) with contrast revealing a prevascular lymph node mass (solid arrow) during the initial diagnosis of b - cell lymphoma . (b) postchemotherapy axial chest ct with contrast illustrating near - complete resolution of the previously seen prevascular lymph node mass (dotted arrow). The patient was subsequently scheduled for a ct - guided biopsy of the supraclavicular lesion . The results of the biopsy were consistent with b cell lymphoma . Following the biopsy confirmation, the patient completed six cycles of outpatient rituximab, cyclophosphamide, hydroxydaunorubicin, oncovin, and prednisone therapy . At his last outpatient oncology visit, the patient did not experience any cognitive symptoms, and he had no extranodal involvement at diagnosis or follow - up . The patient's lactate dehydrogenase level was not measured as a part of his follow - up . This would place the patient at a low risk for developing a secondary cns lymphoma relapse.8 24 approximately 7 months posttreatment, the patient was hospitalized at an outside medical center following a 1-week period of worsening mental status . On admission, the patient was found to have elevated serum sodium levels in the 160s, and further work - up revealed a suprasellar mass on head ct (fig . Upon arrival to our institution, the patient was found to have diabetes insipidus . With a known history of systemic lymphoma, ct scan of the chest, abdomen, and pelvis displayed marked interval improvement in the degree of lymphadenopathy with near - complete resolution of the previous mediastinal lymphadenopathy (fig . A brain magnetic resonance imaging (mri) revealed a homogeneously enhancing suprasellar mass with surrounding edema (fig . (a) preoperative axial head computed tomography (ct) without contrast from an outside institution revealing a 2.6-cm suprasellar mass (solid arrow). (b) postoperative axial head ct without contrast illustrating the results of the right frontal orbital craniotomy for debulking and biopsy (dotted arrow). Preoperative (a) axial and (b) coronal t1-weighted cranial magnetic resonance imaging with contrast, revealing a 3-cm suprasellar mass with surrounding edema (solid arrows). The patient was taken for a right fronto - orbital craniotomy and translaminar terminalis approach for biopsy of the lesion (fig . Histologically, the samples showed highly cellular clumps of lymphocytes on hematoxylin and eosin staining (fig . C), and immunohistochemical studies were positive for bcl2, bcl6, cd10, cd20, and cd79a (fig . 5a 5f) highlighted the proliferation of 5 to 10% of the neoplastic cells present in the biopsy . The patient was placed on high - dose methotrexate, and his mental status improved . Unfortunately, the patient's condition progressed and he succumbed to his illness . Histopathology of the biopsied suprasellar mass under (a) low magnification (50) and (b, c) high magnification (200) revealing highly cellular clumps of lymphocytes consistent with diffuse large b - cell lymphoma (hematoxylin and eosin). Immunohistochemistry of the biopsied suprasellar mass stained positive for (a) bcl2, (b) bcl6, (c) cd10, (d) cd20, (e) cd79a, and (f) ki-67, all consistent with diffuse large b - cell lymphoma (200). The incidence of scnsl in the general population ranges from 4 to 23%.2 25 26 27 the factors that most significantly influence the incidence rate of scnsl include the variant of primary lymphoma, involvement of more than one extranodal site, a serum lactate dehydrogenase level greater than three times the normal limit, an advanced stage of the systemic disease, and a high international prognostic index.2 3 28 29 other studies have found that no one indicator of scnsl is reliable on its own, but that the combination of several factors can help elucidate the risk of developing scnsl and the need for possible prophylaxis . In particular, initial involvement of the breast, testis, and bone marrow with primary disease are heavily associated with an increased risk of developing scnsl.30 populations with the highest risk are those with immune deficiencies, either innate or acquired . In the 1980s, a steep increase in the incidence of scnsl paralleled the increase in incidence of human immunodeficiency virus and autoimmune deficiency syndrome . However, with the advent of highly active antiretroviral therapy in the mid-1990s, the incidence has decreased and remained fairly steady since that time . The age of diagnosis of both primary and secondary cns lymphoma has been steadily increasing, focusing more studies on treatment of an elderly population.31 32 33 34 35 as previously mentioned, the histologic grade of the primary lymphoma differentially influences the risk of developing scnsl . Depending on whether the primary lymphoma is classified as indolent, aggressive, or highly aggressive, there is a 3%, 9%, and 27% risk, respectively, of developing scnsl.36 with specific regard to diffuse large b - cell lymphoma (dlbcl), the incidence has been reported as 5%, but interestingly, when the primary lymphoma is of the mediastinal large b - cell variant, the risk of scnsl climbs to 19%, as in this case . Although most scnls present with leptomeningeal disease, dlbcl most often presents with parenchymal disease.3 indolent lymphomas usually carry a low risk of recurrence, but when cns disease has been found, it is usually after the histologic transformation to a more aggressive variant.27 37 38 furthermore, presence of at least two of these: bone marrow, skin involvement, and b symptoms, increases the risk of scnl in indolent primary lymphomas to 7%.8 24 28 the characteristic clinical presentation of scnsl is a new - onset headache (50%), palsies of cranial nerves iii, iv, vi, and vii, changes in mental status (29%), and even coma and seizures (2329%).39 it typically presents within 6 months of diagnosis of the primary lymphoma, which is typically confirmed with csf studies and imaging.25 26 flow cytometry, however, is more sensitive than csf cytology, and polymerase chain reaction studies can be used for further confirmation.37 40 mri is the current gold standard for localizing the recurrence because it has superior sensitivity compared with ct . Parenchymal lesions usually present with homogeneously enhancing superficial or periventricular lesions, but ring enhancement patterns can also be seen, especially in the population with acquired immunodeficiency syndrome . Scnsl is characterized as an isolated recurrence 50% of the time; although most of these patients go on to develop systemic recurrences within several months . Isolated cns recurrence has a worse prognosis than cns disease at the time of diagnosis, suggesting an alternative disease mechanism.41 survival is slightly better in isolated cns recurrence when compared with systemic recurrence, which is the major cause of death in secondary cns lymphoma . Unfortunately, the median survival time is <6 months when no treatment has been administered . Treatment and cns prophylaxis after the discovery of primary lymphoma is an area of active investigation . Based on the results of the large retrospective ricover-60 trial, intravenous (iv) rituximab is added to cyclophosphamide, doxorubicin, vincristine, and prednisolone (chop) therapy because it has shown a decreased incidence of scnsl from 6.9 to 4.1%.24 25 26 39 40 41 42 43 another study found that a regimen of acvbp with iv methotrexate (mtx) may also be superior to standard chop therapy.30 the use of iv mtx has been shown to increase survival times for isolated scnsl, especially for parenchymal scnsl.44 despite these results, a strong consensus has yet to be reached on the indications for, efficacy of, and means of cns prophylaxis . This is partially due to the retrospective nature of the studies to date and the variance in treatment regimens among the different studies . Also, the histopathology of the primary lymphoma is a determining factor in the efficacy of treatment . For example, although iv rituximab decreased the incidence of scnsl overall, it does not seem to influence the incidence of scnsl in dlbcl (30%). Interestingly, the patient in this case did not meet the criteria for increased risk of developing scnsl, yet he still developed the disease . This leads us to believe that indeed no one factor is a definitive indicator that a patient will progress to a scnsl . The classification of mediastinal dlbcl may have elevated the patient's risk of progression to scnsl; however, his lack of other indicative risk factors made this an uncommon occurrence in an already uncommon condition . Despite the unusual presentation in this case (panhypopituitarism), the patient did have an isolated cns relapse within 6 months, and the mental status change resolved in response to mtx treatment . Isolated scnsl is a rare disease in which standardized treatment guidelines have yet to be developed . This case is one particular example where a patient designated as low risk for developing scnsl did progress to an isolated occurrence of the disease . Additionally, although treatment extended the patient's survival time and resolved the change in mental status, the disease continued to progress and the patient succumbed to his illness.
The cellular thiol - disulfide redox environment is defined by protein thiols (psh) and disulfides (psox) as well as low molecular weight thiols and disulfides . In mammalian cells, by far the most abundant low molecular weight sulfhydryl molecule is glutathione (gsh). Together with its disulfide (gssg), this pair is often referred to as the cellular thiol - disulfide redox buffer . In the cytosol of eukaryotic cells, glutathione is highly reducing with a ratio of gsh to gssg of at least 3,000 [1, 2], and consequently the majority of protein cysteines are found as psh . The high concentrations of psh and gsh in this compartment are important in the cellular defense against thiol oxidants, during thiol - disulfide stress, formation of mixed disulfides between protein and glutathione (pssg) serves as a mechanism for protecting psh and gsh from irreversible oxidation . In contrast to cytosolic proteins, secretory proteins often contain disulfide bonds, and the glutathione redox pool in the secretory compartments of the cell is found to be considerably more oxidizing than the cytosolic pool . Disulfide bond formation is an essential step for the correct folding of many secretory proteins, and in eukaryotic cells their folding and assembly takes place in the endoplasmic reticulum (er). In this compartment, molecular chaperones and enzymes for disulfide bond formation and glycosylation support protein folding . The maintenance of a proper er redox environment is crucial for the folding of secretory proteins . If the redox environment becomes too reducing, the formation of disulfide bonds is hampered . If too oxidizing, folding intermediates with nonnative disulfide bonds can accumulate . A number of oxidoreductases, which may have different functions and/or substrate or tissue specificities in the assistance of folding secretory proteins, the best characterized oxidoreductase is protein disulfide isomerase (pdi), which introduces, reduces, and reorganizes disulfide bonds in a broad variety of substrate proteins . The oxidative pathway remains unresolved, but pdi may be reoxidized by a number of enzymes including pdi peroxidases, gpx7 and gpx8, peroxiredoxin 4, and the flavoprotein ero1 (endoplasmic reticulum oxidoreductin 1), for review see [10, 11]. Professional secretory cells are specialized in producing secretory proteins and are characterized by their abundant er . One example is the terminally differentiated b cell, also referred to as plasma cell, which secretes enormous amounts of antibodies, that is, immunoglobulins (ig). While resting b cells do not secrete antibody, they do express a membrane - bound ig on their cell surface as a subunit of the b cell receptor, which upon binding of antigen activates a signaling cascade that can lead to differentiation into antibody - secreting plasma cells . The differentiation is accompanied by many morphological changes to accommodate production of large amounts of secreted antibody . This includes a general increase in cell volume with a preferential expansion of the er . In addition, the differentiation is accompanied by dramatic changes in the proteome of the cell [13, 14]; as expected, the er proteins are significantly up - regulated . Igm is typically secreted as disulfide - linked pentamers or hexamers of a subassembly consisting of two identical heavy chains () and two light chains (). The pentameric holoprotein in addition contains a j - chain, which the hexamer does not . As each subassembly contains 16 disulfide bonds and the j - chain contributes 4 disulfide bonds, ros production is increased during b cell differentiation and counterbalanced by a strong antioxidant response . We set out to investigate how this enormous load on the secretory machinery affects the global thiol - disulfide environment of the b cell . We have applied a previously developed method for quantitative determination of the absolute levels of psh, psox, and pssg on all cellular proteins (including membrane proteins) in cultured mammalian cells, and combined these data with quantifications of gsh and gssg in the same cells . In this way, we have obtained a picture of the global changes in cellular thiol - disulfide redox status during differentiation of the resting b cell into an antibody - secreting plasma cell . Quantitative studies of the cellular redox status involve a variety of technical challenges due to the reactive nature of the sh group . Great care must be taken to avoid artificial air oxidation and to eliminate cross - reactivity between the thiol and disulfide specific reagents, which can otherwise lead to deceptive conclusions . By applying a previously developed technology that carefully considers these technical pitfalls, we can quantitatively determine the cellular levels of total sulfhydryl equivalents in low molecular mass thiols and in protein . The key features of the experimental approach are illustrated in figure 1 . To avoid perturbation of the cellular thiol - disulfide status during cell lysis and sample preparation, cells were acidified by the addition of tca to a final concentration of 10%, resulting in immediate protein denaturation and precipitation . This combination of rapid trapping and deprotonation simultaneously unfolds redox enzymes, some of which have low thiol pka and are fairly acid - stable, and quenches generic thiols by protonation . To fully exploit the strength of our approach, we did not facs - sort cells before analysis, nor did we homogenize and fractionate cells . The tca pellets were solubilized by sonicating in appropriate buffers with high concentrations of sds or urea to quantify the different sulfhydryl species in all cellular proteins including membrane proteins . Psh and psox levels were determined with a highly sensitive hplc assay based on the thiol quantification agent 4-dps . The total value of protein cysteines (total ps) was calculated by the addition of psh and psox and to verify the method, this value was also determined experimentally . For experiments performed on resting b cells, there is an excellent agreement between the experimentally determined value and the calculated sum of the experimentally determined psh and psox (data not shown). Finally, pssg levels were selectively quantified by the use of the thiol derivatization agent sbd - f . The sbd - gs derivative is highly fluorescent and can be quantified specifically due to its unique retention time in an hplc chromatogram . In addition to protein sulfhydryls, the total protein content of each sample was determined and used as a common denominator to compare the individual samples . This is a crucial step as it eliminates any bias from a possible uneven division of the tca pellet into fractions . Furthermore, the requirement for a common denominator in this study is particularly important, as it also eliminates any bias due to morphological differences between cell samples . The total protein content was quantified using a method based on complete hydrolysis in hcl followed by quantification of released amino acids with ninhydrin . This constitutes a highly reproducible and sensitive method and, with a proper standard, it yields numbers that can be calibrated to amino acids in protein . Furthermore, the ninhydrin assay is independent of protein solubility and hence includes both soluble and membrane proteins . Thus, all the following data will be shown as sulfhydryl per amino acid (sh / aa). As a model for b cell differentiation, we used a previously established system based on the murine b cell lymphoma 1.29 which can be induced by lipopolysaccharide (lps) to secrete igm [13, 19]. To obtain a well - defined reference point for the differentiation of b cells into plasma cells, we quantified the thiol - disulfide status in uninduced b cells to obtain a reference point for differentiation into plasma cells . Cells were seeded to a density of 0.2 10 cells / ml, and samples for redox quantification were taken each day during the next four days . Although cell density increased considerably during this period, the protein redox state remained constant throughout the experiment (figures 2(a) and 2(b)). In addition, levels of pssg, gssg, and gsh remained constant (data not shown), and we concluded that the global thiol - disulfide status is independent of cell density . Accordingly, the mean value of data obtained for each of the redox species during the four days was calculated, and the relative distributions of the different protein and glutathione sulfhydryl equivalents are given in table 1 . From these data, we concluded that the vast majority of cellular sulfhydryl equivalents exists in the reduced thiol form with only 5% and 9% of the ps and gs equivalents engaged in disulfide bond formation, respectively . Together, these data describe the total thiol - disulfide environment of resting b cells, and we used them as reference point for studying the differentiation into antibody - secreting plasma cells . In the remaining part of this study interestingly, the distribution of thiol and disulfide equivalents in resting b cells is very similar to that of hek (human embryonic kidney) cells, where 6% of the ps equivalents were found as psox and 8.5% of the gs equivalents were found as gssg . In addition, our observation that cellular pssg levels are extremely low is supported by results in hek and hela cells . It should be mentioned that although cells are grown in the presence of -mercaptoethanol, which was detected in the tca supernatant and also in very small amounts in the tca pellet, it did not interfere with the glutathione or pssg measurements because fluorescent -mercaptoethanol derivatives were separated efficiently from gs derivatives by hplc (data not shown). Resting 1.29 cells were treated with lps to induce differentiation into antibody - secreting plasma cells . Samples were prepared for global thiol quantification after 1, 2, 3, and 4 days of lps treatment . From the sh / aa of total ps equivalents (figure 3(a)), we find that the frequency of cysteine residues in proteins is fairly constant (~2%) throughout the differentiation . This is in excellent agreement with the experimentally determined values for other mammalian cell lines as well as calculated values for eukaryotes in general hansen [3, 20]. The sh / aa for total ps was expected to be largely unaffected during differentiation as the igm monomer has a cysteine frequency of 2.5% (igm has 1,540 amino acids, of which 38 are cysteines). Although the absolute value of total ps equivalents remained unchanged throughout the experiment, the distribution of protein thiols and disulfides was influenced by the lps - induced cell differentiation . The percentage of protein thiols engaged in disulfide bond formation remained largely unaffected for two days after lps induction, but at day three the psox values had doubled, and a total increase by a factor of 3.3 was found at day four (figure 3(b)). Likewise, after a lag time of two days, on day three pssg had increased by a factor of 2.2, but in contrast to psox, the pssg value did not increase further on day four (figure 3(c)). Interestingly, the ratio of pssg to psox remained essentially unchanged throughout the experiment (figure 3(d)). Quantification of soluble glutathione equivalents revealed that the absolute concentrations of gssg remained largely unaffected (figure 4(a)), but the fraction of oxidized gs equivalents (gs in gssg) relative to total gs equivalents (total gs) increased from 8.8% to 14.5% (figure 4(b)). This was caused by a gradual decrease in gsh (figure 4(a)) resulting in an overall decrease of 56% in (total gs) at day 4 compared to day 0 . The gs equivalents were not recovered as pssg, which throughout the study remained a minute fraction of total gs equivalents (figure 4(c)). To rule out that the decrease in intracellular gs was caused by an increase in dying cells, the level of apoptotic and necrotic cells was measured using flow cytometry and staining with the cell - impermeable dye propidium iodide (pi). Although the fraction of viable (pi - negative) cells decreased during the differentiation by a factor of 1.5 (supplementary material figure 1 available online at http://dx.doi.org/10.1155/2013/898563), it could not account for our observed decrease in intracellular glutathione (see supplementary material text). As the decrease in intracellular gs was not explained by an increase in cell death, we measured whether gs equivalents were secreted by the cells . No glutathione was detectable in a blank medium sample (data not shown); media from uninduced cells, however, contained measurable amounts of glutathione, and the values increased significantly on day three and four after induction (figure 4(d)). It should be noted that these numbers are only rough estimates and that the values are most likely underestimated due to extracellular gs degradation catalyzed by -glutamyl transferase . From the data shown in figures 4(a) and 4(d), the increase in extracellular gs / aa equivalents at day 4 relative to day 0 was calculated to (0.23 0.1) 10 while the decrease in intracellular gs / aa was calculated to (0.46 0.05) 10 . As the two numbers are in the same size range, it is possible that the differentiating cells secrete glutathione (details are given in supplementary material text). The transformation of resting b cells into antibody - secreting plasma cells involves an extensive expansion of the er and both er resident proteins and proteins involved in redox balance are up - regulated linearly during differentiation . How cells cope with this sudden increase in secretory activity has been the subject of numerous studies [22, 23]. This study, for the first time, provides a quantitative overview of the cellular thiol - disulfide status during differentiation of resting b cells into antibody - secreting plasma cells . We applied a previously developed method to quantify soluble gsh and gssg as well as protein thiols and disulfides in cells . Importantly, the method includes both soluble and membrane proteins, which precludes bias due to morphological changes during b cell differentiation . We find that the differentiation process affects the global protein thiol - disulfide status with an increase factor of 3.3 in the fraction of oxidized protein thiols at day 4 of differentiation, compared to day 0 . The effects on the glutathione redox status are less significant with an increase factor of 1.6 in the fraction of oxidized gs equivalents . The changes in glutathione redox state were caused by a general depletion of gs equivalents from differentiating b cells . The differentiation of b cells into plasma cells has been studied in great detail at the proteomic level [13, 14]., the cell prepares by ensuring that metabolic capacity and secretory machinery can cope with the mass production of antibody molecules . We did not find any change in protein thiol - disulfide status until the third day of activation, when the fraction of psox increased by a factor of 2.2 . The kinetics for the change in protein redox state were identical to the kinetics for igm production . Our results suggest that a general expansion of the er does not affect protein redox status until an extensive production of cargo proteins is initiated . The increase of igm production at day three is possibly preempted by a process known as proactive unfolded protein response (proactive upr). The upr is a stress signaling process that is initiated when unfolded polypeptides accumulate in the er . This process leads to an up - regulation of er chaperones and folding enzymes which prevents er stress . While unfolded protein stress (or er stress) is not involved in the initial expansion of the er in professional secretory cells [13, 14], it is essential for b cell differentiation [26, 27]. Upr - induced oxidases such as ero1 may facilitate the change in protein redox state on the third day of differentiation to initiate disulfide - dependent igm polymerization and its subsequent secretion . Initially gssg was thought to provide oxidizing equivalents for disulfide bond formation, but after identification of the ero1 proteins this hypothesis was discarded . Instead, gsh now is considered to be involved in the isomerization of nonnative disulfide bonds [2830] to consume excess oxidizing equivalents produced by the ero1 proteins and to activate ero1 by reducing its regulatory disulfides . Consequently, the abundance of gssg in the er is altogether assumed to be at least partially caused by ero1 activity . The mechanisms by which the er maintains its gsh / gssg redox balance are unknown . Excess gssg could be reduced by an er resident glutathione reductase, it could be transported to the cytosol for reduction or it could be secreted from the cells . During b cell differentiation ero1 is up - regulated by factors of 3.0 and 2.4 at day 3 and 4, respectively, and consequently we expected gssg levels to increase . Surprisingly, gssg levels remained constant throughout differentiation, but the overall cellular glutathione redox status did become more oxidizing gradually (figure 4(a)). This was the result of a depletion of total gs equivalents at the expense of gsh (figure 4(b)). There are three possible explanations for the decrease in total intracellular gs, (1) differentiation of b cells leads to secretion of gs equivalents, (2) gsh is irreversibly oxidized to sulfinic or sulfonic acids, which is not detected by the quantification method, and (3) gs equivalents are released by the fraction of pi positive cells . We found an increase in extracellular gs on days 3 and 4 of the differentiation that was of about the same magnitude as the intracellular decrease (figure 4(d)). This result supports model (1) and suggests that gsh converted to gssg by the up - regulation of ero1 proteins and is exported to the media . This export could serve as a mechanism for relieving cells from any oxidative load caused by up - regulation of ero1 proteins . We can, however, not make any certain conclusions regarding the cause of intracellular gs depletion, as the levels of extracellular gs could in principle be explained by the fraction of pi - positive cells releasing their intracellular gs content to the media (see supplementary material text). Due to the extremely reducing glutathione redox potential of the cytosol, the vast majority of pssg is expected to be found in the oxidizing compartments of the cell . In a study of liver microsomes, 50% of the gs equivalents were found as pssg, suggesting that a major fraction of the glutathione in the er is associated with protein . However, this fraction was subsequently estimated to be significantly lower (i.e., less than 2% pssg) based on whole - cell quantification with the assumption that no pssg is found in the cytosol . Under the same assumption; that is, that all pssg equivalents are found in the er and that the concentrations of gs equivalents are the same in all cellular compartments, we can estimate that the maximal fraction of pssg is relative to total gs equivalents in the er, in fully differentiated b cells . The er volume is reported to constitute at least 10% of total cell volume in antibody - secreting b cells and, accordingly, maximally 7% (0.7%/10%) of the gs equivalents in er are found as pssg . Thus, even in highly active secretory cells, pssg only constitutes a minor fraction of total gs equivalents of the er . These results support the notion that the er glutathione redox environment is more reducing than previously assumed . It is generally assumed that the level of gssg is critical for the amounts of pssg formed . Interestingly, we found that the ratio of pssg to psox was independent of differentiation (figure 3(d)), suggesting that the oxidizing compartments of the cell maintain a constant level of pssg, and consequently, that the er glutathione redox status is tightly regulated throughout differentiation . This may be explained by the activation of oxidative stress during the early stage of b cell differentiation and followed by a strong antioxidant response [16, 36]. Maintenance of a proper er glutathione redox environment can be a crucial factor in securing the correct folding of igm . In this study, we have for the first time characterized the changes in thiol - disulfide state during differentiation of b cells . In general, the differentiation does not cause massive thiol - disulfide stress to the cells . The steady state levels of pssg are maintained at very low levels, even in fully differentiated cells, and the overall protein redox state is not affected until late in differentiation, when large - scale igm production has started and the er stress response has been activated . 1.29 cells were maintained in suspension as described in and after 2 days, cell culture medium was replaced by fresh medium . For differentiation, cells were cultured in the presence of 20 g / ml lps (sigma). Three independent cultures were induced with lps and samples were taken after 1, 2, 3, or 4 days of differentiation . As a control, samples from 3 independent cultures grown without lps were collected as well . Each day after lps activation, samples were collected for flow cytometric analysis . Cells were stained with pi (sigma) and flow cytometry data were obtained with facscalibur (bd biosciences) and analyzed using cellquest software (bd biosciences). Cells were harvested by centrifugation followed by a wash step with 10 ml dulbecco's 1x pbs (paa laboratories) to eliminate traces of protein from the media . Cells were resuspended in 1 ml ice - cold 10% (w / v) tca and incubated on ice for 30 minutes followed by centrifugation . The supernatant, used for quantification of gsh and gssg, was immediately frozen in n2 and kept at 80c until later use . The tca pellet, used for protein thiol quantification, was washed in 10% tca by four cycles of sonication and centrifugation . Before the final centrifugation step, the suspension was divided in four to quantify psh, psox, pssg, and total ps . The psh, pssg, and total ps samples were immediately frozen in n2 and kept at 80c until later use . The psox sample was directly solubilized and alkylated by sonicating the pellet in 500 l of 5% sds, 1 mm edta, 20 mm nem (sigma) in 0.5 m tris - cl ph 8.3 . The alkylation was allowed to proceed for at least 20 min before the sample was transferred to 80c . Thiol and disulfide species in tca supernatant and tca pellet fractions were quantified as described in . Briefly, psh samples were solubilized in 5% sds, 1 mm edta in 0.4 m sodium citrate, ph 4.5 and protein thiols were quantified by the addition of 4-dps (sigma) to a final concentration of 0.5 mm followed by hplc analysis . For quantification of psox, samples alkylated with nem were reduced by the addition of bh (sigma) to a final concentration of 3.3% (w / v). Prior to quantification with 4-dps, bh was destroyed by the addition of hcl, as described in . Total ps was quantified by solubilizing the pellet in 5% sds, 1 mm edta, and 0.5 m tris - cl ph 8.3, reducing all thiols with bh, followed by thiol quantification with 4-dps . The pssg sample was solubilized in 6 m urea, 8 mm edta, and 200 mm bicine ph 9.2 . Disulfides were reduced with 2.1 mm thp (calbiochem) and thiols were derivatized by the addition of 6.4 mm sbd - f (fluka) for 1 hour at 60c . To compare samples, total protein content was determined by using a ninhydrin based assay . An hplc assay based on thiol derivatization with n-(1-pyrenyl)maleimides (fluka) was used to quantify gssg and total gs (gsh + gssg) from the supernatant as described in . For quantification of secreted glutathione, proteins in media from harvested cells were precipitated by the addition of tca to 10% (v / w) and incubated on ice for 30 minutes followed by centrifugation.
Cutaneous horn (synonyms; cornu cutaneum: cornu humanum) is a conical, hyperkeratotic protrusion that often resembles an animal horn . The term cutaneous horn is a morphologic designation referring to unusually cohesive keratinized material and not a true pathologic diagnosis . The earliest documented case of cutaneous horn, or cornu cutaneum, was that of an elderly welsh woman in london who was displayed commercially as an anomaly of nature in 1588 . There were several other accounts of cutaneous horns in the sixteenth and seventeenth centuries, including those described by danish anatomist thomas bartholin in 1670 . Illustrations from that time portray these growths as grotesque, and numerous natural and supernatural theories arose regarding their etiology . For centuries cutaneous horns have been a subject of curiosities and controversies . In the late eighteenth century, the london surgeons everard home and his brother - in - law john hunter are generally credited with the characterization of cutaneous horns as a medical disorder . Though cutaneous horn has been described at various sites, horn over the penis is very rare and represents the most unusual site . The first case report of a penile horn was published as early as 1854 . Since then there has been sporadic reporting of cases by dermatologists, surgeons and urologists mainly for curiosity and various conditions which may present as a penile horn . Cutaneous horn occurs mainly in individuals who are above 50 years of age and penile horns are no exception to this rule . They are common in males after 50 years and probably coincide with the age group of occurrence of penile cancer . To this date lowe and mc cullogh reported that penile horn may be benign in 4256% of cases, premalignant in 2237% or frankly malignant in 2022% . Cutaneous horn is a morphologic designation for a protuberant mass of keratin produced by unusual cohesiveness of keratinized material . It is rather intriguing to note that why only few patients develop penile horn when compared with other patients with similar disease . The roles of chronic irritation, phimosis, surgical trauma and radiotherapy that have been implicated in penile horn formation have also been found to predispose to carcinoma penis . The emphasis is on the long - standing phimosis with chronic, prolonged preputial inflammation; however, it has also been seen in circumcised men . Adult circumcision has been found to precede horn formation by a period ranging from 2 weeks to a year . The analysis of the cases reported so far do not reveal any common factor that predisposes to the development of horn over the underlying pathology . The occurrence of horn in different disorders ranging from benign viral disease to malignant carcinoma further augments the view that the keratinous growth probably represents a reactionary event, which does not depend on the underlying pathology . Pseudoepitheliomatous, keratotic and micaceous balanitis is another rare disease, which has been found to be associated with penile horn . It was, originally described by jacob and civatte who considered it to be benign . Similarly, verrucous carcinoma is another tumor which has been found to be associated with penile horn . This tumor is a highly keratinizing tumor, and this probably predisposes for penile horn formation . The progression of cutaneous horn to malignancy though has been reported probably represents the manifestation of underlying tumor . Causes of penile horn the role of human papillomavirus (hpv) in penile carcinoma is well studied . The hpv 16 and 18 are implicated as the causative agents . In penile horns that arise from malignancies such as verrucous carcinoma, penile horns present as elongated, keratinous, white or yellowish projections that range from a few millimeters to centimeters in size arising from the glans penis [figures 1 and 2]. Traumatic breakage of the horn is rare and can occur due to the projectile nature of the growth . Hard keratotic mass arising from glans penis the patients seek treatment for the disfigurement and difficulty posed during intercourse . In general horns arising from malignant lesions tend to be harder on their bases due to the inflammatory process . Their surface is rough, irregular, laminated or fissured, the ends pointed, blunt or clubbed . The color varies; it is usually grayish - yellow, but may be even blackish . Commonly they are small in size, a fraction of an inch or an inch or thereabouts in length, but exceptionally attain considerable proportions . The base, which rests directly on the skin, may be broad, flattened, or concave, with the underlying and adjacent tissues normal or the papill hypertrophied; and in some cases there is more or less inflammation, which may be followed by suppuration . They are, as a rule, painless but become painful when knocked or irritated . The histopathology of the cause is diagnostic in most cases . From the histopathological point of view cutaneous horn can be classified as benign, premalignant and malignant based on the origin . It consists of closely agglutinated epidermic cells, forming small columns or rods . In the columns they have their starting - point in the rete mucosum, either from that lying above the papilla or that lining the follicles and glands . Keratinous mass overlying the epidermis (40) part two is the underlying pathology beneath the keratotic mass . Though histopathology is diagnostic certain other investigations are required particularly in patients with underlying malignancy . Approximately one - third of penile cutaneous horns are associated with an underlying malignancy, and so magnetic resonance imaging is helpful when there is uncertainty regarding the depth of infiltration or proximal extension . As kaposi noted more than a century ago, cutaneous horns can be removed by simple detachment and cauterization of the papillary base . Stage one is establishing the diagnosis and next stage is a definitive treatment based on the histopathology . Penile horn can hide either benign or malignant lesions . Therefore, what is really important is not the cutaneous horn itself, but the subjacent disease . Hence, it is justifiable to perform a local surgical excision for the histopathological diagnosis of its base . A wide local surgical excision is performed on the lesion in case of suspected malignancy to obtain the histopathological diagnosis . Though various methods including electrosurgical excision, laser and cryosurgery, have been described as effective laser therapy with carbon dioxide or neodymium: yttrium aluminum garnet laser leaves lesser scarring with more cosmetic results . They are not preferred as they alter the histopathology of the lesion . In case of a benign lesion, excision of the horn would suffice . In case of verrucous carcinoma, wide local surgical excision should be followed up regularly . If the biopsy reveals squamous cell carcinoma, the treatment of choice is partial or complete penectomy with urethral diversion and perineal urethrostomy . The penile horn continues to fascinate the dermatologists and surgeons alike because of the morphological appearance and presentation . The penile horn is only a morphological entity and the true pathology masked by it.
The turnover rate (employee separations) of healthcare workers has created a cycle of exhaustion and discontent . High turnover affects the institution's ability to consistently provide high - quality care and increases institutional costs related to the recruitment, orientation, and lower productivity of newly hired staff . This is an oklahoma university medical system (oums) performance improvement educational intervention study . We will use a 5-year longitudinal design with repeated measures to examine the effect of diffusion of the heartmath healthcare program revitalizing care techniques within oums . The variables include pre and post training scores on the personal and organizational quality assessment questionnaire (poqa - r), scores on the independently administered oums annual employee engagement survey, and separations from oums as reported by the human resources department as turnover rates . The training sessions included a 5-hour presentation with a 2-hour follow - up program provided 2 or more weeks later . Participants received an emwave2 training reinforcement device to use during the time period between the first training and the follow - up training . Data from the emwave2 will provide personal reinforcement to the user and will not be collected or analyzed by the investigators . The most significant measured result noted after training 90% of the nursing leadership, vice presidents, directors, and managers and 93% of the oncology staff was the continued decline of the turnover rate to <14% for the overall oncology oums service line within the first year of the program being instituted . This was an improvement from a 2009 high of 73% for one of the oncology service lines with a 34% at the time of training, when newly hired people were beginning to leave again, plateauing and even increasing the rate at that time . Engagement scores for the oncology unit improved from the previous year, and the poqa scores for both the leadership group and the oncology group showed many significant improvements during the time of measurement.
Whenever lesions in the ascending aorta and aortic arch have from direct aortic cannulation, arterial cannulation via the femoral artery has been used for a long time . However, because retrograde aortic dissection and nonperfusion into the true lumen are possible, the technique of selective antegrade perfusion under deep hypothermia using the axillary artery has become a standard perfusion method . Axillary artery cannulation, however, has some drawbacks, including technical problems . Limitations of deep hypothermia have also been reported . The benefits of using selective perfusion under moderate hypothermia for brain protection have been reported in recent years . Reported that cannulation via the brachial artery, instead of the axillary artery, could be useful for a good operative field, a short operation time, and brain protection . Methods for protecting the brain during surgeries of the ascending aorta and the aortic arch have been developing, but remain controversial . Antegrade perfusion via the axillary artery shows better results than retrograde perfusion via the femoral artery; nevertheless, both of them have benefits and drawbacks . We tried to use antegrade and retrograde perfusion at the same time, with the aim of avoiding the fatal problems of either method alone . Also we expected the brachial artery approach to be easier than that of the axillary artery . We report our clinical experiences using the ascending aorta and aortic arch replacement with perfusion via the brachial and femoral arteries under moderate hypothermia . Forty - six consecutive patients underwent replacements of the ascending aorta and aortic arch between july 2005 and may 2010 . We reviewed 36 patients who had been operated using a perfusion method via the right brachial and femoral artery under moderate hypothermia . Ten patients were excluded because deep hypothermia or two cerebral perfusions including the left common carotid artery were used . We analyzed the preoperative diagnoses, operations, cardiopulmonary bypass time, selective antegrade cerebral perfusion time under circulatory arrest, lowest core temperature, operation mortality rate, and neurologic deficits by retrospectively reviewing the medical records . We defined the postoperative neurologic states showing delirium, irritability, or confusion during the postoperative days with normal brain computed tomography or mri findings as minor neurologic dysfunction, and the states among the above with definite lesions in brain ct or mri, or motor dysfunctions, as major neurologic dysfunction . We positioned the patients in supine position with the right arm abducted, and made incisions in the right axillary and inguinal area to expose the right brachial and the femoral artery at the same time in the manner by tasdemir et al . . After performing a median sternotomy and exposing the aorta and heart, we administered heparin and inserted cannulae into the right brachial and femoral artery . We directly inserted a 12-fr cannula (fem - flex ii, edwards lifesciences, usa) into the brachial artery, or an anastomosed 8-mm graft (intergard, intervascular, usa) to the brachial artery in an end - to - side manner when it was small . We directly inserted an 18-fr cannula (fem - flex ii, edwards lifesciences, usa) into the femoral artery . By reviewing the preoperative ct, we decided to use the femoral artery, which was connected to the true lumen . We connected the cardiopulmonary bypass circuit to the two cannulae using a y - shaped tube . Venous cannulae were inserted into the ivc and svc . With the cardiopulmonary bypass running and the rectal temperature lowered to 24, we stopped femoral artery perfusion and maintained 40% of total perfusion via the right brachial artery . After blocking the aortic arch vessels with vascular clamps, we performed aortotomy and directly infused cardioplegic solution into the coronary artery ora . Without clamping, we anastomosed the distal aorta, which was open, to a prosthetic bypass graft in an end - to - end manner . We anastomosed the aortic arch vessels, including the innominate artery, to the side of the prosthetic graft in the shape of an island simultaneously or to the prosthetic graft with 4 branches (intergard, maquet gmbh & co., germany) in an end - to - end manner, according to the range of the lesions . After finishing the anastomoses of the aortic arch, we anastomosed a 10-mm sized prosthetic graft to the side of the prosthetic graft in an end - to - side manner and used it as an arterial perfusion line . We then clamped the proximal side and started perfusion antegradely . While raising body temperature, we performed proximal anastomosis of the aorta . We verified that cerebral oxygen saturation (cerebral oximeter, invos monitor rs 232, somanetics, usa) was constantly maintained at a certain standard during the entire operation, including during cerebral perfusion . The mean age of the patients was 61.9 years (29 to 79 years), and 19 were male and 17 were female . The preoperative diagnoses were acute type a aortic dissection in 31 (86%) patients, and aortic aneurysm without dissection in 5 (14%) patients . There were 3 patients who were in preoperative shock with a creatinine level elevated to over 2.5, showing renal dysfunction (table 1). We performed ascending aorta replacement in 9 cases (25%), ascending aorta and hemiarch replacement in 13 cases (36%), ascending aorta and total arch replacement in 13 cases (36%), and total aortic arch replacement in 1 case (3%). Operations which were performed simultaneously were a coronary bypass graft in 3 cases, aortic valve replacement in 2 cases, and aortic root reimplantation in 1 case . Mean cardiopulmonary bypass time was 209.485.1 minutes, and selective antegrade cerebral perfusion time under the circulatory arrest was 36.124.2 minutes . Five patients died within the first 30 days after operation (mortality rate, 13.8%). The causes of death were diffuse hypoxic brain damage in 1, acute myocardial infarction in 1, mediastinitis in l, bleeding in 1, and low cardiac output in l. there were 2 (5.5%) cases of minor neurologic dysfunction defined as delirium, irritability, or confusion during the postoperative days without brain ct and mri abnormalities . There were 6 (16.6%) cases of major neurologic dysfuction, with patients showing motor dysfunction or definite brain lesions in brain ct or mri . Diffuse hypoxic brain damage occurred in 1 patient, left brain infarction in 3 patients, and right brain infarction in 2 patients . Of the 6 patients who had major neurologic dysfunctions, 3 patients had preoperative unconsciousness or brain infarction . Other complications were one case of reoperation due to bleeding, one case of mediastinitis and one case of vocal cord palsy . There were no complications related to the cannulation of the right brachial artery in the axillary area . In 3 cases, perfusion techniques for protecting the brain during surgeries of the ascending aorta and aortic arch have been controversial for a long time, but are constantly being developed . The complementary addition of retrograde cerebral perfusion has produced better operation results . Though this technique continues to be used widely, has shown through animal experiments that retrograde cerebral perfusion cannot supply complete perfusion to brain tissues . For this reason, surgeries using antegrade perfusion techniques started to be reported, demonstrating good operative results . Recently, selective antegrade cerebral perfusion using the axillary artery became a standard perfusion technique for performing ascending aorta and aortic arch operations [1,13 - 15]. A wide review of the literature shows that axillary artery cannulation has produced better results in the protection of the brain than the femoral artery cannulation . However, gulbins et al . Pointed out that there is a lack of evidence for the axillary artery to be recommended as a standard cannulation site . Direct cannulation into the femoral artery in acute type a aortic dissection can cause retrograde dissection or malperfusion to the true lumen . Dissection of the innominate artery may also occur during axillary artery cannulation, as imanaka et al . We therefore tried to perform antegrade and retrograde perfusion simultaneously, in order to provide against the fatal shortcomings of each approach . Applying deep hypothermia requires ample time to raise and lower the temperature and may cause some side effects . Wilde reported that deep hypothermia could keep coagulation down, and change the components of blood . Cooper et al . Reported that deep hypothermia could suppress the function of vascular endothelial cells and be involved in cell death, consequently bringing about multiple organ dysfunction . To avoid the drawbacks of deep hypothermia, some trials used selective cerebral perfusion under moderate hypothermia, resulting in excellent brain protection . We performed surgeries while lowering the core temperature to around 24, but we did not block cerebral perfusion during the entire time of operation . This allowed us to perform operations without the concern of brain damage, and required little time for raising and lowering the core temperature and for cardiopulmonary bypass . There were 3 cases of renal dysfunction, which we believe to be related to preoperative renal dysfunction due to shock, and to be independent of the temperature during operation . Reported that using the brachial artery instead of the axillary artery for arterial cannulation could provide a good operative field, save operation time, and show good brain protection . It took 10 to 15 minutes to cannulate the artery directly and 25 to 30 minutes to connect a prosthetic graft to the brachial artery when it was very small . According to our experiences, the cannulation of the brachial artery was easier and supplied a cleaner operative field than that of the axillary artery . The incidence of major cerebral dysfunctions was a bit higher (6 cases, 16.6%). This resulted from our inclusion of 3 cases in which the state of preoperative unconsciousness or brain infarction could have been identified . There was diffuse hypoxic brain damage in 1 case, left brain infarction in 3 cases, and right brain infarction in 2 cases, so we supposed that only right cerebral perfusion might not be the cause of brain damage . The mortality rate (13.8%) was also higher than in previous studies, resulting from a higher rate of acute aortic dissection in our study group . Even though methods of brain protection for ascending aorta and aortic arch operations are continuously progressing, there is still much debate about which sites are good to cannulate for arterial access, and to what degree it would be effective and safe to lower temperatures . . Noted that additional methods for brain protection are needed, since cerebral perfusion through the right axillary artery cannot supply enough perfusion to the left brain hemisphere in some people, pointing out that the development of circle of willis could be incomplete embriologically . Kazui et al . Suggested the " kazui technique ", in which antegrade cerebral perfusion is performed with catheters inserted into the three aortic arch branches during aortic arch replacement . Olsson and thelin suggested bilateral cerebral perfusion via the right axillary artery and the left common carotid artery by inserting a supplementary catheter into the left common carotid artery during circulatory arrest . The authors have also inserted supplementary catheters into the left common carotid artery and the left subclavian artery recently, and will be reporting the results . Using the right brachial and the femoral arteries as routes for arterial access under moderate hypothermia showed satisfactory results when there were lesions which made direct cannulation into the ascending aorta difficult during ascending aorta and aortic arch replacements . Further studies are needed for to improve bilateral cerebral perfusion for more complete brain protection.
The risk revolution is one of the most significant advances that have occurred in medicine over the past decades . In the current state of incomplete knowledge of most human diseases, the probabilistic approach allows us to make accurate predictions for a group of individuals presenting with specific attributes or exposures . Risk assessment has become increasingly important in the prevention of chronic diseases and has recently been applied to oral diseases due to the realization that severe forms of the two most prevalent dental diseases, i.e., caries and periodontal disease are clustered in a minority of the population who are hypothesized at being at higher risk . Consequently, a new paradigm emerging to control dental disease involves identification and targeting high risk individuals and intercepting the disease process . Cigarette smoking has long been associated with a variety of oral conditions including periodontal diseases . Experimental evidence accumulated over the last two decades has indicated that cigarette smoking is a true risk factor for periodontitis . Smokers have both increased prevalence and more severe extent of periodontal disease compared to non - smokers . Tobacco and some of its volatile and non - volatile components have been found to affect human gingival fibroblasts . Among the multiple volatile components, some reactive aldehydes are thought to have a prominent cytopathic effect, resulting in a dose dependent human gingival fibroblast inhibition of cell adhesion related to morphological alteration of cytoskeletal structure . Acrolein, a very reactive compound is a volatile flammable liquid with a pungent, choking disagreeable odor . In cigarettes, experimental data suggests that acrolein is detrimental to human gingival fibroblasts (hgf) survival and consequently to the oral connective tissue . They are well recognized to have a high cytotoxic and genotoxic effect on cultured human bronchial epithelial cells and fibroblasts, as well as on human skin fibroblasts . This in vitro study is focused on the toxic nature of a volatile smoke component - acrolein on the proliferation and attachment of human gingival fibroblasts . Human gingival fibroblasts (hgf) strains from healthy subjects with non - inflamed gingiva which did not bleed on probing were utilized . A split thickness flap was raised at the donor site using bard parker no-15 and careful dissection was carried out [figure 1a]. A conventional method was preferred over punch biopsy to delineate the epithelium from the underlying connective tissue . The biopsy tissue was collected in the sterile test tube containing dulbecco's modified eagle's medium (dmem) and transported to the laboratory . (a) procuring gingival connective tissue; (b) human gingival fibroblast in a mono layer; (c) human gingival fibroblasts - acrolein treated (1:100000 molar); (d) human gingival fibroblasts - acrolein treated(1:10000 molar) after 3 washes in dmem supplemented with gentamycin, the tissues were minced into small pieces plated in petri dishes . Trypsin - versene - glucose (tvg) solution containing 0.25% trypsin was added and incubated at 37c for 2 hours . The tvg was discarded, and the cells resuspended in dmem containing 10% fetal calf serum (fcs), and were then seeded into 25 cm tissue culture flask and incubated at 37c in an atmosphere of 5% co2 . The confluent layer of cells obtained was designated as first passage cells . Human gingival fibroblasts were seeded in 96 well microtitration plate at a density of 45,000 cells / well in dmem containing 10% fcs . About 24 wells seeded with 45,000 cells per well formed the sample group wherein three groups of 8 wells were treated with 10, 310 and 10 m acrolein respectively in an atmosphere of 5% co2 and at a temperature of 37c . Untreated cell cultures, obtained from the same biopsies as the test fibroblast cells, were utilized as the control group and the acrolein treated cells were considered as the study group . The attached cells at each of the different concentrations of acrolein were removed with 0.25% trypsin and evaluated by a neubauer hemocytometer . Human gingival fibroblasts were seeded in 96 well microtitration plates at a density of 10,000 cells / dish in dmem with 10% fcs . Cells were incubated for 24 hours at a temperature of 37c in an atmosphere of 5% co2 to allow attachment to the plate . Culture wells were rinsed once to remove unattached cells and the culture medium was changed to fresh dmem with 10% fcs at 37c . Cell cultures were incubated in the presence of 10 310, 10, 310 and 10 concentrations of acrolein . The wells were trypsinized (0.25%) to remove the cells and then counted using a hemocytometer . The suspension was mixed thoroughly to disperse the cells and a small sample (20 l) was collected into the tip of a pasteur pipette and transferred to the edge of the hemocytometer chamber . The cells lying within this 1 mm area were counted and analyses was made using the formula c = n / v where c is the cell concentration (cells / ml), n is the number of cells counted and v is the volume counted (ml). A total of 5 squares were counted using a slide of depth 0.1 mm and an area of 1 mm and values obtained using the equation c = n10/5 . The cell cultures were studied for morphology before counting, using an inverted phase contrast microscope (leica, w. germany) and photomicrographed . Human gingival fibroblasts between 3 to 6 passages were grown to confluency . For the attachment assay, the cell cultures seeded in a 96 well microtitration plates at a density of 45,000 cells / well . They were then incubated at concentrations of 10 (c1), 310 (c2), 10 (c3) acrolein in an atmosphere of 5% c02 and at a temperature of 37c . The proliferation assay that was carried over a 5-day period incubated cells at concentrations of 10 (c1), 310 (c2), 10 - 5 (c3), 310 - 6 (c4), 10 - 6 (c5) acrolein in an atmosphere of 5% co2 and at a temperature of 37c . A total of 5 squares were counted and the concentration of human gingival fibroblast was evaluated using the formula c = n10/5 for 1 ml of suspension . In the present study, geometric mean and standard deviation were estimated for each study group after log transformation . The mean values were compared by one - way analysis of variance (anova) and further multiple range tests by tukey's- honestly significant difference (hsd) were employed to identify the significant groups at 5% level . A split thickness flap was raised at the donor site using bard parker no-15 and careful dissection was carried out [figure 1a]. A conventional method was preferred over punch biopsy to delineate the epithelium from the underlying connective tissue . The biopsy tissue was collected in the sterile test tube containing dulbecco's modified eagle's medium (dmem) and transported to the laboratory . (a) procuring gingival connective tissue; (b) human gingival fibroblast in a mono layer; (c) human gingival fibroblasts - acrolein treated (1:100000 molar); (d) human gingival fibroblasts - acrolein treated(1:10000 molar) after 3 washes in dmem supplemented with gentamycin, the tissues were minced into small pieces plated in petri dishes . Trypsin - versene - glucose (tvg) solution containing 0.25% trypsin was added and incubated at 37c for 2 hours . The tvg was discarded, and the cells resuspended in dmem containing 10% fetal calf serum (fcs), and were then seeded into 25 cm tissue culture flask and incubated at 37c in an atmosphere of 5% co2 . The confluent layer of cells obtained was designated as first passage cells . Human gingival fibroblasts were seeded in 96 well microtitration plate at a density of 45,000 cells / well in dmem containing 10% fcs . About 24 wells seeded with 45,000 cells per well formed the sample group wherein three groups of 8 wells were treated with 10, 310 and 10 m acrolein respectively in an atmosphere of 5% co2 and at a temperature of 37c . Untreated cell cultures, obtained from the same biopsies as the test fibroblast cells, were utilized as the control group and the acrolein treated cells were considered as the study group . The attached cells at each of the different concentrations of acrolein were removed with 0.25% trypsin and evaluated by a neubauer hemocytometer . Human gingival fibroblasts were seeded in 96 well microtitration plates at a density of 10,000 cells / dish in dmem with 10% fcs . Cells were incubated for 24 hours at a temperature of 37c in an atmosphere of 5% co2 to allow attachment to the plate . Culture wells were rinsed once to remove unattached cells and the culture medium was changed to fresh dmem with 10% fcs at 37c . Cell cultures were incubated in the presence of 10 310, 10, 310 and 10 concentrations of acrolein . The wells were trypsinized (0.25%) to remove the cells and then counted using a hemocytometer . The suspension was mixed thoroughly to disperse the cells and a small sample (20 l) was collected into the tip of a pasteur pipette and transferred to the edge of the hemocytometer chamber . The cells lying within this 1 mm area were counted and analyses was made using the formula c = n / v where c is the cell concentration (cells / ml), n is the number of cells counted and v is the volume counted (ml). A total of 5 squares were counted using a slide of depth 0.1 mm and an area of 1 mm and values obtained using the equation c = n10/5 . The cell cultures were studied for morphology before counting, using an inverted phase contrast microscope (leica, w. germany) and photomicrographed . Human gingival fibroblasts between 3 to 6 passages were grown to confluency . For the attachment assay, the cell cultures seeded in a 96 well microtitration plates at a density of 45,000 cells / well . They were then incubated at concentrations of 10 (c1), 310 (c2), 10 (c3) acrolein in an atmosphere of 5% c02 and at a temperature of 37c . The proliferation assay that was carried over a 5-day period incubated cells at concentrations of 10 (c1), 310 (c2), 10 - 5 (c3), 310 - 6 (c4), 10 - 6 (c5) acrolein in an atmosphere of 5% co2 and at a temperature of 37c . A total of 5 squares were counted and the concentration of human gingival fibroblast was evaluated using the formula c = n10/5 for 1 ml of suspension . In the present study, geometric mean and standard deviation were estimated for each study group after log transformation . The mean values were compared by one - way analysis of variance (anova) and further multiple range tests by tukey's- honestly significant difference (hsd) were employed to identify the significant groups at 5% level . The human gingival fibroblast attachment evaluated at three hours indicated that acrolein caused a dose dependent inhibition of cell attachment [table 1]. At low concentration of acrolein (10 - 5) as the concentration of acrolein increased (10 - 4), the cells rapidly lost their attachment capacity [table 2]. The number of cells attached / well decreased from a mean value of 29,930 in c3 group (10 - 5) to 20,505 in c1group (10) also the mean values in c3 (29,930) and c2 (27,441) were significantly higher compared to c1 (20,505) [table 3]. In the present study, the human gingival fibroblast proliferation evaluated at five days indicated that the untreated cell cultures (control group) proliferated from 10,000 cells / well to an average of 29,697 cells / well [table 4, figure 2b]. In the acrolein treated cell cultures (study group), the proliferation ability decreases from 21,184 cells / well in the c5 (10) group to 10,154 in the c1 (10) group [table 5]. Further statistical evaluation indicates that: the mean value in the control group (29,697) is significantly higher than the mean values in the study group.the mean values of c5 (21,184) and c4 (20,068) are significantly higher than the mean values in c3 (16,691), c2 (16,244) and c1 (10,154).further the mean values of c3 and c2 are significantly higher than c1 [table 6]. Thus a dose - dependent inhibition of proliferation is seen and at very high concentration (10) of acrolein a complete inhibition of proliferation is noted . The mean value in the control group (29,697) is significantly higher than the mean values in the study group . The mean values of c5 (21,184) and c4 (20,068) are significantly higher than the mean values in c3 (16,691), c2 (16,244) and c1 (10,154). Further the mean values of c3 and c2 are significantly higher than c1 [table 6]. Thus a dose - dependent inhibition of proliferation is seen and at very high concentration (10) of acrolein a complete inhibition of proliferation is noted . Human gingival fibroblast attachment in acrole in treated cell cultures (study group) (a) dose - related effects of acrolein on human gingival fibroblast attachment; (b) dose - related effects of acrolein on human gingival fibroblast proliferation mean, standard deviation and test of significance of mean values between different study groups for attachment assay (one - way anova) mean, standard deviation and test of significance of mean values between different groups for attachment assay (tukey- hsd) human gingival fibroblast proliferation in acrolein treated cell culture mean, standard deviation and test of significance of mean values between different groups for proliferation assay (one - way anova) mean, standard deviation and test of significance of mean values between different groups for proliferation assay human gingival fibroblasts seen in the control group are spindle shaped, oriented in a parallel manner forming a cohesive layer [figure 1b]. In contrast, the test group shows disruption of the fibroblast cytoskeleton leading to loss of shape and orientation . There is a dose dependent increase in vacuolisation and degeneration of the nucleus observed [figure 1c and d]. Periodontal diseases are opportunistic infections caused by specific periopathogenic microorganisms and their metabolic products . The onset, progress, and severity are determined by the individual host response modulated by various factors . The current complex model maintains a bacterial etiology taking into consideration individual susceptibility as well as environmental and host response influences . The current list of risk indicators and putative risk factors is being shaped by ongoing research efforts, and multiple attributes and exposures have been associated with increased odds of periodontitis . This has led to the current understanding that periodontitis is a multifactorial disease whose clinical manifestations are the result of specific interactions between particular genetic susceptibility traits and environmental factors . Experimental evidence accumulated over the last two decades has indicated that cigarette smoking is a true risk factor for periodontitis . Tonetti has indicated that this environmental exposure has been associated with 2 - 3 fold increase in the odds of developing clinically detectable periodontitis . Regression analyses done by zambon et al ., have shown that the relative risk of attachment loss among 25 - 74 year subjects with a history of moderate smoking was 2.77 and 4.75 for heavy smokers . Periodontal disease is the result of an imbalance between tissue destruction and repair . In health, fibroblasts are responsible for the production and maintenance of the connective tissue matrix . They are the predominant cells of the periodontal ligament and have an important role in the development, function and regeneration of the tooth support . In consideration of the important role played by fibroblasts in the periodontal ligament homeostasis, they have been described by tencate as the architect, builder, and caretaker of the periodontal ligament . In recent years, many clinical and epidemiological studies have indicated that cigarette smoking significantly increases the risk factor for periodontal disease, especially in younger people . Haber et al ., have demonstrated that the noxious effect of cigarette smoking, rather than poor oral hygiene and increased plaque, act directly on periodontal tissues . Evidence indicates that tobacco and some of its volatile and non - volatile components have been found to affect many types of cells including gingival fibroblasts . Among the volatile components of cigarette smoke some reactive aldehydes have a prominent cytopathic effect . Grafstrom et al ., have recognized them to have a high cytotoxic and genotoxic effect on cultured human bronchial epithelial cells and fibroblasts, and inhibit both fibroblast - mediated gel contraction and fibronectin production . Acrolein, one subtype of several aldehydes present in cigarette smoke is a very reactive volatile compound . In cigarettes, acrolein being a cytotoxic agent induces microtubule depolymerisation, and triggers feedback inhibition of new tubulin synthesis affecting cell adhesion and proliferation . The adhesion capacity and organization of the cytoskeleton microtubules and vimentin associated filaments in cultured human gingival fibroblasts, we examined the attachment, proliferation and morphology of human gingival fibroblasts in culture after exposure to acrolein . For this study,, recognized that it is present in small, but significant or toxic quantities in cigarette smoke . Human gingival fibroblast strains from healthy subjects with non - inflamed gingiva who were never exposed to tobacco were included in the study . The criteria for selecting the particular age group was based on studies by haber and monterio da silva which have indicated that cigarette smoking significantly increases the risk factor for periodontal disease especially in younger people . These results are in agreement with the study done by rota who stated that acrolein caused a dose - dependent inhibition of human gingival fibroblast adhesion strictly related to the morphological alterations of cytoskeletal structures, and by cattaneo who stated that acrolein caused a dose dependent inhibition of human gingival fibroblast attachment and proliferation when subjected to different concentrations of acrolein ranging from 10 to 10 . Further evidence is obtained from a study by poggi, which indicated that acrolein produced a dose - dependent decrease in cell replication and adhesion by causing a disruption of microtubules, vimentin intermediate filaments and actin filaments . Thus, maurizio s. tonetti stated that although no direct causative role of cigarette smoke on periodontal diseases has been proven, a connection is considered to be plausible . This study confirms the hypothesis that cigarette smoke is a significant risk factor in the development and progression of periodontal disease and impairs the ability of gingival fibroblasts to maintain the integrity of the periodontal connective tissue.
Despite significant advances in our understanding of paediatric pain and the publication of pain management guidelines by several leading paediatric bodies in recent years, multiple studies and reviews show that pain in children continues to be poorly managed . As maclean et al . (2007) note, there remains a gap between what we know to be effective, easily implemented pain management strategies, and what is actually practiced . Given these findings are based on their review of pain management practices in a paediatric teaching hospital in a high income country, it is perhaps not surprising this gap is larger in low income countries where resources, in their broadest sense, are more constrained . Some barriers to managing a child's pain are common to a wide variety of health care settings, such as lack of provider training in the recognition, assessment and management of pain, and attitudes and beliefs regarding pain and its management . Other barriers likely play a significant role mainly in low income countries where resources in terms of manpower, equipment, and medications, are in chronic short supply and must be balanced across the competing needs of patients presenting to providers practicing in these settings . Despite these issues, given the current state of knowledge in this area, and the wide variety of options now available for managing paediatric pain, many of these barriers can be overcome through adaptation of published guidelines to address the unique needs and barriers of specific health care settings . This paper describes the development of a paediatric analgesia and sedation protocol, tailored to the specific setting of the medical research council (mrc) paediatric ward in the gambia, west africa . Although a combined paediatric and adult protocol was ultimately developed, only the paediatric portion is reported here . For clarity of presentation, the protocol development process will be described in 3 steps . However, it is important to note, that an iterative process was employed beginning with a recognized need to improve pain management expressed by local clinical staff, and with feedback from local providers sought and incorporated throughout the development process . As noted above, protocol development began with an expressed desire for a pain management protocol tailored to the mrc paediatric ward, to facilitate efforts by clinical staff toward improving pain management . As a first step, key local informants including the senior clinician of the hospital, the matron, and another senior nurse, were interviewed to gain a comprehensive understanding of the hospitals resources, current practices and staff level of training, medication availability, and cost implications . Two important considerations emerged from this consultation process, which were shortage of airway support capabilities and limited staff training in pain assessment and monitoring . To further assess the airway capabilities on the ward, sufficient airway equipment was located to organize two complete airway kits, which included oral airways, bag - valve - masks, intubation medications and equipment . Discussions with physician and nursing staff, revealed both had little training or experience in pain management . For this reason it was felt that a more directive and structured protocol, with a strong educational component to accompany roll out of the protocol was needed . The second step in development of the protocol began with a review of published paediatric analgesia and sedation guidelines, the evidence base for their development where possible, and consultation with experts in paediatric sedation and analgesia . As most published guidelines were developed in and for high income health care settings, during the review process and again in consultation with key local informants a list of issues relevant to paediatric pain management on the mrc ward was identified . Concerns were identified with respect to several unique attributes of the gambian population, specifically the relative high prevalence of hemoglobinopathies [3, 4] and under - nutrition particularly in the first 2 years of life . It was notable that despite the importance of cultural in perceptions and beliefs with respect to pain, no cultural issues were identified as important to pain management efforts in this setting . Hemoglobinopathies, like sickle cell anemia and glucose-6-phosphatase deficiency (g6pd), are relatively common in the gambia [3, 4] and present challenges for managing pain . Many established guidelines and experts recommend against sedation in sickle disease patients, and sickle trait patients with low oxygen saturations, unless anaesthesia is in attendance . Given anaesthesia support is not available at the mrc, these were included as absolute contraindications to sedation in the mrc protocol . Of additional concern is the potential for local anaesthetic induced methemoglobinemia . For a variety of reasons, including effectiveness, hemodynamic safety requiring no special monitoring, and availability of inexpensive preparations, local anaesthetics are ideal for management of brief painful procedures . While a variety of local anaesthetics have been reported to induce methemoglobinemia, reported cases have occurred mainly in very young infants or where excessive quantities of topical anaesthetic are used . Although an uncommon complication and relatively easily managed in the general population with methylene blue, treatment of methemoglobinemia is significantly more complicated in individuals with g6pd deficiency where methylene blue can cause acute hemolysis and more intensive care, including exchange transfusions, may be required . Given the high incidence of g6pd in the gambian population, cost and time required for testing, and potential for this serious complication whose treatment is beyond the resource capacity of the setting, use of topical anaesthetics was strictly limited to children at least 6 months of age and within recommended dosing guidelines . Guidelines and experts generally recommend 3 months of age corrected for prematurity; however, given the prevalence of under - nutrition and difficulties in accurately assessing both age of gestation and date of birth in this setting, the age restriction was broadened to ensure minimum safety guidelines were observed . Based on the findings of the first two stages of protocol development outlined above, a draft protocol was created and circulated to key local informants and an expert in paediatric pain management for feedback and amendment . Perhaps not surprising considering the iterative nature of the development process, with the exception noted below, no major changes were suggested . At this stage the draft appeared as a numbered list of process steps with considerations at each step outlined within the section . For example, within the analgesia section, all available options were listed with their indications, contraindications, and dosages . While this format was modelled after other published protocols, and meant to emphasize options and provider choice, feedback from key local informants suggested that a more limited and algorithmic approach, presented as a flow chart would facilitate adoption of the protocol, particularly early on in the course of the campaign to improve pain management . Based on this feedback the protocol was reworked into a flow chart (see figure 1), with the original protocol with small amendments included as a detailed reference or guide . The amended draft was again circulated to key local informants and the pain management expert, with no further revisions suggested . As a final step in the development of the protocol, the protocol was presented to the physician group at academic rounds, and at a staff meeting to the nursing and health attendant staff, with minor changes to the protocol incorporated as a result of feedback from these sessions . In addition to the final product, that is, the paediatric pain management protocol tailored to the mrc ward, other benefits were gained through the process of development . As a result of the equipment survey, two airway kits were created and placed together with other basic resuscitation equipment into a strategic location within the unit for ready access . Equally important is early evidence that through the educational and feedback sessions, further interest in improving patient care was fostered among clinical staff . As one physician reported i encountered a case today where i would normally not have considered pain management, but after the session the other day, i decided i better do something . As clemmer and spuhler (1998) have argued, the purpose of creating protocols is greater than reducing practice variation, it also creates new paradigms and changes the culture in which health care is delivered, with the protocol itself designed to be transient, and the development process and the changes it produces, more important than the product itself . However, to ensure successful implementation of the protocol and ongoing improvements in paediatric pain management, further steps are needed . Ongoing education of clinical staff, particularly early in the implementation process and as new staff are hired, is essential to ensure safe and appropriate pain management procedures . Intermittent reassessment and revision based on experiences in using the protocol is needed to allow for adaptation as the needs of the patients served and the resources and options available change . Despite some progress in recent years, pain continues to be undertreated globally, particularly in children, and particularly in low income countries . Published guidelines based on best available evidence, can and should be adapted to allow for optimal pain management given the resources and capabilities of a given health care setting . It is hoped that the development process and protocol described here will not only help to improve care on the mrc ward, but serve as an example to others working toward improving pain management in similar health care settings.
H. pylori infection is reported to include pathologic changes of the stomach, including edema and congestive surface epithelium . A characteristic event in gastritis is the infiltration of the subepithelial gastric lamina propria by phagocytes, mainly neutrophils and macrophages, that produce large amounts of reactive oxygen species (ros). Ros activate the oxidant - sensitive transcription factor nf-b, which induces expression of the inflammatory genes, oncogenes, and cell - cycle regulators . H. pylori - induced gastric mucosal injury and inflammation are mediated by proinflammatory cytokines such as interleukin (il)-8 and il-1 as well as inflammatory enzymes, including inducible nitric oxide synthase (inos). Transcription of these inflammatory mediators is regulated by the oxidant - sensitive transcription factor nf-b [610]. Nf-b is an inducible transcription factor composed of p50/p65 (heterodimer) or p50 (homodimer). Nf-b is retained in the cytoplasm by binding to the inhibitory protein ib. Extracellular stimuli trigger rapid degradation of ib by proteasomes, allowing nf-b to translocate into the nucleus and bind to the dna sites of target genes, including il-8, il-1, and inos . . H. pylori - elicited neutrophils produce ros, which subsequently injure gastric mucosal cells . Ros cause peroxidation of membrane lipids, thus increasing the level of lipid peroxide (lpo) in the damaged tissues . We previously demonstrated that lpo production increases in parallel with il-8 production in h. pylori - infected cells . Myeloperoxidase (mpo) is more abundantly expressed in neutrophils than other cells and thus, is used as a biomarker for neutrophil infiltration . In neutrophils, . Therefore, high levels of lpo and increased mpo activity could reflect oxidative damage and inflammatory responses of cells . Korean red ginseng, which is the steamed root of a 6-year - old korean ginseng (panax ginseng meyer), is used in asian countries as a traditional medicine for the treatment of various diseases, including inflammatory disorders [1618]. An in vitro study showed that korean red ginseng inhibited adhesion of h. pylori to gastric epithelial cells . Korean red ginseng extract (rge) inhibits h. pylori - induced oxidative damage in gastric epithelial cells . Previously we showed hepatoprotective effects of korean red ginseng in rats and mouse liver, which may be contributed by its antioxidant activity . Therefore, the antioxidant or anti - inflammatory effects of rge, containing ginsenosides, may protect gastric mucosa from inflammation caused by h. pylori infection . In the present study, we investigated whether rge protects against h. pylori - induced gastric inflammation in mongolian gerbils . Animal models for h. pylori infection have been developed to replicate many features of human gastric inflammation and carcinogenesis in order to test potential therapeutic agents for the prevention and treatment of h. pylori - associated gastric disease . The mongolian gerbil model is the best animal model for this purpose because h. pylori infection induces chronic gastritis, gastric ulcers, and intestinal metaplasia in these animals . Mongolian gerbils develop gastric neoplasia and gastric cancer after chronic infection by h. pylori strain 7.13, as used in the present study . After the infection of gerbils with h. pylori, we determined: the changes in lpo level, which is an index of oxidative membrane damage; the activity of mpo, a biomarker of neutrophil infiltration; the induction of inflammatory mediator keratinocyte chemoattractant factor (kc), an il-8 homolog in rodents; il-1; inos; and the phosphorylation of ib, which reflects the activation of nf-b . In addition, viable h. pylori colonization in the stomach, changes in food intake and body weight, stomach weight / total body weight, and histological analysis of gastric mucosa were compared between animals that received rge and those that did not . Five - wk - old male specific - pathogen - free mongolian gerbils (mgs / sea) with an average weight of approximately 40 g were purchased from charles river laboratories (wilmington, ma, usa). Gerbils were housed in polypropylene cages on hard wood chip bedding in groups of five / cage . The animals were maintained in a temperature - controlled room (22 2c) with a 12-h light protocols were reviewed and approved by the institutional animal care and use committee of the yonsei university medical center (seoul, korea; permit no . All animals were maintained in the specific pathogen - free facility at yonsei university medical center . Bacteria were grown on horse blood agar plates containing 4% columbia agar base (oxoid, basingstoke, hampshire, uk), 5% defibrinated horse blood (hemostat labs, dixon, ca, usa), 0.2% -cyclodextrin, 10 g / ml vancomycin, 5 g / ml cefsulodin, 2.5 u / ml polymyxin b, 5 g / ml trimethoprim, and 8 g / ml amphotericin b at 37c under microaerophilic conditions . A microaerobic atmosphere was generated using a campygen sachet (oxoid) in a gas pack jar . For liquid culture, h. pylori was grown in brucella broth (difco & bbl diagnostics, franklin lakes, nj, usa) containing 10% fbs (gibco - brl, grand island, ny, usa). 10 bacteria were collected and resuspended in 500 l of brucella broth for the infection of each animal . A standardized water extract of korean red ginseng was prepared and supplied by the korea ginseng corporation (daejeon, korea) as described previously . The content of crude saponin in rge is approximately 7%, and it is composed of the following ginsenosides: 8.27 mg / g of rb1, 3.22 mg / g of rb2, 3.90 mg / g of rc, 1.09 mg / g of rd, 2.58 mg / g of re, 1.61 mg / g of rf, 2.01 mg / g of rg1, 1.35 mg / g for (20s)-rg2, 1.04 one wk after inoculation with h. pylori, mongolian gerbils were fed control ain76a diet (research diets, inc, new brunswick, nj, usa) or a diet containing rge (200 mg rge / each gerbil) for 6 wk . As a negative control, mongolian gerbils that were not inoculated with h. pylori were fed the control diet ain76a . Gerbils that were inoculated with h. pylori were fed the control diet ain76a and considered as a positive h. pylori control . This level of rge supplementation (200 mg rge / gerbil) was adapted from previous studies showing the protective effect of rge against oxidative stress - mediated epithelial damage . Body weight and food intake were measured every wk during the experimental period . At the end of experimental period, gastric mucosal tissues were examined histologically and h. pylori colonization was confirmed . For biochemical analyses, gastric mucosal samples were homogenized in 10 mm tris buffer (ph 7.4). The homogenates were used for determining lpo level, mpo activity, and protein levels of kc, inos, phospho - specific ib and ib. For mrna level of kc, il-1, and inos, total rna was isolated from a gastric mucosal sample by the guanidine thiocyanate extraction method . Rge supplementation had no effect on any of these parameters in animals not infected with h. pylori, determined in our preliminary study . The number of viable h. pylori in the animal stomach was determined as previously described . After the animals were fasted for 24 h, they were euthanized, and their stomachs excised . The stomach was dissected along the greater curvature and washed with 0.01 m phosphate - buffered saline (pbs, ph 7.4) and then divided longitudinally into two halves . One half of each stomach was homogenized in 10 ml of pbs using a polytron . The plates were incubated at 37c under microaerobic conditions for 5 d. the colonies were counted and the number of viable h. pylori was expressed as colony forming units / g of tissue . The other half of each stomach was fixed in 10% neutral buffered formalin and embedded in paraffin . Paraffin sections were cut into 4-m slices and stained with hematoxylin and eosin for morphological observation . Morphological features of the gastric antrum and body were graded using the following four - point scale: grade 0 (normal), grade 1 (mild), grade 2 (moderate), and grade 3 (severe). Four aspects of gastric lesions were recorded according to the updated sydney system: polymorphonuclear leukocytes (pmns) infiltration; chronic inflammation, such as mononuclear cell infiltration and lymphoid nodule formation; intestinal metaplasia and hyperplasia; and formation of heterotopic proliferative glands . Lpo levels were measured by colorimetric assay as thiobarbituric acid reactive substances and the results were expressed as pg / mg protein . One unit of mpo activity was defined as the activity required to degrade 1 mol of peroxide / min at 25c . Mrna expression of inos and kc was assessed using real - time reverse transcription - polymerase chain reaction (rt - pcr) analysis . Total rna isolated from mucosal homogenate was reverse transcribed into cdna and used for pcr with mongolian gerbil - specific primers for kc, il-1, inos, and -actin . Sequences of kc primers were cacccgctcgcttcttc (forward primer) and atgctcttggggtgaatcc (reverse primer). For inos, the forward primer was gcatgaccttggtgtttgggtgcc and the reverse primer was gcagcctgtgtgaacctggtgaagc . For -actin, real - time rt - pcr reactions were prepared using taqman reagents (applied biosystems, foster city, ca, usa) for inos, kc, and -actin . A dna engine (ptc-200) and its system interface software (mj research, waltham, ma, usa) were used to run samples and analyze data . The -actin gene was amplified in the same reaction and served as the reference gene . Kc and inos mrna levels were reported relative to those of animals not inoculated with h. pylori that were fed the control diet . Kc and inos mrna values for the negative control group were set equal to 1 . The level of kc in gastric mucosal tissues was measured using an enzyme - linked immunosorbent assay and a mouse kc assay kit (ibl, gunma, japan). Total cell extracts were prepared from gastric mucosa and separated by sds - polyacrylamide gel electrophoresis under reducing conditions . After blocking using 5% nonfat dry milk, the membranes were incubated with anti - inos (santa cruz biotechnology, santa cruz, ca, usa), anti - phospho - ib, anti - ib (cell signaling technology, inc ., beverly, ma, usa), and anti - actin antibodies (santa cruz biotechnology). The immunoreactive proteins were visualized using anti - mouse secondary antibody conjugated to horseradish peroxidase, followed by enhanced chemiluminescence (amersham). Cary, nc, usa). Statistical differences between groups were determined using one - way analysis of variance and newman keuls test . All values were expressed as the mean standard deviation for 10 gerbils in each group . In order to examine gross changes of h. pylori - infected mongolian gerbils consuming rge dietary supplements, food intake and body weight change were determined every wk during the experimental period . The weight gain and food intake were similar in all three groups (data not shown). This finding was supported by previous studies showing that h. pylori infection did not affect either body weight or food intake in mongolian gerbils . To determine whether rge inhibits h. pylori colonization in gastric mucosa, the number of viable h. pylori in the stomachs of gerbils infected with h. pylori were determined after 6 wk of dietary supplementation with rge (fig . In addition, stomach wet weights were compared between groups at the end of the experiment (fig . Animals infected with h. pylori had significantly more h. pylori colonization and greater stomach weight than noninfected animals . Rge supplementation had no effect on the number of viable h. pylori in the stomach . H. pylori - induced increases in the stomach weight tended to be smaller in the rge - treatment group than in the control - diet group, but this difference was not significant . Rge had no antibacterial effect and did not reduce pathologic changes of the stomach, such as edema, in animals infected with h. pylori . In h. pylori - infected animals, moderate to severe gastritis was accompanied by pmn infiltration, mainly neutrophil infiltration, and by lymphoid follicle formation in the mucosa and submucosa . The hyperplasia and mucous - gland metaplasia of epithelial cells in infected animals were obvious (fig . 2a, middle panel) in comparison with the normal gastric mucosal regions of noninfected animals (fig . The gastric mucosal lesions of rge - supplemented animals showed less evidence of inflammatory cell infiltration, hyperplasia, and intestinal metaplasia than those of infected animals fed the control diet (fig . 2a, right panel). H. pylori - induced chronic inflammation was reduced by rge treatment . However, none of these differences between h. pylori - infected animals that were supplemented with rge and those that were fed the control diet were significant . Taken together, rge improved the histological grade of pmn infiltration, intestinal metaplasia, and hyperplasia in mongolian gerbils, which suggests that rge has an anti - inflammatory effect against h. pylori - induced gastric inflammation . 3a, mpo activity in gastric mucosa was increased by h. pylori infection, and was attenuated by rge supplementation . The reduced mpo activity in the gastric mucosal tissues of the rge - treatment group was associated with reduced infiltration by neutrophils (fig . 2). Rge supplementation inhibited h. pylori - induced neutrophil infiltration in the gastric mucosal lesions of mongolian gerbils . The level of lpo, an oxidative damage index, was higher in the gastric mucosal tissues of h. pylori - infected animals than that in noninfected animals (fig . Rge supplementation suppressed the h. pylori - induced increase in the lpo level of gastric mucosal tissues . To investigate the inhibitory effects of rge against h. pylori - induced inflammation, the expression levels of important inflammatory mediators (kc, il-1, inos) were determined in the gastric mucosal tissues of animals infected with h. pylori that were and were not supplemented with rge . As shown in fig . 4, the mrna expression of kc, il-1, and inos in gastric mucosal tissues was greater in h. pylori - infected animals than in non - infected animals . Il-1, and inos was significantly lower in the rge - treatment group than in the control - diet group . Protein levels of kc and inos induced by h. pylori infection were also lower in the rge - treatment group than in the control - diet group, as determined by enzyme - linked immunosorbent assay and western blotting, respectively (fig . 5b, the level of phospho - ib was greater in the h. pylori - infected groups than in the noninfected group, and was lower in the rge - treatment group than in the control - diet group . Ib, which was lower in the h. pylori - infected groups than in the noninfected group, was maintained in the rge - treatment group . This suggests that rge supplementation may inhibit nf-b activation by suppressing phosphorylation of ib in the gastric mucosal tissues of h. pylori - infected mongolian gerbils . The present study demonstrates that dietary supplementation of rge fed to mongolian gerbils for 6 wk improves h. pylori - induced gastric lesions, as determined by histological observation . Rge moderated the h. pylori - induced increase in neutrophil infiltration, mpo activity, lpo level, and the expression of inflammatory mediators (kc, il-1, inos). Rge was also associated with a reduction in i phosphorylation relative to that measured in animals fed the control diet . This demonstrates that rge has an anti - inflammatory effect on h. pylori - induced gastric inflammation in mongolian gerbils . However, the number of viable bacteria obtained from the gastric mucosal tissues of h. pylori - infected animals fed a diet supplemented with rge was not different from that obtained from animals receiving a control diet without rge . Rge may not have an antibacterial effect on h. pylori colonization in the gastric mucosa of mongolian gerbils . A previous study demonstrated that panaxytriol isolated from ginseng was effective in inhibiting h. pylori growth with an mic of 50 g / ml . However, our preliminary study using gastric epithelial ags cells showed that rge did not affect the growth of h. pylori for 24 h culture (data not shown). In addition, long - term exposure of rge to the cells and animals infected with h. pylori is necessary to determine whether rge has bactericidal / bacteriostatic effect . Even though rge has no cytotoxic effect on the bacterium, rge may be beneficial for preventing and inhibiting the development of the gastric inflammation induced by h. pylori infection by reducing oxidative stress and suppressing the expression of inflammatory mediators in gastric mucosa . Kc, an il-8 homolog, is a neutrophil chemoattractant that is involved in murine inflammation by stimulating neutrophil infiltration into infected tissues . Increased activity of mpo represents neutrophil infiltration to the infected tissues and propagation of inflammation . H. pylori - associated gastric mucosal injuries, including inflammation, are attributed to the activated neutrophils that adhere to postcapillary venules and subsequently migrate into the interstitium . We found that h. pylori infection increased kc expression and mpo activity, suggesting increased infiltration of neutrophils into gastric mucosal tissues of mongolian gerbils . The results are supported by histological observation showing neutrophil infiltration in h. pylori - infected gastric mucosa in the present study . Because rge supplementation reduced kc expression, rge may attenuate gastric inflammation by suppressing kc - mediated neutrophil infiltration into h. pylori - infected gastric mucosal tissues of mongolian gerbils . Rge supplementation inhibited the expression of the inflammatory mediators (inos, kc, and il-1) that was induced by h. pylori infection . Increased activity of inos and high levels of kc and il-1 have been observed in the gastric mucosa of patients with chronic gastritis and gastric adenocarcinoma . Neutrophil infiltration is positively correlated with the expression of inos and inflammatory cytokines in gastric mucosa . These studies showed that the upregulation of inos, kc, and il-1 by h. pylori infection might be associated with neutrophil infiltration . Ros are produced from the activated neutrophils in h. pylori - infected gastric mucosa . Ros activate oxidant - mediated transcription factors such as nf-b, which induces the expression of inos, kc, and il-1. Therefore, rge inhibits the expression of inflammatory cytokines including inos, kc, and il-1 by suppressing the neutrophil infiltration caused by h. pylori infection in the gastric mucosa of mongolian gerbils . Because the expressions of inflammatory mediators are critical for gastric inflammation and carcinogenesis, rge may prevent the development of the gastric inflammation and gastric cancer that is associated with h. pylori infection . Phosphorylation of ib is required for nf-b activation, which regulates the expression of kc, il-1, and inos . Phosphorylation of ib acts as a trigger for ib degradation, allowing the nuclear translocation of nf-b and the expression of nf-b target genes . Even though the mongolian gerbil model is good for studying gastric inflammation and gastric cancer induced by h. pylori infection, there are few antibodies reported in the studies using mongolian gerbils . Due to lack of antibodies, it is difficult to examine the serum levels of inflammatory mediators such as cytokines, which is a noninvasive way to confirm gastritis . Therefore, we assessed the phospho - specific form of ib as a biomarker of nf-b activation in the present study . Several studies have demonstrated that h. pylori induces the expression of proinflammatory mediators such as kc, il-1, and inos through the activation of nf-b . In the present study, the results suggest that rge inhibits the expression of kc, il-1, and inos in the h. pylori - infected gastric mucosal tissues of mongolian gerbils by suppressing the phosphorylation of ib, and thus inhibits nf-b activation . Lipid peroxidation is involved in the pathogenesis of gastric diseases, including gastritis, that are associated with h. pylori infection . In the present study, the lpo level in the gastric mucosal tissues of mongolian gerbils was increased by h. pylori infection . The inhibitory effect of rge on increases in lpo levels induced by h. pylori infection may be related to a reduction in mpo activity in the gastric mucosal tissues of animals supplemented with rge . The main source of ros production may be host neutrophils that are activated by h. pylori . Therefore, rge may decrease the production of ros and lipid peroxidation through inhibition of kc - mediated neutrophil infiltration in h. pylori - infected gastric mucosa . Previously, we found that h. pylori itself activates nadph oxidase to produce ros in gastric epithelial cells, resulting in the induction of nf-b - mediated expression of il-8, il-1, and inos [68]. Therefore, rge may inhibit nadph oxidase and thus suppress the ros production that activates nf-b and induces expression of il-8, il-1, and inos in gastric epithelial cells . Further study should be undertaken to determine whether rge inhibits ros production by suppressing nadph oxidase in h. pylori - infected gastric epithelial cells or gastric mucosal tissues . The present study suggests that rge attenuates h. pylori - induced expression of inflammatory mediators without affecting the number of viable h. pylori . Therefore, it is assumed that rge suppresses h. pylori - induced inflammation including nf-b activation and expression of inflammatory mediators, without direct action on h. pylori . Even though the first choice of the h. pylori therapy is eradication of the bacteria by antibiotics, the complete clearance of the bacteria is difficult in most patients . The inhibition of h. pylori - induced expression of inflammatory mediators by rge may be useful for prevention of inflammation and possibly carcinogenesis mediated by the h. pylori infection . Our findings demonstrate that h. pylori induced oxidative stress (determined by lpo levels in gastric mucosa), inflammation (examined by expressions of cytokines and inos, histologic observation of neutrophil infiltration, and mpo activity), and proliferation (observed by histologic hyperplasia), which were inhibited by rge treatment . The precise mechanism of rge on proliferation, mucosal destruction, inflammation, oxidative stress, and any presence of dysplasia or metaplasia should be determined to evaluate the anti - inflammatory effect of rge using various gastric epithelial cells infected with h. pylori . In conclusion, rge supplementation inhibits neutrophil infiltration and lipid peroxidation, determined by mpo activity and lpo level, and attenuates the induction of inflammatory mediators (kc, il-1, inos), which results in suppression of h. pylori - induced gastric inflammation in mongolian gerbils . Therefore, rge may be beneficial for the prevention and treatment of h. pylori - associated gastric inflammation.
Fungal infections represent today a serious and notyetsolved health problem even in industrialized countries (sternberg, 1994; edmond et al ., 1999; zaoutis et al ., 2005; pfaller and diekema et al ., 2007) not only hiv infection, but lifeprolonging technologies invasive technologies, therapy prior to organ transplantation and anticancer drugs have provided an opportunity for fungi to colonize and cause disease in humans . In europe, fungal infections account for 17% of the intensive care unit infections (rupp, 2007) and in the usa, deaths caused by fungal infections have increased from the 10th most common cause of death among hospitalized individuals to 7th in the last 10 years (martin et al ., 2003). And not only the incidence but the diversity of pathogenic fungi encountered as etiological factors of fungal infections has increased in the last years in immunocompromissed individuals . In these patients, eradication of the infection relies in chemotherapy . While superficial infections caused by dermatophytes are relatively simple to eradicate, treatment of deep invasive mycosis is more complex as the therapeutic arsenal available is more limited . Polyenes and azoles (and only recently echinocandines) are the frequent choice and pharmacokinetics limits, in some cases, their utility while the development of resistance against azoles, the most common agents, may limit their usefulness in the coming years (sanglard et al ., 1995; the identification of novel therapeutic approaches to fight against disease is therefore of primary importance in basic research . The main reason for this relies on its common niche, as this fungus inhabits the human gastrointestinal and urogenital tract in a significant part of the population, where it behaves as a harmless commensal organism (odds, 1988). However, upon alteration of the host defences, c. albicans disseminates within the human body gaining access to internal organs and causing severe infections (called candidiasis). Candida albicans thus behaves as an opportunistic pathogen . The ability of this fungus to change its morphology from a yeastlike (unicellular) to a filamentous (hyphal or mycelia) form (a property called dimorphism) is environmentally regulated by factors, such as the temperature (lee et al ., 1975), the ph (soll et al ., 1978; odds, 1994) or the availability of nutrients (gow and gooday, 1982), and plays a major, albeit nonexclusive, role in its ability to produce disease (ryley and ryley et al ., 1990; lo et al ., 1997; kobayashi and cutler, 1998; romani, 2004). Spores (resting conidia) of a. fumigatus are ubiquitous in the environment and are continuously inhaled and deposited in the lungs where they are phagocytosed and eliminated . However, in the impaired immune individuals, conidia germinate and destroy alveolar macrophages, mature into germ tubes and hyphae that can in turn invade vessels and disseminate hematogenously (latge, 1999). Due to the mechanism of dissemination of spores (air), infections are difficult to control even in carefully controlled environments and may lead to death of the patient . Cryptococcus neoformans is the most common cause of fungal infections of the central nervous system . Cryptococcus neoformans is a basidiomycete yeastlike fungus found in the environment that can infect and cause disease in a wide variety of animal hosts, insects, birds and humans (perfect and casadevall, 2002). Infection in humans also occurs by inhalation of basidiospores that enter the lungs, either proliferating immediately or establishing a dormant infection that can be reactivated at a later stage depending on the host . A characteristic feature of this fungus is the presence of a capsule, which is unique in fungal pathogens and impedes phagocytosis in the absence of host antibodies (mcfadden et al ., the capsule enables dissemination of c. neoformans to the central nervous system, where it generates a fatal meningoencephalitis if untreated . Finally, histoplasma capsulatum, is a dimorphic specie frequently encountered in the environment as saprophyte . Moldproduced spores that are inhaled germinate in the lung where they are converted to a yeast form, which is a process absolutely required for pathogenicity (medoff et al . While the biology (life cycle, metabolism and morphogenesis) of all these fungal species greatly differ, they also share certain common features that enable a successful colonization of the human host and are able to counteract its defence mechanisms . Such features are frequently called virulence factors and they comprise metabolic, structural and morphological features (navarrogarca et al ., 2001) among others, although it has been proposed that only those involved in the direct interaction with host cells should be considered as true virulence factors (odds et al ., 2003). Their identification is an active area of research as they may provide the basis for the development of novel therapies to treat fungal infections (alonsomonge et al ., 2003). While several virulence traits have been identified in many fungal species, the cell wall is still the most promising target in drug discovery for different reasons . First, it is unique to the fungus, and therefore, fulfils a priori the requirement of selectivity for drug discovery . Second, it is an essential structure to the cell, whose inhibition leads to cell death and most frequently lysis . Third, and most importantly, it is the most external structure present in the fungal cell and therefore, mediates the interaction of the fungus with the mammalian host cells . As a consequence, it is involved in adhesion, colonization, signaling and immune recognition, and therefore plays a major role during infection . We aim to summarize here the structural and functional aspects of the cell wall in fungal pathogens . We highlight recent findings that indicate the relevance of the cell wall in the interaction with the host immune cells and how this process is essential to prime and develop a protective immune response (romani, 2004) and contributes significantly to the control and pathology of the infection (casadevall and pirofski, 1999; casadevall and pirofski, 2001). The cell wall is an essential structure that maintains the viability of fungal cells, conferring their typical morphology and protecting the cell against external injuries . As the most external cellular structure of pathogenic microorganisms, it also carries important antigenic determinants and mediates adhesion to the host tissues, being therefore crucial to initiate colonization and therefore, cause disease (calderone and fonzi, 2001; sundstrom, 2002). The cell wall is the structure sensed by the host immune cells . As a consequence, it participates in triggering and orchestrating the whole innate and adaptive immune response against the microorganism . It is normally a multilayered structure composed by glucans, dglucose polymers with 1,3, 1,6 and 1,3 (in the case of histoplasma, see below) linkages that account for 5060% of the total cell wall . A minor, but essential, component is chitin, a 1,4 nacetylglucosamine polymer (12%) while mannan (also called phosphopeptidomannan) is composed of mannoproteins and represents about 3540% of it . The 1,3 glucan and chitin moiety are mainly responsible for providing the cell wall strength and appear as a dense inner layer by transmission electron microscopy . The synthesis of both polymers is coordinated and regulated in response to different environmental conditions . Drugs or stress conditions that alter the amount of one of these components frequently trigger a mechanism that increases the synthesis of the others, thus providing the necessary strength to maintain cell integrity (ram et al ., 1998; lagorce et al ., the external outer layer is composed of mannoproteins and appears much lighter, being largely responsible for determining the porosity of the cell wall . 1,3 glucan is distributed through the cell surface and is covalently linked to some chitin chains, providing a scaffold to which mannoproteins are also covalently attached (fig . 1). The outer layer is composed of cell wall proteins (cwps) that are attached to the inner layer via glycosylphosphatidylinositol (gpi) or internal repeat domains (pir) linkages . In c. albicans, the most external part of the cell wall is mainly composed of mannoproteins, also called cell wall proteins (cwps), which are normally highly glycosylated (either o or nglycosylated) with mannosecontaining polysaccharides; carbohydrates can account for up to 90% of their molecular mass . Oglycosylation occurs among fungi at serine and/or threonine residues and involves the addition of mannoses through 1,2 or 1,3 (as occurs in s. cerevisiae) type linkages . As the linkage of some cell wall proteins to 1,3 glucan can be cleaved by treatment with alkalis, it has been hypothesized that ochains are involved (kapteyn et al ., 1999). Nglycosylation takes place at asparagine residues; the inner core of the added glycan moiety is composed of 1,6 mannose to which moieties are sequentially incorporated . In c. albicans, cwps frequently contain internal repeats (named pircwps) that are directly linked to 1,3 glucan, whereas others contain a glycosylphosphatidylinositol derivedstructure (gpicwps) and are attached to the 1,6 glucan . Interestingly, a different type of linkage (1,2 type) does exist (suzuki et al ., 1995; kobayashi et al . 2003), and it has been shown to play a role in protection against disseminated candidiasis (dromer et al ., 2002). Hyphae of a. fumigatus contain four major carbohydrate polymers: chitin, galactomannan, branched 1,3/1,6 glucans and linear 1,3/1,4 glucans (fontaine et al ., 2000). The complex composition of the conidial cell wall is incompletely defined (bernard and latge, 2001), but in contrast to hyphae, conidia have other morphologically distinct features: an outermost layer (paris et al ., 2003a, b) and an inner cell wall layer that is exposed during the swelling (tronchin et al ., 1995), a process that can occur within macrophages (philippe et al ., 2003) and participates in infection . The outer conidial cell wall consists largely of hydrophobic proteins and is lost when conidia develop into filaments . The cell wall of mycelia, which has been more extensively characterized, consist of branched 1,3 glucan covalently bound to chitin, 1,3 and 1,4 glucans and galactomannan (fontaine et al ., 2000). The most distinctive feature of cryptococcus neoformans is the polysaccharide capsule (janbon, 2004). The presence of a polysaccharide capsule gives to this fungus some pathogenic attributes comparable to those of classical encapsulated bacteria such as streptococcus pneumoniae, haemophilus influenzae and neisseria meningitidis . The polysaccharide capsule of c. neoformans is highly antiphagocytic, poorly immunogenic and is essential for virulence, as deduced from the avirulence of strains in which key components of its biosynthetic pathway have been deleted (chang and kwonchung, 1994; chang et al ., 1996). The capsule of c. neoformans contains two major polysaccharides, glucuronoxylomannan (gxm) and galactoxylomannan (galxm). Gxm is a linear 1,3 mannan with a 1,2 glucuronic acid residue attached at every third mannose (cherniak et al ., 1988). Each trisaccharide of the backbone is also substituted with up to four xyloses, which are either 1,2 or 1,4linked (cherniak et al . Xylosylated mannoses tend not to be acetylated (cherniak et al ., 1988; janbon et al ., 2001; moyrand et al ., gxm forms a complex and large molecularweight structure that involves the selfassociation of molecules and the selfentanglement of different fibres (turner and cherniak, 1991; mcfadden et al . Gxm is also released from the capsule and accumulates in tissues during infection, blocking effective immune responses and contributing to the pathology of the disease (vecchiarelli, 2000). High concentrations of gxm in tissue were hypothesized to cause dysfunction of cellular processes (graybill et al ., 2000) because of the high viscosity achieved in tissues . However, recent studies suggest that this does not occur at concentrations that are relevant in vivo (mcfadden et al ., 2006). Galxm is an 1,6 galactan that contains branches of 1,3 galactose1,4 mannose1,3 mannose . In turn, the branch sugars can be linked to 1,3 or 1,2 xylose . Whereas all sugars in gxm and most of the sugars in galxm are in the pyranose configuration the cell wall of histoplasma yeast contain primarily three polysaccharides: chitin, glucans (1,3, 1,6linked and 1,3glucan) (domer, 1971; reiss, 1977). Immunofluorescence localization in crosssections of wildtype yeast cells with 1,3 and 1,3glucanspecific antibodies show a nonhomogeneous spatial distribution . Although some overlap exists between 1,3 glucan and 1,3 glucan, the cell wall is somewhat layered, with 1,3 glucan being more external . Recognition of pathogens by the innate immunity requires the identification of pathogenassociated molecular patterns (pamps). These structures represent surface determinants that are absent in mammalian cells and are sensed by specific structures (called pattern recognition receptors prrs) present on the surface of the immune cells (underhill and ozinsky, 2002; underhill, 2004). Different prrs recognize different pamps and contribute in this way to the generation of a balanced response against microorganisms (underhill, 2003b) (fig . 2). This figure depicts the multiple receptors that act either alone or simultaneously as sensors for different cell wall components of fungal cells walls . Receptor engagement induces intracellular signals that lead either to endocytosis and phagocytosis signalling or both of them . Tolllike receptors (tlrs) are cell membrane associated (tlr1, tlr2, tlr4, tlr5 y tlr6) or intracellular (tlr3, tlr7, tlr8 y tlr9) prr receptors . Several tlrs have been implicated in the recognition of fungal components: tlr2 was initially described to play a role in zymosan (a glucan enriched particle) recognition (underhill et al ., 1999). Recent studies have shown that tlr2 recognizes phospholipomannan (plm) (jouault et al ., 2003), while tlr4 recognizes olinked mannans (netea et al ., 2006). Tlr6 is involved in the recognition of zymosan (underhill, 2003a) while tlr9 detects fungal dna (wagner, 2001). In addition to tlrs, ctype lectin receptors (clrs) are mainly membranebound receptors that also recognize polysaccharide structures from fungal cells: dectin1 recognizes glucans (brown and gordon, 2001), whereas the macrophage mannose receptor (mr) and dcsign (dendritic cellspecific icam3grabbing nonintegrin) recognize nlinked mannans (stahl and ezekowitz, 1998; cambi et al ., 2003). Structurally, prrs normally have an extracellular pathogenrecognition domain [the leurich repeat (lrr) domain in tlrs and the ctype lectin domain (cld) in clrs] (fig . 2). The intracellular signalling domain (the tlrinterleukin 1 receptor, tir domain) of tlrs and the immunoreceptor tyrosinebased activationlike motif (itam) from some clrs, such as dectin1, are responsible for transducing the intracellular signals that are ultimately responsible for the functional activity of the receptor . Although ubiquitous, the amount of each individual prrs differs greatly for each type of immune cell, stage of growth / differentiation and biological specie (netea et al ., 2008). Pattern recognition receptors are differentially expressed in the surface of immune cells (fig . Phagocytes are essential components of the innate system in the control of the fungal infection as they contribute to eliminate the microbe . Monocytes express high levels of tlrs on their cell membranes and moderate levels of clrs . Macrophages present high expression levels of tlrs and clrs and dcs, which are essential for antigen processing and presentation to t cells, and also express most of the prrs that are important for the recognition of fungal pathogens . By contrast, neutrophils show moderate expression of tlrs and a high expression of phagocytic receptors . Thus, the mixture of prrs that is expressed by each of these cell types contributes to generate the initial response following recognition of fungal pathogens . The main cells of the host innate immune response are monocytes, macrophages, neutrophils and dendritic cells . Tlr, tolllike receptors; mr, mannose receptor; fcr, fc receptor; cr3, complement receptor . Due to the localization of mannoproteins and mannans in the outermost part of the fungal cell wall, mannan detection may be expected to be one of the first steps in the recognition mediated by immune system cells . However, other components such as glucan and chitin (at an inner level) also influence the recognition of fungal cells by leucocytes . We will summarize how this process occurs in the different fungal species with special emphasis in the model fungal pathogen c. albicans . Both mannans and mannoproteins from the c. albicans cell wall have important immunostimulatory activities (garner et al ., 1994; gomez et al ., 1996; gomez et al ., 2000 the ctypelectin mr was among the first described prrs for fungi (stahl and ezekowitz, 1998). It was the first receptor on the surface of macrophages to be described as a mannan receptor (wileman and stahl, 1986; stephenson and shepherd, 1987). The mr recognizes carbohydrates with terminal mannose, fucose or glcnac (taylor et al ., 2005a). Recognition of the pamp occurs via the carbohydraterecognition domain (crds) present in the extracellular region of the receptor (linehan et al ., 2000). In vitro studies have demonstrate that the mr preferentially recognizes linked oligomannoses with branched, rather than linear, structures (kery et al ., 1992). A recent study has demonstrated that in monocytes and macrophages, the mr recognizes branched nbound mannans from c. albicans (netea et al ., 2006). No significant differences were found between normal and mr/ (knock out) mice using a experimental model of infection with c. albicans, although knockout mice had higher average fungal burdens in some of the organs, they were competent in inflammatory cell recruitment and antibody production, indicating that the mr is not required for the normal host defence during disseminated candidiasis or even for phagocytosis (lee et al ., 2003). By contrast, recognition of the shorter linear structures of obound mannan is mediated by tlr4 (netea et al ., 2006) with the resultant production of appropriate cytokines (tada et al ., 2002). Dcsign is a receptor that is specifically expressed on the cell membrane of dcs (cambi et al ., 2003) and some subpopulations of tissue macrophages (soilleux et al ., 2002 dcsign recognizes carbohydrates such as high mannose structures in a cadependent manner with specificity being achieved through unique interactions with its ligands and tetramerization of the receptor (koppel et al ., it has been shown recently that dcsign is able to bind c. albicans in dcsigntransfected cell lines and in human monocytederived dcs; this results in the internalization of c. albicans in specific dcsignenriched vesicles, which are distinguishable from those containing the mr, also expressed in dcs (cambi et al ., 2003). The linked mannose structures on the surface of c. albicans are recognized by the mr, tlr4 and dcsign, and 1,2 mannosides, present in mannoproteins and plm (fradin et al ., 2008; mille et al ., 2008), are recognized through tlr2 (jouault et al ., 2003). A recent study has shown that galectin3, a slectin involved in the recognition of 1,2 mannosides on the surface of the cell (fradin et al ., 2000), can discriminate between pathogenic c. albicans and nonpathogenic s. cerevisiae, and that an association between galectin3 and tlr2 is involved in this process (jouault et al ., 2006). Dendritic cells are able to recognize the different morphologies of c. albicans and generate a different response: yeast cells trigger il12 production and activate a protective th1 response, whereas hyphal forms repress these processes but trigger il4 production . Dendritic cells pulsed with the yeast forms were able to generate an antifungal protective immunity, indicating that dcs can sense and differentiate between both morphologies and types of response that can lead to eradication of the microbe or acquisition of a commensalism state (d'ostiani et al . Another lectin family member, dectin2, has also been described to function as a receptor for c. albicans mannans (ariizumi et al ., 2000). Dectin2 is present on tissue macrophages, langerhans cells and dcs (taylor et al ., 2005b). Due to its short intracytoplasmic tail this receptor seems to be mainly involved in the recognition of c. albicans hyphae (sato et al . Candida albicans mannan is also recognized by other proteins, called collectins, which are all secreted as large multimeric complexes . At least three collectins, mannosebinding lectin (mbl), surfactant protein a (spa) and surfactant protein d (spd), have been implicated in antifungal immunity . Mannosebinding lectin is a serum protein that recognizes selected terminal monosaccharides, such as mannose, fucose and nacetylglucosamine (turner and hamvas, 2000). Fungal binding by mbl triggers a protease cascade through the mblassociated serine proteases (masp1 and masp2) that leads to activation of the complement pathway and deposition (or opsonization) of complement components, such as c3b, on the microbial surface, thereby promoting opsonic fungal recognition (kilpatrick, 2002; holmskov et al ., 2003) mbl plays an important role in the firstline defence against c. albicans without the need for opsonophagocytosis by dcs, in which a direct interaction of mbl with c. albicans results in agglutination and accelerated complement activation via the lectin pathway, leading to inhibition of growth (ip and lau, 2004). However, a recent work indicates that the lectin pathway of complement activation in human neutrophils is important for the opsonophagocytosis of yeasts but not of bacteria (brouwer et al ., 2008). Spa and spd recognize a broad range of microbes, including h. capsulatum, a. fumigatus, c. albicans and c. neoformans (kishore et al ., 2006), but they do not trigger complement activation and their primary role appears to involve microbial agglutination . The figure shows the activation of the complement cascade in response to fungal mannan recognition mediated by mbl . Conidia of a. fumigatus are recognized specifically by dcsign as demonstrated using stable transfectants and monocytederived dcs . Binding and internalization of a. fumigatus conidia correlates with dcsign surface expression levels and is abolished in the presence of a. fumigatusderived cell wall galactomannans (serranogomez et al ., 2004). The clinical relevance of this interaction is emphasized by the presence of dcsign in lung dcs and alveolar macrophages, and further illustrated by the dcsigndependent attachment of a. fumigatus conidia to the cell membrane of il4treated monocytederived macrophages (serranogomez et al ., 2004). On the other hand, conidia have been shown to adhere to langerhans cells in a dose and timedependent manner involving in this interaction a receptor with galactomannan structure specificity (persat et al ., 2003). Recent studies suggest a therapeutic role of ex vivoadministered mbl, possibly through mblmediated complement activation and other protective mechanisms aimed both directly at the pathogen, and indirectly through modulation of the host inflammatory responses (kaur et al ., 2007). Manoproteins of this fungal pathogen are efficiently recognized by dcs and competitive mannosylated inhibitors and calcium chelators interfere with tcell stimulation . Furthermore, using transfected cell lines, the type ii ctype lectin receptor dcspecific icam3grabbing nonintegrin (cd209) was shown to have affinity for cryptococcus mannoproteins . Dendritic cells are also able to stimulate mannoproteinspecific t cells, suggesting that dcs provide a crucial link between innate and adaptive immune responses to c. neoformans via a process that is dependent upon the efficient uptake of mannoprotein by mrs (mansour et al ., 2006). However, in the presence of macrophages, binding of encapsulated c. neoformans is minimal in absence of opsonins . Following incubation in serum, c. neoformans potently activates complement, resulting in surface deposition of the third component of complement . Macrophages bind and phagocytose opsonized c. neoformans via three major complement receptors (cr) for c3 fragments, designated cd35 (cr1), cd11b / cd18 (cr3) and cd11c / cd18 (cr4). Antibody in normal human serum generally lacks opsonic activity, although vaccination can elicit anticapsular antibodies that are opsonic . The major component of cryptococcal capsule, gxm, is shed from the fungus and circulates in the blood and cerebrospinal fluid of patients with cryptococcosis . Gxm binding to macrophage receptors triggers activation of nuclear factorkb (nfb), but not mitogenactivated protein kinases (mapk). As stated before, the skeletal component of the cell wall of the majority of fungal pathogens is based on a core structure of 1,3 glucan covalently linked to 1,6 glucan and chitin . These polymers form hydrogen bonds between adjacent polysaccharide chains to form a threedimensional network of microfibrils . It is generally accepted that these skeletal components of the cell wall are found close to the cell membrane in an inner layer; however, some chitin and glucan can be present throughout the thickness of the whole wall . Candida albicans cell wall comprises approximately 60% glucan (klis et al ., 2001). Although initially thought to be hidden under the mannoprotein external layer, recent evidences suggests that glucans are indeed exposed on the cell surface although restricted to specific regions, such as bud scars (gantner et al ., 2005). Glucans can stimulate leucocytes in vitro, which induces cytotoxic and antimicrobial activities as well as the production of proinflammatory mediators, cytokines and chemokines (brown and gordon, 2005). Glucans are released into the circulation during systemic fungal infections (obayashi et al ., 1995). Cr3 is an integrin that recognizes pathogens opsonized by ic3b (the inactivated form of complement component c3b) and glucans . Carbohydrate recognition is mediated by a lectin domain (diamond et al ., 1993; 1996), which is distinct from the normal ligandbinding site (the i domain) of cr3 (diamond et al ., 1993). The lectin domain mediates recognition of both the yeast and hyphal forms of c. albicans (forsyth et al ., 1998; forsyth and mathews, 2002), as well as several other fungi . Recognition by cr3 does not trigger protective host responses, such as the respiratory burst (wright and silverstein, 1983), and can repress proinflammatory signals (wright and silverstein, 1982; brandhorst et al ., dectin1 is a transmembrane receptor that contains a nonclassical extracelular ctype lectin domain that specifically recognizes 1,3 glucans (brown and gordon, 2001; brown, 2006) and which is expressed in the surface of myeloid cells (monocyte / macrophage, dcs and neutrophil lineages) (taylor et al ., 2002; brown, 2006). It was initially demonstrated that this receptor triggers the phagocytosis of glucan containing particles when expressed on the surface of nonphagocytic cells (brown and gordon, 2001) and that significantly contributes to the immunological response against fungal glucans (brown et al ., later, it was shown that this molecule, which is expressed at low levels on macrophages but higher levels on dendritic cells, was recruited to phagosomes containing zymosan (brown et al . Dectin1 can recognize several fungi, including c. albicans yeast, although it does not appear to recognize c. albicans hyphae (gantner et al ., 2005). The cytoplasmic tail of dectin1 contains an itam, which can mediate various protective responses through spleen tyrosine kinase and caspase recruitment domain protein 9 (syk card9)dependent pathways, such as the stimulation of interleukin 2 (il2), il10 (rogers et al ., 2005), il6 and il17 production (leibundgutlandmann et al ., 2007). Although sykdependent signalling from dectin1 is sufficient for these responses, stimulation of the mapk nfb pathways, with subsequent production of proinflammatory cytokines, such as tumour necrosis factor (tnf), requires collaborative signalling with the tlr2 receptor (brown et al . A recent study suggests that phagocytosis of c. albicans by neutrophils can be mediated by the recognition of the cell wall component 1,6 glucan (rubinbejerano et al ., 2007). Beads coated with 1,6 glucan are well ingested by neutrophils, and the treatment of yeast cells with 1,6 glucanase results in a reduced phagocytosis . This recognition appears to be mediated by cr3 following opsonization by c3d fragments that bind 1,6 glucan . In a. fumigatus dectin1 is involved in generating inflammatory responses to specific morphological forms of this organism both in vitro and in vivo . Aspergillus fumigatus possesses a cell wall significantly made up of glucans (similar to c. albicans) (beauvais and latge, 2001). Alveolar macrophages are critical for recognizing and reacting to a. fumigatus leading to production of proinflammatory cytokines such as tnf, il1, ccl3/mip1, cxcl2/mip2, il6, gmcsf and gcsf, all of which are significantly attenuated by blocking dectin1 with monoclonal antibodies (steele et al ., 2005). In addition, tlr2 plays an accessory role with dectin1 in mediating the alveolar macrophage inflammatory response to live fungal cells . Resting conidia are inhaled into the lung and go through phenotypic changes that lead to recent evidences suggest that the inflammatory response triggered by alveolar macrophages is different depending on the morphological stage and glucan exposure of the fungal cells recognized . In this sense, cytokine and chemokine production mediated by dectin1 occurs only during the swelling and germination of conidia (steele et al ., this result confirms that no specific morphology is intrinsically associated in fungi with virulence, as it was already known from the clinical experience with fungi . Dectin1 recognition of germ tubes also stimulates tnf production in the absence of tlr2 and myd88 signalling (gersuk et al ., 2006). An interesting observation is that yeast cells normally mask the glucan to immune cells . When c. albicans cells are switched to a filamentous mode of growth under host environmental conditions, they mask glucan that is exposed in yeast cells and, as a consequence, they are unable to activate dectin1 mediated defences (gantner et al ., 2005). This result suggests the appealing possibility that fungi have evolved to escape immune system recognition through the masking of specific components of the cellular surface that could be able to trigger an effective antifungal response . In fact, a recent screening in s. cerevisiae for the enhanced recognition by glucan antibodies has led to the identification of several genes involved in this process and, among them, some signalling pathways controlling cell integrity (wheeler and fink, 2006). A similar behaviour has been observed in other fungal pathogens . In a. fumigatus resting conidia are ingested by macrophages but generate a reduced and controlled immune response without absence of reactive oxygen species . This is consistent with the fact that glucan is also masked in this cellular type . In contrast, maturing conidia and germ tubes are able to bind dectin1 and generate a productive antifungal response in collaboration with tlrs (gersuk et al ., 2006). In h. capsulatum, the less common polysaccharide, 1,3 glucan, has been correlated with pathogenicity or linked directly to virulence by a yetunknown mechanism . Histoplasma capsulatum exposes 1,3glucan in the outermost layer of cell wall and contributes to pathogenesis by concealing immunostimulatory glucans from detection by host phagocytic cells . Production of proinflammatory tnf by phagocytes is suppressed either by the presence of the 1,3 glucan layer on yeast cells or by rna interference based depletion of the host glucan receptor dectin1 . Thus, it has revealed an important mechanism by which h. capsulatum thwarts the host immune system (rappleye et al ., 2007). By contrast, little is known regarding glucan recognition in c. neoformans . A recent work, however, suggests that dectin1 is not required for the host defence to c. neoformans as the authors did not found significant differences in the clinical course and cytokines production between dectin1 genedeficient and control mice, suggesting that dectin1 is not essential for the development of host protective responses to the fungal pathogen (nakamura et al ., 2007). On one hand, chitin, a less studied polysaccharide component of the c. albicans cell wall, induces recruitment of immune cells that principally release il4 and il13 (van der graaf et al ., 2006). Little is known about the recognition pathways of chitin, its role during c. albicans infections and recognition receptors . On the other hand, bacterial and fungal dna that is poorly methylated, in contrast to mammalian dna, has been proposed to be instrumental in the recognition of nonself dna by tlr9 (wagner, 2001). Although the recognition of fungal dna has not been properly demonstrated, the involvement of tlr9 in the recognition of c. albicans is supported by the observation that cytokine production from cd4 + t cells from tlr9/ mice is skewed (higher il4, lower ifn) compared with cytokine production from cd4 + t cells derived from wildtype mice upon challenge with c. albicans yeast (bellocchio et al ., 2004). No studies have investigated the possible role of rna recognition systems (that is, tlr3, tlr7 and tlr8) in the host response to c. albicans infection . Although the surface structures being recognized by the host cells are beginning to be determined precisely, much more work is needed to understand the interaction of fungal pamps with their receptors on the host cell membrane . For example, little is known about the recognition of components of the fungal cell wall like chitin, surface proteins or products that are secreted by fungal cells . Recognition of the different morphologies associated with fungi promises to be an attractive area for future research as they are important evasion mechanisms . In this sense, it is important to note the differential exposure of several structures of the cell wall (such as glucan), depending on the fungal morphology with mannans and glycans acting as shields that may mask immune responses . Although both mannans and glucans can induce proinflamatory signals, the parallel stimulation of the mannan and glucan recognition pathways has a synergistic effect on the amplification of the immune response . May therefore provide essential information in order to develop novel antifungal therapies and a challenge for basic research . It is clear that the pathogen host interaction results in a bidirectional talk, where both the microorganism and the host cells are in a permanent dialogue, influencing each other's behaviour . The identification of the key components of such interplay at the molecular level (signals, mechanisms and responses) will have important consequences in the future and will surely allow better approaches to treat fungal infections . Although the surface structures being recognized by the host cells are beginning to be determined precisely, much more work is needed to understand the interaction of fungal pamps with their receptors on the host cell membrane . For example, little is known about the recognition of components of the fungal cell wall like chitin, surface proteins or products that are secreted by fungal cells . Recognition of the different morphologies associated with fungi promises to be an attractive area for future research as they are important evasion mechanisms . In this sense, it is important to note the differential exposure of several structures of the cell wall (such as glucan), depending on the fungal morphology with mannans and glycans acting as shields that may mask immune responses . Although both mannans and glucans can induce proinflamatory signals, the parallel stimulation of the mannan and glucan recognition pathways has a synergistic effect on the amplification of the immune response . May therefore provide essential information in order to develop novel antifungal therapies and a challenge for basic research . It is clear that the pathogen host interaction results in a bidirectional talk, where both the microorganism and the host cells are in a permanent dialogue, influencing each other's behaviour . The identification of the key components of such interplay at the molecular level (signals, mechanisms and responses) will have important consequences in the future and will surely allow better approaches to treat fungal infections.
Mutations in psen1 and psen2 genes, which encode polytopic proteins termed presenilin 1 (ps1) and presenilin 2 (ps2), respectively, cause autosomal dominant early - onset familial alzheimer's disease (fad). Both ps1 and ps2 proteins (ps) share about 63% homology with the highest similarity in the transmembrane domains where most of the fad - linked mutations are found [2, 3]. Since the first report of mutation in the psen1 on chromosome 14, about 170 mutations have been identified, making mutations in psen1 the most common cause of autosomal dominant early - onset ad . In the case of psen2, 18 mutations have been reported so far, although not all have been confirmed to be pathogenic [2, 5]. As a probable explanation for the disparity between the two genes, defects in psen2 function may be offset by the normal function of its homolog psen1 . In support of this view, psen2 null mice do not exhibit the phenotypic and functional defects seen in mice lacking psen1 gene . Psen1 knockout (ko) mice are lethal, and disruption of psen2 and psen1 genes causes earlier embryonic lethality compared to psen1 ko [610]. As supported by mouse model studies, it appears that ps1 contributes largely to total -amyloid (a) production in the brain [11, 12]. Ps is the catalytic subunit of -secretase, the enzyme responsible for intramembraneous cleavage of amyloid precursor protein (app) to generate peptides . Fad - linked ps variants enhance the production of highly fibrillogenic a42 peptides that are deposited early in the brains of patients with ad . Ps is ubiquitously expressed in the nervous system and peripheral tissue and found localized in secretory and endocytic organelles in all cell types, as well as synaptic structures in neurons [14, 15]. As predicted from its broad pattern of expression, ps's function extends far beyond processing of app and the pathogenesis of ad . For example, ps's catalytic function is required for intramembraneous -secretase cleavage of notch receptors, which releases the notch intracellular domain (nicd). Nuclear signaling mediated by nicd is essential during mammalian development; mice with ablated psen1 alleles die in late embryogenesis and exhibit phenotypes reminiscent of mice lacking notch 1 [6, 7]. Thus, ps - dependent activation of notch signaling is essential for early development . Transgenic expression of fad - linked mutant ps1 fully rescues the developmental phenotypes in mice with psen1 deficiency [16, 17], supporting the notion that fad - linked ps1 variants are functional, but acquired deleterious properties that have profound pathophysiological consequences . Candidate approaches and proteomic studies have identified a wide spectrum of type i membrane proteins that undergo -secretase cleavage, including notch ligands, deleted in colorectal cancer (dcc), and cadherins (reviewed in [13, 1821]). Uniformly these substrates all undergo an ectodomain shedding by -secretases, which in many cases is triggered by the binding of extracellular ligands . Interestingly, several noncatalytic -secretase - independent functions have been assigned to ps, such as its role in regulating intracellular calcium homeostasis (reviewed in). Synapses are continuously reconfigured, both structurally and functionally, during embryonic development and throughout adult life, forming the basis for learning and memory [23, 24]. Neuronal inability to exhibit such plastic changes has been proposed to be a root cause for various psychiatric and neurodegenerative disorders such as ad [23, 25, 26]. Not surprisingly, the duration and severity of cognitive impairments in ad patients closely parallels the extent of synaptic loss, leading to the notion that synaptic dysfunction is a critical element in the pathophysiology of ad . Notably, memory and cognitive decline observed in ad patients correlate better with the synaptic pathology than either a plaque load or tangle density, and synapse loss appears to precede neuronal degeneration . Findings from several laboratories suggesting that a might play a critical role in synaptic dysfunction have added significant information to the traditional amyloid cascade hypothesis of ad [28, 29]. A can affect synaptic transmission [3033], synaptic protein localization, ampa and nmda receptor trafficking [35, 36], and spine formation [35, 3739]. Fad - linked mutations in ps1 were originally thought to enhance the production of a42 peptides by a gain - of - function mechanism . However, it is becoming clear that fad - linked ps1 variants also exhibit partial - loss - of - enzymatic - function observed as diminution of a40 peptide production and defects in the extent of processing certain other transmembrane substrates (reviewed in [40, 41]). For example, fad - linked ps1 mutations are thought to attenuate -secretase processing and generate reduced levels of the intracellular domains of app, notch, n - cadherin, ephb2, and epha4 [4245]. Taken together, it is plausible that fad - linked mutations in ps1 exert pathophysiological effects on the synapses by elevating a42 levels and by a-independent mechanisms involving altered processing of -secretase substrates involved in synaptic function . This paper discusses findings from various animal models that reveal the role of ps and fad - linked ps mutations in synapse formation and function . Several mouse models (reviewed in; see http://www.alzforum.org/res/com/tra/) and a few rat models [4750] have been developed in order to recapitulate the main pathological features of ad and elucidate the mechanisms by which fad - linked ps mutations contribute to ad pathogenesis . A variety of mouse models have been characterized such as mice expressing fad - linked ps variants harboring point mutations or deletion mutation [51, 52], and fad - linked psen1 knock - in (ki) [m146v variant, i213 t variant and p264l variant], and e10 loop deletion ki . These fad - ps1 single transgenic or ki mouse models do not exhibit significant a deposition in the brain . Therefore, the phenotypes described in these fad - ps1 single transgenic mice are not due to classical a pathology . In an attempt to reproduce more closely the human ad pathology, psen1 ki coexpressing app swedish mutant and hyperphosphorylated tau mutants have been made . In order to study the physiological function of ps, ko models of psen1 and psen2 [610], psen1 conditional ko [5860], as well as double psen1 and psen2 conditional ko mice have also been created . In order to examine amyloid pathology, transgenic mice expressing app mutants in a ps null background have been developed; such as psen1 conditional ko coexpressing app v717i variant and app v717f variant . In these models, a deposition is attenuated by the lack of ps1 expression and consequent loss of -secretase activity . Besides their utility in examining proteolytic processing of app into a40 and a42 peptides in vivo and phenocopying pathological hallmarks of ad (amyloid deposition and tau phosphorylation), these models have been extensively used to examine changes in synaptic transmission, synaptic plasticity, and associated signaling . In addition, several groups have generated drosophila models (reviewed in), and caenorhabditis elegans models (reviewed in) expressing human ps1 or ps2 bearing fad - linked mutations, in an effort to understand mechanistic contribution of ps to ad pathology and neuronal dysfunction . Synaptic transmission and long - term potentiation (ltp) contribute to several forms of memory storage . Using slice preparations from transgenic mice, we and others have demonstrated that expression of fad - linked ps1 does not alter basal synaptic transmission, but leads to higher degree of ltp induction in the hippocampus ([57, 6569] reviewed in). However, one group has reported impairment of synaptic transmission associated with an increase of paired - pulse facilitation, an index of presynaptic release, in neurons of 6 month - old psen1 m146v ki mice . Ltp induction by high - frequency stimulation in hippocampal ca1 area was also enlarged in this animal model . Interestingly, in psen1 m146v ki animal model, ltp induced by carbachol (a muscarinic agonist) was reduced in ca1 hippocampal area, suggesting that fad - linked ps1 variant might interfere with cholinergic cellular cascades as well . The ki mouse models allow us to examine the functional properties of molecules associated with pathology when they are expressed at endogenous levels without any alteration in their spatial or temporal pattern of expression . Therefore, ki animal models give us the opportunity to rule out pathophysiological consequences (such as protein misfolding) associated with aberrant overexpression of proteins associated with human genetic disorders . Interestingly, it has been described that the lack of ps function or overexpression of ps1 mutant was also associated with changes in presynaptic function . We have observed an increase of spontaneous miniature excitatory postsynaptic current in cortical neurons isolated from psen1 ko mice, while others have reported that expression of mutant ps1 in cultured hippocampal neurons depresses synaptic transmission by reducing the number of synapses . Another group has also observed that ps1 deficiency increases synaptic release and affects the number and docking of synaptic vesicles . It was also shown that basal transmitter release was increased at the neuro - muscular junction in drosophila lacking ps expression . However, even though basal synaptic transmission seems to be intensified in this later model, synaptic strength and plasticity were impaired after posttetanic potentiation . As a likely consequence,, it has been reported that ltp induction declines more rapidly in ca1 hippocampal area of mice with only one allele of psen1 . In agreement with these observations, it has been recently found that a ca3-dependent presynaptic form of ltp in the hippocampus was attenuated in double psen1 and psen2 conditional ko mice . Intriguingly, single psen1 conditional ko mice do not show major changes in brain plasticity, suggesting that expression of ps2 might be sufficient to overcome the 6080% loss of ps1 in the forebrain of these animals . First of all, it becomes apparent from these studies that ps is an essential element for the normal synapse function . Second, it becomes evident that ps dosage is a critical component for ps - dependent cellular function(s). Indeed, ps1 expression is developmentally regulated in rodent brain, reaching a peak of expression during the critical period of synaptogenesis between postnatal days 7 to 14 . Accordingly, we can stipulate that ps - dependent substrates expressed during embryogenesis or early in development may significantly contribute to synaptic physiology . In this regard, it also remains to be established whether differences in ps - dependent proteolysis of developmentally regulated molecules might underlie changes in synaptic function later on in life . A well - known example is a condition where stress - induced early life biochemical events influence life - span changes in cognitive function and ad - associated abnormalities . Accordingly, it has been proposed that age - related decline in cortical cholinergic function in ad patients might have developmental origins . Finally, it has also been speculated that ps - dependent modulation of signaling pathways that are important in development may contribute to the neurodegenerative process . Taken together, studies from various laboratories suggest that ps is specifically involved in cellular component(s) necessary for synaptic transmission and plasticity, and that fad - linked mutations in ps1 may disrupt the normal cascade of synaptic events . A distinct feature of the nervous system is the intricate network of synaptic connections among neurons . The changes in the strength and efficacy of existing synapses, as well as remodeling of connectivity through the loss and gain of synapses in the neuronal network, are believed to be the basis of learning and memory in the brain . Interestingly, ltp has been associated with the increase in spine formation and spine head growth, whereas long - term depression (ltd) has been associated with spine shrinkage and retraction . The morphology of dendritic spines is known to change in response to several factors including learning, age, hormones, and disease conditions . In addition to their morphological plasticity, spine - like protrusions also display rapid motility, changing shape and size in a matter of seconds to minutes . This morphological plasticity suggests that long - term memory might be encoded by alterations in spiny structures and associated synaptic contacts . Collectively, these events are critically important in synaptogenesis, in modulating of existing synapses, as well as in long - term synaptic plasticity [83, 84]. It has been reported that a is closely associated with a decrease of spine formation and motility [35, 37, 85]. Overproduction of a in ps mutant transgenic mice coexpressing the swedish app mutant causes age - associated decrease of synaptic excitability [57, 86, 87] and spine collapse [38, 88]. However, it has also been reported that acute a application (less than 4 h) was associated with an increase of filopodia and growth cones in hippocampal cultures . In support of this idea, it was shown that application of low levels of a is associated with an increase of ltp, whereas higher concentration of a reduced synaptic potentiation [32, 90]. Collectively, these observations suggest that a might have dual roles on synapse formation . Conflicting results have also been observed in regard to spine morphology in neurons lacking ps expression . Treatment with compound e, a -secretase inhibitor (10 nm; 24 h), produced an increase of spine - like protrusions in isolated neurons [71, 91]; whereas the density of spines was found to be decreased upon prolonged treatment with the same inhibitor (50 nm; seven days). In addition, neurons lacking both ps1 and ps2 expression have marked diminution in spine density . To further support the effect of -secretase inhibition on dendritic spines, recent in vivo study showed that -secretase inhibitor treatment in wild - type mice significantly reduced the number of spine density in somatosensory cortex, while -secretase inhibitor treated app null mice did not exhibit any effect . These findings suggest that app - dependent mechanism may underlie the ps - dependent morphological changes observed . The apparent discrepancy between inhibitor treatment and loss of ps expression on spine density may be also due to differential effects of inhibitors that target mainly -secretase and genetic inactivation of ps that results in reduced -secretase - dependent and -independent function . All together, these observations support the idea that ps gene dosage and the level of expression may differentially influence synaptic morphology . Although the molecular mechanisms that underlie these morphological changes are not completely understood, emerging evidence supports at least two important signaling pathways that have been linked to dendrite spine formation and ad etiology: (1) camp - dependent activation of pka has been shown to be critical for the maintenance of the late phase of ltp, and downstream phosphorylation of creb has been linked to formation of new spines . Interestingly, it has been shown that a inhibits pka / creb pathway, (2) the rho family of small gtpases, well - known regulators of the actin cytoskeleton, has profound influence on spine formation . Among the members of this family rac1, cdc42, rnd1, and ras promote spine formation and growth, whereas rap and rhoa induce shrinkage and loss of spines [80, 95]. P21-activated kinase (pak) is a downstream signaling effector of the rho / rac family of small gtpases and has been shown to be associated to spine formation and memory consolidation . A recent paper by shuai and colleagues suggests that the act of forgetting might also be linked to activation of the rac pathway, using a simplistic model of olfactory learning in the fruit fly drosophila . With the help of genetic manipulation, they were able to distinguish changes in rac activity during passive memory decay, interference learning, and reversal learning, which are three different forms of forgetting events . In drosophila olfactory memory model, it appears that camp / pka and rac / pak - dependent memory acquisition and forgetting events are independent, as suggested by this group and others [98, 99]. In a more complex system, as it has been proposed in the mammals, it seems that memory consolidation might mechanistically require both pathways [96, 100, 101]. As demonstrated by several groups, rac signaling cascade in the brain is directly linked to an increase of spine formation through subsequent activation of pak leading to f - actin polymerization and changes in membrane morphology . Besides the known involvement of camp / pka / creb activation cascade, rac / pak - dependent cellular events also appear to be intimately associated with the process of memory consolidation, at least in rodents . It is very exciting to think that perhaps similar cellular pathways as the one described above may be relevant to human disorders associated with memory dysfunction . One of the known hallmarks of ad is that patients do forget recent events, therefore, they are unable to consolidate their new memory . In our lab, we have shown that the lack of ps function or expression in cortical neurons produced an increase of steady - state levels of creb and rac / pak cascade activation, which was also associated with an increase of spine - like protrusions . Even though our study shows increase of phosphorylated creb especially in dendritic area, more recently, shen and collaborators have shown that creb transcription was indeed reduced in ps deficient neuron through ps - independent mechanism . Are these signaling events meaningful in the context of ad? Perhaps . As discussed above, recent studies support the idea that fad - linked mutations in ps1 might cause a partial loss of function [40, 41]. It still remains to be determined whether rac / pak signaling is altered in neurons expressing fad - linked ps1 variants . If this is the case, one might want to consider the possibility that changes in camp / pka / creb or rac / pak signaling in neurons might represent some of the earliest cellular dysfunctions that are relevant to synapse elimination and associated cognitive decline in ad . -secretase - dependent ps function mediates transmembrane proteolysis of several substrates including app, n- and e - cadherins, -protocadherin, cd44, dcc, ephrin / eph receptors, leukocyte - common antigen related, nectin-1, and syndecan (reviewed in [18, 20, 21]). Many of these substrates function as cell - adhesion molecules or cell surface receptors and are known for their diverse functions during development and are involved in axon guidance, neuronal outgrowth and synaptogenesis [103113]. In addition, these molecules are also well known to be coupled to diverse intracellular signaling pathways [20, 44, 45, 108110, 114118]. It has been proposed that app can affect synaptic function by its dual roles via its cell adhesive properties or through its putative receptor - like intracellular signaling components [112, 116, 117]. Indeed, it has been shown that accumulation of the app intracellular domain can mediate a phosphoinositide - dependant calcium signaling . Several other substrates of -secretase are also coupled with intracellular signaling events that can potentially influence synaptic function . For example, eph receptors and n - cadherin are known to be coupled to rac and creb signaling, respectively [45, 115, 117, 120, 121]. Lack of ephb expression or kinase - defective ephb is associated with a reduction in glutamatergic synapses and abnormal spine development [120122]. It has also been shown that three substrates of ps, namely erbb4, -protocadherin, and leukocyte - common antigen related, are associated with psd-95 clustering at the synapse [123, 124] and ampa receptor function . Consistent with these findings, we have previously reported that the lack of ps function increases axodendritic contacts, which was accompanied by increases of psd-95 clusters, spine - like protrusions, and ampa receptors - mediated synaptic transmission [71, 91]. Moreover, ps1 ko neurons and wt neurons treated with -secretase inhibitors exhibited increases in the extent of camp / pka activation [71, 91]. Camp / pka signaling plays a critical role in regulating short and long - term synaptic physiology . It has been demonstrated that stimulus - induced activation of pka pathway can also affect the synaptic morphology; therefore, it can indirectly affect basal synaptic transmission . Thus, there exists a close relationship between increased phosphorylation of pka substrates and enhanced synaptic transmission in neurons lacking ps function [71, 91]. Signaling downstream of dcc, the netrin receptor, is also modulated by -secretase activity . Upon binding of the ligand netrin, dcc undergoes metalloprotease - dependent ectocomain shedding, which generates a membrane - tethered dcc c - terminal fragment (ctf) derivative, consisting of the transmembrane segment and the intracellular domain . Dcc ctf undergoes intramembraneous proteolysis by -secretase, and accumulation of dcc ctf in neuroblastoma cells treated with -secretase inhibitors stimulates neurite outgrowth [71, 129]. -secretase processing of dcc attenuates camp - dependent signaling cascades associated with dcc ctf . In this case, it is clear that -secretase terminates intracellular signaling associated with dcc . However, it remains to be determined if -secretase cleavage of other substrates would significantly impact cellular functions, especially pertaining to synaptic process, through termination of receptor - mediated signaling events (see our proposed model in figure 1). More recently, it was found that epha4 undergoes ps - dependent endoproteolytic process, and epha4 ctf accumulates following inhibition of -secretase activity or in cells lacking ps expression . Accumulation of epha4 ctf was found tightly linked to an increase of spine - like protrusions in hippocampal cultures . Overexpression of an inactive rac form abolished the enhancement of dendritic spines in neurons and lamellipodia formation in nih3t3 cell lines . In addition, this study showed that overexpression of membrane - tethered epha4 intracellular domain was also associated with an increase of lamellipodia formation in nih3t3 cell lines . All together, these results suggest that enhanced accumulation of epha4 intracellular domain may induce rac - dependent signaling events that regulate cell morphology . It is clear that loss of intramembraneous proteolysis of -secretase substrates leads to the accumulation of their membrane - tethered cytosolic domains . The ctfs of certain substrates might serve as membrane anchors to facilitate the recruitment of signaling proteins in a manner that enhances phosphorylation of downstream signaling substrates . One of the signalings that have been implicated with ps function is gsk3 (reviewed in). It is well established that ps1 can interact with the gsk3/-catenin complex [131133]. However, besides this direct physical interaction with ps1, it is known that gsk3 is a ligand - receptor signaling molecule downstream of the activation of phosphatidylinositol-3-kinase pathway (reviewed in). Specifically, it has been shown that gsk3 signaling is important for axon specification and elongation during the establishment of neuronal polarity (review by). In addition, it has been reported that decrease of gsk3 activity parallels ltp induction paradigms, whereas inhibition of phosphatidylinositol-3-kinase and subsequent activation of gsk3 lead to decrease of ltp (; reviewed in [130, 137]). Decreased phosphorylation of gsk3 at the ser 9 residue, indicative of an increase of gsk activity, was also observed in ps1-deficient neurons as well as in ps1 neurons carrying fad - linked mutations [69, 138141]. Alteration of phosphatidylinositol-3-kinase /akt signaling cascade has been proposed to be the link between gsk3 activity and ps function [138, 140, 142]. Interestingly, increase of gsk3 activity also leads to hyperphosphorylation of tau protein, which underlies one of the known pathological hallmarks of ad, namely the tangle formation (reviewed in). It has been proposed that membrane microdomains rich in cholesterol and sphingolipids, termed lipid rafts, might influence -secretase activity and processing of substrates (reviewed in). Lipid rafts play an important role in the maintenance of synapses through dendritic spine formation and ampa receptor function . Raft - dependent mechanisms facilitate trafficking of receptors in and out of the synapse and regulate synapse function (reviewed in). Lipid rafts are known to serve as membrane platforms that compartmentalize diverse receptor - mediated signaling . Indeed, it was found that critical regulation of signaling associated with erbb4, dcc, and epha4, three -secretase substrates, involves their recruitment into lipid raft microdomains [45, 146, 147]. Based on the differences in spatiotemporal distribution of -secretase complexes and substrates [148, 149], different ps - dependent substrates might be subjected to different level of proteolysis depending on their membrane microdomain distribution at a given time during embryonic development and in adult life . Besides a direct interaction of -secretase substrates with intracellular phosphorylation cascades, one of the key features of ps function is its role in intracellular ca homeostasis (reviewed in [22, 150, 151]). Several studies have concluded that fad - linked ps mutant expression in transfected cells and cultured neurons is associated with enhanced ca release from endoplasmic reticulum store . It has been reported that neurons generated from psen1 m146v ki mice exhibit an increase of ip3-evoked ca responses in brain slices as early as in one month old . This ca dysregulation appears to be specific to intracellular endoplasmic reticulum store since it does not affect the voltage - gated ca entry . However, it has been shown that l - type ca channel may be involved after stress induction at the neuromuscular junction in drosophila larvae expressing fad - linked ps1 mutant . Accordingly, in this model system, the level of synaptic plasticity and memory paradigm was normal following heat shock stimulation or endoplasmic reticulum stress, but reduced after 24 h of stimulation recovery . These results suggest that mutation in ps might alter synaptic behavior following recovery of stress conditions . It has been also proposed that ps might serve as a passive ca leak channel in the endoplasmic reticulum and fad - linked ps variants might fail to exhibit this property . Using reconstituted planar lipid bilayers, tu and collaborators demonstrated that ps by itself could form low - conductance divalent ion channels, which was not the case in several mutated forms of ps . It remains to be determined if results from these experimental conditions are applicable to in vivo situations that are relevant to the disease state . More recently, stutzmann and collaborators have established that the ryanodine receptor - evoked ca release (especially through ryr2 isoform) was increased in ca1 hippocampal slices of psen1 m146v ki mice coexpressing swedish app and hyperphosphorylated tau mutants . As a consequence, they observed an aberrant increase of ryanodine - dependent presynaptic neurotransmission, along with increases of long - term synaptic plasticity . Conversely, shen and collaborators have observed a decrease of ryanodine - dependent presynaptic release in hippocampal neurons of ps - deficient mice . All together, stutzmann group concluded from their study that significant ca alterations are present at an early age even though ca homeostasis appears to be maintained . Compensatory mechanisms seem likely to take place in order to maintain normal synaptic function in early age . However, these subtle ca - mediated alterations may have profound impact later on that can affect synaptic and cognitive functions in disease states . However, it is becoming clear that fad - linked mutations in ps proteins affect diverse physiological processes in addition to promoting the production of highly fibrillogenic a42 peptides . The identification and characterization of -secretase substrates and the mechanistic details on the successive cleavage of substrates by the -secretase have enhanced our understanding of how partial loss - of - function associated with fad - linked ps mutations can in fact lead to a gain of activities with reference to intracellular signaling associated with certain substrates such as dcc, erbb4, and epha4 . At least in some cases, lack of -secretase processing leads to profound changes in synaptic structure and functions as a consequence of sustained intracellular signaling by substrate ctfs . As details begin to emerge on additional -secretase substrates, it will be possible to determine whether -secretase cleavage of neuronal receptors is indeed a regulatory step that modulates physiological signaling downstream of ligand binding and ectodomain shedding . Still, the major task is to establish whether or not altered signaling directly contributes to ad pathogenesis and/or ad - related synaptic dysfunction.
Familial hypocalciuric hypercalcemia (fhh) is a heterogenic, autosomal dominantly inherited disorder characterized by hypercalcemia with (relative) hyperparathyroidism, and hypocalciuria 1 . Classically, fhh is caused by inactivating mutations in the gene encoding the calciumsensing receptor (casr) on chromosome 3q13, termed fhh type 1 (fhh1) 2, 3, 4 . Recently, further two fhh phenotypes have been identified; fhh2 have been shown to be caused by inactivating mutations in the gene encoding subunit alpha11 of the g protein (gna11) on chromosome 19p13.3 and fhh3 by mutations affecting codon 15 (p.arg15leu, p.arg15cys, and p.arg15his) in the gene encoding the adaptor protein 2 sigma subunit (ap2s1) on chromosome 19q13.32 5, 6 . However, it is an important differential diagnosis to primary hyperparathyroidism (phpt). Due to the biochemical similarity to mild phpt, patients are at risk of being referred to parathyroidectomy (ptx) which does not benefit patients with fhh1 . New data, however, suggest that fhh3 is associated with hypercalcemic symptoms in> 20% of patients 10, thus giving rise to suspicion that mutations in ap2s1 have more deleterious effects . At the time of writing, 55 index cases of fhh3 have been reported 6, 10, 11, 12, 13 . We now report a family with fhh3 among whom two brothers had ptx performed due to suspected phpt with one of the brothers having a concomitant diagnosis of a neuroendocrine tumor (net). The study is conducted in accordance with the helsinki declaration and approved by the health research ethics committee in the central denmark region (no . The index case, a male born in 1976, was diagnosed with hyperparathyroid hypercalcemia at the age of 36 (table 1). Despite only moderate hypercalcemia (ionized calcium 1.48 mmol / l), he had numerous symptoms possibly attributable to hypercalcemia including tiredness, a progressive feeling of muscle weakness, and pain in the upper extremities . Dxa scans showed a normal bmd at the hip (tscore 0.3) and mild osteopenia at the lumbar spine (tscore 1.3) and forearm (tscore 1.3) 14 . Creatinine clearance ratio (cccr = 0.005), a genetic test was performed for fhh1, which is in accordance with the diagnostic guidelines for phpt 15 . Family screening revealed a father with intermittently elevated serum levels (total calcium 2.522.62 mmol / l).the oldest brother (born 1971) refused testing, whereas another brother (born 1973) had normocalcemia . Biochemical characteristics of the fhh3 family means of the biochemical measurements of affected members in the fhh3 family . Cccr, calcium creatinine clearance ratio . * treated with cinacalcet . * * treated for hypoparathyroidism . Besides hypercalcemic symptoms, the index patient also had gastrointestinal symptoms (46 loose stools per day), leading to a colonoscopy, which showed an intussusception of the terminal ileum . Histological examination showed a radically excised intermediategrade net, which was immunohistochemically positive for cd56, chromogranin a, and synaptofysin . The cooccurrence of hyperparathyroid hypercalcemia and a net leads to suspicion of a multiple endocrine neoplasia (men) syndrome, but additional genetic tests did not reveal mutations in cdc73, ret, protooncogene, or men1 . Biochemical testing and scans of the pituitary gland and the pancreas showed no signs of additional tumors . Due to the patients young age and the clinical suspicion of a men1 syndrome, the hyperparathyroid hypercalcemia was considered as a state of phpt and he was referred to ptx . Prior to surgery, neck ultrasound suggested an enlarged parathyroid gland on the right inferior side of the thyroid gland, but a parathyroid scintigraphy (pertechnetate/99mtcmibi) did not support the finding . Subtotal ptx was performed in march 2014 with removal of the upper right and lower left glands, as well as half of the upper left gland and the thymus gland . Following the second operation, calcium and pth levels remained elevated and the patient had sustained complaints of hypercalcemic symptoms . Accordingly, treatment with cinacalcet was initiated causing normalization of serum calcium levels and symptomatic relief . Due to the improved wellbeing following normalization of calcium levels, a third ptx was performed 6 months later with removal and partial autoimplantation of the remaining halfgland on the right thigh (vastus lateralis, m. quadriceps femoris). Subsequently, the patient developed hypoparathyroidism, but despite consistent needs for treatment, he reported an improved wellbeing . Due to the complicated course of the index patient, his brother (born 1971) who initially refused biochemical screening reconsidered and had biochemical tests performed showing hyperparathyroid hypercalcemia (table 1). He only had weak complains of tiredness . Due to the occurrence of a men1like syndrome in the family, he was tested for mutations similar to the index case and underwent colonoscopy without any pathological findings . Further examinations revealed a cccr = 0.005, no renal calcifications, normal bmd (except for a hip tscore of 1.1) 14 . The lower right gland was not identified, but as pth fell from 17.0 to 3.7 pth increased, however, to supranormal levels within 10 days following surgery with persistently elevated ionized calcium levels (1.391.46 we therefore screened the two brothers for mutations in ap2s1 and gna11 and found a c.44g> a substitution in ap2s1 resulting in p.arg15his, a mutation previously reported to cause fhh3 6, 10, 11 . Screening of the remaining family revealed that the brothers had inherited the mutation from their father, whereas the mother, a brother, and three children were mutation negative (fig . The histopathological analysis of the glands from the index patients showed one gland with a focus of hyperplasia, two glands with diffuse hyperplasia, and an intrathyroidal process diagnosed as a parathyroid adenoma . The hyperplasia in one gland was characterized by dense fibrosis with hyperplasia of both chief and oxyphil cells and loss of lipid cells . In the other glands, hyperplasia was also present and characterized by loss of lipid cells and increased amount of chief cells . The adenoma showed uniform waterclear cells with solid growth pattern and few scattered isles of oxyphil cells . The removed glands from the brother also showed hyperplasia, which in one gland was characterized by loss of lipid cells and hypercellularity of both chief cells and oxyphil cells, whereas the other two glands were characterized by a more normal fat distribution although still with hypercellularity of oxyphil and chief cells (fig . Histological pictures of the parathyroid glands from the index patient (a c) and his brother (d). (a) gland from the index patients showing diffuse hyperplasia characterized by loss of lipid cells and increased amount of chief cells . (b) gland from the index patient showing a hyperplastic area in an otherwise normal gland . (c) intrathyroid parathyroid adenoma characterized by uniform waterclear cells, a solid growth pattern, and with no lipid cells . (d) gland from the brother of the index patient showing a mixed oxyphil and chief cell hypercellularity . The histopathological analysis of the glands from the index patients showed one gland with a focus of hyperplasia, two glands with diffuse hyperplasia, and an intrathyroidal process diagnosed as a parathyroid adenoma . The hyperplasia in one gland was characterized by dense fibrosis with hyperplasia of both chief and oxyphil cells and loss of lipid cells . In the other glands, hyperplasia was also present and characterized by loss of lipid cells and increased amount of chief cells . The adenoma showed uniform waterclear cells with solid growth pattern and few scattered isles of oxyphil cells . The removed glands from the brother also showed hyperplasia, which in one gland was characterized by loss of lipid cells and hypercellularity of both chief cells and oxyphil cells, whereas the other two glands were characterized by a more normal fat distribution although still with hypercellularity of oxyphil and chief cells (fig . Histological pictures of the parathyroid glands from the index patient (a c) and his brother (d). (a) gland from the index patients showing diffuse hyperplasia characterized by loss of lipid cells and increased amount of chief cells . (b) gland from the index patient showing a hyperplastic area in an otherwise normal gland . (c) intrathyroid parathyroid adenoma characterized by uniform waterclear cells, a solid growth pattern, and with no lipid cells . (d) gland from the brother of the index patient showing a mixed oxyphil and chief cell hypercellularity . Ap2s1 mutations causing fhh3 have recently been reported and only sparse data are available on patients with fhh3 . We believe that the disease courses of the patients reported raise several clinical important issues . First of all, the index case represents the first reported association between a net and fhh3 . Secondly, our report supports the previously reported notion on some patients with fhh3 having symptomatic hypercalcemia . Finally, to avoid unnecessary surgery and risk of postsurgical hypoparathyroidism, our report calls for increased awareness of the presence of mutations in other genes than the casr, which may cause fhh . The cooccurrence of a net and hyperparathyroid hypercalcemia in a relatively young patient leads to the suspicion of a men1 syndrome . Men1 is autosomal dominant inherited and is characterized by phpt, pancreatic tumors, pituitary tumors, and more seldom nets typically located to the adrenal gland, or derived from the embryonic foregut 16, 17 . Our index patient presented with assumed phpt, which is typically the first manifestation of men1 and occurs in 95% of cases 18, 19 . In addition, he had a net (formerly known as carcinoid), which have been reported to occur in 4% of men1 patients 16, 19, 20 . In retrospect, the clinical men1 diagnosis was not clearcut, with several lines of evidence suggesting that our index patient was most likely a socalled phenocopy, that is, a phenotype resembling men1 without being it 21, 22 . The net found in our index patient was located to the hindgut, which is very rare in men1 . In addition, the patient was negative for all mutations known to cause men1, although about 515% of considered men1 cases are genetically unverified 17, 23, 24 . Furthermore, only the index patient had affection of more than one organ, and as the penetrance of men1 is close to 100% in patients older than 50 years, it is unlikely that the 71yearold father should be unaffected 20, 25 . The low cccr is also not typical for phpt, but can occur due to low vitamin d. according to thakker et al ., men1 phenocopies are seen in up to 10% of cases with the causative mutations found in other genes including cdc73 and casr . Consequently, the absence of mutations in the men1 gene should lead to analysis of these genes 26 . Our case adds ap2s1 to the genes that need to be considered, when examining a clinical, but genetically unverified men1 patient . In addition to the biochemical findings, the presumed diagnosis of phpt was supported by symptoms, which could be attributable to hypercalcemia . Reports of coexisting fhh1 and phpt have previously been published 27, 28, 29 . It may therefore be considered whether the index patient had developed phpt superimposed on his inherited fhh3, which is supported by the histopathological findings showing multiple gland affection with both adenoma and hyperplasia . No previous reports on histopathological findings in parathyroid glands from fhh3 patients report adenomas, but only diffuse hyperplastic or normal glands 10, 11, 30 . However, the findings of similar serum calcium levels, pth levels, and low cccr in the index patient and his brother (table 1) do not support that the index patient had developed phpt on top of his inherited fhh3 . Rather, our findings support previous reports on hypercalcemic symptoms in approximately 20% of fhh3 patients . Ap2s1 mutations are associated with different phenotypes, where p.arg15his give cause to the mildest phenotype, that is, the lowest degree of elevated calcium levels, and also the least degree of hypocalciuria 10 . Interestingly, no correlations have been found between genotype and symptoms, and it can be speculated whether the reported symptoms are induced by iatrogenic factors as proposed by marx et al . Who found a similar level of hypercalcemic symptoms among fhh1 patients in 1981 31 . However, further characteristics of fhh3 patients need to be performed in order to clarify whether fhh3 is indeed associated with a more severe course, as well as whether there is any correlation to neuroendocrine tumors . In conclusion, we have reported the first case with cooccurrence of fhh3 and a net in the distal ilium . Although our index case was most likely a phenocopy, resembling an atypical men1like syndrome, we believe that further attention should be paid to whether fhh3 may be associated with other endocrine tumors . Furthermore, our cases underline the importance of considering fhh3 in families with hyperparathyroid hypercalcemia, including patients with a clinical suspicion of men1 who are mutationnegative, as this may spare patients for the worry of being diagnosed with a cancer susceptibility syndrome and ptx . The authors declare that there is no conflict of interest regarding the publication of this manuscript.
In a network querying problem, one is given a small network, corresponding to a known pathway or a complex of interest . The goal is to identify similar instances in a large network, where similarity is measured in terms of sequence or interaction patterns . Previous approaches to the query problem required precise information on the interaction pattern of the query and were usually limited to small queries (24 proteins). Pathblast a server for querying linear pathways within a protein protein interaction (ppi) network (1)was subsequently extended to allow searching for more general structures (2). A general framework for subnetwork querying was developed (3), but it is applicable only to very small queries due to its complexity . Two other methods are netmatch, a cytoscape (4) plugin implementing the work of ferro et al . (5) that utilizes fast heuristics for subgraph isomorphism to identify approximate matches of queries within a collection of networks, and netgrep (6), a system for searching networks for patterns corresponding to small sets of proteins with specified attributes and topology . The torque server implements a novel method for querying protein networks that does not require information on the interconnections (topology) among the query proteins (7) (figure 1). This makes torque applicable in broader scenarios, such as querying complexes or pathways whose topologies are not completely known, or even when querying from species for which ppi information is not available . (8) also studied queries with no topology information, but since their method is enumerative it was applied to very small queries (24 proteins). It was tested extensively on hundreds of queries of known complexes from a variety of species (7). It was shown to yield far more matches than the qnet topology - based approach (2), while providing results that are highly functionally coherent . The network induced by the vertices labeled a, b, c, d and e is a match to the query, where vertex c is an insertion and query element 4 is deleted . (a) the query proteins; (b) the queried network . Colored vertices in the network match nodes of the same color in the query . The network induced by the vertices labeled a, b, c, d and e is a match to the query, where vertex c is an insertion and query element 4 is deleted . The torque web server implements the algorithms in (7) for querying protein sets across species . It combines three approaches: a dynamic programming method utilizing color coding, integer linear programming and a fast heuristic based on shortest paths . Torque automatically selects the best method to apply at each stage and outputs the highest scoring match . Scores are based on the underlying network structure, on interaction confidence values and on sequence similarities between matching proteins . The input for torque consists of: a query set of proteins in species a;their protein sequences;a ppi network for species b;the sequences of the network proteins . A query set of proteins in species a; their protein sequences; a ppi network for species b; the sequences of the network proteins . All inputs are in simple text format: the query set can be entered directly as a comma - delimited or whitespace - delimited list.protein sequences are given in the standard fasta format.the ppi network is given as a text file, where each row represents an interaction and contains the ids of the interacting pair and a confidence value for it in the range [0, 1]. The query set can be entered directly as a comma - delimited or whitespace - delimited list . The ppi network is given as a text file, where each row represents an interaction and contains the ids of the interacting pair and a confidence value for it in the range [0, 1]. It is possible to use a single fasta file (input 2) for many queries, if it contains the sequences for all proteins in all queries . When the query field is left blank, torque will use all the proteins in input 2 as the query . If input 1 contains uniprot protein ids (www.uniprot.org), their sequences need not be entered in input 2; instead, torque automatically retrieves them from the uniprot database . For several target species, currently, the server supports this option for the three target species saccharomyces cerevisiae, drosophila melanogaster and homo sapiens . The user can indicate one of these target species instead of providing inputs 3 and 4 . The user can control two parameters of the algorithm, setting a trade - off between speed and sensitivity . The user can set the threshold for blast similarity (e - value). By setting a lower threshold, less homologs will be identified for the query proteins, making the algorithm faster but less sensitive . The second parameter is a threshold for the confidence values of ppi network edges provided as part of input 3 . Edges whose confidence value is lower than the threshold are discarded; hence, this parameter determines the sparsity of the target network and affects the number of possible matches and the running time . The running time of torque is typically a few minutes, but may be up to an hour, depending on the size and other properties of the query (for more details, see (7)). If several queries are submitted to the server at the same time, they are queued and executed sequentially . Rather than waiting for the results online, they can be accessed later, in two ways: when a torque job is started, it is assigned a nine - digit job i d . This i d can be used to access the results later from the main torque page.before submitting a query, the user may enter an email address . Once torque has finished processing the query, the results will be sent to the email address provided . When a torque job is started, it is assigned a nine - digit job i d . This i d can be used to access the results later from the main torque page . Before submitting a query once torque has finished processing the query, the results will be sent to the email address provided . The web server generates a web page (figure 2) with the image of the top - scoring match for the query in the target network, as well as an auxiliary file in.sif format that can be viewed using the cytoscape software (4). The content of the.sif file includes, for each edge, a numerical value representing the confidence in the interaction it represents, as provided in the input . The image shows the subgraph induced by the top - scoring match in the ppi network . Each vertex is labeled with its protein name in the ppi network and its matching query protein, if such exists . Insertion vertices are shown in gray, and proteins from the query for which there was no match in the solution (deletions) are listed separately . The following example uses as query the mouse dna synthesome complex, downloaded from the corum website (http://mips.gsf.de/genre/proj/corum/index.html). This 13-member complex was queried in the yeast network (5430 proteins, 39 936 interactions). Examining the subnetwork identified by torque we find that it is functionally coherent (nucleotidyltransferase activity, p <1.4e 10) and significantly intersects the yeast alpha dna polymerase: primase complex, supporting its biological plausibility . The input for torque consists of: a query set of proteins in species a;their protein sequences;a ppi network for species b;the sequences of the network proteins . A query set of proteins in species a; their protein sequences; a ppi network for species b; the sequences of the network proteins . All inputs are in simple text format: the query set can be entered directly as a comma - delimited or whitespace - delimited list.protein sequences are given in the standard fasta format.the ppi network is given as a text file, where each row represents an interaction and contains the ids of the interacting pair and a confidence value for it in the range [0, 1]. The query set can be entered directly as a comma - delimited or whitespace - delimited list . The ppi network is given as a text file, where each row represents an interaction and contains the ids of the interacting pair and a confidence value for it in the range [0, 1]. It is possible to use a single fasta file (input 2) for many queries, if it contains the sequences for all proteins in all queries . When the query field is left blank, torque will use all the proteins in input 2 as the query . If input 1 contains uniprot protein ids (www.uniprot.org), their sequences need not be entered in input 2; instead, torque automatically retrieves them from the uniprot database . For several target species, currently, the server supports this option for the three target species saccharomyces cerevisiae, drosophila melanogaster and homo sapiens . The user can indicate one of these target species instead of providing inputs 3 and 4 . The user can control two parameters of the algorithm, setting a trade - off between speed and sensitivity . The user can set the threshold for blast similarity (e - value). By setting a lower threshold, less homologs will be identified for the query proteins, making the algorithm faster but less sensitive . The second parameter is a threshold for the confidence values of ppi network edges provided as part of input 3 . Edges whose confidence value is lower than the threshold are discarded; hence, this parameter determines the sparsity of the target network and affects the number of possible matches and the running time . The running time of torque is typically a few minutes, but may be up to an hour, depending on the size and other properties of the query (for more details, see (7)). If several queries are submitted to the server at the same time, they are queued and executed sequentially . Rather than waiting for the results online, they can be accessed later, in two ways: when a torque job is started, it is assigned a nine - digit job i d . This i d can be used to access the results later from the main torque page.before submitting a query, the user may enter an email address . Once torque has finished processing the query, the results will be sent to the email address provided . When a torque job is started, it is assigned a nine - digit job i d . This i d can be used to access the results later from the main torque page . Before submitting a query once torque has finished processing the query, the results will be sent to the email address provided . The web server generates a web page (figure 2) with the image of the top - scoring match for the query in the target network, as well as an auxiliary file in.sif format that can be viewed using the cytoscape software (4). The content of the.sif file includes, for each edge, a numerical value representing the confidence in the interaction it represents, as provided in the input . The image shows the subgraph induced by the top - scoring match in the ppi network . Each vertex is labeled with its protein name in the ppi network and its matching query protein, if such exists . Insertion vertices are shown in gray, and proteins from the query for which there was no match in the solution (deletions) are listed separately . The following example uses as query the mouse dna synthesome complex, downloaded from the corum website (http://mips.gsf.de/genre/proj/corum/index.html). This 13-member complex was queried in the yeast network (5430 proteins, 39 936 interactions). Examining the subnetwork identified by torque we find that it is functionally coherent (nucleotidyltransferase activity, p <1.4e 10) and significantly intersects the yeast alpha dna polymerase: primase complex, supporting its biological plausibility . The torque web server allows users to run topology - free queries on predefined or user - provided target networks . The result is a subnetwork of the target network most similar to the query, and is presented both graphically and as a downloadable text file . ); german - israel foundation grant (to r.s . ); postdoctoral fellowship from the edmond j. safra bioinformatics program at tel aviv university (to f.h . ). Funding for open access charge
Cutaneous metastases are defined as dermal or hypodermal neoplastic tissue that has no contiguity with the primary tumor . Skin metastases from internal neoplasms are an uncommon clinical finding with an overall incidence of 5.3% and the most common cause is breast cancer with an incidence of 23.9%.1 in general, skin metastases of breast cancer affect the dermis and histologically appear as malignant ductal epithelial cells in sheets, cords, glands, or are arranged in a diffuse infiltrate.2 the finding of transepidermal elimination on cutaneous metastases is exceptional and has only been reported in a few cases.3,4 mehregan classified transepidermal elimination into three types, and the elimination of dermal tumor nests corresponds to type 3 which involves an active interaction between epidermis and dermal connective tissue.5 although transepidermal elimination is the histological feature of the classical perforating disorders, it is also described in other cutaneous conditions and in tumors such as melanocytic nevus,6 eccrine poroma,7 malignant melanoma,8 pilomatricoma,9 and metastatic carcinoma.3,4 in this report we present a case of perforating cutaneous metastasis from breast cancer with mucin 1 (muci) expression . In february 2010, a 48-year - old argentine woman had undergone tumorectomy in her left breast with diagnosis of an invasive ductal carcinoma with low nuclear and histological differentiation grades; estrogen (er) and progesterone (pr) receptors were negative and her2/neu was positive . In september 2011, a mastectomy with immediate breast reconstruction was performed due to local tumor recurrence and the patient received systemic chemotherapy . In march 2012 physical examination revealed an erythematous nodule that was 4 cm in diameter, polylobulated, and with ulcerated surface on the chest region . Multiple erythematous painful nodules from 5 mm to 2 cm were distributed on her chest and over the reconstructed breast (figure 1). A skin biopsy of one of the small lesions revealed skin metastasis from breast carcinoma (er - pr - her2/neu+). Muci expression was studied and a strong reaction was found with a mixed pattern at the plasma membrane and in the cytoplasm (figure 2). Tumor cells in the papillary dermis appeared to penetrate through the epidermis, suggesting transepidermal elimination . The epidermis showed no signals of ulceration (figure 3), and in some malignant cells, a muci moderate reaction was found . Cutaneous metastases from breast carcinoma usually appear months to years after the diagnosis and treatment of the primary malignancy.10,11 the most common localizations are in the chest wall and abdomen, but they can also be found in the scalp and extremities.10 the clinical presentations vary over a wide range of different patterns . Nodules are the most common manifestation (80%), followed by telangiectatic carcinoma (11%), erysipeloid carcinoma (3%), en cuirasse carcinoma (3%), alopecia neoplastica (2%), and a zosteriform type (0.8%).12 a diagnosis of cutaneous metastases is based on the clinical manifestations and the histopathologic study of the lesions . Histopathologically, cutaneous metastatic nodules show malignant cells in the dermis arranged in nests surrounded with desmoplastic stroma.2 in our patient, clinically, the skin lesions were nodules, but histologically, tumor cells were not restricted to dermal nests since they also showed perforation and transepidermal elimination . Altered structures of the dermis and foreign material like neoplastic cells or external substances mehregan5 classified transepidermal elimination into three types which differ in the mechanism of removal . In type 1, nonmotile cells or small particles, which produce minimal or no dermal reaction, can be caught between keratinocytes and carried to the epidermis surface during corneocyte differentiation . In type 2, motile cells or microorganisms actively migrate into the epidermis and are subsequently eliminated with normal desquamation similar to type 1 . The phenomenon of transepidermal elimination occurs in certain dermatoses in which altered structures of the dermis and foreign substances induce an inflammatory response causing the release of collagenases, elastases, and proteases . This inflammatory response generates alteration of the matrix with necrosis and perforation, and can also stimulate pseudoepitheliomatous hyperplasia of the epidermis and subsequent formation of transepidermal perforating canals with elimination of the dermal material.4,5 in a case reported by ohnishi et al,3 breast cancer cutaneous metastases with transepidermal elimination presented with epidermotropism of neoplastic cells and pagetoid spread, features that our patient did not show . On the other hand, abbas et al4 published a case of perforating cutaneous metastasis from an ovarian carcinoma which showed malignant cells in the dermis and hypodermis with areas of transepidermal elimination without epidermotropism . Immunohistochemical staining of the tumor cells was positive for muci, as we report in our case . Almost all breast cancer cells express muci1316 although benign breast neoplasms and normal breast cells express this mucin as well.17,18 it is considered that muci nonapical expression, as well as its overexpression, are the hallmarks of muci reactivity in breast cancer cells.19 although contradictory results have been found between muci expression and survival in breast cancer patients, more than 70% of studies on tumor samples have found that the presence of any muci in the majority of tumor cells is associated with an improved prognosis.20 in relation to subcellular localization of muci, it has been observed that patients with tumors with the lineal (membrane) pattern have better survival.21 23 rahn et al20 reported that aberrantly localized muci in the tumor cell cytoplasm or nonapical membrane is associated with a worse prognosis . In a previous report, we found a significant decrease of muci apical expression frequency according to histological as well as nuclear grade increment . In this sense, it is known that histological grade is an accurate predictor of tumor behavior.24 the presence of apical membrane staining would indicate that muci targeting pathways are intact, and it has been associated with better prognosis that is possibly related to functional differentiation of the tumor.24 rahn et al20 also found a significantly lower mean nuclear grade in tumors with high muci expression (50%). Coincidentally, in the primary tumor of our patient, a high nonapical muci expression along with low nuclear and differentiation grades was observed . Muci may alter the interaction between tumor cells and their environment, changing the composition . It has been observed that muci cytoplasmic tail interacts with -catenin through a similar motif to that found in e - cadherin and inhibits the formation of an e - cadherin--catenin complex, reducing cell cell adhesion.19 similar to abbas et al,4 it is possible that in our case, the contributing factors to transepidermal elimination could be related to a tumor dermis interaction in which the epidermis does not seem to be implicated . The physical effect by the expanding tumor and the inflammatory response are factors to be considered . Also, the possibility of a vascular compromise resulting in necrosis and ulceration of the epidermis as well as muci expression may play a role.
Patients with copd or asthma frequently experience exacerbations of their illness . Studies from norway and the uk have shown that each year ~50% of copd patients experience an exacerbation that leads to a visit to a general practitioner (gp), in - hospital treatment, or self - administered treatment with antibiotics or systemic corticosteroids.1,2 in a study from the united states, ~25% of asthma patients reported to use a short course with oral corticosteroids during a period of 3 months.3 treatment with systemic corticosteroids is recommended in both severe copd exacerbations4,5 and asthma attacks.6,7 such medication counteracts the inflammatory response in the bronchial tree, and by doing so, alleviates the accompanying bronchial obstruction . In asthma attacks, there is firm evidence for a favorable effect of systemic corticosteroids,6 for copd exacerbations the evidence refers mainly to clinical trials in hospitalized patients.4 in copd guidelines, the criteria for starting such treatment are not clear cut, but it is often recommended when symptoms are not relieved after stepping up treatment with inhaled bronchodilators.8 benefit from systemic corticosteroid treatment has to be weighed against adverse effects, such as increased fragility of the bones and increased blood levels of glucose.4 improvement in lung function has been a main outcome measure in studies on the effects of systemic corticosteroids.9,10 this implies that the acute deterioration of lung function associated with the exacerbation is a main target for the systemic corticosteroids . It would, therefore, probably be useful, when deciding on prescribing systemic corticosteroids, to know whether the patient actually suffers from increased bronchial obstruction and if so, to which degree? However, doing spirometry in the acute phase of a copd exacerbation is not recommended in the global initiative for chronic obstructive lung disease (gold) guidelines,5 and it might not be convenient in all cases with asthma attacks . Other sources of information that could reflect increased bronchial obstruction could be the symptoms of the patient, as well as chest findings and assessment of oxygen saturation (spo2) by pulse oximetry . The aim of this study was to describe how these clinical findings are associated with a decrease in lung function during exacerbations . We also wanted to find out whether the strength of these associations would be affected when they could be described in terms of change from stable state . This observational prospective study was carried out in seven general practice offices in the north and south of norway . Patients aged 40 years or older registered in the electronic medical record with a diagnosis of asthma or copd (or both) in the previous 5 years were identified, and a random sample of 1,111 patients was invited to participate . Of the 380 patients who met for baseline registration between april 2009 and march 2010, 376 were considered to be in a stable phase of their disease and were included in the study . Out of those, 210 were diagnosed with asthma by their gps, 74 with copd, and 92 with both asthma and copd.11 they were all asked to visit their gp within 23 days if they experienced exacerbations of their lung disease the following 12 months . All participants gave written consent, and the study was approved by the regional committee for medical and health research ethics in north norway . Respiratory symptoms the previous week and relevant quality of life items were examined using the norwegian translation of the clinical copd questionnaire (ccq).12 in the ccq, the symptoms short of breath at rest, short of breath doing physical activities, coughing, and production of phlegm were classified into scores from 0 (never) to 6 (almost all the time), and a mean score of respiratory symptoms was calculated . The ccq also contains questions on depression and concern about the disease getting worse with the same score system and four questions on activity limitation due to the illness, also with a score system from 0 (not limited at all) to 6 (totally limited). Smoking habit and hospitalizations due to the lung disease the previous year were reported on a separate questionnaire . On a pop - up questionnaire in the electronic medical record the examining gp recorded comorbidities and treatment given, including antibiotics and systemic corticosteroids for exacerbations the previous year . Exacerbation of asthma or copd the year before baseline was defined as exacerbations that were treated with antibiotics and/or systemic corticosteroids or ended with hospitalization, a definition previously used for copd exacerbations.1 the gps also reported the presence of wheezes, crackles, diminished breath sounds, and prolonged expiration after auscultation of the lungs . C - reactive protein (crp) was analyzed using near patient tests: afinion as100 analyzer, orion quickread crp, or abx micros crp, which all could display values down to 8 mg / l . Spo2 was measured by a digital handheld pulse oximeter, onyx ii model 0550 (nonin medical, inc ., spirometry was carried out after the pulse oximetry, following the european respiratory society / american thoracic society guidelines.13 spirare sps310 spirometers (diagnostica as, oslo, norway) were used . Post - bronchodilator spirometry was carried out 20 minutes after inhalation of 0.4 mg salbutamol . The post - bronchodilator forced expiratory volume in 1 second (fev1) and forced vital capacity (fvc) were used in the analyses . Norwegian reference values for spirometry were applied.14 the participants filled in the ccq, this time concerning the previous 24 hours . Respiratory symptoms the previous 24 hours were also reported by the gps based on history taking on a pop - up questionnaire and shortness of breath, coughing, phlegm production, and wheezing were classified into three grades: 1) not present or as normal, 2) more bothersome than normal, and 3) very bothersome . Chest findings, the crp value, and pulse oximetry were recorded as done at baseline . Lung function testing was also carried out with the same procedure, but post - bronchodilator spirometry was not carried out . A significant drop in fev1was defined as a drop of 10% from baseline15 and of at least 200 ml . How such a drop in fev1 was associated with baseline characteristics and symptoms, signs and test results at exacerbation was analyzed by chi - square test, fischer s exact test (dichotomous variables), and mann whitney test (the ccq variables). Significant decreases in spo2 were defined as a reduction of at least 2% to 95% and 92%, respectively . Likelihood ratios were calculated for findings significantly associated with the fixed drop in fev1 using online software (m.k . Associations with percentage change in fev1 from baseline were analyzed by linear regression making it possible to have the degree of change as outcome . This observational prospective study was carried out in seven general practice offices in the north and south of norway . Patients aged 40 years or older registered in the electronic medical record with a diagnosis of asthma or copd (or both) in the previous 5 years were identified, and a random sample of 1,111 patients was invited to participate . Of the 380 patients who met for baseline registration between april 2009 and march 2010, 376 were considered to be in a stable phase of their disease and were included in the study . Out of those, 210 were diagnosed with asthma by their gps, 74 with copd, and 92 with both asthma and copd.11 they were all asked to visit their gp within 23 days if they experienced exacerbations of their lung disease the following 12 months . All participants gave written consent, and the study was approved by the regional committee for medical and health research ethics in north norway . Respiratory symptoms the previous week and relevant quality of life items were examined using the norwegian translation of the clinical copd questionnaire (ccq).12 in the ccq, the symptoms short of breath at rest, short of breath doing physical activities, coughing, and production of phlegm were classified into scores from 0 (never) to 6 (almost all the time), and a mean score of respiratory symptoms was calculated . The ccq also contains questions on depression and concern about the disease getting worse with the same score system and four questions on activity limitation due to the illness, also with a score system from 0 (not limited at all) to 6 (totally limited). Smoking habit and hospitalizations due to the lung disease the previous year were reported on a separate questionnaire . On a pop - up questionnaire in the electronic medical record the examining gp recorded comorbidities and treatment given, including antibiotics and systemic corticosteroids for exacerbations the previous year . Exacerbation of asthma or copd the year before baseline was defined as exacerbations that were treated with antibiotics and/or systemic corticosteroids or ended with hospitalization, a definition previously used for copd exacerbations.1 the gps also reported the presence of wheezes, crackles, diminished breath sounds, and prolonged expiration after auscultation of the lungs . C - reactive protein (crp) was analyzed using near patient tests: afinion as100 analyzer, orion quickread crp, or abx micros crp, which all could display values down to 8 mg / l . Spo2 was measured by a digital handheld pulse oximeter, onyx ii model 0550 (nonin medical, inc ., spirometry was carried out after the pulse oximetry, following the european respiratory society / american thoracic society guidelines.13 spirare sps310 spirometers (diagnostica as, oslo, norway) were used . Post - bronchodilator spirometry was carried out 20 minutes after inhalation of 0.4 mg salbutamol . The post - bronchodilator forced expiratory volume in 1 second (fev1) and forced vital capacity (fvc) were used in the analyses . The participants filled in the ccq, this time concerning the previous 24 hours . Respiratory symptoms the previous 24 hours were also reported by the gps based on history taking on a pop - up questionnaire and shortness of breath, coughing, phlegm production, and wheezing were classified into three grades: 1) not present or as normal, 2) more bothersome than normal, and 3) very bothersome . Chest findings, the crp value, and pulse oximetry were recorded as done at baseline . Lung function testing was also carried out with the same procedure, but post - bronchodilator spirometry was not carried out . A significant drop in fev1was defined as a drop of 10% from baseline15 and of at least 200 ml . How such a drop in fev1 was associated with baseline characteristics and symptoms, signs and test results at exacerbation was analyzed by chi - square test, fischer s exact test (dichotomous variables), and mann whitney test (the ccq variables). Changes from baseline were found by subtracting baseline values from the values at exacerbation . Significant increase in crp was defined as an increase of at least 10 mg significant decreases in spo2 were defined as a reduction of at least 2% to 95% and 92%, respectively . Likelihood ratios were calculated for findings significantly associated with the fixed drop in fev1 using online software (m.k . Associations with percentage change in fev1 from baseline were analyzed by linear regression making it possible to have the degree of change as outcome . During the 1-year follow - up period, 109 patients visited their gp due to one or more exacerbations . For patients who visited the gp with several exacerbations, the first exacerbation was, as a rule, included in the analysis . However, 21 patients were excluded due to incomplete data from the exacerbations, in most cases because spirometry was not done . Seventeen gps took part in the examinations of the 88 included patients at baseline, whereas 34 gps shared the examinations during the exacerbations, and 41 patients (47%) were examined by the same gp both times . The mean age of the patients at baseline was 63 years, and 66% were female . A copd diagnosis (or both asthma and copd) had been given to 48 (55%) patients at baseline, and patients with a copd diagnosis had significantly more frequent history of exacerbation the previous year . They were also different from the patients in the asthma group in other ways (table 1). The distribution of fev1 at baseline and at exacerbation is shown in figure 1, with predicted mean values of 76.1% and 70.8%, respectively . Among the asthma patients, the corresponding fev1% predicted values were 87.5 and 83.0 and among the copd patients, 61.2 and 54.7 . The distribution of change from baseline is shown in figure 2 . A significant drop in fev1 at exacerbation (10% and at least 200 ml) the patients with this drop in lung function had more frequent copd diagnosis at baseline than those without (p=0.04, table 2). During spirometry at baseline 75 patients (85%) expired for more than 6 seconds, at exacerbation the corresponding number was 67 (76%). Ten of the 13 patients who reported very bothersome wheezing had a significant drop in fev1 (p=0.001, table 2). In the asthma group, only two patients had this symptom, but a significant drop in fev1 was found in both . An abnormal finding by chest auscultation was found in 68 patients (77%), and a new sign (not recorded at baseline) was found in 48 patients (55%). Any abnormal chest sign, whether new or not, was recorded more frequently in patients with a significant drop in fev1 (table 2) compared with other patients . Crackles was associated with a drop in fev1, whereas wheezes was not . In 26 patients (30%), one or more of the four chest signs were recorded both at baseline and exacerbation, and with similar frequency whether the same gp performed the auscultation at both occasions, 24% and 34%, respectively (p=0.3). Spo2 values 92% were found in 11 patients, and in 10 of these, the saturation had dropped 2% or more between baseline and exacerbation . This drop in spo2 was associated with a significant drop in fev1 (p=0.02). There was a median increase in ccq score of 1.25 for respiratory symptoms between baseline and exacerbation, but no difference was found between the patients with a significant drop in fev1 and the other patients (table 3). The diagnostic value of findings, significantly indicating a drop in fev1, is shown in table 4 . The asthma and copd subgroups did not differ when it came to likelihood ratios of very bothersome wheezing experienced by the patients and crackles on auscultation . A diagnostic value of spo2 dropping to below 93% was only found in the copd group . When the percentage drop in fev1 was used as outcome in univariable linear regression, the fev1/fvc ratio was the strongest predictor among the baseline characteristics (table 5). Treatment with long - acting beta - agonist / inhaled corticosteroids seemed to slightly counteract the drop in fev1, but this association was not statistically significant . Very bothersome wheezing during exacerbation, as experienced by the patient, was the strongest indicator of change in fev1 among the symptoms, and prolonged expiration and any abnormal auscultation finding were now stronger indicators than crackles . A decrease in spo2 of at least 2% to a value of 92% was still strongly associated with a drop in fev1 . We have attempted to find alternatives to spirometry in assessing drop in lung function during asthma and copd exacerbations . One strong indicator of a significant drop in lung function was increased wheezing as experienced by the patient . As far as we know, this finding has not been reported previously to be a sign of a drop in lung function . Patient experienced wheezing was a stronger predictor of drop in lung function than were wheezes on auscultation . Decreased spo2 measured as spo2 92% was also strongly associated with a drop in fev1 . Only one copd patient had spo2 92% at baseline, telling us that this is a relevant finding for primary care . A drop in fev1 was most frequently found in the patients with a copd diagnosis, and the fev1/fvc ratio at baseline was strongly associated with a change in lung function in the linear regression, indicating that the severity of the copd should be taken into account . We have attempted to find alternatives to spirometry in assessing drop in lung function during asthma and copd exacerbations . One strong indicator of a significant drop in lung function was increased wheezing as experienced by the patient . As far as we know, this finding has not been reported previously to be a sign of a drop in lung function . Patient experienced wheezing was a stronger predictor of drop in lung function than were wheezes on auscultation . Decreased spo2 measured as spo2 92% was also strongly associated with a drop in fev1 . Only one copd patient had spo2 92% at baseline, telling us that this is a relevant finding for primary care . A drop in fev1 was most frequently found in the patients with a copd diagnosis, and the fev1/fvc ratio at baseline was strongly associated with a change in lung function in the linear regression, indicating that the severity of the copd should be taken into account . As part of a prospective study with baseline examinations, we were able to collect post - bronchodilator spirometry at stable state in all patients . The spirometry was well performed, and although fewer patients expired for more than 6 seconds during exacerbation than at baseline, there are reasons to believe that valid fev1 values were obtained . The cutoff level of 10% for drop in fev1 may be regarded as arbitrary, and the results are strengthened by using the percentage drop in fev1 as continuous outcome variable in linear regression . However, we did not find any great benefit of taking the baseline findings into account . One good reason for doing this is the difficulties in differentiating between asthma and copd in many patients with obstructive lung disease.11,16 a second justification is the similar challenges in the two diseases when it comes to treating exacerbations with oral corticosteroids . This is rather a small clinical study, and the results should be interpreted with caution . Not all patients who were assessed during exacerbation were included, due to incomplete data collection in the practices . Whereas the collection of baseline data was well organized, the participating practices were not always as prepared when it came to the exacerbations . This has probably not resulted in any systematic selection bias influencing the association between findings and drop in lung function . We have not found studies evaluating wheezing, as experienced by patients, as a sign of drop in lung function, only as an independent predictor of copd in general.17 wheezing is not one of the items in score sheets for health status in copd patients, such as the ccq12 and the copd assessment test (cat)18 and neither in the exacerbations of chronic pulmonary disease tool (exact).19 decreased spo2 during copd exacerbations has been shown in previous studies,20,21 but decreased spo2 has not previously been linked to the magnitude of drop in fev1 . A strong link between reduced fev1 and reduced pulse oximetry values has been shown in several studies, also among asthma and copd patients in general practice.22 introduction of pulse oximeters in primary care was recommended in 2010,23 and our results support this development . In a previous publication from this project, we showed that decreased spo2 predicted treatment with oral corticosteroids.24 there was, however, no association between patient experienced wheezing and the prescribing of oral corticosteroids (among the 13 patients with very bothersome wheezing, 6 [46.2%] were treated with oral corticosteroids, compared to 40% in the remaining patients). One may question why not just spirometry can be used in the assessment of lung function during asthma and copd exacerbations . It was successfully applied in this study and has also been performed in other studies without reports of adverse experiences.9,10 the recommendation in the gold guidelines, not to use spirometry during exacerbations,5 is probably based on experiences from hospital and with severely ill outpatients . In primary care, the majority of copd patients have a mild or moderate disease, as was also the case in this study . When a spirometry result from stable state is available and performed within the previous year, a new spirometry can usually give a valid measure of drop in lung function . However, coughing may force the patient to terminate the expiratory maneuver too early, and this may explain why the expiration lasted less than 6 seconds more frequently during exacerbation than at baseline in this study . Clinical assessment without spirometry is often needed . To find wheezes by auscultation of the chest wheezes were recorded as present or absent, but their intensity in terms of number and duration was not documented . Consequently, when wheezes were recorded as present in both stable state and during exacerbation, we had no information about the change in the intensity . The difficulties in interpreting auscultation findings also relate to crackles and prolonged expiration, which were stronger indicators of a drop in fev1 than wheezes in this study . To ask primary care patients with asthma or copd exacerbations about wheezing seems to be a simple and a rational approach when assessing change in lung function . . Increased wheezing and low pulse oximetry values are probably useful to take into account when treatment with oral corticosteroids is considered . However, we do not know to which degree treatment with oral corticosteroids should be based on a drop in fev1 . More studies are needed to help identify the clinical findings that can be helpful in the difficult decision to prescribe this potent medication.
Diagnostic lumbar puncture (dlp) is a frequent procedure used in the diagnosis of neural system disorders . Post - lumbar puncture syndrome is a common complication of dlp occurring in about 340% of patients [14]. Post - lumbar puncture headache (plph) is the predominant symptom of this syndrome, probably resulting from the leakage of cerebrospinal fluid into the epidural cavity through the post - puncture opening in the dura mater . The loss of cerebrospinal fluid causes a drop off in intracranial pressure (icp), causing compensative dilatation of cerebral vessels, which is reflected by the headache [13, 5]. This theory has one significant weakness, namely that plph do not occur in every patient following dlp . Transcranial doppler ultrasonography (tcd) enables us to assess blood flow in the intracranial arteries non - invasively . Assuming that tcd parameters are influenced both by changes in cerebral vessel diameters and by fluctuations in icp [68], we aimed to verify if dlp resulted in significant changes in cerebral blood flow (cbf) that could be visualized by tcd . Therefore, we identified a group of subjects who developed plph following dlp and compared their pre- and post - puncture blood flow parameters with respective values of plph - free subjects . This study included patients at the department of neurology, who required a scheduled dlp . Exclusion criteria from this group included emergency lumbar punctures, inadequate temporal bone windows, stenosis of the middle cerebral arteries, hemodynamically significant stenosis of the common carotid arteries, atrial fibrillation, and patients who were immobilized . All the procedures were approved by the local ethics committee of the ludwik rydygier collegium medicum in bydgoszcz . Tcd was performed 24 h before dlp and repeated within 24 h after the procedure . Lumbar puncture was done following standard protocol by one of 11 physicians employed at the department . Plph was diagnosed according to the international classification of headache disorders (ich - ii) guidelines . The presence and severity of plph was evaluated for 5 days, on a daily basis, using a numeric rating scale (nrs). Sixty - six patients were enrolled to this study, including 37 men and 29 women . The mean age of these patients was 47.4 16.5 years (range from 16 to 88, table 1). Patients were subjected to diagnostic procedures due to cranial mononeuropathy (n = 12), polyneuropathy (n = 7), multiple sclerosis (n = 13), vertigo (n = 7), diffuse injuries of the brain or spinal cord (n = 9), epilepsy (n = 5), and other reasons.table 1clinical characteristics of patients who developed post - lumbar puncture headache (plph) and in plph - free individualsparameterplph - free (n = 45)plph (n = 21)p valueage in years, mean sd49.3 17.843.2 12.50.16women, n (%) 13 (28.9)16 (76.2)0.00031men, n (%) 32 (71.1)5 (23.8)0.00026history of headache, n (%) 9 (20)14 (66.7)0.00021 tension - type headache, n (%) 6 (13.3)11 (52)0.00034 migraine without aura, n (%) 3 (6.7)2 (9.5)0.21 other type of headache, n (%) 0 (0)1 (4.8)arterial hypertension, n (%) 12 (26.67)3 (14.29)0.26diabetes, n (%) 9 (20)2 (9.5)0.29hypercholesterolemia, n (%) 15 (33.3)4 (19.1)0.23hematocrit in%, mean sd41.8 3.339.1 3.90.006hemoglobin in g / l, mean sd14.2 1.313.0 1.50.001 clinical characteristics of patients who developed post - lumbar puncture headache (plph) and in plph - free individuals lumbar puncture was performed in the lateral recumbent position, using the intervertebral space between l4 and l5 or between l5 and s1, with the aid of a 22-gauge needle (bd spinal needle quincke type point). All the procedures were performed between 11 and 12 a.m. following the procedure, the patients were ordered to stay in bed for 8 h. tcd was performed using a pioneer apparatus (nicolet / eme) with a 2-mhz probe . Following localization of the temporal window, the middle cerebral artery (mca) was identified . The probe was placed so as to record the peak possible velocity from the vessel . The measurements included mean velocity (vmean), peak systolic velocity (vmax), and gosling s pulsatility index (pi) at 5456 mm, in the left and right mca . All tcds were performed by the same physician being experienced in neurosonology and unaware of plph presence and severity in patients examined . Mean values of normally distributed variables were compared with student s t test for independent samples, whereas the variables whose distributions were not normal were compared with the non - parametric mann distributions of discrete variables were compared between the groups with the aid of test . Calculations were performed using statistica 7 (statsoft, poland) software, and statistical significance was defined as p 0.05 . This study included patients at the department of neurology, who required a scheduled dlp . Exclusion criteria from this group included emergency lumbar punctures, inadequate temporal bone windows, stenosis of the middle cerebral arteries, hemodynamically significant stenosis of the common carotid arteries, atrial fibrillation, and patients who were immobilized . All the procedures were approved by the local ethics committee of the ludwik rydygier collegium medicum in bydgoszcz . Tcd was performed 24 h before dlp and repeated within 24 h after the procedure . Lumbar puncture was done following standard protocol by one of 11 physicians employed at the department . Plph was diagnosed according to the international classification of headache disorders (ich - ii) guidelines . The presence and severity of plph was evaluated for 5 days, on a daily basis, using a numeric rating scale (nrs). Sixty - six patients were enrolled to this study, including 37 men and 29 women . The mean age of these patients was 47.4 16.5 years (range from 16 to 88, table 1). Patients were subjected to diagnostic procedures due to cranial mononeuropathy (n = 12), polyneuropathy (n = 7), multiple sclerosis (n = 13), vertigo (n = 7), diffuse injuries of the brain or spinal cord (n = 9), epilepsy (n = 5), and other reasons.table 1clinical characteristics of patients who developed post - lumbar puncture headache (plph) and in plph - free individualsparameterplph - free (n = 45)plph (n = 21)p valueage in years, mean sd49.3 17.843.2 12.50.16women, n (%) 13 (28.9)16 (76.2)0.00031men, n (%) 32 (71.1)5 (23.8)0.00026history of headache, n (%) 9 (20)14 (66.7)0.00021 tension - type headache, n (%) 6 (13.3)11 (52)0.00034 migraine without aura, n (%) 3 (6.7)2 (9.5)0.21 other type of headache, n (%) 0 (0)1 (4.8)arterial hypertension, n (%) 12 (26.67)3 (14.29)0.26diabetes, n (%) 9 (20)2 (9.5)0.29hypercholesterolemia, n (%) 15 (33.3)4 (19.1)0.23hematocrit in%, mean sd41.8 3.339.1 3.90.006hemoglobin in g / l, mean sd14.2 1.313.0 1.50.001 clinical characteristics of patients who developed post - lumbar puncture headache (plph) and in plph - free individuals lumbar puncture was performed in the lateral recumbent position, using the intervertebral space between l4 and l5 or between l5 and s1, with the aid of a 22-gauge needle (bd spinal needle quincke type point). The volumes of collected cerebral fluid ranged from around 610 ml . All the procedures were performed between 11 and 12 a.m. following the procedure, the patients were ordered to stay in bed for 8 h. tcd was performed using a pioneer apparatus (nicolet / eme) with a 2-mhz probe . Following localization of the temporal window, the middle cerebral artery (mca) was identified . The probe was placed so as to record the peak possible velocity from the vessel . The measurements included mean velocity (vmean), peak systolic velocity (vmax), and gosling s pulsatility index (pi) at 5456 mm, in the left and right mca . All tcds were performed by the same physician being experienced in neurosonology and unaware of plph presence and severity in patients examined . Mean values of normally distributed variables were compared with student s t test for independent samples, whereas the variables whose distributions were not normal were compared with the non - parametric mann distributions of discrete variables were compared between the groups with the aid of test . Calculations were performed using statistica 7 (statsoft, poland) software, and statistical significance was defined as p 0.05 . Post - lumbar puncture headache was observed in 21 out of 66 patients who underwent dlp (32%), whereas symptoms of post - lumbar puncture syndrome were not noted in the remaining 45 subjects (68%). In most patients (86%), the symptoms manifested on the first day following dlp, on average 17.7 10.2 h after the procedure (range 744 h). Plph persisted 5.5 1.8 days on average (range 210 days). Female patients predominated amongst the plph cases (16, compared to five men, p <0.0003). Most patients who developed plph (n = 14) had a history of headaches, mostly tension headaches . The mean age of patients with plph was lower than for unaffected individuals (43.2 vs. 49.3 years), but this difference was insignificant (table 1). In both groups of patients, no significant differences were observed in vmean, vmax and pi between the right and left mcas both before dlp and following this procedure (table 2).table 2pre- and post - puncture values (mean sd) of mean velocity (vmean), peak systolic velocity (vmax), and gosling s pulsatility index (pi) in the right (mca r) and left (mca l) middle cerebral arteries of patients who developed post - lumbar puncture headache (plph) and in plph - free individualsplph - free (n = 45)plph (n = 21)p valuepre - puncture vmean, mca r (m / s)55.2 9.771.9 24.90.0002post - puncture vmean, mca r (m / s)55.5 12.658.4 20.20.47p value0.860.0004pre - puncture vmean, mca l (m / s)55 12.0169.12 22.560.0015post - puncture vmean, mca l (m / s)54.2 13.259.4 19.10.19p value0.700.008pre - puncture vmax, mca r (m / s)89.9 16.2109.3 36.90.004post - puncture vmax, mca r (m / s)91.1 21.589.8 30.10.84p value0.700.0002pre - puncture vmax, mca l (m / s)89.8 19.4104.3 32.20.03post - puncture vmax, mca l (m / s)88.7 20.490.7 28.00.74p value0.740.009pre - puncture pi, mca r0.99 0.200.86 0.140.01post - puncture pi, mca r1.0 0.210.89 0.120.03p value0.460.41pre - puncture pi, mca l0.98 0.220.84 0.130.01post - puncture pi, mca l0.99 0.230.86 0.130.01p value0.430.65 pre- and post - puncture values (mean sd) of mean velocity (vmean), peak systolic velocity (vmax), and gosling s pulsatility index (pi) in the right (mca r) and left (mca l) middle cerebral arteries of patients who developed post - lumbar puncture headache (plph) and in plph - free individuals in patients who developed plph, bilateral pre - puncture values of vmean and vmax were significantly higher and pi was significantly lower compared to unaffected individuals . No significant differences were observed between these groups in terms of post - puncture vmean and vmax, but the post - puncture pi was still significantly lower in plph cases (table 2). Moreover, hemoglobin concentration and hematocrit values were significantly lower in patients who developed headache compared to unaffected individuals (table 1). In plph cases, the post - puncture values of vmean and vmax were significantly lower than the respective baseline parameters . Significant puncture - related changes in bilateral vmean and vmax were not observed in patients who did not develop plph . After the puncture, a slight increase in pi was observed bilaterally in both groups, but these changes lacked statistical significance (table 2). When study results were stratified according to patient gender, significant post - puncture changes in vmean and vmax were observed only in women (p <0.01 and p <0.07 in right and left mca, respectively). A significant inverse correlation was present between plph severity on nrs and bilateral pre - puncture pi (fig . 1).fig . 1correlation between post - lumbar puncture headache (plph) severity on numeric rating scale and pre - puncture gosling s pulsatility index (pi) in the left middle cerebral artery correlation between post - lumbar puncture headache (plph) severity on numeric rating scale and pre - puncture gosling s pulsatility index (pi) in the left middle cerebral artery post - lumbar puncture headache is believed to result from cerebrospinal fluid leakage through the post - puncture opening, with a subsequent decrease in intracranial pressure and cerebral vessel dilatation [13, 5]. This theory was confirmed by our study . Following the puncture, we observed significant decreases in vmean and vmax in bilateral mcas of patients who developed plph when compared to their respective pre - puncture values . The drop off in vmean and vmax observed in this group of patients may result from the dilatation of intracranial vessels, a consequence of lowered icp . Similar puncture - related decreases in vmax in patients with plph were previously described by gobel et al ., but only affecting the right mca . In our study, significant puncture - related changes in vmean and vmax were not observed in bilateral mcas of plph - free individuals . Presumably, the loss of cerebrospinal fluid in these patients was not significant enough to be reflected by compensative dilatation of cerebral vessels . The value of pi illustrates the resistance of a vascular bed (supplied by a given artery) when examined by tcd . There is a linear relationship between changes in pi and icp . A decrease in pi may result both from lowered icp and from vascular dilatation [7, 8]. Assuming that the loss of cerebrospinal fluid with further decrease in icp is the reason for plph, pi should decrease during the early phase of post - lumbar puncture syndrome . Reactive dilatation of cerebral vessels due to decreased icp should result in further pi drop off . We did not observe significant puncture - related changes in pi, both in patients who developed plph and in unaffected individuals . Presumably, icp fluctuations were slight or transient and therefore we failed to record them . Noticeably, baseline (pre - puncture) pi values in patients who later developed plph were significantly lower compared to subjects free of this condition . This finding suggests that compensative dilatation of cerebral vessels does not accompany every decrease in icp but is rather characterized by low values of this parameter . There exist linear relationships between pi or vmax changes and changes in icp in cerebral vessels . Pi is known to decrease and vmax to increase with lowered icp [7, 8]. Thus, it is likely that the baseline icp in patients who later developed plph was lower than in unaffected individuals . Consequently, further icp drop off due to cerebrospinal fluid loss might result in compensative vascular dilatation in patients with plph . A relatively higher baseline icp in plph - free individuals might in turn protect them against intracranial hypotension and resulting post - puncture headache . This theory was supported by a significant correlation observed in our study, between pre - puncture pi and plph severity: the lower the baseline pi (and indirectly icp) the more severe the plph . In cases with plph, baseline vmean and vmax values were higher and pi lower than in unaffected individuals . Vmean and vmax are known to decrease with age [6, 11]. Consequently, higher baseline values of these parameters in plph patients might be associated with the higher age of this group, compared to unaffected individuals . In our study, age differences between these two groups were insignificant, and therefore, unlikely to be responsible for the results found in this experiment . The predominance of women amongst the plph patients might be another potential reason for flow velocity differences observed between affected and unaffected individuals . Higher vmean and vmax values were previously demonstrated in females compared to males and these differences were attributed to higher values of cbf in women [11, 12]. Additionally, our study revealed significantly lower hematocrit and hemoglobin values in plph subjects than in unaffected individuals . A lowered hematocrit is known to enhance flow velocity, and decreases pi due to reduced resistance . Consequently, decreased hematocrit values might be responsible for higher values of vmean and vmax and lower pi observed in the plph cases ., hematocrit values do not influence flow velocities unless they are below 35% . In conclusion, the findings of this study partially confirm the theory behind the etiology of plph stated in the introduction, and suggest that higher baseline values of vmean and vmax and low pi in bilateral mcas predispose patients to this condition . Additional risk factors of plph were observed to include female gender, history of headaches, and decreased hematocrit and hemoglobin levels . Finally, within the 24 h following puncture, significant decreases in vmean and vmax were observed in bilateral mcas of patients who developed plph.
The mammalian transcriptome and proteome is far more diverse than expected from one geneone mrnaone protein paradigm (1). This diversity arises due to the generation of multiple transcripts from a gene using alternative transcriptional and splicing events . Alternative transcriptional events that involve use of multiple promoters and/or transcriptional termination result in multiple pre - mrnas from the same gene that can further undergo alternative splicing to generate a plethora of transcript variants corresponding to a single gene (2). Therefore, a gene can yield transcript variants that differ in either their regulatory utrs or / and protein coding regions; thereby expanding the complexity of mammalian genomes (35). In particular, the role of alternative promoter activity is critical in transcriptional regulation, as their precise utilization allows the balanced expression of corresponding pre - mrna variants in different cell and/or developmental contexts . In fact, recent evidence suggests that at least half of the mammalian genes use alternative promoters generating multiple transcript variants (3,5). Therefore, identifying all possible gene promoters, their usage and epigenetic modification states in specific cell populations, tissues and their developmental stages and disease conditions is critical to understanding a diversity of physiological processes associated with normal and diseased states . Several high - throughput technologies, such as cap analysis gene expression (cage), chromatin immunoprecipitation (chip) followed by microarray analysis (chip chip), (6,7), and more recently, chip coupled with sequencing (chip - seq) (8) and sequencing of cdnas (rna - seq) (5), are enabling the genome - wide identification of alternative promoters and their patterns of use . However, these high - throughput approaches need to be applied with caution because of the inherent problems with each method (9). In our recent study, we have shown that a combination of chip - seq and computational technique provides a better approach to annotate active promoters (9,10). Although epd database (11) provides curated promoter sequences for eukaryotic organisms, it does not provide promoter activity information at tissue / cell centric level . In this update of mpromdb we have removed chip chip results and added active rnap - ii promoters identified after analyzing six different cell types of human and 10 different cell / tissue types of mouse chip - seq experiments performed with rnap - ii antibody . In addition, we have added enrichment profile of various transcription factors obtained from chip - seq data sets . These promoters along with their annotations are provided as a user - friendly database, where each known and chip - seq promoter is linked to a new interface for visualization of enrichment profile . Here, we describe the updates of our mpromdb, which enables users to study promoter activity at tissue / cell centric level for human and mouse genome . In this update, we have added (i) a comprehensive knowledgebase of known and novel promoters, (ii) promoters identified from rnap - ii chip - seq experiments, (iii) advance search and filter options and (iv) visualization of chip - seq profiles and promoters using gbrowse (12). The comprehensive promoter knowledgebase was generated from various known gene models (refseq, vega, ensembl, mgi and ucsc known genes), predicted gene models (aceview, tromer, mgc, sgp, sib, genscan, geneid, n - scan and augustus abinitio), orthologous gene model (xenoref), genbank mrnas, spliced ests, cage promoters and mrna - seq tags (figure 1). The gene models, mrnas and spliced ests were downloaded from ucsc genome browser database (13), cage promoters location were downloaded from fantom4 project (14) and mrna - seq raw reads were downloaded from ncbi geo database . We have also added promoter regions of recently discovered non - coding genes class (lincrna) transcribed by rnap - ii (15,16). The total number of records in the knowledgebase can be found in table s1 . Deep sequencing datasets were downloaded from ncbi geo server and processed by our analysis and annotation pipeline . Novel promoters are compared to various existing experimental and predicted gene promoter regions and status of novel promoters is deposited in the relational tables . The database is integrated with open source genome browser (gbrowse) to visualize the promoter and various chip - seq enrichment profiles . Deep sequencing datasets were downloaded from ncbi geo server and processed by our analysis and annotation pipeline . Novel promoters are compared to various existing experimental and predicted gene promoter regions and status of novel promoters is deposited in the relational tables . The database is integrated with open source genome browser (gbrowse) to visualize the promoter and various chip - seq enrichment profiles . The rnap - ii chip - seq data sets includes the data generated at our lab (9) and data sets from various published and unpublished studies available freely at ncbi geo database . The human rnap - ii chip - seq data sets include six different cell lines: cd4 + t, hela s3, k562, nb4, lymphoblastoid and jurkat, whereas mouse samples include five different tissues and five different cell types: brain, liver, lung, spleen, kidney, embryonic stem cell (v6.5), mouse embryonic fibroblasts b4, mouse embryonic fibroblasts b6, bone marrow - derived macrophages and 3t3-l1 (9,1723). The ncbi geo accession numbers of the data sets are provided in table s2 . On the downloaded chip - seq data sets, we apply our pipeline (figure 1) that includes alignment, identification of significant enriched regions, promoter prediction and annotation . Bowtie program (24) was applied to map reads to the reference genome (mm9 version for mouse and hg18 version for human), allowing up to two mismatches . We obtained 174 777 943 and 333 192 049 uniquely mapped reads for mouse and human genome respectively (table s3). Significant peaks were identified using our three steps procedure as described in (9) at p - value = 0.01 . After identification of significant rnap - ii bound peaks we apply our recently published program for prediction of rnap - ii bound promoters (10). Following promoter prediction, we performed promoter annotation using our reference promoter knowledgebase as summarized in figures s1 and s2 . Finally, we identified 48 366 mouse and 42 893 human promoters bound by rnap - ii where 39% and 42% of the promoters in mouse and human respectively were annotated as novel promoters (table 1). In case the predicted chip - seq promoters lie within 1 to 0.5 kb of known tss or within the first exons of known transcripts, they are defined as novel promoters. It is worth noting that 65% and 90% of novel promoters in mouse and human, respectively, are supported by additional sources (novel gene models, mrnas, spliced ests, cage tags and orthologous gene model) (table s4). Table 1.summary of rnap - ii bound promoters identified in various tissues / cell types for human and mouse using chip - seq data setsspeciestissue / cell typeno . Of known promotersno . Of novel promotersno . Of tissue/ cell - specific promotersno . Of cpg promotersno . Of bidirectional promotersno . Of total promotersmousebrain15 9485270397813 864137321 218liver12 3193189164210 421125015 508kidney15 0594632199512 879134819 691spleen908921218068273106711 210lung15 3735142193513 986137420 515embryonic stem cell(v6.5)11 8952880274512 063131414 775mouse embryonic fibroblasts b410 558226127310 898124112 819mouse embryonic fibroblasts b611 887276170610 886123714 648bone marrow - derived macrophages (untreated)13 320397787012 038129817 297bone marrow - derived macrophages (2 h)12 647371356611 846129416 260bone marrow - derived macrophages (4 h)13 119404168811 926129217 1603t3-l1 cells (untreated)848913731138597103898623t3-l1 cells (day 1)868416261548803107293103t3-l1 cells (day 2)850815931748415104210 1013t3-l1 cells (day 3)837415401368371103599143t3-l1 cells (day 4)69761422194679384883983t3-l1 cells (day 6)4039144392740305115482total29 51718 84917 90224 587180148 366humanjurkat cells7417140354176537928820k562 cells16 4108012642216 918132024 422lymphoblastoid cells19 6178998662920 682131128 615nb4 cells12 925294491613 650115615 869hela_s3 cells13 9823502210114 812121217 484cd4 + t cells14 3294137133615 740122018 466cd4 + t cells (2 h)7354126717479558828621cd4 + t cells (12 h)11 470238937712 740117213 859total24 96717 92618 49627 488150142 893 summary of rnap - ii bound promoters identified in various tissues / cell types for human and mouse using chip - seq data sets furthermore, our analysis has identified promoters for 15 493 and 14 266 protein - coding genes in mouse and human respectively . A gene is defined as protein coding if it has at least one protein - coding transcript in refseq / vega gene models, or else it is a non - coding gene . Please note that a protein coding gene can generate transcript variants that are non - coding rnas . We also observed that 40% and 36% of protein coding genes in mouse and human are expressed from alternative promoters (table 2). Surprisingly, 37% of promoters in mouse and 43% of human promoters were identified in a single cell / tissue suggesting that they are cell / tissue - specific promoters . Additionally, we analyzed the cpg - richness and bidirectionality of the promoters and found that 51% and 64% of promoters are cpg - rich and there are 1801 and 1501 bidirectional promoters in mouse and human respectively . Additionally, we also provide significant enrichment profiles of various factors (mouse oct4, cebpa, chd7, c - myc, ctcf, esrrb, foxa1, foxa2, gfp, klf4, n - myc, nr5a2, p300, rbbp5, setdb1, sirt1, sox2, stat3, stat4, stat6, suz12, tbp, tbx3, tcfcp2i1, wdr5, zfx; human oct4, cbp, ctcf, ets1, klf4, nanog, p300, pcaf, phf8, pparg, runx, sox2, stat1, tfii, tip60, znf263, suz12, mof, igf1r, nfkb) calculated from different published and unpublished chip - seq datas ets (table s5a and b). (a) mpromdb main search page where a user can perform search based on either entrez gene id / symbol or specific tissue / cell type and the resulting page is shown in (b) and (c), respectively . (d) user can visualize the chip - seq profile for any promoter displayed on (b) or (c) by clicking on the promoter position link . Table 2.alternative promoter usage for active protein - coding genes in mouse and humanprotein - coding genesmouse (%) human (%) 1-promoter genes9290 (60)9051 (63.44)2-promoter genes3490 (22.5)3192 (22.37)3-promoter genes2707 (17.5)2023 (14.18)total15 49314 266 screenshots of mpromdb and search results . (a) mpromdb main search page where a user can perform search based on either entrez gene id / symbol or specific tissue / cell type and the resulting page is shown in (b) and (c), respectively . (d) user can visualize the chip - seq profile for any promoter displayed on (b) or (c) by clicking on the promoter position link . Alternative promoter usage for active protein - coding genes in mouse and human mpromdb as a web - based application has many layers: the core application (designed in django), a backend database (mysql), a visualization component (gbrowse) and a web server (apache) (see supplementary file 1). The promoter information corresponding to a particular gene can be retrieved from the database using entrez geneid or gene symbol . We also provide additional search and filter options such as selection of tissue / cell type, tissue / cell specific promoters, known / novel promoters and coding / non - coding gene promoters . The gene search query returns result at two different levels (see figure 2, supplementary file 2, supplementary tables s6 and s7). The first level provides information (promoter position, cpg type and bidirectional type) regarding all promoters of the queried gene that are present in the promoter knowledgebase . The second level of search result lists all promoters identified from chip - seq data sets for the queried gene . Visualization of the promoter position and chip - seq data enrichment profile is implemented using gbrowse (12), an open source genome browser platform . Gbrowse is simple but highly configurable web - based genome browser, which provides a fast and customizable interface for visualizing data that is stored in a backend database, as well as the data that is uploaded by the user . Gbrowse is lighter than ucsc genome browser and offers many advantages especially in displaying the results and tracks . Some of the features unique to gbrowse are: glyphs and balloons to represent different features, organizing features sub categories to more depth, multi - language support, view genbank, chado and biosql feature databases, third party loading . On gbrowse the identified promoter location and enrichment profile of the analyzed chip - seq data sets are shown (figure 2d). Further, users can directly type the genome coordinates or gene symbol on gbrowse for searching . Users have an option to turn on / off the tracks that are displayed on the genome browser . In this update, we have added (i) a comprehensive knowledgebase of known and novel promoters, (ii) promoters identified from rnap - ii chip - seq experiments, (iii) advance search and filter options and (iv) visualization of chip - seq profiles and promoters using gbrowse (12). The comprehensive promoter knowledgebase was generated from various known gene models (refseq, vega, ensembl, mgi and ucsc known genes), predicted gene models (aceview, tromer, mgc, sgp, sib, genscan, geneid, n - scan and augustus abinitio), orthologous gene model (xenoref), genbank mrnas, spliced ests, cage promoters and mrna - seq tags (figure 1). The gene models, mrnas and spliced ests were downloaded from ucsc genome browser database (13), cage promoters location were downloaded from fantom4 project (14) and mrna - seq raw reads were downloaded from ncbi geo database . We have also added promoter regions of recently discovered non - coding genes class (lincrna) transcribed by rnap - ii (15,16). The total number of records in the knowledgebase can be found in table s1 . Deep sequencing datasets were downloaded from ncbi geo server and processed by our analysis and annotation pipeline . Novel promoters are compared to various existing experimental and predicted gene promoter regions and status of novel promoters is deposited in the relational tables . The database is integrated with open source genome browser (gbrowse) to visualize the promoter and various chip - seq enrichment profiles . Deep sequencing datasets were downloaded from ncbi geo server and processed by our analysis and annotation pipeline . Novel promoters are compared to various existing experimental and predicted gene promoter regions and status of novel promoters is deposited in the relational tables . The database is integrated with open source genome browser (gbrowse) to visualize the promoter and various chip - seq enrichment profiles . The rnap - ii chip - seq data sets includes the data generated at our lab (9) and data sets from various published and unpublished studies available freely at ncbi geo database . The human rnap - ii chip - seq data sets include six different cell lines: cd4 + t, hela s3, k562, nb4, lymphoblastoid and jurkat, whereas mouse samples include five different tissues and five different cell types: brain, liver, lung, spleen, kidney, embryonic stem cell (v6.5), mouse embryonic fibroblasts b4, mouse embryonic fibroblasts b6, bone marrow - derived macrophages and 3t3-l1 (9,1723). The ncbi geo accession numbers of the data sets are provided in table s2 . On the downloaded chip - seq data sets, we apply our pipeline (figure 1) that includes alignment, identification of significant enriched regions, promoter prediction and annotation . Bowtie program (24) was applied to map reads to the reference genome (mm9 version for mouse and hg18 version for human), allowing up to two mismatches . We obtained 174 777 943 and 333 192 049 uniquely mapped reads for mouse and human genome respectively (table s3). Significant peaks were identified using our three steps procedure as described in (9) at p - value = 0.01 . After identification of significant rnap - ii bound peaks we apply our recently published program for prediction of rnap - ii bound promoters (10). Following promoter prediction, we performed promoter annotation using our reference promoter knowledgebase as summarized in figures s1 and s2 . Finally, we identified 48 366 mouse and 42 893 human promoters bound by rnap - ii where 39% and 42% of the promoters in mouse and human respectively were annotated as novel promoters (table 1). In case the predicted chip - seq promoters lie within 1 to 0.5 kb of known tss or within the first exons of known transcripts, they are defined as novel promoters. It is worth noting that 65% and 90% of novel promoters in mouse and human, respectively, are supported by additional sources (novel gene models, mrnas, spliced ests, cage tags and orthologous gene model) (table s4). Table 1.summary of rnap - ii bound promoters identified in various tissues / cell types for human and mouse using chip - seq data setsspeciestissue / cell typeno . Of known promotersno . Of novel promotersno . Of tissue/ cell - specific promotersno . Of cpg promotersno . Of bidirectional promotersno . Of total promotersmousebrain15 9485270397813 864137321 218liver12 3193189164210 421125015 508kidney15 0594632199512 879134819 691spleen908921218068273106711 210lung15 3735142193513 986137420 515embryonic stem cell(v6.5)11 8952880274512 063131414 775mouse embryonic fibroblasts b410 558226127310 898124112 819mouse embryonic fibroblasts b611 887276170610 886123714 648bone marrow - derived macrophages (untreated)13 320397787012 038129817 297bone marrow - derived macrophages (2 h)12 647371356611 846129416 260bone marrow - derived macrophages (4 h)13 119404168811 926129217 1603t3-l1 cells (untreated)848913731138597103898623t3-l1 cells (day 1)868416261548803107293103t3-l1 cells (day 2)850815931748415104210 1013t3-l1 cells (day 3)837415401368371103599143t3-l1 cells (day 4)69761422194679384883983t3-l1 cells (day 6)4039144392740305115482total29 51718 84917 90224 587180148 366humanjurkat cells7417140354176537928820k562 cells16 4108012642216 918132024 422lymphoblastoid cells19 6178998662920 682131128 615nb4 cells12 925294491613 650115615 869hela_s3 cells13 9823502210114 812121217 484cd4 + t cells14 3294137133615 740122018 466cd4 + t cells (2 h)7354126717479558828621cd4 + t cells (12 h)11 470238937712 740117213 859total24 96717 92618 49627 488150142 893 summary of rnap - ii bound promoters identified in various tissues / cell types for human and mouse using chip - seq data sets furthermore, our analysis has identified promoters for 15 493 and 14 266 protein - coding genes in mouse and human respectively . A gene is defined as protein coding if it has at least one protein - coding transcript in refseq / vega gene models, or else it is a non - coding gene . Please note that a protein coding gene can generate transcript variants that are non - coding rnas . We also observed that 40% and 36% of protein coding genes in mouse and human are expressed from alternative promoters (table 2). Surprisingly, 37% of promoters in mouse and 43% of human promoters were identified in a single cell / tissue suggesting that they are cell / tissue - specific promoters . Additionally, we analyzed the cpg - richness and bidirectionality of the promoters and found that 51% and 64% of promoters are cpg - rich and there are 1801 and 1501 bidirectional promoters in mouse and human respectively . Additionally, we also provide significant enrichment profiles of various factors (mouse oct4, cebpa, chd7, c - myc, ctcf, esrrb, foxa1, foxa2, gfp, klf4, n - myc, nr5a2, p300, rbbp5, setdb1, sirt1, sox2, stat3, stat4, stat6, suz12, tbp, tbx3, tcfcp2i1, wdr5, zfx; human oct4, cbp, ctcf, ets1, klf4, nanog, p300, pcaf, phf8, pparg, runx, sox2, stat1, tfii, tip60, znf263, suz12, mof, igf1r, nfkb) calculated from different published and unpublished chip - seq datas ets (table s5a and b). (a) mpromdb main search page where a user can perform search based on either entrez gene id / symbol or specific tissue / cell type and the resulting page is shown in (b) and (c), respectively . (d) user can visualize the chip - seq profile for any promoter displayed on (b) or (c) by clicking on the promoter position link . Table 2.alternative promoter usage for active protein - coding genes in mouse and humanprotein - coding genesmouse (%) human (%) 1-promoter genes9290 (60)9051 (63.44)2-promoter genes3490 (22.5)3192 (22.37)3-promoter genes2707 (17.5)2023 (14.18)total15 49314 266 screenshots of mpromdb and search results . (a) mpromdb main search page where a user can perform search based on either entrez gene id / symbol or specific tissue / cell type and the resulting page is shown in (b) and (c), respectively . (d) user can visualize the chip - seq profile for any promoter displayed on (b) or (c) by clicking on the promoter position link . Mpromdb as a web - based application has many layers: the core application (designed in django), a backend database (mysql), a visualization component (gbrowse) and a web server (apache) (see supplementary file 1). The promoter information corresponding to a particular gene can be retrieved from the database using entrez geneid or gene symbol . We also provide additional search and filter options such as selection of tissue / cell type, tissue / cell specific promoters, known / novel promoters and coding / non - coding gene promoters . The gene search query returns result at two different levels (see figure 2, supplementary file 2, supplementary tables s6 and s7). The first level provides information (promoter position, cpg type and bidirectional type) regarding all promoters of the queried gene that are present in the promoter knowledgebase . The second level of search result lists all promoters identified from chip - seq data sets for the queried gene . Visualization of the promoter position and chip - seq data enrichment profile is implemented using gbrowse (12), an open source genome browser platform . Gbrowse is simple but highly configurable web - based genome browser, which provides a fast and customizable interface for visualizing data that is stored in a backend database, as well as the data that is uploaded by the user . Gbrowse is lighter than ucsc genome browser and offers many advantages especially in displaying the results and tracks . Some of the features unique to gbrowse are: glyphs and balloons to represent different features, organizing features sub categories to more depth, multi - language support, view genbank, chado and biosql feature databases, third party loading . On gbrowse the identified promoter location and enrichment profile of the analyzed chip - seq data sets are shown (figure 2d). Further, users can directly type the genome coordinates or gene symbol on gbrowse for searching . Users have an option to turn on / off the tracks that are displayed on the genome browser . In future, we plan to include epigenetic histone modifications profile identified from chip - seq data sets that are currently available at ncbi geo and integrate it to our promoter knowledgebase . We will also continue to collect rnap - ii and transcription factors chip - seq data sets from a wider variety of tissues and cell types to routinely update mpromdb . We also plan to include other mammalian data sets, and add additional features and search options to the frontend of the database . In conclusion, mpromdb will provide integrated transcriptional regulatory information for mammalian genomes in an easily accessible way . We believe that the updates will facilitate large - scale chip - seq data analysis and contribute toward the elucidation of mammalian transcriptional regulatory networks . Nhgri / nih grant (#r01hg003362); american cancer society research scholar grant (#rsg-07 - 097 - 01 to r.d . ); and philadelphia healthcare trust . R.d . Holds a philadelphia healthcare trust endowed chair position . Funding for open access charge: national institutes of health grant (#r01hg003362 to r.d . ).
Many potential therapies for severe and/or chronic wounds fail as a result of poor vasculature . Hence, strategies to improve blood vessel supply into a wound bed are thought to promote wound healing . Transplantations of mesenchymal stem cells (mscs) have shown great potential as a therapeutic agent for the treatment of a range of disorders, including wound healing, and have become the subject of numerous clinical trials . However, whilst the safety of msc transplantation does not seem to be an issue, the effectiveness of such treatment has exhibited considerable variability . This variation in effect is problematic when translating preclinical research into msc - based clinical therapy . We recently demonstrated that human msc - conditioned medium (msc - cm) was stimulatory to epidermal and fibroblast cell adherence and migration . Other reports suggest that msc are pro - angiogenic also through their paracrine activity on endothelial cells . Whilst there are reports that msc are capable of endothelial differentiation, engraftment into new vasculature is low in vivo . Hence, these and other studies have contributed to recent thought that the predominant regenerative activity of mscs is due to their secretion of factors that stimulate endogenous cells at wound sites . In this investigation, we have examined the effects of msc - cm on endothelial cells, using the cell line eahy-926 as a model system . We report that msc - cm promotes endothelial cell adhesion and migration, but that these effects show considerable donor - donor variability . Further, we have identified extracellular matrix (ecm) proteins that are secreted by mscs using maldi / tof - tof mass spectrometry . We provide data to suggest that ecm composition plays a major role in the donor - donor variation we have seen . These findings demonstrate proof of principle of the need to screen the msc secretome in order to optimise the application of mscs in the clinic . Cell culture and mass spectrometry of conditioned medium eahy-926 endothelial cells were maintained in dmem / f12 culture medium (invitrogen, paisley, uk) supplemented with 10% (v / v) fetal calf serum (fcs) (invitrogen) and 1% (v / v) penicillin and streptomycin (invitrogen), incubated at 37c and in a humidified atmosphere containing 5% (v / v) co2 . Passaging was performed at ~90% confluence and cells were re - seeded at 1 x 10 cells / cm . Mscs were isolated from the iliac crest biopsies of bone marrow donors following ethical approval and with informed consent, as previously described . The adherent cell population obtained was consistent with the characteristics of mscs laid out by the international society for cellular therapy (isct). Conditioned medium was generated from msc cultures of equal cell number in serum free conditions, using dmem / f12 supplemented with insulin, transferrin and selenium (invitrogen). Protein content of msc cm was determined by maldi - tof / tof mass spectrometry as previously described . Characterization of msc after three passages in culture, bone marrow derived cells were assessed by immunoprofiling for cd markers and by examining their differentiation potential to form osteoblasts, adipocytes and chondrocytes, by staining with alkaline phosphatase, oil red o, and toluidine blue respectively as per the criteria established for a msc phenotype by the isct . Coating of culture plates culture plates were coated with msc - cm or type - i collagen, decorin, or fibronectin (all sigma - aldrich). Protein solutions were diluted in pbs to 0.2mg / ml and added to each well (50l for 96-well plates, 500l for 24-well plates). These were refrigerated for 24 hours before being rinsed with pbs immediately prior to use . Cell adherence / spreading coated 24-well tissue culture plates were seeded with 2x10 eahy-926 endothelial cells in dmem / f12 supplemented with 1% penicillin / streptomycin (sigma - aldrich) and 1% its - x (sigma - aldrich) and incubated for 2 hours at 37c and 5% co2 before digital images were captured (progres cf, jenoptik) and analysed using image - j software . Scratch assays were established using previously published methods, in protein - coated tissue culture plates (as described above). Cell migration was automatically captured and analysed at hourly intervals using an incucyte live - cell imaging system (essen bioscience). Data were tested for significance using the mann - whitney u test . Those differences that fell within a 95%, 99% or 99.9% confidence interval were considered to be significant, indicated by asterisks within figures (* p<0.05 * * p<0.01 * * * p<0.001). Bone marrow cells obtained from iliac crest biopsies showed characteristics consistent with those expected of msc (figure 1). Msc - cm coating of culture plates resulted in the significant enhancement of the spreading of eahy-926 endothelial cells upon the culture surface . This result was subject to a marked inter - donor variability, with conditioned media generated by both msc-1 and msc-3 resulting in a significantly greater degree of eahy-926 endothelial cell spreading than that generated by msc-2 (figure 2a, 2b). Eahy-926 endothelial cell adherence on fibronectin coated plates was most advanced after two hours, compared to plates coated in either type i collagen or with decorin (figure 3). On type i collagen - coated plates, the presence of msc - cm appeared to enhance the rate of eahy-926 endothelial cell migration into scratch - wounds compared to unconditioned media (figure 4a, left). Eahy-926 endothelial cells in msc - cm closed scratch - wounds to a significantly greater degree than those in unconditioned media over a 12-hour time course (figure 4b, left). Once again, the degree of this msc - cm mediated enhancement of eahy-926 endothelial cell migration was subject to inter - donor variability . Conditioned medium generated by msc-1 (and msc-3) elicited a greater degree of scratch - wound closure than msc-2 over 12 hours (figure 4b, left). Cells isolated from bone marrow meet the minimum criteria for identification as msc.cells are immunoreactive for cd73, cd90 and cd105, whilst lacking immunoreactivity for cd14, cd34 and cd45, as shown by histograms obtained by flow cytometry, and readily differentiate to form osteoblasts, adipocytes and chondrocytes in vitro . Representative phase contrast images are shown of cells following tri - lineage differentiation and staining with alkaline phosphotase, oil red o, and toluidine blue (top, left to right). Msc - cm coating of culture plates influences eahy-926 endothelial cell adherence and spreading.a: msc - cm coating of culture plates influences eahy-926 endothelial cell adherence and spreading . After 4 hours in culture eahy-926 endothelial cells were observably more spread on culture plates coated with msc - cm than on plates coated with unconditioned (control) medium . B: after 4 hours in culture the average cell area was significantly greater for eahy-926 endothelial cells on msc - cm coated culture plates and 389m2 than those cells on unconditioned (control) medium coated culture plates . Data shown are means sem in relative units (* * * = p<0.001 mann whitney u test). Ecm protein coating of culture plates influences eahy-926 endothelial cells adherence and spreading.after 4 hours in culture eahy-926 endothelial cells were observably more spread on culture plates coated with fibronectin than on plates coated with type i collagen or decorin . B: after 4 hours in culture the average cell area was significantly greater for eahy-926 endothelial cells on fibronectin compared to those cells on either type i collagen or decorin . Data shown are means sem in relative units (* * = p<0.01, * * * = p<0.001, mann whitney u test). Eahy-926 endothelial cells closed scratch wounds faster in msc - cm than in unconditioned medium on type i collagen, fibronectin, and decorin coated culture plates . A: eahy-926 cells on fibronectin coated culture plates closed scratch wounds significantly faster than those on either type i collagen or decorin . B: after 12 hours eahy-926 endothelial cells in msc - cm had closed scratch wounds by a significantly greater degree than those in unconditioned control medium . 12 hours post - scratching, eahy-926 endothelial cells on plates coated fibronectin had closed scratch wounds by a significantly greater degree than those on either type i collagen or decorin . On fibronectin and decorin, medium conditioned by msc-2 on type one collagen, medium conditioned by msc-2 was associated with significantly reduced scratch closure compared to msc-1 . All three were found to contain fibronectin, collagen type i, collagen type vi, and lumican, whilst cartilage oligomeric matrix protein (comp) and sparc were present in two out of three msc - cm and laminin, decorin, heparan sulphate proteoglycan (hspg) and igfbp-1 were each only observed in one msc - cm (table 1). Of these, hence, not only was there clear inter - donor variability in the ecm components of the msc secretome, but the presence of these proteoglycans seemed to be associated with a reduction in the efficacy of msc - cm . When type i collagen, decorin and fibronectin were used as culture substrata, the degree of eahy-926 endothelial cell spreading appeared to be similar upon both type i collagen and decorin and greatly enhanced upon fibronectin (figure 2a, 2b). Similarly, scratch - wound closure by eahy-926 endothelial cells in unconditioned media appeared to be similar upon type i collagen and decorin, but markedly greater upon fibronectin (figure 4a, 4b). In the presence of each ecm substrate the presence of msc - cm resulted in significantly enhanced scratch wound closure compared to unconditioned media (figure 4b). As seen previously upon type i collagen coated culture plates, the degree of closure upon both decorin and fibronectin coated plates was either significantly or near significantly (p=0.057 by mann whitney u test) less in the presence of medium conditioned by msc-2, compared to medium conditioned by either msc-1 or msc-3 (figure 4b). Mass spectrometry of msc - cm from 3 separate donors.maldi-tof/tof mass spectrometry of msc - cm detected variable protein content between media conditioned by msc from three different patient donors . We have previously shown that msc - cm promotes the migration of skin cells in a wound healing model, and identified numerous potentially beneficial factors that may contribute to this effect . In vivo wound healing is, however, a complex process influenced by a host of cellular events, including angiogenesis . If msc can stimulate endothelial cells as suggested here and elsewhere this supports their potential use in the treatment of cutaneous wounds . In these experiments, this is similar to previous studies in which msc - cm has been shown to stimulate angiogenesis, supporting the investigation of msc - cm as a pro - angiogenic agent . Although it is possible for proliferation of eahy-926 endothelial cells to have contributed somewhat to the closure of the scratch wounds, these scratch assay experiments were performed over the course of 12 hours . The reported doubling time for these cells is over 25 hours . To significantly affect the rate of scratch wound closure, those cells at the leading edge of the scratch margins would be required to undergo repeated doublings, and this is unlikely to have had a major influence on scratch wound closure over the time course of these studies . Mass spectrometry of msc - cm revealed numerous factors (including fibronectin and collagen) in medium conditioned by each of the three msc examined and some, including laminin and decorin, in one or two but not all three of the msc - cm samples . Of these ecm components, fibronectin, collagen and laminin are known to promote or support angiogenesis . Unusually, in these experiments collagen did not seem to induce any observable cell response when compared to decorin . Fibronectin and collagen contain protein motifs are known to mediate angiogenesis by integrin receptor signaling in vivo and in vitro . Decorin inhibits endothelial cell migration and tubule formation in vitro and inhibits the pro - angiogenic effects of vegf . Lumican interferes with 21 receptor activity and inhibits angiogenesis both in vitro and in vivo . Whilst lumican was present in each of the msc - cm used in these investigations, decorin was only found within the msc - cm that consistently showed significantly less enhancement of eahy-926 endothelial cell migration . As the method (maldi - tof / tof mass spectrometry) used to detect these protein components within msc - cm was not quantitative, it was not possible to determine whether differences in concentrations of each ecm component were related to efficacy of the conditioned media . Msc - cm coating of culture plates enhanced eahy-926 endothelial cell adherence, as did coating with fibronectin . Cell adherence to these substrata was examined in an indirect fashion, by assessing the average area of cells in the immediate - early period after seeding . As cells settle upon a permissive substrate they spread out from the rounded morphology observed in suspension to adopt a flattened morphology that is usually seen in vitro in adherent cell populations . After prolonged periods of time, cells in culture, including endothelial cells, synthesize matrix molecules that may also promote cell adhesion, potentially masking the initial effects of the original substrate being investigated . Of the matrix proteins detected in msc - cm by maldi - tof / tof mass spectrometry, fibronectin was observed to have a profound effect upon cell adherence, similar to those findings concerning cell migration . However, the addition of msc - cm to endothelial cell scratch assays performed upon fibronectin coated culture plates resulted in a further enhancement of endothelial cell migration, suggesting that fibronectin may not be solely responsible for the entire effect . Further experiments investigating the effects of msc secreted growth factors and cytokines individually, and in combination, may reveal their relative contribution to the enhancement of endothelial cell migration . The relatively low number of individual donors examined during this study is a clear limitation, and although the results presented support the conclusions that (i) msc donor variation and secretome composition may account for differential effects of mscs on endothelial cells, and (ii) that this variation should be taken into consideration in msc - based regenerative medicine, subsequent investigation of greater numbers of samples is required to further authenticate these findings . Angiogenesis depends on endothelial cell migration and the actions of endothelial cell chemotactic factors, e.g. Vegf and il-8, and ecm proteins such as collagens, fibronectin and laminin . Many of these pro - angiogenic factors have been found to be present within the msc secretome both within this investigation and in previous studies . These experiments have showed that msc - cm enhances both the rate of endothelial cell migration and the adherence of these cells to their culture surface, and that this effect was, in part, mediated by the presence of fibronectin . The effects of msc - cm upon endothelial cell migration were not entirely induced by fibronectin, as suggested by the further enhancement of eahy-926 endothelial cell migration by msc - cm in the presence of exogenous fibronectin . Factors such as interleukin (il)-8, vegf, and laminin have all been shown to be stimulatory to endothelial cells and these factors have been shown to be present within msc - cm . It seems likely that these known mediators of angiogenesis might contribute to the effects of msc - cm upon eahy926 endothelial cells observed in these investigations . Overall, the data presented here support the hypothesis that msc may stimulate the formation of new vasculature, and that this may be an important aspect of msc - mediated enhancement of wound healing.
Due to the fact that the majority of pancreatic cancers are unresectable upon diagnosis, curative intent is rarely a goal of treatment, rather increasing survival, time to progression, and quality of life are more realistic goals . Without treatment, median survival for patients with an advanced stage of disease ranges from 3 to 4 months, whereas in patients receiving chemotherapy with single - agent gemcitabine, median survival times between 4.9 and 7.2 months have been reported in randomized phase iii studies . Gemcitabine has been the solo player in the field of pancreatic cancer, treatment after replacing 5-fu since 1997, and is still regarded as one standard of care for the first - line systemic chemotherapeutic treatment of patients with advanced pancreatic cancer worldwide . So far, only two randomized phase iii trials have demonstrated a significant prolongation of survival with the use of gemcitabine - based combination therapy with either erlotinib or capecitabine . Eventually, progression will occur and the real challenge will be how to treat a patient with advanced pancreatic cancer failing to respond or progressing after gemcitabine . There is no evidence - based treatment recommendation for these patients . The national comprehensive cancer network guidelines for pancreatic adenocarcinoma currently recommend second - line chemotherapeutic treatment after gemcitabine failure in selected patients using, for example, single - agent capecitabine or a combination therapy of fluorouracil, leucovorin and oxaliplatin (folfox-) like regimen . To date, there is no large randomized trial confirming the survival advantages of second - line chemotherapy over best supportive care, yet the preliminary results from a small randomized german study comparing bsc alone versus 5-fu, folinic acid, and oxaliplatin plus bsc after gemcitabine failure showed a prolongation of median survival by approximately 2.6 months with the use of chemotherapy (2.3 versus 4.9 months). These data were supported by a japanese study that reported a median survival time of approximately 1.9 months after failure of first - line gemcitabine in 74 patients with pancreatic cancer (of whom 97% received no second - line treatment). Many protocols containing oxaliplatin, 5fu, and leucovorin, as folfox, flox, and 3-week bolus 5fu plus leucovorin and oxaliplatin, are known . Preclinical data suggested that the 5-fu plus oxaliplatin combination is more cytotoxic when 5-fu is given as a short exposure, which gives a rationale for exploring the toxicity and efficacy of such protocols in advanced pancreatic cancer . In the current study, we conducted a randomized trial to compare two protocols; flox and the 3-weeek bolus protocol regarding toxicity, response rate, and time to progression as primary end points, then overall survival as secondary endpoints . Patients with advanced unresectable or metastatic pancreatic adenocarcinoma were enrolled under the following eligibility criteria . (i) patients with histologically or cytologically proven locally advanced or metastatic pancreatic adenocarcinoma, (ii) with at least 1 bidimensionally measurable lesion (world health organization (who) criteria); (iii) eastern cooperative oncology group (ecog) ps of 1 - 2; (iv) tumor progression after first line gemcitabine (whether gemcitabine pretreated or gemcitabine resistance); (v) absence of severe uncontrolled cardiovascular, metabolic, infectious, or neurological diseases; (vi) adequate bone marrow reserve (neutrophil count> 1.5 10/l, platelet count> 100.000/mm and hb> 10 g / dl); (vii) adequate liver function (serum bilirubin <1.5 mg / dl, serum transaminases <2x the upper limit of normal); (viii) adequate renal function (serum creatinine <1.5 mg / dl); (ix) and age between 18 and 75 years . All participating patients were required to give written informed consent, and ethical approval from moc committee was obtained before the start of the whole procedure . Exclusion criteria histologic types other than adenocarcinoma.neuropathy ctcae grade 1.ototoxicity> ctcae grade 2.serious, active comorbidity, including any of the following: unstable angina and/or nyha class ii iv congestive heart failure requiring hospitalization within the past 12 months, transmural myocardial infarction within the past 12 months, acute bacterial or fungal infection requiring iv antibiotics, chronic obstructive pulmonary disease exacerbation or other respiratory illness requiring hospitalization or precluding study therapy, hepatic insufficiency resulting in clinical jaundice and/or coagulation defects, active gastrointestinal (gi) ulcers, gi bleeding, inflammatory bowel disease, or gi obstruction, inadequately controlled hypertension, defined as systolic bp> 150 mm hg and/or diastolic bp> 90 mm hg on antihypertensive medications, serious cardiac arrhythmia on medication (well - controlled atrial fibrillation on medication allowed), and history of hypertensive crisis or hypertensive encephalopathy . Serious, active comorbidity, including any of the following: unstable angina and/or nyha class ii iv congestive heart failure requiring hospitalization within the past 12 months, transmural myocardial infarction within the past 12 months, acute bacterial or fungal infection requiring iv antibiotics, chronic obstructive pulmonary disease exacerbation or other respiratory illness requiring hospitalization or precluding study therapy, hepatic insufficiency resulting in clinical jaundice and/or coagulation defects, active gastrointestinal (gi) ulcers, gi bleeding, inflammatory bowel disease, or gi obstruction, inadequately controlled hypertension, defined as systolic bp> 150 mm hg and/or diastolic bp> 90 mm hg on antihypertensive medications, serious cardiac arrhythmia on medication (well - controlled atrial fibrillation on medication allowed), and history of hypertensive crisis or hypertensive encephalopathy . All patients were subjected to staging procedures consisted of medical history, physical examination, echocardiography, serum chemistry panel, complete blood picture, cea, and ca 19 - 9 . Extent of disease was determined by chest x - rays, computed tomography and/or nuclear magnetic resonance, and endoscopy as needed . Patients were randomly assigned to one of the treatment regimens (block randomization at 4), where 24 patients were enrolled for each treatment group . Oxaliplatin 85 mg / m was administered as a 2-hour infusion before lv and fu on days 1, 15, and 29 of the treatment cycle . Lv 500 mg / m was administered as a 2-hour intravenous infusion weekly for 6 consecutive weeks (on days 1, 8, 15, 22, 29, and 36 of the treatment cycle), followed by a 2-week rest period . Fu 500 mg / m was administered as an intravenous bolus 1 hour after the lv infusion was begun and was administered weekly for 6 weeks (on days 1, 8, 15, 22, 29, and 36 of the treatment cycle), followed by a 2-week rest period . 2-hour intravenous infusion of oxaliplatin 40 mg / m was followed by bolus leucovorin 250 mg / m and bolus 5-fu 500 mg / m . Each course consisted of weekly administrations for 3 consecutive weeks followed by a week of rest . Therapy continued until disease progression, unacceptable toxicity, patient's refusal, or a maximum of 6 courses . All patients received intravenous dexamethasone 8 mg, ondansitrone 8 mg as antiemetic prophylaxis . Therapy was withheld in case of a platelet count of less than 100.000/mm or a neutrophil count of less than 1.500/mm or for bilirubin greater than 1.5 times the upper reference level (url) or transaminases greater than 3 times the url . During the entire study period, patients received full supportive care to control pain or other symptoms, with careful recording of the treatment . Oxaliplatin was reduced in the event of persistent paresthesia / dysesthesia between cycles or with pain lasting for> 7 days according to staff physician's decision . When paresthesia / dysesthesia with either pain or functional impairment persisted between cycles, oxaliplatin was discontinued . Measurable disease response was assessed by recist criteria . Partial response (pr), stable disease (sd), and progressive disease (pd) were determined according to these criteria . The sum of pr and sd was reported as disease control rate (dcr). Os was estimated from the date of first treatment to the date of death or the last followup . Clinical benefit assessment was based on patients and physician - reported improvement of cancer - related symptoms and/or stabilization of improvement of ps . The ttp was calculated from the first treatment infusion to the first objective evidence of disease progression assessed by ct scan measurements or early death or date of clinical deterioration and patient not assessable for response . Ttp and os since the start of treatment were estimated on an intent - to - treat basis and analyzed according to the kaplan - meier method . Comparison between survival curves was done through log rank test to estimate p value utilizing graphpad prism version 5 software . The required number of patients for this phase ii study was determined according to a jehan phase ii optimal design for a goal of 20% true clinical benefit; with - and -error probability of 0.05 and 0.20, respectively, an accrual of 24 patients assessable for response was planned . Forty - eight patients with unresectable or metastatic pancreatic cancer pretreated with gemcitabine (including gemcitabine resistance or gemcitabine pretreated) in ain shams university hospitals were included along the period between october 2008 and september 2011 . Sixteen males out of total twenty - four cases were encountered in flox arm compared to 17 in 3-week bolus arm . Grade 3 or 4 toxicities experienced by at least 5% of patients according to treatment arm are summarized in table 2 . Two cases of neutropenia exceeding grade 2 (but no febrile neutropenia) were observed; one in each treatment groups . Grade 3 anemia was recorded in 3 patients (2 in flox arm, one in 3-week arm). No complete response was registered among all assessable 48 patients throughout the study duration for flox regimen, three patients (12.5%) had partial response, five patients (21%) had stable disease, and three out of 8 patients with pain at presentation (37.5%) had clinical benefit . The median time to progression was 3.9 months (95% ci, 24.6) (range: 1.55.5). Median survival time was 8 months (95% ci, 4.012). For 3-week regimen, two patients (8%) had partial response, five patients (21%) had stable disease, and four out of 8 patients with pain at presentation (50%) had clinical benefit as shown in table 3 . The median time to progression was 4 months (95% ci, 1.85) (range: 1.26). Median survival time was 9 months (95% ci, 3.513) as shown in figures 1(a) and 1(b). There was no statistical significance in progression - free survival between the 2 regimens (p value by log rank test = .4619), and so was the situation in overall survival (p - value by log rank test = .5248). Although it was not planned as a target for the current study, yet it was an interesting issue to compare cost of chemotherapy per patient for every 8 weeks of treatment for each regimen . For flox regimen this cost was approximately 1200 usd versus 1400 usd for the 3-weeks regimen (due to mainly the amount of discarded oxaliplatin in every injection time that was more in the second regimen) as in table 4 . Advanced pancreatic cancer remains a rapidly lethal cancer, with a median survival of 6 months with currently approved therapies . The role of second - line chemotherapy after failure of first - line therapy in such cases is not well established, but a theoretical possibility exists in which salvage chemotherapy after the failure of first - line treatment may influence the survival . For the scale of patients with good performance status, progressing after first - line gemcitabine therapy, nccn recommends fluoropyrimidine - based chemotherapy . But for time being there is still a debate to treat or best supportive care? A phase iii trial after failure of first - line gemcitabine compared bsc plus with biweekly oxaliplatin combined with weekly 5-fu as 24 hours infusion plus leucovorin, versus bsc alone . After the first 46 patients out of 165 planned, the bsc arm had to be closed because bsc alone was no longer accepted by participating centers, with a possible survival benefit for second - line chemotherapy: 21 weeks (95% ci; .7; 23.3) versus 10 weeks (95% ci; 7.7; 12.3). So a second question is as the following: what is the best option of treatment? Adding oxaliplatin to continuous infusion fluoropyrimidine as a second - line salvage therapy for this category has been investigated in some phase ii trials [1012]. In a series of unselected patients the folfox4 regimen yielded a 14% pr rate with 38% of patients showing sd for a dcr of 57% . Median duration of pr was 5.2 months, while median time to progression and overall survival was 4 and 6.7 months, respectively, but all the regimens of continuous infusion necessitate either hospitalization or pump application with their financial load upon health care system . This was the rationale to investigate regimens including oxaliplatin and bolus fluorouracil, with the theoretical premise of being as active as continuous infusion regimens, as well simpler in administration, less in cost, and better in toxicity profile . In the current study, two regimens of oxaliplatin and bolus fluorouracil have been investigated, flox regimen that was used in metastatic colorectal cancer with adequate efficacy and acceptable toxicity profile . The current study revealed nonprogression (pr + sd) in 33.5% for first regimen and 29% for second regimen, and 37.5% had clinical benefit (flox regimen) compared to 50% in 3-week regimen . Median survival time was 8 months and 9 months for both regimens, respectively, with no statistically significant difference in progression - free or overall survival . Two cases of neutropenia exceeding grade 2 (but no febrile neutropenia) were observed; one in each treatment group . Grade 3 anemia was recorded in 3 patients (2 in flox arm, one in 3-week arm). So it is the time for the 3rd question; are these results comparable to those of folfox regimens (infusion fluorouracil)?, 2007, carried out a retrospective study including 42 patients who received standard folfox4 regimen biweekly until progression or unacceptable toxicity . The study revealed six partial responses (14%) and 16 stabilizations (38%) were recorded for a tumor growth control rate of 57% . The median time to progression (ttp) was 4 months (range 17 months), and median overall survival (os) was 6.7 months (range 29 months). A stabilization of performance status (ps) and a subjective improvement of cancer - related symptoms was recorded in 27 patients . The good nonprogression rate in this study may be attributed to the high percentage of responding patients in this study to the first line therapy (50%) compared to 12% in our study . Tsavaris et al ., 2005, in a prospective phase ii study evaluated a second - line combination regimen of oxaliplatin together with leucovorin - modulated 5-fu in 30 patients and revealed an encouraging response rate of 23% with a corresponding disease - control rate of 53% . These data correlate well with the retrospective analysis from italy, which found a response rate of 14% together with a disease - control rate of 52% with the use of a folfox-4 regimen in gemcitabine - pretreated patients . Another phase ii trial of oxaliplatin plus capecitabine in a series of 41 patients reported a pr in one case and sd in eight patients with a median os of 5.8 months, and a 6-month and 1-year survival rate of 48% and 22%, respectively . Preliminary results of another trial of oxp/5-fu in a series of 23 patients have shown an os of 4 months . In a study on 23 gemcitabine pretreated patients with advanced pancreatic cancer revealed no objective response in all 17 assessable patients and 4 patients had stable disease, whereas 13 had tumor progression . The regimen was associated with 36% clinical benefit . In conclusion, combining oxaliplatin to bolus fluorouracil (either in flox or 3-week regimens) as a second line in gemcitabine pretreated patients with advanced or metastatic pancreatic adenocarcinoma showed encouraging efficacy, acceptable toxicity, and some clinical benefit specially when palliation or good quality of life is a target keeping in mind the simplicity in administration, the no need for hospitalization, and the less financial load specially with flox . Further studies with large number of patients investigating the efficacy and tolerability of such bolus regimens in gemcitabine - pretreated pancreatic cancer patients are warranted.
Primary peritonitis constitutes less than 1% of peritonitis and spontaneous bacterial peritonitis usually occurs in patients with comorbid conditions . In absence of comorbid conditions, including liver cirrhosis, immunosuppression, or nephrotic syndrome, primary peritonitis is rare, particularly in cases of healthy young subjects . Primary peritonitis due to s. pyogenes is an unusual condition because streptococcus pyogenes usually causes pharyngitis, erysipelas, and necrotizing fasciitis . In this report, we present the first case to the best of our knowledge of primary peritonitis due to s. pyogenes in korea . 29-yr - old woman presented to the emergency room with lower abdominal pain on april 20, 2011 . She had no travel history and had not taken any medication . On physical examination, she was alert and cooperative . Her body temperature was 38, blood pressure 80/60 mmhg, pulse 113 beats per minute, respiratory rate 20 breaths per minute, and oxygen saturation 99% while breathing ambient air . Results of gynecological examination from gynecologists were also normal and no history of abnormal vaginal discharge was known . Initial blood tests showed leukocyte count of 6,248/l, platelet count of 133,000/l, c - reactive protein (crp) level of 12.36 mg / dl, and procalcitonin level of 36.9 ng / ml . Renal and liver function tests, clotting screen, and arterial blood gas were all within normal range . Abdominal ct revealed edematous swelling of the intestinal wall and ascites with peritoneal enhancement suggesting peritonitis (fig . As physical, laboratory, and radiologic findings suggested acute peritonitis, laparoscopy searching for etiology was performed . Purulent ascites was found in the pelvic cavity but both ovaries and fallopian tubes were intact (fig . There were no intra - abdominal abnormalities such as bowel perforation, appendicitis, or necrosis . Reports of blood culture, ascites culture, and cervical swab culture showed gram - positive cocci . Initial empiric antibiotics (ampicillin / sulbactam 2 g/1 g every 6 hr) switched to penicillin g (300 mu every 4 hr) and metronidazole (500 mg every 8 hr). Primary peritonitis caused by streptococcus pyogenes is uncommon and rarely diagnosed in a healthy person without underlying diseases . Spontaneous bacterial peritonitis due to streptococcus pyogenes in a cirrhotic child was reported in korea (1) but s. pyogenes peritonitis in a healthy person has not yet been reported in korea . Therefore, this is the first case of primary peritonitis due to streptococcus pyogenes in a healthy person in korea . It is reported that most instances of spontaneous primary peritonitis are due to streptococcus pneumoniae (2). There are a few cases describing s. pyogenes peritonitis in healthy women, even though the entry site of s. pyogenes in peritonitis is not uncertain . (3) suggested that in some women, s. pyogenes in peritonitis may be via the genital tract, despite lack of gynecological symptoms even though many studies have shown an absence of s. pyogenes as normal flora of the female genital tract . The hematogenous route may be an alternate, possibly from pharyngeal or cutaneous primary sites (3). In this case, ascending genital infections was considered to be the entry site because of the positive cervical swab culture . The majority of primary peritonitis is diagnosed retrospectively when secondary causes are excluded after surgical approach (4). Preference for laparoscopy or laparotomy is established by the surgeon's choice and laparotomy is predominantly performed in previous cases . However, farooq and ammori (5) claimed that laparoscopy could be used as a diagnostic tool in the management of generalized peritonitis . We chose laparoscopy as a diagnostic tool in this case because no significant abnormalities suggesting secondary peritonitis were found on abdominal ct . The severe infection of s. pyogenes requires a high index of suspicion, prompt diagnosis, and rapid initiation of appropriate antibiotics (6). In this case, reports of blood culture, abdominal ascites culture, and cervical swab culture showed gram - positive cocci, so ampicillin / sulbactam was applied . After final result of culture confirmed s. pyogenes, antibiotics were switched to penicillin g and metronidazole . It is reported that some s. pyogenes serotypes are more commonly associated with invasive group a streptococcal disease than other gas isolates (7 - 9). We did not obtain the serotype of s. pyogenes, so further study on s. pyogenes serotypes in primary peritonitis is required . In summary, we report the first case of primary peritonitis in korea in a young, healthy woman due to s. pyogenes . The port of entry was thought to be via the genital tract, despite no local symptoms . Laparoscopy as a diagnostic tool was performed in this case and we recommend laparoscopy over laparotomy when no significant abnormalities suggesting secondary peritonitis are seen on abdomen computed tomography . An appropriate diagnostic approach and prompt antibiotic therapy is essential in primary gas peritonitis.
Carbon monoxide (co) is a colorless, odorless, and nonirritant gas that is lighter than air, and it is a product of incomplete combustion of hydrocarbons.1) accidental, suicidal or homicidal intoxications with co have a long history . Acute co poisoning is an important clinical problem and may lead large proportion of patients to fatal death . Moreover, frequent neurologic and cardiovascular consequences have been described.2 - 4) the neurologic manifestations of co poisoning have been well described, and include headache, dizziness, weakness, nausea, and confusion.3)4) cardiac consequences have been reported, including arrhythmias and electrocardiographic alterations, acute myocardial infarction, pulmonary edema, and cardiogenic shock.5)6) among these, myocardial injury is common in patients with moderate to severe co poisoning,2) manifested as elevated cardiac biomarkers and the changes of regional wall motion abnormality in echocardiography.7) on the other hand, an association between thromboembolic accidents and co poisoning has been shown less frequently in the literatures.8 - 14) we report a co poisoning case complicated by intracardiac thrombus . A 24-year - old female patient with no preexisting disease was brought to the emergency unit for altered mentality due to suicidal exposure to co. the duration of the exposure was unclear . She showed a good general appearance, the level of consciousness was alert: glasgow coma scale was measuring up to 15 . Vital signs were blood pressure of 132/101 mmhg, pulse rate of 87/min, respiration rate of 20/min and body temperature of 35.4. oxygen saturation measured using pulse oxymetry was 100% when 15 l / min oxygen was applied through a reservoir bag mask . She was 164 cm tall and weighed 50 kg, and her body mass index was 18.6 kg / m . Lower and upper limb arterial and venous examination revealed normal circulation . In detailed system examinations, no pathological neurologic signs were detected . Laboratory analyses revealed the following: white blood cells, 21200/l; blood urea nitrogen, 17 mg / dl; creatinine, 0.75 mg / dl, and blood glucose, 101 mg / dl, d - dimer 0.28 ug / ml . Cardiac enzymes were elevated (ck: 3306 u / l, ck - mb: 90.6 ng / ml, troponin i: 1.899 ng / ml, lactate dehydrogenase: 334 u / l). Arterial blood gas was performed and revealed ph 7.40, paco2 33 mmhg, pao2 380 mmhg, hco3 20 mmol / l, and the fraction of carboxyhemoglobin 16.0% (reference range <2%). Pain was mainly retrosternal, lasted for several minutes, with no aggravating or relieving factors, and no change in position or respiration . Coronary computed tomography (ct) angiography performed to rule out coronary artery disease revealed normal coronary artery . Transthoracic echocardiography on the same day showed moderately reduced ejection fraction (42%), and akinesia of left ventricular apex . Stress induced cardiomyopathy or ischemic insult of left anterior descending artery were suspected . During comprehensive echocardiographic examination, echogenic mass with multiple nodularity in right atrium (ra) was identified . The size measured about 30 15 mm, and it appeared to be attached to the junction of superior vena cava . Transesophageal echocardiography and cardiac magnetic resonance imaging (mri) were requested for further characterization of the mass . In mid - esophageal 140 degree view the mass was highly mobile and oscillating up and down across the tricuspid valve throughout the cardiac cycle (fig . The foremost diagnosis to exclude in this patient was intracardiac thrombus, and therefore we started anticoagulation therapy immediately . Cardiac mri 1 day after anticoagulation therapy showed delayed enhancement suggestive of a thrombus, and an obvious reduction in size of the thrombus to 8 mm (fig ., she was questioned concerning recent potential precipitating conditions, such as surgery, immobilization and use of medications including oral contraceptives . Furthermore, she was evaluated for genetic and connective tissue disease leading to thrombophilic conditions . Complete lower extremity ultrasound and abdominopelvic ct was conducted for suspicion of peripheral vein thrombosis and it demonstrated no thrombosis in other organs . The follow - up transthoracic echocardiogram was done on sixth day after anticoagulation, and showed no residual thrombus in the ra and normalized left ventricular (lv) systolic function (fig . The patient has been free of symptoms and there have been no clinical features of neurologic or thromboembolic complications during the 3-months of follow - up . Co poisoning has special impact on organs sensitive to oxygen deprivation such as the heart, brain, and kidney . Myocardial injury assessed by ecg and cardiac enzyme elevation from moderate to severe co poisoning is common (~40%) than expected.2) the proposed mechanism of global left ventricular dysfunction is tissue hypoxia and resultant myocardial stunning . The affinity of hemoglobin for co is more than 200 times greater than its affinity for oxygen, and competitive inhibition of oxygen release leads to tissue hypoxia.3) usually, the left ventricular dysfunction was transient and would be normalized with conventional treatment including high concentration of oxygen . In our case, left ventricular systolic dysfunction with regional wall motion abnormalities was associated with co poisoning and recovered with conventional therapy . In contrast, an association between thromboembolic accidents and co poisoning has been shown less commonly in the literatures . To our knowledge, this is the first korean case of acute co poisoning combined with ra thrombus formation . Besides lv thrombus formation associated with transient apical ballooning of lv,15) there have been several reports regarding arterial and venous system thrombosis and related embolism including popliteal artery,8)9) superior sagittal sinus,10) vein of labbe,11) mesenteric artery,12) basillar trunk,13) and popliteal vein.14) a plausible explanation for thromboembolic events is the effect of co on platelets aggregation . Co poisoning leads to some changes in blood vessel and co and nitric oxide exchange on platelet . Disturbed mitochondrial mechanisms by no and its derivatives facilitate production of free oxygen radicals.16) oxidative stress enhanced by free oxygen radicals may lead to endothelial damage, and subsequent platelet aggregation.17) although the optimal therapy and duration of anticoagulation for co induced ra thrombus is still unknown, the use of anticoagulant therapy in the acute phase and until complete resolution of thrombus appears to be appropriate in patients with atrial thrombus.18)19) in conclusion, myocardial injury is common in co poisoning . Thromboembolism could occur in cardiac chambers and peripheral vessels, although it was less frequent . Therefore, patients presented with co poisoning should undergo echocardiographic examination followed by serial ecg and cardiac enzyme evaluation . Careful examination should be performed for the assessment of intracardiac thrombus, in addition to the exact evaluation of ventricle function.
Kindler syndrome (ks) is a rare autosomal recessive genodermatosis, which was first described in a 14-year - old girl in 1954 by kindler and later by forman et al . In 1989 . More than 120 cases have been reported since the original report by kindler; the largest series being a cluster of 26 patients identified within a tribe in the bocas del toro province on the northwestern caribbean coast of panama . The syndrome is a combination of features of inherited blistering skin disorders (e.g., dystrophic epidermolysis bullosa) and congenital poikilodermas (e.g., rothmund - thompson syndrome) and should be differentiated due to clinical overlap with hereditary acrokeratotic poikiloderma (hap) and dystrophic epidermolysis bullosa . Apart from the skin changes, changes in the oral and conjunctival mucosa, phimosis and radiological changes, namely a dome - shaped skull (turricephaly), rib and mandibular abnormalities have been reported . Other features that vary between cases include acral hyperkeratosis, nail dystrophy, webbing and contractures of the fingers and toes, alopecia, actinic changes, pigmentation of lips and onchodystrophy . The association of aggressive periodontitis with ks was based on a single case in 1996 and later confirmed with a larger population of patients . A number of oral features have been described, such as gingival swelling, advanced periodontal bone loss, mild - to - severe gingivitis, dental caries, and leukokeratosis of buccal mucosa . Dental findings had been briefly reported for kindler patients in dermatologic and pediatric publications including oral lesions, atrophy of buccal mucosa, limited oral opening, malocclusion, dystrophic teeth, ankyloglossia, bleeding gums, lip erosions and geographic tongue, atrophy of gingiva, erosion of the hard palate, gingival swelling and desquamative gingivitis . A 16-year - old female patient presented with the chief complaint of bleeding gums, ulcerations of buccal mucosa, missing teeth and difficulty in swallowing . Patient's mother reported that she had two children; one was healthy physically and mentally . Both of her pregnancies and deliveries were normal, but history of the affected child revealed skin blisters beginning at the age of 3 months . These blisters were filled with clear fluid and left scars after their rupture, and occurred until the age of 1 year . Cutaneous examination revealed multiple hypopigmented and a few hyperpigmented macules of variable sizes, distributed over his face, neck, trunk, and limbs [figure 1]. Skin over the hands and neck was dry, atrophic and photosensitive to the sunlight . Areas of hyper- and hypo - pigmentation on face absence of palmar creases hyperkeratotic plaques on the flexures scarring was evident on the soft tissues of the buccal mucosa and tongue . Tongue showed reduced mobility and was quite hard due to fibrosis [figure 4]. In certain areas, erythema extended to mucogingival junction; resulting in appearance of desquamative gingivitis [figure 5]. Desquamative gingivitis restricted mouth opening due to fibrosed commissures orthopantomograph showed areas of moderate bone loss around all the teeth present . Multiple congenitally missing teeth, and retained deciduous teeth were reported [figure 7]. Orthopantomograph showing retained deciduous and congenitally missing permanent teeth histopathologic examination of atrophic skin lesions in patients with ks reveals nonspecific features of poikiloderma . The epidermis is flattened and atrophic; edema is present at the dermoepidermal junction, and the basal layer shows focal vacuolization with basal cell degeneration . Other histologic features include a prominence of dermal capillaries, pigmentary incontinence, and possibly, perivascular lymphocytic infiltrate . A 16-year - old female patient presented with the chief complaint of bleeding gums, ulcerations of buccal mucosa, missing teeth and difficulty in swallowing . Patient's mother reported that she had two children; one was healthy physically and mentally . Both of her pregnancies and deliveries were normal, but history of the affected child revealed skin blisters beginning at the age of 3 months . These blisters were filled with clear fluid and left scars after their rupture, and occurred until the age of 1 year . Cutaneous examination revealed multiple hypopigmented and a few hyperpigmented macules of variable sizes, distributed over his face, neck, trunk, and limbs [figure 1]. Skin over the hands and neck was dry, atrophic and photosensitive to the sunlight . Areas of hyper- and hypo - pigmentation on face absence of palmar creases hyperkeratotic plaques on the flexures tongue showed reduced mobility and was quite hard due to fibrosis [figure 4]. Deep pockets with marked bleeding on minimal probing were present around the teeth . In certain areas, erythema extended to mucogingival junction; resulting in appearance of desquamative gingivitis [figure 5]. Multiple congenitally missing teeth, and retained deciduous teeth were reported [figure 7]. Histopathologic examination of atrophic skin lesions in patients with ks reveals nonspecific features of poikiloderma . The epidermis is flattened and atrophic; edema is present at the dermoepidermal junction, and the basal layer shows focal vacuolization with basal cell degeneration . Other histologic features include a prominence of dermal capillaries, pigmentary incontinence, and possibly, perivascular lymphocytic infiltrate . In 2003, siegel et al . Mapped the disease locus to band 20p12.3 by using linkage and homozygosity analysis in an isolated cohort of patients with ks . Loss - of - function mutations were identified in the candidate gene flj20116, which was renamed kindlin-1 (kind1). This gene encodes a 677-amino acid protein, kind1, which is thought to play a regulatory role in inhibiting oversecretion of basement membrane components by basal keratinocytes at the dermoepidermal junction . An autosomal recessive pattern of transmission is usual, but sporadic cases are not uncommon . In ks, there is an unusual interruption and reduplication of the basement membrane and a broad reticular pattern of type vii collagen staining deep into the connective tissue beneath the basement membrane . It has also been suggested that ks and weary's hap are variants of the same disease . However, the mode of inheritance, onset of blistering, photosensitivity and presence of eczema is different in these two syndromes . The level of ultrastructural cleavage for blistering appears to be junctional in ks and intraepidermal in hap . The dominant cutaneous findings in ks are increased skin fragility, acral blistering, photosensitivity, atrophy, and poikiloderma . Although increased skin fragility may be explained by the weakening of basal keratinocyte - extracellular matrix adhesion, the pathomechanisms of other features such as photosensitivity and skin atrophy remain unclear . Mucosal involvement is very common and may lead to urethral, anal and esophageal stenosis . Our patient presented with acral blisters in the neonatal period and childhood, diffuse poikiloderma, skin fragility and atrophic changes, which were more prominent on skin exposed areas . A set of clinical diagnostic criteria has recently been proposed for this condition to facilitate clinical diagnosis . The major criteria are acral blistering in infancy and childhood, progressive poikiloderma, skin atrophy, photosensitivity, and gingival fragility, and/or swelling . The additional features of these criteria are nail dystrophy, ectropion, palmoplantar keratoderma, leukokeratosis of lips, squamous cell carcinoma, anhidrosis, skeletal abnormalities, and dental problems . According to the proposed criteria, the presence of four major criteria makes the diagnosis certain, the presence of three major and two minor criteria makes the diagnosis probable, and diagnosis is considered to be likely if two major and two minor / additional features are present . According to these criteria a definitive diagnosis of ks was made . Several conditions that can cause blistering, cutaneous atrophy, and/or poikilodermatous skin changes must be differentiated from ks . Ks might be difficult to differentiate from variants of epidermolysis bullosa in newborns . Progressive improvement of blistering, photosensitivity, poikilodermatous changes, and cutaneous atrophy with age help to differentiate ks from epidermolysis bullosa . In dystrophic epidermolysis bullosa, there is a mutation in the gene encoding type vii0 collagen (cola7a0) distinguishing it from ks . Rothmund - thomson syndrome shows poikiloderma and photosensitivity like ks, but additional features like sparse hair, hypogonadism, and cataracts in the former condition distinguish it from ks . Bloom's syndrome is characterized by telangiectasia and photosensitivity with the presence of erythema on the face and other sun - exposed areas without showing true poikiloderma . Short stature, recurrent infections, and increased frequency of hematological malignancies are also features of this disease . Patients with cockayne's syndrome develop erythema in photo - distributed areas, atrophy, and hyperpigmentation . The associated features of dwarfism, cachexia, progressive pigmentary retinopathy, deafness, and birdlike faces differentiate cockayne's syndrome from ks . Reticulated hyperpigmentation, nail dystrophy, and leukoplakia are characteristic features of dyskeratosis congenita . Unlike ks, the pigmentary changes are not truly poikilodermatous and bullae are not an important feature of this rare genodermatosis . Good wound care including the use of topical and systemic antibiotics for infected bullous lesions and ulcerations might reduce the morbidity . Patients usually have a normal life span, but significant morbidity may be caused by secondary infections of congenital blisters; mucosal involvement leading to urethral, anal and esophageal stenosis; aggressive periodontitis, and ocular complications.
Central serous chorioretinopathy (cscr) is a chronic idiopathic condition affecting young to middle - aged patients with men affected more commonly than women . It is characterized by serous detachment of the neurosensory retina, with focal or multifocal areas of leakage of the retinal pigment epithelium (rpe) affecting the macular area . The exact cause of cscr is not clearly understood . Nevertheless, it is associated with psychological stress and systemic corticosteroid therapy, which causes hyperpermeability of choriocapillaries, leading to dysfunctional degeneration of the rpe [1, 2]. A 23-year - old man presented with a sudden decrease of visual acuity of the right eye (re) 4 days after rhinoplasty for a deviation of the nasal septum . General anesthesia was induced with propofol 2 - 5 mg / kg i.v . And sufentanil 0.5 g / kg i.v . No corticosteroids, antibiotics or other postoperative treatment was used . At presentation, best - corrected visual acuity of the re was 6/9 with metamorphopsia . Fundus examination revealed a well - delineated serous elevation of the macula and fluorescein angiography (fa) showed a focal rpe leakage . The optical coherence tomography (oct) sections through the macula depicted a mild neurosensory retinal detachment with an increase in retinal thickness equal to 245 m (fig . Two weeks later, without any treatment, a gradual improvement of the symptoms was assessed . One month after the operation, visual acuity of the re returned to 6/6 and the neurosensory retinal detachment disappeared . Also, fa revealed the disappearance of rpe leakage and the retinal thickness of the macula measured with oct was 183 m (fig . Cscr is a multifactorial disease with controversial etiopathology and it is usually associated with steroid use, pregnancy and stress . The exact mechanism by which glucocorticoids are involved in the development of cscr is still unknown . It is possible that a constitutionally determined susceptibility of the posterior blood - retinal barrier must be present so that, under the effect of exogenous or endogenous glucocorticoids, cscr develops . Found elevated values of urinary free cortisol in patients suffering from cscr not exposed to exogenous glucocorticoids and without biological signs of endogenous cushing's syndrome . Psychologic stress has been known to produce hypothalamic - pituitary - adrenal axis abnormalities like endogenous cortical excess, which has been found in some patients with cscr . In fact, the use of imidazole derivatives like oxy- and xylometazoline, which directly stimulate alpha - receptors and are more alpha-2-selective, are associated with the manifestation of cscr [6, 7]. In our case, the use of xylometazoline may have enhanced the post - traumatic stress and induced adrenergic stimulation leading to an increase in the choroidal circulation and alteration of the pump action of the rpe, which is related with the development of the cscr . However, the simultaneous increase in choroidal resistance has no effect on choroidal blood flow, which will be regulated to be maintained constant . In summary, we present a case of cscr after rhinoplasty, which to the best of our knowledge has not been previously reported . This case shows a possible association between the postoperative stress or the use of xylometazoline and cscr and widens the spectrum of drugs associated with the occurrence of the disease.
One of the most common anomalies in newborn infants is cleft lip and/or cleft palate (cl / p). Cdc recently estimated that each year in the united states (us), about 2,650 babies are born with a cp and 4440 babies are born with a cl with or without a cp . Isolated orofacial clefts or clefts that occur with no other major birth defects are one of the most common types of birth defects in the us . To understand the role of environmental and genetic factors in the development of clefts, many authors provide evidence in the form of epidemiological data on the prevalence of oral clefts . Vanderas reviewed studies published in english and reported the incidence of cl and cp among different races . Cooper et al . Reported asian (chinese, japanese, and other asian) oral - facial cleft birth prevalence based on the published reports . The prevalence rates of cl / p were lower than 2/1000 live births, but the rates differed from population to population . Some investigators have reported different prevalence rates of cl / p from region to region . The prevalence rates of cl / p in the central highlands of madagascar were greater than those in the coastal region . Studied regional variations of live births with oral clefts in the netherlands and found that the overall live birth prevalence was significantly higher in the northern netherlands than in the rest of the country . In the middle east, the incidence has variably been reported as 0.3 - 2.19/1000 live births . Iran is a large country in the middle east, with many different ethnic groups . The major groups are persian, azari, kurd, lur, baloch, arab, turkmen, bakhtiari, qashqai, mazandaran, guilan, tali, and pashtu . The reported prevalence of oral clefts among the iranian population varies from 0.86 to 3.73/1000 births . The prevalence at birth of clefts and associated malformations among the 19,369 live births in a maternity hospital in shiraz city (south of iran) was 1.03/1000 . A 7-year retrospective study in a maternity hospital in tehran (capital of iran) showed that the overall incidence was 2.14/1000 from 11,651 live births . Reported the birth prevalence of oral clefts among three main ethnic groups in gorgan in the northern of iran . Of 37,951 live births in the largest hospital in gorgan, the overall prevalence of oral clefts was 0.97/1000 live births . The prevalence of oral clefts in the sistani was higher than that in the fars and turkmean group, 1.47, 0.86, and 0.88/1000, respectively . The prevalence of cl / p among live births in yazd province (center of iran) was 0.86/1000 births . A study was carried out in hospitals of hamedan city (west of iran) by zandi and heidari . Cp is the second most common birth defect . In spite of several studies about the prevalence of this, no investigation evaluated this prevalence in the west and north - west area of iran . Twelve provinces from 31 provinces of iran are in the west and north - west area, with different ethnic groups: azari, kurd, lur, bakhtiari, qashqai, guilak, and fars . The aims of the present study are to ascertain the prevalence of cl / p among live births among four provinces in the west and north - west of iran with different ethnic / cultural . In a cross - sectional study; over 5 years from 2008 to 2012, we select four provinces such as [figure 1] east azarbaijan, kurdestan, gilan, and markazi have different ethnic / cultural, and the prevalence of oral clefts was not reported in them until now . The people of east azarbaijan, kurdestan, gilan, and markazi are azari, kurd, gilak, and fars, respectively . The capital cities of them are tabriz, sanandaj, rasht, and arak city, respectively . At the 2011 census by the statistical center of iran, the population of tabriz, sanandaj, rasht, and arak were, 1,695,094, 450,167, 918,445, and 599,634, respectively . The population under study included all infants born alive in the university hospitals from the medical universities with a maternity unit in each of the capital cities from these four provinces . All hospitals have registered medical information of patients according to the code in the international classification of diseases (icd 10 revision). In the hospital, the physicians report all birth defects, and the medical record center registers the code of defect and other information of patients . We gathered information of infants with cl / p who were born in hospitals, including the date and place of birth, gender, and type of clefts . The relevant icd-10 diagnosis codes of cp, cl, cl / p are q35, q36, and q37, respectively . The cleft birth/1000 live births was calculated separately for all provinces and all years, during 2008 - 2012 . Four west and north - west provinces of iran that the capital city of them included in this study the data were performed using spss software v19 . Prevalence was calculated by using the percentages of cl / p in the total sample . In addition, to study the effect of the place and date of birth, type of clefts, and gender that were tabulated from the infants with cl / p, prevalence was compared between the different groups using chi - square and fisher's exact test . Prevalence was calculated by using the percentages of cl / p in the total sample . In addition, to study the effect of the place and date of birth, type of clefts, and gender that were tabulated from the infants with cl / p, prevalence was compared between the different groups using chi - square and fisher's exact test . During the study, 52 infants with cl with or without cp (cl / p) or cp were born alive in hospitals with a maternity unit in four cities in the west and north - west of iran [table 1]. In total, there were 107,317 registered live births during 2008 - 2012 . The prevalence during 2008 - 2012 in rasht, arak, sanandaj, and tabriz cities was 557, 352, 503, and 559/1,000,000 live births, respectively (p = 0.000) like prevalence of arak is less than others significantly [table 2]. Frequency of clefts live births in four west and north - west cities of iran from 2008 - 2012 based on sex and cleft type frequency (annual prevalence of clefts per 1000 live births) of cl / p in four west and north - west cities of iran from 2008 - 2012 according to the annual prevalence of clefts birth, the highest prevalence of clefts occurred in rasht city, and the electronic reports of live - birth infants of arak city had not any reports of children with clefts in 2011 . Annual clefts birth prevalence among the four provinces was statistically different (p <0.05). Table 3 and figure 2 demonstrate the incidence of clefts in the four provinces during 2008 - 2012 . (prevalence of clefts per 1000 live births) in four west and north - west cities of iran from 2008 - 2012 the annual prevalence of cl / p in four west and north - west cities of iran from 2008 - 2012 overall, of 52 infants with cl / p or cp, there was cp (23; 44.2%) more common, followed by cl / p (19; 36.6%) and cl (10; 19.2%). The prevalence of clp was greater in arak city and tabriz city, and the incidence of cl was greater in sanandaj city, and cp was greater in rasht city, whereas we did not get any electronic reports of infants with cl in rasht city among live births who were born in the hospital with a maternity unit during 2008 - 2012 [table 2]. There were statistically significant differences among the four provinces in the prevalence of cl and palate based on the cleft types: cl, cp, and, clp like there were a statistically significant difference among the four provinces in prevalence of cp (p = 0.003). Of the 52 infants with clefts, 24 (46.15%) were girls and 28 (53.85%) were boys [table 4]. The greatest prevalence of girls with clefts was in rasht city and the boys with clefts was in arak city . The prevalence of cl / p based on sex was statistically different between the four provinces (p <0.05). Frequency (prevalence of clefts per 1000 live births) in four west and north - west cities of iran from 2008 - 2012 by gender there is a significant relationship between sex and cleft types (p = 0.017). From 19 infants with clp, 26.3% of infants were females, and 73.7% were males, clp was found most frequently in males (p = 0.016). And of 23 infants with cp, 56.5% of infants were females and 43.5% were males (p = 0.45). Of 10 infants with cl, this study was conducted to explore the prevalence of cl / p in the capital cities of four provinces in the west and north - west of iran by using electronic medical information from the hospitals . Until now, the prevalence of oral clefts was not reported for the population of four provinces: markazi, east azarbaijan, kurdestan, and gilan . Several studies have reported the prevalence of cl / p in the iranian population since 1986 . The main purpose of the current study is to explore the distribution and prevalence of cl / p and type of clefts in the capital city of four provinces synchronously from 2008 to 2012 . The overall prevalence of cl / p in the population of four capital cities of four provinces in the west and north - west of iran was 0.48/1000 live births . We used only electronic records (hospital - based) of children who were born in hospitals and eventually were diagnosed . So probably those children who were not diagnosed at birth in the hospital were not registered . There was a wide variation in the incidence of cl / p from 2008 to 2012, and from city - to - city . The highest incidence of cl / p occurred in rasht city of gilan province (1.27/1000) in 2011 . Zandi and heidari also reported the prevalence of cleft anomalies, ranging from 0.42/1000 in 1994 to 1.70/1000 in 1998 from hamedan city in iran . With respect to ethnicity, the prevalence of oral cleft in gorgan city (in iran) has been reported . In fars, turkamean, and sistani, the prevalence of cl / p was 0.86, 0.88, and 1.47/1000, respectively . According to cooper et al ., the prevalence of live births with cleft anomalies is different from population to population . In this study, there were statistically significant differences among the four provinces in the frequency of clefts (p = 0.000) and cleft types (p = 0.000). The prevalence of cp in rasht was more than that of other types of clefts . Similarly, elliott et al . Reported that there was regional variance in clefts within nine zambian provinces . In the present study, overall, cp was more common (44.2%), followed by cl / p (36.6%) and cl (19.2%). Most previous studies, reported that the prevalence of cl / p was higher than other types of oral clefts as well as the iranian investigators reported that the prevalence of cl / p was higher . Some studies reported the equal distribution of males and females with cl / p . In the present study, differences in distribution among boys and girls with various types of cleft, cl, cp, and cl / p, cp was found most frequently in females, and cl / p was found most frequently in males . The majority of the studies similarly reported that cl / p was significantly more common in males than in females, and cp was more common in females than in males . We explored the prevalence of cl / p in four capital cities of the west and north - west provinces of iran synchronously from 2008 to 2012 . Overall, there were differences among the four cities in the prevalence of oral clefts . Conversely, the effect of gender on the prevalence of cl / p also showed regional differences . The different gender effects on the prevalence of cl / p from city - to - city may be explained by environmental and/or genetic factors affecting the development of oral clefts . This investigation was supported by grant 91 - 02 - 32 - 18216 from the vice - chancellor for research of iran university of medical sciences . This investigation was supported by grant 91 - 02 - 32 - 18216 from the vice - chancellor for research of iran university of medical sciences . Nj contributed in the conception of the work, conducting the study, revising the draft, approval of the final version of the manuscript, and agreed for all aspects of the work . Shj contributed in the conception of the work, drafting and revising the draft, approval of the final version of the manuscript, and agreed for all aspects of the work.
Cardiovascular diseases (cvds) account for about 30 percent of all deaths worldwide, and hyperlipidemia, hypertension, and smoking are well known as the three major risk factors of the mortality rates of cvds . Regarding the advances in the study and understanding of the mechanisms involved in the positive and negative effects of botanical drugs on health and diseases, one of the areas which has gained attention in recent years is the protective and destructive effects of herbal agents on the cardiovascular system . Based on the previous experimental studies and existing traditional and folk medicine knowledge about some of the cardiovascular beneficial effects concerning rosa damascena l. (rd) and quercus infectoria (qi), we have selected these two herbal drugs for the present study . The q. infectoria olivier (fagaceae) is a shrub that grows in asia minor, iran, and greece . The galls of q. infectoria have analgesic cns depressant, antiparkinsonian, antidiabetic [35], anti - inflammatory, and antioxidant activity . Recently, the hepatoprotective effects of q. infectoria galls against ccl4-induced tissue damage have been reported . Rosa damascena l. is a small plant, that is cultivated all over the world due to its scent and visual beauty . The theraputical effects of rosa damascena l. are due to its anti - inflammatory, analgesic, hypnotic, and antispasmodic [9, 11] properties . Antioxidant and antidiabetic [12, 13], heart inotropic, usefulness in treatment of menstrual bleeding, antitussive, tracheal relaxant, and relaxing activity are the other effects that attributed to rosa damascena l. considering the beneficial effects of quercus infectoria and rosa damascena l. reported in the literature, the administration of these agents especially in the eastern societies is growing . In the present study we investigated the effects of chronic administration of quercus infectoria and rosa damascena l. on the hemodynamic, heart performance, lipid profile, and plasma atherogenic indices of rabbits with / without hyperlipidemia to elucidate the outcome of a long - term consumption of these agents on the cardiovascular system . Experiments were conformed to the national guidelines for conducting animal studies (ethic committee permission no . 86/123ka kerman university of medical sciences, iran) and were performed on 36 new zealand white rabbits weighing between 2.5 and 3.5 kg . Sodium thiopental was purchased from biochemie (austria) and cholesterol from merck (germany). Galls of quercus infectoria (qi) and flowers of rosa damascena l. (rd) were collected during the spring of 2012 from isfahan and kerman (provinces of iran), respectively; they were identified and confirmed by the botany department of bahonar, university of kerman, iran . The galls of qi and air - dried flowers of rd (300 g) were grinded and macerated in 1000 ml methanol at room temperature for 3 days . Then the mixtures were filtered and evaporated in vacuum to yield a waxy mass extract from rd and a powder mass extract from qi . Rabbits were kept under appropriate animal care and were randomly divided into 6 groups as control (ctl), rd, qi, hyperlipidemic (h), hyperlipidemic+rd (h+rd), and hyperlipidemic+qi (h+qi). The rd and qi groups were fed with normal rabbit chow supplemented with 1.5 g rd and qi extracts, respectively, in each kg of the diet for 45 days . This dosage was calculated based on the current using pattern among consumers and previous studies . Cholesterol (0.5%) and hydrogenated vegetable oil (16%) were added to the diet of the hyperlipidemic (h) groups during the 45 days of this experiment . The h+qi and h+rd groups received 1.5 g qi and rd extracts, respectively, in each kg of their diet in addition to cholesterol and hydrogenated vegetable oil during the study . The fasting blood sample was taken from ear vein on the first and the 46th day of the experiment in order to measure the plasma total cholesterol (tc), low - density lipoprotein (ldl), high - density lipoprotein (hdl), and the triglyceride (tg) levels by routine laboratory methods . The atherogenic indices of plasma, as markers of plasma atherogenicity, were calculated as tc / hdl and ldl / hdl . At the end of the experiment, animals were anaesthetized by the injection of sodium thiopental (50 mg / kg, ip) and were maintained with a 1% halothane in a 30% o269% n2o mixture during the surgical procedure . Deep anesthesia was confirmed and maintained throughout the surgery as judged by the absence of withdrawal response to a pinch stimulus applied to the hind limbs . A heparinized saline - filled (7 units / ml) cannula was connected to a pressure transducer, and a powerlab analog to digital converter (ad instruments, australia) was inserted into the left carotid artery to record the heart rate and arterial blood pressure (bp). The other cannula which went through the right carotid artery was inserted into the left ventricle, and the left ventricular pressure (lvp) was recorded . The gaseous anesthesia was discontinued at the end of the surgery, and the time window for animal recovery from the surgery was 30 min . The mean arterial pressure (map) was calculated by map = pd + (ps pd)/3 formula, where pd is the diastolic arterial pressure and ps is the systolic arterial pressure . The maximum velocity of contraction (max dp / dt) and the maximum velocity of relaxation (min dp / dt) were calculated from the left ventricular pressure pulse . Pressure - rate product (prp), an indirect measure of myocardial oxygen demand, was determined as the product of the heart rate and mean arterial pressure ((mapheart rate) 1,000). Comparisons were performed between basal and final values in each group by student's paired t - test and among the different groups by one - way anova which was followed by the post hoc tukey's test . The levels of basal plasma lipids and basal atherogenic indices of the different groups had no significant difference . Consumption of normal chow alone or along with rd or qi for 45 days did not cause any significant change on the lipid profile and atherogenic indices of the ctl and qi groups . The triglyceride level, however, showed significant increase in the rd group (p <0.01). The high - fat diet induced hyperlipidemia as significant increase in the tc, ldl, and tg and atherogenic indices in all groups compared to its related basal values (table 1, figures 1 and 2). The qi administration along with the hyperlipidic diet decreased the tc and ldl when compared to the h and h+rd groups (p <0.001 and p <0.01, resp . ). The level of ldl was also reduced in the h+rd group (p <0.01 versus h group). The level of tg was enhanced in the h group compared with the ctl group (p <0.01); however, the consumption of qi attenuated this effect (p <0.05 versus h group) (table 1). Two atherogenic indices of plasma, tc / hdl and ldl / hdl, significantly increased in the h and h+rd groups (p <0.001 versus ctl and rd groups). Tc / hdl showed nonsignificant increase in the h+qi group (p <0.055 compared to qi group and p = 0.058 compared to the ctl group) (figure 1). The ldl / hdl ratio was associated with a lesser increase in the h+qi group than that of the h and h+rd (p <0.01 when compared to the ctl and qi groups) (figure 2). At the end of this study, the comparison of the blood pressure among the different animal groups did not show any significant effect of rd or qi (each alone) on this parameter . Yet, in those animals which received a combination of rd and high - fat diet, systolic, diastolic, and the mean arterial pressures increased significantly whenever it was compared to its corresponding groups, that is, the ctl, rd, and h. in this study, the high - fat regimen alone or plus qi had no significant effect on the blood pressure compared to its matching groups (figure 3). The heart rate, pulse pressure, the maximum velocity of heart contraction (+ dp / dt max = max dp / dt), and the maximum velocity of heart relaxation (dp / dt max= min dp / dt) did not show any significant difference among the animal groups (table 2). The prp was greater in the h+rd and h+qi groups; however, this index was only significant in the h+rd, when compared to the rd group (p <0.05) (table 2). The left ventricular developed pressure (lvdp) and the left ventricular systolic pressure (lvsp) increased significantly in the h+rd group compared to the ctl and rd groups (p <0.05 and p <0.0001, resp .) And in the h+qi groups (p <0.01 versus qi groups). The lvdp and lvsp also increased in the h groups compared to the rd group (p <0.05). The h and the h+rd groups showed maximum levels of left ventricular end diastolic pressure (lvedp); on the contrary, the qi group showed a minimum level of this parameter . In addition, the lvedp had dropped in the h+qi group compared to the h group (p <0.05) (figure 4). This study aimed to assess the influence of the chronic administration of a methanolic extract of two famous herbal drugs, that is, rosa damascena l. and quercus infectoria, on hemodynamic, heart performance, lipid profile, and plasma atherogenic indices of rabbits with / without high - fat diet . The results revealed the obvious beneficial effect of qi on harmful outcomes of a hyperlipidic diet as the attenuation of plasma atherogenic indices, the prevention of hyperlipidemia, and the improvement of the cardiovascular performance . On the other hand, the rd administration showed a mild decreasing effect on plasma lipid profile and the atherogenic indices . However, the administration of rd along with a high - fat diet increased the index of myocardial oxygen consumption and the risk of hypertension . The inhibition of pancreatic lipase (pl) as a pivotal enzyme in the intestinal absorption of triglycerides and hmg coa reductase, the other important enzyme, that is, involved in the endogenous cholesterol biosynthesis, is the target of the pl inhibitors and statins, respectively . In vitro experiments indicated that especially qi and to some extent rd have inhibitory effect on pancreatic lipase and hmg coa reductase enzyme . The results of previous and present in vivo studies obviously have confirmed the antilipidemic effect of qi, but rd had no considerable effect . Therefore, a part of the antilipidemic and antiatherogenic effects of qi revealed in the present study may mediate through inhibition of pl and hmg coa reductase enzymes . In addition, qi contains some bioactive agents, and its main component is tannin . This phenolic compound is able to precipitate proteins [28, 29], for example, pl enzyme, and hence may provide a portion of antilipidemic and antiatherogenic effects of qi . Previous studies showed that the use of high - lipid diet contains 1% cholesterol for 8 and 10 weeks and had no significant effect on the blood pressure, heart rate, prp, max dp / dt, and min dp / dt indices of rabbits . Still, even 4 weeks of a high - cholesterol regimen increases the vascular resistance and decreases the endothelium - dependent vasodilatation . Consistent with the previous reports, in our study, 45 days of a highfat diet had no significant effect on hemodynamic and heart performance of the h group compared to the ctl group . However, coadministration of rd and high - fat diet was associated with an increase in the blood pressure, lvsp, and lvdp . The positive chronotropic and inotropic effect of rd has been observed in the isolated heart of guinea pigs . This effect apparently is mediated through the stimulation of -adrenoceptor [33, 34]. The opening of the calcium channels and the elevation of the intracellular camp levels like the effect of phosphodiesterase iii inhibitors are likely to be the other possible mechanisms which may be involved in the inotropic effect of rd . Cardiac output, in turn, is the product of stroke volume and heart rate . The increase of heart contractility leads to the increase of stroke volume and consequently the blood pressure . In our study, a nonsignificant increasing trend of max dp / dt as an index of heart contractility in the h+rd group was observed . The discrepancy between our findings and the results of boskabady et al . Related to the chronotropic effect of rd may come from the two different conducting methods, in vivo method versus isolated heart method, and hence influence of endogenic factors such as autonomic nervous system feedback in our study . The combination of the negative effect of hyperlipidemia on the vascular vasodilatation along with the partial increase of heart contractility due to positive inotropic effect of rd is a likely reason for explaining the high blood pressure and lvsp in the h+rd group . However, there is the possibility of unknown effects of rd on the arterial vessel that should be investigated in future studies . The results of this study revealed the significant antilipidemic and antiatherogenic effects of qi but not rd . This may be partly mediated by the inhibition of pl and hmg coa reductase enzymes . Regarding some side effects of synthetic lipid - lowering drugs, for example, myopathy and liver damages for statins [25, 37] and gastric irritation, flushing, hyperuricemia, dry skin, and abnormal liver function for pl synthetic inhibitors, qi can be considered as a new candidate for reducing plasma lipids in future human studies . In addition, the use of rd along with a high - fat diet increased the risk of hypertension in rabbits . If our results can be extrapolated to human, this adverse effect of rd in cases with hyperlipidemia context should be considered and investigated.
Multicentric reticulohistiocytosis (mrh) is a rare multisystem syndrome characterized by polyarthritis and papulonodular skin lesions with typical dermal infiltration of histiocytes and multinucleated giant cells . The disease may involve the skin, tendon sheath, synovium, bone, liver, salivary gland, kidney, lymph node, heart and lung . In mrh, an association with hyperlipidemia (3058%), a positive skin tuberculin test (1250%), systemic vasculitis and autoimmune disease has been described . Of utmost clinical importance such an association has been documented in up to 28% of all reported cases in the world literature, the most common being bronchial, breast, stomach, and cervical carcinomas . Here, we report, for the first time, a case of mrh presenting with liver carcinoma, thus highlighting the association of mrh with malignant disease . A 61-year - old man presented with a 4-month history of a nonpruritic rash, which started on his forearm and face after sun exposure and subsequently spread to the ear, scalp and upper chest, after which asymptomatic skin lesions appeared on the lateral margin of his finger . The patient denied any history of photosensitivity but complained of low - grade fever and painful swelling of the joints in his wrist, knee and ankle, accompanied by restricted activity for 1 month . He had a sensation of a foreign body in his pharynx with difficulty in swallowing for about 1 month . The patient also had a history of hepatitis b, which was diagnosed in the 1970's, and severe knee joint pain with bony spurs, which were confirmed by x - ray, for at least 2 years . Treatment with hydroxychloroquine and thalidomide for solar dermatitis in other hospitals showed no therapeutic effect . Physical examination showed a confluent erythematous eruption affecting his scalp, face, neck and the extensor aspect of his forearm, which was characterized by ruby - red, translucent and grouped papules (fig . Red nodules could also be found on the dorsum of the nose, lateral area of the fingers and tongue tip (fig . An extensive laboratory evaluation, including white cell count, urinalysis, stool studies, renal function, electrolytes, cholesterol and triglycerides, erythrocyte sedimentation rate, antistreptolysin o level, rheumatoid factor and antinuclear antibody were normal . U / l), alt 125 u / l (<50 u / l), alp 159 u / l), ggt 100 u / l (345 u / l), total bilirubin 30 mol / l (3.420.4 mol / l), tba 21 mol / l (<6.8 mol / l) and total protein, albumin and globulin were normal . Hepatitis index studies showed hbsag(+), hbsab <0.2 iu / l (> 10 iu / l), hbeab(+), hbsab <hbeag(), hbeab(+), hbcab(+), hbcigm(), havigm() and hcv(). The afp level was significantly elevated (6,820 g / l, normal range <10 type - b ultrasonic examination revealed a solid tumor (91 69 mm) on the right lobe of the liver, which was suspected to be a small hepatocellular carcinoma . Five - fu, oxaliplatin and thp were used as anticancer drugs . The afp level after the interventional treatment was 1,027.5 g / l, and the tumor mass decreased to 67 66 mm . The cutaneous symptoms improved significantly within 1 month (several large nodules disappeared immediately; later, the erythematous rash and grouped papules resolved and the patient's arthralgia and swelling of joints gradually improved). Skin biopsy on the right forearm showed infiltration of the dermis with polymorphic histiocytes and giant cells with the histiocytic marker cd68 was positive, as were leukocyte common antigen, hla - dr, lysozyme and vimentin (fig . Langerhans cell markers (s-100 and cd1a) were negative and the histological appearances were consistent with mrh . Mrh, often referred to as lipoid dermato - arthritis, was first reported in 1937 by weber and freudenthal . Mrh is so rare that fewer than 300 cases have been reported in the literature . In 1969, barrow and holubar first raised the question of whether there was an association between mrh and malignancy . Snow and muller reported a malignancy rate of 25% in 133 cases of mrh reported in the literature until 1994 . Eleven [6, 7, 8, 9, 10, 11, 12, 13, 14, 15] of the 66 cases we reviewed (english - language literature from 1995 until now) had cancer and were evaluated for the following parameters: age, sex, type of neoplasm at presentation, duration preceding or following the diagnosis of cancer that mrh developed and treatment response of both the tumor and mrh . The results are presented in table 1 (including the present case). For most of these cases (including the present case), the onset of malignancy and mrh occurred within approximately 3 years, and in some cases, the onset of mrh also occurred in close proximity to the time of recurrence of a previously diagnosed malignancy [13, 15]. This is the first case report of mrh with liver carcinoma . Although the etiology of mrh is unknown, the possibility that mrh reflects a constellation of symptoms seen within paraneoplastic syndrome is supported by the frequency of associated neoplasm (18% based on our review), the remission of the lesions after tumor treatment (6 of 12 cases [6, 7, 8, 10, 11, 12]) and the onset of mrh just prior to the relapse of the neoplasm (case no . 8 of table 1).
- 0194), 23 patients from the department of pathology, gangnam severance hospital, were enrolled in this study . The patients ranged in age from 35 to 59 years old, with a mean age of 47 . Fresh surgical samples of ptc with (13 cases) or without (10 cases) lt were collected from the records in the department of pathology with the patients agreement and the formal permission of the irb . The prognostic parameters (tumor size, extra - thyroidal extension of ptc, and lymph node metastasis) were analyzed . Among the subtypes of ptc samples in this group, the nontumor portions were used for measuring the mrna quantities of the cytokines, and the ptc portions were subject to immunohistochemical staining of cip1 (p21)/kip1 (p27) for protein expression analysis, as described in more detail in later section . The nontumor portions of the patient samples were used to measure the mrna levels of the following cytokines: tumor necrosis factor (tnf-), interferon (ifn-), il-2, il-4, il-10, and il-1. The 13 cases with concomitant ptc and lt were referred to as the objective group, and the 10 cases of ptc without lt were used as a reference or control group . Quantitative real - time polymerase chain reaction (pcr) was performed according to the manual of lightcycler 480 real - time pcr system (roche applied science, manheim, germany). The reference gene value (actin and 18s rna) and il-1 value were measured in every sample . Although it is known to be meaningless to compare the levels of cytokines from the same specimen, the expressed cytokine levels could be ranked and compared in this research via a quantitative real - time pcr method . Using the concept of relative quantification, the cytokine values were corrected for differences in quality and quantity by dividing the concentration of a target rna by the concentration of a reference rna in the same sample (relative ratio = concentration of target / concentration of reference). The most common way to compare expression levels of different samples is to designate one of the samples as calibrator, where all other samples are compared to this calibrator . For normalization of the final results, the target / reference ratio of each sample is divided by the target / reference ratio of the calibrator sample: calibrator normalized ratio=(sample; concentration of target / concentration of reference)/(calibrator; concentration of target / concentration of reference). In the present work this means that the reference gene was calculated, but the target gene could not be detected despite many pcr amplification processes . In these cases, we adjusted these not detected values to zero (0). The immunohistochemistry (ihc) of the p27 protein expression in the ptc tumor tissue from all 23 cases was analyzed using paraffin - embedded tissue . Formalin - fixed paraffin - embedded sections (3 m thick) were dewaxed in xylene and rehydrated through graded alcohols to water . Antigen retrieval was performed in citrate buffer (ph 6.0) within a microwave pressure cooker, and endogenous biotin detection was blocked with the avidin - biotin blocking kit (vector laboratories inc ., burlingame, ca, usa). Optimum primary antibody dilutions were predetermined, and appropriate positive control samples (tissues known to be positive for the immunohistochemical marker) and negative control samples (test tissue sections without the addition of primary antibody) were used for p27 (novocastra, newcastle upon tyne, uk). After incubation, the slide was washed with phosphate buffered saline, and a secondary incubation was carried out with biotin anti - mouse / anti - rabbit igg followed by streptavidin - hrp (signet pathology system, dedham, ma, usa) for 30 minutes . When p27 immunoreaction was interpreted, only the nuclear staining on ptc cells was regarded as positive . Its measurement was evaluated by the following two - tiered grading system: low grade (negative staining or faint staining in less than 30% of the tumor cells) and high grade (positive staining in more than 30% of the tumor cells) (fig . Nuclear p27 immunoreactivity was considered altered when the expression was less than 30% of previously published, clinically relevant levels . In 21 cases, the results of ihc were summarized in two groups: the cases with lt (n=13) and the cases without lt (n=8). Two cases were not performed, for the ihc sections for p27 were devoid of tumor tissue . The pearson chi - square test was used to examine the relationships of cytokines (tnf-, ifn-, il-2, il-4, il-10, and il-1) and p27 expression with the clinicopathological characteristics . All reported p - values were 2-sided, and the significance was set at .05 . All statistical tests were performed with spss ver . 17.0 (spss inc ., chicago, il, usa). - 0194), 23 patients from the department of pathology, gangnam severance hospital, were enrolled in this study . The patients ranged in age from 35 to 59 years old, with a mean age of 47 . Fresh surgical samples of ptc with (13 cases) or without (10 cases) lt were collected from the records in the department of pathology with the patients agreement and the formal permission of the irb . The prognostic parameters (tumor size, extra - thyroidal extension of ptc, and lymph node metastasis) were analyzed . Among the subtypes of ptc samples in this group, the nontumor portions were used for measuring the mrna quantities of the cytokines, and the ptc portions were subject to immunohistochemical staining of cip1 (p21)/kip1 (p27) for protein expression analysis, as described in more detail in later section . The nontumor portions of the patient samples were used to measure the mrna levels of the following cytokines: tumor necrosis factor (tnf-), interferon (ifn-), il-2, il-4, il-10, and il-1. The 13 cases with concomitant ptc and lt were referred to as the objective group, and the 10 cases of ptc without lt were used as a reference or control group . Quantitative real - time polymerase chain reaction (pcr) was performed according to the manual of lightcycler 480 real - time pcr system (roche applied science, manheim, germany). The reference gene value (actin and 18s rna) and il-1 value were measured in every sample . Although it is known to be meaningless to compare the levels of cytokines from the same specimen, the expressed cytokine levels could be ranked and compared in this research via a quantitative real - time pcr method . Using the concept of relative quantification, the cytokine values were corrected for differences in quality and quantity by dividing the concentration of a target rna by the concentration of a reference rna in the same sample (relative ratio = concentration of target / concentration of reference). The most common way to compare expression levels of different samples is to designate one of the samples as calibrator, where all other samples are compared to this calibrator . For normalization of the final results, the target / reference ratio of each sample is divided by the target / reference ratio of the calibrator sample: calibrator normalized ratio=(sample; concentration of target / concentration of reference)/(calibrator; concentration of target / concentration of reference). In the present work this means that the reference gene was calculated, but the target gene could not be detected despite many pcr amplification processes . In these cases the immunohistochemistry (ihc) of the p27 protein expression in the ptc tumor tissue from all 23 cases was analyzed using paraffin - embedded tissue . Formalin - fixed paraffin - embedded sections (3 m thick) were dewaxed in xylene and rehydrated through graded alcohols to water . Antigen retrieval was performed in citrate buffer (ph 6.0) within a microwave pressure cooker, and endogenous biotin detection was blocked with the avidin - biotin blocking kit (vector laboratories inc ., burlingame, ca, usa). Optimum primary antibody dilutions were predetermined, and appropriate positive control samples (tissues known to be positive for the immunohistochemical marker) and negative control samples (test tissue sections without the addition of primary antibody) were used for p27 (novocastra, newcastle upon tyne, uk). After incubation, the slide was washed with phosphate buffered saline, and a secondary incubation was carried out with biotin anti - mouse / anti - rabbit igg followed by streptavidin - hrp (signet pathology system, dedham, ma, usa) for 30 minutes . When p27 immunoreaction was interpreted, only the nuclear staining on ptc cells was regarded as positive . Its measurement was evaluated by the following two - tiered grading system: low grade (negative staining or faint staining in less than 30% of the tumor cells) and high grade (positive staining in more than 30% of the tumor cells) (fig . Nuclear p27 immunoreactivity was considered altered when the expression was less than 30% of previously published, clinically relevant levels . In 21 cases, the results of ihc were summarized in two groups: the cases with lt (n=13) and the cases without lt (n=8). Two cases were not performed, for the ihc sections for p27 were devoid of tumor tissue . The pearson chi - square test was used to examine the relationships of cytokines (tnf-, ifn-, il-2, il-4, il-10, and il-1) and p27 expression with the clinicopathological characteristics . All reported p - values were 2-sided, and the significance was set at .05 . All statistical tests were performed with spss ver . 17.0 (spss inc ., chicago, il, usa). The subtypes of the ptcs with lt were determined to be the most conventional (11/13, 84.61%), and those of only two cases were follicular variants (2/13, 15.38%). The tumor sizes ranged from 0.2 to 1.1 cm, with an average of 0.55 cm . Of the 13 cases of this type, six cases showed extrathyroidal tumor extension (et) (6/13, 46.15%), and two cases presented with lymph node metastasis (2/13, 15.38%). The subtypes of the ptcs with lt were all conventional (10/10, 100%). Tumor sizes ranged from 0.1 to 1.5 cm, with an average of 0.61 cm . There were three cases with lymph node metastasis (3/10, 30%). In all 23 cases, the cytokine immune profiles were summarized into two groups: the cases with lt (n=13) and the cases without lt (n=10). The cytokines could have originated from inflammatory cells, thyroid tissue, and endothelial cells . In this research, after manipulating the data using the concept of a calibrator with il-1, each sample of ptc with lt was compared (table 1). Among the six cytokines analyzed, based on these factors, the cytokine expression in the ptc samples with lt represented a mixed th1 (tnf- and ifn-) and th2 (il-4 and il-10) immunity . After manipulating data using the concept of a calibrator with il-1, each sample of ptc without lt in contrast to the cases of ptc with lt, the cases without lt frequently exhibited nondetectable cytokine levels . Among the six cytokines analyzed, the expression levels of ifn-, il-10, and il-2 levels were too low to be measured . Based on these data, the cytokines expressed in ptc without lt represented a mixed th1 (tnf-) and th2 (il-4 and il-1) immunity . The prognostic parameters (tumor size, et, and lymph node metastasis) were not statistically related to lt, but the cases without lt had a tendency for lymph node metastasis (table 3). The cases with lt had enhanced expression of the cytokines (tnf-, ifn-, il-4, il-10, and il-2) compared to the samples of ptc without lt . Among the five cytokines, the expression levels of tnf-, ifn-, and il-4 were significantly higher in the cases with lt than in those without lt (p<.05). In terms of p27 as a surrogate marker for lymph node metastasis, the degree of p27 expression was not correlated with lymph node metastasis in this study; high - grade expression of p27 had a tendency to occur in ptc cases with lt . In contrast, lymph node metastasis occurred slightly more frequently in ptc cases without lt . Conclusively, the degree of p27 expression did not show any correlation with lymph node metastasis in this study (p=.15) (table 4). Due to this unexpected finding, which revealed in the insufficiency of the ptc cases without lt to serve as a reference group, this study adopted a new goal to use the ptc cases with lt to analyze the relationship between cytokine immune profiles and prognostic parameters . In addition, the ptc cases in this study were mostly microcarcinomas, which might represent the incipient phase of the tumors . The incipient phase of tumors must always have a limitation in representing proper tumor staging, such as tumor size, nodal metastasis, and tumor extension . Hence, in this study, p27 was used as a surrogate marker of lymph node metastasis in the cases of microcarcinoma (as an incipient carcinoma). Therefore, the statistical analysis of this profiles solely made use of the ptc cases with lt . Except for the il-4 cytokine, the expression levels of the cytokines tnf-, ifn-, and il-10 were lower in the cases with low - grade expression of p27 than those with high - grade expression of p27, but there was no statistical significance (table 5). The cases with et had a tendency to demonstrate higher levels of cytokine expression than those with intrathyroidal tumor confinement (table 6). Again, there was no statistical significance . In summary, although the data were not statistically significant, the trends follow a pattern where higher cytokine levels were present in the cases with high grade expression of p27 (except for il-4) and et . The subtypes of the ptcs with lt were determined to be the most conventional (11/13, 84.61%), and those of only two cases were follicular variants (2/13, 15.38%). The tumor sizes ranged from 0.2 to 1.1 cm, with an average of 0.55 cm . Of the 13 cases of this type, six cases showed extrathyroidal tumor extension (et) (6/13, 46.15%), and two cases presented with lymph node metastasis (2/13, 15.38%). The subtypes of the ptcs with lt were all conventional (10/10, 100%). Tumor sizes ranged from 0.1 to 1.5 cm, with an average of 0.61 cm . There were three cases with lymph node metastasis (3/10, 30%). In all 23 cases, the cytokine immune profiles were summarized into two groups: the cases with lt (n=13) and the cases without lt (n=10). The cytokines could have originated from inflammatory cells, thyroid tissue, and endothelial cells . In this research, after manipulating the data using the concept of a calibrator with il-1, each sample of ptc with lt was compared (table 1). Among the six cytokines analyzed, based on these factors, the cytokine expression in the ptc samples with lt represented a mixed th1 (tnf- and ifn-) and th2 (il-4 and il-10) immunity . After manipulating data using the concept of a calibrator with il-1, each sample of ptc without lt in contrast to the cases of ptc with lt, the cases without lt frequently exhibited nondetectable cytokine levels . Among the six cytokines analyzed, the expression levels of ifn-, il-10, and il-2 levels were too low to be measured . Based on these data, the cytokines expressed in ptc without lt represented a mixed th1 (tnf-) and th2 (il-4 and il-1) immunity . The subtypes of the ptcs with lt were determined to be the most conventional (11/13, 84.61%), and those of only two cases were follicular variants (2/13, 15.38%). The tumor sizes ranged from 0.2 to 1.1 cm, with an average of 0.55 cm . Of the 13 cases of this type, six cases showed extrathyroidal tumor extension (et) (6/13, 46.15%), and two cases presented with lymph node metastasis (2/13, 15.38%). The subtypes of the ptcs with lt were all conventional (10/10, 100%). Three cases with et were present (3/10, 30%). Tumor sizes ranged from 0.1 to 1.5 cm, with an average of 0.61 cm . In all 23 cases, the cytokine immune profiles were summarized into two groups: the cases with lt (n=13) and the cases without lt (n=10). The cytokines could have originated from inflammatory cells, thyroid tissue, and endothelial cells . In this research, after manipulating the data using the concept of a calibrator with il-1, each sample of ptc with lt was compared (table 1). Among the six cytokines analyzed, tnf-, il-4, and ifn- were relatively well expressed . Based on these factors, the cytokine expression in the ptc samples with lt represented a mixed th1 (tnf- and ifn-) and th2 (il-4 and il-10) immunity . After manipulating data using the concept of a calibrator with il-1, each sample of ptc without lt was compared (table 2). In contrast to the cases of ptc with lt, the cases without lt frequently exhibited nondetectable cytokine levels . Among the six cytokines analyzed, the expression levels of ifn-, il-10, and il-2 levels were too low to be measured . Based on these data, the cytokines expressed in ptc without lt represented a mixed th1 (tnf-) and th2 (il-4 and il-1) immunity . The prognostic parameters (tumor size, et, and lymph node metastasis) were not statistically related to lt, but the cases without lt had a tendency for lymph node metastasis (table 3). The cases with lt had enhanced expression of the cytokines (tnf-, ifn-, il-4, il-10, and il-2) compared to the samples of ptc without lt . Among the five cytokines, the expression levels of tnf-, ifn-, and il-4 were significantly higher in the cases with lt than in those without lt (p<.05). In terms of p27 as a surrogate marker for lymph node metastasis, the degree of p27 expression was not correlated with lymph node metastasis in this study; high - grade expression of p27 had a tendency to occur in ptc cases with lt . In contrast, lymph node metastasis occurred slightly more frequently in ptc cases without lt . Conclusively, the degree of p27 expression did not show any correlation with lymph node metastasis in this study (p=.15) (table 4). Due to this unexpected finding, which revealed in the insufficiency of the ptc cases without lt to serve as a reference group, this study adopted a new goal to use the ptc cases with lt to analyze the relationship between cytokine immune profiles and prognostic parameters . In addition, the ptc cases in this study were mostly microcarcinomas, which might represent the incipient phase of the tumors . The incipient phase of tumors must always have a limitation in representing proper tumor staging, such as tumor size, nodal metastasis, and tumor extension . Hence, in this study, p27 was used as a surrogate marker of lymph node metastasis in the cases of microcarcinoma (as an incipient carcinoma). Therefore, the statistical analysis of this profiles solely made use of the ptc cases with lt . Except for the il-4 cytokine, the expression levels of the cytokines tnf-, ifn-, and il-10 were lower in the cases with low - grade expression of p27 than those with high - grade expression of p27, but there was no statistical significance (table 5). The cases with et had a tendency to demonstrate higher levels of cytokine expression than those with intrathyroidal tumor confinement (table 6). Again, there was no statistical significance . In summary, although the data were not statistically significant, the trends follow a pattern where higher cytokine levels were present in the cases with high grade expression of p27 (except for il-4) and et . This study revealed the presence of mixed th1 (ifn-, tnf-, and il-2) and th2 (il-4 and il-10) immunity in lymphocytes in cases of ptc with lt . Although there is no statistical significance with a limited case number, this study could infer some meaningful results . In the cases with lt, the higher expression of cytokine levels had a tendency to be associated with high p27 immuno - reactivity (table 5). Furthermore, except for il-4, all cytokines were decreased in the cases with lt and p27 underexpression, which represents the increased possibility of lymph node metastasis . Because il-4 is associated with aggressive ptc, the fact that all cytokine except il-4 were highly expressed in the cases with lt and increased p27 expression supports the hypothesis that high expression of cytokines except il-4 may contribute to anticancer effect on the ptc in terms of lymph node metastasis . In contrast, the cases with et revealed the higher expression of cytokines than those without et . Based on these results, we propose that the higher expression of cytokines tnf-, ifn-, il-2, and il-1 might inhibit nodal metastasis but not inhibit (or possibly enhance) the extrathyroidal extension . In view of helper t cell immunity, mixed th1 and th2 immunity seems to play a role in anticancer activity by inhibiting lymph node metastasis . There have been several studies on the immune profiles of thyroiditis . Among them, phenekos et al . Reported that ht and graves disease have two different helper t cell immunities . In their report, with the preferential expression of il-2, ifn-, il-12, and il-18, a th1 pattern of immune response which is characteristic of cellular immunity, is dominant in ht . In contrast, ajjan et al . Reported a mixed th1 and th2 immune response in ht cases . They reported that reverse transcription polymerase chain reaction results showed both th1 and th2 immunity . Our findings demonstrated that il-4 expression, together with other cytokines, has a tendency to be higher in the cases with et . In contrast, in the cases with underexpression of p27, which may represent lymph node metastasis, il-4 was higher than other cytokines . This may imply that il-4 contributes to the lymphatic spread of the tumor, a concept that is supported by vella et al . Who demonstrated that il-4 levels were augmented in aggressive ptcs . They suggested that ptc cells receive protection from apoptosis by il-4 production in the activated t lymphocytes of thyroid glands . To determine which of these conflicting results in terms of both nodal metastasis and capsular tumor extension are correct, further study may be necessary to disclose the role of il-4 in ptc biological behavior . A previous work by yip et al . Demonstrated with in vitro tests that il-1 was an anticancer factor, which suppressed the proliferation and reduced the invasive potential of human ptc cells . In this study, il-1 was found to be constitutively expressed in all cases and was used as a calibrator to compare cytokine levels among the cases . Unfortunately, due to its use as a calibrator in this study, il-1 expression levels in each case could not be compared . It is generally accepted that there is a beneficial relationship between chronic lt and the biological behavior of ptc, which results in improved prognoses . Paulson et al . Suggested that chronic lt might have a protective role in tumor spread . Supporting this evidence, mitsiades et al . Reported that th1 cytokines, such as ifn- and tnf-, increase the sensitivity of both normal and neoplastic thyrocytes to fasl and trail, which lead to apoptosis . Established that ht was associated with ptc, as was chronic inflammation with cancer in other locations . They also mentioned that the coexistence of ht in ptc cases introduced favorable clinical outcomes compared with those of ptc without ht . Determined that patients with ptc and chronic lt had smaller tumor sizes, a lower incidence of capsular invasion, and a significantly lower incidence of lymph node metastases compared to patients without chronic lt . Several studies have also indicated that antithyroid antibodies are able to recognize these malignant cells and destroy them in the same way that they destroy normal follicular cells, contributing to the low rate of clinical progression of these lesions . The p27 protein was first identified as an inhibitor of cyclin e / cdk2 complexes during transforming growth factor induced g1 arrest . The inhibitory roles of p27 towards cyclin / cdk complexes are weakened by phosphorylation directed by certain signal transduction pathways . The current model delineates that p27 suppresses tumorigenesis by inhibiting cyclin / cdk activity in the nucleus, but it exerts other functions in the cytoplasm that are potentially oncogenic . There have been several clinical studies describing the relationship between the expression of p27 and lymph node metastasis . Reported that p27 expression in nonmetastasizing ptc was lower than that in normal thyroid tissue and higher than that in metastasizing ptc . Our ihc analysis showed that p27 expression did not demonstrate any relationship to lymph node metastasis in ptc with lt, but this may be attributed to the early stage of the tumors, i.e., our study mainly included patients with microcarcinomas . There may be a chance that even ptc cases with low expression of p27 were too incipient to reveal lymph node metastasis . With this limitation in the evaluation of the relationship between cytokine levels and nodal metastasis, the common p27 marker was used as a surrogate marker to represent the possibility of nodal metastasis in early phase ptcs . As aforementioned, after focusing on the cases with lt, the cases with low - grade expression of p27 tended to be associated with lower levels of cytokines than those with high - grade expression of p27 . This may implicate that the cases with lower levels of mixed th1 and th2 cytokines have a higher probability of having lymph node metastasis . Considering the low cytokine expression in the cases with underexpression of p27 (except for il-4), our results indicate that mixed th1 and th2 immune cytokines have a tendency toward anticancer effects in terms of lymph node metastasis . To predict tumor prognosis from cytokine levels
An 83-year - old woman presented with sudden visual loss that had developed in both eyes (oculus uterque, ou) the previous day . She did not complain of any associated headache, scalp tenderness, jaw claudication or constitutional symptoms such as weight loss, fever, malaise or sweats . Her visual acuities included perception of light in the right eye (oculus dexter, od) and perception of hand motion in the left eye (oculus sinister, os). Fundus examination revealed mild retinal arterial narrowing and chalky - white disc swelling ou (fig . The results of the hardy - rand - rittler test and ishihara test showed total dyschromatopsia ou . Although electroretinography findings were within normal limits, visual evoked potentials showed delayed p100 latency ou . Brain magnetic resonance imaging scans and angiography results showed diffuse bilateral stenosis of vertebral arteries and external carotid arteries without significant intracranial vessels stenosis . The crp level, esr and platelet count were elevated and measured to be 5 mg / dl (upper normal limit, 0.5 mg / dl), 55 mm / h (upper normal limit, 20 mm / h), and 510 k/l (upper normal limit, 400 k/l), respectively . Following a presumptive diagnosis of silent gca - associated aaion ou, the patient was hospitalized and treated with intravenous 250 mg methylprednisolone every 6 hours for 3 days . Biopsy of the left temporal artery was performed, and 3 cm of the temporal artery was acquired . Lymphocytes, epithelioid histiocytes, and multinucleated giant cells had diffusely infiltrated into the entire vessel wall, especially in the arterial wall media (fig . After 7 days, the patient's visual acuity os improved slightly to being able to count fingers . The crp level and esr decreased to 1.07 mg / dl and 30 mm / h, respectively . Oral prednisolone therapy was slowly tapered down from 60 mg per day, and steroid treatment was maintained with deflazacort 30 mg per day . However, after 4 months, the patient's visual acuities deteriorated to no light perception od and light perception os . Gca should be strongly suspected when patients greater than 50 years of age present with headaches . The incidence of gca in scandivian countries and north america ranges between 6.9 and 32.8 per 100,000 . However, the occurrence of gca is rare in african americans, hispanics, and asians [8 - 10]. There have only been a few reports of gca among asians [5,6,11 - 15]. In japan, a nationwide gca survey revealed an extremely low prevalence of 1.47 per 100,000 population, which is approximately 1 / 140 of that reported in the us . Pereira et al . Reported that gca was seen 20 times less frequently in asians than in caucasians . . Stated that, for over a period of 22 years, only 7 patients were diagnosed with gca by temporal artery biopsy in a tertiary medical center in saudi arabia . The incidence of gca in asians was far lower than that in caucasians; however, the incidence is now increasing in the asian population . After 36 years of no reported cases of gca, in 2010, aui - aree et al . Reported 4 gca cases in thailand . Cullen et al . Noted that of the 7 biopsy - confirmed gca cases reported over the past 10 years in singapore, 3 were reported in 2009 . This trend may be associated with an increase in the maximum life span of the asian population . Suspected diagnosis of gca by rheumatologists and ophthalmologists, along with extensive laboratory tests, may be other important factors . However, a nation - wide epidemiologic study would be needed to clarify the association of life span and gca incidence in asians . In korea, only a few biopsy - confirmed gca cases have been reported; however, there have been no gca - associated aaion cases so far . To our knowledge, this is the first biopsy - confirmed report of gca - associated aaion in korea . Our patient was diagnosed with silent gca, and the clinical features overlapped with non - arteritic aion . When asian patients aged> 50 years present with acute visual loss and disc swelling and no other symptom, non - arteritic aion accounts for more than 90% of these cases . In such circumstances, laboratory parameters, such as esr, crp level and platelet count can serve as indicators in the diagnosis of gca . Reported that the crp level has a sensitivity of 100% for gca, and the combination of crp level and esr has a specificity of 97% . In a large population - based cross - sectional study, documented that the odds of a positive biopsy were 1.5 times greater with an esr of 47 to 100 mm / h, 5.3 times greater with a crp of> 2.45 mg / dl, and 4.2 times greater with a platelet count of> 400,000 l . The above 3 parameters were elevated in our patient (crp, 5 mg / dl; esr, 55 mm / h; and platelet count, 510 k/l). These test results are known to be normal in non - arteritic aion . In conclusion, although this disease is rare in asians, gca - associated aaion should be considered when an elderly patient presents with sudden visual loss and disc edema . Gca should be suspected and laboratory tests should be performed, even in the absence of typical symptoms.
The largest uncertainty in the influence of aerosol particles and clouds on the climate system is caused by aerosol cloud microphysics determine cloud albedo in the visible and infrared (ir) spectral ranges, cloud lifetime, and precipitation properties . Cloud radiative properties are strongly linked to the microphysical state of clouds such as number concentration and size of liquid droplets and ice crystals . Aerosol particles can act as cloud condensation nuclei (ccn) and as ice nuclei (in) influencing the aggregation state and the microphysical properties of cloud particles . Knowledge on the glaciation of clouds is essential to estimate cloud radiative forcing on the climate system . In the atmosphere ice crystals form through heterogeneous and homogeneous ice nucleation . At temperatures below 235 k homogeneous nucleation takes place, whereas at higher temperatures ice does not form spontaneously . In this temperature range ice nucleation occurs heterogeneously; i.e., it is triggered by the presence of aerosol particles providing foreign surfaces that reduce the energy barrier for nucleation . Several mechanisms are known by which aerosol particles catalyze the formation of the ice phase in clouds: deposition, condensation, contact, and immersion freezing . The deposition mode involves the growth of ice directly from the vapor phase, whereas condensation freezing occurs if the ice phase is formed immediately after condensation of water vapor on a solid particle as liquid intermediate . If an in has already been immersed in a droplet and causes freezing, the process is termed immersion freezing . Contact freezing happens if a supercooled droplet freezes at the moment of contact with an in . In mixed - phase (liquid and ice) and cirrus clouds the dominant nucleation mechanism is suspected to be immersion or contact freezing, and to a lesser extent deposition nucleation . The ice nucleating ability of an aerosol particle in each of the four modes at fixed temperature and humidity conditions depends on its physicochemical properties, e.g., surface structure, size, and/or chemical composition . Although several requirements for an effective in have already been proposed decades ago, the exact mechanisms of nucleation are still not adequately understood . It is known that the ice nucleation efficiency of a particle is not necessarily determined by the entire particle but by so - called active sites on the particle s surface . However, information on the nature and location of active sites is still limited and a prediction of the ice nucleation efficiency of a particle based on its physicochemical properties is not yet possible . Atmospheric mineral particles originate from arid regions such as deserts, from volcanic eruptions and from soil due to agricultural use . They are released into the air by the action of wind and are omnipresent in our atmosphere . Recent studies confirm the importance of mineral dust particles for ice cloud formation . Aerosol mass spectrometry suggested that 50% of the material in ice crystal residues in clouds over wyoming was composed of mineral dusts . Another in situ study analyzed the residual particles within cirrus ice crystals and found an enrichment of mineral dust particles of 61% compared to their near - cloud abundance . Natural dust particles rarely consist of pure mineral phases but are internal mixtures of diverse mineral components covered with other inorganic, organic, and/or biological substances . The main mineral dust particles found in the atmosphere are clays (kaolinite, illite, montmorillonite), quartz, feldspars, and calcite . Within the last years, extensive efforts have been made to better understand and predict the role of mineral dusts in the formation of atmospheric ice clouds . Several laboratory studies on the ice nucleation activity (ina) of mineral dust particles have been performed by many groups . Because different measurement techniques are applied, the comparison of the results is often challenging . An extensive comparison and overview of the studies on mineral dusts was given in recent years . Most studies focused on clay minerals with kaolinite being the clay mineral studied most intensively . In all studies kaolinite shows ina in immersion freezing mode above 243 k. in a study of all common clay materials using the same method, illite was found to be the most active in followed by kaolinite and montmorillonite . The study by zimmermann et al . Gives a good comparison between the ina of different minerals in the deposition mode . The ina of closely related materials, like the feldspars, was rather different . In fact, microcline (k - feldspar) needed the lowest supersaturation at 261 k to initiate ice formation (i.e., in activation). The species active at the lowest supersaturation were kaolinite, illite, hematite, and microcline . Kaolinite and muscovite were found to be active at lower supersaturations and were therefore considered rather efficient in, whereas quartz and calcite were poor in . Montmorillonite was found a good in below a temperature around 241 k. most of the laboratory studies on mineral dust either focused on clay minerals that are often obtained from natural samples or on purely natural dusts . Concerning natural dusts, arizona test dust (atd) is the most widely used proxy within the field . Initial freezing is reported around 249 k. another natural dust sample frequently studied is volcanic ash . Many of these natural dusts are mixtures of different clays, quartz, and feldspars with varying composition . Recently atkinson et al . Performed the first comparative study on ice nucleation in the immersion mode looking not only at single minerals from the clay group but also at k - feldspar, na / ca - feldspar, quartz, and calcite as well . Almost simultaneously yakobi - hanock et al . Conducted a similar study on ice nucleation of 24 mineral samples in the deposition mode . Both studies find the ice nucleating ability of k - feldspar exceptionally high compared to other minerals . In the immersion mode k - feldspar already nucleates ice at temperatures of 250.5 k whereas for the other minerals only lower nucleation temperatures were found . Only recently was the ina of k - feldspar found to be even better than that of na / ca - feldspar (247 k). Conclude that k - feldspar is the key component determining the ina of atmospheric mineral dusts . As already mentioned, the majority of the studies concentrated on the experimental description of the ice nucleation behavior of mineral dusts . In case of immersion freezing initial and/or median freezing temperatures are reported for a vast set of atmospherically relevant minerals . Where the authors relate the ina of the different minerals to their particular surface charges . For example, they suggest that the in properties of clays, especially of the ice active kaolinite, might be due to electrostatic interactions between their charged surfaces, counterions and the polar water molecule . Minerals with such ionic surfaces are believed to promote ice nucleation, as they are more likely to form hydrogen bonds with water molecules . Shen et al . Found fluorine mica as an example of extremely high ina . Overall, a fundamental understanding of the heterogeneous ice nucleation on mineral dusts is still missing . For example, the nature of active sites is a matter of speculation only . The goal of our study was to investigate the ina of selected mineral particles as well as their chemical nature to identify possible characteristics of active sites . We performed experiments with the oil - immersion freezing method with pure and pretreated (heated, enzymatic pretreated, milled) dust particles . In addition, we characterized the particles with field emission gun scanning electron microscopy (feg - sem) and tunneling electron microscopy (tem), energy - dispersive x - ray spectroscopy (edx), x - ray powder diffraction (xrd), and attenuated total reflection fourier transform infrared spectroscopy (atr - ftir). Combining these data we propose a possible explanation why specific minerals, in particular k - feldspars, are good in, whereas others are not . On the basis of the experiments, we propose a first interpretation of the nature of active sites . Oil - immersion freezing experiments under a cryomicroscope were carried out to test the ina of different mineral dust samples . In addition, the particles were characterized regarding their surface and bulk properties by the following set - ups . Nucleation properties of the samples were obtained with an optical microscope and a homemade cryocell . The experimental setup has already been used in former studies, and a detailed description can be found elsewhere . Here, only a short description of the principle is given . The core of the experiment is a thermoregulated cryocell consisting of a peltier element in a teflon box . The cryocell that has a glass window on top is placed on an olympus bx51 optical microscope desk below the objective . The mineral dust samples were studied in the oil - immersion mode: a drop of an oil matrix (8085 wt% paraffin, 1520 wt% lanolin) with dispersed small water droplets (1040 m) containing mineral dust particles was put on a glass slide and placed on the peltier stage . The peltier element was then chilled at a constant cooling rate, until all visible droplets were frozen . In earlier measurements, no influence of the cooling rate (0.110 k / min) on the median freezing temperature was found within the uncertainty of the method, which is about 1 k (see supporting information). Whenever freezing of droplets was observed, a picture was taken and the respective temperature was recorded . Frozen droplets can be easily distinguished from liquid ones as they appear dark due to increased light scattering and contain visible internal structures, such as edges or cubes . Finally, each picture was analyzed to determine the fraction of frozen droplets, which was then plotted against temperature to obtain a nucleation curve characteristic for a specific sample . To compare different nucleation curves, we determined the median freezing temperature, t50, which is the temperature where 50% of all droplets in the picture are frozen . This value is more reliable than the initial freezing temperature, which is the temperature where the first droplet freezes, because the latter may be influenced by statistical variations and is less reproducible . Sem and tem measurements were performed at the ustem at the vienna university of technology . For sem, the milled mineral dust samples were put on a graphite plate and coated with 4 nm of au / pd alloy by sputtering (program: 30s, 15 ma). The powder is placed on a steel sample holder and then inserted into an x - ray diffractometer (panalyticalxpert pro; bragg the 2 angle was varied between 5 and 120. as x - ray source, the cu k line was used in all the experiments (0.154 44 nm). All samples were used without further treatment prior to the xrd experiments except milling . The measuring time varied between 1 h for the single mineral samples and 3 h for the natural samples . The ftir study of the mineral samples was taken on a bruker vector 22 . At least 1000 scans were collected per sample to get a sufficient signal - to - noise ratio at 4 cm spectral resolution . The surface areas of the quartz and montmorillonite samples were measured using a commercial liquid nitrogen adsorption system (asap2020, micromeritics). Data evaluation was based on the model by brunauer, emmett, and teller (bet). The surface areas of the other mineral dust samples could not be measured as too little material was available . The geometrical surface area of those minerals was estimated on the basis of the sem images . In total the ina of 13 different mineral dust samples was investigated with the cryomicroscope . The studied samples are calcite, gypsum, three different quartz samples (quartz i, quartz ii, quartz iii), microcline, albite, andesine, arizona test dust (atd), montmorillonite, kaolinite, limestone, and volcanic ash (table 1). The ina of the mineral dust particles was investigated with pure (as purchased) and freshly milled, heat - treated, and enzyme - treated particles . Three sets of experiments were performed with pretreated samples: first, the minerals were milled to initial sizes between 1 and 10 m with an agate mortar or a swing mill (retsch mm400). Suspensions of mineral dust particles in milli - q water with concentrations of 20 and 50 mg / ml were prepared and then mixed with oil to obtain an emulsion . The water droplets in the emulsion were 1040 m in size and contained around 110 particles at a concentration of 20 mg / ml and about twice as much at concentrations of 50 mg / ml . Second, the most ice nucleation active samples were selected and heated at 523 k for 45 h. in addition, the feldspars and quartz i were also heated at 373 and 773 k to control for surface alteration with temperature and to remove possible organic impurities, which are known to promote ice nucleation in some cases, and to ensure that the ina is only related to the mineral phases . For all temperature - treated particles the ina was determined before and after the heat treatment . Third, selected samples were treated with enzymes to exclude the possibility that their ina is due to adsorbed biological impurities, and to specifically block nucleation sites . For observing the impact of specific blocking, it was important to select a submolecular coverage of the mineral surface . Otherwise, the effect would not be related to the sites but would be due to the entire coverage only . As enzymes we used papain (2 mg / ml), pronase e (5 mg / ml), cellulose onozuka (5 mg / ml), and lipase (2 mg / ml), which break down proteins, polysaccharides, or lipids . Three different enzymatic treatment experiments were performed . After each step ice nucleation measurements were performed: (a) first, each enzyme was added to separate suspensions of pure milli - q water and mineral dust particles and left for 35 h at incubation temperatures of 308 k (lipase), 310 k (pronase e, onozucka) and 340 k (papain), (b) second, the enzymes were added all at once to the suspensions and the samples were left in incubation in total for 5 h increasing the temperature stepwise, respectively, and (c) in the last step, the enzymes were added and nucleation measurements were conducted immediately without incubation . In total, the ina of 13 mineral dust samples was investigated with the cryo - microscope (table 1 and supporting information). The most active species with t50 values> 247 k are quartz i, microcline, atd, and kaolinite . All other samples had much lower t50 values (<242 k), but they were still higher than those for pure water, indicating that the nucleation activation barrier was still slightly reduced by the mineral dust particles . The minerals are grouped into nonsilicates, quartz, feldspar, clays, and natural samples . The most active dusts are quartz, microcline (k - feldspar), atd, and kaolinite . Three different feldspar samples were tested: albite (na - feldspar), microcline (k - feldspar), and andesine (na / ca - feldspar). Considerable differences in ina among the feldspars were found: microcline had a t50 value of 249 k, whereas the t50 values for andesine and albite were much lower: 240 and 239 k, respectively . To explain these differences the chemical bulk composition was analyzed with xrd and edx . The surface structure of microcline is rougher than that of albite, but no significant difference in the morphology of the samples could be identified . These impurities appear on some albite grains, whereas over 70% are highly pure albite . Edx mapping over cracks did not reveal any migration of particular atoms to these sites . Because the penetration depth of x - rays and the exciting electrons is larger than a few hundred nanometers, these analytical methods are not surface the microcline sample is crystalline and almost pure, except for the above - mentioned albite content . Macroscopic defects observed in the microcline sample are as common as in albite and can therefore not explain the difference in the ina observed among the feldspars . The t50 for the most ice active quartz i sample was 249 k. the quartz ii and the quartz iii samples had t50 values of 239 and 235 k, respectively . The sem images of the quartz samples revealed that the quartz i sample (figure 2a) contained the largest fraction of particles with diameters below 1 m followed by quartz ii and quartz iii (figure 2b, c). The diffractograms of all three tested -quartzes show that no other phase was present . The bet surface area of quartz i sample was 5.5 m / g . Quartz ii had specific bet area of 2.0 m / g and quartz iii 0.5 m / g (all measured before the initial freezing experiment, i.e., prior to further milling). Quartz i is shown in the top left image (a), quartz ii at top right (b), and quartz iii below (c). Gypsum and calcite became active in at low temperatures with t50 values of 239 and 237 k, respectively . The gypsum sample contained around 4% of caso40.5h2o, with the rest being pure caso42h2o (gypsum), given by xrd quantification . Montmorillonite had a t50 of 240 k. a determination of the exact mineral composition is difficult as the layered structure of montmorillonite is not directly observable in powder xrd . By this method the exact quantity of those two components in montmorillonite is unknown, but we expect less than 10% each . The atd sample had much smaller particle sizes than the other samples, with hardly any particles larger than 5 m . Its composition (based on powder xrd phase analysis and sem - edx) was 1520% microcline, 1520% na / ca - feldspar, and 5060% quartz . Minor components were quartz, other feldspars, titanium iron oxide, and aluminum oxides . The volcanic ash was almost inactive with a t50 of 238 k, but due to the k - feldspar content the initial freezing temperature was much higher (figure s1, supporting information). The natural kaolinite used in this study was no single mineral component sample, as it contained also quartz, muscovite, and halloysite . Natural limestone showed the same ina as technical calcite with a t50 of 237 k, and it consisted only of calcite mineral on the basis of the xrd and ftir analysis . Additional milling of the microcline sample increased the t50 marginally (from 249 to 250 k). Heat treatment of this sample reduces the activity again, leading to the normal median freezing range 249250 k. for albite, milling had no effect on the t50, but the initial freezing temperature increased significantly as the albite sample contains some (<1%) k - feldspar and more k - feldspar surface became available during milling . Additional milling of both less active quartz samples (quartz ii and iii) increased their t50 values: after 4 min of milling in the metal swing mill the t50 values of the samples both changed to 241 k and after 2 min milling time an increase by up to 5 k was visible, whereas the activity of the quartz i sample did not further increase . The initial freezing temperatures of the samples quartz ii and iii increased from 242 to 246 k, respectively the surface areas of both minerals were about 3 m / g after milling . The absolute number of active surface nucleation site density ns was calculated using the relation given in eq 1, where fice is the frozen fraction at the given temperature t and s is the particle surface per droplet obtained directly from bet specific surface area.1 active surface site density depending on temperature plotted for all quartz samples . Quartz i shows the highest surface site density, and the original quartz iii sample shows almost no ina . Quartz ii and iii where milled for 4 min, resulting in a drastic ina increase for quartz iii . Nevertheless, within the measurement uncertainty the t50 change only marginally by heat treatments . Temperature treatment of the quartz and the kaolinite samples did not show any significant change in freezing behavior . Except for the particles treated with cellulose onozuka, the freezing curves of microcline changed drastically after enzymatic treatment . The t50 of the enzyme - treated microcline sample shifted to lower temperatures (240 k for microcline and 246 k for fine milled microcline) compared to the pure microcline sample (249 k/250 k) (table s1, supporting information). After heating the enzyme - treated microcline samples to 773 k, the t50 values returned almost to their initial values (t50 after enzymes and heating: 248 k). The particles mixed with enzymes at low temperatures and direct freezing measurements resulted in the same t50 values as the enzyme - treated samples with incubation . For albite the same procedure was applied and no distinct loss in ina was observed . In addition, heat and enzyme treatment resulted in no freezing behavior change . A clear loss of ina could be observed for quartz i after the sample was treated with enzymes . Although for treatment with papain the activity was almost unchanged, a treatment with lipase and pronase e clearly shifted the freezing curves to lower temperature values (papain, 249 k; pronase e, 247 k; lipase, 247 k). When all enzymes were applied together, t50 was 244 k. the activity was always restored to the original level after 4 h heating at 773 k. there is still no molecular description of the exact nature of nucleation sites on mineral dust particles in the literature . Adsorption of water through surface oh groups of the silica is reported, which is in agreement with later studies on kaolinite . Surface amphotericity and size matching between the ice structure and the solid surface has a strong influence on ina . Obviously, it is not the perfect quartz surface itself that nucleates ice at a higher temperature (see the low in activity of the coarse quartz iii), but rather local defects, which would support the concept of active sites . Those defects may be atomic lattice distortions caused by impurities, leading to a better structure matching between the ice and the particle surface, or crystallographic dislocations . On the basis of the experiments, we suggest that the defect density is different in the three quartz samples, and that it is increased by mechanical milling, which is known to generate nucleation sites . This would explain the reported variations of ina, which range from quartz with t50 = 243 k being the second best in after the feldspars to studies finding quartz one of the worst in together with most oxides . The minerals investigated in this study exhibit median freezing temperature (t50) values varying over a range of 13 k between the most (atd, 250 k) and least (calcite, 237 k) potent in (figure 1). Structural analysis showed that there is no direct correlation of the ina with the crystal structure of the minerals . This is especially true for the feldspar group that showed considerable differences in their ina . Milling of the samples increased the ina, which indicates that the freshly produced surfaces provide nucleation active sites that are not accessible otherwise . Suppressing ina with specific enzymes with particular chemical functionalities, which can interact with possible surface functional groups on the minerals, was successful in several cases . Subsequent heat treatment to remove the enzymes from the surface resulted in a reactivation of the nucleation activity of the respective mineral . All these experiments point to the crucial importance of the mineral surface itself and the involvement of the surface chemistry of these particles, as there is no spectroscopic evidence for any particularity to distinguish active surface sites of different quality . The ice nucleation property of specific quartz samples is not a result of their perfect quartz structure, but rather of local defects acting as nucleation sites . It is still not possible to study these sites directly with conventional methods, but some conclusions can be taken from the immersion freezing experiments carried out in this study . As the silanol groups thought to play an important role in the ice nucleation process are present in almost all silicates that show different t50 values in aqueous immersion, they alone do not act as good in . Ice nucleation is rather a complex interplay between the forming ice structure and the local surface structure of the mineral particle and therefore the arrangement of the functional groups (on the surface). The local electronic configuration, as well as distance and arrangement of functional groups influence the capability of a particle to act as good in . Possible functional groups are metal - hydroxyl, fluorine, or ionic oxygen species . The functional groups need to be able to act as a hydrogen bond donor and/or acceptor . A certain particle surface is able to act as in, if the functional groups are arranged properly . Here, we define a molecular site analogous to (molecular) catalysis as an arrangement of functional groups able to stabilize water molecules in an ice - like structure . A single molecular site may stabilize ice embryos, but to form a good nucleation site, a larger area with domains of molecular sites is needed . These domains nucleate ice at a given temperature, if the stabilized ice cluster is almost as large as the critical ice cluster at this temperature . The molecular sites are of different composition, size, and concentration on different minerals and samples . The assumption of specific molecular sites is based on the fact that with only partial surface coverage with enzymes the ina is lowered, but not totally lost . In addition, the ina of the mineral particles can be increased by increasing the available surface area . The higher ina of quartz i is attributed to an increased concentration of functional groups by the manufacturing (milling) process . For example, quartz iii froze almost heterogeneously before milling, whereas introducing further defects (by milling) increased the activity more than would be expected by just increasing the specific surface area . Molecular sites are of different form and surface density on mineral dust particles . We assume that the domains of arranged molecular sites conform to a material specific distribution with larger domains, resulting in larger stabilized ice clusters and higher nucleation temperatures being less frequent . With this idea it is possible to explain the increase in nucleation temperatures with increasing surface area . The feldspar family has higher t50 values than the quartz sample of comparable surface area in agreement with atkinson et al . And yakobi - hancock et al . The structure of feldspars is closely related to quartz, but si is partly substituted by al . The sio4/alo4 tetrahedra in feldspar are slightly tilted due to the charge compensating cations; surface distortions from the basic quartz structure may even be larger and defects (in particular ionic defects) are much more common, so more frequent molecular sites are expected for feldspars . Nevertheless, the feldspars have quite large differences in t50 values with microcline being active at a much higher temperature in this study and in the study by atkinson et al . The latest studies showed also good ice nucleation activities in the deposition mode for the orthoclase phase of k - feldspar, so the increased activity of k - feldspar need not be phase specific . The sem images of the feldspar samples are quite similar and a morphological difference cannot explain the different ice nucleation behavior . On the basis of the tem - edx measurements, if ice nucleation occurs at macroscopic defect sites such as cracks, it is not due to a local element accumulation, but rather to the steric configuration there . Extrinsic ina by organic adsorbates on microcline or its inhibition on the plagioclases can be excluded on the basis of the enzymatic and temperature treatment experiments . The inhibition of ice nucleation sites by enzymes may be understood as steric hindrance or blocking of the site . Further experiments revealed that the loss of ina is a result of a reversible active site hindrance / blocking and not a destruction, as the initial activity was regained after enzyme removal . Our results indicate that the higher ina of the k - feldspar sample is an intrinsic property and not a result of adsorbed organic / biological material . The investigated feldspars have different counter cations with different ionic radii (rk> rna rca). In addition the plagioclases (na / ca - feldspars) have a higher al / si ordering than the k - feldspars . The measurements leave only the conclusion that the difference in the ina of the feldspars is a result of the difference in ionic radius of the cations and therefore the local chemical configuration at the surface . The surface cations released into the surface bilayer may interact with water to enhance / inhibit ice formation . The resulting depletion of cations in the outermost layer may be different for each cation due to the differences in ionic radii . The ion charge density of the cations of the mineral was already suggested to influence ice nucleation on mineral surfaces . The cations around the surface have different affinity to water molecules and potential bonds are of different strength . Surface calcium ions on calcite are known to bind the water quite tightly and thus inhibit ice nucleation by fixing the water molecules in ice structure mismatching locations . The difference in ina of microcline and the plagioclases may also be a result of the more random cation / aluminum distribution in the k - feldspars compared to the na / ca feldspars . The tendency of the surface to interact with water molecules is increased by this process as dangling bonds remain at the surface . The hydration shells of ca, na, and k ions have different sizes and shapes . Ca and na belong to the chaotrope family (structure breaking ions) whereas k is a kosmotrope (structure making ion). Small ions with high charge density are considered to be chaotrope and have a strong interaction with water water hydrogen bonds are broken to form the hydration shells with larger residence times of water molecules compared to the shells of kosmotropic ions . These strong chaotrope - water interactions inhibit an ice - like structuring of water molecules in the vicinity of the ions . Kosmotropes like k on the other hand have a weaker interaction with water than the intermolecular water water interaction . The k ions form hydration shells, but the water molecules are bonded more weakly and have high exchange rates . Therefore, any thermodynamic phase change of water by k ions is kinetically less hindered than by chaotrope ions . In feldspar the cations released into the water stay close to the surface due to surface charging and charge compensation and are then able to interact with water molecules . In the case of ca and na, ice nucleation is inhibited by their chaotropic behavior, whereas k has a positive or at least a neutral effect . In addition, it was shown that koh is easily incorporated into the ice structure . The size of k is around the size of a h3o ion, whereas na and ca are far too small to fit well into the ice structure . This would further lower the negative effect of the k ions to the formation of ice - like structures close to the vicinity of the surface bilayer . This is in agreement with a former study where lower ice nucleation temperatures were found for micas containing al ions instead of k ions, where again the aluminum ion has a much higher charge density . Our kaolinite sample contains small amounts of k - feldspar, which gives the sample most of its ina together with a slightly larger surface area . Any exact explanation of the ice nucleation behavior of our montmorillonite sample is difficult, as exact mineral composition analysis and structure determination are lacking . A distinct phase identification by xrd was not possible due to the layered stacking structure of montmorillonite . On the basis of the sem - edx, the larger amounts of mg compared to k, na, and ca found suggest chaotropic influence of the magnesium ions if the surfaces of the mineral support ice - like arranged water molecules . Nevertheless, the montmorillonite acts as a heterogeneous in, but at rather low temperatures compared to k - feldspar . As already reported, the calcite surface has a strong affinity to water molecules . The water molecules are tightly bound to the surface and cannot arrange in ice - like structures . The water molecules are possibly bound to hydrolysis species, chemisorbed on the surface of calcite . In gypsum, the strong calcium water interaction may lead to a similar behavior . In agreement with the feldspars, the investigated volcanic ash acts as a rather poor in with a t50 of 238 k. the ash sample from the eyafjallajkull eruption 2010 is mainly composed of the weak in albite (na - feldspar). The higher initial freezing temperature can be easily explained by the inhomogeneity of the sample . The titanium iron oxide which was found in the ash seems to have no influence on the ina, but no experiments on single minerals could be performed . This partly explains why in a former study volcanic ash showed both high in activity, as well as almost none . K - feldspar rich volcanic ash has a larger tendency to act as a good in than ash containing mainly plagioclases (na / ca - feldspar). It cannot be stated directly that only the mineral composition determines the ina as volcanic ash eruptions are often accompanied by sulfuric acid and other gases that may alter the surface and ice nucleation properties . The atd sample had a slightly larger surface area than the other dust samples, probably leading to a slightly overestimated t50 value compared to the other samples . Still, the atd sample was a rather good in, which was not surprising due to its k - feldspar content . In addition, the quartz content may also act as in, depending on the preprocessing of the sample . The feldspar family has higher t50 values than the quartz sample of comparable surface area in agreement with atkinson et al . And yakobi - hancock et al . For the deposition mode the structure of feldspars is closely related to quartz, but si is partly substituted by al . The sio4/alo4 tetrahedra in feldspar are slightly tilted due to the charge compensating cations; surface distortions from the basic quartz structure may even be larger and defects (in particular ionic defects) are much more common, so more frequent molecular sites are expected for feldspars . Nevertheless, the feldspars have quite large differences in t50 values with microcline being active at a much higher temperature in this study and in the study by atkinson et al . The latest studies showed also good ice nucleation activities in the deposition mode for the orthoclase phase of k - feldspar, so the increased activity of k - feldspar need not be phase specific . The sem images of the feldspar samples are quite similar and a morphological difference cannot explain the different ice nucleation behavior . On the basis of the tem - edx measurements, if ice nucleation occurs at macroscopic defect sites such as cracks, it is not due to a local element accumulation, but rather to the steric configuration there . Extrinsic ina by organic adsorbates on microcline or its inhibition on the plagioclases can be excluded on the basis of the enzymatic and temperature treatment experiments . The inhibition of ice nucleation sites by enzymes may be understood as steric hindrance or blocking of the site . Further experiments revealed that the loss of ina is a result of a reversible active site hindrance / blocking and not a destruction, as the initial activity was regained after enzyme removal . Our results indicate that the higher ina of the k - feldspar sample is an intrinsic property and not a result of adsorbed organic / biological material . The investigated feldspars have different counter cations with different ionic radii (rk> rna rca). In addition the plagioclases (na / ca - feldspars) have a higher al / si ordering than the k - feldspars . The measurements leave only the conclusion that the difference in the ina of the feldspars is a result of the difference in ionic radius of the cations and therefore the local chemical configuration at the surface . The surface cations released into the surface bilayer may interact with water to enhance / inhibit ice formation . The resulting depletion of cations in the outermost layer may be different for each cation due to the differences in ionic radii . The ion charge density of the cations of the mineral was already suggested to influence ice nucleation on mineral surfaces . The cations around the surface have different affinity to water molecules and potential bonds are of different strength . Surface calcium ions on calcite are known to bind the water quite tightly and thus inhibit ice nucleation by fixing the water molecules in ice structure mismatching locations . The difference in ina of microcline and the plagioclases may also be a result of the more random cation / aluminum distribution in the k - feldspars compared to the na / ca feldspars . As already mentioned, feldspar surfaces are cation deficient in aqueous solution . The tendency of the surface to interact with water molecules is increased by this process as dangling bonds remain at the surface . The hydration shells of ca, na, and k ions have different sizes and shapes . Ca and na belong to the chaotrope family (structure breaking ions) whereas k is a kosmotrope (structure making ion). Small ions with high charge density are considered to be chaotrope and have a strong interaction with water . The weaker water water hydrogen bonds are broken to form the hydration shells with larger residence times of water molecules compared to the shells of kosmotropic ions . These strong chaotrope - water interactions inhibit an ice - like structuring of water molecules in the vicinity of the ions . Kosmotropes like k on the other hand have a weaker interaction with water than the intermolecular water water interaction . The k ions form hydration shells, but the water molecules are bonded more weakly and have high exchange rates . Therefore, any thermodynamic phase change of water by k ions is kinetically less hindered than by chaotrope ions . In feldspar the cations released into the water stay close to the surface due to surface charging and charge compensation and are then able to interact with water molecules . In the case of ca and na, ice nucleation is inhibited by their chaotropic behavior, whereas k has a positive or at least a neutral effect . In addition, it was shown that koh is easily incorporated into the ice structure . The size of k is around the size of a h3o ion, whereas na and ca are far too small to fit well into the ice structure . This would further lower the negative effect of the k ions to the formation of ice - like structures close to the vicinity of the surface bilayer . This is in agreement with a former study where lower ice nucleation temperatures were found for micas containing al ions instead of k ions, where again the aluminum ion has a much higher charge density . The ice nucleation behavior of various mineral samples was investigated with a special focus on feldspars, which are known to be among the most ice nucleation active species . The feldspars are more ice nucleation active than most quartz samples, and k - feldspar is by far the most active in of the feldspar family . The size of the cation, and its binding energy toward water are the key factors determining ina . Different quartz samples showed a large discrepancy of their ina . With the presented idea of domains of molecular sites able to bind and arrange water molecules in an ice - like structure acting as ice nucleation sites, we suggest that the history of the quartz particles and dust particles in general has an important influence . Ina is enhanced by introducing more defects to a quartz surface by mechanical milling . The nucleation sites suggested here are not necessarily the same on each particle, but rather caused by a stochastic arrangement of functional groups which are able to bind water molecules . Therefore, nucleation site sizes, as well as the corresponding nucleation temperature, conform to a statistical distribution . Consequently, the freezing curves determined with our experimental setup can be shifted to higher temperatures by increasing the particle surface for active in like k - feldspar . Still, an open task for future work will be to understand the processes that lead to site formation on the molecular level.
Sixty - three fecal samples were collected from laboratory ferrets (mustela putorius furo) at the national institute of infectious diseases, tokyo, japan, on may 24, 2013 . These ferrets had been imported from a farm in the united states for influenza research 7 days before sample collection . Fecal specimens were diluted with 10 mmol / l phosphate - buffered saline to prepare a 10% suspension, shaken at 4c for 1 h, and clarified by centrifugation at 10,000 g for 30 min . The supernatant was passed through a 0.45-m membrane filter (millipore, bedford, ma, usa), and stored at 80c until use . Rna was extracted by using the magna pure lc total nucleic acid isolation kit (roche applied science, mannheim, germany) according to the manufacturer s recommendations . Reverse transcription was performed by using the superscript ii rnase h reverse transcription procedure (invitrogen, carlsbad, ca, usa) and primer tx30sxn as described (14). Ferret hev rna was detected by using a nested, broad - spectrum reverse transcription pcr (15). Sequences were similar to those detected in ferret serum samples in the united states (11), which suggested that the laboratory ferrets were infected in the united states and then transported to japan . Rna from 2 ferret hevs was randomly selected, and the full - length genome was amplified by using reverse transcription pcr with primers based on nucleotide sequences derived from strains from the netherlands and united states (table 1). Sequence of the 5-terminal noncoding regions of the genome was determined by using rapid amplification of cdna ends kits (invitrogen) according to the manufacturer s instructions . All pcr products were purified by using the qiaquick pcr purification kit (qiagen, valencia, ca, usa) and cloned into the ta cloning vector pcr2.1 (invitrogen). Nucleotide sequencing was conducted by using an abi 3130 genetic analyzer automated aequencer (applied biosystems, foster city, ca, usa). * values in parentheses indicate positions of the primer corresponding to the entire genome of hepatitis e virus (jn998607) isolated from ferret . Both ferret hev genomes consisted of 6,820 nt and a poly (a) tail (genbank accession nos . Ab890001 and ab890374), and nucleotide sequence identity was 99.6% . Genomic structure of strains from the united states was similar to that of 2 strains from the netherlands . The amino acid alignment of orf2 indicated that ferret hev orf2 has an additional 6 amino acids at the n terminus . However, because the seventh codon is aug, it is unclear which codon was used for the orf2 translation initiation . The orf1 of strains from the united states encodes 1,589 aa, which is 7 aa shorter than orf1 of both strains from the netherlands . In addition, the ferret hev strains from the united states have 2 aa insertions between amino acid residues 596597 (thr) and 631632 (ile) and 9 aa deletions in amino acid residues 645653 (cys - leu - arg - ser - ser - pro - lys - pro - pro), which corresponds to those of strains from the netherlands . Similar to ferret hev from the netherlands, an additional putative 183-aa orf 4 (nt 30581) was found in strains from the united states . Ab890375ab890379) showed that nucleotide identities among them were 98.9%99.5%, which indicated that genetically similar ferret hev strains had circulated at the ferret farm in the united states . Nucleotide and deduced amino acid sequence identities between ferret hev from the united states and other hevs are shown in table 2 . The entire genome of strains from the united states shared relatively high nucleotide sequence identities (82.4%82.5%) with strains from the netherlands . These trees showed that although strains from the united states were closely related to strains from the netherlands, they formed a new and distinct cluster (figure). We observed similar phylogenetic clustering when we analyzed nucleotide sequences of orf1 and orf3 separately . Although we cannot conclude whether ferret hev from the united states is a new genotype, these results indicated that there is genetic variety in ferret hev . Researchers should also bear in mind that some laboratory ferrets are contaminated with ferret hev . Phylogenetic relationships among genotypes 14 and wild boar, rabbit, rat, avian, bat, and ferret isolates of hepatitis e virus . Phylogenetic trees with 1,000 bootstrap replicates were generated by using the neighbor - joining method (njplot 2.3, http://njplot.sharewarejunction.com/) based on a) the entire genome and b) open reading frame 2 . We amplified the entire genome of 2 ferret hev strains isolated from laboratory ferrets imported from the united states . Nucleotide sequence comparisons showed that 2 ferret hev strains from the united states had high (99.6%) identity and shared 98.6%100% identities with partial sequences of orf1 that were detected in the united states (11), which indicated that genetically similar ferret hev was circulating in laboratory ferrets . Although nucleotide sequence identities of the entire genome for strains from the united states and the netherlands was 82.4%82.5%, orf2 showed relatively high amino acid identities (94.2%94.8%), which suggested that isolated from the united states and the netherlands share similar antigenicity . Ferret hev like particles derived from 1 of the isolates from the netherlands were cross - reactive with serum from hev - infected laboratory ferrets in the united states (11). In conclusion, we isolated and identified 2 ferret hev strains from laboratory ferrets imported from the united states.
Radial extracorporeal shock wave therapy (rswt) generates pressure waves through the collision of solid bodies1 . There are a few recent reports regarding the effectiveness of extracorporeal shock wave therapy (eswt) on neurogenic heterotopic ossification (ho) in the lower extremity, but to our knowledge, the use of eswt or rswt to treat neurogenic ho in the upper extremity has not been reported in the literature4 . We report 2 cases of rswt used to treat neurogenic ho in the upper extremities . In both cases, improvements in pain, range of motion (rom), muscle strength, and hand function were observed . Each patient gave their written informed consent and agreed to participate in the treatment . This case report was approved by the ethics committee of the sahmyook medical center . A 49-year - old man was admitted to our physical medicine and rehabilitation (pmr) department . A subarachnoid hemorrhage (sa) occurred 10 months prior to admission and neurogenic ho of the left shoulder and elbow was diagnosed 2 months before his admission . He had been taking disodium etidronate 800 mg per day (fig . 1. (a) in case a, bone scan, x - ray, and musculoskeletal ultrasound demonstrate ho in the left shoulder and elbow . Arrows indicate the ho sites.ho: heterotropic ossification; subs: subscapularis; cp: coracoid process; un: ulnar nerve; me: medial epicondyle; olec: olecranon). In spite of the medication, he continued to complain of constant pain, limited rom, muscle weakness, and impaired hand function . Rswt was administered to the inferior portion of the coracoid process of the left shoulder and the medial epicondyle (me) of the left elbow using ultrasonographic (usg) guidance . The target points of rswt were the ho area that could be seen with usg . (a) in case a, bone scan, x - ray, and musculoskeletal ultrasound demonstrate ho in the left shoulder and elbow . : heterotropic ossification; subs: subscapularis; cp: coracoid process; un: ulnar nerve; me: medial epicondyle; olec: olecranon a 52-year - old man with a 6-month history of hypoxic brain injury was admitted to our pmr and diagnosed with neurogenic ho of the right elbow (fig . 1). Rswt was administered to the ho area including the me and olecranon of the right elbow using usg guidance . Medications were not subsequently required due to a good response to rswt . In both cases, rswt was administered using the master plus mp 2000 (storz, tgerwilen, switzerland), and the rswt protocol consisted of 3,000 pulses at a frequency of 12 hz during each treatment . The intensity level ranged from 25 bars, and it was administered 5 times a week for 4 weeks, a total of 20 treatments . During rswt, all other treatments, including physical and occupational therapy, were continued as usual . Both patients were allowed to take previously prescribed oral medications but additional analgesics or antispastic medications were not permitted . Pain assessed with the numerical rating scale (nrs), rom, muscle strength assessed with the manual muscle test (mmt), a hand evaluation test, and the jebsen - taylor hand function test were evaluated prior to each treatment, after treatment, and following 1 month of treatment . Pain was reduced from 8 to 0 on the nrs, and the patients remained pain - free for 1 month after treatment . In case a, rom of flexion, abduction, adduction, internal rotation, and external rotation of the left shoulder and additionally, flexion of the left elbow was improved and maintained . The mmt result also showed improvement and the improvement was maintained for 1 month (table 1table 1.range of motion, manual muscle test, hand evaluation test and, jebsen - taylor hand function test resultstestcase acase bbeforeafterfollow up upbeforeafterfollow uprange of motion()shoulderflexion 90140 * 145extension 202020abduction90130 130adduction1020 20internal rotation6070 70external rotation2060 60 * elbowflexion 90100 * 100 * 4080 * 85extensionfullfullfullfullfullfullsupination7070706065 80pronation7060606062 80manual muscle testshoulderflexionfairfair+fair+extensionfairgoodgoodabductionfairfair+fair+horizontal abductionfairfair+fair+horizontal adductionfairgoodgoodelbow flexionfairgoodgoodfairfairfairextensionfairgoodgoodfairfairfairhand evaluation test grasp power (kg)1420 18 * 121212lateral pinch (kg)3.54.5 * 5.5 * 1.52.5 * 2tripod pinch (kg)23.0 2.5 * 211.5nine - hole pegboard (sec)30.625.7 * 25.0 * 13865.1 * 58.7purdue pegboard test (number) 1112 12 * 03 * 1jebson - taylor hand function test (sec)writing55.3445.00 43.71ntntntcard turning9.317.87 8.76 * 11.0411.076.9small common object12.1610.59 10.15nt47.3 19.5feeding13.8112.25 10.94ntnt25stacking checkers7.134.50 * 4.12ntntntlarge light object (sec)5.845.914.81 8.125.71 * 6.34large heavy object (sec)6.945.78 4.63 * 8.697.12 * 5.06*follow up period was 4 weeks . Functional testing of hand strength and speed of hand movement showed improvements that were maintained at least for 1 month after the end of treatment (table 1). Follow up period was 4 weeks . Improved score; nt: not testable; affected side in case b, right elbow flexion, supination, and pronation were improved, the improvements were maintained for 1 month . In contrast to case a, improvement in the mmt result was not seen (table 1). In the hand function test, the strength of the hand and speed of hand movement improved, and these improvements were maintained at least for 1 month after the end of treatment (table 1). Ho is a complicated and significant medical problem characterized by abnormal growth of bone in soft tissues, commonly around large joints . In its severe form, the condition causes pain, limited rom, and loss of function in the affected joint . Neurogenic ho is associated with injuries to the central nervous system, occurs 24 months after a neurological insult, and mainly affects the major synovial joints between spastic muscles6 . Primary treatment is a combination of gentle passive rom exercises and bisphosphonate medication, such as disodium etidronate or nonsteroidal anti - inflammatory drugs . Surgical excision may be considered for complicated cases, but surgical complications and postoperative recurrence are common4 . Eswt has been described in several case reports as a new treatment strategy for neurogenic ho, but it has been restricted to the lower extremities7 . Eswt has been shown to promote bone healing in stress fractures, avascular necrosis, and delayed and/or bony nonunion, and it has been widely used for managing the pain of various musculoskeletal conditions8 . Eswt consists of a sequence of single sonic pulses characterized by high peak pressure (1001,000 bars) of short duration (0.2 s) and has a focused pressure field with deep penetration depth . Compared with eswt, rswt is characterized by 110 bars of pressure of 0.20.5 ms duration and has a radial pressure field with shallow penetration depth . Despite the physical differences, the stimulation effects and therapeutic mechanisms of eswt and rswt are almost the same1 . In our cases, pain, rom, muscle strength, and hand function improved although imaging studies with radiographs and bone scans showed no changes . This result is consistent with previous studies that reported improvement in pain and function without changes in imaging studies7, 8 . Based on the results of these studies, it is our opinion that imaging findings do not accurately reflect the pain and function caused by neurogenic ho . The mechanism of pain reduction with eswt or rswt is not well known and there are several hypotheses9 . Eswt or rswt generates oscillations in tissue that lead to improvement of microcirculation and metabolic activity1 . Immediate pain reduction after eswt could be the result of a hyperstimulation analgesic effect10 . The improvements observed in rom, mmt, and hand function of the present two cases could be associated with pain reduction, since proper management of pain caused by neurogenic ho with rswt could have been the cause of the improvements in rom and hand function . As reported by previous studies, in our cases, the improvements in pain, rom, mmt, and hand function were maintained for 1 month after the rswt treatment7 . The mechanism of the long - term maintenance of the improvements is not known but rswt in the early phase of neurogenic ho is effective at preventing progression . They were the inferior part of the coracoid process of the left shoulder and the me of the left elbow in case a, and the me and olecranon of the right elbow in case b. imaging guidance when administering rswt for treating neurogenic ho could help to correctly focus on the ho site and avoid the other vulnerable structures such as vessels and nerves2, 10 . In conclusion, rswt improved the pain, rom, and hand function of two patients with upper extremity neurogenic ho . Further studies are needed to support these results and to understand the mechanism behind the effectiveness of rswt, as well as to devise a protocol for rswt for neurogenic ho.
Stairway falls are a leading cause of injury in patients less than 5 years of age [1, 2]. While the majority of these injuries occur when a child steps down the stairs, approximately 3% of injuries will be associated with a caregiver falling while carrying a child . This specific mechanism has been shown to result in injury patterns that are more likely to necessitate hospitalization and more likely to involve trauma to the head and fractures to the extremities . While it is often necessary for a parent or caregiver to carry children in their arms while walking down stairs, the child may obstruct the caretaker s view on the stairway (fig . This can lead to a fall by the caretaker and an injury to the child and/or caretaker . To date, several previous studies have been conducted evaluating stairway injuries in children, but none have focused on this specific mechanism (fall from caregiver s arms) or the injuries associated with these falls . The goal of this study was to identify injuries that may occur when a caretaker falls while carrying a child on a stairway, to understand the pathomechanics of this injury, and to perform a cost analysis of the injury.fig . D bird s eye view of how the child can obstruct the caretaker s view on the stairway a side view of the caretaker s unobstructed view on the stairway . D bird s eye view of how the child can obstruct the caretaker s view on the stairway emergency department and orthopedic clinic records were reviewed between 2004 and 2012 to identify patients with an orthopedic injury after a fall from stairs . Sixteen children were retrospectively found to have a fracture from a fall - in - arms injury sustained while a caregiver was going down stairs, and were included in this study . Patient identification occurred at a routine weekly fracture conference, where every emergency department fracture in which the orthopedic service was consulted was presented . If the patient met the inclusion criteria, they were then added to the database . The following demographic and epidemiologic data were recorded for each patient: age, gender, location of injury, and mechanism of fall . Additionally, radiographs were reviewed to assess fracture location, type, displacement, and treatment . Cost analysis data was obtained from the hospital billing department and included all emergency department care, inpatient care, and subsequent follow - up . This study was granted a waiver of informed consent, including permission and assent, in accordance with 45 cfr 46.116(d) and 45 cfr 46.408, and a waiver of hipaa authorization per 45 cfr 164.512(i). The study was authorized by the local ethical committee and was performed in accordance with the ethical standards of the 1964 declaration of helsinki as revised in 2000 . Sixteen children presented to the emergency room and orthopedic clinic of our hospital after sustaining an injury when their caretaker fell while carrying them down the stairs . Our billing records reveal that we, as an institution, treat approximately 9,500 fractures per year, giving an incidence of approximately 1 fracture by this mechanism per 5,000 fractures . Interviews with the parents yielded information regarding the specifics of the fall and the possible pathomechanics of the child s injuries . The parent or caregiver noted in all cases that the child was being held in front as they descended the stairs . The child obscured their view and they missed a step and fell (fig . The age at the time of injury averaged 14 months and ranged from 7 months to 51 months of age . Eight (50%) sustained femur fractures, six (38%) sustained tibia fractures, and one (6%) sustained a metatarsal fracture . There was one both bone forearm fracture (6%); this occurred in the eldest child (51 months). Four of these patients, however, required a reduction or manipulation, three of which were performed in the operating room . Functionally, all patients did well, with no deficits noted at final follow - up . Cost analysis was performed amongst our 16 patients to determine the financial burden accrued in relation to these accidental traumas (table 1). The average total charge of the treatment of the fractures was $6,785 (standard deviation $11,183; range $948$45,876). Five of the 16 children (31%) had a skeletal survey, as the treating physicians were concerned about possible child abuse; the average total charge for those receiving a skeletal survey was $7,024 . After a social service consultation and a skeletal survey were obtained in these cases, no patient was felt to be the victim of child abuse . For those children not requiring a skeletal survey, three children (19%) required a closed reduction of their femur fractures in the operating room; their total care charges averaged $23,568 . For the children not treated in the operating room, the average charge was $2,912.table 1cost of fall - associated accidental traumasage (months)sexfractured bone(s)costskeletal survey18mtibia / fibula$2,607no7ftibia$2,024no12ffemur$4,276yes10mfemur$7,861yes12mfemur$9,080no16ftibia$2,801no10mmetatarsal$1,328no17mfemur$19,748yes12ftibia / fibula$2,594no7ffemur$4,231yes51fulna$3,907no15.6 (avg . Age)$5,496 (avg . Injuries incurred on stairs, particularly in patients under the age of five, can occur with relative frequency . Three previous studies have been conducted that have evaluated stairway injuries in children [3, 4, 6]. Included in these studies were primarily children who fell while walking on the stairs, and none focused on the variable of a caretaker falling while carrying a child . It was noted, however, in these studies that children who sustained injuries while being carried tended to have more severe injuries than those who fell while walking themselves down stairs . In our study, all patients identified had incurred a fracture, and nearly all of these involved the lower extremity . Of the 16 children, half (50%) sustained femur fractures and 38% sustained tibia fractures . These results show that the pattern of injury differs from that of a child who falls while walking down the stairs . However, a child who is dropped, or fallen upon, while being carried appears more likely to sustain a long bone fracture to the lower extremity . Pierce et al . Have the only series currently published that examines the incidence of femur fractures and falls down stairs . Their series evaluated femur fractures that were due to a reported fall down stairs (either solo or in a caretaker s arms), and evaluated a plausibility model to check whether they could identify cases of nonaccidental trauma . In their subgroup of caretaker falls, this mechanism most commonly caused buckle fractures, followed by transverse / short oblique fractures . They examined the energy absorbed by the patients during falls and noted that the greater number of stairs in the fall correlated to the fracture pattern type, noting that spiral fractures were associated with falls from 1 to 3 steps and buckle fractures with falls from 4 to 15 steps . In our study, we saw an even distribution of spiral and buckle fractures that may be associated with the variability in fall heights that were observed in our patient population . Pierce et al . Also employed a plausibility model to help identify if certain aspects taken from the history could be used as independent identifiers of child abuse . They found that if a caregiver could not give specific details about the fall dynamics as well as the position of the child before and after the fall, the child may have been a victim of abuse . Although this model has not been validated, and was not employed here, it may provide guidance to treating physicians and can reduce costs and avoid exposing patients to unnecessary radiation from a skeletal survey . In our series, all caregivers were able to provide a detailed history regarding the nature of their child s injury, and subsequent non - accidental trauma work - ups suggested no cases of abuse . Additionally, no child in our study had a concomitant injury other than the fracture . This is consistent with other studies, where abused children tended to have other injuries such as bruising as well head and trunk injuries . The total charge for the children who received a skeletal survey as part of their work - up was $7,024 . It is the duty of treating physicians whether they are primary care physicians, emergency room physicians, or orthopedists to be vigilant in the work - up of suspected nonaccidental trauma, and the skeletal survey is frequently the first test ordered following a history and physical . With that said, in cases where the caregiver can provide a clear history, the skeletal survey can be deferred to minimize costs and radiation exposure to the child . Three children in our series had to go to the operating room for a surgical reduction . All of these were for diaphyseal femur fractures that were treated with a spica cast . The costs related to the treatment of these femur fractures dwarf the costs of the other patients in this series . When taken as two separate groups, the average charge for femur fracture treatment in the emergency room was $2,912, compared to $23,568 for treatment in the operating room . This study does have limitations and is biased toward orthopedic injuries, as all of the cases reported were obtained through orthopedic emergency room consults and clinic visits . Isolated injuries to the head or torso would not involve an orthopedic consult and thus were not included in this group . This most likely underestimates the total number of children seen at our hospital due to a fall down stairs while being carried by a caregiver . Additionally, the number of children with relatively minor injuries who did not seek medical treatment further underestimates the true incidence of this mechanism of injury . This paper describes the type of orthopedic injuries sustained during a fall down stairs while in a caregiver s arms . What our study adds to the literature is that nearly one - third of the children underwent a skeletal survey due to concerns regarding child abuse . Additionally, the average cost of these injuries was not insignificant and averaged $6,785 . Thirdly, we believe that the pathomechanics of this injury are as follows: the caregiver descends the stairs carrying a child in front.the size of the child obscures the view of the subsequent stair (fig . 1a d).the caregiver misses the step and falls.the momentum usually causes the caregiver and child to fall forward down the stairs (fig . 2).fig . 2they miss the step and fall, often landing on the child as they fall the caregiver descends the stairs carrying a child in front . The size of the child obscures the view of the subsequent stair (fig . The momentum usually causes the caregiver and child to fall forward down the stairs (fig . 2they miss the step and fall, often landing on the child as they fall they miss the step and fall, often landing on the child as they fall with a better understanding of this mechanism, the treating er physician can avoid routine skeletal surveys when the parent describes a plausible sequence, as we note above . Finally, with awareness of this mechanism, prevention of these injuries may be possible . Our recommendations are for the caregiver to hold on to the handrail while traversing the steps . In addition to using the handrail, the caretaker s view of the stairs should be unobstructed (fig . 3). This can be accomplished by positioning the child on the opposite side of the body to the handrail . We hope that these recommendations serve to remind healthcare providers as to the dangers of carrying children on stairways . At times this may be necessary, and can be performed safely if the proper precautions are taken.fig . In addition to using the handrail, the caretaker s view of the stairs should be unobstructed the caregiver should hold on to the handrail while traversing the steps . In addition to using the handrail, the caretaker s view of the stairs should be unobstructed in conclusion, a fall in a caregiver s arms while going down stairs can result in multiple orthopedic injuries, particularly to the lower extremity . The costs of treating these injuries are not insignificant, averaging nearly $7,000, and the suspicion of child abuse can be both costly and unnecessary in the case of a true accident . While descending the stairs with a child in their arms, the caregiver should hold the child to the side so as not to obscure their vision of the step with one arm, ideally holding the handrail with the other.
To date, four prostaglandin (pg) derivatives (unoprostone, latanoprost, travoprost and bimatoprost) have been marketed across the world . In addition, in 2008 tafluprost was marketed in some european countries and in japan . Prost - type pg derivatives (that is, pg derivatives other than unoprostone) are now the drugs of first choice for the treatment of glaucoma because of their potent intraocular pressure (iop)-lowering activity, the low likelihood of systemic adverse reactions, the once - daily application, and good patient adherence . As of end july 2009, tafluprost has been approved in 21 countries . No preservative - free tafluprost preparation has yet been marketed in japan, even though both a preservative - containing preparation (tapros) and a preservativefree preparation (taflotan) have been marketed in other countries . This review will describe the pharmacological profile of tafluprost (the latest pg derivative) and also the clinical studies of this drug conducted across the world, while focusing especially on those conducted in japan . (tokyo, japan), their original concept having been to develop a new product with an efficacy and safety comparable to or higher than those of latanoprost (a prostanoid fp receptor agonist). Prost - type pg derivatives (ie, those other than unoprostone), were discovered as compounds that retained the 15-position hydroxyl group of natural pgf2, and had high pharmacological activity . The hydroxyl group at the 15-position was considered indispensable for the manifestation of the activity of pgs.1 however, tafluprost is a novel pgf2 derivative in which the 15-position hydroxyl group is substituted by 2 fluorine atoms (figure 1). Because of this substitution, ketonization by 15-hydroxy - dehydrogenase (one of the major pathways involved in the metabolization of pgs) does not occur with this compound . As a result, it is metabolized only through beta - oxidation of the alpha - chain of pg skeleton.2 because of this lack of one pathway for its metabolization, tafluprost may expected to have a prolonged action, but it has been shown to lack a tendency to accumulate.2 in pg derivatives other than bimatoprost, the alpha - chain ending of the pg skeleton has been isopropyl - esterified, and for this reason these derivatives are converted into an active form (carboxylic acid form) by corneal esterase, and penetrate rapidly into the anterior chamber of the eye . It has been reported that tafluprost not only has an affinity for the fp receptor that is about 12 times higher than that of latanoprost, but that it has almost no potential to bind to the other receptors.3 among the other pg derivatives, the affinity of travoprost for the prostanoid fp receptor has been reported to be 2.8 times as high as that of latanoprost.4 for both unoprostone and bimatoprost, the receptors on which they act were uncertain at the time of launch onto the market . However, each had been reported to have a low affinity for the prostanoid fp receptor.5,6 later, only nonmetabolized bimatoprost was found not to bind to the conventional fp receptor, but instead to the prostamide receptor, which is a complex receptor consisting of fp and splice - variant fp receptors.7 figure 2 shows images indicating the receptorbinding affinities of pg derivatives for various prostanoid receptors . A simple summary of these reports on the affinities of the existing pg derivatives for the fp receptor would be that tafluprost has the highest affinity for the fp receptor among the pg derivatives currently available (notably, higher than that of latanoprost). We previously reported that the iop - lowering activity of each of these pg derivatives was absent in prostanoid fp receptor - knockout mice, indicating that the fp receptor is involved to a greater or lesser extent in the iop - lowering action of each pg derivative.8,9 the iop - lowering activity of tafluprost has been demonstrated both in ocular normotensive monkeys and in laser - induced ocular hypertensive monkeys.3 in the former the maximal iop reductions achieved with a single dose of tafluprost (0.00002 to 0.0025%) were dose - dependent, with statistical significance being reached at doses of 0.0005 and 00025%, and the potency of tafluprost at 00005% was almost equal to that of latanoprost at 0005% (figure 3).3 similarly, in laser - induced ocular hypertensive monkeys, single - dose applications of tafluprost (0.00002 to 0.0025%) induced a dose - dependent iop reduction.3 when normotensive monkeys received repeated doses of tafluprost (0.0015%, 0.0025%, or 0.005%) once daily for 5 days, this drug exhibited iop - lowering effects not only on the first day, but also on the third and fifth days of administration, without an attenuation of efficacy over time (figure 4).3 when 0.005% of latanoprost was administered instead in the same study, the iop measured at 24 hours after each dose was equal to the baseline iop level . However, when any one of the above concentrations of tafluprost was administered, the iop levels at the trough - points on the third to fifth days were significantly lower than those in the vehicle - treatment group (figure 4).3 these results suggest that the duration of action of tafluprost may become longer upon repeated dosing . Like latanoprost, tafluprost lowers iop by stimulating the outflow of aqueous humor through the uveoscleral passway.3 although latanoprost and tafluprost lower iop through actions on the same receptor and through the same mechanism, the magnitude of the iop reduction in a given individual may differ between these two drugs . In our recent study on monkeys that had a low susceptibility to latanoprost and displayed an inadequate reduction of iop in response to latanoprost, the magnitude of the iop reduction induced by tafluprost (0.0015%) was greater than that induced by latanoprost (0.005%) in all ten monkeys tested.10 this suggests that switching to tafluprost may be useful in cases in which the iop reduction achieved with latanoprost is insufficient . One of the known adverse reactions to pg derivatives is pigmentation of the iris and/or eyelids . Melanoma cells that had been incubated for 4 days in a medium supplemented with a high concentration of tafluprost failed to exhibit the elevated melanin content seen in cultures containing the same concentration of latanoprost (figure 5).3 admittedly, a very high concentration of each drug was used in this study . Nevertheless, the lack of reaction in the tafluprost - treated cells, despite the presence of such a reaction in the latanoprost - treated ones, may indicate (a) that the incidence of iris or eyelid pigmentation will be low with tafluprost and (b) that if such pigmentation does develop following treatment with this drug, it will not be severe . Other data have raised the possibility that tafluprost might improve blood flow as well as other pg derivatives . For instance, izumi n et al11 noted that administration of tafluprost ophthalmic solution elevated feline retinal blood flow . Moreover, in a rabbit model of disturbed blood flow induced by administration of endothelin-1 (et-1) into the vitreous, an improvement in blood flow was demonstrated with tafluprost.12 indeed, when latanoprost, travoprost, or tafluprost ophthalmic solution was administered 2 hours before the intravitreous injection of et-1, the disturbance of the retinal blood flow was significantly inhibited in all the groups . However, such a significant effect was observed only in the tafluprost - treated group when the same ophthalmic solutions were administered 4 hours before intravitreous injection of et-1 . This result suggests that the ocular blood flow - improving effect may be more prolonged with tafluprost than with latanoprost or travoprost . Regarding the mechanism responsible for the blood flow improvement, dong y et al13 noted that tafluprost relaxed rabbit ciliary artery smooth muscle, and that the relaxation was not dependent on endothelium - derived factors . Moreover, it apparently did not involve a reduction in agonist - induced ca influx or increased ca extrusion into the extracellular space . However, they did obtain evidence that the tafluprost - induced relaxation might be due, at least in part, to an inhibition of the capacitative entry of extracellular ca . Since we really do not have sufficient means of measuring blood flow in animal models and human eyes, the clinical relevance of improvement of ocular blood flow by pg derivatives including tafluprost should be verified in the future study . In a recent study, kanamori et al14 reported neuroprotective effects of tafluprost . In a rat model in which retinal ganglion cell apoptosis was induced by serum - removal or by glutamate exposure they also noted that in a rat model of optic - nerve crush, treatment with tafluprost ophthalmic solution increased the survival rate of retinal ganglion cells . Clinical studies on tafluprost have been carried out both in western countries1419 and in japan, in each case using preservativecontaining tafluprost preparations . Two phase i studies were conducted in england, one on healthy japanese men and one on healthy non - japanese men.15,16 the therapeutic concentration of tafluprost has been set at 0.0015% on the basis of results from phase ii dose - response study performed in japan . In japan, three phase iii clinical studies have been carried out using taflprost at that concentration (0.0015%). Incidentally, for the dosage and administration of this drug, it is indicated that it should be administered once daily (one drop / dose). Of the three phase iii clinical studies conducted in japan, one was designed as a non - inferiority study aimed at comparing the efficacy of tafluprost with that of latanoprost . In that study a randomized, single - blind comparative study involving 109 patients with primary open angle glaucoma or ocular hypertension (reference drug: latanoprost ophthalmic solution) the magnitude of the iop reduction in the tafluprost and latanoprost treatment group after 4 week administration was 6.6 2.5 mmhg (27.6 9.6%) and 6.2 2.5 mmhg (25.9 9.7%), respectively . Thus endorsing the noninferiority of this drug versus latanoprost (figure 6).20 moreover, the percentage of patients showing a reduction of 20% or more in iop was 80.4% in the tafluprost treatmentgroup against 70.6% in the latanoprost - treatment group . The second phase iii clinical study of tafluprost was designed as a long - term dosing study primarily aimed at evaluating its safety in prolonged use . In that study involving 351 patients with open angle glaucoma (including normotensive glaucoma) or ocular hypertension the magnitude of the iop reduction seen following treatment with tafluprost studied within the range 4.9 to 5.7 mmhg throughout the 52-week study period . Thus, this drug exerted its iop - lowering effect in a stable manner during prolonged use (see product overview: http://www.santen.co.jp/medical/common/pdf/info_package/tenpu/tapros.pdf). The third phase iii clinical study was designed as a comparative study aimed at evaluating the efficacy of tafluprost in patients with normal tension glaucoma . According to the results of the epidemiological survey of glaucoma in japan carried out in tajimi city, gifu prefecture in 2000 and 2001 (often referred to as the tajimi study), the prevalence of glaucoma at ages over 40 is 5% in japan, and normal tension glaucoma accounts for more than 70% of all glaucoma cases.21 to date, however, no iop - lowering agent has been shown in clinical trials to be effective against normal tension glaucoma (the most frequent type of glaucoma in japan). In unpublished randomized masked comparative study involving 94 patients with normotensive glaucoma (reference drug: placebo ophthalmic solution), the magnitude of the iop reduction in the tafluprost - treatment group was 4.0 mmhg (95% confidence interval: 3.5 to 4.5 mmhg), and this was significantly greater than that in the placebo - treatment group (figure 7). For tafluprost versus latanoprost, noninferiority was demonstrated by anova (and almost by ancova) in a phase iii, 24-month study in patients with open - angle glaucoma or ocular hypertension.17 in addition, the iop - lowering efficacy of tafluprost in adjunctive use with timolol demonstrated by egorov and ropo.18 a clinical equivalence between preservativefree and preservative - containing prescriptions has been reported both by uusitalo h et al19 in healthy volunteers, and by hamacher t et al22 in patients with glaucoma or ocular hypertension . Thus the penetration of tafluprost into the anterior chamber is apparently not affected by preservative benzalkonium chloride . At present, there are insufficient clinical data comparing tafluprost and other pg derivatives because of its short marketing history . Clinical studies on tafluprost have been carried out both in western countries1419 and in japan, in each case using preservativecontaining tafluprost preparations . Two phase i studies were conducted in england, one on healthy japanese men and one on healthy non - japanese men.15,16 the therapeutic concentration of tafluprost has been set at 0.0015% on the basis of results from phase ii dose - response study performed in japan . In japan, three phase iii clinical studies have been carried out using taflprost at that concentration (0.0015%). Incidentally, for the dosage and administration of this drug, it is indicated that it should be administered once daily (one drop / dose). Of the three phase iii clinical studies conducted in japan, one was designed as a non - inferiority study aimed at comparing the efficacy of tafluprost with that of latanoprost . In that study a randomized, single - blind comparative study involving 109 patients with primary open angle glaucoma or ocular hypertension (reference drug: latanoprost ophthalmic solution) the magnitude of the iop reduction in the tafluprost and latanoprost treatment group after 4 week administration was 6.6 2.5 mmhg (27.6 9.6%) and 6.2 2.5 mmhg (25.9 9.7%), respectively . Thus endorsing the noninferiority of this drug versus latanoprost (figure 6).20 moreover, the percentage of patients showing a reduction of 20% or more in iop was 80.4% in the tafluprost treatmentgroup against 70.6% in the latanoprost - treatment group . The second phase iii clinical study of tafluprost was designed as a long - term dosing study primarily aimed at evaluating its safety in prolonged use . In that study involving 351 patients with open angle glaucoma (including normotensive glaucoma) or ocular hypertension the magnitude of the iop reduction seen following treatment with tafluprost studied within the range 4.9 to 5.7 mmhg throughout the 52-week study period . Thus, this drug exerted its iop - lowering effect in a stable manner during prolonged use (see product overview: http://www.santen.co.jp/medical/common/pdf/info_package/tenpu/tapros.pdf). The third phase iii clinical study was designed as a comparative study aimed at evaluating the efficacy of tafluprost in patients with normal tension glaucoma . According to the results of the epidemiological survey of glaucoma in japan carried out in tajimi city, gifu prefecture in 2000 and 2001 (often referred to as the tajimi study), the prevalence of glaucoma at ages over 40 is 5% in japan, and normal tension glaucoma accounts for more than 70% of all glaucoma cases.21 to date, however, no iop - lowering agent has been shown in clinical trials to be effective against normal tension glaucoma (the most frequent type of glaucoma in japan). In unpublished randomized masked comparative study involving 94 patients with normotensive glaucoma (reference drug: placebo ophthalmic solution), the magnitude of the iop reduction in the tafluprost - treatment group was 4.0 mmhg (95% confidence interval: 3.5 to 4.5 mmhg), and this was significantly greater than that in the placebo - treatment group (figure 7). For tafluprost versus latanoprost, noninferiority was demonstrated by anova (and almost by ancova) in a phase iii, 24-month study in patients with open - angle glaucoma or ocular hypertension.17 in addition, the iop - lowering efficacy of tafluprost in adjunctive use with timolol demonstrated by egorov and ropo.18 a clinical equivalence between preservativefree and preservative - containing prescriptions has been reported both by uusitalo h et al19 in healthy volunteers, and by hamacher t et al22 in patients with glaucoma or ocular hypertension . Thus the penetration of tafluprost into the anterior chamber is apparently not affected by preservative benzalkonium chloride . At present, there are insufficient clinical data comparing tafluprost and other pg derivatives because of its short marketing history . The phase iii clinical trial of 4 weeks aimed at comparing to latanoprost revealed that the incidence of adverse reactions did not differ between those two treatment groups (40.0% and 48.1%, respectively, p = 0.443, fisher s exact test). N = 55), which was higher than that of latanoprost (13.0%, n = 54), but not significant . Of the total population studied in japan (483 patients), 326 patients (67.5%) showed adverse reactions to tafluprost ophthalmic solution 0.0015% (including abnormal changes in laboratory parameters). The most common adverse reactions reported were conjunctival hyperemia (151 cases, 31.3%), eyelash abnormalities (93 cases, 19.3%), itching sensation (85 cases, 17.6%), ocular irritation (65 cases, 13.5%), and iris pigmentation (39 cases, 8.1%). The adverse reactions were mild in more than 95% of all cases, and no severe adverse reaction was noted . Like the other pg derivatives, this drug requires particular care when used for aphakic eyes or intraocular lensimplanted eyes, in patients with bronchial asthma or a history of it, in patients with endophthalmitis (iritis, uveitis), or in pregnant, women, or lactating women, and so on . These adverse reactions by tafluprost were comparable to other new pg derivatives such as travoprost and bimatoprost . It contains 15 g tafluprost per ml, a concentration that is the lowest among the pg derivative preparations on the japanese market . It is a clear, colorless aqueous ophthalmic solution, with a ph of 5.7 to 6.3 and an osmotic pressure ratio of 1.0 to 1.1 . This product is intended to be stored at room temperature, and its expiration period is 3 years after manufacture . Hyodo et al24 reported that this container was highly praised in an evaluation of various indicators of the impressions of users, and that elderly patients (65 years old) could use it as easily as nonelderly patients . Thus, since this ophthalmic solution can be stored at room temperature and is supplied in a highly comfortable container, there is expected to be high adherence of patients to the dosing instructions . It contains 15 g tafluprost per ml, a concentration that is the lowest among the pg derivative preparations on the japanese market . It is a clear, colorless aqueous ophthalmic solution, with a ph of 5.7 to 6.3 and an osmotic pressure ratio of 1.0 to 1.1 . This product is intended to be stored at room temperature, and its expiration period is 3 years after manufacture . Hyodo et al24 reported that this container was highly praised in an evaluation of various indicators of the impressions of users, and that elderly patients (65 years old) could use it as easily as nonelderly patients . Thus, since this ophthalmic solution can be stored at room temperature and is supplied in a highly comfortable container, there is expected to be high adherence of patients to the dosing instructions . Tafluprost 0.0015% ophthalmic solution contains a new pg analogue with an iop - lowering activity and safety comparable to those of latanoprost . Since it can be stored at room temperature and is supplied in a container that patients find easy to handle, there is expected to be a high patient adherence to the dosing instructions.
Sleep disorders and diurnal sleepiness are frequent in parkinson s disease.1 polysomnography studies have shown rapid - eye - movement (rem) sleep dysregulation with rem sleep onset on diurnal naps2,3 and loss of muscle atonia,4 which is defined as excessive amount of sustained or intermittent elevation of submental electromyographic tone or excessive phasic submental or limb electromyographic twitching.4 loss of rem atonia is a core phenomenon of rem sleep behavioral disorder (rbd),5 a condition characterized by vigorous and injurious motor behaviors during rem sleep.6 the orexin system plays a key role in rem sleep regulation . The loss of orexin neurons results in narcolepsy - cataplexy, a condition characterized by severe diurnal sleepiness, rem sleep onset during daytime naps, and cataplexies . Rem sleep without atonia (rswa) and rbd have also been reported to occur in narcolepsy.7 orexin neurotransmission has been shown to be altered in parkinson s disease (pd).810 however, polysomnographic data were not available in these postmortem studies . Furthermore, we showed that ventricular orexin levels were not correlated with mean sleep latency, suggesting that orexin deficit might not be involved in daytime sleepiness in pd.11 thus, the clinical expression of orexin deficit in pd remains unknown.12 the objective of this study was to determine whether orexin - a levels in ventricular cerebrospinal fluid (csf) from pd patients were correlated with rem sleep without atonia . Consecutive patients with idiopathic pd13 who were scheduled for deep brain - stimulation neurosurgery were invited to participate in the study, irrespective of whether they had sleep complaints . We did not include patients taking medications known to affect sleep or rem atonia or patients with sleep apnea syndrome defined as an apnea / hypopnea index greater than ten per hour of sleep . Disease severity was assessed based on the motor subscore of the unified parkinson s disease rating scale iii after overnight withdrawal of dopaminergic treatment . The study was approved by the appropriate ethics committee, and informed consent was obtained from all patients prior to study inclusion . Sleep recordings were obtained during attended polysomnography 1 week before the scheduled date of neurosurgery . Polysomnography included electroencephalogram recordings (c4a1, c3a2, and o1o2 leads), two electrooculograms, one submental electromyogram (emg), and bilateral anterior tibialis emgs . Also recorded were nasal pressure, oral airflow, thoracic and abdominal movements, and pulse oximetry . Patients took their usual pd medications and were free to go to sleep when they wanted to . Sleep stages were scored by two sleep specialists who had extensive experience with recordings in pd patients (ab and xd), according to the modified american academy of sleep medicine criteria,14 with allowance for rswa . Rswa was scored as previously described by lapierre and montplaisir.16 tonic chin - muscle activity during rem sleep was defined as chin emg amplitude greater than twice the amplitude measured during a baseline emg signal for atonia . Phasic emg events were defined as any burst of activity lasting 0.35 seconds and having amplitude greater than four times the baseline emg signal . Tonic and phasic emg activities were scored from the submental emg signal per 3-second mini - epochs of rem sleep containing or not containing any emg activity (tonic, phasic, or a combination of both emg activities).17 we then reported loss of rem atonia as the percentage of rem sleep mini - epochs with any emg activity . Ventriculography performed to assist in the proper placement of an electrode in the subthalamic nucleus require the removal of csf just before the injection of the contrast agent into the ventricle . In each of our patients, 3 ml of ventricular csf was immediately frozen and stored at 80c until use for the orexin - a assay8 orexin - a (hypocretin-1) was measured in crude csf using a commercially available radioimmunoassay kit (phoenix pharmaceuticals, belmont, ca, usa). The detection limit was 50 pg / ml, and intra - assay variability was 5% . Correlations between orexin - a levels and sleep parameters were evaluated using spearman s rank - correlation test and the nonparametric mann - whitney test . Consecutive patients with idiopathic pd13 who were scheduled for deep brain - stimulation neurosurgery were invited to participate in the study, irrespective of whether they had sleep complaints . We did not include patients taking medications known to affect sleep or rem atonia or patients with sleep apnea syndrome defined as an apnea / hypopnea index greater than ten per hour of sleep . Disease severity was assessed based on the motor subscore of the unified parkinson s disease rating scale iii after overnight withdrawal of dopaminergic treatment . The study was approved by the appropriate ethics committee, and informed consent was obtained from all patients prior to study inclusion . Sleep recordings were obtained during attended polysomnography 1 week before the scheduled date of neurosurgery . Polysomnography included electroencephalogram recordings (c4a1, c3a2, and o1o2 leads), two electrooculograms, one submental electromyogram (emg), and bilateral anterior tibialis emgs . Also recorded were nasal pressure, oral airflow, thoracic and abdominal movements, and pulse oximetry . Patients took their usual pd medications and were free to go to sleep when they wanted to . Sleep stages were scored by two sleep specialists who had extensive experience with recordings in pd patients (ab and xd), according to the modified american academy of sleep medicine criteria,14 with allowance for rswa . Rswa was scored as previously described by lapierre and montplaisir.16 tonic chin - muscle activity during rem sleep was defined as chin emg amplitude greater than twice the amplitude measured during a baseline emg signal for atonia . Phasic emg events were defined as any burst of activity lasting 0.35 seconds and having amplitude greater than four times the baseline emg signal . Tonic and phasic emg activities were scored from the submental emg signal per 3-second mini - epochs of rem sleep containing or not containing any emg activity (tonic, phasic, or a combination of both emg activities).17 we then reported loss of rem atonia as the percentage of rem sleep mini - epochs with any emg activity . Ventriculography performed to assist in the proper placement of an electrode in the subthalamic nucleus require the removal of csf just before the injection of the contrast agent into the ventricle . In each of our patients, 3 ml of ventricular csf was immediately frozen and stored at 80c until use for the orexin - a assay8 orexin - a (hypocretin-1) was measured in crude csf using a commercially available radioimmunoassay kit (phoenix pharmaceuticals, belmont, ca, usa). The detection limit was 50 pg / ml, and intra - assay variability was 5% . Each csf sample was tested in duplicate . Correlations between orexin - a levels and sleep parameters were evaluated using spearman s rank - correlation test and the nonparametric mann - whitney test . We studied eight consecutive patients four males and four females whose clinical features are reported in table 1 . In all eight patients, surgery was performed under regional anesthesia between 10 am and 12 am . No patients or bed partners reported violent movements during sleep, although the spouse of patient #7 reported limb and body jerking . Orexin - a levels did not correlate with total sleep time (p = 0.23), rem duration (p = 0.45), or rem latency (p = 0.66). In contrast, orexin - a levels showed a significant positive correlation with the percentage of rem epochs without atonia, ie, percentage of 3-second mini - epochs classified as any (= 0.83, p = 0.027) (figure 1a). As previously described6,17 rswa is considered clinically significant when any submental emg activity was present for more than 18% of the total rem sleep duration . According to this criterion, four of our patients had rswa (#2, #3, #4, and #7). These four patients had higher median (interquartile range) orexin - a levels than the four patients with rem sleep atonia (235 pg / ml [215345] vs 94 pg / ml [44147]; mann whitney test p = 0.036, figure 1b). We studied eight consecutive patients four males and four females whose clinical features are reported in table 1 . In all eight patients, surgery was performed under regional anesthesia between 10 am and 12 am . No patients or bed partners reported violent movements during sleep, although the spouse of patient #7 reported limb and body jerking . Orexin - a levels did not correlate with total sleep time (p = 0.23), rem duration (p = 0.45), or rem latency (p = 0.66). In contrast, orexin - a levels showed a significant positive correlation with the percentage of rem epochs without atonia, ie, percentage of 3-second mini - epochs classified as any (= 0.83, p = 0.027) (figure 1a). As previously described6,17 rswa is considered clinically significant when any submental emg activity was present for more than 18% of the total rem sleep duration . According to this criterion, four of our patients had rswa (#2, #3, #4, and #7). These four patients had higher median (interquartile range) orexin - a levels than the four patients with rem sleep atonia (235 pg / ml [215345] vs 94 pg / ml [44147]; mann whitney test p = 0.036, figure 1b). Our results show a significant relationship between ventricular csf orexin - a levels and rem sleep characteristics in patients with pd . Despite the small number of patients our results suggest that orexin - a signaling may be associated with loss of muscle atonia during rem sleep in patients with pd . To our knowledge, this is the first study of potential correlations between ventricular csf orexin - a levels and polysomnographic data in patients with pd . We undertook this study to investigate the physiological significance of altered orexin neurotransmission in pd, which has generated controversy.12 the strength of our study is the use of ventricular csf . A previous study in pd patients found that ventricular csf orexin levels correlated with the number of orexinergic neurons.9 furthermore, while a lumbar csf study failed to report a significant correlation between orexin levels and disease severity in a large group of 62 pd patients,18 a significant correlation was reported with ventricular samples.8 the main limitations of our study are the small number of patients and the absence of control subjects . We excluded patients taking sleep - altering medications and emg activities concurrent with respiratory arousals,19 which may have further limited bias in our study . In our study, pd patients with higher ventricular csf orexin levels exhibited larger numbers of rswa epochs than did patients with lower orexin levels, suggesting that preserved orexin drive may be involved in loss of rem atonia . These results are congruent with experiments demonstrating that orexin neurons are strongly involved in muscle - tone control . Orexin neurons exert a facilitating influence on muscle tone, both directly via their projections on trigeminal motor neurons20 and spinal motor neurons21 and indirectly via the locus coeruleus neurons.22 orexin injections into the locus coeruleus increase muscle tone23 and interrupt pedunculopontine nucleus - induced muscle atonia.24 however, regulation of muscle atonia relies on complex relationships and interactions between the orexin system, the locus coeruleus (in which orexin facilitates muscle activity), and the pontine inhibitory area (in which orexin inhibits muscle activity). Our results contrast with those obtained in narcolepsy - cataplexy, in which orexin levels negatively correlated with rswa.25 however, narcolepsy - cataplexy and pd are two different diseases, and the process leading to orexinergic neuron loss is likely different . Orexin neurons are the primary target of an acute and specific neuronal aggression in narcolepsy, leading to a 90% reduction in the orexin neuron pool.26 in contrast, pd is a chronic, slowly progressive neurodegenerative disease, affecting primarily dopaminergic neurons, with a process not fully understood, leading to partial (23%60%) orexin neuron loss.10 as an illustration, no cataplexy has been reported in pd patients, even in patients with undetectable orexin levels.8,12 our results are also in contrast with a recent study that found similar orexin lumbar levels in five rbd patients.27 however, these patients had idiopathic rbd and no sign of pd . The loss of rem atonia in patients with higher orexin levels illustrates the complexity of the symptoms induced by altered orexin neurotransmission in pd.28 experimental trials of orexin antagonists could be of interest in the transgenic mouse model of rswa.
Transcutaneous electrical nerve stimulation (tens) is the application of an electric current through the skin to stimulate the nervous system . This type of electrical stimulation activates spinal afferent pathways that connect to spinal gray matter of the dorsal horn modulating sensory afferent traffic . The electric current stimulates the underlying fibers producing painless paresthesias without causing damage to the skin1, 2 . Its application technique varies depending on several parameters and can be divided into high frequency (50 hz) low intensity and low frequency (10 hz) high intensity tens, both of which are used to relieve both acute and chronic pain3,4,5 . Acupuncture is also widely used in clinical settings for the relief of pain caused by lower back injury, fibromyalgia, and headache disorders, among others . Uniting the technique of acupuncture analgesia with electrotherapy, with certain modifications, has created electroacupuncture which is used as a substitute for conventional acupuncture, and in cases where clinical acupuncture alone has noeffect5, 6 . Low frequency tens is also called acupuncture like tens, because it interacting with the peripheral nervous system eliciting a pricking sensation, that is modulated by the frequency of electrical stimulation, the current intensity and the pulse duration . To present this kind of sensation, the procedure differs from classical electroacupuncture, as it does not use needles, only electrodes with a high intensity of the electrical current7,8,9 . Currently, several terms are used to describe the transcutaneous electrical stimulation of acupoint . For example: acu - tens (tens applied to an acupoint) and teas (transcutaneous electric acupoint stimulation) that involves any electric current applied to acupoints10 . In this study, two different areas of electrodes, 1 cm and 15 cm, te5 (waiguan) and pc6 (neiguan) acupoints . According to chinese traditional medicine stimulation of the te5 acupoint is indicated for arthritis in the wrist and finger joints, and that of the acupoint pc6 is indicated for pain in the forearm, carpal tunnel, and wrist, median nerve palsy, and pain and contracture in the elbow and arm . This study analyzed whether the areas of electrodes elicit different effects . When tens is applied to acupoints frequency of 10 hz with sufficient intensity to promote muscle jerks . The latency of the pain threshold and its intensity in healthy subjects subjected to cold - induced pain was measured . This was a single - blind, quasi - experimental study with a control and placebo . Forty - eight subjects (convenience sample) were recruited from the departmental centres of the university federal of pernambuco (ufpe). They were divided into three groups of 16 subjects, composed of both sexes aged between 18 and 30 years . The groups were formed by the allocation of the subjects who were verbally invited to particpate and sent to the laboratory . All of the participants provided their written informed consent . After reading and accepting the terms of the study, subjects were allocated to three groups: the 1 cm electrode group, the 15 cm electrode group, and the placebo group . The subjects were allocated by raffle in blocks of four to each group in succession . During the period of experimentation subjects showed no pathological state in the region subjected to cold - induced pain, did not use allopathic and/or homeopathic drugs, showed no intolerance or phobia at low temperatures, and the female subjects, were not in a state of pre - menstrual tension or menstrual flow . All experiments were performed in the laboratory of electrothermy at the department of physical therapy of the federal university of pernambuco . The first experimental group (8 males and 8 females) was stimulated by acupuncture like tens on the te5 and pc6 acupoints with 1 cm electrodes; the second experimental group (9 males and 7 females) was also stimulated by acupuncture like tens on the same acupoints with 15 cm electrodes; and the placebo group (10 females and 6 males) were told they were receiving microcurrent stimulation of the deltoid muscle with a 15 cm electrode . The study received approval from the university federal of pernambuco s research ethical committee, under the registration of sisnep fr-294607, caae-0315.0.172.000 - 9 based on resolution 466/12 national health council . The experimental intervention consisted of three stages (six cycles) which were termed pretreatment time (cycles 1 and 2), treatment time (cycles 3 and 4) and post treatment time (cycles 5 and 6). Each cycle lasted ten minutes, making a total of one hour trial . In the first cycle, subjects put their non - dominant hand in a container of warm water (37 c) for five minutes . The temperature was maintained by an electrical water heater and constant measurement by mercury thermometer incoterm - l 212/04 . This procedure aimed to equalize the temperature of the hand of all subjects before the procedure of cold - induced pain . After this, the hands were removed from the container and placed into another with icy water 02c (control performed by the mercury thermometer incoterm - l 212/04). The time to pain threshold from when the individuals put their hands into the icy water to the moment when they expressed pain was measured in seconds by digital stopwatch (cronobio sw2018). The subjects were asked to keep their hands in cold water for thirty more seconds, during this time (depending on the tolerance) they were asked to describe the painful sensation using a visual analog scale (values from 0 to 10, where 0 corresponds to no pain and 10 refers to the maximum tolerable pain) to assess pain intensity . After this they were allowed to take their hands out of the icy . After a rest interval, that varied among the individuals, butwas short enough to complete half the period of the last five minutes of the first cycle, the subjects again put their hands for 5 minutes in warm water, beginning the second cycle, followed immersion in cold water . Procedure was repeated, completing two cycles of cold - induced pain, with pretreatment time, lasting twenty minutes . In the third cycle after wiring for tens, subjects again put their hands into the warm water for five minutes, and then into the container with cold water . The time to the pain threshold and pain intensity were measured, and the procedure was repeated for a fourth cycle, twenty minutes of tens application in total . Acupuncture - like tens (10 hz) was delivered with a balanced, asymmetrical, biphasic pulsed current (tensys et9771 kld) of 1 ms (millisecond) pulse duration, with sufficient intensity of electric current to cause muscle jerks when placed over the te5 and pc6 acupoints, located two from the wrist crease, on the posterior and anterior forearm, respectively . To standardize electrical stimulation the cathode was placed on the te5 and the anode on the pc6 acupoints . The electrical stimulation of acupuncture - like tens was pervormed with 1 cm and 15 cm electrodes . At the end of the treatment period, the subjects were subjected to two more cycles, the fifth and sixth following the same method described above, to evaluate the effect of tens post - treatment (tens off). In the placebo group, subjects were subjected to the same procedure of the cold - induced pain test (pre - treatment, treatment and post - treatment), but the electrodes were placed on the shoulder (without connection to any acupoint) on the belly of the anterior deltoid muscle and the individuals were told that they were receiving a microcurrent treatment, in which they would not feel any sensation . They were told that the microcurrent works with very low intensities, was imperceptible, and had a painkilling effect . They were connected to the first channel of the equipment, and the second channel was connected so that the lights on the device certified that the current was supposedly operating . However the data of the latency of the pain threshold are presented as the mean standard deviation (sd). The results of pain intensity are presented as the average scores on the visual analog scale (vas). The latency of the pain threshold between cycles within each group was examined using repeated measures one - way anova and the post hoc newman - keuls test . For the pain intensity, the analysis between cycles within each group was performed using the friedman test . The groups pain threshold latencies were compared one - way anova followed by, post hoc newman - keuls test, when necessary . The effect size was calculated using cohen s d formula to investigate the clinical significance . A acupuncture - like tens with electrodes with an area of 1 cm showed effects on the pain threshold latency during application, while acupuncture - like tens with 15 cm electrodes showed effects after tens application . The placebo group showed no significant changes in any experimental phase (table 1table 1.the latency threshold (seconds) of pain in the different periods of acupuncture tens with electrodes of 1 cm, 15 cm, and placeboelectrodespretreatmenttreatmentposttreatment1 cm30.9 8.945.78 11.8 * 39.5 11.615 cm25.5 7.732.0 12.936.3 13.0placebo25.2 10.725.2 7.622.4 7.4anova and post hoc newman - keuls . Results expressed in mean sd (seconds) significant difference from pre - treatment the intensity of pain was reduced during tens treatment with 1 cm electrodes both in relation to the time before treatment and after treatment (table 2table 2.pain intensity in the different periods of acupuncture - like tens with electrodes 1 cm, 15 cm, and placeboelectrodespretreatment(mean ranks)treatment(mean ranks)posttreatment(mean ranks)1 cm2.91.1*2.0 15 cm1.32.6 * 2.1placebo2.12.11.7friedman test . * significant difference from pre - treatment . * * significant difference from pre - treatment and post - treatment). With the 15 cm electrode the sensation of pain increased in relation to the time before treatment . In the placebo group * significant difference from pre - treatment . * * significant difference from pre - treatment and post - treatment table 3table 3.pain threshold latency (seconds) of the groupsplacebo1 cm15 cmpre - treatment22.4 7.425.2 10.725.2 7.6treatment39.5 11.6 * 30.9 8.945.8 11.8*post - treatment36.3 13.0 25.5 7.732.0 12.9anova and post hoc newman - keuls . * significant difference from the placebo group at pre - treatment . * * significant difference between the 15 cm group and placebo group shows the results of the pain threshold latency times of the groups . During the treatment, the 1 cm electrode group showed a longer pain threshold latency than the other two groups . After treatment the tens groups (1 cm and 15 cm) electrodes showed pain threshold latencies longer than the placebo group . * significant difference between the 15 cm group and placebo group the effect size (cohen s d) with 1 cm electrodes was d = 0.98 pain and of 15 cm was d = 0.88 for the pain threshold latency time and respectively d = 0.96 and d = 0.91 post - treatment pain threshold latency time . To induce experimental pain without causing tissue injury we used a model called the cold pressure test, also known as the cold - induced pain test . In this model pain is induced through local hypothermia, since low temperatures (04c) cause to painful sensations through both vasoconstriction11, 12 and the activation of thermal nociceptors (a- and c fibers) that signal potential tissue damage . This information is sent via the peripheral and central pathways to the somatosensory cortex11 . This information of pain has different representations in the cerebral cortex, a sensory version and a psychological one, that might be interpreted in this experiment as the pain threshold latency and pain intensity, respectively13 . This is due to the characteristics of electric current, that has low frequency and high intensity, activating the supra - segmental pathways of -endorphin and met - enkephalin14 . We found that the low frequency, high intensity tens was bearable, and prolonged the pain threshold latency in the acute phase, and that prolongation of the pain threshold latency was dependent on the size of the electrode . A previous study15 demonstrated that analgesia of 80 hz tens for pain induced by mechanical which was measured subjectively by subjects pressure was by increasing the intensity of electrical current . The frequency and pulse duration are also parameters that influence analgesia16 . In our study, it was found that the size of the electrode and its location affected analgesia . Initially, a high threshold of stimulation was required for both electrodes at the respective coupled acupoints, that are distal from the muscular motor points of the forearm, and required high intensities to promote muscle twitch and sting sensation . A functional magnetic resonance imaging study of healthy subjects subjected to cold - induced pain, and demonstrated that the periaqueductal gray, the superior frontal gyrus, anterior cingulate cortex, thalamus, left insula, right inferior frontal gyrus and left inferior temporal gyrus were activated17 . These structures are related to the perception of the pain threshold, but not pain intensity . These structures are also activated when stimuli acupoints, by needles or by transcutaneous electrical current18 . As the action of acupuncture - like tens with 10 hz was relatively rapid at prolonging the pain threshold latency, during or after application, it suggests that it acts directly on a- and c fiber, promoting action potentials in them . This would have served as a mechanism of segment concurrence, which is usually seen as fibers a- mediating the stimulation of high frequency tens . When the painful stimulus of low temperature triggered the a- and c fibers they were already receiving electrical stimulus, leaving them less responsive to the cold stimulus . Its influence on the pain threshold latency during and after tens application, may be due the concentration of the stimulus in the receptive field of the nerve endings being stimulated by electrical current, the smaller electrode focused on the acupoints, while the larger electrodes encompassed this area and most of the surrounding regions . These acupoints are stimulated by needles, classically, and they have a large concentration of mechanical stimuli in their areas . Studies have shown that acupoints located in the areas of dermatomes, myotomes and sclerotomes which are pain afferents, are more effective than acupoints which are distant from them18, 19 . In the placebo group, which received no electrical stimulation, no statistical differences were observed among the pre-, and during-, and post - treatment periods . Table 3 compares the pain threshold latencies of the groups . During tens treatment, the 1 cm electrode group showed significant differences from the other two groups . This result corroborates the hypothesis that the concentration of eletrical stimulus in a small area is more effective than that over larger areas . Acupuncture points have intrinsic neuronal properties, as well as increased conductance, low impedance, and high electric potential compared to other locations . It has been suggested that the meridians are more a functional concept than anatomical, a multiple system incorporating the physiological, neurological, endocrine and immune systems9 . The values show that the 1 cm electrode group showed a reduction in pain intensity during the tens treatment compared to pretreatment, while the 15 cm electrode group showed an increase in pain compared to pretreatment . As mentioned above, the pain threshold latency and pain intensity are mediated differently by the central nervous system11 . Another study14 applied tens to the li4 (he - gu) and pc6 (neiguan) acupoints of subjects submitted to cold - induced pain with a current intensity of 3 ma, pulse duration of 300 s and frequency of 4 hz, and noted a reduction in pain intensity relative to a placebo group over periods of 30 to 170 seconds of cold - induced pain . Some other studies1, 20 have also reported significant changes in pain intensity with electroanalgesia, while, others11, 21, 22 have reported that the intensity of pain showed no significant change with the use of tens . Items that differed in these works were the experimental pain models, parameters of electrical stimulation, location of the electrodes and the number of subjects involved in each experiment, as well as the recruitment and randomization methods . Another controversial point is the measurement of pain using the visual analog scale since, even though it is widely used and accepted, its results tend to be contradictory . The 15 cm electrode group showed an increase in the sensation of pain intensity, rather than a reduction, during the tens treatment, but there was no significant difference in the timeof the pain threshold latency . In the case of the 1 cm electrode, the result was consistent . The intensity of pain is subjective measure which depends on the interpretation and previous experience of each individual . This may cause some confusion at the time of assessment, making it impossible to compare the results of pain intensity between groups . We suggest that as well as the measurement of pain intensity using the vas scale, some objective form of measurement is also used, such as the pain threshold latency, measurement of the conduction velocity of nociceptive fibers . The effect size, as calculated by cohen s d, of the 1 cm electrode group showed a percentage ranging from 88% to 98% when compared to the other groups, indicating that the 1-cm group, during the tens treatment, had this percentage of individuals with higher values than their respective control . At post - treatment the percentage was 9196% compared to the placebo group . This demonstrates there was a clinically significant difference between the 1 cm group and the placebo group . In the literature, we could find no other references reporting statistically significant results for this type of treatment . Our findings support the view that acupuncture - like tens at 10 hz frequency, applied to pc6 and te5 acupoints with the parameters described above, increases the pain threshold latency during tens treatment with 1 cm electrodes and post - treatment with 15 cm electrodes . The pain intensity was reduced during tens treatment when applied to the acupoints with an electrode area of 1 cm . The effect size calculations show that tens applied to these acupoints were clinically significant . The combination of acupuncture - like tens and acupoints is a treatment choice for acute pain in the hand region.
Tetralogy of fallot (tof) is the most common form of cyanotic congenital heart disease . Impairment in exercise tolerance after total repair of tetralogy of fallot has been frequently reported and speculated to be due to variable causes including residual right ventricular outflow tract (rvot) obstruction, branch pulmonary artery stenosis, pulmonary insufficiency, pulmonary pathology, and chronotropic incompetence . Pulmonary regurgitation (pr) has been shown to be related to the use of transannular patch during rvot reconstruction and aggressive infundibulectomy involving the pulmonary valve annulus . Adverse effects of pr include progressive dilatation of rv, reduced exercise capacity, arrhythmia, and sudden death . A number of children have premature ventricular beats after repair of the tetralogy of fallot . These beats are of concern in patients with residual hemodynamic abnormalities; 24-hr electrocardiographic (holter) monitoring studies should be performed to be certain that occult short episodes of ventricular tachycardia are not occurring . Exercise studies may be useful in provoking cardiac arrhythmias that are not apparent at rest . The aim of this study was to assess the exercise performance of young patients following the repair of tetralogy of fallot and to assess the influence of different variables related to the surgical repair on exercise testing . This study was carried out at the children's hospital, pediatric cardiology department, ain shams university in the period from march 2008 to february 2010 . It included 21 patients operated on for tetralogy of fallot compared to 15 healthy age- and sex - matched children . All patients underwent total correction for tof at ages ranging between 2 and 10 years . Total correction was performed by closing the vsd and reconstruction of the rvot via either transatrial - transpulmonary or right ventriculotomy approaches . All patients were subjected to twelve - lead ecg to comment on rate, rhythm, p wave, axis, qrs duration, bundle branch block, and chamber enlargement . M mode, two - dimensional, and color doppler echocardiographic examination using ge health care ultrasound vivid 7 was done for all patients to comment on pulmonary valve regurgitation or residual stenosis, branch pulmonary arteries, right ventricular size, and function, residual vsd and leak across, movement of ivs, left ventricular function, and other associated cardiac anomalies . Exercise stress testing was performed by using a schiller mtm-1500 treadmill using the modified bruce protocol . The resting ecgs of all patients revealed normal sinus rhythm and rbbb, 16 patients with complete rbbb, and 5 patients with incomplete rbbb . Qrs durations were prolonged but less than 180 msec in 19 patients, and more than 180 msec in only 1 patient . Echocardiographic examination showed variable degrees of pulmonary regurge in 20 patients (95%); severe pr in 12 patients, moderate pr in 2 patients, and mild pr in 6 patients . There was abnormal right ventricular dilation in 5 patients (23.8%) detected by 2d echo . Residual vsd was detected in 2 patients and branch pulmonary artery stenosis in 5 patients . Three patients (14.2%) developed exercise - induced uniform infrequent pvcs during stress testing . Sustained ventricular tachycardia was not detected in any patient . While infrequent pvcs developed in 2 control subjects (13.3%). Only one patient (4.7%) of the study group developed exercise - induced complete heart block (chb) as detected by stress testing . There was no statistical significant difference between cases and control as regards the work time . Cases showed lower work stage and time, but the difference did not reach a significant level p = 0.10, 0.22 . While they showed significantly lower max sbp, max hr, max mets, and% of mets when compared to control p <0.05 as shown in table 1 . Cases with aortopulmonary shunt showed significantly lower work time, work stage, and max mets when compared with those without aortopulmonary shunt p <0.05 . As shown in table 2 . Surgical correction of tof is directed at relieving all possible sources of right ventricular outflow tract obstruction . If anatomically and surgically possible, pulmonary valve function is preserved by avoiding a transannular patch . Palliative aortopulmonary shunt procedures are performed prior to total correction to increase pulmonary blood flow in severely cyanotic infants . Numerous 20 to 30 years follow - up studies have documented the excellent clinical results of surgical repair of tof . However, the nature of the repair leaves each patient with some degree of excessive hemodynamic burden because of residual defects, valvular abnormalities, or myocardial factors . Resting ecgs of all patients revealed normal sinus rhythm and rbbb, 16 patients with complete rbbb, and 5 patients with incomplete rbbb, whereas no conduction disturbances were shown in the control group . This was in accordance to sarubbi et al . Who assessed the exercise capacity in young patients after total repair of fallot tetralogy and found that all the patients presented complete rbbb, whereas no conductance disturbances were shown in the control group . Patients with repaired tof frequently have right bundle - branch block with greatly prolonged qrs duration, usually attributed to the effects of cardiac surgery and this electric abnormality has been recognized not only as a risk factor for sudden cardiac death in these patients but also as a contributor to rv dysfunction . In our study pulmonary regurgitation was observed in 20 patients (95%), 12 of them (57%) had severe pr and 8 (38%) had mild - to - moderate pr . This is in accordance to eyskens et al . Who found that all patients had variable degrees of pulmonary regurgitation on standard echocardiography after total correction of tof . Pulmonary regurgitation has been attributed to the use of transannular patch during rvot reconstruction and aggressive infundibulectomy involving the pulmonary valve annulus . Adverse effects of pr include progressive dilatation of rv, reduced exercise capacity, arrhythmia and sudden death . Our study showed no statistical significant difference between cases and control as regards the work time . Cases showed lower work stage and time but the difference did not reach a significant level . The maximal work time served as a criterion of exercise capacity when maximum o2 consumption cannot be measured . This result showed that exercise capacity in patients undergoing surgical repair was generally good as compared with matched control subjects . This was in accordance to pietrucha and rudzinski who assessed the exercise capacity in 23 patients after surgical correction of tof (21 males and two female) with mean age 14.9 2.9 years and 27 patients without any cardiac disorder (19 boys, 8 girls) age- and sex - matched and found that workload achieved by patients after tetralogy of fallot correction was comparable to healthy subjects . Found that intermediate - term exercise performance in patients who underwent primary complete repair of tof in early childhood was nearly normal . Several previous studies observed an association between pulmonary regurgitation and exercise impairment in the form of decreased exercise time, vo2 max and maximum achieved mets when compared with normal control subjects during exercise stress testing . In our study, this relationship was not detected . However, our results are similar to samman et al . Who were unable to demonstrate a relationship between the degree of pulmonary regurgitation and exercise capacity in patients with repaired tetralogy of fallot and ascribed these contradictory finding to the different methods used to measure the degree of pulmonary regurgitation in these studies in comparison with their study . Also our results are in accordance to geva et al . Who found that pr degree . Found no correlation between the presence or degree of pulmonary regurgitation and its effect on exercise capacity after tof repair . As shown in our study, there was no relation between the degree of pulmonary regurge and the exercise capacity in short term followup . As impaired exercise tolerance after tof repair as detected by exercise stress testing (decreased work time, work stage, max hr, and max achieved mets when compared with control subjects) is multifactorial in origin; patients with severe pulmonary regurge may have cardiovascular compensation with good chronotropic response to exercise while those with mild or no pr may have other causes that impair their exercise tolerance as chronotropic incompetence and lack of physical fitness . In the present study, cases with previous aortopulmonary shunt showed significantly lower exercise indices when compared to those without previous aortopulmonary shunt . Study who found that prior aortopulmonary shunt procedures were not associated with reduced exercise performance after tof repair . Impaired exercise performance in the patients with previous aortopulmonary shunts might be due to sever tof that necessitated the performance of a shunt . Moreover, palliation by means of an aortopulmonary shunts that had been initially performed, leading to changes in the pulmonary vascular system, which is pathologically altered and can in turn, negatively affect exercise capacity . We discovered that only one patient (4.7%) of our study group developed exercise - induced complete heart block (chb) as detected by stress testing . The chb revealed by his exercise test probably contributed to the growth impairment of that child . Exercise tolerance after total correction of fallot tetralogy is slightly impaired on short - term followup . Thus abnormal cardiac function and haemodynamic abnormalities secondary to pr and residual defects appear after longer periods of followup . Patients with previous aortopulmonary shunts showed lower exercise performance when compared to those without previous aortopulmonary shunt . The present study did not reveal any serious ventricular arrhythmias since it is seen in those patients with the longest period of follow up . Postoperative exercise testing in patients with tof can unmask a complete heart block that was not elicited by the standard 12-lead ecg recording.
Since its original description by mc burney in 1894, appendectomy has been one of the most common surgical procedures performed by surgeons . In the last decades, laparoscopic appendectomy was an increasingly accepted treatment method for acute appendicitis, particularly for obese or female patients . Natural orifice transluminal endoscopic surgery (notes) is a new approach that allows for minimal invasive surgery through the natural orifices such as mouth, anus, or vagina . Less incision on the abdomen helps to reduce surgical pain, analgesic requirement, recovery time, hernia formation, intra - abdominal adhesion, and surgical site infection . However, notes has several disadvantages and limitations with the currently available instruments, including limited access and less familiar working angles and operative views . In the past few years this study aimed to summarize the recent clinical appraisals, feasibility, complications, and limitations of transvaginal appendectomy for humans and to outline techniques . Electronic searches in december 2013 of the pubmed / medline, cochrane, google scholar, and ebscohost - academic search complete, including cinahl, used the key words [(vaginal or transvaginal) and (appendectomy or appendectomies or appendicectomy or appendicectomies)]. All the studies including congress proceedings and abstracts that describe the clinical course of patients were accepted for the analysis . Two reviewers (mehmet ali yagci and cuneyt kayaalp) assessed the list of titles and/or abstracts of the scanned articles at pubmed / medline and cochrane using the key words in a function of [all fields]. If the articles met our inclusion criteria, full - text versions were obtained for assessment . If the articles were obviously irrelevant to the aim of this systematic review, they were excluded . Additional studies were also excluded due to their content (editorial letters, reviews, experimental studies, duplicated studies, technical notes not including patient data, and survey studies including questionnaires). After pubmed and cochrane searches, we scanned the ebscohost - academic search complete and google scholar databases with the same key words but using the [title] function . If any additional studies were found, they were added to the first search results . The unpublished, potentially relevant, trials at the registered trials database at https://www.clinicaltrials.gov/ were searched as well . The references of the selected relevant articles were cross checked to decrease the possibility of missing publications . Transvaginal appendectomy was defined as a way of natural orifice translumenal endoscopic surgery for the appendix . All the patients were included, irrespective of age, region, race, obesity, comorbidities, or history of previous surgery . No restrictions were made on language, country, or journal . In cases of disagreement during the study selection and analysis data for affiliation, number of the patients, age, clinical findings, inclusion and exclusion criteria, body mass index, history of previous abdominal surgery, trocar sites (pure or hybrid) and types, scope site and types (flexible or rigid), vaginal access and colpotomy closure techniques, intraoperative and postoperative complications, operating time, conversion to conventional laparoscopy or open surgery, postoperative pain, length of hospital stay, time off work, long term sexual function, and cosmetic satisfaction were recorded . A computer program including spreadsheet was used for records (excel 2013, microsoft windows). If there were any missing data, we tried to contact the authors via e - mail . Data were tabulated in tables, and column sums were created with the numbers or the means standard deviations, or the ranges of relevant parameters . When studies reported the median and range, we estimated the mean and standard deviation using the method described by hozo et al . . Basic calculations were used for the total numbers of the dichotomous outcomes and weighted means with ranges for the continuous outcomes . Chi - square test or the fisher exact test (if expected values were less than 5) and student's t - test were used for statistical analysis of both dichotomous and continuous variables (spss 13.0). A total of 154 articles were retrieved from the pubmed / medline database and no additional study was available in the cochrane library . After the elimination of the 96 irrelevant studies, google scholar, ebscohost - academic search complete, https://www.clinicaltrials.gov/, and reference cross - checking defined 26, 17, 6, and 2 studies, respectively (figure 1). After the elimination of repetitive studies in several databases or sources, seven studies were added to the previously selected 58 articles . Studies including inadequate patient data, concomitant hysterectomy, experimental studies, and duplicated data were eliminated and finally 13 articles [315] were selected for the analysis (figure 1). Two studies [10, 11] belonged to the same clinical series and their data were complementary (early and late results). As a result, we analyzed 12 clinical studies contained in 13 articles . Some studies had duplicated results [1622] and their latest or the most comprehensive versions were accepted for the analysis [6, 1013]. There were a total of 112 transvaginal appendectomies . Studies originated in europe, north / south america, and asia, and two of them included international multicenter data [6, 13]. Publications were generally (11/13) in english but one was in german, and one was in japanese . The patients' ages were generally in the mid - twenties or mid - thirties; however, there was a large age range (1874 years). All the patients were in the american society of anesthesia (asa) i - ii scores . A diagnosis of complicated appendicitis (perforation, abscess, and mass) was usually an exclusion criterion . Kg / m) were also excluded, and the mean body mass index of the patients in this systematic review was 23.2 kg / m (table 2) [4, 79, 13, 14]. Previous abdominal or pelvic surgery was not an exclusion criterion in all studies and 11% of the patients had a history of abdominal or pelvic surgery [9, 15]. Most of the cases (96%) were of acute appendicitis, while others (4%) were chronic appendicitis or incidental appendectomies . Four of them were intraoperative complications: appendicular artery hemorrhage (n: 3) and inability to sustain the pneumoperitoneum (n: 1). Those cases required additional abdominal trocar access and were accepted as a conversion to conventional laparoscopy (3.6%), but no case required conversion to open surgery . Postoperative complications occurred in five patients and all were treated by nonsurgical methods (table 3). Intra - abdominal abscess, urinary retention, urinary infection, and dyspareunia were treated by percutaneous drainage plus antibiotics, foley catheter placement, antibiotics, and just waiting, respectively . The mean length of hospital stay was longer in the german series (3.4 days) because of their national health system, [3, 9], and the mean length of hospital stay was 1.25 days for the rest of the studies . Some studies used only the transvaginal access, called a pure or totally transvaginal appendectomy . Others used an abdominal assistance (usually a 5 mm umbilical trocar) to the transvaginal access and are called a hybrid technique (table 4). Pure transvaginal appendectomy was performed on only 22% of the cases and the remaining were hybrid procedures (78%). When we compared the operating time and the complications for both techniques, there were no differences . The operating times for pure [4, 10] and hybrid [5, 9, 1215] techniques were 48.3 11.8 minutes and 49.6 25.5 minutes, respectively (p = 0.83). Complication rates for pure [3, 4, 10] and hybrid [5, 79, 1215] techniques were 19.0% and 5.5%, respectively (p = 0.09). Some authors used flexible endoscopes (20%) and others preferred rigid laparoscopes (80%). Operating times with flexible endoscopes [4, 5, 12, 13] and rigid laparoscopes [9, 10, 1315] were 71.9 13.3 minutes and 45.2 21.6 minutes, respectively (p = 0.0007). Complication rates for using flexible [35, 8, 12, 13] and rigid [7, 9, 10, 1315] scopes were 0% and 11.4%, respectively (p = 0.33). Transvaginal appendectomy during vaginal hysterectomy was first described in 1949 and, at the time, was performed by the gynecologists with the aim of incidental appendectomy [6, 23]. Those studies did not include the acute appendicitis cases and their primary objectives were the treatment of gynecological pathologies, not the appendix . In 2008, the first transvaginal appendectomy without vaginal hysterectomy was reported by palanivelu and coworkers from india and after a short period of time three more cases were reported one from germany and two from georgia . Interestingly, these first three separate reports of transvaginal appendectomies all described the totally transvaginal (pure) technique using only an endoscope [3, 4, 22]. In those cases, there was no abdominal trocar for assistance, nor was there any other transvaginal equipment except endoscopes . Transection of the appendixes was done with scissors [3, 4] or snares through the endoscopic channels . All the specimens were removed with the help of the endoscope and no extraction bags were used . Reported that, before the first successful case, they experienced three prior conversions to conventional laparoscopic appendectomy due to technical difficulties with this pure endoscopic technique . Bernhardt et al . Used the same technique and reported that their case was not an acute appendicitis, but a recurring subacute appendicitis . We can conclude that, despite its minimal invasiveness, technical difficulties limit the application of the pure transvaginal technique to highly selected cases . But for now, this analysis revealed that this earliest described transvaginal appendectomy technique was the least commonly preferred one relative to others subsequently described . Another technique for pure transvaginal appendectomy was reported using the placement of a single incision laparoscopic surgery (sils) port into the incised posterior vaginal fornix . The authors preferred a 5 mm 30 rigid telescope and two working ports (5 mm and 12 mm) on the sils port . They divided the mesoappendix with a stapler or an energy device and the appendix was likewise divided with an endoscopic stapler . They reported almost half the operating time (mean 44.4 minutes) of the previously described endoscope - only pure transvaginal appendectomy . Although this new technique seemed more adaptable to daily surgical practice, the authors warned that the sils port was inadequate as it was too short, which made placement difficult . They concluded that there was still room for innovation in the development of the technique . This analysis pointed out that hybrid procedures with umbilical port assistances were more common (72%) than the pure transvaginal techniques . Hybrid techniques had some advantages over pure ones, such as safer transvaginal introduction under direct vision, transumbilical view when necessary, and two directional working in the abdominal cavity . A hybrid procedure was started with pneumoperitoneum via a veress needle at the umbilicus and a 5 mm trocar was inserted via the umbilicus to inspect the abdominal cavity . After that a vaginal trocar (1015 mm) was placed at the posterior fornix of the vagina . An additional working port was created in three different ways in the studies: (i) the channel of the laparoscope was used; (ii) a second 5 mm trocar was inserted from the posterior fornix; or (iii) a second 2.3 mm trocar was placed through the umbilicus . Using a flexible endoscope instead of no clear benefits of flexible endoscopes over the rigid scopes were seen in this systematic analysis . Transferring the surgeons from open surgery to laparoscopic surgery provided the patients with a more comfortable postoperative course and a more rapid recovery . However, its benefits on postoperative pain and patient recovery were not as amazing as in the previous transfer from open to laparoscopy . A recent meta - analysis found no difference on postoperative pain and length of hospital stay between the single port and the multiport laparoscopic appendectomies . Natural orifice surgery is a novel technique that can have a positive influence on postoperative pain and recovery . An important drawback of this technique may be the unfamiliarity of the access to the abdomen for surgeons who are generally familiar with abdominal incisions or transanal surgeries . A second point that may keep surgeons away from this technique this systematic review demonstrated that, from the technical point of view, the equipment required for transvaginal appendectomy was not too distinct from the well - known existing conventional laparoscopic appendectomy equipment . There was no need for special equipment such as long trocars or flexible endoscopes . Only two studies compared the results of transvaginal and conventional laparoscopic appendectomies [9, 10]. Despite the limited number of the patients in those studies, there was a trend towards shorter hospital stays [9, 10], quicker recovery, and less analgesic requirement for the transvaginal groups (table 5). Recent meta - analyses including thousands of conventional laparoscopic appendectomies demonstrated that the wound infection rate was 3.34% and the length of hospital stay was 1.92.9 days [24, 25]. When compared to those results, this systematic review demonstrated that transvaginal appendectomy can be a rational alternative to conventional laparoscopic appendectomy in selected patients . It has very low wound infection rates (zero in this study) and short hospital stays (mean 1.9 days). Today first, there is not enough data of this technique for the morbidly obese patients . There is a considerable amount of obese people in the western countries and transvaginal appendectomy studies are necessary including morbid obese patients . We believe that minimal invasive surgeries like transvaginal appendectomy can have a place for the morbid obese patients in future . Secondly, the risk of delving into the cultural sensitivity of using the vagina as an access point, particularly in third world countries can be a limitation . This can be a problem even in the most promiscuous cultures where virginity still runs some amount of the population . As a conclusion, appendectomy is one of the most common emergency visceral surgical procedures . The early results of transvaginal appendectomy in this systematic review show some promise for improved postoperative pain and patient recovery . Using hybrid techniques with rigid laparoscopes may provide an easier adaptation for surgeons to this novel appendectomy method . For now, transvaginal appendectomy looks suitable for nonmorbid obese patients (bmi <35) and noncomplicated appendicitis . Of course, its potential advantages and disadvantages will become clearer in the future with comparative studies . More studies are also necessary on the role of transvaginal appendectomy in some subgroups like morbidly obese patients or perforated appendicitis.
Breast cancer screening programmes are now an established part of the health care service of many countries . The continuous evaluation of this practice is based on observational studies, leading to the possibility of confounding and self - selection bias . To assess the effect of screening, breast cancer mortality in both screened and not screened women has to be compared; this can be looked upon as the relative risk (rr, or rate ratio) of breast cancer mortality . Confounding bias of the rr occurs when the prevalence of a risk factor (or set of risk factors) for breast cancer death is imbalanced across the compared groups . To adjust for the confounding effect, the prevalence of the risk factor(s) has to become similar in both groups . Usually age is the only risk factor measured when evaluating population - based breast cancer screening programmes, because information on date of birth and date of invitation of women is mostly available . This term covers both within - stratum confounding, for example too - broad age categories, and confounding due to unmeasured variables . Self - selection bias can be regarded as a special form of residual confounding because participation may induce an imbalance in the risk factors for breast cancer death . Having accounted for age, we clarified the influence of adjustment for residual confounding on the rate ratio of breast cancer death . We compared the mortality rate in the screened (ms) with not screened women (mns). This results in an apparent screening mortality association (rra) that is seemingly real, but not necessarily so because of possible residual confounding bias . Specific screening effect rrs, and a non - specific effect of the potential confounding factor(s) c, which is reflected in the following formula . \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\begin{aligned} {\text{rr}}_{\text{a}} & = {\text{m}}_{\text{s}} /{\text{m}}_{\text{ns}} \\ & = {\text{rr}}_{\text{s}} * {\text{c}} \\ & = {\text{rr}}_{\text{s}} * \left [{{\text{p}} _ {1} {\text{rr}}_{\text{c}} + \left ({1-{\text{p}} _ {1}} \right)} \right]\,/\,\left [{{\text{p}} _ {2} {\text{rr}}_{\text{c}} + \left ({1-{\text{p}} _ {2}} \right)} \right] \\ \end{aligned} $$\end{document} the quantity c thus represents the effect of the potential confounder(s) among screened and the not screened women . The influence of c depends on the relative risk of breast cancer death rrc, the proportion p1 of screened women with the confounder present, and the proportion p2 of not screened women having the confounder . The formula is based on previous work by cornfield and colleagues, schlesselman and greenland ., that the apparent rra is 0.50, and a risk factor producing a twofold increase in risk of breast cancer death (rrc) is present among 20% (p1) of the screened group and 50% (p2) of the not screened group . Then, the non - specific part of the apparent screening effect is 0.20 * 2 + 0.80 * 1 = 1.20 among the screened women, and 0.50 * 2 + 0.50 * 1 = 1.50 among the not screened women . The ratio of these non - specific effects is 1.2/1.5 = 0.80, which is the influence of confounding (c) among the screened and not screened groups . 1a heuristic device to address residual confounding in the mortality effect of breast cancer screening . Both arrows on the left indicate the observed breast cancer mortality risk in the screened and not screened group, suggesting rra = 0.50 . We assume that a confounder with a twofold relative risk on breast cancer death (rrc), is present among 20% (p1) of the women in the screened group and among 50% (p2) in the not screened group . The arrow on the right indicates the expected breast cancer mortality risk in the not screened population when the presence of the risk factor in that group is adjusted from 50% to 20% . 2) a heuristic device to address residual confounding in the mortality effect of breast cancer screening . Both arrows on the left indicate the observed breast cancer mortality risk in the screened and not screened group, suggesting rra = 0.50 . We assume that a confounder with a twofold relative risk on breast cancer death (rrc), is present among 20% (p1) of the women in the screened group and among 50% (p2) in the not screened group . The arrow on the right indicates the expected breast cancer mortality risk in the not screened population when the presence of the risk factor in that group is adjusted from 50% to 20% . 2) in the above calculation we used the cohort approach and the risk ratio (or rate ratio) as a measure of effect . However, this same method can be applied when the odds ratio (or) is the effect measure . Control design has been increasingly used for the evaluation of screening programmes [612]. In the case control evaluation, the odds of having been screened versus not screened in the case group of breast cancer deaths is compared to the same odds in the control group of invited women from whom the cases originate . As an example, we report on a case control study conducted within the nijmegen breast cancer screening programme which started in 1975 . After adjustment for age, we found that the breast cancer mortality rate in the screened group was 65% lower than that of the not screened group: or = 0.35 and 95% confidence interval (ci) = 0.190.64 . Dense mammographic breast pattern, for which a high relative risk of 6 has been reported, is a likely candidate for being treated as a confounding factor . Despite its strength, nevertheless, suppose its prevalence in all screened women is 5% (p1 = 0.05) in contrast to a supposed 20% (p2 = 0.20) prevalence in the not screened women, then, according to the formula, the apparent or of 0.35 would be adjusted to an or of 0.56 (see also fig . 2, left upper diagram).fig . 2diagrams of the adjustment for residual confounding in the effectiveness measurement of breast cancer service screening . Mortality or = 0.35; panel b is for or = 0.50 and panel c for or = 0.75 . From top to bottom, the figures represent the adjusted ors for confounding factors with rrc = 6, 4, 2 and 1.5, respectively . The x - axis displays the proportion (p2) of the not screened population with the confounding factor . The lines displayed in the figures present the adjusted or for the confounding factor for p2 ranging from 0.0 to 0.6, and four different points of departure for p1 of the screened population (upper line at p1 = 0.05, then p1 = 0.10, p1 = 0.20 and the lowest line p1 = 0.35). The y - axis in each figure depicts the expected ors adjusted for residual confounding diagrams of the adjustment for residual confounding in the effectiveness measurement of breast cancer service screening . Panel a shows the baseline situation of an age - adjusted screening mortality or = 0.35; panel b is for or = 0.50 and panel c for or = 0.75 . From top to bottom, the figures represent the adjusted ors for confounding factors with rrc = 6, 4, 2 and 1.5, respectively . The x - axis displays the proportion (p2) of the not screened population with the confounding factor . The lines displayed in the figures present the adjusted or for the confounding factor for p2 ranging from 0.0 to 0.6, and four different points of departure for p1 of the screened population (upper line at p1 = 0.05, then p1 = 0.10, p1 = 0.20 and the lowest line p1 = 0.35). The y - axis in each figure depicts the expected ors adjusted for residual confounding other risk factors for breast cancer like obesity, socio - economic status, nulliparity, late age at menopause, early age at menarche, and family history show a 1.5 to fourfold relative risk of breast cancer at most . We assume that the risk magnitude of the factors applies to the incidence and mortality alike . Panel a shows the baseline situation of an age - adjusted screening mortality or of 0.35; panel b is for or = 0.50 and panel c for or = 0.75 . The expected values of the ors in order of decreasing magnitude are displayed on the y - axis in each figure: after adjustment for dense breast pattern rrc = 6; late age at menopause rrc = 4; nulliparity rrc = 2; and serious overweight rrc = 1.5 . The x - axis shows the proportion (p2) of the not screened population with the confounding factor . In each figure, the lines present the or adjusted for the confounding factor with p2 ranging from 0 to 0.6, and four different situations of the proportion (p1) confounder in the screened group: the upper line is for a p1 = 0.05, then p1 = 0.10, p1 = 0.20 and the lowest line for a p1 = 0.35 . In practice, previous screening programme evaluations have qualitatively discussed the magnitude of residual confounding bias on their effectiveness estimate [6, 9, 10, 12] or estimated the amount of bias due to self - selection [7, 8, 11]. We present an educated and pragmatic method to quantify the potential impact of residual confounding, and to de - bias the comparison of screened with unscreened groups, a method originally introduced by cornfield et al . . Our results demonstrate that residual confounding has a minor influence on the observed screening effect . Closely related to residual confounding the difference between these three biases is subtle; the nuances seem to lie in the clarification of definable confounding factors or a combination of indefinable confounding factors . Self - selection into screening may result in an imbalance of a combination of indefinable risk factors, causing a different background risk of dying from breast cancer in screened versus not screened women . Healthy screenee bias may occur because some women in the not screened group, although invited for screening, may already have been diagnosed with cancer, while screened women were not diagnosed with breast cancer at the time of participation . Both biases can be regarded as a form of residual confounding since participation in screening may be correlated with the baseline risk of dying from breast cancer . An estimate of the amount of self - selection can be obtained by calculating the ratio of the breast cancer deaths among not invited and not screened women . This calculation is not possible in a steady state situation of population based screening since there is no uninvited group . By using the implementation period of screening, we quantified a 0.84 lower background risk in not screened women compared with not yet invited women . Duffy et al . Proposed a factor based on data from the swedish and canadian screening trials, showing a 1.36 higher risk for not screened women . With these factors, the difference in background risk between not screened and screened women can be calculated by taking the percentage uptake in a programme into account . For instance, if we use duffy s factor of 1.36 and if the screening uptake is 80%, which is in accordance with most european programmes, not screened women have a 1.42 higher background risk compared with screened women . This factor actually represents c in our formula, it is the difference in background risk p1 = 0 and p2 = 1 . In this scenario an apparent or of 0.35 would be adjusted to 0.51 . However, using our factor of 0.84, not screened women have a 0.80 lower background risk compared with screened women . In our scenario an apparent or of 0.35 would be adjusted to 0.28 . In cornfield s original paper apparent effect, then rra = c, and rrs = 1 . In our example we applied this method to adjust ors for combinations of p2 between 0 and 0.6, and values of p1 = 0.05, 0.10, 0.20 and 0.35 . These values were chosen based on the expected prevalence of the risk factors in the female population, i.e. 5% for mammographic density, 10% for late age at menopause, 20% for nulliparity, and 35% for serious overweight . As, we aimed to challenge the age - adjusted screening effect, we developed scenarios where p1 was smaller than p2 . Our calculation does not account for random error or uncertainties about the relation of risk factors and breast cancer . It is possible to correct for this by using more complex techniques based on a monte carlo and a bayesian approach . However, the aim of this study was to present a heuristic device to address residual confounding . In conclusion, in studies on breast cancer screening the mortality reduction ranges from 38 to 70% [612]. As we have shown, residual confounding does not have a great effect on these estimates of screening effectiveness . After having addressed for age, future breast cancer screening programme evaluations can ignore residual confounding.
Cough is one of the most distressing symptoms in cancer patients with lung or mediastinal metastasis or due to complications of cancer treatment . Twenty to 42% of cough do not respond to conventional medications and are referred to as refractory cough and these are often a medical challenge . It shows features such as abnormal throat sensation (laryngeal parasthesia), increased cough sensitivity to tussigens (hypertussia), and cough triggered by nontussive stimuli such as cold or talking (allotusia). Gabapentin is known to be effective in treating neuropathic pain with central sensitization and findings from the present case predicts its effectiveness in treating refractory cancer related cough . It further affirms the fact that vagal neuropathy may be associated with refractory chronic cough . A 15-year - old boy, who had previously been diagnosed with malignant spindle cell sarcoma, was referred to the department of palliative care and psycho - oncology for chronic refractory cough . Following histopathological diagnosis of spindle cell sarcoma of right lower limb in the year 2014, he had undergone surgery followed by radiotherapy for local control . In may 2015, he presented to the clinical oncology department with a history of persistent dry cough of 6 months duration . A computed tomography scan of thorax [figure 1] revealed a large heterogenous hypodense soft tissue mass (10.5 cm 10.3 cm) in the right lower lobe with extension to the left atrium through the right inferior pulmonary vein . In addition, there were enlarged right paratracheal, subcarinal, and hilar lymph nodes . Computed tomography scan of thorax showing the mass in the right lower lobe with extension to the left atrium through the inferior pulmonary vein the child had persistent cough for the duration of 6 months . The cough intensity on a numerical rating scale (nrs) was 10 (out of 10). Each bout of cough lasted for 30 s and there were 20 such bouts in a day . Cough was severe in the morning and was triggered by activities that involved walking, talking, or exposure to the cold environment . His eastern cooperative oncology group (ecog) performance status score at the time of presentation was 3 . A trial of codeine phosphate started by the primary treating team did not reduce cough but instead caused excessive drowsiness and giddiness due to which he had to stop the medicines . Patient was started on gabapentin 50 mg 3 times a day and advised to increase the dose by 50 mg every 3 days until response was obtained or the child felt drowsy (in the latter case, the drug dose would be decreased). The patient responded significantly well with 200 mg / day of gabapentin after 1 week without any side effects such as drowsiness or giddiness and he continues to improve . There was a decrease in the cough intensity to 2 (out of 10 on nrs) and both cough duration and bouts (2/day). The child is now able to enjoy his routine life and socialize with friends and relatives . Patients with primary or metastatic cancer of the lung often present with distressing symptoms such as breathlessness and cough which significantly impacts their quality of life . There are multimodal options for treatment in cancer related cough which include corticosteroids, bronchodilators, brachytherapy, laser therapies, and opioids . Our patient had an extensive mass crossing the mediastinum which precluded radiation to the mass as this involved significant risk to the mediastinal structures . Opioids are commonly used in cancer patients for the management of pain, cough, and breathlessness . Opioids act by stimulating the mu receptors in the cough centers of the brain and helps in suppressing the cough . In one study, slow release morphine sulfate showed a significant improvement in the cough related quality of life as compared to placebo and this was not associated with cough reflex sensitivity which is consistent with central action of morphine . The treatment, on the contrary, caused significant drowsiness and giddiness affecting his quality of life . Cough reflex is mediated by the stimulation of the vagal primary afferent nerve distributed along the tracheobronchial tree . Thus, rapidly adapting receptors of the vagal afferents are known to be evoked by mechanical stimuli and deformity in the airway epithelium, which results in cough . Thus, an unresectable mass in the mediastinum acts as a constant source of irritation for the airway which in turn triggers cough . We used gabapentin in our patient with successful control in cough intensity, duration, and frequency . Gabapentin is a lipophilic structural analog of the neurotransmitter gamma aminobutyric acid which is proven to have a central action . It is known to act on the alpha 2 and delta receptor of calcium channel inhibiting the release of neurotransmitters such as substance p, a tussigenic agent, and possibly inhibits the n - methyl - d - aspartate receptors . Recent trials have shown the superiority of gabapentin in reducing the frequency and intensity of cough . Peripheral cough sensitivity to capsaicin was not changed by gabapentin which proves its central effect . In the same study, there was a significant improvement in cough related quality of life in the gabapentin arm . The common side effects of gabapentin include dizziness, fatigue, headache, and confusion which was not reported by our patient . There is, thus, a need to explore the use of neuromodulatory agents in symptom conditions which are known to have a neural origin such as cough, pruritus, and hiccoughs.
Dipeptidyl peptidase4 (dpp4) inhibitors improve glycemic control in patients with type 2 diabetes by preventing degradation of two incretin hormones, glucagonlike peptide1 (glp1) and glucosedependent insulinotropic polypeptide (gip), that are secreted from the intestine on ingestion of various nutrients . Recent studies have shown associations of dpp4 inhibitors efficacy with age and fasting plasma glucose levels, as well as baseline glycated hemoglobin (hba1c) and body mass index (bmi), but clinical parameters that predict the efficacy of dpp4 inhibitors are largely unknown . The present study showed that alterations in hba1c level on administration of dpp4 inhibitors as monotherapy are associated with estimated intake of fish, estimated intake of dietary n3 polyunsaturated fatty acid (pufa), and serum levels of eicosapentaenoic acid (epa) and docosahexaenoic acid (dha). The protocol was approved by the ethics committee of kansai electric power hospital, and carried out in accordance with the principles of the declaration of helsinki . A total of 72 untreated japanese patients with type 2 diabetes (the japan diabetes society criteria of 2010; age 64.6 11.3 years; duration of diabetes 9.0 8.9 years; baseline hba1c 7.2 0.7%; bmi 24.5 4.3 kg / m) who had been on diet and exercise therapies participated in the current study . Dpp4 inhibitors (sitagliptin, alogliptin or vildagliptin) were given for 4 months and no other antidiabetic drugs were used during the period . A total of 59 patients received sitagliptin, 12 received alogliptin and one received vildagliptin . Hba1c levels were determined before the initiation of dpp4 inhibitors and 4 months after the initiation of dpp4 inhibitors, and were shown in national glycohemoglobin standardization program values, as recommended by the japan diabetes society . Fasting serum levels of dha, epa and arachidonic acid (aa) were determined based on fatty acid composition of total lipids including phospholipids, triglycerides and cholesteryl esters in the serum of 20 patients (age 63.1 11.7 years; duration of diabetes 6.7 5.7 years; baseline hba1c 7.0 0.8%; bmi 24.2 3.1 kg / m) before initiation of dpp4 inhibitors . Selfadministered 3day food records, which were recorded during the 4month period, were analyzed for estimated intake of various nutrients using healthy maker pro 501 (mushroomsoft co., ltd ., all statistical calculations were carried out using pasw statistics 18 (sas institute inc ., cary, nc, usa), including linear regression analyses of the associations between changes in hba1c levels and various parameters . Multiple linear regression analyses were carried out to identify the parameters potentially associated with hba1c reduction, and simple regression analyses were carried out to evaluate their contributions . In the present study, dpp4 inhibitors, similarly to previous reports, significantly reduced hba1c levels, but not bodyweight (before initiation of dpp4 inhibitors 7.2 0.7%; 4 months after initiation of dpp4 inhibitors 6.7 0.6% [paired ttest, p <0.01 vs before]). Multiple regression analysis of hba1c reduction (hba1c) taking into account sex, age, duration of diabetes, bmi, baseline hba1c and estimated intake of various food categories in 3day food records showed that hba1c was well correlated with baseline hba1c, but not with bmi (table 1). Hba1c also showed a significant association with estimated intake of fish and seafood in the food records (figure 1a and table 1). Among fish and seafood, estimated intake of fish, but not shellfish and other seafood, showed a significant association with hba1c (table s1). The beneficial effects of fish on human health have been partly attributed to pufa, such as epa and dha . Hba1c was significantly correlated with estimated intake of epa and dha, along with baseline hba1c (figure 1b and table s2). As serum epa and dha levels might serve as markers for intake of corresponding fatty acids (figure s1), we analyzed associations of hba1c with serum epa and dha levels . Serum levels of epa and dha, but not n6 pufa arachidonic acid, were well correlated with hba1c (figure 1c). Although hba1c reduction showed a significant association with estimated intake of milk products (table 1), we were unable to find nutrients in milk products, including saturated fatty acids, that were responsible for the association . Multiple regression analysis regarding changes of glycated hemoglobin (hba1c) levels (hba1c) by taking into account sex, age, duration of diabetes, body mass index (bmi), baseline hba1c (national glycohemoglobin standardization program [ngsp]) and estimated intake of various food categories in 3day food records in 72 patients with type 2 diabetes . Statistical calculation was carried out using pasw statistics 18 (sas institute inc . ). B and denote nonstandardized and standardized regression coefficients, respectively . For analysis of changes of hba1c levels, the correlation coefficient squared (r) was 0.550 and the fvalue with 15 degrees of freedom was 3.499 for a pvalue of 0.003 . (a) correlation between estimated intake of fish and seafood with glycated hemoglobin (hba1c) reduction (national glycohemoglobin standardization program [ngsp],%) 4 months after initiation of dipeptidyl peptidase4 inhibitors (hba1c; n = 72). (b) correlation between estimated intake of eicosapentaenoic acid (epa), docosahexaenoic (dha) with hba1c (n = 72). (c) correlation between serum levels of epa, dha and arachidonic acid (aa) with hba1c (n = 20). Linear regression analyses were carried out to calculate the correlation coefficient (r) and pvalues . We find that changes of hba1c levels on administration of dpp4 inhibitors are associated with estimated intake of fish and estimated intake of dietary n3 pufa, as well as serum epa and dha levels . Despite being a retrospective cohort study with a limited sample size, these findings are clinically important in two respects: (i) the efficacy of dpp4 inhibitors can be predicted by serum epa and dha levels; and (ii) consuming more fish with diet therapy can enhance the efficacy of dpp4 inhibitors . Furthermore, the current findings suggest that the differing efficacies of dpp4 inhibitors found among different ethnicities might be partly a result of differences in fish consumption . Although many studies have shown the beneficial effects of dietary n3 pufa from fish, the mechanisms involving dietary n3 pufa in dpp4 inhibitor efficacy have not yet been investigated . Although epa and dha have been shown to prevent excessive adiposity, thereby ameliorating insulin resistance in animal models, the effects of n3 pufa on glycemic control in type 2 diabetes itself are somewhat controversial . Interestingly, it has been found that epa and dha enhance glp1 secretion, possibly through free fatty acid receptors, such as gpr120, in glp1secreting cells and mice . It is thus possible that dietary n3 pufa and dpp4 inhibitors synergistically increase biologicallyactive glp1 levels to facilitate maintenance of glycemic control, but it remains to be determined whether epa and dha enhance glp1 secretion in patients with type 2 diabetes . In addition, whether the present findings hold true for dpp4 inhibitors in general is not known, as most of the patients in the current study received sitagliptin or alogliptin, and vildagliptin patients were limited . We find that the reduction of hba1c by dpp4 inhibitors significantly correlates with estimated intake of fish, estimated intake of epa and dha, and serum levels of epa and dha . Figure s1 correlation between estimated intakesand serum concentrations of eicosapentaenoic acid (epa) anddocosahexaenoic (dha; n = 16). Table s1 association of glycated hemoglobin(hba1c) reduction and estimated intake of fish, shellfish and other seafood table s2 association of glycated hemoglobin(hba1c) reduction and estimated intake ofpolyunsaturated fatty acids click here for additional data file.
For patients with non - small cell lung cancer (nsclc), physicians have long been puzzled by the task of identifying candidates who may suffer major postoperative cardiopulmonary complications if they were to undergo lung resection surgery . Among the few available tests, the cardiopulmonary exercise test (cpet) is a standard tool to assess the surgical risk of patients with nsclc [13]. Specifically, maximal oxygen uptake (vo2max) during symptom - limited exercise was found to be a more reliable than other parameters of spirometry, such as forced expiratory volume in 1 second (fev1) or the ratio of fev1 against forced vital capacity (fvc), to predict postoperative morbidity and mortality among nsclc patients . As an alternative to cpet, excise - based diagnostic tests, such as stair - climbing test (sct), have been reported to be a safe, economical way to assess risk - associated factors of patients [47]. Interestingly, for patients with nsclc, since sct requires patients to ride cycles, it is more stressful than cardiopulmonary exercise and can be considered as valid tool to detect any abnormalities in the oxygen transport system . Thus, it is plausible that sct may be helpful in predicting cardiopulmonary complications after lung resection . However, definitive evidence is lacking to determine whether sct is superior to cpet to predict postoperative cardiopulmonary complications for patients with nsclc . In this study, we used statistical methods to assess whether the key parameters of sct, including exercise oxygen desaturation (eod), may be independent and proficient prognostic factors predicting postoperative cardiopulmonary complications among patients with nsclc who received various extents of lung resection . In this study, all protocols were reviewed and approved by the ethics committee at the cancer hospital (institute), chinese academy of medical sciences in beijing, china . A total of 413 patients with non - small cell lung cancer (nsclc) performer the stair - climbing test between january 2010 and july 2015 . We excluded 74 patients due to lack of complete clinical data, 53 patients were excluded because they failed to correctly perform the pulmonary function test, 12 patients were excluded as they received lung resection and esophagectomy at the same time, and 103 patients were excluded because they did not receive surgery afterwards . Thus, 171 eligible nsclc patients were enrolled in this study, including 41 females and 130 males . None of the patients had received any antineoplastic therapy such as radiotherapy and/or chemotherapy in the 6 months prior to surgery . All patients in the study participated in the symptom - limited stair - climbing test preoperatively by climbing 5 floors from the 1 floor to the 6 floor in our surgical building . There are 20 steps and 1 intermediate landing between each floor, and each step is 0.153 m in height . The patients were instructed before the stair - climbing test and encouraged to climb the stairs as fast as they could without stopping to rest until they reached the highest floor possible . The maximum height (to the 6 floor) was 18.4 m. the test was complete when patients reached either the 6 floor or the patients presented an apparent symptom such as severe dyspnea with oxygen desaturation, severe leg fatigue, or chest pain, which indicated exhaustion and they could not climb any more . All patients were accompanied by 2 physicians all the time during the test, who would monitor their symptoms and recorded test results simultaneously . Heart rate and capillary oxygen saturation were recorded before the test, at each floor during the test, and after resting for 15 min after completing the test, using a portable pulse - oxy meter with finger probe, called the autobox (newtech, shenzhen, china). The resting oxygen saturation (osat) and lowest osat during the test were recorded and used to calculate the desaturation level . For air leak management, single thoracic drainage in the chest was induced into the 2 intercostal space, midclavicular line (pneumonectomy), and the 7 intercostal axillary line (wedge resection and lobectomy). With the exception of pneumonectomy, all the drainage tubes were put into the chest with the front - most end reaching the top of the chest . At the end of the operation, residual lung tissues were carefully examined, and then air - leak tissue was stitched by prolene thread until there was no air leak from the residual lung tissue . Spirometry, flow - volume curves, and absolute lung volumes were measured using a pulmonary function test apparatus . The diffusion capacity for carbon monoxide (dlco) was determined using a standard single - breath technique . Best results were selected in 2 acceptable measuring results at intervals of at least 510 min between 2 measurements . All patients underwent surgical resection for lung cancer by either thoracotomy (n=129) or video - assisted thoracoscopic surgery (vats, n=42). Procedures included pneumonectomy in 22 cases, lobectomy in 122 cases, and pulmonary wedge resection in 27 cases . Postoperative treatment was focused on early mobilization, chest physiotherapy and physical rehabilitation, pain control, and antibiotic and anti - thrombotic prophylaxis . Postoperative complications and deaths were defined as those occurring 030 days postoperatively, according to the guideline reported by bolliger et al ., smith et al ., and brutsche et al . . Statistical analyses were performed using sas software (sas institute, cary, nc). Categorical variables of clinical characteristics are shown as percentages and were compared using the chi - square test . Continuous variables are presented as means standard deviations and compared by use of the t test . The utility of the complication as a predictive marker for drainage tube length of postoperative stay and hospital stay was investigated using kaplan - meier analysis . Logistic regression analysis was used to determine the association of preoperative factors with postoperative complications . Factors with a significant difference in univariate analysis (p value <0.05) were measured again by multivariate analysis to determine their independence . A p value in this study, all protocols were reviewed and approved by the ethics committee at the cancer hospital (institute), chinese academy of medical sciences in beijing, china . A total of 413 patients with non - small cell lung cancer (nsclc) performer the stair - climbing test between january 2010 and july 2015 . We excluded 74 patients due to lack of complete clinical data, 53 patients were excluded because they failed to correctly perform the pulmonary function test, 12 patients were excluded as they received lung resection and esophagectomy at the same time, and 103 patients were excluded because they did not receive surgery afterwards . Thus, 171 eligible nsclc patients were enrolled in this study, including 41 females and 130 males . None of the patients had received any antineoplastic therapy such as radiotherapy and/or chemotherapy in the 6 months prior to surgery . All patients in the study participated in the symptom - limited stair - climbing test preoperatively by climbing 5 floors from the 1 floor to the 6 floor in our surgical building . There are 20 steps and 1 intermediate landing between each floor, and each step is 0.153 m in height . The patients were instructed before the stair - climbing test and encouraged to climb the stairs as fast as they could without stopping to rest until they reached the highest floor possible . The maximum height (to the 6 floor) was 18.4 m. the test was complete when patients reached either the 6 floor or the patients presented an apparent symptom such as severe dyspnea with oxygen desaturation, severe leg fatigue, or chest pain, which indicated exhaustion and they could not climb any more . All patients were accompanied by 2 physicians all the time during the test, who would monitor their symptoms and recorded test results simultaneously . Heart rate and capillary oxygen saturation were recorded before the test, at each floor during the test, and after resting for 15 min after completing the test, using a portable pulse - oxy meter with finger probe, called the autobox (newtech, shenzhen, china). The resting oxygen saturation (osat) and lowest osat during the test were recorded and used to calculate the desaturation level . For air leak management, single thoracic drainage in the chest was induced into the 2 intercostal space, midclavicular line (pneumonectomy), and the 7 intercostal axillary line (wedge resection and lobectomy). With the exception of pneumonectomy, all the drainage tubes were put into the chest with the front - most end reaching the top of the chest . At the end of the operation, residual lung tissues were carefully examined, and then air - leak tissue was stitched by prolene thread until there was no air leak from the residual lung tissue . Spirometry, flow - volume curves, and absolute lung volumes were measured using a pulmonary function test apparatus . The diffusion capacity for carbon monoxide (dlco) was determined using a standard single - breath technique . Best results were selected in 2 acceptable measuring results at intervals of at least 510 min between 2 measurements . All patients underwent surgical resection for lung cancer by either thoracotomy (n=129) or video - assisted thoracoscopic surgery (vats, n=42). Procedures included pneumonectomy in 22 cases, lobectomy in 122 cases, and pulmonary wedge resection in 27 cases . Postoperative treatment was focused on early mobilization, chest physiotherapy and physical rehabilitation, pain control, and antibiotic and anti - thrombotic prophylaxis . Postoperative complications and deaths were defined as those occurring 030 days postoperatively, according to the guideline reported by bolliger et al ., statistical analyses were performed using sas software (sas institute, cary, nc). Categorical variables of clinical characteristics are shown as percentages and were compared using the chi - square test . Continuous variables are presented as means standard deviations and compared by use of the t test . The utility of the complication as a predictive marker for drainage tube length of postoperative stay and hospital stay was investigated using kaplan - meier analysis . Logistic regression analysis was used to determine the association of preoperative factors with postoperative complications . Factors with a significant difference in univariate analysis (p value <0.05) were measured again by multivariate analysis to determine their independence . A total of 171 non - small cell lung cancer patients were included in the study . One of these deaths was a 75-year - old male and another was a 59-year - old female, whose exercise oxygen desaturation (eod) were both greater than 5, and both died from respiratory failure 1 and 80.5, respectively, days postoperatively despite being supported by mechanical ventilation . The third patient was a 64-year - old male who died from postoperative bleeding in the chest after a lobectomy . There was no air leak from the chest of patients for more than 2 days before closing the chest, and no patient had empyema . Baseline information and the comparison between the complication group and the complication - free group are shown in table 2 . There were no significant differences in sex ratio, bmi, smoking, lung resection, spirometry measurements (fev1, mvv%, dlco and dlco%), or stair - climbing test results (pre - climb sao2, climbing - end sao2, and climbing - end heart rate) between the groups . While comparing those parameters between the complication group and the complication - free group, there were significant differences in age, fev1%, mvv, height of climbing, eod, and heart rate change between the 2 groups . Finally, logistic regression analysis showed that eod and heart rate change were independent predictors of complications (table 3). A model for predicting the probability of postoperative complications based on logistic regression was hypothesized as: probability = e/(1+e), =1.136 + (0.114eod) + (0.040heart rate change), in which e represented the base of natural logarithms and the was the regression coefficient in the logistic regression . The accuracy of the model was evaluated by use of the roc curve, which showed that the area under the roc curve (auc) was 0.750 (95% ci: 0.6680.831) (figure 1). If the cutoff probability value was larger than 0.193, the patient was considered to have high risk of suffering from postoperative cardiopulmonary complications, and vice versa . Patients without a postoperative cardiopulmonary complication had a median length of drainage time of 4.3 days (95% ci, 3.44.5) and a median length of hospital stay of 9.4 days (95% ci, 8.99.8), as compared to 5.9 days (95% ci, 5.36.4) (figure 2, p<0.001), and 13.1 days (95% ci, 10.915.3) (figure 3, p<0.001) for patients with postoperative complications . Complications such as chronic obstructive pulmonary disease (copd) and coronary artery disease are very common among those patients, with high risk of surgical morbidity and mortality . Thus, it is critical to perform preoperative assessment on cardiopulmonary function to predict the risk of postoperative complications and death . Use of vital capacity for the prediction of surgical risk was first reported as early as 1955 . Since then, lung functional testing has been used to predict the risk of postoperative complications and even mortality . The 2 most commonly used parameters of conventional pulmonary function test are fev1 and dlco, which were confirmed by univariate analysis in our study . However, multivariate analysis showed that fev1% was not an independent predictor of postoperative complications for patients with nsclc . Before this study, poor exercise capacity has long been used as the major predictor of postoperative cardiopulmonary complications after lung resection in patients with nsclc . However, nsclc patients with poor exercise capacity not only have high risk of postoperative cardiopulmonary complications, but also have longer hospital stay . In the present study, our results showed that eod and heart rate change were independent predictors of postoperative cardiopulmonary complications for patients with nsclc, confirming the predictions from other studies . Brunelli reported that complication rates in patients with and without eod> 4% and <4% were 36% and 22%, respectively . In addition, a previous study by our team found the rate of postoperative cardiopulmonary complications was significantly higher in patients with eod 5% and heart rate change <55 beats / min than that in the group with eod <5% and heart rate change 55 beats / min . Therefore, in the present study, we successfully established a model to predict the risk of postoperative cardiopulmonary complication using scts parameters of eod and heart rate change . It is worth noting that, in the present study, the patients without postoperative cardiopulmonary complication had a shorter hospital stay than those with postoperative cardiopulmonary complications . Also, the patients without postoperative cardiopulmonary complication had a shorter drainage time than those with postoperative cardiopulmonary complications . The possible explanation is that a patient who has postoperative cardiopulmonary complications creates more pleural effusion than one does not, further confirming that sct may be an effective method to predict postoperative cardiopulmonary complications in nsclc patients . However, well - established formal cardiopulmonary exercise testing (cpet) is still be recommended for precise assessment of these patients with high eod or low heart beat change during the stair - climbing test . We provided definitive evidence that eod and heart rate change in sct are independent predictors for postoperative cardiopulmonary complications in nsclc patients . A follow - up study with a much larger patient pool however, based on the information of our study, it is highly recommended for all lung resection candidates with poor conventional function test results to perform a stair - climbing test.
Total joint replacement usually represents the final route for treatment of degenerative disease of the knee . Joint replacements are more and more frequent and routine these days thanks to, for example, the consequent aging of the general population, increased functional requirements, and the development and use of new materials and more sophisticated surgical techniques . In this context, there is a need to develop new protocols for management and use of transfusion therapies in the field of orthopedic surgery . Transfusion of homologous blood are frequent and costly and expose patients to potential risks of infection [1, 2]; hence several methods have been proposed to avoid them [3, 4]. Preoperative blood donation and intra- and postoperative blood collection and administration of pharmaceutical agents to either reduce blood loss (e.g., tranexamic acid) or stimulate the production of erythrocytes (e.g., erythropoietin) have been proposed as alternative techniques to transfusion of homologous blood in various studies [3, 4]. In the scientific literature, there are several reports of studies where reinfusion of blood collection in postoperative orthopedic surgery, especially in prosthesis surgery [514], is analyzed . The aim of the present study was to verify the safety, the clinical efficacy, and the possible benefits of reinfusion of postoperatively collected autologous blood in total knee replacement procedures, with special emphasis on cost - benefit and reinfusion procedure, by comparing autologous blood transfusion with nonautologous blood transfusion . Between 2011 and 2012, one hundred twenty - four patients with a mean age of 71.2 6.8 years and a range between 50 and 84 years were included in the study . The first group consisted of a series of sixty - four consecutive patients (male to female ratio 1: 5, range of age between 62 and 84 years), who underwent one stage unilateral total knee arthroplasty using a blood reinfusion device in 2012 . Fifty - eight of these patients received autologous transfusion and six patients were excluded, five due to systemic pathologies . The control group consisted of sixty consecutive patients (male to female ratio 1: 3, age ranging from 50 to 79 years). This population was operated on consecutively in 2011 but is not subjected to autologous blood reinfusion because we have been using this device since january 1, 2012 . Before any study - related measures were taken all patients read and signed informed consent for any possible transfusion of homologous red blood cell and a specific consent for reinfusion, after adequate information on possible risks and benefits of both methods . The manuscript was performed in accordance with the ethical standards of the 1964 declaration of helsinki as revised in 2000; for this type of study formal consent is not required . Antibiotic prophylaxis was obtained by administration of ceftriaxone 1 g intramuscular injection once daily and teicoplanin 800 mg intravenous injection once daily, 30 minutes before inducing anaesthesia . Antithrombotic prophylaxis was obtained by administration of enoxaparin sodium 4,000 i.u . Once daily by subcutaneous injection for 35 days, 12 hours before surgery; two patients had an urticarial reaction and therefore it has been replaced with fondaparinux sodium 2.5 mg once daily by subcutaneous injection for 35 days . Patients were subjected to surgical intervention for unilateral primary arthroplasty knee, by implanting a zimmer's nexgen cemented prosthesis or how medical's triathlon prosthesis . Surgery was carried out by the same surgeon on all patients; a standard surgical procedure was performed including a longitudinal medial skin incision and median parapatellar quadriceps splitting approach . Limb ischemia was achieved through temporary leg loop tire located at the root of the limb and the tourniquet was deflated after the step of cementing . Postoperative pain was controlled with paracetamol 100 ml/10 mg endovenous with a 4-hour minimum interval between each administration . Bellovac abt is a drainage system for postoperative collection, filtration, and reinfusion of shed autologous blood . It consists of all components required for collection and reinfusion of one unit of shed autologous blood . The initial negative suction pressure is 90 mmhg (12 kpa), generating safe and efficient drainage . Once the recovery of shed blood is completed (within <6 hours) the transfusion bag can be replaced with a collection bag for evacuation only, thus serving as a simple wound drainage (card system technical bellovac abt for drainage and the recovery of the blood postoperative manufacturer: astra tech ab, via cristoni, casalecchio di reno (bo)). For all patients, we decided that a homologous transfusion therapy was only indicated for haemoglobin values below 8 g / dl . The study group consisted of a series of sixty - four consecutive patients with mean age 73.3 5.7 years (14 males and 50 females), while the control group consisted of sixty consecutive patients with mean age 69 7.2 years (18 males and 42 females). We excluded patients with systemic pathologies such as uncompensated diabetes mellitus, cancer, severe cardiovascular pathologies, immunodepression, anticoagulating or antiaggregating therapy, coagulation disorders including deep venous thrombosis, and ongoing infections . We considered as discriminating factors hemoglobin values <12 g / dl for women and <14 g / dl for men . Length of surgery was 2.24 0.38 hours in the study group versus 2.06 0.32 hours (p = 0.17). Hemoglobin values (hb; g / dl) were checked preoperatively, immediately after surgery, on the first day and the second day after the operation, and on discharge . They were later compared between groups . In the study group, patients were subjected to a microbiological culture of a blood sample (20 ml) from the bag of postoperative recovery, at the end of the procedure of reinfusion . In our hospital, the transfusion medicine unite has provided the following expense items: the cost of an autologous blood retransfusion system is around 68,00, while the costs of an allogenic blood transfusion, including cross - matching, delivery, and refrigerated storage, are stated to be 270 . Added costs of the postoperative drain and the abt system are 20 and 68, respectively . All data are presented as mean sd or median (iqr) as appropriate . Groups were compared using the one - way anova or t - test for normally distributed data and the nonparametric kruskal - wallis or mann - whitney u test for non - normally distributed variables . The study group consisted of a series of sixty - four consecutive patients with mean age 73.3 5.7 years, 14 male and 50 female, while the control group consisted of sixty consecutive patients with mean age 69 7.2 years, 18 male and 42 female (p <0.05). The average body weight of the study group was 70.8 8.8 kg and 73.1 8.0 kg (p = 0.43). In the study group, all the patients received autologous blood transfusion . In the first six hours 400 122.4 ml (min . 600) was collected and retransfused; within 24 hours there was 198.5 142.4 ml of blood drained in the drainage . In the control group, because of the intraoperative use of a tourniquet, intraoperative blood loss was negligible in both groups . We noticed a reduction rate of allogeneic blood transfusion between the study and the control group (10.3% versus 30%; p = 0.08). Six patients in the study group, four women and two men, were subjected to allogeneic transfusion, five patients received one unit of homologous blood between the second and fourth days postoperatively, and one patient received two units of homologous blood ., we registered 18 patients who received homologous blood transfusion; each one had received a bag of homologous whole blood . The transfusion trigger in the abt group (n = 6) was 7.5 0.1 g / dl, whereas that in the control group (n = 18) was 7.3 0.2 g / dl (p = 0.09). One unit of red blood cells can be expected to result in a hemoglobin increase of 1 g / dl in a typical adult . In the abt group we recorded an increase in hemoglobin equal to 0.7 0.3 (g / dl), after autologous transfusion . In this group we recorded an increase in hemoglobin equal to 1.3 0.2 (g / dl) (n = 7 bags) versus 0.9 0.1 (g / dl) (n = 18 bags) in the control group after homologous transfusion (p <0.01). Therefore, we noticed a greater rise in hemoglobin after homologous transfusion in the group given reinfusion (figure 1). The tourniquet time was 1.13 0.27 hours in study group versus 1.04 0.27 hours in control group (p = 0.36). In the study group the mean length of stay at the hospital (los) was 7.88 0.7 days, while it was 8.96 2.47 days for the control group (p = 0.03). Really, we did not find any significant difference for hemoglobin count between groups from admission to hospital discharge (table 1 and figure 2); as expected, we did not find any difference between groups considering the reduction in hemoglobin for study's time points (table 2 and figure 3). The results of microbiological cultures performed on blood samples taken from the postoperative blood bag at the end of the procedure of reinfusion were negative in all cases . In our study a total knee replacement surgical procedure, along with the complementary use of a device for postoperative collection and reinfusion of shed blood resulted in an average reduction of the length of hospital stay equal to 1.08 0.76 days (p = 0.03 versus control). The cost of an autologous blood retransfusion system is around 68,00, while the costs of a allogeneic blood transfusion are stated to be 270, including cross - matching, delivery, and refrigerated storage . In the present study, 18 allogeneic transfusions were given in the no - drainage group, while 7 allogeneic transfusions were given in the abt group, at a cost of 4.860,00 and 1.890,00, respectively . The additional costs of the postoperative drain and the abt system were 20 and 68, respectively, in either group at a cost of 1.160,00 (n = 58) and 4.352,00 (n = 64). The average cost per patient turned out to be lower in the group receiving reinfusion (97.53 versus 103.79; p <0.01). Primarily, autologous blood reduces the need for allogeneic blood transfusion; furthermore, it prevents the transmission of viral diseases (hepatitis c virus, hepatitis b virus, human immunodeficiency virus, and creutzfeldt - jacob virus), transfusion reactions, and transfusion errors [16, 17]. The main advantage of postoperative collection and reinfusion of shed blood is this method's simplicity; hence it finds its application in traumatized patients . However, its main disadvantage is the risk of contamination during blood collection [8, 18]. Identify some possible complications of collection of red blood cells, such as nonimmunologic haemolysis, gas embolism, nonhaemolytic transfusion reaction, coagulopathies, contamination with drugs, the intraoperative use of washing solutions in the surgical site and infectious agents, cytokines, and other microaggregates . The risk of complications decreased due to improvement of techniques and practices as well as increased experience with autologous blood collection systems . Cleveland clinic has performed a five - year retrospective study of complications, with both homologous and collected shed blood, noting that the incidence of complications with collected blood was around 0.027% compared to 0.14% of homologous blood . In our study the results of microbiological cultures performed on blood samples taken from the postoperative blood bag at the end of the reinfusion were negative in all cases . The purpose of collection of shed blood is to reduce or eliminate the need for homologous blood transfusion and the associated risk of infectious and noninfectious complications . During 2006, a meta - analysis of the recovery of red blood cells in adult elective surgery showed that recovery of blood could reduce the need for homologous blood transfusion . The use of recovered red blood cells has reduced the exposure to allogeneic blood by 39% with an average saving of 0.67 units per patient . In 2013 a meta - analysis proved that the use of a postoperative autotransfusion reinfusion system reduced significantly the demand for allogeneic blood transfusions . It also cut the number of patients who needed allogeneic blood transfusions and the cost of hospitalization after total knee arthroplasty . Collection of blood in orthopedic surgery results in greater safety and efficacy [2426]. 94 cases have been studied but a power analysis of the study was not performed; however, we argue that the use of a device for autologous blood collection and washing results in an average reduction of 4 units of allogeneic blood and cost savings of an average of 406.84 dollars per patient . In the literature these authors suggest that autologous blood transfusion drains have no effect on the proportion of transfused patients in primary total knee arthroplasty [2834]. The postoperative hemoglobin levels, the length of hospital stay, and the adverse events are also comparable between groups . In our opinion autologous blood collection and reinfusion, by the use of postoperative systems, is a procedure that allows limiting the transfusion of homologous blood to patients undergoing tkr, improving the postoperative course from a psychophysical point of view and allowing an early transfer to rehabilitation unit . We noticed a reduction in allogenic blood transfusion between the study and the control group (10.3% versus 30%; p = 0.08). Reinfusion group patients also displayed a reduction in the length of stay in hospital by 1.08 0.76 days (p = 0.03 versus control). Concerning costs, the question is whether savings derived from the reduction in allogeneic blood transfusion requirements outweighed the extra costs of the abt system . Zacharopoulos et al . Stated that use of the postoperative blood reinfusion systems is highly effective in reducing the demand for homologous blood transfusion for patients undergoing total knee replacement surgery, resulting in important cost savings in the management of these patients . A previous study observing patients undergoing tka found net savings in different cost scenarios of 5 to 106 per patient with the same abt system as used in this study and 52 to 50 per patient with another abt system . A review of cost - effectiveness on blood - saving measures stated that cell salvage had lower costs compared with all of the alternative blood - saving strategies except acute normovolemic dilution and concluded that autotransfusion may be a cost - effective method to reduce allogeneic transfusions [37, 38]. The evidence that supports the use of red blood cell recovery in knee prosthesis is stronger and comprises randomized studies and one large retrospective review [39, 40]. The average cost per patient was found to be lower in the group receiving reinfusion (97.53 versus 103.79; p <0.01). This work presents a lot of strengths such as the same characteristics of the sample, the surgical technique performed by the same surgeon, and the rigorous cost analysis; on the contrary we are aware of some weaknesses such as the retrospective design . This study has confirmed the absolute safety of the device and the absence of bacteria in examined samples . Our results emphasize the effectiveness of this procedure and have the characteristics of simplicity, low cost, easy reproducibility, and safety . In addition, this recovery system replaces the simple postoperative surgical drainage, representing a further saving of economic resources . Finally we conclude that the use of the shed blood recovery system bellovac abt constitutes a valid device, which can find wide application in orthopedics, especially in the context of total knee replacement surgery.
This may be spontaneous or secondary to mechanical factors like vigorous scratching or combing the hair . A 19-year - old female patient presented with short, rough, and unruly hair on the scalp since childhood . Patient gave a history of knots getting caught in fine - toothed comb whenever the scalp was combed with breakage of few hairs . There was no history of excessive cosmetic use or parlor activities for hair care . On examination, the scalp hairs were dry, curly, and short in length up to the nape of neck, transverse split ends (trichoschisis) were seen in majority of hairs [figure 1]. Microscopic examination of the hair shaft revealed knotted portions of hair; no other shaft abnormalities were noted except for trichoschisis at the distal portion of the shaft [figure 5]. Short curly hair on the scalp small nodules on the distal portion of hair shaft sparse hair in the temporal region trichonodosis and trichoschisis in light microscopy there are two types, one rare variety of unknown etiology involves abnormally growing scalp and body hair with spontaneous trichonodosis which is predisposed to splintering and fracturing . The second commoner type, encountered in patients with normal scalp and body hair, is considered secondary to mechanical forces such as combing and brushing . The hairs in this type are dry and curly, but no abnormality in structure or growth pattern occurs . Rarely, more than one knot is found on a single hair and most were a simple half hitch knot . When the hair of subjects with trichonodosis was combed or brushed, knots were observed to catch in fine toothed combs and to a lesser extent, in brushes . In those with extensive trichonodosis, breakage usually occurred at the knot, but proximal breakage and several uprooted telogen hairs were also seen . Kinky hair tends to be flat in cross section, whereas curly or straight hair is oval to round . These flat or ribbon - shaped hairs do not lie flat on a level surface but remain spiral . This recoiling may lead to an entanglement which, by chance, forms a knot that results in trichonodosis . Mechanical factors such as scratching, combing, washing or friction may produce tangling and knotting of hairs . The pubic and thigh regions are most frequently involved since curliness of the hairs in those areas predisposes them to knotting . If the knots are pulled excessively tight, transverse splintering of the hair shaft and simulation of trichorrhexis nodosa may result . These knots resemble the ova of body, head and pubic lice and light microscopic examination is necessary for differentiation . The nodules in trichonodosis are located distally, whereas the ova are located in the proximal shaft . Acquired type of trichonodosis due to mechanical factors is a common occurrence but reported less in literature . Spontaneous type of trichonodosis associated with abnormal scalp and body hair is a rare occurrence . This type starts at an early age and hair breaks away after a particular length due to the fracture of hair shaft at the knot . Trichonodosis must be considered when patients with kinky hair complain of hair loss or breakage, and the cause is not apparent.
Neural plasticity is the brain's ability to change in response to normal developmental processes, experience, and injury . The mechanisms involved in plasticity in the nervous system are thought to support cognition, meaning that brain function is improved . There is evidence from neuroimaging that subjects achieving high scores on cognitive tasks compared to low performers complete these tests with lower cortical activation particularly in the frontal brain region [1, 2]. Hypothesis, assuming that experts with high cognitive performance are characterized by a more efficient cortical function . . Suggest that this particular characteristic can only be inferred from brain activation, when experts and nonexperts are compared at similar behavioral performance . Within the last years this hypothesis has been extended to experts of movement - related tasks . In this respect, standard eeg techniques have been used to investigate the effect of performance level on the allocation of cortical resources during motor tasks . During the preparation of a shot, haufler et al . Observed less cortical activity in skilled shooters compared to novice subjects . In line with this finding, del percio et al . Also found decreased cortical activity in experts prior to a shot requiring high precision and interpreted this observation as index for selective event- or task - related cortical activation . Neural efficiency has also been confirmed in professional piano players, who completed a motor task involving finger movements with lower cortical activity than less skilled controls . Although these findings consistently support the efficiency of cortical function in athletes, some evidences from tasks requiring movements in response to visual stimuli question the general applicability of this hypothesis . In this respect, hung et al . Reported higher lateralized readiness potentials during posner's visuoattentional task in elite tennis players compared to nonathletes . In line with these results, endo et al . Showed that athletes had greater motor cortex activity than nonathletes during a task, in which subjects were asked to abduct the right index finger in response to visual stimuli . Evidence from longitudinal studies investigating effects of motor training consistently supports the efficiency of cortical function in high performers, because motor cortex activity decreased despite improvements on task performance after a training period [5, 10, 11]. Similarly, 4 weeks of endurance training in cyclists led to improved aerobic performance but decreased brain cortical activity during exercise . Based on those findings, the neural efficiency hypothesis might also be applicable to endurance athletes . So far researches have not yet investigated efficacy of cortical function during exercise between subjects of different aerobic performance levels . However, the current state of research indicates that resting eeg rhythms predict neural efficiency during cognitive and sensorimotor tasks . Alpha synchronization at rest represented by high eeg alpha power is related to increased cognitive and motor performance [13, 14]. In line with these findings, elite karate athletes compared to nonathletes show higher alpha-1 power at parietal and occipital regions at rest with eyes closed . Moreover, training levels also influence the reactivity to eyes opening, so that athletes maintain higher alpha power than nonathletes . Whereas alpha is considered the dominant rhythm in the human brain during mental inactivity, beta activity is regarded as index of information processing at the cognitive level . In previous studies increased alpha power and/or decreased beta power, reflected by a higher alpha / beta ratio, were associated with a decreased level of arousal or vigilance [18, 19]. This pattern is considered normal for the resting state due to a lack of task - specific activation demands . However, endurance exercise increases arousal due to preparedness for external input . Applying the neural efficiency hypothesis, high cortical function despite minimal energy consumption should be indicated by an increased alpha / beta ratio in high performers . In previous trials, high and low performers were differentiated by their individual training levels or participation in competitions [4, 15, 21]. For endurance athletes, maximal oxygen consumption allows a more appropriate and objective classification, because this variable is considered gold - standard and predicts time - trial performance . This is due to the concept that an athlete's maximal oxygen consumption is mainly determined by the oxygen delivery to the mitochondria and its utilization, which in turn are limiting the oxidative production of atp required for the energy supply of the working muscles . As neural efficiency is task - related, it is necessary to study brain cortical activity in athletes directly during endurance exercise . The majority of studies investigating brain function while moving predominantly examined subjects during cycling exercise, because it does not create stepping impacts that provoke strong neck muscle contractions and electrode movements . Furthermore, experienced cyclists are thought to be able to maintain a stable body position even at demanding workloads, so that the likeliness of movement - related artefacts in the eeg signal is reduced . The present study investigates whether or not aerobic power has an effect on the alpha / beta ratio during exercise . Additionally, the authors examine if resting eeg predicts brain cortical activity during exercise . In line with the neural efficiency hypothesis subjects with high maximal oxygen consumption cyclists and triathletes with a minimum cycling training volume of 4 hours per week were directly recruited from local sports clubs . Eligible subjects had to be healthy, between 18 and 35 years, nonsmokers, and right handed . Before the trial commenced all participants underwent health screening following the s1-guideline of the dgsp, which included personal anamnesis, orthopaedic assessment, and measurement of resting ecg and blood pressure . Any complications limiting the performance or safety of exercise led to exclusion from the study . Following the screening process, all study procedures were approved by the local ethics committee and followed the guidelines of the declaration of helsinki . Two laboratory visits separated by 3 to 5 days were scheduled . In the first laboratory session aerobic and anaerobic performance the second visit included recording of eeg rhythms at rest and during endurance exercise at constant workload . Based on maximal oxygen consumption measured on the first visit, the sample was split into a group of lower aerobic power (low; vo2max 49 ml / min / kg; n = 15) and a group of higher aerobic power (high; vo2max 50 ml / min / kg; n = 14). Environmental temperature was held constant at 20c and nutrition was standardized (last main meal2 h; 500 ml30 min). Following the assessment of body weight, subjects completed an incremental test with spirometry (cortex medical, metamax 3b, germany) on a high performance cycling ergometer (fes, germany). After a 5 min warm - up at 80 w (f)/100 w (m), the workload was increased by 25 w/3 min until volitional exhaustion . This was defined as the inability to maintain a cadence of at least 60 rpm at the given workload . Heart rate and respiratory parameters were recorded continuously . Using the enzymatic - amperometric method (dr . Mueller geraetebau, super gl ambulance, germany), lactate concentration was analysed in blood taken from an ear lobe after each increment . Collected data were processed with winlactat (mesics, germany). According to the dickhuth model, the individual anaerobic threshold (pians) additionally, vo2max was determined as highest value over a 30 s period . On the second laboratory visit eeg was recorded under the following conditions: resting with eyes closed while sitting on the ergometer (2 min) and during cycling at constant load . The exercise protocol included a 5 min warm - up (80 w [f]/100 w [m]), 30 min at 100% of the individual anaerobic threshold, and a 5 min cool - down at a low workload (80 w [f]/100 w [m]). Brain cortical activity was recorded over 1 min at 10 and 20 as well as 30 min and subjects maintained a cadence of 90 rpm . Heart rate and cadence were displayed in real - time on a monitor placed in the subjects' natural viewing direction . Prior to the assessments, all subjects were instructed to stabilize their body position and avoid head movements and contractions of the jaw throughout the cycling exercise . Using a breathable cap, active agcl electrodes were placed on the subject's scalp to record eeg from frontal (f3, f4, fz, f7, and f8), central (c3, c4, and cz), and parietal (p3, p4, pz, p7, and p8) brain regions . The electrodes, which were positioned according to the international 10:20 system, were filled with an electrolyte gel to reduce impedance below 10 k. the eeg signal was amplified by the quickamp system (brainvision, germany) and sampled at 512 hz . Following the data acquisition, the analyzer 2.0 (brainvision, germany) was used for processing the eeg recordings . After a reduction of the sampling rate to 256 hz, data were digitally band - pass filtered (time constant 0.0318 s; 24 db / octave) and a frequency range of 3.0 to 40.0 hz remained for analysis . The recorded epochs represented the 10th, 20th, and 30th minutes during constant load cycling at pians . Following a manual inspection the artefacts tagged by the software were either rejected or confirmed . Subsequently, those segments were averaged individually within each recording period . By using a hanning window (20%), the eeg data were fast - fourier - transformed (fft) to calculate power values in the alpha (7.512.49 hz) and beta (12.532 hz) frequency domain . Subsequently, the alpha / beta ratio was calculated and averaged over the epochs representing the recordings during exercise . Accurate test - retest reliability for the alpha and beta power during cycling at 90 rpm has been reported with the eeg acquisition and processing methods used in the present study . Prior to group comparisons, gaussian distribution of the collected data was verified by the shapiro - wilk test . One - way anova (factor: group) was used to compare anthropometric measures between medium and high fit subjects . The effect of maximal oxygen consumption on alpha / beta ratio was analysed by applying 2 (group: low, high) 2 (condition: rest, exercise) 3 (region: frontal, central, and parietal) anova . In a subsequent analysis frequency (alpha, beta) was included as additional factor to assess the effect of maximal oxygen consumption on eeg spectral power . In case of nonsphericity greenhouse - geisser correction was applied . Between - subjects and within - subjects effects as well as interactions were reported and further analysed using fischer's lsd post hoc test . Subsequently, linear regression was used to predict brain cortical activity during exercise and maximal power from resting eeg . The adjusted pearson's multivariate coefficient of determination and as standardized coefficient are provided . For all statistical analyses, an alpha level of p brain cortical activity during exercise was recorded at 100% of the individual anaerobic threshold, which was 3.31 0.37 wkg and 2.74 0.45 wkg in high and low (f(1,27) = 13.66; p = 0.001; eta = 0.336), respectively . Subjects with higher maximal oxygen consumption also reached greater maximal power (4.67 0.33 wkg versus 4.11 0.49 wkg; f(1,27) = 13.28; p = 0.001; eta = 0.330) than the low group . The statistical analysis revealed main effects of group (f(1,27) = 12.04; p = 0.002; eta = 0.308), condition (f(1,27) = 4.24; p = 0.049; eta = 0.136), and region (f(2,26) = 8.50; p = 0.002; eta = 0.239) on subjects' alpha / beta ratio . Moreover, there was an interaction of condition and region (f(2,26) = 4.37; p = 0.025; eta = 0.139). Whereas alpha / beta ratio was increased at central brain region compared to parietal (t(28) = 3.36; p = 0.002) and frontal sites (t(28) = 2.74; p = 0.010) in the exercise condition, no regional differences were confirmed for the resting state . Furthermore, alpha / beta ratio was significantly different between high and low at all electrode sites (figure 1) in both the resting state (frontal: t(28) = 2.86; p = 0.008; central: t(28) = 2.52; p = 0.018; parietal: t(28) = 2.67; p = 0.013) and the exercise condition (frontal: t(28) = 3.19; p = 0.004; central: t(28) = 2.62; p = 0.014; parietal: t(28) = 2.37; p = 0.025). When frequency was included as additional factor, interactions with condition (f(1,27) = 11.37; p = 0.002; eta = 0.296) and group (f(1,27) = 8.43; p = 0.007; eta = 0.238) were confirmed . Compared to the resting state alpha (t(28) = 7.39; p <0.001) and beta power (t(27) = 12.43; p <0.001) were significantly increased across electrode sites during exercise . Moreover, high showed less beta power than low (t(28) = 2.45; p = 0.020). The relation between resting eeg rhythms, brain cortical activity during exercise, and maximal power is shown in table 3 . Whereas alpha / beta ratio at rest explained 57% of variance of alpha / beta ratio during exercise at frontal brain region, resting eeg at other electrode sites did not predict brain cortical activity during exercise . When frontal alpha / beta ratio at rest was used as the independent variable for the prediction of maximal power, the model was able to explain 15% of the variance compared to 18% and 26% for the use of central and parietal alpha / beta ratio, respectively . Compared to the resting state, the alpha / beta ratio was decreased during cycling exercise as beta power increased more than alpha power . This change towards a higher level of arousal or vigilance has also been reported in a recent review by ludyga et al . . Increased beta activity reflecting higher cortical activation might be the result of greater processing demands during exercise and the tendency of the sensorimotor system to maintain the current network set . The decrease of the alpha / beta ratio from rest to exercise was most pronounced at central brain region, where inter alia sensorimotor information of lower extremities is integrated . In this respect, the maintenance of pedaling movements is associated with increasing feedback from sensory afferents and feed - forward due to the recruitment of motor neurons [12, 30]. Although the magnitude of the changes in alpha / beta ratio from rest to exercise was similar between groups, high compared to low had a higher index in both conditions . Differences between athletes of high and low training or performance levels have also been observed at rest previously [4, 21]. . Found enhanced cortical synchronization of pyramidal neurons reflected by increased alpha activity in elite karate athletes . As alpha power serves as an inverse indicator of mental alertness or arousal [18, 19], this implies that athletes are more efficient in posing cortical neurons into a nonoperative mode . Consequently, it can be assumed that a lower level of arousal at rest, which was also observed in the present trial, is due to greater relaxation ability in subjects with higher maximal oxygen consumption . This is further supported by a lower beta power in high, because a decrease in beta power has been reported to be the eeg response to relaxation . By maintaining a low arousal at rest, attentional resources may be reserved for a subsequent recruitment in movement - related tasks and associated information processing . The present results support this assumption as high resting alpha / beta ratio was associated with high alpha / beta ratio at frontal brain region during exercise . In previous studies resting alpha and beta activity have also been related to different measures of cognitive and motor performance, so that neural efficiency in the resting state is suggested to predict task - related performance [13, 14]. This is also applicable to endurance exercise as arousal at rest was directly related to maximal power during cycling . Similar to the resting state, cyclists in high showed a higher alpha / beta ratio than low during exercise at the individual anaerobic threshold . This observation indicates that the neural efficiency hypothesis is applicable to endurance - trained athletes . The present findings are further supported by ludyga et al ., who confirmed a negative correlation between changes of aerobic performance and cyclists' brain cortical activity after a 4-week training period . Other studies have also shown that training elicits a decrease of cortical activity and the suppression of task - irrelevant cognitive processes [32, 33] during different movement - related tasks . Evidence from animal studies suggests that improved neural processing and increasing influence of the cerebellar thalamic cortical circuit are underlying mechanisms of training - induced enhancement of neural efficiency . In this respect, taniwaki et al . Have proposed that this increased influence reflects a change from internal to increasingly external and automatic processing of motor tasks . The execution of highly automated movements, such as handwriting, does not require much attentional resources . Therefore, the lower level of arousal during exercise in high could be explained by cycling becoming an increasingly automated process with training . The reservation of cortical sources in experts is further supported by the results of httermann and memmert, who showed that athletes compared to nonathletes had higher cognitive performance during cycling exercise of similar relative intensity . Furthermore, improvements in circulatory capacity and cerebrovasculature have also been suggested as underlying mechanisms for differences in eeg spectral power between athletes and nonathletes [21, 38]. Maximal oxygen consumption is correlated with cerebral blood flow, which is considered as a proxy for assessing neurogenesis . This indicates an increased formation rate of new neurons and improved cerebral blood flow in high compared to low . These improvements elicited by endurance exercise are thought to improve energy supply by creating a more supportive and nutritive environment for the surrounding neurons . However, future research is necessary to investigate whether or not an optimized energy supply accounts for enhanced neural efficiency during exercise . A methodological concern of eeg recordings during exercise is the potential impact of physiologic and mechanical disturbances . To reduce the possibility and impact of artefacts, the present study used a data acquisition and processing approach, which has proven reliable . Additionally, only experienced cyclists were included in the study, because their ability to stabilize the upper body at moderate to high intensity is necessary to reduce movement - related artefacts when eeg is recorded during exercise on a stationary bike . Therefore, it remains unclear whether or not the development of the alpha / beta ratio over time was different between groups . Nonetheless, the present results indicate a higher level of arousal in cyclists with lower aerobic fitness . As this was observed in both conditions, it cannot be ruled out that differences in alpha / beta ratio during exercise between high and low are mainly due to the differences observed in the resting state . Whereas previous studies also reported differences in alpha activity at rest between elite - athletes and nonathletes [15, 16, 40], this is not supported by the present findings . This could be due to a lack of high differences in performance and/or training levels between groups and the low sample size of the present study . However, the differences in alpha / beta ratio confirmed between groups imply that this index is sensitive to small differences in aerobic power . Nonetheless, further investigations with higher sample size and more aerobic fitness subgroups are warranted to test and extend the current findings . Furthermore, it remains unclear whether or not other variables related to neural efficiency, such as cognitive performance and intelligence, have influenced the observed differences between high and low . In conclusion, cyclists with high aerobic fitness compared to peers with less aerobic fitness are able to complete submaximal cycling exercise with a lower level of brain cortical activity . This indicates enhanced neural efficiency in subjects with high aerobic power, possibly due to the inhibition of task - irrelevant cognitive processes . Moreover the use of resting eeg rhythms as predictor for task performance is also applicable to cycling as resting state arousal predicted maximal power.
Obesity is a major public health problem with over two - thirds of americans overweight and greater than one - third obese . While new data have suggested a leveling off of the prevalence of childhood obesity, 12.4% of kindergarteners are obese and overweight five - year olds are four times as likely as normal weight five - year olds to become obese [2, 3]. It has been well documented that obesity leads to cardiac, metabolic, and other systemic health derangements . It has also been shown that these unfavorable changes may start as early as three years of age . Well - child checks have long been recognized as opportunities to foster healthy growth and development . These regular visits, which are performed with a health care provider, traditionally occur during the newborn period, at one, two, four, six, nine, twelve, fifteen, eighteen, and twenty - four months and every year thereafter . The goal is to provide continuity of care and allow for anticipatory guidance to be given . Recognizing that diet and nutrition are linked with obesity, it is important to address these topics . However, guidelines on nutrition counseling remain vague, and visit time is constrained by a multitude of other encouraged and essential components . Yet studies show that when it comes to counseling during well - child checks, less is more and focusing on fewer topics is more effective . However, these are notably imprecise with regard to early and targeted interventions to prevent and treat obesity in pediatric populations . Regarding nutrition counseling during well - child care within the first year of life, the american academy of pediatrics (aap) bright future guidelines contains goals for temporal introduction of foods rather than composition of diet . Even at the one - year visit, surprisingly, there is no mention of nutrition guidance at the fifteen- or eighteen - month well - child checks and it is not until the two - year visit that the subject of obesity is first addressed in the guidelines . Meanwhile, research shows that a rapid transition occurs between the one- and two - year well - child checks, when diet habits seemingly shift to favor fast foods, with the french fry as the number one consumed vegetable consumed by two - year olds . The world health organization (who) strongly advocates for exclusive breastfeeding in the first six months of life and offers recommendations on complimentary feeding habits . These include continuing on - demand breastfeeding until two years of age and starting at 6 months of age, gradually increasing the number of feedings, consistency, and variety of other foods . For a nonbreastfed child, who further recommends providing four to five meals per day, with one or two healthy snacks aimed to meet the child's nutritional needs . These who guidelines are appropriately aimed toward a global audience, with an emphasis on preventing malnutrition and ensuring adequate growth . Current literature on prevention and treatment for obesity has overwhelmingly focused on adolescent and school aged populations . The aap recommends screening for obesity starting at two years, while united states preventive services task force (uspstf) suggests waiting until age six [7, 10]. These recommendations bypass a likely window of opportunity for primary prevention prior to the second year of life, and in the case of the uspstf prior to six years . Given these vague universal recommendations, we hypothesize that significant variability exists in clinical practice . It has been demonstrated that there is variability among pediatric primary care practices regarding obesity counseling, attitudes, and perceptions . Some prior studies have focused on family medicine primary care providers' (pcps) beliefs and practices pertaining to childhood obesity . However, many of these studies have placed emphasis more specifically on evaluation of treatment modalities, perception of obesity as a disease, and physician training [1318]. Further, much of the previous work on childhood obesity appears directed beyond the age of five years, with few interventions studied between two and six years of age . This study builds upon the existing literature by offering a family medicine perspective and focusing specifically on perceived barriers and anticipatory guidance discussed at the early well - child checks particularly those prior to the second year of life . This is further warranted as much of the current literature occurred prior to the updated 2008 aap bright futures guidelines [7, 20]. Given the recent emphasis on primary care and the likely influx of pediatric patients via the accountable care act, family physicians will continue to provide a substantial amount of care for pediatric populations . The goal of the present study is to assess the perception of family medicine pcps in a university based family medicine network surrounding the barriers of preventing and treating obesity in the young child and to analyze pcps reported behaviors at well - child checks . In addition, the present study allows for a comparison of attitudes and practice between family medicine pcps and pediatric pcps who participated in an earlier study using a similar survey . The sample included all family medicine physicians, physician assistants (pas), and nurse practitioners (nps) at eleven family medicine duke primary care sites in duke university health systems . The survey used in the present study was developed based on a similar study performed in pediatric practices, current epidemiological literature, and recommendations from the american academy of pediatrics (aap) and the united states preventive services task force (uspstf) [6, 10, 11]. Previous authors were contacted for permission to utilize a similar survey tool . The survey contained three independent sections, each with a brief introduction . The sections were as follows: (i) perceived barriers in treating obesity, (ii) current pcp practices at well - child checks, and (iii) demographic information . Introductory phone calls with follow - up emails were sent in january 2012, prior to the in - person survey administration . An agreed upon morning or lunch hour time was arranged to include a ten- minute presentation explaining the goals of the project, with subsequent survey administration to all pcps who attended the meetings . An agreement was made to present the study findings to the participating sites at the conclusion of the study . Data collection was performed during january and february 2012 and the data were analyzed in march 2012 . Demographic data are presented as percentages / proportions . For questions related to perceived barriers, we calculated the percentage of respondents who indicated how important each issue was on a likert scale 15 (not important, slightly important, moderately important, very important, and critically important), as well as the combined percentage of those who responded either very important (4) or critically important (5). For pcp behaviors assessing anticipatory guidance, multiple responses were accepted (i.e., mark all well - child checks that apply). This study was reviewed by the research advisory board of the primary care research committee and the institutional review board of duke university and was found to be an exempt study (pro00034169). Surveys were completed by 56 of the 78 family medicine pcps (41 family medicine physicians, 8 physician assistants, and 7 nurse practitioners) at the 11 participating clinics, for a 72% response rate . Approximately 1/3 (35%) were 4049 years old, 1/3 (33%) were 3039, 27% were 50 + years old, and 5% were twenty through twenty - nine years old . The majority of pcps were medical doctors or doctors of osteopathic medicine (md / do) (73%), with physician assistants and nurse practitioners making up 14% and 13%, respectively . The average reported body mass index (bmi) of respondents was 24.71 kg / m (7 of the 54 respondents did not complete the bmi measures). Approximately 1/3 (33%) of the pcps were classified as overweight and 0.6% were in the obese category . Reported bmi closely mirrored pcps perception of their weight, as 30% indicated they were overweight and 2% believed they were obese . Pcps were asked to rate the relative importance of specific barriers to preventing or treating overweight or obese children . These questions related to children of all ages and focused on many factors including the child, parents, family unit, influence of society, and pcp factors . The five barriers that were most often rated as either very important or critically important were as follows: (i) families do not get enough exercise (93%); (ii) families often have fast food meals (86%); (iii) parent is not motivated to change diet or lifestyle (81%); (iv) families watch too much tv (79%); and (v) child is not motivated to change diet or lifestyle (75%) (table 1). The following barriers were rated as very important or critically important by 6072% of pcps: parent is unaware that child is overweight, parents are overweight so they are not concerned that child is overweight, families are too busy to eat home cooked meals, healthy foods are too expensive, tv advertisements promote unhealthy foods, pcps have limited time to discuss nutrition, and pcps are frustrated with the low success rate of treating overweight children . Barriers that pcps were less likely to rate as very important or critically important were as follows: overweight child does not act sick, overweight child is a good eater, parents do not have time to shop for healthier foods, families are too busy to eat meals together, healthy lifestyle habits are too complicated to follow, published reports about diet and nutrition are often confusing, school lunches promote unhealthy eating habits, pcps' time constraints, lack of training to treat overweight children, compensation for obesity treatment, access to nutritionists, and pcps' weight status or body mass index (table 1). Pcps were asked to mark all of the well - child checks in which they discuss a variety of health topics with patients . Analyzing the barriers perceived by pcps as most important to preventing and treating obesity revealed trends regarding fast food consumption and physical inactivity . As shown in table 2, even by their own report, most pcps did not discuss fast foods at or prior to the twelve - month visit . At the eighteen - month visit fast foods are discussed by 32% of pcps . Meanwhile, the two - year visit is the first well - child visit at which the majority of pcps (68%) discuss fast food . While the majority of pcps ultimately discuss this topic, the discussion is not undertaken by a majority of pcps at a specific encounter until the two- through five - year visits . Fruit and vegetable discussion increases in frequency as the child ages, with a peak of 63% of pcps discussing this at the twelve - month visit, before dropping to 51% at the eighteen - month visit . Between 22% and 26% of pcps discuss having 3 meals per day by the twelve - month visit, whereas 65% are discussing meal frequency at the two- through five - year visits . Physical inactivity / exercise was another area of concern with 93% of pcps recognizing this as a contribution to obesity, yet this topic was discussed by at most 23% of pcps at and/or before the twelve - month visit . By the eighteen - month visit, at most 48% of pcps had ever discussed the topic with their patients or families . The two- through five - year visits are the first time at which the majority of pcps (68%) discuss this topic . The percent of well - child visits where screen time is discussed closely mirrors physical activity / exercise, and a similar trend is seen regarding the discussion of fast foods (table 2). A major finding of the current study involved the relative importance pcps ascribe to perceived barriers in treating obesity . Our results reproduced those of a previous study utilizing a similar survey but performed within a pediatric setting . Our results confirm that family medicine pcps share the same top six concerns when dealing with perceptions surrounding obesity . These concerns center around physical inactivity, fast food consumption, and motivation to change . The barriers identified were in areas that were inconsistently addressed in practice, specifically prior to the two - year well - child check . Despite the apparent lack of congruence between the identified barriers and the actions by pcps in clinical practice, furthermore, due to the self - reported nature, pcps may overestimate how often they address certain issues . A second major finding of the current study was the inconsistency pcps demonstrated concerning when discussion took place for physical activity, fruit and vegetable selection, screen time, juice, and other beverage choices . This study suggests that primary prevention interventions targeting obesity in practice are either misplaced or missed altogether in some cases, which is consistent with other recent studies demonstrating missed opportunity for primary prevention of obesity [2124]. As this study is representative of an academic practice population with close geographic proximity, further study on a larger scale and in other practice populations the aap recommendations make no mention of fruits and vegetables until the five- and six - year well - child visits . In another case, the aap guidelines suggest the discussion of having 3 meals per day at the nine- and twelve - month well - child checks . However, in this study, only 26% of pcps have this discussion specifically at or before the twelve - month well - child visit . Interestingly 65% of pcps have this discussion at the two- through five - year well - child visits despite lack of specific recommendation to do so . Pcps seem to be aware of existing guidelines but, in this example, delay the delivery . Other than this specific recommendation at the five - year well - child visit, all of the earlier well - child visit nutrition and diet guidelines are relatively nonspecific regarding diet composition . This likely contributes toward the variability observed in this study, as many pcps chose to have discussions, such as fruits and vegetables, at differing well - child visits . Therefore, we believe that it would be advantageous to the goals of obesity prevention and treatment to have early and targeted interventions that precede adoption of adverse lifestyle choices [2527]. Although it is beyond the scope of this paper, innovative approaches in obesity treatment have been identified over the past decade [2830]. Comparing this study of family medicine pcps with a similar study done with pediatric providers revealed some similarities in practice behavior . Pcps behavior in both studies reflected the general aap anticipatory guidance guidelines pertaining to obesity [7, 11]. However, the anticipatory guidance discussions were not consistently performed at specific visits in either study, with greater variability observed in this family practice study (see table 2). Different methodologies were used in data collection, as the study for family medicine pcps was measured using a cumulative approach, whereas the pediatric study was measured at point of first intervention . In comparing these studies, we chose to use the most conservative estimates by summating the percentages of anticipatory guidance being discussed . For example, a single pcp may have indicated that they discussed fast food at both the four- and six - month visits . Our study would count both of these as unique interventions being done by different pcps . Consequently, these findings may offer a realistic representation or, otherwise, an overestimation of how often topics were discussed at well - child checks . The present study identifies discrepancies in pcps adherence to counseling guidelines for nutrition, exercise, and screen time . In regard to exercise and screen time, this study demonstrates similar increases in the percentage of pcps discussing these topics, with the majority doing so at the two- through five - year well - child checks, and a peak between the six- through eleven - year well - child checks . However, the aap guidelines suggest that a majority of pcps address each of these topics much earlier . It would be beyond the scope of this discussion to address all elements of the survey . Therefore, the remainder of this discussion will focus on the results relevant to fast food counseling and nutrition and their role in obesity prevention . A surprising result from this study was that there is no clear consensus as to when pcps are having discussions about fast food . While a prior study indicated that 62% of pediatricians addressed fast foods at or prior to twelve - month well - child visits, this study shows that at most 39% of family physicians did so (table 2). These estimates suggest that there is still a large percentage of the population receiving no counseling on fast food during the entire first year of life . It is not until the two - year well - child visit that a majority of pcps discuss fast food . Meanwhile, previous research has shown that there is a profound shift in dietary habits toward fast foods, such as french fries, that occurs between the one- and two - year well - child checks . To address fast food consumption, pcps could consider integrating a universal french fry discussion regularly at the twelve - month well - child care visit . Given the recognition that food transitioning towards fast foods such as french fries occurs within the subsequent window from twelve months to twenty - four months, it might be beneficial to offer a specific intervention at this visit . Furthermore, prior research has shown that a dedicated intervention targeting two - year olds and their families can significantly reduce bmi . The french fry discussion could take the form of a purposeful talk with family members about the importance of avoiding fast foods, fried foods, and sweetened beverages . For example, using motivational interviewing techniques has been shown to be effective in changing behavior relating to obesity, and this approach may address such a complex behavior [32, 33]. This visit could additionally include handouts or printouts about alternative foods and snacks that are affordable and can be prepared quickly . Rather, this should be an individualized discussion, in which family members are encouraged to voice their concerns and devise solutions that meet their unique situation . As such, we would not anticipate a discussion of this relevance requiring anything less than ten minutes of dedicated visit time . The goal of this discussion would be to leverage the patient - physician - family relationship to positively impact lifestyle choices for both the child and the family . Further study is needed to examine actual obesity prevention and treatment guidelines in clinical practice and to discern the specifics, feasibility, and benefits of incorporating additional counseling into routine well - child care.
Prostate cancer is a common malignancy and a main cause of cancer - related death in men . In 2014 in the united states, an estimated 233 000 new cases will be diagnosed and 29 480 men will die of the disease . In recent years, with the widely adopted prostate - specific antigen (psa)-based screening and biopsy program, the majority of prostate cancer can be detected in the early stage and can be treated by radical prostatectomy . However, approximately 30% of prostate cancer patients will experience recurrence after the initial surgery and many of them will develop metastatic disease [47]., the disease progresses relatively slow, but other cases grow aggressively and rapidly metastasize to other part of the body . Currently, the major challenge in prostate cancer management is to predict the outcome of the disease accurately at the time of diagnosis, to identify who will need active treatment . Clinical stage, psa, and gleason score are currently commonly used as prognostic indicators, but the accuracy is limited . It is well known that the initiation and progression of prostate cancer results from the accumulation of genetic and epigenetic changes . Epigenetic changes are characteristic of nearly all human tumors, including prostate cancer, and include changes in dna methylation, micrornas, and histone modifications . Identification of epigenetic changes involved in the initiation and progression of prostate cancer will identify novel diagnostic and prognostic biomarkers and therapeutic targets . Although the exact mechanism of how these epigenetic changes arise in prostate cancer is not well understood, the fact that they occur much more frequently than genetic changes may make them useful as potential biomarkers . Dna methylation is the best studied epigenetic modification in prostate cancers, which occurs at cpg islands in the promoter region of a number of genes and cause transcriptional silencing of gene expression . Promoter hypermethylation of critical genes could be useful biomarkers and therapeutic targets for prostate cancer . The protocadherin8 gene is located on human chromosome 13q14.3; the gen product contains 6 extracellular cadherin domains, a transmembrane domain, and a cytoplasmic domain . Protocadherin8 plays crucial roles in cell adhesion, signal transduction, proliferation, migration, and invasion [1924]. A growing number of studies have demonstrated that protocadherin8 functions as a tumor suppressor in human cancers [1924]. Moreover, it is frequently inactivated by promoter methylation in bladder cancer, renal cell carcinoma, nasopharyngeal carcinoma, gastric cancer and breast cancer, and is associated with poor prognosis [1924]. However, the methylation status and its clinical significance in prostate cancer remain unclear . In the current study, we analyzed the methylation status of protocadherin8 in localized prostate cancer tissues using methylation - specific pcr (msp). Msp is a major technique for detecting gene methylation and can provide specific and sensitive results . We also evaluated its association with biochemical recurrence - free survival of patients with prostate cancer in order to analyze its potential as a biomarker in this disease . A total of 162 prostate cancer tissues were obtained from patients with early - stage prostate cancer during radical retropubic prostatectomy at the third hospital of hebei medical university between 1999 and 2008 . Prostate tissues obtained from 47 patients with benign prostatic hyperplasia (bph) during transurethral resection of prostate at the same time in the same hospital were used as normal controls . None of the patients with prostate cancer received any form of anti - tumor therapy before surgery, and none received adjuvant therapy before recurrence . The samples were flash - frozen in liquid nitrogen at the time of collection and stored at 80c until used . Biochemical recurrence was defined as the period between radical prostatectomy and the measurement of 2 successive values of serum psa level 0.2 ng / ml . The common clinicopathologic parameters were recorded, including preoperative serum psa, pathological stage, seminal vesicle invasion, gleason score, lymph node status, margin status, and follow - up data . The patients were followed up at intervals, ranging from 15 months to 60 months . This study was performed according to the declaration of helsinki and was approved by the ethics committee of the third hospital of hebei medical university (no . Genomic dna was isolated from frozen tissues using the dneasy tissue kit (qiagen, valencia, ca). The isolated dna was modified with bisulfite using epitect bisulfite kit (qiagen, valencia, ca) and standard protocol as described previously . Bisulfite modified dna was used for msp with primers specific for either methylated or unmethylated dna . Methylated: forward 5-cggttattggttattcggttcc-3 and reverse 5-acgaactctaaaaacgcgcg-3. Unmethylated: forward 5-ggtggttattggttatttggttt-3 and reverse 5-ccaacaaactctaaaaacacaca-3. Amplifications were carried out using the following profile: 1 cycle of 95c for 5 min, 40 cycles of 95c for 30 s, 60c for 30 s, and 72c for 30 s, and 1 cycle of 72c for 5 min . In vitro methylated dna and unmethylated dna (new england biolabs, beverly, ma, usa) was used as methylation and unmethylation positive control, and water blanks were included with each assay as previously reported . Msp products were separated in 2% agarose gel, stained with ethidium bromide, and visualized under ultraviolet illumination for analysis . Samples were scored as methylation negative when bands were present only in the unmethylated dna lane and as methylation positive when methylated alleles were present in the methylated dna lane . Statistical analysis was done using sas version 8.0 (sas institute, cary, n.c . The difference of protocadherin8 methylation status between prostate cancer tissues and controls were evaluated using fisher s exact test . The associations between protocadherin8 methylation and clinicopathologic parameters were evaluated by chi - square test . For biochemical recurrence - free survival analysis, kaplan - meier survival analysis was used and the differences in survival were analyzed using the log - rank test . Univariate and multivariate cox proportional hazard models were used to evaluate the prognostic effect of protocadherin8 methylation in prostate cancer . A total of 162 prostate cancer tissues were obtained from patients with early - stage prostate cancer during radical retropubic prostatectomy at the third hospital of hebei medical university between 1999 and 2008 . Prostate tissues obtained from 47 patients with benign prostatic hyperplasia (bph) during transurethral resection of prostate at the same time in the same hospital were used as normal controls . None of the patients with prostate cancer received any form of anti - tumor therapy before surgery, and none received adjuvant therapy before recurrence . The samples were flash - frozen in liquid nitrogen at the time of collection and stored at 80c until used . Biochemical recurrence was defined as the period between radical prostatectomy and the measurement of 2 successive values of serum psa level 0.2 ng / ml . The common clinicopathologic parameters were recorded, including preoperative serum psa, pathological stage, seminal vesicle invasion, gleason score, lymph node status, margin status, and follow - up data . The patients were followed up at intervals, ranging from 15 months to 60 months . This study was performed according to the declaration of helsinki and was approved by the ethics committee of the third hospital of hebei medical university (no . Genomic dna was isolated from frozen tissues using the dneasy tissue kit (qiagen, valencia, ca). The isolated dna was modified with bisulfite using epitect bisulfite kit (qiagen, valencia, ca) and standard protocol as described previously . Bisulfite modified dna was used for msp with primers specific for either methylated or unmethylated dna . Methylated: forward 5-cggttattggttattcggttcc-3 and reverse 5-acgaactctaaaaacgcgcg-3. Unmethylated: forward 5-ggtggttattggttatttggttt-3 and reverse 5-ccaacaaactctaaaaacacaca-3. Amplifications were carried out using the following profile: 1 cycle of 95c for 5 min, 40 cycles of 95c for 30 s, 60c for 30 s, and 72c for 30 s, and 1 cycle of 72c for 5 min . In vitro methylated dna and unmethylated dna (new england biolabs, beverly, ma, usa) was used as methylation and unmethylation positive control, and water blanks were included with each assay as previously reported . Msp products were separated in 2% agarose gel, stained with ethidium bromide, and visualized under ultraviolet illumination for analysis . Samples were scored as methylation negative when bands were present only in the unmethylated dna lane and as methylation positive when methylated alleles were present in the methylated dna lane . Statistical analysis was done using sas version 8.0 (sas institute, cary, n.c ., usa) the difference of protocadherin8 methylation status between prostate cancer tissues and controls were evaluated using fisher s exact test . The associations between protocadherin8 methylation and clinicopathologic parameters were evaluated by chi - square test . For biochemical recurrence - free survival analysis, kaplan - meier survival analysis was used and the differences in survival were analyzed using the log - rank test . Univariate and multivariate cox proportional hazard models were used to evaluate the prognostic effect of protocadherin8 methylation in prostate cancer . In the current study, the methylation status of protocadherin8 in 162 prostate cancer tissues and 47 controls was detected by msp . Protocadherin8 methylation was detected in 76 (46.9%) prostate cancer cases (figure 1). However, no protocadherin8 methylation was found in the controls, and the difference between prostate cancer cases and controls was statistically significant (p<0.0001). Subsequently, we linked the methylation status of protocadherin8 to clinicopathologic parameters in prostate cancer cases to elucidate its clinical significance . Protocadherin8 methylation was significantly associated with advanced pathologic stage (p=0.0122), higher level of preoperative psa (p=0.0004), higher gleason score, (p=0.0187), positive lymph node metastasis (p=0.0314), and biochemical recurrence (p<0.0001). However, it was not significantly associated with age, surgical margin status, or seminal vesicle invasion . Next, we examined the biochemical recurrence - free survival of patients with prostate cancer according to protocadherin8 methylation status to elucidate its prognostic value . Interestingly, patients with protocadherin8 methylated had worse prognosis than patients without (p<0.0001, figure 2). To further determine the associations between biochemical recurrence - free survival and potential risk factors, univariate and multivariate cox regression model analysis was performed . Univariate cox regression analysis first showed that gleason score, preoperative psa level, pathologic stage, and protocadherin8 promoter methylation were risk factors for poor biochemical recurrence - free survival . These risk factors were entered into multivariate cox regression analysis, revealing that protocadherin8 methylation and gleason score were independent prognostic risk factors for biochemical recurrence - free survival of patients with prostate cancer . It is of great important to identify novel prognostic and predictive markers to understand this multifaceted disease process and to identify which patients need more aggressive treatment after initial curative surgery [6,7,1416]. Dna methylation of cpg islands within the promoter region of genes is an alternative mechanism of gene silence to genetic changes and is frequently involved in the development and progression of many types of human cancers, including prostate cancer . Aberrant promoter methylation of some genes that are normally unmethylated may be used as potential molecular markers for the diagnosis, surveillance, and prognosis in prostate cancer . Protocadherin8 is a tumor suppressor gene and is frequently silenced by aberrant promoter methylation in several human cancers . To date, the association between promoter methylation of protocadherin8 and the prognosis of prostate cancer has not been reported . This is the first study to investigate the prognostic value of protocadherin8 methylation in prostate cancer based on a relatively large number of clinical samples . In the current study, we analyzed the methylation status of protocadherin8 in 162 prostate cancer tissues and 47 normal prostate tissues using msp . We demonstrated that protocadherin8 methylation appeared more frequently in prostate cancer tissues than in normal prostate tissues . Moreover, when we analyzed the association between protocadherin8 methylation and traditional clinicopathologic features in prostate cancer, we found that protocadherin8 methylation was significantly correlated with advanced pathologic stage, higher level of preoperative psa, higher gleason score, positive lymph node metastasis, and the occurrence of biochemical recurrence . These results suggest that protocadherin8 methylation plays an import role in the progression of prostate cancer and may be associated with the poor prognosis . To verify this hypothesis, kaplan - meier survival analysis was performed, showing that the biochemical recurrence - free survival time of patients with protocadherin8 methylated was significantly shorter than patients without . Moreover, univariate and multivariate cox regression analysis demonstrated that protocadherin8 methylation is an independent predictor of the prognosis of prostate cancer . These results suggest that the detection of protocadherin8 methylation in tumor samples after surgery may help identify the patients prone to recurrence and could be a novel predictor for disease course in prostate cancer patients . Our present data demonstrated that aberrant promoter methylation of protocadherin8 occurred frequently in prostate cancer, but not in normal prostate tissues . This result indicates that protocadherin8 methylation is tumor - specific and may be an early event in prostate cancer . In addition, the clinical significance of protocadherin8 methylation in prostate cancer is similar to findings of studies on other cancers [1921]. Our findings further verified the possibility of using protocadherin8 methylation as a potential biomarker in prostate cancer . Studies are needed to investigate the cause of protocadherin8 methylation and to discover how to reverse the methylation status of protocadherin8 in prostate cancer . Promoter methylation of protocadherin8 is a frequent event in prostate cancer, and is associated with traditional risk factors of poor prognosis and shorter biochemical recurrence - free survival time . The present results indicate that protocadherin8 methylation is an independent prognostic factor for biochemical recurrence - free survival in prostate cancer patients . Our findings suggest that protocadherin8 methylation might be a useful prognostic biomarker and a potential therapeutic target for prostate cancer.
Madelung's disease is characterised by multiple disfiguring abnormal fat masses in the head, the neck, and the radix of upper limbs; in 90% of cases it's associated with alcohol abuse . The local injections of phosphatidylcholine / deoxycholate solution have been gaining an increasing consensus as a non - invasive method to shrink localized adiposities . The authors report their long term experience on the assessment of serial intralipotherapy with phosphatidylcholine / deoxycholate in two patients affected by madelung's disease . Two male patients suffering from madelung's disease underwent serial intralipotherapy with phosphatidylcholine / deoxycholate (lipostabil -nattermann pharma, cologne, germany). Pre- and 6 months post - treatment dimensions were assessed by measuring three diameters in each lesion with a 7.5 mhz probe ultrasound (us) scan performed by the same operator . A 45-year - old man, smoker, without history of alcohol abuse, affected by multiple comorbidities, presented with symmetric huge lipomatosis of the head, neck, dorsum, posterior aspect of the arms and testicles . Chest x - rays and head and neck magnetic resonance imaging (mri) confirmed the infiltrative distribution of the lipomatosis and excluded the involvement of the trachea and other deep structures . Even if a previous surgical excision of some cervico - occipital adipose deposits had been successful, the patient, who was still physically and psychologically impaired, refused a further surgical treatment under general anaesthesia of the remaining untreated adipose deposits: these infiltrating masses were therefore addressed with serial intralesional lipostabil injections . Under us scan control 5 ml of lipostabil were injected into the jugular, submandibular and right cheek masses, respectively . The injections were repeated monthly for an overall of three treatments per lesion [figures 1 and 2]. Case 1, right cheek mass: (a) pre - treatment view; (b) post - treatment view case 1, submandibular and jugular masses: (a) pre - treatment view; (b) post - treatment view a 49-year - old - man, with a history of alcohol abuse and multiple comorbidities presented with enormous bilateral axillary fat deposits and some unpleasant adipose deposits in the dorsum and the submental and supraclavear areas . The axillary masses were surgically addressed, with no evidence of recurrence at 4 years follow - up . Three other smaller submental and bilateral supraclavear deposits were injected with 5 ml of lipostabil each under us scan control . The injections were repeated monthly for an overall of three treatments per lesion [figures 3 and 4]. Case 2, bilateral supraclavear masses: (a) pre - treatment view; (b) post - treatment view case 2, submental mass: (a) pre - treatment view; (b) post - treatment view a 45-year - old man, smoker, without history of alcohol abuse, affected by multiple comorbidities, presented with symmetric huge lipomatosis of the head, neck, dorsum, posterior aspect of the arms and testicles . Chest x - rays and head and neck magnetic resonance imaging (mri) confirmed the infiltrative distribution of the lipomatosis and excluded the involvement of the trachea and other deep structures . Even if a previous surgical excision of some cervico - occipital adipose deposits had been successful, the patient, who was still physically and psychologically impaired, refused a further surgical treatment under general anaesthesia of the remaining untreated adipose deposits: these infiltrating masses were therefore addressed with serial intralesional lipostabil injections . Under us scan control 5 ml of lipostabil were injected into the jugular, submandibular and right cheek masses, respectively . The injections were repeated monthly for an overall of three treatments per lesion [figures 1 and 2]. Case 1, right cheek mass: (a) pre - treatment view; (b) post - treatment view case 1, submandibular and jugular masses: (a) pre - treatment view; (b) post - treatment view a 49-year - old - man, with a history of alcohol abuse and multiple comorbidities presented with enormous bilateral axillary fat deposits and some unpleasant adipose deposits in the dorsum and the submental and supraclavear areas . The axillary masses were surgically addressed, with no evidence of recurrence at 4 years follow - up . Three other smaller submental and bilateral supraclavear deposits were injected with 5 ml of lipostabil each under us scan control . The injections were repeated monthly for an overall of three treatments per lesion [figures 3 and 4]. Case 2, bilateral supraclavear masses: (a) pre - treatment view; (b) post - treatment view case 2, submental mass: (a) pre - treatment view; (b) post - treatment view clinically, a significant progressive shrinkage together with a change from a soft to a harder consistency of the adipose masses was appreciated . No alterations were reported in serum lipid pattern 1 month after the last treatment . At 6 months follow - up all of the lesions appeared stable . Dimension changes in the treated lesions as demonstrated by us scan 6 months after the treatment are reported in table 1 and figure 5 . No local and/or systemic side - effects were reported . In both patients, one treated lesion out of three showed a slow clinical progression and required surgical excision . All of the other treated lesions are clinically stable at 5 years follow - up . Measures in centimetres of the three main diameters at us scan before and after 3 injections of lipostabil ultrasound scan images - case 1, right cheek mass: (a) pretreatment; (b) post - treatment madelung's disease is a lipomatosis classified in type 1, with adipose masses symmetrically distributed in the body and in type 2, with a diffuse obese - like fat distribution . Diagnosis is clinically based and mri, computed tomography, and us scan allow evaluation of the fat deposits distribution . Our two cases belong to type 1 with evident deposits in the head and neck . Both patients had their major masses surgically removed; the smaller, but more visible ones were deliberately addressed non - surgically with lipostabil, in order to avoid or at least postpone further surgery . Treatment of hyperlipidemias and fat emboli, but diffusely employed subcutaneously in an off - label regimen to reduce localised adiposity and the volume of lipomas . The off - label use of lipostabil for the treatment of localised adiposity is actually controversial in the literature . In 2010, the united states food and drug administration (fda) cautioned medical spas against misleading consumers by false statements about drugs including phosphatidylcholine / deoxycholate that would eliminate fat in a procedure called lipodissolve . The fda keeps encouraging health care professionals and consumers to report any side - effects with the use of these drugs to the fda's medwatch adverse event reporting program . It is approved for cardiological use to reduce cholesterol in some countries in europe, though not including the united kingdom . Until date, lipostabil is not available in the italian market as the product trade registration was no longer provided by the manufacturer since may the 20 2004 . Nevertheless, in italy, by the law 94/1998 the clinical use of phosphatidylcholine / deoxycholate is currently allowed as a galenical under the following strict circumstances: the treatment should be tailored on one individual patient, the physician should provide the patient a fully informed consent and the prescription should provide both the patient's identity data and a reference number to the physician's medical archive . Its lipolytic action seems to be based on stimulation of lipase activity, emulsification and transport of triglycerides and a detergent action by its two main components, both causing cell membrane lysis, inflammation, fibrosis and degeneration of fat tissue . In one case acute renal failure and liver dysfunction have been reported as severe systemic side - effects following a single high dose subcutaneous injection . Recently, it has been suggested that phosphatidylcholine might eventually have some therapeutic role in some cancers as animal studies indicate that deficiencies in choline and phosphatidylcholine may disrupt cell membrane signal transduction in ways that could lead to various cancers . Furthermore, there is ample evidence that liver cancer is promoted in various animals by choline - deficient diets, and it has been shown that excess choline has a protective effect against carcinogenesis . Known safety limits of phosphatidylcholine / deoxycholate compound are 15 mg / kg . A successful experience of serial intralipotherapy with a blend of lidocaine, aminophillin, l - carnitine, phosphatidylcholine and deoxycholate solution for the treatment of one patient affected by madelung's disease is reported . According to the literature common off - label use of phosphatidylcholine / deoxycholate compound for localised fat deposits ranges between 1000 and 250 mg / session . Our choice of lipostabil dosage, therefore, considered both the fat masses size and those safety limits . Our results objectively demonstrated an average reduction of 42.5% in the three us scan measured diameters in all of the treated lesions 6 months after the treatment [table 2 and figure 5]. Percentage reduction of the masses at us scan in the three main diameters the 5 years clinical follow - up demonstrated the long - term functional and cosmetic stable results in 66% of the treated lesions . The treatment also proved to be safe as serum lipid status was not modified at 1 month since the last infiltration session . In madelung's disease, the surgical approach is always invasive and often risky both for the anatomical complexity of the involved areas (cervico - facial regions) and for these patients general conditions, which are poor most of the time . The objectively demonstrated efficacy and safety of the treatment at the employed dosage together with its easy execution confirm the role of lipostabil as a non - invasive palliative reasonable therapeutic opportunity in madelung's disease and an alternative to surgery in the more awkward locations of the disease . The phosphatidylcholine / deoxycholate compound needs wide investigation for new treatment uses and long - term studies and hence that the recommended dose and safe application technique can be standardised . The use of lipodissolve products should be considered an experimental treatment and be performed under strict medical control for both therapeutical and cosmetic purposes . Our experience might, therefore, further contribute to the investigation of limits and possibilities of the clinical use of phosphatidylcholine / deoxycholate in the treatment of localised adiposities of any nature . According to our experience the inclusion of phosphatidylcholine / deoxycholate intralesional intralipotherapy in the armamentarium for the palliative treatment of madelung's disease might be recommended to reduce the volume and limit the growth of the pathological adipose masses and to restrict the aggressive and often unacceptable anatomical consequences of the disease.
Unawareness, lack of insight, or anosognosia refers to impaired awareness in persons with dementia [17]. Awareness is multifactorial and likely modular [4, 810], with each domain separable and potentially unique . Most of the literature on awareness in persons with dementia describes the clinical correlates of one awareness domain (reviews by [1, 4, 11]), but the few studies that have contrasted awareness for different domains have found differential patterns of clinical correlates [1215]. This paper provides further support for the modality specific nature of awareness in dementia by contrasting the clinical correlates for awareness of balance in addition to more commonly measured awareness of day - to - day function and memory . Awareness quantification remains elusive, and there is no consensus method for measuring awareness (e.g., [4, 9]). Awareness has been measured with clinician ratings [16, 17]; or based on discrepancy between self - report versus clinicians' impression or versus informant report assessed with interview [10, 18] or questionnaires [7, 12, 14, 1921]; or discrepancy between self - report and objective performance [21, 22], which, depending on the task, measures self - monitoring or metacognitive abilities . Detail difficulties with patient / informant discrepancies and the assumption that caregiver informants' or clinicians' reports are a better reflection of reality . Moreover, worry, anxiety, defensiveness, denial, or focus on more important problems can influence reflection for persons with dementia . Caregivers' reports may be more highly correlated with objective measures of cognition than patient self - reports, suggesting there is value in using patient / informant discrepancies . Nevertheless, caregiver / patient discrepancies may be a better measurement of patients' awareness of function, whereas clinician / patient discrepancies may be a better measure of patients' awareness of cognition . Due, in part, to measurement challenges when assessing awareness, the literature on the clinical correlates of awareness in persons with dementia is contradictory . Most, but not all, of the cumulative data suggest increasing dementia severity is associated with reduced awareness [1, 16, 18]. Others have found few group - based differences, but high individual variability in awareness declines when studied over one year, potentially because severity and awareness are mediated by cognitive reserve . Other important clinical correlates of awareness include depression [18, 21, 22, 25], neuropsychiatric status [1921, 26] caregiver burden [10, 11, 14, 26], activities of daily living, and neuropsychological status [12, 19, 20, 22, 2729] which demonstrate variability in associations with awareness across domains and measurement methods . Models of awareness suggest awareness is mediated by the frontal lobes [2, 3] or the right frontal lobe [30, 31], and lack of awareness is associated with other behavioural indicators of frontal dysfunction, such as increased apathy . Localized imaging has implicated the orbitofrontal cortex, but most have implicated medial structures [34, 35], including the anterior and posterior cingulate in awareness . Despite converging evidence for prefrontal involvement in awareness, awareness may or may not be associated with tests of executive function (see review by). Some studies demonstrate strong relationships between awareness and executive functioning [12, 19, 20, 27], with others reporting nonsignificant and trivial associations [19, 29]. Although clearly composite measures that rely on more basic cognitive functions, many summary scores from traditional tests of executive function are associated with the dorsolateral prefrontal circuit, and awareness has been associated with more midline [3436] or orbitofrontal aspects of the prefrontal cortex . Contradictory data on the clinical correlates of awareness is also due to the assumption that awareness is a unitary construct (see reviews by [4, 8]). Differential patterns of clinical correlates have been demonstrated for awareness of cognitive deficits versus awareness of behaviours [1215], suggesting that awareness is modality specific . The primary purpose of this paper is to describe the clinical correlates of awareness of balance in addition to the more commonly measured awareness of function in basic and instrumental activities of daily living (badls and iadls, resp .) And awareness of memory . Awareness of balance is important in persons with dementia due to its relation with fall risk . We hypothesize that awareness of balance will be associated with physical variables, such as gait, falls, and objectively measured balance . Based on the conceptualization of markova and colleagues and work suggesting differential clinical correlates for awareness of specific domains [13, 15], we hypothesize that awareness of functional abilities, memory, and balance will have differential patterns of clinical correlates . A secondary purpose of this paper is to contrast awareness for balance, function, and memory for those diagnosed with mild cognitive impairment (mci). Reduced awareness has been demonstrated for persons at high risk for dementia, and specifically for persons with amnestic mci (amci). Moreover, since awareness appears to differ based on dementia subtype, awareness for balance, function, and memory could be differentially affected for participants diagnosed with dementia due to ad versus non - ad dementias . Therefore, the final comparison will explore awareness in groups of persons diagnosed with amci, non - amnestic mci, ad, and non - ad dementias . Patients were from an interdisciplinary memory clinic established to provide early stage dementia differential diagnoses for rural persons . For this irb approved study, patients who were diagnosed with no cognitive impairment were excluded, and only patients who received a diagnosis of dementia or a variant of mci were included . Diagnoses in this specialty clinic were consistent with the review of diagnostic guidelines provided by the canadian consensus on the diagnosis and treatment of dementias using recent comprehensive blood work, ct head scan, and interprofessional assessment data from neurology, neuropsychology, and physical therapy . The assessment procedures included standardized approaches (e.g., questionnaires, neuropsychological testing) and also family interviews for clinical history and interviews with the informal caregiver who accompanied patients to the clinic (families were strongly encouraged to attend the assessment and patients were asked to bring someone who knew them well . In the unusual circumstance when patients attended the clinic alone, telephone interviews were conducted with someone who knew them well, but questionnaire data were not collected). The sample consisted of 259 patients (in the clinic's 6th data release), and the vast majority (74%) reported their ancestry as european, 9% were first nations or metis, and 17% chose other, rather than selecting one of the aforementioned categories, african or asian ancestry . Table 1 includes descriptive information for the total clinical sample (n = 259 patients) and details the subgroups based on diagnosis . Patients with dementia due to ad was the most common diagnosis (n = 113), and another heterogeneous subgroup (n = 100) was created of patients with non - ad dementias (i.e., vascular dementias, mixed dementias, diffuse lewy body disease, dementia due to parkinsons' disease, huntington's dementia, variants of frontotemporal lobar degeneration, and dementias not otherwise specified). In addition, a third group included patients diagnosed with amnestic (single or multiple domain) mild cognitive impairment (amci; n = 23) and a fourth group included patients diagnosed with nonamnestic mci (non - amci; n = 23; single or multiple domains, which included those with diagnoses of vascular cognitive impairment, no dementia). Although most of the clinic data were focused on patients for diagnostic purposes, informal caregivers (n = 244) provided important collateral and personal information . Caregivers (m age = 61.40, sd = 14.63) were typically family members and most of many were females (64%): 33% were wives, 20% were husbands, 31% were daughters, 10% were sons of the patient, with a remaining 7% whose relationship status included grandchildren, nieces, nephews, or friends . Clinical correlates of awareness measures (1) assessment of severity . The clinical dementia rating (cdr) is a standardized and psychometrically sound clinician - based rating scale (0 to 3; no impairment to severe impairment), but summing the box scores of the six rating areas of the cdr (cdr - sob) provides a more detailed quantitative measure of global dementia severity and is more sensitive to detecting changes in dementia severity over time . Patients rated their performance on the reliable and valid lawton instrumental activities of daily living (iadl higher scores indicating independent functioning). Patients' caregivers rated patients' performance of adls on two psychometrically strong scales: the functional assessment questionnaire (faq) and the bristol adl questionnaire where higher scores indicate impaired performance . The neuropsychiatric inventory (npi) is a well - researched and psychometrically strong caregiver rating of patients' behaviours and associated caregiver distress . The centre for epidemiologic studies of depression (cesd), a reliable and valid screen of depression, was self - rated by patients, with four factors: (1) depressed affect (2) lack of positive affect (3) somatic / vegetative and (4) interpersonal measuring social disconnectedness . Self - report of caregiver burden was assessed with the short form of the zarit burden interview, which was shown to be psychometrically similar to the longer versions . The global severity index from the brief symptom inventory (bsi) measured caregiver self - report of overall psychological distress . (5) assessment of physical variables . A comprehensivephysical therapy assessment included the psychometrically strong berg balance scale (bbs) and the performance oriented mobility assessment (poma, which is a measure of gait and balance). Caregiver and patient reports of falls within the past 6 months were combined with bbs to estimate the probability of falling . Patient self - report on the activities - specific balance confidence (abc) scale measured self - reported confidence in balance while doing a variety of day - to - day activities . Each patient received a comprehensive neuropsychological assessment (see for a review of the strong psychometric properties of these tests), and selected measures of executive function and working memory were analyzed . The ability to alternate attention was measured with the trail making test part b (tmt b). The ability to inhibit an automatic response was measured with the stroop interference score . Cognitive flexibility with speeded retrieval of language - based knowledge was measured using animal naming and phonemic fluency (benton oral word association test). Digit span backward subtest from the wechsler adult intelligence scale 3rd edition (wais - iii) measured working memory . Finally, the index scores from the repeatable battery for the assessment of neuropsychological status (rbans) were analyzed . Awareness of functional deficits (af) was operationalized using patient / caregiver congruence on reports of the patient's ability to independently perform six iadls: management of finances, use of telephone, use of transportation, shopping, meal preparation, and performance of housework (patient self - report version of the lawton iadl scale; and caregiver report of patient's function from the bristol adl scale). For each iadl, congruence was ranked on a 5-point scale; the congruence ranking was summed across the six iadl items for a total of 30 possible points, with higher scores indicating greater awareness . Data were available for 201 participants, and as can be seen in table 1, most patients had good awareness of their functional abilities . Af was significantly higher in the two mci diagnostic groups when compared with the two groups with dementia diagnoses . Awareness of memory (am) was based on congruence between patient's self - reports of memory on a standardized scale (self - rating of memory scale) and performance on a neuropsychological test of new learning (repeatable battery for assessment of neuropsychological status; rbans delayed memory index score). The delayed memory measure was chosen since it best captured consolidation difficulties asked about in the self - rating of memory scale . Both the self rating of memory standardized scores and the rbans index scores were transformed into a linear ranked scale from 1 to 5, with 1 indicating the lowest self - rating of memory and the lowest memory performance . The am score was created based on the congruence in ranking between self - reported and objectively measured memory, with 5 indicating perfect congruence . Complete data were available for 192 participants . As can be seen in table 1, most participants' am was at the mid - point of the scale, but the ad and the amci subgroups reported significantly lower am than the non - ad dementia and non - amci groups . Awareness of balance (ab) was based on congruence between patients' ratings of balance confidence on the abc scale and the probability of falling . The abc and probability of falling were each transformed into ranked scores with 1 indicating low confidence or high probability of falling and 4 representing high confidence or low probability of falling . The ab score was created based on the congruence in ranking between self - reported balance confidence and objectively measured probability of falling, with 1 indicating low congruence and 4 indicating perfect congruence . Perfect congruence between balance confidence and objective measurement may not be sufficient for stability; rather underestimation of balance (i.e., less confidence than objective measurement would support) has been shown to be associated with greater stability (e.g., [38, 65]). Consistent with this premise, ab ranking of 5 represented an underestimation of balance confidence relative to objectively measured balance . Approximately one third of the sample (36%) reported equivalent balance confidence to measured stability, 27% reported greater balance confidence than would be supported by objective measurement (i.e., reduced awareness), and 37% reported an underestimation of balance, which may be appropriate awareness for maximal stability (e.g., [38, 65]). Although the sample size was relatively small, ab was high for all groups and did not differ significantly for patients with diagnoses of amci, non - amci, ad, or non - ad dementias (see table 1). Zero - order correlations were completed separately for af (table 2), am (table 3), and ab (table 4). Only variables with significant correlations were used to minimize specification errors (potential over- or undercorrection) as predictors in simultaneous multiple regression equations . For each measure of awareness, analyses were conducted for the overall sample, but also for each of the four diagnostic groups . Descriptors of magnitude of association were consistent with guidelines for small, medium, and large effect sizes provided by cohen . As can be seen in table 2, af was highly correlated with caregiver report of adls (faq and bristol adl each large magnitude associations). Together these data suggest af was highly associated, but not redundant, with more comprehensive measures of day - to - day function . Similarly, am was highly associated, but not redundant with the measures used to create it . As can be seen in table 3, these associations were strong for the non - ad dementia and two mci groups but trivial for the ad group . Finally, ab also demonstrated moderate, but nonredundant, associations with the variables used to create it . As can be seen in table 4, the association with the abc scale was a moderate magnitude overall and for all diagnostic groups except the non - amci group . Also seen in table 4, ab was associated with both fall history in the past 6 months for the larger samples and overall . Ab was associated with probability of falling only for specific diagnostic groups and the overall sample . The cell sizes for the poma were below 10 for the mci groups, but the small association was significant for the overall sample . Overall, the correlations provide evidence for the convergent validity for each of the derived awareness measures . Of interest, each measure of awareness appeared orthogonal: awareness of function was not associated with either awareness of memory (rs = 0.026, p> 0.05, trivial magnitude) or balance (rs = 0.207, p> 0.05, small magnitude), and the latter two measures of awareness are similarly not well associated (rs = 0.153, p> 0.05, small magnitude). For the overall sample, regression diagnostics suggested the bristol adl - caregiver, npi - distress, and rbans immediate and total scale indices were multicollinear, so these variables were excluded from the regression equation . The remaining predictors of cdr - sob, iadl - patient, faq - caregiver, npi - severity, zbi, probability of falling, bbs, clock drawing, rbans language, and visuospatial / constructional indices accounted for a large proportion of af variance (r = 0.688, p <0.001). Not all predictors were equally predictive, however, and only the faq - caregiver (t = 4.64, p <0.001) and zbi (t = 3.06, p = 0.003) were significant predictors of af . Equivalent regression procedures were conducted separately for the four diagnostic subgroups, and across these analyses only measures of function were significant predictors of af (ad group faq - caregiver t = 3.29, p = 0.002; non - ad group faq - caregiver t = 3.03, p = 0.004; amci group iadl - patient t = 2.30, p = 0.035; and non - amci group badl - caregiver t = 2.37, p = 0.029). Awareness of memory demonstrated a different pattern of zero - order correlations (see table 3), and the results of the regression analyses also suggested that the clinical correlates of am clearly differed from those of af . For the overall sample, the initial regression diagnostics resulted in removal of npi - severity and distress in addition to the rbans total scale index score due to multicollinearity . The overall model accounted for a large proportion of variance in am (r = 0.736, p <0.001), but of the predictors (iadl - patient, cesd overall, cesd depressed affect, cesd somatic / vegetative, cesd interpersonal, bsi global severity, animal naming, and rbans immediate memory were excluded) only the cesd - lack of positive affect (t = 3.19, p = 0.002), the rbans visuospatial / constructional index (t = 2.63, p = 0.01), and the rbans delayed memory index (t = 8.65, p <0.001) remained significant . The regression equations for the diagnostic groups differed from the predictors for the overall group . For the non - amci group the overall model was nonsignificant (likely due to only 9 participants having all variables complete). For the non - ad dementia group the rbans delayed memory index was the only significant predictor of am (t = 2.32, p = 0.028), but for the few amci patients with all predictors complete the delayed memory was not significant (t = 2.22, p = 0.053). Perhaps most salient was the radically different associations between am and the clinical correlates for the ad group . Here, only the iadl - patient (t = 2.15, p = 0.035) and cesd lack of positive affect (t = 2.32, p = 0.024) predicted am . The zero - order correlations that drove the regression equations for ab are shown in table 4 . The regression equations for the overall sample were less plagued by small sample size problems than the two mci groups . The clinical correlates of probability of falling, poma, and the bbs were excluded, however, due to multicollinearity . The remaining predictors were all significant: faq - caregiver (t = 4.77, p <0.001), the abc scale (t = 6.61, p <0.01), and fall history in last 6 months (coded yes / no, t = 8.01, p <0.001) and together accounted for a large proportion of variance in ab (r = 0.757, p <0.001). When compared across the diagnostic groups, the two regression equations for the mci groups were not statistically significant, likely due to small sample sizes . For both dementia groups the abc scale was a significant predictor of ab (ad group t = 4.61, p = 0.038, non - ad t = 2.34, p = 0.014) but, in addition, for the non - ad group the fall history in last 6 months was significant (t = 3.81, p = 0.001). These data support the hypothesis that awareness for different domains, specifically awareness of function, memory, and balance, would differentially relate to clinical correlates . This is in keeping with early work on awareness demonstrating differential clinical correlates for specific awareness domains [1215] and provides support for the assertion by markova and colleagues that awareness must be conceptualized as specific to the domain being measured, and that research on one domain cannot be generalized to another domain . In addition to finding differential patterns of clinical correlates across domains of awareness, these data suggest that diagnostic group is also an important consideration in the clinical correlates of awareness . This was most evident in the clinical correlates for the ad group versus the non - ad and amci groups for awareness of memory . Here, the relationship between specific symptoms of depression and awareness of memory was only evident for the ad group . In contrast, the clinical correlates for the other groups remain restricted to measures of memory . Regarding caution in cross - domain generalization is not sufficient, and diagnostic grouping is another important consideration, at least for some domains of awareness . Awareness of function was lower for the groups diagnosed with dementia than those with mci whereas awareness of memory was lower for the group with ad dementia and the group with amci, often considered a precursor to ad, than for the non - ad dementia or non - amci groups . Our data suggest that awareness of specific domains was orthogonal: awareness of function was not associated with awareness of memory or awareness of balance . This was in contrast to the findings by ott and colleagues who found moderate correlations between awareness of memory and awareness of function . Our method for measuring awareness of function was similar to that used by ott and colleagues (namely, patient / caregiver discrepancy), but we used a discrepancy between performance and self - report to assess memory and balance awareness, which may account for these inconsistent findings . Evidence for the modality specific nature of awareness is provided by the differential patterns of clinical correlates depending on domain measured . We found that the relation between caregiver burden and distress depended on the modality of awareness measured: reduced awareness of function was associated with increased caregiver reports of burden, which is consistent with findings from previous research [10, 11, 14]. Balance awareness was the only awareness measure associated with physical variables such as past history of falls and self - reported balance confidence . The relation between balance awareness and falls is consistent with previous research demonstrating a strong relationship between proprioception and balance or falls . Balance awareness was not related to any measure of neuropsychological functioning, despite previously reported relationships between risk of falls and measures of executive function . Although none of the domains of awareness were associated with measures of executive function, awareness of memory was associated with neuropsychological variables of the delayed memory index and the visuospatial / constructional indices from the rbans . The associations with neuropsychological variables differed, however, when the diagnostic groups were considered separately . Interestingly, awareness of memory was not associated with the delayed memory scores for the ad group . A floor effect in the delayed memory score appears to have created problems with heteroscedasticity in the bivariate memory awareness relationship, which may have attenuated any associations . The possible floor effect in memory measures did not, however, impact the association between depressive symptoms and awareness of memory, only for the ad group . The findings of differential clinical correlates for awareness of memory based on diagnostic group may speak to some of the most contradictory findings regarding correlates of awareness . Neuropsychological function is inconsistently related to awareness [1, 12, 19, 20, 27, 29], and the relationship between awareness in dementia and depression is complicated, with clinical lore and empirical data supporting the notion that increased awareness is associated with more symptoms of depressed mood [18, 25], but increased awareness and depression may only be related to subclinical (or dysthymia) rather than major depression . Our data suggest that in addition to modality of awareness being considered when measuring associations of neuropsychological and depressive symptoms with awareness, diagnostic group is an additional important consideration . Patients with dementia due to ad appear to have differential clinical correlates for awareness of memory versus patients with non - ad dementia, for example . Although the prediction of differential clinical correlates for the different domains of awareness was supported, some of our predictions regarding these clinical correlates were contrary to previous research . In zero - order associations, severity was associated with awareness of function, but with no other domain of awareness . Moreover, severity did not account for sufficient unique variance in awareness of function and was, therefore, not a significant predictor . This finding is in contrast to the cumulative cross - sectional data demonstrating an association between severity of cognitive impairment and awareness (see for a thorough review) and is contrary to the more compelling longitudinal data demonstrating decreasing awareness with increasing cognitive impairment [16, 18]. These contrasting findings likely speak to the orthogonal and domain - specific nature of the construct of awareness . Aalten and colleagues' and mcdaniel and colleagues' prospective studies measured awareness by clinician ratings based on an interview with patient and caregiver regarding the patient's history of cognitive deficits and their impact on function . Finally, all measures of awareness were associated with some measure of independence in daily function, particularly instrumental activities of daily living which is evidence against modality specificity . Assessment of functional abilities as a clinical correlate for measures of awareness is not often reported in the literature, but the few studies that do exist suggest that decreased awareness is associated with increased functional limitations, which is consistent with our data . Despite adding to the converging research on the modality - specific nature of awareness [4, 810], these data are limited by the inconsistency in the measurement methods used for each modality of awareness . Measurement of awareness of function was based on caregiver / patient discrepancy, whereas awareness of memory and of balance was based on discrepancy between self - report and objective measures of performance . If awareness is a true construct, it should not be highly dependent on how it is measured . If, for example, awareness of function differs greatly when measured with caregiver / patient discrepancy versus patient / observation discrepancy, then this would not be a construct at all and would be considered an artifact of measurement . If awareness is an artifact of measurement, future research measuring awareness of different modalities of awareness with different methods for measuring awareness will find markedly different clinical correlates than those presented here . Another more problematic limitation of these data is the fact that this sample is derived from a specialty clinic . Specialty clinic patients have been postulated to have higher awareness than the general dementia population due to the referral process for specialty clinics . It is unclear how having higher awareness may have impacted the differential patterns of clinical correlates for these multiple domains of awareness . Although replication is required, these data demonstrate differential patterns of clinical correlates for awareness of function and memory . In addition, this study provides a novel contribution by describing the clinical correlates for awareness of balance . These data provide evidence for modality specific relations between awareness and clinical correlates in a database with a wide range of standardized measures of clinical correlates including severity, function, neuropsychiatric symptoms, depression, caregiver burden and distress, and a comprehensive assessment of neuropsychological status . Differing patterns of clinical correlates for awareness of function, awareness of memory, and awareness of balance provide support for the modality specific uniqueness of awareness measures for each of these domains . Data demonstrating different patterns of awareness based on diagnostic group (namely, amci, non - amci, ad, and non - ad dementia diagnoses) provides further evidence for the modality specific nature of awareness . Modality specificity, if replicated in different populations, for example, stroke patients, could have implications for rehabilitation . These data would suggest that rehabilitation needs to be targeted to a domain of awareness since awareness is not a unitary construct . Future research is needed on the clinical course and implications for day - to - day care associated with impairments in specific modalities of awareness for persons with dementia.
Severe skin and soft tissue infections of the head and neck are rare conditions that may emerge secondarily to oropharyngeal infections . Anaerobic bacteria are often involved and may contribute to extensive inflammation, necrosis, and abscess formation . Secondary focal complications as bacterial invasion of vasculature, venous or arterial septic embolisation to the brain, spine or thorax may appear . Lemierre's syndrome (ls) is a manifestation with anaerobic aetiology and septic thrombophlebitis of the internal jugular vein . Cervicocranial necrotizing fasciitis (cnf) is a more superficial infection, and descending necrotizing mediastinitis (dnm) is a deep manifestation of this group of diseases . Broad - spectrum antibiotics are the basis of treatment, and early surgery is often necessary, especially in nf and dnm . The role of adjuvant treatment with hyperbaric oxygen (hbot) in these conditions is controversial . Especially for infections with anaerobic microbes, other than in knowledge of the possible benefit of adjuvant treatment is important for this group of patients . Here we present three cases with definite or probable involvement of anaerobic bacteria, where hbo was used with a favourable outcome . A 67-year - old man in previously good condition, experienced a sore throat and dysphagia for 5 days . On admission to hospital temperature was 38,1c, heart rate (hr) 125/min, blood pressure (bp) 110/59 mm hg, respiratory rate (rr) 30/min, and sa02 87% with 12 l 02/min supplement via a nonrebreather mask . On clinical examination the neck was asymmetric with an enlarged mass on the left side, and crepitus was felt by palpation . A ct - scan demonstrated soft tissue swelling, subcutaneous gas (figure 2), and a muscle abscess in the neck . Antibiotic treatment was initiated, and he had to undergo immediate surgery with drainage of the abscess . Mixed anaerobic microbes were identified (table 1). Due to the foci of infection, gas - production in the tissue and positive cultures for anaerobic bacteria, it was decided to start with hyperbaric oxygen treatment (hbot) for 90 min sequences at 3 atmosphere absolute (ata). Hbot at 3 ata was chosen based on the recommendation for treatment of clostridial myonecrosis from undersea and hyperbaric medical society (uhms). A total of 5 hbot were performed in the next 2.5 days, the first starting a few hours after the initial surgery . Already after 3 hbots the surgeon reported a halt of the ongoing necrotizing infection in the area . After 5 hbots the patients condition was reported to be under control and stabilized, and hbot was discontinued . During hbo - treatment the sequential organ failure assessment (sofa) score decreased from 12 to 5, and vasopressor was ceased (figure 1). Although the condition improved, another ct - scan of the neck and chest demonstrated thrombosis of the left jugular vein and an additional abscess in the upper mediastinum . After 27 days in the icu, the patient was transferred to the medical ward, were he stayed another 36 days before he was discharged from hospital to home . Changes in c - reactive protein (, mg / l), procalcitonin (, g / l * 100) and sequential organ failure assessment -score * 10 () during the first twelve days in hospital . The hyperbaric oxygen treatment period is marked . Crp, c - reactive protein; pct, procalcitonin; sofa, sequential organ failure assessment; hbo, hyperbaric oxygen . Changes in c - reactive protein (, mg / l), procalcitonin (, g / l * 100) and sequential organ failure assessment -score * 10 () during the first twelve days in hospital . The hyperbaric oxygen treatment period is marked . Crp, c - reactive protein; pct, procalcitonin; sofa, sequential organ failure assessment; hbo, hyperbaric oxygen . Figure 2computed tomography scan of thorax, showing loculaments of air in the tissue of the mediastinum (white arrows) in patient #1 . Computed tomography scan of thorax, showing loculaments of air in the tissue of the mediastinum (white arrows) in patient #1 . Table 1clinical data of patient #1 and #2.localizationdetection methodmicrobepatient #1blood cultureculture / v3-v4 sequencingcampylobacter species (rectus / showae)anaerobic blood culturemicroscopygram positive coccusneckculturepeptostreptococcus anaerobius, propionibacterium acnesmediastinumv1-v3, group specific primersparvimonas spp ., treponema denticola, prevotella dentalis, prevotella biviamediastinumv3 v4 sequencingporphyromonas gingivalis, bacteriodes species (parabecteriodes goldsteinii)patient #2tonsilsmicroscopyfusiform gram negative rodsculturehaemophilus parainfluenzae, streptococcus viridans aggregatibacter aphrophilus, group b streptococcus, mediastinum, tonsilsculturestreptococcus milleri, prevotella speciesmediastinumculturepeptostreptococcus speciesused ripseq software a healthy 53 year old man with psoriatic disease experienced 6 days of sore throat . Due to sudden onset of chest pain a coronary event was suspected . On admittance to hospital he was in reduced general state with a temperature of 37, 3c, hr 90/min, a ct - scan of neck and chest showed inflammation of the upper and lower mediastinum, involving the pericardium, and gas was seen in deep tissue layers . Figure 3computed tomography scan of thorax, showing loculaments of air in the tissue of the mediastinum (black arrow) in patient #2 . Computed tomography scan of thorax, showing loculaments of air in the tissue of the mediastinum (black arrow) in patient #2 . It was decided to treat the surgical wound with vacuum assisted closure (vac), and initially not by hbot . However, over the next 5 days his condition did not improve, a ct - scan demonstrated bilateral empyema, significant inflammation in soft tissue of the neck and mediastinum, and gas surrounding the heart . Due to the foci of infection, gas - production in the tissue and identification of anaerobic pathogens, he underwent a total of 5 hbo - treatments the next 3 days, as described in case 1 . Upon hbot, the patient improved, vasopressors were ceased, and crp decreased from 285 to 116 mg / l (figure 4). Four days after the last hbo - treatment his sternum was closed . After a total of 21 days in icu he was discharged to the ear - nose - and throat ward (ent). Changes in c - reactive protein (, mg / l), procalcitonin (, g / l 100) and and sequential organ failure assessment -score * 10 () during the first 16 days in hospital . The hyperbaric oxygen treatment period is marked . Hbo, hyperbaric oxygen; crp, c - reactive protein; pct, procalcitonin; sofa, sequential organ failure assessment . Changes in c - reactive protein (, mg / l), procalcitonin (, g / l * 100) and and sequential organ failure assessment -score * 10 () during the first 16 days in hospital . The hyperbaric oxygen treatment period is marked . Hbo, hyperbaric oxygen; crp, c - reactive protein; pct, procalcitonin; sofa, sequential organ failure assessment . A previously healthy woman, age 22, had a history of 6 days with progressive dysphagia . She was admitted to the local hospital due to increasing systemic signs of infection, accompanied by tenderness of the neck and chest pain . She received treatment with antibiotics for one day, before she was transferred to the regional hospital . Distinct tenderness on the left side of the neck was found, as well as discrete oedema . On inspection of the oropharynx, slight elevation of the left side of the lateral pharyngeal wall was seen . Laboratory results are given in figure 5 . A new ct - scan and an mri confirmed the findings of inflammatory changes in the neck as well as an mediastinal abscess, together with thromboses of the left jugular and subclavian veins . The abscess was not suited for surgical drainage due to difficult access; small volume and density measured by ct . She was treated with antibiotics and lmhw in the infectious diseases ward . In an attempt to reduce further progression of inflammation and pus formation, hbot was started (3 ata, 90 min) whereby the patient's condition improved shortly after this treatment was introduced (figure 5). Three days after discontinuation of hbot she was transferred to her local hospital for further conservative measures . After two weeks she was discharged from the local hospital, where treatment was continued with antibiotics for another 2 weeks and anticoagulation for 3 months . Changes in c - reactive protein (, mg / l) and, sequential organ failure assessment -score * 10 () during the first 13 days in hospital . The hyperbaric oxygen treatment period is marked . Hbo, hyperbaric oxygen; crp, c - reactive protein; sofa, sequential organ failure assessment . Changes in c - reactive protein (, mg / l) and, sequential organ failure assessment -score * 10 () during the first 13 days in hospital . The hyperbaric oxygen treatment period is marked . Hbo, hyperbaric oxygen; crp, c - reactive protein; sofa, sequential organ failure assessment . In each of these three cases we diagnosed the patient with an extensive soft - tissue infection of the neck and mediastinum . Patient #1 and #3 met the criteria for lemierre's syndrome, and patient #2 had findings consistent with dnm . In patient #1 and #2 several bacteria were identified with an oropharyngeal origin . Both anaerobic and aerobic bacteria were probably involved in the disease of these two patients . Anaerobic involvement was probable also the case in patient #3, as crepitations in the skin were found under clinical examination . The contribution of hbot to the recovery of each patient will be discussed in the following . Descending necrotizing infections of the head and neck are rare and the case fatality rate is high . Severe infections of the head and neck often start with symptoms from the source of infection . In lemierre's syndrome sore throat and neck pain the origin is often a pharyngotonsillitis or a peritonsillar abscess . In cnf, dysphagia and a sore throat a dental infection is often the primary source of infection in dnm, pharyngeal infection is most often the primary source . In our three cases, all presented with a history of sore throat and dysphagia . The two patients with lemierre's syndrome both had oropharyngeal infections with downward spread of infection to the mediastinum . In lemierre's syndrome the spread is usually metastatic from the thrombophlebitis of the affected vein . In dnm the spread is probably facilitated by gravity, breathing and negative intrathoracic pressure . The systemic effects predominate when the mediastinum becomes more involved; capillary leak, possible respiratory distress syndrome (ards) and empyema . The necrotizing infections described herein are typically polymicrobial, and anaerobic microbes normally harboured in the oral cavity are usually involved . All the tested bacteria were sensitive to penicillin g and are considered sensitive to the initial empiric therapy . However, the sub - optimal effect of antibiotics observed was most likely caused by local factors as impaired perfusion, oxygen depletion, impaired immunofunction or bacterial community mediated antibiotic tolerance mechanisms . Strictly anaerobic microbes are easily killed during specimen transport and handling if anaerobic conditions are not maintained ., often considered the main bacteria causing lemierre's syndrome, are extremely sensitive to o2 and can be missed by traditional culture methods . The usefulness of alternative techniques is illustrated in case 1, where 16srdna detection identified in total 6 species that were not identified by conventional culture . 16srdna sequencing in mixed infections gives mixed chromatograms where overlying sequences make it difficult to identify which nucleic acid belong to which microbe . This was overcome by using the newly developed software ripseq that identified 2 microbes (porphyromonas gingivalis and bacteroides spp . ). The 16srdna sequencing, in this study targeted either or both of the variable gene regions v1-v3 and v3-v4 . Using group specific primers and ripseq we were able to identify an additional 4 microbes . Such detection methods based on genus / species specific nucleic acids are particularly useful in infections caused by fastidious and oxygen sensitive bacteria . Earlier only infections caused by a single bacterial species could be detected by 16 rdna sequencing, but by using group specific primers and rip seq software this can be accomplished also for polymicrobial infections, even after antimicrobial therapy is started, as illustrated in this case report . Patient #1 and #2 were treated in a multiplace - chamber due their need of intensive care and respirator (haux - quadro 2500 - 2200). In patient #1, an improvement in the clinical condition was objectively observed after three hbots . He received two additional treatments, and his clinical condition further improved, objectively observed by marked reduction of the sofa - score (figure 1). However, his condition worsened a few days later, and an abscess in the mediastinum was found and removed by drainage . One might argue a need for additional hbot in this patient, but this was not done . However, his clinical condition worsened and it was not until the start of hbot at day 5 one was able to get control over his infection and his condition stabilized . This patient was treated in a monoplace - chamber (baramed hyperbaric chambers, etc). The use of hbot in conjunction with surgical debridement, antibiotic therapy and maximal critical - care therapy for severe soft tissue infections is widely accepted, but the efficacy of hbo remains unproven . In soft tissue infections, an area of hypoxia develops . The hypoxia impairs phagocytosis, and the drop in ph creates a milieu for growth of anaerobic organisms . Gas is frequently seen in crepitant necrotizing infections, as described in our three cases . Hbot provides oxygenation to otherwise ischemic areas, and reduces the impact of hypoxia on leukocyte function . Hbot of infections also occurs via hbo acting as a bactericide or as a bacteristatic agent to some microorganisms, and through an additive and/or synergistic effect on some antimicrobial drugs . In patient #1 the surgeon reported vital tissue only in the affected area, shortly after start of hbot which may illustrate its therapeutic potential . In all the cases, a clinical improvement was seen after the start of hbot, but the specific role of hbot in this improvement is difficult to estimate . The necrotizing infections described herein are typically polymicrobial, and anaerobic microbes normally harboured in the oral cavity are usually involved . All the tested bacteria were sensitive to penicillin g and are considered sensitive to the initial empiric therapy . However, the sub - optimal effect of antibiotics observed was most likely caused by local factors as impaired perfusion, oxygen depletion, impaired immunofunction or bacterial community mediated antibiotic tolerance mechanisms . Strictly anaerobic microbes are easily killed during specimen transport and handling if anaerobic conditions are not maintained ., often considered the main bacteria causing lemierre's syndrome, are extremely sensitive to o2 and can be missed by traditional culture methods . The usefulness of alternative techniques is illustrated in case 1, where 16srdna detection identified in total 6 species that were not identified by conventional culture . 16srdna sequencing in mixed infections gives mixed chromatograms where overlying sequences make it difficult to identify which nucleic acid belong to which microbe . This was overcome by using the newly developed software ripseq that identified 2 microbes (porphyromonas gingivalis and bacteroides spp . ). The 16srdna sequencing, in this study targeted either or both of the variable gene regions v1-v3 and v3-v4 . Using group specific primers and ripseq we were able to identify an additional 4 microbes . Such detection methods based on genus / species specific nucleic acids are particularly useful in infections caused by fastidious and oxygen sensitive bacteria . Earlier only infections caused by a single bacterial species could be detected by 16 rdna sequencing, but by using group specific primers and rip seq software this can be accomplished also for polymicrobial infections, even after antimicrobial therapy is started, as illustrated in this case report . Patient #1 and #2 were treated in a multiplace - chamber due their need of intensive care and respirator (haux - quadro 2500 - 2200). In patient #1, an improvement in the clinical condition was objectively observed after three hbots . He received two additional treatments, and his clinical condition further improved, objectively observed by marked reduction of the sofa - score (figure 1). However, his condition worsened a few days later, and an abscess in the mediastinum was found and removed by drainage . One might argue a need for additional hbot in this patient, but this was not done . However, his clinical condition worsened and it was not until the start of hbot at day 5 one was able to get control over his infection and his condition stabilized . This patient was treated in a monoplace - chamber (baramed hyperbaric chambers, etc). The use of hbot in conjunction with surgical debridement, antibiotic therapy and maximal critical - care therapy for severe soft tissue infections is widely accepted, but the efficacy of hbo remains unproven . In soft tissue infections, an area of hypoxia develops . The hypoxia impairs phagocytosis, and the drop in ph creates a milieu for growth of anaerobic organisms . Gas is frequently seen in crepitant necrotizing infections, as described in our three cases . Hbot provides oxygenation to otherwise ischemic areas, and reduces the impact of hypoxia on leukocyte function . Hbot of infections also occurs via hbo acting as a bactericide or as a bacteristatic agent to some microorganisms, and through an additive and/or synergistic effect on some antimicrobial drugs . In patient #1 the surgeon reported vital tissue only in the affected area, shortly after start of hbot which may illustrate its therapeutic potential . In all the cases, a clinical improvement was seen after the start of hbot, but the specific role of hbot in this improvement is difficult to estimate . Data on hbot of such infections are scarce and not conclusive, but somewhat in support of this . Recent availability of hbot with intensive care facilities at our hospital has led to three hbo treated cases all demonstrating a significant clinical improvement . We also show that hbot may be used on the basis of only strong clinical suspicion of anaerobic infection . The cases demonstrate that use of polymerase chain reaction is especially useful in the diagnostics of anaerobic infections . When hbot is available, it should be considered as adjunctive treatment in extensive infections with anaerobes, but more studies are needed to evaluate the effect.
The binding of il-6 to its receptor induces the activation of multiple signal transduction pathways such as jak / stats (janus tyrosine kinase / signal transducers and activators of transcription) pathway, ras / erk (extracellular signal - regulated kinase) pathway, and pi 3-k (phosphotidylinositol 3-kinase)/akt pathway via gp130 tyrosine phosphorylation . The roles of jak / stats pathway and ras / erk pathway in the biological effects of il-6 have been extensively investigated . However, what role pi 3-k / akt plays in il-6 signaling is less clear . Akt is a serine (ser)/threonine (thr) protein kinase which resides within the cytosol in a catalytically inactive state in quiescent or serum - starved cells . After stimulation of cells with growth factors and cytokines, akt is catalytically activated by phosphorylation at thr308 and ser473 . Activated akt in turn phosphorylates downstream target molecules and induces the expression of anti - apoptosis proteins, which promote induction of its anti - apoptosis effect . Recently, growing evidence suggests the involvement of pi 3-k / akt in il-6-dependent survival and proliferative responses in several types of cells [3 - 6]. Still, whether pi 3-k / akt plays the same role in il-6-dependent growth of 7td1 mouse - mouse b cell hybridoma is not known . In our previous work, we showed that erk cascade but not stat3 contributed to il-6-dependent growth of 7td1 cells . Here we report that il-6 triggers activation of pi3-k / akt signaling in 7td1 cells, and that il-6-induced pi 3-k / akt activation is essential for the optimal growth of 7td1 cells . -mercaptoethanol and recombinant human il-6 (10u / mg) were added to the medium at final concentration of 5 10mol / l and 5 ng / ml, respectively . Wortmannin (sigma) was dissolved in dmso to 2.5 mm and stored at -20c . Dmso was added to control cells to keep concentrations of dmso (<0.1%) equal in all samples . The cells were pretreated with wortmannin for 30 min at 37c before il-6 was added to the medium . The cells were seeded into 96-well plate and cultured in the presence of different dose of il-6 for 72 h. afterwards, 10 l mtt (sigma, 5 mg / ml) was added to each well, 4 h later, an equal volume of 10%sds-10 mm hcl was added to dissolve the blue crystals of formazan . The samples were measured at od 570 nm by an elisa reader (dynatech laboratories, inc . U.s.a . ). After protein determination, total cell lysates (5 10cell / sample) were boiled in 2 reducing sds loading buffer of equal volume for 10 min . After electrophoresis, proteins were transferred to a 0.45 3 m pore - size nitrocellulose membrane at 40 v for 2 h. non - specific binding sites on the nitrocellulose membrane were blocked by incubation in blocking buffer (5% w / v, non - fat dried milk) for 1 h at 37c . The blots were washed once with tris - buffered saline (10 mm tris / hcl ph 7.5, 150 mm nacl) and incubated with the primary antibody for 1 h at 37c or overnight at 4c . After the removal of excess primary antibody with three washes, the blots were incubated with a secondary antibody (goat anti - mouse or goat anti - rabbit antibodies conjugated with horseradish peroxidase). The membrane was developed with enhanced chemiluminescence reagent and exposed to hyperfilm - ecl(amersham life science corp .) For detection . Akt and phospho - akt (ser473) antibodies were products of new england biolabs (beverly, ma, u.s.a . ). Anti-(human xiap) antibody was a product of medical and biological laboratories (naka, nagoya, japan). Anti - bcl-2 and anti - caspase-3 antibodies were obtained from santa cruz biotechnology (santa cruz, ca, u.s.a . ). -mercaptoethanol and recombinant human il-6 (10u / mg) were added to the medium at final concentration of 5 10mol / l and 5 ng / ml, respectively . Wortmannin (sigma) was dissolved in dmso to 2.5 mm and stored at -20c . Dmso was added to control cells to keep concentrations of dmso (<0.1%) equal in all samples . The cells were pretreated with wortmannin for 30 min at 37c before il-6 was added to the medium . The cells were seeded into 96-well plate and cultured in the presence of different dose of il-6 for 72 h. afterwards, 10 l mtt (sigma, 5 mg / ml) was added to each well, 4 h later, an equal volume of 10%sds-10 mm hcl was added to dissolve the blue crystals of formazan . The samples were measured at od 570 nm by an elisa reader (dynatech laboratories, inc . U.s.a . ). After protein determination, total cell lysates (5 10cell / sample) were boiled in 2 reducing sds loading buffer of equal volume for 10 min . After electrophoresis, proteins were transferred to a 0.45 3 m pore - size nitrocellulose membrane at 40 v for 2 h. non - specific binding sites on the nitrocellulose membrane were blocked by incubation in blocking buffer (5% w / v, non - fat dried milk) for 1 h at 37c . The blots were washed once with tris - buffered saline (10 mm tris / hcl ph 7.5, 150 mm nacl) and incubated with the primary antibody for 1 h at 37c or overnight at 4c . After the removal of excess primary antibody with three washes, the blots were incubated with a secondary antibody (goat anti - mouse or goat anti - rabbit antibodies conjugated with horseradish peroxidase). The membrane was developed with enhanced chemiluminescence reagent and exposed to hyperfilm - ecl(amersham life science corp .) For detection . Akt and phospho - akt (ser473) antibodies were products of new england biolabs (beverly, ma, u.s.a . ). Anti-(human xiap) antibody was a product of medical and biological laboratories (naka, nagoya, japan). Anti - bcl-2 and anti - caspase-3 antibodies were obtained from santa cruz biotechnology (santa cruz, ca, u.s.a . ). Il-6 induced phosphorylation (ser473) of akt, a downstream effector of pi 3-k, in 7td1 cells . This activation by il-6 occurred as early as 5 min, and was dependent on the dose of il-6 . Il-6 stimulated phosphorylation of akt in a dose- and time - dependent manner in 7td1 cells . 7td1 cells were starved in il-6-free medium for 6 h. then the cells were cultured in the presence of different dose of il-6 for 5 min or in the presence of 1 ng / ml il-6 for 0, 5, 10, 30, 60 min respectively . After the cells were collected and washed, whole - cell extracts were prepared and subjected to western - blotting assay . This figure is representative of 3 separate experiments . To investigate what role pi 3k / akt plays in the signal transduction of il-6 in 7td1 hybridoma cells, we determined the effects of wortmannin, a pi 3-k specific inhibitor at 10100 nmol / l, on il-6-induced phosphorylation of akt and il-6-dependent growth of 7td1 cells . It was found that wortmannin significantly antagonized il-6-induced phosphorylation of akt and il-6-dependent growth of 7td1 cells and the inhibitory effects of wortmannin were dependent on its concentration . These data confirm that activation of akt is mediated by a pi 3-k - dependent mechanism and suggest that il-6-induced pi 3-k / akt activation is essential for the optimal growth of 7td1 cells (fig . Effects of wortmannin on il-6-induced phosphorylation of akt (a) and il-6-dependent growth of 7td1 cells (b). 7td1 cells were starved in il-6-free medium for 6 h. then the cells were pretreated with wortmannin or dmso of equal volume for 30 min at 37c before il-6 was added into the medium . (after the cells were collected and washed, whole - cell extracts were prepared and subjected to western - blotting assay . (b) the cells were seeded into 96-well plate (2 10cells per well) and cultured in the presence of different dose of il-6 for 72 h. afterwards, mtt assay was performed to determine the effect of wortmannin on il-6-dependent growth of 7td1 cells . The preceding experiments suggest that il-6-induced pi 3-k / akt activation is essential for the optimal growth of 7td1 cells . Recent evidence has indicated that proteins of the inhibitor of apoptosis (iap) family, whose expression might be under the regulation of nf-b, can block apoptotic events by directly binding and inhibiting selected caspases . A potent mammalian iap is x - linked iap (xiap), for which the mechanism of action involves the direct binding and inhibition of caspase-3 and caspase-7, two key effector proteases of apoptosis . It is reported that the level of bcl-2, but not bcl - xl and mcl-1, decreased after il-6 deprivation . To examine the effects of il-6-induced pi3-k / akt activation on these apoptosis - related proteins, we further studied il-6-induced expression of bcl-2 as well as xiap and caspase-3 in 7td1 cells by western - blotting assay with bcl-2, xiap, and caspase-3 antibodies, with or without wortmannin . Untreated 7td1 cells displayed significant levels of these apoptosis - related gene products (fig . 3). Il-6 significantly up - regulated the levels of xiap and bcl-2 but had little effect on the level of caspase-3 . . Taken together, these data suggest that il-6 might induce up - regulation of xiap through pi 3-k / akt activation . Effects of il-6 and wortmannin on the expression of apoptosis - related proteins in 7td1 cells . (a) 7td1 cells were starved in il-6-free medium for 6 h. then the cells were cultured in the presence of 1 ng / ml il-6 for various periods as indicated . At the end of the incubation period, whole - cell extracts were prepared and subjected to western - blotting assay . (b) 7td1 cells were starved in il-6-free medium for 6 h. then the cells were pretreated with wortmannin or dmso of equal volume for 30 min at 37c before il-6 was added into the medium . The cells were cultured for 1 h in the presence of il-6 . After the cells were collected and washed, whole - cell extracts were prepared and subjected to western - blotting assay . Il-6 induced phosphorylation (ser473) of akt, a downstream effector of pi 3-k, in 7td1 cells . This activation by il-6 occurred as early as 5 min, and was dependent on the dose of il-6 . Il-6 stimulated phosphorylation of akt in a dose- and time - dependent manner in 7td1 cells . 7td1 cells were starved in il-6-free medium for 6 h. then the cells were cultured in the presence of different dose of il-6 for 5 min or in the presence of 1 ng / ml il-6 for 0, 5, 10, 30, 60 min respectively . After the cells were collected and washed, whole - cell extracts were prepared and subjected to western - blotting assay . To investigate what role pi 3k / akt plays in the signal transduction of il-6 in 7td1 hybridoma cells, we determined the effects of wortmannin, a pi 3-k specific inhibitor at 10100 nmol / l, on il-6-induced phosphorylation of akt and il-6-dependent growth of 7td1 cells . It was found that wortmannin significantly antagonized il-6-induced phosphorylation of akt and il-6-dependent growth of 7td1 cells and the inhibitory effects of wortmannin were dependent on its concentration . These data confirm that activation of akt is mediated by a pi 3-k - dependent mechanism and suggest that il-6-induced pi 3-k / akt activation is essential for the optimal growth of 7td1 cells (fig . Effects of wortmannin on il-6-induced phosphorylation of akt (a) and il-6-dependent growth of 7td1 cells (b). 7td1 cells were starved in il-6-free medium for 6 h. then the cells were pretreated with wortmannin or dmso of equal volume for 30 min at 37c before il-6 was added into the medium . (after the cells were collected and washed, whole - cell extracts were prepared and subjected to western - blotting assay . (b) the cells were seeded into 96-well plate (2 10cells per well) and cultured in the presence of different dose of il-6 for 72 h. afterwards, mtt assay was performed to determine the effect of wortmannin on il-6-dependent growth of 7td1 cells . The preceding experiments suggest that il-6-induced pi 3-k / akt activation is essential for the optimal growth of 7td1 cells . Recent evidence has indicated that proteins of the inhibitor of apoptosis (iap) family, whose expression might be under the regulation of nf-b, can block apoptotic events by directly binding and inhibiting selected caspases . A potent mammalian iap is x - linked iap (xiap), for which the mechanism of action involves the direct binding and inhibition of caspase-3 and caspase-7, two key effector proteases of apoptosis . It is reported that the level of bcl-2, but not bcl - xl and mcl-1, decreased after il-6 deprivation . To examine the effects of il-6-induced pi3-k / akt activation on these apoptosis - related proteins, we further studied il-6-induced expression of bcl-2 as well as xiap and caspase-3 in 7td1 cells by western - blotting assay with bcl-2, xiap, and caspase-3 antibodies, with or without wortmannin . Untreated 7td1 cells displayed significant levels of these apoptosis - related gene products (fig . 3). Il-6 significantly up - regulated the levels of xiap and bcl-2 but had little effect on the level of caspase-3 . . Taken together, these data suggest that il-6 might induce up - regulation of xiap through pi 3-k / akt activation . Effects of il-6 and wortmannin on the expression of apoptosis - related proteins in 7td1 cells . (a) 7td1 cells were starved in il-6-free medium for 6 h. then the cells were cultured in the presence of 1 ng / ml il-6 for various periods as indicated . At the end of the incubation period, (b) 7td1 cells were starved in il-6-free medium for 6 h. then the cells were pretreated with wortmannin or dmso of equal volume for 30 min at 37c before il-6 was added into the medium . The cells were cultured for 1 h in the presence of il-6 . After the cells were collected and washed, whole - cell extracts were prepared and subjected to western - blotting assay . Il-6 inhibits physiological cell death and allows expansion of populations of serum - stimulated cells . How il-6 can promote the growth of 7td1 cells remains elusive . In our previous work, we showed that erk cascade but not stat3 contributed to il-6-dependent growth of 7td1 cells . However, activation of erk cascade seems not to be sufficient since mek inhibitor pd098059 pretreatment resulted in partial blockade of il-6-induced growth of 7td1 cells although il-6-induced activity of erk cascade can be completely blocked by pd098059 of the same concentration . In this work, we show that il-6-induced pi 3-k / akt activation is also essential for the optimal growth of 7td1 cells . Taken together, our data suggest that il-6 promotes the growth of 7td1 cells via activation of multiple signal transduction pathways including erk cascade and pi 3-k / akt pathway . Recently, growing evidence suggests the involvement of pi 3-k / akt in il-6-dependent survival and proliferative responses in several types of cells [3 - 6]. Our data are consistent with these findings, further confirming the important roles of pi 3-k / akt in il-6 signaling . Furthermore, we found that xiap, but not bcl-2, might be a downstream target molecule of akt since both constitutive and il-6-induced expression of xiap, but not bcl-2, in 7td1 cells was inhibited by wortmannin . Recent evidence has indicated that the expression of xiap might be under the regulation of nf-b . Pi 3-k / akt pathway is thought to be involved in the full activation of nf-b through phosphorylation of the rel proteins . This is the first report that xiap is involved in il-6-mediated anti - apoptosis mechanism.
Endoscopic ultrasound (eus)-guided tissue acquisition is the diagnostic procedure of choice in many diseases of the gastrointestinal tract and adjacent structures . This procedure is well known for its high accuracy and low complication rate; however, its outcome closely relies on several factors . The location and characteristics of the lesion, endosonographer's experience, needle size and type, sampling technique, sample preparation, presence of a cytopathologist for rapid on - site examination (rose), and cytologist's expertise are considered some of the important factors.1,2 issues related to needle selection will be discussed here . Currently, there are three different sizes of commercially available eus fine - needle aspiration (eus - fna) needles: 19, 22, and 25 gauge (g). The size of the needle should be chosen consciously because it can directly affect the quality of the procured sample . Generally speaking, larger needles may render bigger tissue for diagnosis; however, samples tend to be bloodier, which might hinder the cytologic interpretation . As a 19 g conventional needle is stiff and has limitation in the transduodenal approach, a new flexible 19 g nitinol needle (expect 19 g flex; boston scientific, natick, ma, usa) has been introduced.3 recently, a new side - port needle has been developed by olympus (tokyo, japan), and it is expected to allow better cellular acquisition.4 the spring - loaded 19 g biopsy needle trucut (cook medical, winston - salem, nc, usa) has been designed for the procurement of tissue core samples;5 however, it is not feasible to use with the transduodenal approach and has been reported to result in technical failures . The newly developed procore needle (cook medical), which incorporates reverse bevel technology, has various available sizes and enables the transduodenal approach.6 currently, there are three different sizes of commercially available eus fine - needle aspiration (eus - fna) needles: 19, 22, and 25 gauge (g). The size of the needle should be chosen consciously because it can directly affect the quality of the procured sample . Generally speaking, larger needles may render bigger tissue for diagnosis; however, samples tend to be bloodier, which might hinder the cytologic interpretation . As a 19 g conventional needle is stiff and has limitation in the transduodenal approach, a new flexible 19 g nitinol needle (expect 19 g flex; boston scientific, natick, ma, usa) has been introduced.3 recently, a new side - port needle has been developed by olympus (tokyo, japan), and it is expected to allow better cellular acquisition.4 the spring - loaded 19 g biopsy needle trucut (cook medical, winston - salem, nc, usa) has been designed for the procurement of tissue core samples;5 however, it is not feasible to use with the transduodenal approach and has been reported to result in technical failures . The newly developed procore needle (cook medical), which incorporates reverse bevel technology, has various available sizes and enables the transduodenal approach.6 the advantage of eus - guided tissue acquisition is its high accuracy and safety . According to a meta - analysis, the pooled diagnostic sensitivity and specificity of eus - fna in the diagnosis of solid pancreatic masses were 86.8% (95% confidence interval [ci], 85.5 to 87.9) and 95.8% (95% ci, 94.6 to 96.7), respectively.7 however, there is no consensus on the number of passes to achieve the highest diagnostic accuracy . Increased number of passes may yield a higher diagnostic accuracy with a theoretically higher complication rate . The average numbers of passes to obtain an adequate diagnostic sample for a solid lesion are known to be five to seven passes for the conventional fna needle . However, the mean number of passes required for diagnosis with the new olympus 22 g side - port needle was only 1.7 in a prospective multicenter study; however, the number of enrolled cases in that study was small.8 the procore needle seems to be able to obtain enough tissue for diagnosis with only a few passes . When single and multiple (two to four) passes of the 25 g procore needle were compared in the diagnosis of solid pancreatic lesions, the sensitivity, specificity, and accuracy were 85% vs. 96%, 100% vs. 100%, and 86% vs. 96%, respectively.9 in a prospective study, the diagnostic accuracy of eus - guided trucut needle core biopsy was 61%, with a mean value of 1.4 needle passes.10 the transduodenal approach was possible only in 40% of the patients . When subgroup analysis was done on technically successful cases only, the diagnostic accuracy was 87.5% . In a multicenter, pooled, cohort study, the overall diagnostic accuracy of the 19 g procore needle was 85%.6 during transduodenal procedures, sampling was done in 94%; however, there were some technical difficulties . The combination of eus - fna / fine - needle biopsy (fnb) techniques revealed the highest diagnostic accuracy of 91% compared with 77% for eus - fna alone and 73% for eus - fnb alone (p=0.008).11 another study showed an 84% diagnostic accuracy with eus - guided trucut needle biopsy and suggested the additional use of eus - fna as a rescue diagnostic tool.12 eus - fnb is useful in obtaining core tissue with a few passes . Rose is critical for the high diagnostic accuracy of eus - fna;13 however, if an endosonographer can obtain visible tissue core with an fnb needle, the outcome may not be dependent on rose, which is not always readily available for many institutions . Aspiration of core tissue with preserved architecture is beneficial for the diagnosis of some specific diseases such as submucosal masses,14 lymphomas,15 and autoimmune pancreatitis.16 as molecular profiling and personalized oncologic therapy are becoming important concepts nowadays, a histologic core biopsy sample is necessary for ancillary testing.17 tissue core can be obtained with a conventional aspiration needle or a specialized fnb needle . A study reported that satisfactory histologic specimens were procured in 94.7% and tissue acquisition for cytological assessment was successful in 100%, including the transduodenal route, when an expect 19 g flex aspiration needle was used.3 the high tissue acquisition rate is partially because of the high elasticity of the needle, which facilitates the transduodenal pass . Small pancreatic lesions (<2 cm) and nueroendocrine tumors are related to a higher complication rate; however, no definite relation was proven with patient's age, location of lesion, needle size, and number of needle passes.18 the type of needle does not seem to pose a big difference in the complication rate . Many studies reported that there was no significant difference in diagnostic outcome and needle size . A study reported that the diagnostic accuracy of the 19 g needle for solid pancreatic and peripancreatic masses was 86.7% and that of the 22 g needle was 78.9% (p=0.268).19 a 19 g aspiration needle could render a higher amount of tissue; however, technical failure was more frequent when the mass was located in the head of the pancreas . When technical failures were excluded, the diagnostic accuracy of the 19 g needle was 94.5% . It can be easily bent in a perpendicular direction and also has a wider puncture range . Therefore, the 25 g needle is better for targeting pancreatic head and uncinate lesions through the transduodenal route . The obtained sample size may be smaller, but it might result in minimal blood contamination . In a prospective, randomized trial comparing 22 and 25 g needles for solid pancreatic masses, the tissue samples provided positive diagnosis in 87.5% in the 22 g group and 95.5% in the 25 g group (p=0.18).20 according to a meta - analysis, the pooled sensitivity of the 22 and 25 g needles was 0.85 (95% ci, 0.82 to 0.88) and 0.93 (95% ci, 0.91 to 0.96), respectively . The pooled specificity of the 22 and 25 g needle was 1 (95% ci, 0.98 to 1.00) and 0.97 (95% ci, 0.93 to 0.99), respectively . The 25 g needle showed a higher sensitivity (p=0.0003) but comparable specificity to (p=0.97) the 22 g needle.21 another study showed that the overall accuracy of the 25 and 22 g eus - fna needles and the 19 g trucut needle was 91.7%, 79.7%, and 54.1%, respectively, in the diagnosis of solid pancreatic masses.22 for head and uncinate lesions, the 25 g fna needle was technically more successful and had significantly superior overall diagnostic accuracy than the other needles . A study compared same - sized fna and fnb needles for the diagnosis of solid pancreatic neoplasms and reported a striking result.23 when five passes of the 22 g echotip ultra needle and two passes of the 22 g echotip procore needle were performed for same lesion alternately for 32 cases, the ability to achieve a diagnosis was 93.8% for fna and 28.1% for fnb . During the fnb procedure, when the echoendoscope was positioned within the duodenum, fnb could not be performed because of technical reasons . The authors did not explain the details of tissue processing failures but noted that the " procore needle failed to obtain enough tissue to survive processing as a regular core biopsy for histology (tissue attrition during processing). " However, a previous randomized trial that compared a 22 g fna needle (expect; boston scientific) and a 22 g fnb needle (echotip procore; cook endoscopy, bloomington, in, usa) for solid pancreatic masses reported different results.24 the diagnostic sufficiency was 100% and 89.3% (p=0.24) for the fna and fnb needle, respectively . The 22 g biopsy needle procured both cytologic and histologic specimen (89.3% and 80%, respectively), with a 3.6% technical failure rate . According to a meta - analysis, needle size confers only a limited effect on the overall outcomes in eus - fna for solid pancreatic masses.25 a study compared 22 g eus - fna without rose and 19 g trucut biopsy.26 the overall accuracy was 76% for both procedures, whereas the combination of the two procedures rendered a 95% diagnostic accuracy . Thus, eus - fnb showed a similar diagnostic accuracy to eus - fna without rose, with fewer passes . The authors reported that they can obtain a positive report with eus - fnb when eus - fna was negative in cases of gastrointestinal stromal tumors, pancreatic adenocarcinoma, lung cancer, metastatic mediastinal node, retroperitoneal lymphoma, and mediastinal lymphoma.26 usually, a cytological sample is enough to establish a diagnosis; however, histologic assessment may be useful in some cases such as pancreatic tumors other than pancreatic adenocarcinoma, tumors surrounded by chronic pancreatitis, submucosal and intramural gastrointestinal tumors, and for the biopsy of lesions or lymph nodes in which lymphoma is suspected.17 certain diseases such as autoimmune pancreatitis, well - differentiated adenocarcinoma, and highly desmoplastic pancreatic neoplasm may also require tissue core samples for a definitive diagnosis . Histological samples can often be obtained with a standard fna needle, and addition of cell block examination can provide good information that is comparable to an fnb sample.27 therefore, eus - fnb can be a recommendable supplementary technique when additional tissue and histologic section are necessary for an accurate diagnosis and if molecular characterization of tumors is required.8,17 the stiffness of the needle is a large obstacle to overcome in harvesting core tissues with the transduodenal approach . The needle size and type can be some of the factors that influence the diagnostic yield of eus - guided tissue acquisition . There are no convincing data showing any significant advantage between the three commonly used fna needle sizes . The smaller 25 g needle, which yields at least comparable results to the 22 and 19 g needles, may be easier to maneuver . Large - bore needles can procure more tissue; however, the sample tends to be bloodier and technical failure may occur . The yield of an fnb needle is higher with fewer passes and ancillary testing is usually possible . Needle selection is a complex process and should be made on the basis of many aspects, such as the location and physical characteristics of the lesion, availability of rose, and clinical needs considering the suspected diagnosis.29
In this review, pubmed and sciencedirect databases were used to identify relevant articles published until the 3rd of april 2013 (date of search). The search was conducted using the electronic library of king saud bin abdul aziz university for health sciences, riyadh, saudi arabia . Pubmed search identified 3 groups of articles as follows: disease of interest (keyword: autism), geographical location (keywords: saudi, uae, oman, kuwait, qatar, and bahrain), and epidemiological terms (keywords: epidemiology, prognosis, diagnosis, pattern, odds, risk, incidence, prevalence, impact, trends, and biomarker). Finally, the boolean operator and combined the results for each group of articles, a total of 22 articles met the inclusion criteria . Epidemiology of autism and each of the gcc countries individually, which yielded a total of 79 results . The titles of the final list consisting of 101 results were reviewed, 85 articles were excluded because they were not related to epidemiology of autism, and the abstracts of the remaining 16 articles were obtained . After reviewing the 16 abstracts, 6 more articles were eliminated: reviews (n=3), 2 were qualitative studies and abstract / full text of the sixth was irretrievable . A search was conducted for the full text of the remaining 10 articles, of which 8 were located and 2 were not . The first was an article published as a brief communication,16 and the second is an article published during the writing up of this review.17 literature search flowchart . Studies were identified from 3 gcc countries only; oman, saudi arabia, and uae . The 10 included articles, 3 were prevalence studies, and the rest discussed potential risk factors or biomarkers for autism in patients from gcc countries . Prevalence studies were conducted in uae,18 saudi arabia,19 oman,20 and bahrain.17 the prevalence of asd was 1.4 per 10,000 in oman, and 29 per 10,000 for pdd in uae, and 4.3 per 10,000 in bahrain.17,18,20 the saudi study documented patients characteristics and reasons for referral for group of saudi autistic patients.19 male gender and history of developmental delay were significantly associated with autism prevalence in all 3 studies . Consanguinity was present in 28.6% of saudi patients, and behavioral problems such as hyperactivity or aggression were evident in 45% of patients (table 1).19 summary of epidemiological studies on autism / autism spectrum disorder in the gulf cooperation countries . The included studies were conducted in saudi arabia, oman, or bahrain, and all employed the case - control study design . Sample size varied between these studies from 52 to 204 patients; and the risk factors investigated were: suboptimal breastfeeding,21 lead exposure,22 serum osteopontin,23 maternal and paternal age, cesarian section, and prenatal complications . Delayed initiation of breastfeeding and no colostrum intake was associated with increased risk of asd . Exclusive and prolonged breastfeeding (up to 24 months or more) markedly reduced the risk of developing asd.21 higher blood levels of lead22 and osteopontin23 were found in autism patients . Occurrence of autistic disorder was correlated with maternal (or 1.83) and paternal (or 2.08) age above 30 years at time of birth . The disease was also more common among children of mothers who delivered with a cesarian section or had antenatal complications16,17 (table 1). Lipid peroxidation,24 glutathione peroxidase,25 superoxide dismutase, sodium - potassium adenosine triphosphatase,21 lactate, saturated fatty acids,26 and homocysteine26 levels were significantly higher among autistic patients . Inversely, levels of vitamin e,24 glutathione,24 folate, vitamin b12,27 and some polyunsaturated acids were much lower in autistic patients . Serum osteopontin levels were higher among autistic patients,25 and levels were positively related to the severity of autism (table 1). Prevalence studies were conducted in uae,18 saudi arabia,19 oman,20 and bahrain.17 the prevalence of asd was 1.4 per 10,000 in oman, and 29 per 10,000 for pdd in uae, and 4.3 per 10,000 in bahrain.17,18,20 the saudi study documented patients characteristics and reasons for referral for group of saudi autistic patients.19 male gender and history of developmental delay were significantly associated with autism prevalence in all 3 studies . Consanguinity was present in 28.6% of saudi patients, and behavioral problems such as hyperactivity or aggression were evident in 45% of patients (table 1).19 summary of epidemiological studies on autism / autism spectrum disorder in the gulf cooperation countries . The included studies were conducted in saudi arabia, oman, or bahrain, and all employed the case - control study design . Sample size varied between these studies from 52 to 204 patients; and the risk factors investigated were: suboptimal breastfeeding,21 lead exposure,22 serum osteopontin,23 maternal and paternal age, cesarian section, and prenatal complications . Delayed initiation of breastfeeding and no colostrum intake was associated with increased risk of asd . Exclusive and prolonged breastfeeding (up to 24 months or more) markedly reduced the risk of developing asd.21 higher blood levels of lead22 and osteopontin23 were found in autism patients . Occurrence of autistic disorder was correlated with maternal (or 1.83) and paternal (or 2.08) age above 30 years at time of birth . The disease was also more common among children of mothers who delivered with a cesarian section or had antenatal complications16,17 (table 1). Lipid peroxidation,24 glutathione peroxidase,25 superoxide dismutase, sodium - potassium adenosine triphosphatase,21 lactate, saturated fatty acids,26 and homocysteine26 levels were significantly higher among autistic patients . Inversely, levels of vitamin e,24 glutathione,24 folate, vitamin b12,27 and some polyunsaturated acids were much lower in autistic patients . Serum osteopontin levels were higher among autistic patients,25 and levels were positively related to the severity of autism (table 1). The prevalence of asd and pdd was highly variable between included studies.18,20 the difference between both rates could be attributed, in part, to setting, method of assessment, and age of participants . The omani study20 included a larger sample with wide age range to determine prevalence of formally diagnosed asd from medical records . Conversely, the emirati study18 screened a sample of preschool children for undiagnosed pdd, and the case definition for pdd is more inclusive than asd . For example, studies in europe recorded a prevalence that ranged from 1.9 up to 72.6 per 10,000, and the range has been wider (2.8 - 94 per 10,000) in china.1 prevalence is also affected by accessibility to a specialized autism care center and source of case identification (mainly families). A low prevalence rate is expected in areas with no facilities or centers for case reporting . Over time, healthcare professionals and families have learned more about the disorder, and the increased awareness resulted in more comprehensive diagnostic criteria . This emphasizes the need to establish a reliable autism - screening tool that can be applied in community - based studies to produce more precise prevalence in gcc countries . Collaborative efforts should target increasing awareness of the community toward asd to encourage early consultation and diagnosis . Also, availability and accessibility to diagnosis and treatment centers should be assessed in light of the burden of this disorder . The male to female ratio in gcc countries was consistent with studies from elsewhere showing male predilection,1 and there is no evidence to date that explains this finding.12 one possible reason is that female children are more able to mask their behavioral difficulties than males.19 moreover, culture in developing countries may be a contributing factor, as some families may pay more attention to the development of male children compared with females . As the burden of reporting cases falls on parents; there could be a lack of detection or lack of willingness to report certain behavior exhibited by a female child . This cultural perception could explain the older age for females at autism diagnosis in saudi arabia.19 either way; more research is needed to explain other reasons behind this significant gender difference . Still, with consanguinity rates in saudi arabia that range from 34 - 80%, depending on rural, or urban setting, this risk factor deserves further investigation.19,28 lead toxicity has been associated with autism,22 which is in agreement with other research.29 however, the nature of environmental exposure that might have contributed to lead toxicity was not clarified in the study . A strong dose - response protective effect of breastfeeding21 is in agreement with other studies,30,31 but potential for recall bias remains high as data collection depends on parents memory and reporting . Findings for various biomarkers were comparable with studies carried out elsewhere.29,32 - 35 still, more research is needed to clarify applicability of these biomarkers for early screening or monitoring of autistic patients . First, is the sample size, as numbers of cases and controls used were small and cannot be considered representative . Also, the recruitment of cases and controls was from specialized clinics / tertiary care institutions, which might be problematic when extrapolating results to community autistic children in gcc countries . Second, is that cases were recruited from pediatric wards, and none come from psychiatric clinics . The diagnosis of autism must include more comprehensive behavioral / psychological considerations to form a full picture about the disorder . The current study s limitations were the small number of studies identified and absence of studies from 3 gcc countries, which precluded comparing prevalence of autism across countries . Generally, there is an evident lack of research into risk factors affecting the etiology of autism in gcc countries . Consanguinity, multiparity, and closely - spaced pregnancies are common in the gcc region, and provide an exceptional opportunity to learn more about genetic determinants of the disease . Also, dietary habits should be looked into as they could help in i) investigating the risk and prognostic factors of the disease and, ii) assisting families by identifying high - risk foods that could affect their children . More focus should be given to children in psychiatric wards to identify autistic symptoms among them . In conclusion, population - based studies should focus on quantifying the burden of asd in gcc countries . Knowing the burden and extent of disease could help design screening tools that are applicable, culturally acceptable, and cost - effective to identify individuals who can benefit the most from early diagnosis and intervention . Furthermore, raising asd awareness among parents, preschool / elementary school teachers are invaluable in helping autistic children cope with different challenges . Generally, there is an evident lack of research into risk factors affecting the etiology of autism in gcc countries . Consanguinity, multiparity, and closely - spaced pregnancies are common in the gcc region, and provide an exceptional opportunity to learn more about genetic determinants of the disease . Also, dietary habits should be looked into as they could help in i) investigating the risk and prognostic factors of the disease and, ii) assisting families by identifying high - risk foods that could affect their children . More focus should be given to children in psychiatric wards to identify autistic symptoms among them . In conclusion, population - based studies should focus on quantifying the burden of asd in gcc countries . Knowing the burden and extent of disease could help design screening tools that are applicable, culturally acceptable, and cost - effective to identify individuals who can benefit the most from early diagnosis and intervention . Furthermore, raising asd awareness among parents, preschool / elementary school teachers are invaluable in helping autistic children cope with different challenges.
As the cervical spine degenerates with age, there is increased risk of undesirable conditions such as displacement or degeneration of intervertebral disc, slackness of annulus fibrosis, osteophytosis of vertebral body and instability . Degenerative cervical disc may cause posterior neck pain, radiating pain on arm or shoulder, or cervical myelopathy . Anterior cervical discectomy and fusion (acdf) is a safe and standard operation for the treatment of degenerative cervical disc disease concerned with radiculopathy or myelopathy29). The main purposes of intervertebral cage are biomechanical support, restoration of disc height, maintaining of cervical lordosis and ideal osteointegration4,17,19). Tricortical iliac crest autobone graft results in numerous complications including breaking of bone graft, collapsing, pseudoarthrosis, subsidence, angular deformation, protrusion of bone block, pain or bleeding of donor site and infection22,30,31). The most frequently donor site related complication is pain, and infection of harvest site could be a nettlesome problem23). To solve these problems, various types of artificial cages providing immediate firmness without a plate system a standard cage alone for acdf is an effective method to treat degenerative cervical disease23). Short term clinical follow up data has been published less than 18 months after acdf with the polyetheretherketone (peek) cage . In the current study, we present a retrospective long term(mean period: 36 months) study of thirty consecutive patients after acdf with solis cage with iliac autobone graft . We collected information from charts of patients who visited our neurosurgical department from march 2006 to july 2008, retrospectively . Only patients with single level acdf without anterior cervical plate were eligible for the study, and thirty patients were selected (male: 20 patients and female: 10 patients). The mean age was 47.67.1 years (range from 28 to 63 years old). The patients who complained of radiculopathy were 21, myelopathy were 2 and myeloradiculopathy were 7 patients . Mean follow - up period was 36.48.1 months (ranged from 23 to 49 months). A right side skin incision was done in all cases; fluoroscopy was used to check the target level . Complete removal of the disc, lateral decompression and end plate flattening for maximal contact with cage was performed . After selection of ideal trial size by using intraoperative fluoroscopy, harvested cancellous bone from the iliac crest filled in the hollow space of the cage . Finally, we checked that the radiopaque titanium spike was in an adequate location by fluoroscopy . We used the japanese orthopedic association (joa) score for evaluation of myelopathy and visual analogue scale (vas) for radiating pain to estimate postoperative clinical outcome . We assessed degree of pain relief between preoperative and postoperative (last follow - up) status by using two scoring systems . Three parameters were used to evaluate radiologic outcome: anterior disc height (adh), interbody height (ih) and segmental interbody angle (sia) (fig . They were checked by plain x - ray on true lateral standing and classified into flexion, extension and neutral position view and 3d ct scan every 6 months after the surgery . Fusion was defined according to trabecular bony formation across interfaces between cage and endplates and bony bridge formation between endplates . Fusion was classified into 3 classifications: grade i, bridging bone partially filling the cage; grade ii, bridging bone filling the cage; and grade iii, bridging bone within and around the cage26). We collected information from charts of patients who visited our neurosurgical department from march 2006 to july 2008, retrospectively . Only patients with single level acdf without anterior cervical plate were eligible for the study, and thirty patients were selected (male: 20 patients and female: 10 patients). The mean age was 47.67.1 years (range from 28 to 63 years old). The patients who complained of radiculopathy were 21, myelopathy were 2 and myeloradiculopathy were 7 patients . Mean follow - up period was 36.48.1 months (ranged from 23 to 49 months). A right side skin incision was done in all cases; fluoroscopy was used to check the target level . Complete removal of the disc, lateral decompression and end plate flattening for maximal contact with cage was performed . After selection of ideal trial size by using intraoperative fluoroscopy, harvested cancellous bone from the iliac crest filled in the hollow space of the cage . Finally, we checked that the radiopaque titanium spike was in an adequate location by fluoroscopy . We used the japanese orthopedic association (joa) score for evaluation of myelopathy and visual analogue scale (vas) for radiating pain to estimate postoperative clinical outcome . We assessed degree of pain relief between preoperative and postoperative (last follow - up) status by using two scoring systems . Three parameters were used to evaluate radiologic outcome: anterior disc height (adh), interbody height (ih) and segmental interbody angle (sia) (fig . They were checked by plain x - ray on true lateral standing and classified into flexion, extension and neutral position view and 3d ct scan every 6 months after the surgery . Fusion was defined according to trabecular bony formation across interfaces between cage and endplates and bony bridge formation between endplates . Fusion was classified into 3 classifications: grade i, bridging bone partially filling the cage; grade ii, bridging bone filling the cage; and grade iii, bridging bone within and around the cage26). We compared vas for neck and arm between preoperative and last follow - up status, additionally, joa score was also used . The mean vas for neck at the last exam was 2.50.8 and for arm was 3.21.1 (p - value <0.05). In joa scoring assessment for 9 patients who were suffered from myelopathy, score improved from 11.12.9 at preoperative status to 14.52.6 at last exam(p - value <0.05). Among 30 cases, 22 patients were performed 3 dimensional ct scan (3d ct) at last follow - up and remainders were checked by cervical dynamic plain x - ray . Radiological fusion rate was accomplished by 100% in selected group after 36 months after the surgery . Grade i fusion were found in 1 case, grade ii were in 3 cases and grade iii were in 18 cases on 3 dct scan . On plain x - ray, grade i fusion was no case, grade ii were 1 cases and grade iii were 7 cases (fig . The mean adh was 6.271.47 mm before the surgery and improved to 10.631.32 mm after the surgery (p - value <0.05). Some degree of subsidence occurred at the last follow - up and final adh was 8.321.08mm(p - value <0.05). In same way, ih improved from 36.73.35 mm to 41.24.23mm(p - value <0.05) and slightly decreased to 38.73.75 mm at the last exam(p - value <0.05); however, we still achieved an increase of ih . The mean preoperative sia was -3.353.44 and postoperative sia was -6.853.01 (p - value <0.05). At the final exam, sia was -3.213.61, not statistically different between postoperative sia and final exam sia (p - value=0.813). We had no complications concerned with the surgery itself except one case of osteomyelitis . During the follow - up period the superficial osteomyelitis of iliac bone donor site developed in 1 patient and a culture study of the infection site confirmed methicillin resistant staphylococcus aureus (mrsa) infection . We performed local debridement and irrigation and treated with vancomycin intravenous treatment for 10 days . We compared vas for neck and arm between preoperative and last follow - up status, additionally, joa score was also used . The mean vas for neck at the last exam was 2.50.8 and for arm was 3.21.1 (p - value <0.05). In joa scoring assessment for 9 patients who were suffered from myelopathy, score improved from 11.12.9 at preoperative status to 14.52.6 at last exam(p - value <0.05). Among 30 cases, 22 patients were performed 3 dimensional ct scan (3d ct) at last follow - up and remainders were checked by cervical dynamic plain x - ray . Radiological fusion rate was accomplished by 100% in selected group after 36 months after the surgery . Grade i fusion were found in 1 case, grade ii were in 3 cases and grade iii were in 18 cases on 3 dct scan . On plain x - ray, grade i fusion was no case, grade ii were 1 cases and grade iii were 7 cases (fig . The mean adh was 6.271.47 mm before the surgery and improved to 10.631.32 mm after the surgery (p - value <0.05). Some degree of subsidence occurred at the last follow - up and final adh was 8.321.08mm(p - value <0.05). In same way, ih improved from 36.73.35 mm to 41.24.23mm(p - value <0.05) and slightly decreased to 38.73.75 mm at the last exam(p - value <0.05); however, we still achieved an increase of ih . The mean preoperative sia was -3.353.44 and postoperative sia was -6.853.01 (p - value <0.05). At the final exam, sia was -3.213.61, not statistically different between postoperative sia and final exam sia (p - value=0.813). We had no complications concerned with the surgery itself except one case of osteomyelitis . During the follow - up period the superficial osteomyelitis of iliac bone donor site developed in 1 patient and a culture study of the infection site confirmed methicillin resistant staphylococcus aureus (mrsa) infection . We performed local debridement and irrigation and treated with vancomycin intravenous treatment for 10 days . Acdf has been performed for treatment of cervical degenerative disease and applied to infectious disease, cervical trauma and tumorous condition10). Clinically, acdf with cage system began to be used regularly after clinical success of prospective research year 200013). Single level acdf with autograft shows over 95% of fusion rate and approximately 80% of neurologic improvement15,24,25). Some reports postulated there was no need for fusion after cervical discectomy and fusion should be considered only when instability occurs32). The limitation of a cage - alone procedure is weak initial mechanical stability and subsidence to endplate . A cervical anterior plate and screw system provides reduction of kyphotic angulation, prevention of implant migration, and increases fusion rate and durable fixation . There may be, however, dysphasia due to plate and loosening, breakage of screw, plate migration and stress shield3,5,15). Innovative development of surgical instrument have reduced complications of the anterior plate system . However, complications are still reported even though dynamic plate or self locking screw is suggested27). The peek cages are biologically inactive which means they do not induce a corrosive reaction and provide high versatility and good mechanical properties while causing minimal artifacts on mri and ct8,9). Furthermore, excellent radiolucency gives information that surgeon can use to adjust the cage at an optimal location during operation, and bone fusion can be readily evaluated by plain x - ray11,34). Titanium spikes on upper and bottom can make easy to anchor the vertebral body and provide immediate fixation, therefore cage migration is prevented . Elastic modulus is defined as the capacity of returning to its initial shape when load is removed . Lower elastic modulus shows a more natural characteristic with respect of bone material and lead to reduction of stress shield and increase bony fusion rate33). Among several cervical implants, high elastic mismatch between cage and bone can affect bone growth, promoting cortical thinning and subsidence in the case of metallic cages18,34). Generally, it is acceptable that bone fusion is achieved around 3 to 6 months after the surgery when using the peek cage . Cho et al . Reported 100% of bone fusion in forty cases was achieved by using peek cage comparing 93.1% of bone fusion when using iliac tricortical bonegraft9). In this study, we achieved 100% of fusion rate . Only cancellous bone from the iliac crest might be great role of increase fusion rate and small size of patient group might be another cause . The frequency of harvest autograft has decreased gradually, because of the relatively high rate of complications18). Complications of tricortical iliac bone graft are various such as displacement bone graft, pseudoarthrosis, hematoma, pain, nerve injury and infection of donor site20). The incidence of related complications has been reported to be as high as 20% to 50%1,28). Moreover, the low stabilization support of iliac crest grafts requires instrumentation with anterior plate34). To reduce complications related with donor site, many types of material have been studied to substitute autologous bone, but none of these have showed advantage over autologous bone6,16). Many complications related with iliac bone graft have been reduced with the use of cage system23). In our patient group, the wound incision on the donor site was performed minimally and harvested only small amount of cancellous bone to minimize related complications . Numerous materials have been tried to substitute for autologous bone graft to reduce donor site related complications . The ultimate material could provide immediate structural support and osteogenic intergration23). Since introduction of the cervical cage, numerous types of cage have been designed; however subsidence of cage was reported frequently . Ha et al . Studied subsidence in standalone solis cage and found 8.1% of cages had subsidence greater than 3mm12). Noted that a decrease of disc height after operation did not affect clinical outcome20). Lee et al . Found that subsidence occurred on radiologic evaluation at last follow - up when they used dmb rather than autologous bone graft23). However, our data shows that at 36 months follow - up ih is still maintained compared to preoperative ih which implies autologous bone graft helps earlier bone fusion than dbm . Symptomatic adjacent segment problems occur at rate of 2.9% per year during ten years after acdf with autologous bone graft, the risk was lower in multilevel acdf than in single level, and the fusion rate declines as the number of involved levels increase11,14). In our study, we could not find degeneration of adjacent levels, but we concluded that this is due to small size of patient group . In current study, the complications of acdf with the peek cage did not include breaking, pseudoarthrosis, kyphotic angulation, protrusion of cage itself, and severe subsidence . However, one patient suffered from infection of donor site . Local heating and pus discharge occurred at right iliac crest where cancellous bone was harvested and culture study performed . Methicillin - resistant staphylococcus aureus (mrsa) was detected and vancomycin was prescribed for a week . To establish a role of the peek cage in acdf the authors searched many articles to find a long term follow - up study for clinical outcome after acdf with peek cage longer than 36 months but we believe that this study is the first report for long term follow - up . Acdf with the solis cage provides favorable clinical outcomes and radiologic fusion rates comparing with other classical or alternative cervical fusion methods . It does not cause plate relating complication and radiologic opacity of cage spike enable to locate a cage at optimal location by using fluoroscope . There have been several reports that describe the efficacy of acdf with peek cage for short term follow - up, but long term(more than 24 months) follow - up studies are rare . We present here a long term follow - up study for acdf with peek cage and its clinical efficacy is favorable.
The main attributes of biological identity are sex, age, stature, and ethnic background of the individual, which are also called the big four in forensic context . Human identification is of paramount importance, for both legal as well as humanitarian purpose . Albeit there have been tremendous advancements in forensic medicine, this remains a practical problem . The use of dental identification has long been considered a reliable method, especially when other methods (fingerprints) fail because body conditions are not available, and over time, forensic odontology has emerged as a complete branch . Teeth can survive and remain virtually unaffected long after other soft tissue and skeletal tissues have been destroyed . The recognition of teeth as a tissue that withstands great variation in environment (temperature upto 1600 c, humidity, and ph) has lead to its application in personal identification . It has been observed in past time that dental tissues have witnessed its importance worldwide where it has contributed enormously in identification of victims in disaster, 80% of non - thai in tsunami in thailand and 20% in 26/11 incidence where 12 coordinated shooting and bombing attacks were carried by terrorists in mumbai, india's most populous city on 26 november, 2010 were identified using teeth . Other than this, it has been reported that renowned people like adolf hitler and indian prime minister rajiv gandhi were identified using tooth . Several parameters have been proposed for sex determination to identify an individual from teeth, but none of them have proved its reliability . Recently, dna analysis in forensic have gained attraction, but it is expensive and time - consuming . This prompted us to look for other methods of dental identification, which will be cost - effective yet reliable . Tooth pulp is encased in a hard tissue casting, where it may be protected from detrimental effects of impact, trauma, and heat . Developed a technique using pulpal tissue stained with quinacrine mustard, specific for y chromosome to determine sex of an individual . In literature, there is scarcity of relevant studies that analyzed the effect of caries on viability of pulpal tissue in sex determination . So, keeping in mind this fact, present study was conducted to analyze the effect of caries on pulpal tissue stained with quinacrine hydrochloride with the application of fluorescent microscope . This study was carried out in the department of oral pathology and microbiology, swami devi dyal hospital and dental college barwala, panchkula . The study protocol was approved by the ethical committee of college before commencement of the procedure . Fifty maxillary and mandibular permanent teeth that were indicated for extraction for periodontal and endodontic reasons were included in the study . Study sample consisted of 25 male and 25 female teeth, which were further categorized into 5 groups of 10 each (10 from males and 10 from females) based on the extent of caries progression . Group a includes freshly extracted tooth specimens with no caries, group b consisted of tooth specimens with caries in enamel, group c comprised of tooth specimens with caries less than half way of dentin, group d consisted of freshly extracted teeth with caries more than half way of dentin, and group e includes freshly extracted tooth specimen with caries involving pulp . The teeth were examined radiographically and clinically for analyzing the various stages of caries progression [figure 1]. (a) sound teeth, (b) enamel, (c) less than half way of dentin, (d) more than half way of dentin, (e) pulp modeling wax was folded and made into a block . The tooth was embedded on the modeling block . To remove the pulp, the crown it was adequately washed in normal saline to remove any calcified bone or dentine particles . The pulp tissue was then transferred to the dry and clean conical centrifuge tubes containing 5 ml of fixative (3 methanol:1 glacial acetic acid) and left as such for about half an hour to 2 hours for the fixation of the pulp cells . It was then crushed with the glass rod sufficiently to isolate the pulp cells . A suspension five ml of fresh fixative was then added to re - suspend the pellet, and the process was repeated thrice till a clear suspension of the pulp cells was obtained . Thin smears were prepared on chilled microscope slides of 1 mm thickness by the air - drying method i.e., by dropping 2 - 3 drops of the above suspension on the slide from a distance of inches to get a homogenous population of cells . The slide was mounted in buffer of ph 5.5 and was observed under leica dmr fluorescent microscope (oil immersion in dark field at 40) by bv exciting method (emitting a blue - violet color, mainly at 4.047a0 and 4.038a0). Only those cells which contained the characteristic y chromatin i.e., a brightly fluorescent spot attached to the nuclear membrane were counted as positive cells while those which did not show any such fluorescent spot were labeled as negative . Results obtained were subjected to statistical analysis by using independent t - test using spss (version 9.0) software . The tooth was embedded on the modeling block . To remove the pulp, the crown it was adequately washed in normal saline to remove any calcified bone or dentine particles . The pulp tissue was then transferred to the dry and clean conical centrifuge tubes containing 5 ml of fixative (3 methanol:1 glacial acetic acid) and left as such for about half an hour to 2 hours for the fixation of the pulp cells . It was then crushed with the glass rod sufficiently to isolate the pulp cells . A suspension five ml of fresh fixative was then added to re - suspend the pellet, and the process was repeated thrice till a clear suspension of the pulp cells was obtained . Thin smears were prepared on chilled microscope slides of 1 mm thickness by the air - drying method i.e., by dropping 2 - 3 drops of the above suspension on the slide from a distance of inches to get a homogenous population of cells . The slide was mounted in buffer of ph 5.5 and was observed under leica dmr fluorescent microscope (oil immersion in dark field at 40) by bv exciting method (emitting a blue - violet color, mainly at 4.047a0 and 4.038a0). Only those cells which contained the characteristic y chromatin i.e., a brightly fluorescent spot attached to the nuclear membrane were counted as positive cells while those which did not show any such fluorescent spot were labeled as negative . Results obtained were subjected to statistical analysis by using independent t - test using spss (version 9.0) software . This study was done to evaluate the use of the fluorescent body test as a diagnostic test for sex determination . Table 1 showed sensitivity, specificity, positive predictive value, negative predictive value, and efficiency of each of the five groups . The values obtained were highest for sound teeth with caries in enamel and value decreases with the progression of the caries . Table 2 depicted that fluorescent bodies were found to be more in sound teeth in males as the caries increase, the mean percentage of fluorescent bodies observed decreases in males . We also observed the fluorescent spots in females, and the value of the spot increases in female as the caries progresses, thereby giving false positive results in females [figure 3]. The p value were found to be significant for sound teeth and teeth with caries in enamel and involving less than half the way of dentin, whereas it was non - significant for teeth involved with further caries involvement . Diagnostic utility of fluorescent body in identifying gender percentage of fluorescent bodies (in%) in different groups fluorescent photomicrograph showing bright fluorescent cell in males representing y chromosome fluorescent photomicrograph representing faint fluorescence in females despite the fact that tremendous research work is carried out to determine a reliable method, but none have proven its efficacy . The most reliable means of identification include fingerprints, dental comparisons, and biologic methods such as dna profiling . In some cases, however, fingerprints are not available from the deceased, or ante - mortem prints cannot be obtained . Sex determination from skull is highly unreliable although number of workers have described differences in the size of male and female teeth, such measurements seem unlikely to be used to determine the sex of an individual . So, a technique has been developed, which may offer a solution whenever soft tissue remains can be recovered . Casperson et al . Showed that chromosome stained with quinacrine mustard fluoresced differentially along their length when viewed in ultraviolet light and the human y chromosome fluoresced more brightly than other chromosomes . He suggested that alkylating agents like quinacrine acts on the dna portion rich in guanine and accumulate there . This technique has been used in forensic science for sex determination from dried blood stains, saliva, and hair . Thus, it might be applicable to sex determination from tooth pulp some time after death, because the teeth are a stable part of the skeleton and the pulp tissue is well - protected . Seno and ishizu carried out the detection of y chromosome in the nuclei of dental pulp . They found that f- body positive rate in the nucleated cells of male dental pulp was over 30%, even with the male teeth as old as 5 months, after the extraction . With female teeth, typical f - body cannot be detected, and f - body like spot has been observed in 0.4% of cells, indicating that there can be no error in the identification of male tooth from that of female one, even such an f - body like spot is taken as an f - body itself . Present study revealed that in males, 60 - 75% fluorescent y bodies [figure 2] were observed in sound teeth (mean 69.4% bodies), 59 - 70% bodies in tooth with caries in enamel (mean 64.2% bodies), 19 - 53% in teeth with caries in half way of dentin (mean 39.8% bodies), teeth with caries involving more than half way of dentin and involving pulp showed 13 - 29%, 1 - 19% (mean 21.8%, 6.37% bodies) off bodies respectively as shown in table 2 . Seno and ishizu showed a range of 56 - 72% fluorescent y bodies in freshly extracted sound teeth, which are in accordance to sound teeth in this study . Pseudo y body in the present study [figure 4] in females were found to be in the range of 0 - 12% (mean 5.2%), 0 - 12% (mean 5.2%), 14 - 22% (mean 17.8)%, 12 - 22 (mean 16.8%), and 7 - 15% (mean 11.6%) for sound teeth, teeth with caries in enamel, caries in half way of dentin, caries involving more than half way of dentin caries, and caries involving pulp, respectively, as shown in table 2 . Fluorescent photomicrograph representing artifacts or pseudo f - bodies in females discrepancy between various studies could be attributed to random inclusion of carious and non - carious teeth . So, the present study considered the effect of caries on fluorescent body test as literature (when searched via pubmed and medline) revealed lack of studies analyzing this fact . From present study, it can be inferred that as the caries progresses from enamel to dentin and further to pulp tissue, the sensitivity and specificity of determining y chromosome decreases [table 1]. When the caries have involved only enamel or half the way of dentin, it has shown significant difference in fluorescent body test determining males and females, unlike when it involved more than half way of dentin and pulp where the difference is non - significant [table 2]. The decrease in y body could be attributed to the fact that cariogenic bacteria alter the microenvironment of pulp, resulting in alteration in fluorescent staining . As the caries progresses, the inflammatory processes in the pulp are initiated, as the inflammation progresses the internal architecture of the cell is lost, and is also characterized by necrotic poorly stained cellular debris . Many workers attributed the appearance of fluorescent bodies in females to artifacts, whereas others ascribed it to the presence of fluorescent debris . It was necessary to smear pulp cells thinly to prevent masking the fluorescent y chromosomes by fluorescent debris . Sex determination by fluorescent staining of the y chromosome is a reliable technique in teeth with healthy pulp tissue or caries with enamel or upto half way of dentin.
It is a relatively rare odontogenic lesion which exists either as a cystic or a solid variant and is characterised by varied clinical, radiographical and biological features . The central ccot appears as a unilocular or multilocular destructive radiolucent lesion containing irregular calcifications . Various terminologies used for ccot include calcifying odontogenic cyst, gorlin cyst, calcifying ghost cell odontogenic tumour and epithelial odontogenic ghost cell tumour, keratinizing calcifying odontogenic tumour . In 2005, the world health organization classification of head and neck tumors reclassified ccot as an odontogenic tumor and gave it the name of calcifying cystic odontogenic tumor . Is a developmental cyst of odontogenic origin and constitutes about 0.37% to 2% of all odontogenic tumours . Ccot are cysts of primordial origin and not associated with crown of any impacted tooth . Ccot may occur as a central lesion or as a peripheral lesion (although rare). A comprehensive review of the available literature relating to malignant transformation of ccot was undertaken using medline, pubmed, google scholar and scopus in all languages . We used the following keywords for searching: calcifying cystic odontogenic tumour, malignancy and ghost cell odontogencic carcinoma from 20032013 . We also used the related articles feature of pubmed to identify further references of interest within the primary search . These articles were obtained, and from their references lists, pertinent secondary references were also identified and acquired . Ghost cell odontogenic carcinoma (gcoc) is a rare tumour which is a malignant counterpart of ccot . Ghost cell odontogenic carcinoma may arise as a denovo tumour or from previously existing ccot . One third cases of ghost cell odontogenic carcinoma are reported to be derived from a preexisting ccot and malignant transformation may take several years . However some of the ghost cell carcinoma may develop without history of ccot [1214]. Recurrent ccot and gcoc are more common in the maxilla [8, 15]. Painful swelling with local paraesthesia is the most common symptom of ghost cell odontogenic carcinoma . Some authors reported of infiltrative growth, root resorption and tooth displacements in cases of gcoc [16, 17]. Ct scan demonstrated bone expansion and bone destruction with irregularly shaped calcified inside the lesion . Magnetic resonance images showed a mass with high signal intensity . Li et al . Reported an ameloblastoma - like epithelia with prominent features being presence of lots of ghost cells, dysplastic uncalcified dentin or osteodentin . Increased nuclear / cytoplasmic ratio with 12 nucleoloi and atypical mitotic figures were also reported . According to motsugi et al ., tumour cells densely proliferates the epithelial component and the nucleus of tumour cells were enlarged and variable in size . Immunohistochemical analysis of gcoc by motossugi et al . Revealed that 70% of tumour cells were reactive for p53 and ki-67 index was 4% to28% . Expression of ki-67, mmp-9 and timp-1 was stronger in gcoc when compared to ccot . Mmp-9 in stroma is associated with invasive ability of ccot and gcoc and ki-67 is associated with increased cellular proliferation . According to gomes et al ., there is a variable expression of syndecan-1 in stellate reticulum, stromal cells and basal cells of ccot and gcoc and might be associated with the biology of these tumors . A total of 8 cases have been reported in the literature from 2003 - 2013 where ghost cell odontogenic carcinoma has probably developed from ccot . These cases are enlisted in table 1, [8, 13, 14, 1618, 21, 22]. Of the 29 patients diagnosed, 5 died of local recurrence and metastasis to brain and lung has been reported . The most commonly employed treatment was surgery with wide excision . In some cases radiotherapy and after reviewing the literature we conclude that recurrent and long standing case of ccot can undergo malignant transformation . Gcoc, the malignant form of ccot can metastasize and can even lead to deaths . So it is mandatory to follow up the patients with ccot for possible eventual development of malignant counterparts.
An adrenal incidentaloma is an adrenal mass, larger than 1 cm in diameter, detected on imaging studies performed for other indications than adrenal disease [1, 2]. The increasing use of computed tomography (ct) scans and magnetic resonance imaging (mri) causes a marked increase in incidence of adrenal incidentalomas . In approximately 6% of all autopsies and 4% of all abdominal ct scans an incidentaloma of the adrenal gland is discovered [4, 5]. The incidence of adrenal incidentaloma increases with age to an incidence of 10% in patients over 70 years old . Adrenal incidentalomas are characterized by size, growth, imaging characteristics, and functional status . Although rare, the normal function of the adrenal gland can be disrupted by adrenal incidentalomas . In most cases adrenal incidentalomas will be a small, nonhormonal active cortical adenoma, a benign impediment (80%). Some adrenal incidentalomas cause hormonal hypersecretion (15%) or appear to be a primary or secondary malignancy (<5%) [6, 7]. Adrenal incidentalomas can cause disease by hypersecretion of hormones . Conditions due to hormonal activity of adrenal incidentaloma include hypercortisolism, (cushing's syndrome), catecholamine excess (pheochromocytoma), or hyperaldosteronism (conn's syndrome). Subclinical autonomous cortisol hypersecretion is the most frequent hormonal abnormality in patients with adrenal incidentalomas . Some of these patients eventually develop overt clinical cushing's syndrome . Adrenal cortical adenomas with or without hormonal overproduction vascular lesions of the adrenal are suggestive of a medullary derived pheochromocytoma, but confirmation of a pheochromocytoma by serum or urine measurement of metanephrines is required to diagnose pheochromocytoma . Not only will the radiologist appoint this finding in the radiology report, the radiologist will often also add a recommendation for the next diagnostic procedure . This retrospective study aims to get a clear view on the detection rate of adrenal incidentalomas on abdominal ct scans in our hospital, and the subsequent diagnostic procedures used after detection of this incidental finding . This retrospective study was designed to investigate the detection rate of adrenal incidentalomas on abdominal ct scans . For inclusion in this investigation, an adrenal incidentaloma was defined as an adrenal mass, greater than 1 cm in diameter, initially discovered by diagnostic imaging for a clinical condition not related to, or suspicious for, adrenal disease . Two investigators learned from an expert radiologist to examine ct scans of the abdomen for primarily the adrenal gland . Each investigator independently evaluated 180 ct scans out of 360 ct scans, of many patients, that were indicated for diagnostics of hepatic, pancreatic, or renal pathology between 2005 and 2007 . Age, gender, indication for ct scan, and abnormalities in size or morphology, were noted . At the time of examining the adrenal glands, the investigators were not aware of the content of ct scans' radiology report or indication for ct scan . Only after their own judgement about size and aspect of the adrenal glands, indication for ct scan and the radiology report an expert abdominal radiologist (over 45,000 abdominal ct scans examined) reviewed the ct scans marked by the investigators with abnormal adrenal glands in size or morphology and results were compared . If an adrenal incidentaloma was mentioned in the original radiology report, the patients' record was reviewed to determine whether additional investigations, for example, hormonal studies, additional imaging, or interventional diagnostic studies, were performed after the ct . An interobserver test was performed to evaluate the resemblance of the way of evaluation between the investigators and expert radiologist . The ct scans performed for suspected hepatic, pancreatic, or renal pathology of 75 new patients, between 2007 and 2008, were evaluated for this purpose . The interobserver variability was calculated with the friedman test, a non - parametric test for coupled observations, with independent observers . Of the 360 patients studied, 206 (57%) were men and 154 (43%) were women . Of the total of 360 patients, 4 patients were excluded because suspected adrenal pathology was also an indication for imaging in these patients . In the remaining 356 ct scans evaluated, the investigators discovered independently a total of 44 (12%) abnormal adrenal glands in 42 patients (2 bilateral adrenal incidentalomas). Each radiology report was checked for adrenal incidentalomas which were already noted . In 25 (7%) of 356 patients an adrenal mass the expert radiologist reassessed the ct scans of 42 patients; the radiologist discovered 17 patients with an adrenal incidentaloma . Two patients had bilateral incidentalomas, giving a total of 19 adrenal incidentalomas not noted previously (figure 1). The total number of adrenal incidentalomas was 44/356 (12%) in 42 patients . Figure 3 shows an enlarged right adrenal not mentioned in the initial radiology report . In 64 of 356 (18%) patients, a malignancy was the indication for imaging . Patients with an adrenal incidentaloma were more likely to have a malignancy as indication for ct scan, 20/42 (48%). The 25 patients that had an adrenal incidentaloma mentioned in the initial radiology report were checked for additional diagnostic procedures performed . In 3/25 patients a follow - up ct scan none of these patients showed hormonal overproduction caused by the adrenal lesion . In 2 patients (8%) a second ct scan was performed to exclude increase in adrenal size; there was no growth of the adrenal lesion shown . One patient who underwent a hemihepatectomy had a simultaneous resection of the right adrenal incidentaloma . The interobserver variation was calculated using a friedman analysis test to exclude or to demonstrate a significant difference in perception between different readers . The friedman test showed that there was no statistically significant difference in perception between the investigators and the radiologist (p = .867). The detection of adrenal incidentalomas in this study was 7% and the actual incidence of adrenal abnormalities was 12% after focused assessment of ct scans . This is high compared to other studies and can be explained by the relatively large group of patients who underwent imaging examination because of a malignancy [7, 11]. However, because of the absence of histological examination of the enlarged adrenal glands, it cannot simply be concluded that these patients had metastases in the adrenal gland . The incidence of adrenal incidentalomas in the literature varies from 0.5% to 15% and depends mainly on the age of the investigated group [11, 12]. Only 6 of 25 (24%) patients with an adrenal incidentaloma were further investigated with hormonal workup or imaging . One reason for the lack of additional diagnostic testing and treatment after detection of an adrenal incidentaloma is the lack of a clear evidence based guideline . Also unfamiliarity with adrenal incidentalomas by the physician who has requested the ct scan will cause lack of additional screening . Another reason for the lack of additional diagnostic testing of adrenal incidentalomas is the apparent lack of direct clinical consequences [13, 14]. Undetected hormonal hypersecretion will probably reveal itself in time and the chance of an adrenal carcinoma is low with 0.72/million / year [10, 13]. Because of this low risk of malignancy and because of the limited impact of hormonal overproduction in an asymptomatic patient, it is not clear whether a guideline for diagnosis and treatment of adrenal incidentaloma is necessary . Such a guideline may cause an increase in diagnostic procedures with additional burden and uncertainty for the patient . A comprehensive cost - effectiveness study showed however that hormonal analysis of an adrenal incidentaloma is cost effective . The cost effectiveness of additional imaging of the adrenal gland is less clear in this study . In addition, the radiation dose to the patient becomes more important and therefore complementary imaging with an mri scan has its advantage . The optimal strategy for screening and followup of an adrenal incidentaloma is still under discussion . The guideline of the nih (2002) seems to be the best alternative in this debate, but the nih already recognized that the guideline is not based on hard evidence . (table 1) protocols on the diagnostic procedures of adrenal incidentalomas are described in several other publications as well, without describing additional prospective data on the clinical results of these protocols [9, 10, 1518]. There are currently no prospective studies that have examined the effects of an additional diagnostic procedure for adrenal incidentalomas . Following this study a guideline for additional screening and followup was made (figure 2). In each radiology report a recommendation will be added for every patient with an adrenal incidentaloma and the referring physician is pointed to a webpage with a brief summary about adrenal incidentalomas . This website also contains the brochure with information for patients, which can be printed . In conclusion, it is not always noted by the radiologist and focused assessment of abdominal cts increased the detection rate of this abnormality form 7% to 12% . When detected and mentioned in the radiologist's report, only a small percentage of patients receives additional hormonal or imaging investigations to determine the nature of the incidentaloma.
Top down mass spectrometry describes an analytical process for the identification and characterization of whole proteins . The canonical top down experiment consists of a precursor scan to obtain the intact mass of the proteoform(s) under study and a tandem mass spectrum (ms / ms) obtained using ion fragmentation techniques such as ecd, etd, hcd, cid, or uvpd . The defining characteristic of a top down experiment is that the precursor ion is an intact proteoform, not the typical small peptides (less than 3 kda) produced from intentional enzymatic digestion prior to mass spectrometry (ms). Thus, the mass of the precursor ion should represent a native proteoform present in the sample, with its fragment ion masses providing extensive characterization and verification of the primary structure . As larger proteins are targeted, experiments tend toward acquisition logic involving spectral averaging for both the precursor and fragment ions to improve the data quality . These combined data are then analyzed to infer the neutral masses of all intact and fragment ion species observed . For proteins analyzed by electrospray ionization, this analysis to infer mass (aim) uses either isotopic spacings for direct charge state assignment and/or deconvolution of protein charge states . Historically, top down mass spectrometry has targeted the in - depth characterization of a small number of proteoforms; however, the past 5 years has seen a gradual transition to while the number of proteins able to be identified has risen into the thousands, the extent of characterization of each individual proteoform varies and currently there is no scoring framework that captures this aspect of top down proteomics . In certain cases, a protein (arising from a specific gene) may be identified confidently with no inference problem whatsoever, yet may be only partially characterized as shown in figure 1 . In figure 1b, two equivalent proteoforms, one with a post - translational modification (ptm) in the first position and the other with the ptm in the second, will each have the same number of matching fragment ions . Scoring systems based only on matching ions will report equal scores for these two proteoforms . This example illustrates how a proteoform can be clearly identified (i.e., the evidence supporting the identification of either of the two positional isomers is strong), yet not fully characterized . This problem of ptm site localization is encountered in bottom up, and has been dealt with in various ways . In targeted top down ms generating just a few spectra, manual reanalysis of data, or curation of the primary literature, can be used to select one protein form over another highly related one . In such cases, expert decisions are made to distinguish proteoforms with similar primary structures taking into account cleavage propensity of pairs of amino acids, complementary ion pairs, sequence tags, and mass errors of precursor and fragment ions . Incomplete fragmentation may or may not lead to partial characterization of a protein molecule . In panel (a), the matched fragment ions uniquely determine the location of the post - translational modifications (ptms). In panel (b), incomplete fragmentation in the middle of the protein backbone does not yield a definitive ptm localization . In this particular example, the ptm could be located at either of two amino acids, resulting in an identified, but partially characterized proteoform . The c - score framework was developed to handle such cases, routinely encountered in top down proteomics . N - terminal fragment ions are colored red, while c - terminal fragment ions are shown in blue . The numbers below the fragment ions indicate how many ptms are reported on by each ion . With the shift to high - throughput, fully automated data collection, we now seek a framework for scoring of protein identification and proteoform characterization that builds in domain knowledge to achieve the quality of manual analysis without requiring it . All of the mathematical symbols used below are aggregated into table 1 . Fundamentally, the problem of identifying which proteoform is most consistent with an experiment combines both aspects of protein identification (which gene) and characterization (which proteoform). In practice, the problem is one of testing a series of hypotheses about which proteoform was present in the mass spectrometer, and then picking the each candidate proteoform (not simply its protein sequence) constitutes a hypothesis, but since candidate proteoforms does not represent all possible hypotheses to be tested, a scoring system must allow for the possibility that the best scoring proteoform is near the correct answer, but not exactly correct . Further, it is frequently the case that the observed data cannot conclusively differentiate between two or more related proteoforms (as in figure 1b), or the case where multiple proteoforms were actually fragmented together . Typically, the way a proteoform score is used experimentally is not too dissimilar the use of scores in annotating novel nucleotide sequences with blast . For a given search, a minimum cutoff threshold is picked by the operator (a priori), and for each query the answer accepted as correct must be both the highest scoring result and greater than the cutoff threshold . The problem of inferring which proteoform, from the articulated prior list of proteoforms in a database, was observed within the mass spectrometer is well - suited to a bayesian approach (figure 2). In this case, bayes law can be rearticulated as follows:1where (1) pr(proteoformi\|datams / ms) is read as the probability of the ith proteoform given the ms / ms data, and is known as the posterior probability of proteoform i given the observed data; (2) pr(proteoformi) is known as the prior probability of proteoform i; (3) pr(datams / ms\|proteoformi) is read as the probability of the data given proteoform i, and is known as the likelihood of the data given proteoform i; (4) pr(datams / ms) is known as the probability of the data . By convention, this can be taken as the sum of all prior probabilities multiplied by their likelihoods across all hypotheses . Notice that this term scales the posterior probability to be the fraction of the total of the numerators over all proteoforms interrogated . Thus, a multiple testing correction across the database search is integral in this approach . This differs from controlling for the overall false discovery rate of an experiment which can, for example, be handled posthoc with a search against a scrambled sequence database in a manner analogous to that used in earlier work . Problem of assigning which proteoform was present in the mass spectrometer during automated data collection can be envisioned as sorting a list of candidate proteoforms based on the observed ms data and a mathematical model of the process by which the observations were collected . Bayes law provides a useful foundation for building these models . In practice, it is not required that the list of candidate proteoforms be explicitly articulated prior to the analysis . It is sufficient that all candidate forms can be calculated for an explicitly stated set . For example, listing base protein sequences and the ptms to be considered on these sequences defines a list of proteoforms, even if the list is never explicitly written . To be precise, we will define the following variables to restate bayes law from eq 1 . Let mo = observed precursor mass, mi = mass of the ith of n observed fragment ions, so {mi}i = 1n is the set of all n observed fragment ions, and q = the qth of k candidate proteoforms in the database . The posterior probability of hypothesis q, as per eq 1, can be restated aswhere pr(q) is the prior since the probability of the data is, by convention, known, two values are needed to calculate the posterior probability for each hypothesis: the prior probability and the likelihood for the data . In many applications, the prior probabilities can be taken to be all hypotheses are equally probable (i.e., uniform prior probabilities). If there are k competing hypotheses, that is, k proteoforms in the candidate list, then each proteoform has a prior probability of 1/k, but this does not need to be the case . It is possible that one would want to assign proteoforms of proteins that contain experimentally demonstrated ptms (or transcripts informed by rna - seq) higher prior probabilities than proteoforms that contain chemically possible, but otherwise rarely observed modifications . For example, if there are two proteoforms that differ only in the location of a ptm such as in figure 1b, and one of the ptms was known to occur, while the other had never been reported, and the set of observed fragment ions failed to differentiate the two forms, then the known form should be considered the most probable form to have been observed . This degree of differentiation can be achieved with such a scoring system by first setting and then improving the prior probabilities with continued experimentation . Prior probabilities are, by definition, based on information known prior to data collection and are in practice always somewhat arbitrary in their determination . In sharp contrast, the likelihood of the data given the proteoform is calculated under an explicit mathematical model of the processes used to generate top down ms data; calculation of this likelihood requires generative models . Generate the probability of the observed data, given the proteoform in question . Therefore, they take as input the proteoform, and as much knowledge of the measurement process as can be encoded in the model - creation process . For example, a generative model could include the propensity of individual pairs of amino acids to dissociate during fragmentation (e.g., x - p cleavage in ecd and etd is not possible, yet dp bonds are preferentially cleaved in threshold dissociation), or the model could include a function for the difference between the observed and theoretical intact mass . The more knowledge of the measurement process the generative model includes, the better, but since the task is to rank order the list of candidate proteoforms (figure 2), some details can be safely excluded from the generative model if they do not shift the proteoform rankings . For example, during manual data interrogation of an error - tolerant, top down search result, many researchers prefer the observed intact mass to match the theoretical, but allow for the possibility that the masses may not match because the best proteoform in the database is not the correct one . Any scoring system that does not include the closeness of the observed ms1 to the theoretical ms1 is ignoring a valuable observation . Next, this bayesian framework explicitly states the process in the form of two generative models; one for the precursor mass, and the other for the fragment ion masses . Since the models are clearly articulated, they can be defended, rejected, or modified based on community discourse . In practice, this means that the process model can be modified and updated to reflect new understanding of the measurement process, or to reflect changes to the process used . For example, an automated data analysis system can use the same scoring mechanism, but employ different parameter sets that reflect experimental differences . Experiments that use cid or hcd will employ different parameter sets in the generative models used for scoring than the same top down experiment employing ecd / etd or uvpd for protein ion fragmentation . It should be noted that the calculation of scores in this system differs from bayesian approaches commonly seen in biological sequence analysis . In those applications, the generative models usually have unknown parameters that need to be estimated from the sequence data, which is usually taken as being perfectly known . The application here is more like that of edwards where the process is considered known . As will be seen, our generative models have no unknown parameters; instead all values are taken from our knowledge of mass spectrometry, or from prior studies that focused on determining the needed value . Thus, instead of inferring values from the data collected for the study in question, we have a framework for applying knowledge gained in analytic chemistry to the problem of protein inference . Currently, prosightpc and prosight ptm report an expectation, or e - value, for each proteoform . This score is calculated by multiplying the probability of getting at least the observed number of matching fragment ion due to chance by the number of proteoforms interrogated . For this calculation, the probability of getting at least a given number of matching fragment ions is determined using poisson - based model . Here we describe the implementation of this bayesian approach to scoring, and compare one set of generative models to the prosight ptm expectation value used within prosightptm and prosightpc . We show that our implementation, with its current generative models, provides an improvement over the existing scoring system as measured by area under the curve (auc) on the resulting roc chart (auc of 0.99 versus 0.78 for a complex human example and auc 0.85 versus 0.80 in pseudomonas). The observed data in a canonical ms / ms experiment includes (a) the neutral precursor mass, which gives the total molecular weight of the proteoform under study, and (b) a set of neutral fragment ion masses, that is, masses of the products resulting from fragmentation of the proteoform . Also required is a database of possible proteoforms, each of which serves as a hypothesis that could potentially explain the observed ms / ms data . The database of possible proteoforms was generated by combinatorial expansion of all potential proteoforms using the known modification information in the uniprot knowledgebase . Since the observed data mo and each fragment ion, mi, are independently conditioned on q, we could take unfortunately, this approach suffers from two limitations . First the magnitude of i = 1n pr(mi\|q) scales with n. larger lists of ms2 fragment ions lower the calculated value of the ms2 likelihood, relative to lists with few fragment ions, which makes it impossible to directly compare scores between separate queries with differing numbers of ms2 fragment ions . This can be mitigated by weighting by the geometric mean of the number of ms2 fragment ions; 1/n . Second, this approach weighs the ms1 data as simply a single additional matching fragment ion . To avoid this, we introduce two scaling functions, f and g, to map the ranges of the individual generative model to a normalized range; for the precursor generative model, the function f is simply the identity function . For the fragment ion generative model, we define g by its logarithm base, which is simply a linear function on the logarithm base 10 of the fragment probability; g sets the logarithm base 10 of the minimum possible fragment probability to the logarithm base 10 of the minimum possible precursor probability and likewise for the maxima . If min1 is the minimum precursor probability, max1 is the maximum precursor probability, min2 is the minimum fragment probability, and max2 is the maximum fragment probability, then under an assumption of uniform prior, and given the likelihood functions from above, we have2equation 2 therefore reduces the posterior probability of a hypothesis to the data likelihood computation, with a normalization factor equal to the sum of the likelihoods under all possible hypotheses . Since we have assumed that the given database of proteoforms is an exhaustive set of hypotheses, these generative models must allow for the possibility of observing related proteoforms that are not present in the database . The c - score system requires two generative models; one for the precursor mass mo and the other for the set of observed fragment ion masses, {mi}. These models fully prescribe how to compute the likelihood terms on the right - hand side of eq 2 . Note that the particular form of eq 2 implies that all the likelihood (probability) terms need only be computed up to a constant factor . This constant factor cancels between the numerator and denominator of the rhs of eq 2 . The probability pr(mo\|j) of an arbitrary protein sequence j (of theoretical mass mj) producing the observed precursor mass mo can be modeled as a function of m, the difference between the mo and mj . We create the probability distribution pr(mo\|j) such that masses within m of mj have the highest probability, and this probability reduces as a truncated gaussian function with = 1, = 30 da, and a minimum value of 1 10 . Notice that we only need to specify pr(mo\|j) to a constant factor (i.e., we only need to specify a non - negative function f (mo, j) proportional to the probability), and the normalization factor (1/0max(mo)f(mo,j)dmo) that converts it to a probability density function is assumed implicitly . To specify the probability distribution pr(mi\|j), we need an ms2 generative model based on our knowledge of the measurement process during tandem mass spectrometry . We note that each fragmentation event involves cleavage of the intact proteoform at one bond on the protein backbone, resulting in exactly two fragments (although both may not be observed in the spectrometer). The fragmentation propensity depends on the pair of adjacent amino acids flanking the cleavage site . The generative model we choose is based on this observation, and uses the following basic ideas: (1) each theoretically possible fragment ion mass defines a region of width 2m (m m, m + m) called a permissible region . An observed mass mi within a permissible region has a probability proportional to the cleavage propensity of gas phase protein ions at that permissible region . (2) an observed fragment ion mass mi outside of any permissible region has a small, constant probability . These ideas are captured in the probability distribution function of figure 3 . In principal, for any given j, the probability distribution pr(mi\|j) is constructed by assigning a height to every point in the range (0, mj), where mj is the theoretical precursor mass . In practice, ms2 mass lists can contain unexpected ions with mass values greater than mj, and so an arbitrarily large mass of 4 million daltons is taken in place of mj . (the value of 4 million daltons was selected as it is safely above the mass of the largest protein known, titin at 3.9 mda, and allows for a modified form of titin to be present . In practice, this value is effectively infinity .) The assigned heights across the entire range are divided by the total area under the curve, thus defining a probability density function . The heights are assigned as follows: step 1: determine all theoretical fragment ions that j can give rise to, noting their mass and the n- and c - terminal flanking amino acids at each cleavage site . Step 2: for each theoretical fragment ion, calculate a weight,, proportional to the product of the cleavage frequencies for both flanking amino acids as previously determined for the appropriate fragmentation method . Thus, if and are the two flanking amino acids, and f and f are their respective cleavage frequencies, we set = ff. The permissible region associated with a theoretical fragment ion mass, m, is assigned a consistent height equal to the weight computed for the corresponding theoretical fragment ion . Step 3: any point in the range (0, mj) but outside of all permissible regions is assigned a height of noise, which is a constant . Ms2 generative model for fragment ions observed in tandem mass spectrometry (ms / ms). For instruments capable of ms / ms with accurate mass, thin (e.g., low part - per - million wide) permissible regions occur with a search - defined width around each theoretical fragment ion mass . The heights of these regions are scaled by the propensity of the cleavage events required to form the theoretical ion . Different fragmentation methods require different weights, for example ecd has different fragmentation propensities than cid . A very low probability, the weight for chemical or electronic noise, is assigned to any observed mass that does not match one of the theoretical masses . We noted above that the probability density function is obtained by dividing the above - mentioned height function by the sum of the area under the curve, which is different for different j . This total area, denoted by tj, is computed as follows: the kth permissible region has a height equal to k and a width equal to 2m . Regions outside of permissible regions have a height of noise and a total width of p 2(len 1)m, where len is the length of the protein sequence . The resulting probability density function is3 the expressions on the right - hand side specify a probability density while the expression on the left - hand side is a probability mass, which, strictly speaking, should be equated to the probability density over a very small mass interval, . However, such a correction can be safely ignored here because the probability mass pr(mi\|q) is used only in the context of eq 2, with equal powers of in numerator and denominator . Using eqs 2 and 3, it is now possible to calculate a posterior probability pr(q\|mo,{mi}) for every sequence q in the database . This posterior probability is proportional to the likelihood pr(mo,{mi}\|q) since we assume uniform priors (eq 2). Therefore, our search for the maximum a posteriori hypothesis q is equivalent to a maximum likelihood estimation (mle) search, that is, we report the q that maximizes pr(mo,{mi}\|q). We report the best hypothesis q along with its phred - like characterization score, which can be written as c = 10log10(1 pr(q\|mo,{mi})). This final c - score transformation scales the posterior probability of q to the familiar range used in many other bioinformatic applications . C - scores span the standard phred - like score range of 0 to> 500 . Practical ranges of the c - score are evaluated with specific examples and reported in the main text below . Therefore, a c - score of 40 is sufficient to judge a proteoform as extensively or fully characterized, while proteoforms with c - scores between 3 and 40 are identified, but only partially characterized . A c - score below 3 indicates insufficient evidence for either identification or characterization . Note also that since the c - score represents a nonlinear transformation of the posterior probability, which is itself normalized by pr(datams / ms), there is a functional relationship between the highest score in a search, and the second highest score (supporting information figure 1). The typical usage of a score such as the c - score is in high throughput data processing . An operator picks a threshold level of the score and then asserts that any query scoring above the threshold identifies the target data . This is done routinely in annotating dna sequences with tools such as blast . To test the utility of a new scoring model, a set of data where the correct answer can be considered known is needed; this forms the ground truth of the analysis . When the new scoring system gives the known true answer both as the highest score, and the scoring above the operator - defined threshold, the system is said to have delivered a true positive . Likewise, when the best proteoform scoring above threshold is not the known correct answer, it is scored as a false positive, and so on for both true and false negatives . Sensitivity is the proportion of positives which are actually classified as such for a given threshold . Likewise, specificity is the proportion of negatives that are correctly identified as such . For any given arbitrary threshold of a score, a specificity and sensitivity can be calculated from a known data set . By iterating over a number of thresholds, and plotting the resulting sensitivity against its corresponding specificity (or by convention, against 1-specificity) a receiver operating characteristic curve this curve is known to be indicative of the utility of the classifier . By repeating this iterative analysis of with multiple scoring systems, the relative utility of the systems so, to compare the new c - score with the existing prosight e - value, test input data sets with known correct answers are needed . These data sets are searched against the appropriate proteoform database and, for each proteoform returned, the e - value and c - score is calculated . Next, an arbitrary list of threshold values is generated for each score, and for each threshold value in this list, a list of identified proteoforms is generated . The identified proteoform is taken as the form that is both above the threshold score, and to be the highest scoring proteoform . It is therefore possible for a search not to return a proteoform, if no proteoform scores above the cutoff threshold . When searching a test data set with known correct answers, it is possible to classify the search results as either a true positive, true negative, false positive, or false negative . From these classifications, these specificity and sensitivity couplets then become points on the roc chart curve for a given score . The human data files used in this analysis were acquired in the course other studies published previously . Briefly, mitochondrial membrane proteins were isolated from hela s3 cells and separated using a gelfree 8100 fractionation system (expedeon) as described previously . For the analysis at hand, 295 top down experiments from a nanolc - velos orbitrap elite ms analysis of a gelfree fraction containing 1520 kda proteins were selected for intensive manual interrogation to provide a set of highly curated known positives to test parameter sets within the generative models used in development of the c - score framework . Pseudomonas aeruginosa were grown on rich media to mid - log phase, were isolated by centrifugation, lysed, separated with gelfree, and analyzed with mass spectrometry using the methods referenced above . For the secondary data set, a descriptive analysis of intact and tandem mass spectral data was performed using rawmeat 2.1 (http://vastsci.com/rawmeat/, vast scientific). Using these data, related ms2 scans were merged and individual prosight upload format (puf) files were created for each data set . A combination of qualbrowser and prosightpc 3.0 (both thermofisher, san jose, ca) was used, and all potential precursors predicted to have been in the ms1 isolation window were added as potential proteoforms for the experiments . Both ms1 and ms2 data were deisotoped using the xtract algorithm embedded within prosightpc 3.0, generating 623 single experiment puf files . (containing 460 000 forms) and homo_sapiens_2012_02_top_down_complex (containing just over 10 million forms) which are prosight warehouses (.pwf files) for human proteins built against uniprot release 2012_02, available for download (ftp://prosightftp:gsx1gon@prosightpc.northwestern.edu/2012_02/eukaryotes/homo%20sapiens/). Experiments with single proteoforms were selected and verified by at least two group members trained in top down proteomics data analysis, to be considered as true answers, and while subjective each met the following two criteria: the most abundant fragment ions must be accounted for, and the intact mass difference between theoretical and experimental must be small (<10 ppm) or must be explainable (1 da errors from deisotoping, a previously unknown or unannotated post - translational modification, oxidation, etc . ). This will typically involve the assignment of> 50% of fragment ions appearing at a signal - to - noise of 10:1 or higher . However, we note that both experimental conditions (e.g., overfragmentation, generating internal ions) and the selection of data processing parameters will affect the quality of data and thus the fraction of ions matched for each experiment . If evidence was not sufficient to uniquely identify one proteoform for an experiment (arising either from poor data quality or from multiple proteins being fragmented simultaneously), the experiment was excluded from further study here . Using these heuristics, 295 puf files where only one proteoform was present were selected for use here . These files are described in supporting information table 1 and provided in supporting information data set 1 . To facilitate a comparison of c - scores and e - values, a custom c #this application takes, as input, a collection of puf files, the list of manually validated correct answers, and the c - score version number (with a specific parameter set) to use . The c - score version allows various iterations of generative models to be tested against the e - value and each other . The output from the application is an excel spreadsheet containing a correct score and actual score for both the e - value and the c - score . During execution, this application runs prosightpc absolute mass and biomarker searches on each puf file to compile actual search scores . The correct scores are then calculated using the list of correct answers (supporting information table 1). The c - score will be available for testing within the proteoform characterization tool, hosted by the consortium for top down proteomics (http://www.topdownproteomics.org). To compare the e - value to the c - score, we chose as our first input a set of 295 puf files (described above) and a c - score version of 1.0 . The list of correct proteoforms for each of the 295 targets was provided as a csv file . The custom console application was then used to generate an excel spreadsheet that was further analyzed . Two roc curves (one for each score) were plotted on the same chart by checking, for each target, whether the top scoring proteoform was the correct proteoform (figure 4). Subsequently, additional roc curves were generated, where a target was counted as incorrect if the correct proteoform merely tied for the best score, but other proteoforms also shared the same score value . We also calculated the area under each curve as a quantitative measure of difference . Two additional roc curves where generated as before but the correct answer would only be considered a true positive if it uniquely had the best score . Thus, for these curves, if the correct proteoform failed to out - score all other proteoforms in the database it was not considered a true positive . This process was repeated for 136 proteoforms from pseudomonas aeruginosa (data are provided in supporting information data set 2). (a) receiver operating characteristic curves comparing c - scores and e - values on the 295 experiments in the manually curated test data set . The area under the curve for the blue c - score is 0.99 compared to 0.78 for the orange e - value . Notice the large difference in sensitivity of the e - value in the low fpr region, between when ties for the best score are considered as acceptable for identification or not . Although present in c - scores, the problem is much less pronounced, and at a much higher sensitivity . (b) histogram of the 295 c - scores obtained from searching the human database (forward) compared to the c - scores obtained from searching the same experimental data against a scrambled decoy database . Of the decoy hits, only 7% had a c - score above 40, likewise 42% of the forward c - scores are above this value . The c - score was substantially better than the e - value at identifying and characterizing the correct proteoform from the data set of 295 human test cases, as well as the 136 pseudomonas test cases . Figure 4 shows a receiver operating characteristic (roc) curve for both scores on the human data, and the area under the curve for the c - score was 0.99 compared to only 0.78 for the e - value . For the pseudomonas test cases, the c - score also outperformed the e - value with aucs of 0.85 to 0.80, respectively . Clearly, the c - score (with the v1.0 parameter set) dominates the e - value for all levels of specificity and sensitivity . Since the e - value is simply a nonlinear transformation of the number of matching fragment ions, it seems reasonable to assert that this improvement comes from the new score s ability to include additional factors such as known fragmentation propensities and ms1 mass differences both of which are known to be relevant in characterizing proteoforms . These and other such factors are not considered by the current e - value, nor is the score easily extended to consider such factors . When the data are sufficient to completely characterize a proteoform, the c - score is often well above 40, indicating hyperconfidence in the characterization power of the underlying data (figure 5a). However, a major limitation of the e - value occurs when many proteoforms share the same (seemingly confident) score . This can be seen in figure 4 as the vertical distance between the two e - value lines in the specificity range of 0.81.0 (fpr 0.00.2). Figure 5b and c shows two example cases where there is equal evidence for two distinct proteoforms, one with an n - terminal acetylation and the other with the acetylation localized to k7 . In this example, these two proteoforms share a confident e - value of 7 10; however, their c - scores are tied, yet at a much less confident value of 3 . Using the data from these two manually annotated sample sets, and with the understanding of the c - score model, we assert three operating ranges for the c - score: c - score> 40 proteoform is both identified and fully characterized; 3 c - score 40 proteoform is identified, but only partially characterized; c - score <3 proteoform is neither identified nor characterized . (a) a result with a very high c - score of 525, indicating a fully characterized proteoform of protein cytochrome b - c1, o14957 . (b, c) two proteoforms with equivalent e - values and c - scores for 10 kda heat shock protein, p61604 . These data show the complementarity between the e - value (scores protein identification well) and the c - score (reflects confidence in characterization of related proteoforms on a phred - like score from 0 to> 500). To achieve separation between the two proteoforms in figure 5b and c, future iterations of the c - score will allow for differential probabilities for n - terminal acetylation and internal acetylation . N - terminally acetylated, so one may posit that, in the absence of evidence to the contrary, n - terminal acetylation is more likely than internal acetylation . The c - score model can incorporate this bias and many similar issues that provide biochemical and biological context . To achieve even more specificity and sensitivity in the c - score framework, one may use a proteomic database, such as gpmdb, to use peptide - level information linked to the specific gene product to inform these differential probabilities in top down proteomics experiments . In the case of uniprot entry p61604, gpmdb reports that n - terminal acetylation was observed in 69/69 studies, making the proteoform reported in figure 5b a much more likely than the proteoform reported in figure 5c . The characterization of high - throughput lc ms / ms experiments, where hundreds of ms / ms targets are automatically generated for each lc run, forms the foundation of high throughput top down proteomics . Our probabilistic formulation leverages the knowledge of fragmentation propensities and may be further extended to incorporate other types of prior information to improve the scoring (vide supra). To characterize unknown ptms (e.g., a previously unknown methylation), we can extend our c - score model to give a higher probability to common ptm mass shifts (i.e., 42.0105 da for acetylation, 79.966 da for phosphorylation, etc . ), thereby boosting the data likelihood . This will be particularly useful in complex eukaryotic proteomes where the inclusion of all theoretically possible proteoforms in the database (even at search run time) is computationally prohibitive . This framework provides a great deal of flexibility for having an appropriate scoring systems for a given experimental procedure . Our current assumption of uniform priors on candidate proteins makes our procedure a maximum likelihood (ml) inference, but the framework can be readily extended to allow for nonuniform priors without additional overhead . Nonuniform priors may be useful when researchers have a priori belief that some protein forms (e.g., particular combinations of ptms or splice variant) are more likely to be present in the sample (e.g., from rna - seq data). Further, the score remains robust when used with instruments with decreasing mass accuracy . Supporting information figure 2 shows the roc chart resulting from rerunning the analysis on the human test data set with increasing mass tolerances . As tolerance increases, the discriminative power of the score decreases as more fragment ions will match by chance . In sum, we have shown a promising scoring system for protein identification and proteoform scoring to better capture the information content in high - resolution top down proteomics . The c - score model lays forth a path to increase the sophistication of protein identification and characterization platforms to extract maximum value from ms - based proteomics in automated fashion . The conceptual and demonstrable advances outlined above provide a deterministic process to advance the utility of proteomics for nonexperts . Non - bioinformaticists / non - proteomicists to advance protein - based science based on proper description of the fully articulated primary structure for whole proteoforms . When coupled with high value experimentation, we posit that the faithful and more efficient conversion of data streams into knowledge will significantly advance major breakthroughs in mechanistic biology and on the front lines of disease research including improved discovery and validation of protein - based biomarkers.
Chest physiotherapy is routinely employed as a prophylactic measure prior to major surgery and postoperatively to prevent respiratory complications such as atelectasis and pneumonia.1 at present, only limited evidence is available for some of the physiotherapeutic techniques used in patients with copd.2,3 physiotherapy treatment enhances sputum evacuation4 and can be applied as a single technique but usually a combination of techniques is applied to patients with copd . Intrapulmonary percussive ventilation (ipv) is a ventilatory technique that uses a device to deliver small bursts of high - flow air into the lungs at high rates, superimposed upon the spontaneous breathing pattern . This causes airway pressures to oscillate between 5 and 35 cm h2o and the airway walls to vibrate in synchrony with these oscillations . A unique sliding venturi, called a phasitron, which is powered by compressed gas at 0.6 to 6 bar, generates these oscillations in the range of 80 to 650 cycles per minute.5 although several studies have addressed the physiological effects of ipv when used in copd patients, there is need for confirmation of its clinical effectiveness . Previously, the effects of ipv in copd patients were assessed using lung function parameters, arterial blood gases, and duration of hospitalization . Recently developed assessment techniques may give new insights into the effectiveness of airway clearance techniques . One promising new technique is computational fluid dynamics applied to the three - dimensional (3d) images made by ct scanning; this technique allows evaluation of flow and resistance of separate parts of the lung.6,7 in the present study, this novel imaging was used, in addition to more conventional outcome parameters, to visualize the effects of a single ipv treatment in copd patients . Five moderate to severe copd patients (three females and two males) with global initiative for chronic obstructive lung disease stages 3 to 4, who were hospitalized for an acute exacerbation, were included in this study . Tests were performed before and after ipv treatment in a specific order to minimize the influence on other tests . For pre - treatment tests, the sequence was set as follows: forced oscillation technique (fot) in upright sitting and supine positions, conventional lung function measurements (including spirometry and body plethysmography measurements), in- and expiratory muscle strength, diffusion capacity, arterial blood gases sampling, and finally a 3d low - dose ct scan was taken within 1 hour prior to the ipv treatment . Patients were asked to score their dyspnea on a borg dyspnea scale before and after the treatment . No significant changes were evident in the spirometric or body plethysmographic indices due to ipv treatment . Respiratory muscle strength after a single session tended to decrease, but the changes in inspiratory and expiratory muscle strength were not significantly different . We observed a small but nonsignificant change in the dlco / va (diffusion capacity of carbon monoxide): corrected for alveolar volume ratio (p = 0.066). Four out of five patients coughed up one or more flumes during the ipv treatment . All patients reported that they subjectively felt better after the treatment (the change in borg dyspnea score, however, was not significant: p = 0.083). Arterial saturation tended to increase after a single ipv session but the changes were not statistically significant (sao2 at baseline and post - ipv treatment: 95% 3% and 96% 1%, respectively; p = 0.066). 3d airway reconstructions based on the computed tomography (ct) images were made for each patient . For example, some peripheral airways that were blocked before the treatment (possibly due to mucus plugging) were reopened after the treatment . Some airway branches were opened up after ipv and other airways were closed after a single ipv session (figure 2). The resistance measurements by body plethysmography and fot both showed a tendency toward an increase in airway resistance . The increase, however, was not statistically significant (p = 0.109 and p = 0.080 alveolar volume for body plethysmography and fot, respectively). Computational fluid dynamics (cfd) were used to calculate the local resistances for the different branches in the airways . Specific airway resistance, calculated for the local changes in airway resistance, showed changes after the ipv treatment; however, none of the changes were statistically significant . Although the 3d computer models showed no changes in the overall airway resistance, local changes were observed, as indicated in figure 2 . Branches with airway blockage in the preintervention scan were reopened in the post scan . In these branches, airway resistance seemed to decrease, possibly due to movement of mucus; however, this is yet to be confirmed by the use of a control group . Table 2 gives an overview of the airway changes observed in the different patients after a single ipv session . Although data shown here are not compared with the data of a control group, 3d ct imaging has the potential to evaluate the displacement of mucus plugs and removal of mucus plugs in some copd patients after an ipv treatment . Although we saw changes, the use of a control group is needed to confirm our findings . Our study focused on the visualization of the short - term effects of a single ipv treatment . We used functional imaging to demonstrate that the airway geometry was changed by the ipv session whereas lung function parameters did not show any significant differences . The sample size in the present study is small; more patients are needed to verify these findings . The accuracy of ct imaging has been confirmed for the assessment of the bronchodilator response in asthmatic patients8 and for the particle deposition of an aerosol in the lung.9 the usefulness of 3d imaging and cfd processing has also been shown in the assessment of changes in upper airways 10 and small airways.11 for example, cfd can detect changes in airway resistance in patients with asthma.8 one of the main advantages of the cfd method is that this technique allows investigators to make specific models of the patient s airways for use in analyses.12 in our study, we demonstrated that the effect of a single ipv treatment could be evaluated using functional imaging . Despite its small sample size, this study demonstrated that local treatment effects could be visualized with 3d imaging of the airways . The resulting models allow a calculation of the change in airway volume and change in airway resistance . The technique can be used for comparison with traditional outcome parameters, which opens up perspectives for evaluation of physiotherapeutic drainage techniques, and may allow standardization and validation of different airway clearance techniques . Further research should focus on the relationship between mucus displacement and local changes in airway flow and resistance.
Gastrointestinal stromal tumors (gists) are the most common mesenchymal neoplasms of the gastrointestinal tract, with a mean annual incidence of 1015 cases per million people, affecting mainly older individuals at a median age of 5565 years [14]. Radical surgery is the treatment of choice in primary resectable gists, but almost all gists are associated with a risk of recurrence, and approximately 4050% of patients with potentially curative resections develop recurrent or metastatic disease [5, 6]. Radiotherapy has restricted efficacy in the management of gists, principally because the tumor location is surrounded by dose - limiting vital organs . The prognosis of patients with inoperable or metastatic gists was poor until the beginning of the 21st century, when significant progress in understanding the molecular pathogenesis of gists resulted in development of a treatment that has become a model of targeted therapy in oncology . The introduction of imatinib mesylate (gleevec or glivec; novartis), a small - molecule selective inhibitor of receptor tyrosine kinases, has revolutionized the treatment of gists, both in the adjuvant setting and in advanced (i.e., inoperable and/or metastatic) cases . On the basis of recently published results of a clinical trial comparing 12 and 36 months of adjuvant imatinib therapy, demonstrating clinical benefit of longer imatinib treatment in terms of delaying recurrences and improving overall survival (os), both the us food and drug administration (fda) and the european medicines agency (ema) have updated their recommendations and approved 36 months of imatinib treatment in patients with v - kit hardy - zuckerman 4 feline sarcoma viral oncogene homolog (kit)-positive gists (also known as cd117-positive gists) at high risk of recurrence after surgical resection of the primary tumor . Gists may originate anywhere in the gastrointestinal tract most frequently in the stomach, followed by the small intestine . They comprise a heterogeneous group of tumors ranging from small lesions with clinically benign behavior to highly aggressive malignant tumors [810]. Metastases develop mainly in the liver or intraperitoneally and may even occur more than 10 years after surgery on the primary lesion, necessitating long - term follow - up of gist patients [9, 11]. Gists are believed to arise from progenitors related to the interstitial cells of cajal, which are the pacemakers for peristalsis [1214]. Approximately 8595% of gists express kit, which is currently used for routine immunohistochemical diagnosis . Other well - established immunohistochemical markers used for differential diagnosis include dog1 [discovered on gist-1; encoded by the ano1 (anoctamin 1, calcium activated chloride channel) gene], cd34 (a hematopoietic progenitor stem - cell antigen), smooth muscle actin, s100 protein, and desmin (a muscle cell marker) [1621]. Characteristic genomic alterations in both benign and malignant gists mainly involve chromosomal losses of 1p, 14q, and 22q . Additional cytogenetic abnormalities present in metastatic gists involve losses of chromosomes 13q, 15q, and 18, and partial deletions of 11p and 9p [including tumor suppressor genes cdkn2a (cyclin - dependent kinase inhibitor 2a) and cdkn2b], as well as gains of 5p, 8q, and 17q [2228]. Approximately 7580% of sporadic gists harbor kit - activating mutations, and another 513% of sporadic gists carry platelet - derived growth factor receptor, alpha polypeptide (pdgfra)-activating mutations [29, 30]. About two thirds of all mutations in gists occur at the 5 end of kit exon 11 . Less common primary mutation sites in kit include the 3 end of exons 11 and 9 . The most frequently mutated region in pdgfra is exon 18, typically exhibiting the p.d842v substitution . Approximately 1015% of gists do not present detectable mutations in kit or pdgfra [2940]. Kit / pdgfra wild - type gists arise mainly from the stomach and are characterized by distinct clinical and pathological features, including predominant incidence in young female patients, epithelioid morphology, frequent lymphovascular invasion and lymph node metastases, and unpredictable clinical behavior . Wild - type gists carry inactivating mutations in genes coding for mitochondrial succinate dehydrogenase (sdh) complex ii subunits a, b, c, and d, which are components of the krebs cycle and the respiratory chain . Additionally, this subgroup of gists express insulin - like growth factor 1 receptor (igf1r). Wild - type gists are commonly associated with carney s triad, carney - stratakis syndrome, or neurofibromatosis type 1 [4151]. Table 1 summarizes the most important molecular features of gists in terms of kit and pdgfra mutational status.table 1molecular classification of gastrointestinal stromal tumors (gists) according to v - kit hardy - zuckerman 4 feline sarcoma viral oncogene homolog (kit) and platelet - derived growth factor receptor, alpha polypeptide (pdgfra) mutational statusgenotypefeatureskit mutations (7580% of sporadic gists) exon 11most common mutation in sporadic gists (6570%); present in tumors localized at all gastrointestinal sites; best response to imatinib; also reported in familial gists exon 9more common in gists originating from the small bowel / colon; intermediate / dose - dependent response to imatinib in advanced gists exon 13present in tumors localized at all gastrointestinal sites; observed clinical responses to imatinib; reported in familial gists; more often as secondary mutations in imatinib - resistant tumors exon 17present in tumors localized at all gastrointestinal sites; observed clinical responses to imatinib (except for p.d816v); reported in familial gists; more often as secondary mutations in imatinib - resistant tumorspdgfra mutations (513% of sporadic gists) exon 12present in tumors localized at all gastrointestinal sites; observed clinical responses to imatinib exon 14only a few cases described in the literature; more common in gists originating from the stomach exon 18more common in gists originating from the stomach, usually with epithelioid morphology; often related to indolent clinical behavior; p.d842v is the most common and is resistant to imatinib; other exon 18 mutations are sensitive to imatinibkit / pdgfra wild typefrequent in pediatric gists; poor response to imatinib; typical for gists related to neurofibromatosis type 1, carney s triad (gastric gist + pulmonary chondroma paraganglioma), or carney - stratakis syndrome (gist + paraganglioma, characterized by mutations in genes encoding sdh subunits sdha, sdhb, sdhc, sdhd), and/or igf1r expressionigf1r insulin - like growth factor 1 receptor, sdh succinate dehydrogenase molecular classification of gastrointestinal stromal tumors (gists) according to v - kit hardy - zuckerman 4 feline sarcoma viral oncogene homolog (kit) and platelet - derived growth factor receptor, alpha polypeptide (pdgfra) mutational status igf1r insulin - like growth factor 1 receptor, sdh succinate dehydrogenase imatinib mesylate was initially developed for the treatment of chronic myelogenous leukemia, to specifically inhibit the tyrosine kinase activity of breakpoint cluster region c - abl oncogene 1, non - receptor tyrosine kinase (bcr abl) fusion oncoprotein . However, in preclinical studies, it was demonstrated that imatinib also inhibited the activity of kit, pdgfra / b, abl1, and abl2 (also known as arg) tyrosine kinases [53, 54], which encouraged examination of imatinib therapy for other neoplasms driven by constitutive receptor tyrosine kinase activation . The first report describing imatinib treatment in a gist patient with multiple metastatic lesions demonstrated a dramatic response to this therapy . As early as 2002, imatinib was registered for treatment of advanced gists (i.e. In metastatic and/or recurrent and/or inoperable disease). The results of several clinical trials confirmed the high efficacy of imatinib in the treatment of gists in the majority of patients with inoperable / metastatic disease [5660], prolonging median survival from 1019 months (historical data) to approximately 5 years . Two large, parallel, very similar international studies comparing a standard imatinib dose of 400 mg daily with a high dose of 800 mg daily demonstrated a similar response rate and os with the two imatinib doses but better progression - free survival (pfs) in the high - dose treatment arm [6062]. Moreover, data from these trials have shown that the response of gists with kit exon 9 mutations depends on the dose of the drug, and that these patients benefit from a higher dose (800 mg daily) of imatinib, demonstrating significantly longer pfs (18 months) than patients receiving a standard dose of 400 mg daily (6 months). Unfortunately the spectacular activity of imatinib is time limited, and secondary resistance develops in the majority of patients [11, 61]. Although the treatment of choice in primary resectable localized gists is radical resection with negative margins, almost half of the patients ultimately develop recurrent or metastatic disease after potentially curative surgery . Therefore, the idea of adjuvant therapy with imatinib after primary resection has been evoked to delay or prevent relapse and to prolong patients survival . The role of imatinib therapy in the adjuvant setting has been evaluated in several phase ii and iii clinical trials, namely acosog z9000 and z9001 (conducted by the american college of surgeons oncology group), ssgxviii / aio [7, 65] (conducted by the scandinavian sarcoma group and the sarcoma group of the arbeitsgemeinschaft internistische onkologie xviii), rtog s0132 (conducted by the radiation therapy oncology group), and eortc 62024 (conducted by the european organization for research and treatment of cancer). Table 2 presents the most important clinical trials of adjuvant imatinib in gists . Data from the phase iii acosog z9001 trial evaluating 1 year of adjuvant therapy with imatinib 400 mg daily versus placebo in patients after microscopically radical (r0) resection of gists at least 3 cm in diameter showed a significant reduction in the risk of recurrence from 17 to 2% at 1 year (during 20 months of follow - up) [p = 0.0001], with a hazard ratio (hr) of 0.35 . Although the treatment was well tolerated, no significant impact on os was demonstrated, thus implying that adjuvant imatinib delays rather than prevents relapse . The eligibility criteria for this trial were clearly inadequate because more than 40% of patients had tumors between 3 and 6 cm in size, which in the majority were at low risk of relapse and did not require adjuvant therapy after surgery . Nevertheless, in 2008, imatinib was approved for use in adjuvant therapy after resection of primary gists in patients at significant risk of relapse . Importantly, the initial approval lacked definite guidance concerning the optimal duration of treatment and risk assessment criteria.table 2the most important clinical trials of adjuvant therapy with imatinib in gastrointestinal stromal tumors (gists)studystudy designno . 2009 one arm, open, multicenter; imatinib 400 mg daily for 1 year107primary gist kit - positive after radical resection; high risk of relapse: tumor size 10 cm or tumor rupture or <5 intraperitoneal metastasesos at median follow - up of 4 years; 1-year os: 99%; 2-year os: 97%; 3-year os: 97% rfs at median follow - up of 4 years; 1-year rfs: 94%; 2-year rfs: 73%; 3-year rfs: 61% kang et al . 2009 one arm, open, multicenter, prospective; imatinib 400 mg daily for 2 years47primary gist with exon 11 kit mutation after radical resection; high risk of relapse: tumor size 10 cm or mitotic index 10/50 hpfs or tumor size 5 cm and mitotic index 5/50 hpfsrfs at median follow - up of 26.9 months; 1-year rfs: 97.7%; 2-year rfs: 92.7% li et al . 2011 open, non - randomized, prospective, one center; imatinib 400 mg daily for 3 years versus observation56 (imatinib), 49 (observation)primary gist kit - positive after resection; intermediate or high risk of recurrence (nih classification): tumor size> 5 cm and/or mitotic index> 5/50 hpfssignificantly better rfs in the imatinib arm as compared with observation at median follow - up of 45 months (hr 0.188, 95% ci 0.0850.417; p <0.001); 1-year rfs: 100 versus 90%; 2-year rfs: 96 versus 57%; 3-year rfs: 89 versus 48% significantly decreased risk of death due to gist with adjuvant imatinib therapy in comparison with observation at median follow - up of 45 months (hr 0.254, 95% ci 0.0700.931; p = 0.025)jiang et al . 2011 non - randomized, one center, prospective; imatinib 400 mg daily for 5 years versus observation35 (imatinib), 55 (observation)primary gist kit - positive after r0 resection; high risk of relapse (modified nih classification)significantly better rfs with imatinib as compared with observation at median follow - up of 44.0 months (hr 0.122, 95% ci 0.0410.363; p <0.001); 1-year rfs: 100 versus 70.9%; 2-year rfs: 88.0 versus 37.8%; 3-year rfs: 88.0 versus 27.5% acosog z9001, dematteo et al . 2009 [76, 86]double - blind, placebo - controlled, randomized, multicenter; imatinib 400 mg daily versus placebo for 1 year359 (imatinib), 354 (placebo)primary gist kit - positive after radical resection; tumor size 3 cm; low, intermediate, or high risk of relapsesignificant improvement in 1-year rfs in the imatinib arm (98%) as compared with placebo (83%); median follow - up time 19.7 months; hr 0.35; p <0.0001lack of statistically significant difference in 1-year os between study arms (hr 0.66; p = 0.47)ssgxviii / aio, joensuu et al . 2012 [7, 65]two arms, open, randomized, multicenter, prospective; imatinib 400 mg daily for 1 versus 3 years200 (1 year), 200 (3 years)primary gist kit - positive after radical resection; high risk of relapse (modified nih classification): tumor size> 10 cm or mitotic index> 10/50 hpfs or mitotic index> 5/50 and tumor size> 5 cm or tumor rupturesignificant improvement in rfs with 3-year imatinib therapy as compared with 1-year therapy at median follow - up of 54 months (hr 0.46, 95% ci 0.320.65; p <0.0001); 5-year rfs: 65.6 versus 47.9% significant improvement in os with 3-year imatinib therapy as compared with 1-year therapy at median follow - up of 54 months (hr 0.45, 95% ci 0.220.89; p = 0.019); 5-year os: 92.0 versus 81.7% eortc 62024, hohenberger at al . 2012 two arms, open, randomized, multicenter, prospective; imatinib 400 mg daily for 2 years versus observation906primary gist kit - positive after radical resection; intermediate or high risk of relapse (nih classification): tumor size> 5 cm and/or mitotic index> 5/50 hpfstime to imatinib failure at relapse (changed from os)rfs, os, safety: results are expected in 2013acosog american college of surgeons oncology group, aio arbeitsgemeinschaft internistische onkologie, ci confidence interval, eortc european organization for research and treatment of cancer, hpfs high - powered fields, hr hazard ratio, kit v - kit hardy - zuckerman 4 feline sarcoma viral oncogene homolog, nih national institutes of health, os overall survival, r0 microscopically radical resection of the tumor, rfs recurrence - free survival, ssg scandinavian sarcoma groupstudies evaluating adjuvant therapy with imatinib for at least 3 years the most important clinical trials of adjuvant therapy with imatinib in gastrointestinal stromal tumors (gists) acosog american college of surgeons oncology group, aio arbeitsgemeinschaft internistische onkologie, ci confidence interval, eortc european organization for research and treatment of cancer, hpfs high - powered fields, hr hazard ratio, kit v - kit hardy - zuckerman 4 feline sarcoma viral oncogene homolog, nih national institutes of health, os overall survival, r0 microscopically radical resection of the tumor, rfs recurrence - free survival, ssg scandinavian sarcoma group studies evaluating adjuvant therapy with imatinib for at least 3 years only recent updates of the european society for medical oncology (esmo) and national comprehensive cancer network (nccn) guidelines have included the recommendation for 36 months of adjuvant imatinib therapy in adult patients with kit - positive gists at high risk of relapse . However, the optimal duration of imatinib therapy is still unknown . The latest fda and ema approvals for imatinib were based on the results of the ssgxviii / aio trial, which demonstrated that prolonged treatment extends both recurrence - free survival (rfs) and os . Data from the ssgxviii / aio trial, comparing 12 and 36 months of adjuvant imatinib treatment after resection of gists in patients with a high risk of recurrence, were first presented in 2011 at the 47th annual meeting of the american society of clinical oncology . In the 36-month treatment arm, a significant improvement was observed in terms of both rfs (5-year rfs: 65.6 vs. 47.9%; p <0.0001) and os (5-year os: 92.0 vs. 81.7%; p = 0.01; hr 0.45). The study demonstrated that prolonged imatinib treatment was generally well tolerated, and the most common adverse events included anemia, leukopenia, periorbital edema, fatigue, nausea, diarrhea, muscle cramps, and elevated blood lactate dehydrogenase levels . More patients discontinued imatinib therapy in the 36-month treatment arm than in the 12-month arm, for reasons other than gist recurrence (25.8 vs. 12.6%; p <evaluation of the risk factors for recurrence after primary surgery is essential for reliable prognosis, scheduling of follow - up, and identification of patients who may potentially benefit from adjuvant therapy . The main criteria taken into account in a few existing risk stratification systems include the tumor site, size, mitotic index, and tumor rupture; however, the uniform risk criteria remain difficult to determine . The national institutes of health (nih) consensus criteria formulated in 2001 provided the first evidence - based categorization and a practical scheme for risk assessment in the clinical course of this disease . This risk classification was based on the tumor size and mitotic rate [evaluated per 50 high - powered fields (hpfs)] as the most reliable prognostic factors . This scheme was complemented in 2006 by miettinen and lasota from the armed forces institute of pathology (afip), who recognized the significance of the tumor location as an independent prognostic factor in gists . They created a new risk assessment scheme (recommended by the nccn and commonly used) which reflected better prognosis of gastric gists compared with intestinal gists of the same mitotic index and size [21, 6770] (table 3 and fig . 1). The same prognostic factors were taken into account in the nomogram created by gold et al ., which seems to vaguely outperform the nih and nccn afip criteria . Moreover, it has been demonstrated that tumor rupture (either spontaneous or iatrogenic) is an important risk factor, which strongly correlates with the risk of recurrence in gists [72, 73]. This observation has led to the development of modified nih criteria and novel non - linear risk stratification systems, including prognostic contour maps and heat maps, constructed on the basis of the tumor size, site, mitotic index, and incidence of tumor rupture [7375]. These features may provide even more accurate estimation of the risk of recurrence and are appropriate for individualizing risk stratification for adjuvant therapy in gists . Subgroup analysis of the acosog z9001 trial confirmed that the major clinical benefit of adjuvant therapy was limited to the group of patients at high risk of relapse according to the nccn afip criteria (an improvement in 2-year rfs from 41 to 77%; p <0.0001).table 3national comprehensive cancer network (nccn)armed forces institute of pathology (afip) risk criteria after resection of primary gastrointestinal stromal tumors (gists), according to miettinen and lasota tumor parametersprimary tumor location and risk of recurrencesizemitotic indexstomachduodenumsmall intestinerectum2 cm5/50 hpfs0% 0% 0% 0%> 2 cm, 5 cmvery low (1.9%) low (8.3%) low (4.3%) low (8.5%)> 5 cm, 10 cmlow (3.6%) high (34%) intermediate (24%) high (57%)> 10 cmintermediate (12%) high (52%) 2 cm>5/50 hpfsinsufficient datainsufficient datahigh (50%) high (5271%)> 2 cm, 5 cmintermediate (16%) high (5086%) high (7390%)> 5 cm, 10 cmhigh (5586%)> 10 cmhpfs high - powered fieldsfig . 1recurrence - free survival in small - bowel gastrointestinal stromal tumors (gists), according to national comprehensive cancer network (nccn)armed forces institute of pathology (afip) risk categories (based on the authors own data from 659 primary gists after radical resection, presented during the european society of surgical oncology conference) national comprehensive cancer network (nccn)armed forces institute of pathology (afip) risk criteria after resection of primary gastrointestinal stromal tumors (gists), according to miettinen and lasota hpfs high - powered fields recurrence - free survival in small - bowel gastrointestinal stromal tumors (gists), according to national comprehensive cancer network (nccn)armed forces institute of pathology (afip) risk categories (based on the authors own data from 659 primary gists after radical resection, presented during the european society of surgical oncology conference) in addition to clinicopathological factors, molecular features may also present added value to risk stratification of gists . Several studies have demonstrated better prognosis for patients harboring kit exon 11 point mutations or insertions, as well as pdgfra exon 18 mutations . On the other hand, tumors carrying kit exon 11 deletions (especially involving codons 557 or 558) and kit exon it has also been proposed that genomic complexity, defined by a genomic index determined by array comparative genomic hybridization, may serve as a useful adjunct to the current risk stratification systems, which are often uninformative in the case of intermediate - risk patients [84, 85]. It is worth noting that the updated fda and ema approvals for 36 months of imatinib treatment apply to patients who specifically meet the inclusion criteria determined in the ssgxviii / aio trial [7, 65]. In that trial, patients were eligible for the trial if they had kit - positive gists and demonstrated at least one of the following features: longest tumor diameter> 10 cm, mitotic index> 10/50 hpfs, longest tumor diameter> 5 cm and mitotic index> 5/50 hpfs, or tumor rupture prior to or at the time of surgery . This classification represents a modified nih risk - stratification system, complemented with tumor rupture as an independent prognostic factor . Gastric gists constituted approximately half of the cases in both the 12- and 36-month arms, followed by small - intestine gists (37 and 31% of cases, respectively), and gists located in the colon or rectum constituted 8 and 10% of cases, respectively . In 7% of patients in each arm, the results of the ssgxviii / aio trial demonstrated that mutational analysis of gists may have predictive value for the clinical response to adjuvant imatinib therapy, similar to data observed in the metastatic setting . From the molecular point of view, resistance to imatinib has its origins in kit / pdgfra mutational status . Data reported by joensuu and colleagues showed that patients with kit exon 11 mutations benefit the most from prolonged adjuvant treatment . Similar data were shown for patients treated in the acosog z9001 trial; the 2-year rfs rate was 91% for patients treated with adjuvant imatinib harboring kit exon 11 mutations, as compared with 65% in a group of patients with the same genotype receiving placebo (p <0.0001). On the other hand, primary imatinib resistance in the adjuvant setting has been demonstrated especially in cases carrying a pdgfra exon 18 p.d842v mutation, presumably because of the structural alterations at the imatinib binding site . This mutation is detected in approximately 10% of operable gists [75, 87], especially in tumors originating from the stomach (exceeding 20% of cases in this location). Adjuvant imatinib should not be recommended in cases of gists harboring a pdgfra exon 18 p.d842v mutation . In the acosog z9001 trial, interestingly, it has been demonstrated that patients with advanced gists harboring mutations in kit exon 9 may benefit from an imatinib dose increase to 800 mg daily . This indicates that patients with this mutation may be underdosed when receiving 400 mg of imatinib daily, but it has never been examined in any clinical trial in the adjuvant setting . In wild - type gists, the tumor size and mitotic index poorly predict clinical outcome; therefore, current risk stratification systems seem to be inapplicable in this subgroup of patients [50, 51]. Moreover, wild - type gists present a limited response to imatinib treatment, in comparison with gists carrying imatinib - sensitive mutations . Adjuvant imatinib efficacy in kit exon 9 mutants and wild - type gists warrants further study; however, the numbers of patients in these subgroups are usually small, and so statistical significance is difficult to reach when these categories are analyzed . Nevertheless, kit and pdgfra genotyping in gists should be performed routinely in the adjuvant setting, since it may help to tailor the treatment to patients who are more likely to respond to imatinib therapy, or to exclude patients with imatinib - resistance mutations [86, 88]. In the ssgxviii / aio trial, patients were monitored for their response to imatinib with contrast - enhanced computed tomography or magnetic resonance imaging at 6-month intervals for the first 7 years and annually thereafter . An initial staging examination was performed within 28 days before the introduction of imatinib treatment . Blood biochemistry and cell counts were performed at 1- to 3-month intervals in the course of the treatment . Gist relapse is usually observed at the highest frequency within the first 2 years after completion of adjuvant treatment; therefore, regular imaging in this period is especially important for early detection of recurrence [64, 76]. The majority of patients who develop gist recurrence after completion of adjuvant imatinib respond to an imatinib rechallenge regardless of the prior treatment duration . On the basis of the clinical behavior of advanced gists, it may be anticipated that in patients who relapse during adjuvant treatment or within the first few weeks after completion of adjuvant treatment, an increased dose of imatinib or introduction of another tyrosine kinase inhibitor, such as sunitinib, may be beneficial because these cases are probably primarily imatinib resistant . Generally, only a few patients in the ssgxviii / aio trial developed gist recurrence during imatinib treatment (2% of patients in the 12-month arm and 6% of patients in the 36-month arm). This suggests that acquired resistance to adjuvant imatinib (related mainly to occurrence of secondary kit / pdgfra mutations) is infrequent in this patient population [7, 65]. We still do not know if adjuvant imatinib therapy can cure a patient by preventing relapse or can only delay it . In the metastatic setting, interruption of imatinib therapy has been associated with disease relapse at a median of 6 months after stopping imatinib after 1, 3, or 5 years of treatment [89, 90]. The significant improvement in os associated with 3 years versus 1 year of adjuvant imatinib in the ssgxviii / aio trial [7, 65] was based on the limited number of deaths that occurred at median follow - up of 54 months, and so longer follow - up is needed to confirm the os advantage related to 3-year adjuvant imatinib therapy . There are still several unresolved issues concerning future use of adjuvant imatinib in gists . In the coming years, adjuvant imatinib treatment for at least 3 years will be standard therapy in high - risk gist patients harboring sensitive mutations . In intermediate - risk patients, adjuvant imatinib should be considered, provided there is better characterization of individual prognostic features . The role of adjuvant imatinib therapy in patients with wild - type gists or kit exon 9 mutations should be better defined, and the appropriate initial dose of imatinib400 or 800 mg daily in patients with kit exon 9 mutants must be established . The optimal duration of adjuvant imatinib therapy beyond 3 years requires further investigation and should preferably be determined on the basis of randomized controlled trials . Furthermore, the optimal follow - up schedule after discontinuation of the therapy is not well established . The only issue that seems to be incontestable in the immediate future is the necessity for genotyping of every primary gist considered for adjuvant therapy . Despite the striking efficacy of imatinib, recurrent or metastatic gist is still not a curable disease . This implies that prevention of disease recurrence following surgical resection of the primary tumor is the key to further improvement of the clinical outcomes of patients affected by gists . Three years of adjuvant imatinib treatment, as opposed to 1 year of treatment, significantly reduced the risk of recurrence and improved os in patients with kit - positive gists at high risk of recurrence after surgery . Currently, 3 years of adjuvant treatment for patients at high risk of recurrence may be considered as a standard of care . However, it is not clear whether patients who are classified as intermediate risk should be treated with adjuvant imatinib . Results from several phase ii studies support the idea that at least 2 years of adjuvant imatinib treatment is beneficial for intermediate - risk gists (especially those harboring kit exon 11 mutations) and may be considered in this subgroup of patients [9297]. On the other hand, patients with very low - risk or low - risk tumors are likely to be cured by surgery alone and should not receive adjuvant imatinib . Beyond risk assessment for proper selection of patients for adjuvant imatinib therapy it may help to tailor the treatment to patients carrying more sensitive mutations, such as kit exon 11 mutations, or to exclude patients with imatinib - resistance mutations, such as a pdgfra p.d842v mutation . Thus, kit and pdgfra genotyping of patients with gists is obligatory in the adjuvant setting [86, 88].
While the physical disability aspect of multiple sclerosis (ms), the most common demyelinating disease of the central nervous system in young adults, is of great importance, it is now well recognized that it does not reflect all of the facets that patients consider important in their life . Fatigue, depression, and physical disability are only one aspect of a person's experience with ms; it is well documented that cognitive, emotional, and psychological functions contribute to their quality of life (qol). The qol measurements are being considered increasingly important with regard to evaluating disease progression, treatment and the management of care provided to ms patients [2, 3]. The us food and drug administration (fda) and the european medicines agency encourage the use of qol assessment in patients with chronic illnesses [4, 5], and several groups have published detailed recommendations for qol assessment [6, 7]. In ms research, 118 studies that have reported qol as an outcome were performed with ms patients in the clinical trials registry (clinicaltrials.gov, december 31, 2012). Despite the acknowledged need to consider qol issues, qol assessment may be considered to be an unfulfilled promise [911]. Therefore, these issues should be explored and understood to promote both the use and usefulness of measuring qol in ms clinical practice . Here, we explore the difficulties for clinicians to choose and determine the most appropriate qol measure, to be convinced by the clinical utility of the qol assessment implementation in clinical practice and to interpret qol scores . Qol is commonly assessed using self - reported questionnaires . To fully understand and explore the effectiveness of any intervention for the management of ms, it is important to have robust, valid, reliable, and universally applied measures . Generic instruments are generally used to compare qol across different populations, while disease - specific instruments focus on particular health problems and are more sensitive for detecting and quantifying small changes . In ms clinical practice, ms - specific questionnaires are more appropriate due to a better ability to discern qol differences in patients than the 36-item short form . A large number of disease - specific qol instruments have been validated for use in ms patients . The most popular questionnaires are the multiple sclerosis quality of life questionnaire (msqol54), the functional assessment of multiple sclerosis questionnaire (fams), the hamburg quality of life questionnaire in multiple sclerosis (haquams), the quality of life index - multiple sclerosis (qli - ms), the multiple sclerosis quality of life index (msqli), the leeds multiple sclerosis quality of life scale, the ms impact scale (msis-29), the disability and impact profile (dip), the extension of quality - adjusted time without symptoms of disease and toxicity of treatment, and more recently, the multiple sclerosis international quality of life questionnaire . While some reviews tried to describe the different questionnaires as designed specifically for ms patients [2, 25, 26], a clinician contemplating these various rules and instruments may be overwhelmed by their level of complexity . The multiplicity of scales used requires describing their psychometrics and the theoretical and conceptual foundations . Clinicians should be provided better guidance and training that includes evidence of the respective contributions of the various available instruments, the degree to which the tools measure what they claim to measure, and their respective strengths and shortcomings . High - level requirements for development and metric validation of qol measures, especially among the most recent instruments, are now well acknowledged [28, 29]. Briefly, we can mention some limitations about the process of validating the qol questionnaires that may compromise the robustness of the instrument . First, one important issue concerns the conceptual problems related to the definition of qol . The researchers should have well - validated questionnaires based on a clear conceptual basis for qol . One major challenge to explaining the content of the qol dimensions to be measured is to ensure that the subjects' perceptions are accurately taken into account . Interviews with patients are commonly considered as the best method to capture the patient's perceptions [30, 31] and provide the content of the questionnaire . Few ms - specific qol questionnaires were exclusively based on the patient's point of view . Second, the responsiveness or sensitivity to change, defined as the ability to detect a meaningful change, is a core psychometric property of a measuring instrument . Given the availability of many qol instruments, little research has been conducted to test the responsiveness of the qol tools in ms . The haquams showed satisfactory responsiveness to change, the msis-29, msqol-54, and fams moderately detected change in health status [33, 34]. Also, clinicians should prefer the use of the haquams to detect health changes over time of ms patients . Future studies should provide comparisons with responsiveness indices using a direct head - to - head comparison to make the situations in which they were tested comparably . Finally, another point that should be mentioned is related to the number of available languages of the questionnaire . The msqol54 [15, 3537] and the musiqol [24, 3841] these questionnaires were developed simultaneously in a number of countries and thus represent a major strength . Environmental barriers have been described to explain why qol measures have not been routinely implemented in clinical practice . Time and resource are both constraints on clinicians whose main role is providing patient care . A great asset of the qol questionnaire is its acceptability, which concerns the ergonomics of the questionnaire, such as the length of the questionnaire, the paper or electronic format, and the concept of computer adaptive testing . Some authors have suggested that questionnaires intended for use in clinical populations should be as brief as possible because of the nonadaptability with a clinical evaluation and the difficulties of the concentration and perception faced by patients with a cognitive dysfunction [8, 30], such as ms patients . It is common to accept that the average time of completion of a questionnaire should not exceed 10 minutes to be fully compatible with clinical practice . Providing shorter questionnaires in ms qol measures, as is already done in other chronic diseases, may contribute both appropriate and useful for use in clinical practice . A potential opportunity for questionnaire development exists in the growing use of electronic records and e - health research . To our knowledge, there are not any studies that evaluate the feasibility of e - form qol questionnaires in ms patients . However, it is not certain that e - form questionnaires would allow for obtaining qol data in an efficient real - time manner because of the logistics feasibility and the lack of computer stations and hand - held devices . While most qol questionnaires are initially fixed in content and length, future challenges now focus on the concept of computer adaptive testing . The number of items can be reduced substantially by use of item - response theory and computer adaptive testing to target questions through an iterative process in which responses determine which items are subsequently presented . This approach requires development and validation of algorithms in addition to development and validation of the original questionnaire . Today, the neurology quality - of - life measurement initiative is a standardized approach based on extant items used for measuring qol across common neurologic conditions, including multiple sclerosis, for both adults and children [47, 48]. The next challenge is to develop credible strategies for integrating qol data in clinical practice . To enhance the use of qol measures in clinical decision making, improving knowledge about the determinants of qol changes and the potential predictive role of qol on disability may reinforce the conviction of clinicians to use these measures in their ms clinical practice . In the same way, demonstrating that qol feedback should improve health status of ms patients may confirm the relevance of including qol in clinical practice . Clinicians can use qol assessments to check whether interventions have been as effective from the patient's point of view as from the clinician's, and to determine whether further action is required . Knowledge of which factors are determinants of qol in patients with ms would assist clinicians in choosing the most appropriate interventions . Several determinants of qol have been identified with varying strengths of association and include both disease - related variables (disability status [49, 50], disease duration [50, 51], fatigue [52, 53], depression [49, 54]), cognition, sociodemographic variables (age and sex [55, 56], level of education, and marital status). A number of these factors might be amenable to treatment intervention, which might be expected to improve qol: fatigue, depression, and cognition . Predictive factors of long - term disability in patients with ms were also previously reported [60, 61]: sociodemographic variables [62, 63], initial edss score or initial change in edss score [61, 64], number or types of relapses [61, 62], nature of the initial symptoms, and mri findings . The weight of these factors is poorly understood and does not explain the entire change of disability that is observed . In contrast to domains such as heart disease and cancer, few studies have examined the predictive value of qol on disability in patients with ms . Longitudinal studies have described whether the qol level, in addition to conventional clinical and sociodemographic factors, provides prognostic information about the evolution of disability in patients with ms [6770]. These studies have found that scores of mental health qol [67, 69], scores of physical - like dimensions [68, 69, 71], and the score of global qol are independent predictors of disability as assessed using the edss score . There must be at least one plausible mechanism responsible for the link between poor qol and progression in disability . Qol could be a more subtle measure of early disability that is not detected by the edss scale . The identification of early predictors of the long - term evolution of disability status may be useful to identify both high - risk patients who require early and more aggressive therapies and low - risk patients who could avoid lifelong, expensive, and potentially troublesome treatments . Thus, this identification procedure may favor a more homogeneous selection of patients for clinical therapeutic trials . Patient - reported baseline qol levels provide additional prognostic information on ms disability beyond traditional clinical or sociodemographic factors . These findings provide strong support for the integration of qol into clinical practice, in addition to other standard assessments, and reinforce the importance of incorporating a patient's evaluation of their own qol level during patient monitoring and the assessment of treatment effects . Future studies should provide data from longer follow - up times and will likely highlight other robust findings . The impact of qol assessment on health status and other health - related outcomes of patients has already been accomplished in oncology [7375]. To our knowledge, there are no studies that have explored the effect of assessing qol in ms care management . This effect is defined by the negative expectations that derive from a clinical encounter and lead to poor health outcomes and therapy adherence . This theme constitutes an important avenue of ms research in clinical settings for the coming years . In some specific situations, clinicians can be perplexed when interpreting qol scores: (1) what does a qol score mean in the absence of normative / reference values? (3) what is the meaning of qol scores for an individual with cognitive impairment? The practical and clinical interpretations of qol data in a given disorder are difficult unless these data are presented with a reference system . One of the difficulties encountered when interpreting a qol score for clinicians is the lack of norms values . Sf36, a generic instrument, is commonly used because normative data from healthy adults and individuals with a variety of illnesses are available . To our knowledge, no norms were provided for any ms - specific questionnaire . At this time, the qol scores of the reference population described in the validation publication are implicitly used as norms . It is rare to have scores according to sex, gender, and clinical form . Additionally, it becomes imperative to produce norms for the most popular ms - specific instruments . Another concern expressed by clinicians is the interpretation of qol measures in longitudinal studies because qol, self - reported by the patient, might be influenced by psychological phenomena such as adaptation to illness . Adaptation to illness is a potential explanation in cases where, for example, the qol of an individual who has experienced a serious health event or chronic condition is similar to the qol of a healthy individual . Most people with a long - term chronic condition such as ms do not say that physical disability is their primary concern but mention involvement in everyday activities and psychological and emotional well - being . An important mediator of this adaptation process is response shift (rs) which involves changing internal standards, values, and the conceptualization of qol [78, 79]. Rs can be divided into (1) reconceptualization (i.e., a redefinition of qol), (2) reprioritization (i.e., a change in the importance attributed to component domains constituting qol), and (3) recalibration (i.e., a change in a patient's internal standards of measurements). True change may be over- or underestimated when rs is present, leading to biased estimates of the magnitude of change . A recent meta - analysis revealed a substantial body of literature on rs phenomena and concluded that rs was common and significant in qol measurement . Some studies have already investigated this phenomenon in ms populations using the most established methods: the then - test, structural equation modeling (sem), latent trajectory analysis of residuals, recursive partitioning tree analysis as a data mining method, and, more recently, the random forest method . . It would be premature to conclude which method is best for detecting rs in ms patients . Future explorations should be performed to compare the capacity of these methods for detecting rs and the degree of convergence of the isolated phenomena . However, the rs does not necessarily invalidate qol measures when it appears under the reprioritization component . Change in values may simply represent a mechanism by which people gain true changes in qol . Determining how to integrate the rs in the interpretation of qol scores in ms clinical practice is now the next challenge . Prior studies of the relationship between cognitive impairment and qol have been contradictory, highlighting either negligible [8790] or strong links [51, 91, 92] between cognitive disturbances and qol alterations . The use of self - reported outcomes in subjects with cognitive dysfunction is of particular concern . The extent to which ms patients with cognitive dysfunction can validly self - report their qol is a crucial issue that has only partially been examined . While some authors argue that cognitively impaired individuals are unable to produce valid qol measures [94, 95], others reported empirical evidence suggesting that individuals with a moderate degree of cognitive impairment can perform reliable qol assessments [92, 96]. Two recent papers reported data providing strong arguments to support the conclusion that ms patients with executive dysfunction, as determined by the stroop test, and memory dysfunction, as determined by the grober and buschke test, are reliable and consistent when answering a well - validated ms - specific qol questionnaire, the musiqol [24, 38]. These studies provided new evidence about the suitability for using self - reported qol data in these specific populations . The assessment of qol using the musiqol questionnaire could be more widely used without concern over the adequacy of this approach for cognitively impaired patients . However, it has to be acknowledged that a single test of cognitive functioning will never be entirely appropriate . An interdisciplinary approach would be most effective in addressing this deficit [1, 12]. Future studies should provide similar results according to other definitions of cognitive dysfunction that integrate combinations of different composites (i.e., memory, attention, and concentration) and other qol questionnaires . Using qol measures may provide clinicians with information regarding the general health status of their ms patients who might otherwise go unrecognized . Neurologists should consider qol measures in the same way as routine objective measures such as symptomatic evaluation scales, laboratory tests, and radiographs to manage the care of ms patients . In this paper, we discussed several avenues to convince clinicians of the clinical relevance and accuracy of qol instruments and ultimately to enhance the use of qol measures in clinical practice for ms patients.
Obestatin is a 23-amino acid peptide derived from proghrelin, a common prohormone for ghrelin and obestatin . Obestatin, like ghrelin, was originally extracted from rat stomach, and the stomach seems to be a major source of circulating obestatin . Secretion of obestatin is pulsatile, and plasma obestatin level exhibits an ultradian pulsatility with a frequency slightly lower than octanoylated ghrelin and growth hormone . Synthesis and release of ghrelin in the stomach is related to gastric condition . In patients with helicobacter pylori - evoked antral gastritis, plasma concentration of ghrelin and gastric expression of mrna for ghrelin are increased; whereas in the next stage of helicobacter pylori infection, in chronic atrophic gastritis, level of ghrelin is reduced . Previous studies have shown that administration of ghrelin protects various organs such as the heart, kidney and brain against ischemic injury and attenuates sepsis - induced lung injury and mortality . Moreover, ghrelin affects the bone metabolism, stimulating osteogenesis and improving the repair of bone defects . In the gut, pretreatment with ghrelin reduces gastric mucosal damage induced by noxious agents [1113] and inhibits the development of acute experimental pancreatitis . Moreover, apart from its protective effect, ghrelin accelerates the healing of gastric ulcers and exhibits a therapeutic effect in the course of acute pancreatitis and colonic inflammation . Obestatin promotes survival of pancreatic islets, and pretreatment with obestatin inhibits the development of cerulein - induced acute pancreatitis . Tumor necrosis factor- (tnf-) and interleukin-1 (il-1) are cytokines involved in systemic inflammation and are members of a group of cytokines that stimulate acute phase reaction . Tnf- and il-1 are produced mainly by macrophages, but a broad variety of other cell types is also involved in their production . Therefore, the aim of our present investigation was to examine whether obestatin administration exhibits any effect on the healing of chronic gastric ulcers and whether obestatin affects mucosal expression of pro - inflammatory cytokines . Studies were performed on 80 male wistar rats weighing 180200 g and divided randomly into 8 groups . Experiments were conducted following the experimental protocol approved by the local commission of ethics for the care and use of laboratory animals . Animals were housed in cages with wire mesh bottoms, in normal room temperature (221c) and a 12-h light - dark cycle . After fasting for 16 h, rats were anesthetized with pentobarbital (30 mg / kg i.p ., vetbutal, biowet, puawy, poland) and chronic gastric ulcers were induced using our modification of a method originally described by okabe et al . Briefly, a plastic tube of 4.2 mm inner diameter was applied tightly to the serosal surface of the anterior wall of the distal portion of the stomach, proximal to the pylorus . About 70 l of 100% acetic acid was applied through this tube for 20 s. after removal of the acetic acid, the abdomen was closed by sutures . This method was found to result in the formation of chronic ulceration of mucosa and submucosa within the area of acetic acid application . All rats were fasted with unlimited access to water at day 0 and then had free access to food and water . After induction of ulcers or sham operation, rats were treated with saline (0.9% solution of nacl) or obestatin given intraperitoneally twice a day for 6 days (the first injection at the day of ulcer induction, the last injection 1 h before the end of experiment). Obestatin was administered at the dose of 4, 8 or 16 nmol / kg / dose . Rat obestatin was synthesized at the yanaihara institute by a solid phase methodology with fmoc strategy using an automated peptide synthesizer (applied biosystem 9030 pioneer, foster, ca, usa). Six days after induction of chronic gastric ulcers, rats were anesthetized again with pentobarbital and the abdomen was opened by a midline incision . The stomach was exposed and the gastric mucosal blood flow was measured using laser doppler flowmeter (periflux 4001 master monitor, perimed ab, jrflla, sweden). Blood flow was measured in 5 areas of gastric mucosa and mean value of 5 recordings was presented as percent of mucosal blood flow recorded in saline - treated control rats without induction of ulcers . After measurement of mucosal blood flow the area of ulcerated mucosa was measured using a computerized planimeter (morphomat, carl zeiss, berlin, germany) as described previously . Expression of mrna for interleukin-1 and tnf- was determined using reverse transcriptase - polymerase chain reaction (rt - pcr) as described previously . Samples of gastric mucosa were snap frozen in liquid nitrogen and stored at 80c until rna extraction . The interleukin-1 primer sequences were: sense, gctacctatgtcttgcccgt, and antisense, gaccattgctgtttcctagg; the expected length of the product was 543 bp . The tnf- primer sequences were: sense, tactgaacttcggggtgattggtcc, and antisense, cagccttgtcccttgaagagaacc; the expected length of the product was 295 bp . The -actin primer sequences were: sense, ttgtaaccaactgggacgatatgg, and antisense, gatcttgatcttcatggtgctagg; the expected length of the product was 764 bp . Polymerase chain reaction products were detected by electrophoresis on a 1.5% agarose gel containing ethidium bromide . Location of predicted products was confirmed by using 100-bp ladder (takara, shiga, japan) as a standard size marker . The intensity of pcr products was measured using a video image analysis system (kodak digital science). The signal for investigated mrna was standardized against that of the -actin mrna from each sample and the results were expressed as analyzed mrna / b - actin mrna ratio as described earlier . Dna synthesis in gastric mucosa was determined by measurement of [h]thymidine incorporation ([6 - 3h]-thymidine, 2030 ci / mmol, institute for research, production and application of radioisotopes, prague, czech republic) into mucosal dna as described previously . The incorporation of labeled thymidine into dna was determined by counting 0.5 ml dna - containing supernatant in a liquid scintillation system . Dna synthesis was expressed as disintegrations of tritium per minute per g dna (dpm/g dna). Statistical analysis was carried out by one - way analysis of variance (anova) followed by the tukey multiple comparison test using graphpadprism (graphpad software, san diego, ca, usa). Studies were performed on 80 male wistar rats weighing 180200 g and divided randomly into 8 groups . Experiments were conducted following the experimental protocol approved by the local commission of ethics for the care and use of laboratory animals . Animals were housed in cages with wire mesh bottoms, in normal room temperature (221c) and a 12-h light - dark cycle . After fasting for 16 h, rats were anesthetized with pentobarbital (30 mg / kg i.p ., vetbutal, biowet, puawy, poland) and chronic gastric ulcers were induced using our modification of a method originally described by okabe et al . Briefly, a plastic tube of 4.2 mm inner diameter was applied tightly to the serosal surface of the anterior wall of the distal portion of the stomach, proximal to the pylorus . About 70 l of 100% acetic acid was applied through this tube for 20 s. after removal of the acetic acid, the abdomen was closed by sutures . This method was found to result in the formation of chronic ulceration of mucosa and submucosa within the area of acetic acid application . All rats were fasted with unlimited access to water at day 0 and then had free access to food and water . After induction of ulcers or sham operation, rats were treated with saline (0.9% solution of nacl) or obestatin given intraperitoneally twice a day for 6 days (the first injection at the day of ulcer induction, the last injection 1 h before the end of experiment). Obestatin was administered at the dose of 4, 8 or 16 nmol / kg / dose . Rat obestatin was synthesized at the yanaihara institute by a solid phase methodology with fmoc strategy using an automated peptide synthesizer (applied biosystem 9030 pioneer, foster, ca, usa). Six days after induction of chronic gastric ulcers, rats were anesthetized again with pentobarbital and the abdomen was opened by a midline incision . The stomach was exposed and the gastric mucosal blood flow was measured using laser doppler flowmeter (periflux 4001 master monitor, perimed ab, jrflla, sweden). Blood flow was measured in 5 areas of gastric mucosa and mean value of 5 recordings was presented as percent of mucosal blood flow recorded in saline - treated control rats without induction of ulcers . After measurement of mucosal blood flow the area of ulcerated mucosa was measured using a computerized planimeter (morphomat, carl zeiss, berlin, germany) as described previously . Expression of mrna for interleukin-1 and tnf- was determined using reverse transcriptase - polymerase chain reaction (rt - pcr) as described previously . Samples of gastric mucosa were snap frozen in liquid nitrogen and stored at 80c until rna extraction . The interleukin-1 primer sequences were: sense, gctacctatgtcttgcccgt, and antisense, gaccattgctgtttcctagg; the expected length of the product was 543 bp . The tnf- primer sequences were: sense, tactgaacttcggggtgattggtcc, and antisense, cagccttgtcccttgaagagaacc; the expected length of the product was 295 bp . The -actin primer sequences were: sense, ttgtaaccaactgggacgatatgg, and antisense, gatcttgatcttcatggtgctagg; the expected length of the product was 764 bp . Polymerase chain reaction products were detected by electrophoresis on a 1.5% agarose gel containing ethidium bromide . Location of predicted products was confirmed by using 100-bp ladder (takara, shiga, japan) as a standard size marker . The intensity of pcr products was measured using a video image analysis system (kodak digital science). The signal for investigated mrna was standardized against that of the -actin mrna from each sample and the results were expressed as analyzed mrna / b - actin mrna ratio as described earlier . Dna synthesis in gastric mucosa was determined by measurement of [h]thymidine incorporation ([6 - 3h]-thymidine, 2030 ci / mmol, institute for research, production and application of radioisotopes, prague, czech republic) into mucosal dna as described previously . The incorporation of labeled thymidine into dna was determined by counting 0.5 ml dna - containing supernatant in a liquid scintillation system . Dna synthesis was expressed as disintegrations of tritium per minute per g dna (dpm/g dna). Results were expressed as mean sem . Statistical analysis was carried out by one - way analysis of variance (anova) followed by the tukey multiple comparison test using graphpadprism (graphpad software, san diego, ca, usa). Figure 1 shows the influence of obestatin administration on the healing of chronic gastric ulcers . In saline- or obestatin - treated rats without induction of ulcer, treatment with obestatin given at the dose of 4, 8 and 16 nmol / kg / dose reduced ulcer area by 12%, 29% and 27%, respectively . Effect of obestatin given at the doses of 8 and 16 nmol / kg / dose was statistically significant . In rats without induction of ulcers, administration of obestatin failed to affect gastric mucosal blood flow (figure 2). Induction of ulcers significantly increased gastric mucosal blood flow by 23% and this effect was additionally enhanced by treatment with obestatin . Obestatin given at the dose of 8 and 16 nmol / kg / dose exhibited similar and statistically significant effect on gastric mucosal blood flow in rats with ulcers; whereas effect of obestatin given at the dose of 4 nmol / kg was statistically insignificant . In control saline - treated animals, gastric mucosal dna synthesis reached a value of 75.22.8 dpm/g dna (figure 3). Administration of obestatin failed to affect dna synthesis in gastric mucosa in rats without induction of ulcers . In saline - treated rats with ulcers, gastric mucosal dna synthesis was reduced by 42% . Treatment with obestatin partly reversed the ulcer - evoked reduction in dna synthesis in gastric mucosa . This effect was statistically significant after obestatin was administered at the dose of 8 or 16 nmol / kg / dose . In rats with intact gastric mucosa, administration of obestatin at the dose of 8 nmol / kg / dose was without effect on mucosal expression of mrna for pro - inflammatory il-1 in the stomach (figure 4). Administration of obestatin at the dose of 8 nmol / kg / dose partly, but significantly, reversed the ulcer - evoked increase in mucosal expression of mrna for interleukin-1. Administration of obestatin at the dose of 8 nmol / kg / dose was without effect on the ratio of mrna for tnf- to mrna for -actin in gastric mucosa in rats without induction of ulcers (figure 5). Treatment with obestatin at the dose 8 nmol / kg / dose reduced the ulcer - evoked increase in expression of tnf- mrna by 61%, but this value was still higher than that observed in control rats with intact mucosa . Our present study has shown for the first time that obestatin exhibits therapeutic effect in the course of chronic gastric ulcers . This effect was related to a decrease in local inflammatory process, improvement of mucosal blood flow and enhancement of mucosal cell proliferation, leading to acceleration of gastric ulcer healing . Direct mechanism of obestatin s therapeutic effect is not clear because the cellular target of this peptide is uncertain . Initially, zhang et al reported that obestatin binds and activates the orphan g protein - coupled receptor gpr39 . On the other hand, numerous researchers have obtained opposite results . Chartrel et al . Found no specific binding of i - obestatin to grp39 receptor, and they observed no effects of obestatin on gpr39-transfected cells in various functional assays, using the same experimental conditions as zhang et al . Similar negative results were also observed by lauwers et al . And holst . Facing the problem of inconsistent result, zhang et al . Have performed a new, precise study, investigating target cells for obestatin based on induction of an early - response gene c - fos in different tissues . After administration of obestatin, c - fos staining was found in the nuclei of gastric and intestinal mucosa, white adipose tissues, hepatic cords, and kidney tubules . Binding studies, using jejunum homogenates and recombinant gpr39, revealed obestatin - specific displacement curves . Furthermore, zhang et al . Demonstrated that treatment with obestatin induces c - fos expression in gastric mucosa of wild - type, but not gpr39 null, mice, indicating a mediating role of this receptor in obestatin actions . Finally, zhang et al . Concluded that obestatin is a metabolic hormone capable of binding to gpr39 receptor to regulate the functions of diverse gastrointestinal and adipose tissues . However, future studies are needed to confirm results obtained by zhang et al ., as well as to investigate physiological and pathophysiological role of obestatin . Circulation and perfusion of organs is a basic physiological process necessary to sustain oxygenation and nutrition at a cellular level . Microvascular impairment of the abdominal organs has been implicated in the pathogenesis of a variety of disorders, including peptic ulcer disease and inflammatory bowel disease . Blood flow plays an important role in protection of normal gastric mucosa and in the healing of damaged mucosa . Low mucosal blood flow predisposes to injury, whereas high blood flow protects against injurious agents . . Development of peptic ulcer is associated with damage to blood vessels and reduction in mucosal blood flow . During ulcer healing mucosal blood flow returns to normal level . These data are in agreement with results of our present study and indicates the role of blood flow in the therapeutic effect of obestatin in the course of chronic gastric ulcer . Treatment with obestatin has increased mucosal blood flow in the stomach; this effect has been associated with reduction in gastric ulcer area . This obestatin - evoked influence on gastric blood flow seems to be an indirect effect because administration of obestatin has failed to affect gastric blood flow in animals with intact gastric mucosa . Healing of gastric ulcers needs cell proliferation; this process is required for complete regeneration of damaged mucosa . Dna synthesis precedes cell division and the rate of mucosal dna synthesis is an index of mucosal cell proliferation . In our present study, obestatin failed to affect dna synthesis in gastric mucosa in rats without ulcers, but significantly reversed the ulcer - evoked reduction in this parameter . These findings indicate that the obestatin - evoked acceleration of gastric ulcer healing involves promotion of mucosal cell proliferation, but it seems to be the secondary, indirect effect . Our present study has shown that induction of ulcers increases mucosal expression of mrna for il-1 and tnf-. Both of these factors are cytokines involved in local and systemic inflammation, and act synergistically . They are inducers of endothelial adhesion molecules, which are essential for the adhesion of leukocytes to the endothelial surface prior to their migration into the tissues . Il-1 and tnf- play a crucial role in the stimulation of acute phase reaction . These data, together with our observation that treatment with obestatin reverses the ulcer - induced increase in mucosal expression of mrna for il-1 and tnf-, our study has demonstrated that treatment with obestatin accelerates healing of chronic gastric ulcers and this effect is related to improvement of mucosal blood flow, increase in mucosal cell proliferation and reduction in local expression of pro - inflammatory cytokines.
This report describes the design, implementation, and feasibility of the interstitial cystitis: elucidation of psychophysiologic and autonomic characteristics (icepac) study . Interstitial cystitis / bladder pain syndrome (ic / bps) causes severe bladder pain and afflicts about 2.5% of the population.1 the authors hypothesized abnormality of bladder perception at the central and/or peripheral nervous system levels . Typical symptoms and findings support this hypothesis (table 1), and suggest ic / bps is better conceptualized as either a chronic pain disorder, one involving autonomic nervous system dysfunction, or a combination of both . Classification as a chronic pain disorder may imply aberrant afferent (sensory) processing, whereas autonomic nervous system disorders are more often conceptualized as reflecting a primary efferent disturbance (table 1). If ic / bps reflects a nervous system disorder, the large number of comorbid diagnoses associated with ic / bps2 suggests a widespread abnormality, either in a large portion of peripheral nerves or in a single location of the central nervous system responsible for end - organ input, control, or both . A number of ic / bps comorbid psychiatric, chronic pain, and autonomic disorders have been described previously.3,4 examination of the interstitial cystitis database suggests significant overlap of ic / bps with other pain areas, including lower back, pelvic, and abdominal pain in 60%80% of subjects.5 the presence of headache, abdominal pain, tachycardia, panic attacks, dry eyes and mouth, heat intolerance, and cold - sensitive fingers and toes suggests increased sympathetic activity in ic / bps.3,6,7 studies investigating autonomic function in ic / bps identified the presence of abnormal vasomotor tone,810 increased bladder sympathetic neuron density,6,11 and increased urine norepinephrine excretion.12 stress response is partially explored in chronic pain disorders like ic / bps . Prior provocative testing was restricted to physical stressors, though the stress response system behaves differently when activated by physical or psychosocial stressors.13 moreover, disease activity at testing is generally not reported, further complicating interpretation . In feline ic / bps, sympathetic outflow increases1416 while the hypothalamic pituitary adrenal axis does not respond to external threat.17 sympathetic nervous system outflow may become exaggerated since adrenocortical hormone activity normally restrains sympathetic nervous system outflow.3,18 adrenocorticotropic hormone concentrations appear to decline during the stress of an ic / bps flare in women3 and in men with chronic pelvic pain syndrome.19 lutgendorf et al15 found that although mean urinary or salivary cortisol did not differ between women with ic / bps and controls, subjects with higher morning cortisol had significantly less pain and urgency and those with higher urinary free cortisol reported less overall symptomatology (p<0.05). Thus, information to date suggests correlation between lower circulating cortisol concentration, higher sympathetic nervous system outflow, and higher pain levels . The study aims to define autonomic, psychological, and other ic / bps comorbid disorders, evaluate associated changes in autonomic and sensory nervous system structure and function, and characterize stress response physiology . This paper describes the study design and feasibility in a population that is difficult to research in adequate number.20 developed initially by a core group of investigators, the protocols utilized in icepac evolved in the first year of the study through the guidance of an advisory board with expertise in each of the fields encompassed in this complex interdisciplinary effort . The board meets annually to review study progress, advise the investigators, and serves as the data safety and monitoring board . Icepac plans to enroll 228 women aged 1880 years: 76 ic / bps subjects, 76 mpp subjects, 38 family member subjects (female siblings / parents / children of ic / bps patients), and 38 healthy controls . The mpp group was selected to determine if findings are specific to ic / bps or occur with other pelvic pain syndromes . Ic / bps was defined by at least 6 months of urgency, frequency, and bladder pain clearly linked to bladder filling and emptying . Mpp was defined by at least 3 months of chronic pelvic pain unrelated to bladder state and a minimum of two of five pelvic floor tender points scoring> 4/10 on a numeric rating scale (nrs) when examined applying 2 kg pressure with the index finger . The differing pain durations for subjects to be classified as ic / bps or mpp, though not optimally comparable, are required for two reasons: 1) these durations reflect the current definitions found in the literature, and 2) subjects with mpp often become diagnosed and treated, effectively reducing pain burden, before 6 months have elapsed leading to recruitment difficulties if mpp inclusion requires 6 months of recent pain . Family members of ic / bps subjects are excluded if they have any history of ic / bps, mpp, or chronic pelvic pain as they would then be indistinguishable from subjects with pelvic pain . Healthy controls must have no history, symptoms or signs of fibromyalgia, chronic fatigue syndrome, ic / bps, mpp, chronic pelvic pain, migraine headache, or any other putative ic / bps comorbid disorders and be age matched to within 3 years of an ic / bps subject . General exclusion criteria include: attempted, recent, or existing pregnancy, recurrent urinary tract infections in the last 12 months, pelvic or bladder neoplasm, major organ impairment, uncontrolled illness or unstable medical disorder, central or peripheral nervous system disorder associated with its own confounding autonomic and neurologic findings, drug / medical device or noninvasive treatment initiation (eg, bladder instillation, pelvic floor therapy) within 30 days, major surgical intervention (eg, cystoplasty, sacral neuromodulation therapy) within 120 days, use of hormones (except insulin, thyroid replacement, or oral contraceptives), opioid medications or allergy to bupivacaine, inability to stop all autonomic and gastrointestinal motility modifying agents prior to testing, any condition impairing ability to consent and comply with study procedures, or math / speech / needle phobia . All subjects sign an informed consent prior to undergoing any study procedures in accordance with the institutional review board of university hospitals case medical center in cleveland, oh, usa . The study administration is handled by the principal investigator (pi), co - pi, and project manager . Five satellite locations are used to screen and refer patients . To further increase recruitment, subcontracts were developed with summa health systems (akron, oh, usa) and the university of toledo medical center (toledo, oh, usa) to allow recruitment from other hospital systems located in the region . With a diverse group of investigators performing the screening visit, it was necessary to standardize the examination to eliminate procedural bias . A total of four independent screening examinations were performed with each investigator; the first two conducted by the icepac study pi while the trained investigator observed . After observing two examinations, this process took place on four different days and with four different patients to establish examiner consistency . Additional rigor is brought to subject selection by requiring a structured screening examination, even if the referral came from a study investigator trained to perform the visit . A customized filemaker pro (filemaker, inc ., santa clara, ca, usa), password protected database (figure 1) resides on an encrypted network at the medical center . Research assistants (ra) perform real - time entry of all registration, visit, and testing data that is internally validated and stored in the database . The icepac online survey system, developed specifically for this study, allows subjects to enter questionnaire responses into the database . The ra monitors responses in real time at a different terminal to validate subject response patterns, speed, and subject attention . Data are stored in the icepac research database and the icepac online survey system is backed up daily . Data stored within the two systems can be exported and analyzed using the desired analytic software package . Completion is anticipated in early 2015 with enrollment through december 2012 depicted in figure 2 . Subjects may contact icepac study staff or give permission for study staff to contact them and schedule a screening visit (visit 0). In the first year, a steady referral volume originated from a bimonthly interdisciplinary pelvic pain clinic, structured so that appropriate interested subjects could be consented, enrolled, and have their screening visit performed that day . Mothers, sisters, and daughters accompanying study subjects to their visits are directly solicited . In addition to flyers at satellite clinics and postings in internal university / hospital communications, the study is listed on researchmatch.com and clinicaltrials.gov . Investigators also guest lecture at regional ic support group meetings throughout northeast and central ohio . For example, initial inclusion criteria excluded mpp from the ic / bps group and excluded ic / bps from the mpp group to enable clean comparisons . The advisory board was concerned about recruitment and how realistic it might be to find patients with ic / bps who did not have mpp and recommended that the ic / bps group be allowed to have comorbid mpp, while keeping the mpp group clean (without ic / bps). Enrollment (not completed subjects) of the ic / bps group through december 2012 numbers 37, of whom 25 also have mpp . Had this change not been implemented, only twelve subjects would be enrolled while 25 would have been excluded . After informed consent, the initial standard medical evaluation includes a medical history, physical exam, pregnancy, and urine dipstick tests . Physical evaluation includes height, weight, lying and standing blood pressure and heart rate, body temperature, and body mass index . An ra leads each visit to ensure direct, in - person contact between clinical and study personnel.21 once the above information is obtained, a study investigator reviews subject information and performs a routine physical examination of the head, eyes, ears, nose, throat, heart, lungs, extremities, and abdomen and assesses neurologic function . Particular attention is paid to any neurologic findings (eg, neuropathy, parkinsonian features) that would require exclusion . . Figures 3 and 4 show the locations of points examined for tenderness over the abdominal musculature, the inguinal ligaments, adductor muscles, and the pelvic floor musculature . The abdomen, inguinal region, and adductors are examined by applying 3 kg of force using an algometer (model fdn-50; wagner instruments, greenwich, ct, usa). Both the force associated with the first pain experience and a pain score (nrs: 010) at 3 kg (or the maximum tolerated force) are recorded . Pelvic floor muscle examination is done using 2 kg finger pressure where the study investigator standardizes the pressure applied by the digit with the algometer prior to starting the examination . The vulvodynia examination involves moving a lubricated cotton - tipped applicator back and forth inside the vagina (reported as a pressure or pain sensation) followed by a standard six - point assessment of the vulvar mucosa . The subject is oriented to the sensation of pin and cotton on the thigh and asked to determine whether similar contact on the vulva is experienced as pin or cotton and to rank any pain on an nrs of 010 . A diagnosis of vulvodynia requires three or more points ranked at a pain nrs of four or more . The fibromyalgia examination is conducted per american college of rheumatology criteria22 using 4 kg of pressure applied by the thumb standardized against the pressure algometer at standard sites . The fibromyalgia examination is conducted at visit 0 only for healthy controls as fibromyalgia is exclusionary for healthy controls and at visit 2 for ic / bps, mpp, and family members . The ra records the subject pain ratings and study investigator comments pertaining to the examination . Based on history, examination, and referring physician records, subjects are grouped as ic / bps mpp, mpp alone, or healthy subject . If the subject qualifies for the study, the ra schedules additional study visits and the subject is sent home with a urine hat and 24-hour voiding diary to be completed before her next visit . Study ineligibility may lead to one of two actions: 1) the subject may qualify at a later date (ie, if subject had a recent procedure that requires a specific delay before enrollment), and will be contacted to return at the appropriate time; or 2) subject will be excluded from the study indefinitely . Subjects arrive with their completed 24-hour voiding diary having not voided in the prior hour . Subjects use a portable computer to complete the psychological and ohio dysautonomia (odysa) questionnaires40 on the icepac online survey system while the ra monitors progress and validates responses . The questionnaires listed in table 2 are administered in random order to neutralize any questionnaire order effect with the exception of the odysa, which is given last due to its length . The odysa questionnaire was developed over the last several years to query for the presence of symptoms suggestive of comorbid disorders such as chronic fatigue syndrome, fibromyalgia, raynaud s syndrome, complex regional pain syndrome, migraine headache, irritable bowel syndrome, cyclic vomiting syndrome, functional dyspepsia, syncope, and orthostatic intolerance . Subjects are informed that they are not required to answer all questions and may skip questions should they feel uncomfortable for any reason . The ra will verify missing questionnaire data with the subject to determine whether omission was intentional before proceeding forward with the study visit . Visit 1 also includes a 20 ml bladder instillation of a 0.75% bupivacaine solution performed on ic / bps and mpp subjects only . The local anesthetic solution is prepared by the university hospitals research pharmacy (university hospitals, cleveland, oh, usa) and dropped off at the procedure location . Since the intent of this procedure is to relate the change in bladder function to local anesthetic induced change in afferent processing, subjects undergo a baseline bladder ultrasound and uroflow (flopoint elite; verathon, bothell, wa, usa) measurement so that pre- and post - procedure volumes can be matched as closely as possible for an apples to apples prior to receiving the bladder instillation, the investigator cleans the subject s urethra with three benzalkonium chloride swabsticks (aplicare, inc ., meriden, ct, usa), and then inserts a lubricated 8f pediatric catheter (c.r ., murray hill, nj, usa). The subject is asked to hold the solution in the bladder for a minimum of 60 minutes if possible . Subjects are asked to give pain ratings pre- and post - instillation . While waiting to void, subjects are given water to drink and the odysa questionnaire to complete . After 60 minutes of holding the solution, bladder volume is determined via ultrasound for comparison to the baseline volume reading . If the volume is reduced compared to baseline, more water is given and the bladder is subjected to ultrasound again after a suitable period of time has elapsed . Once the volume is approximately equal to that of the baseline recording (10%), a final uroflow is performed . Subjects who received an instillation are given a 3-day voiding diary to return at the final study visit and reminded which medications must be stopped prior to their next visit . At this visit, the investigator reviews medications the subject will need to temporarily discontinue / halt prior to the autonomic testing study visit (visit 2). Autonomic testing includes the cardiac responses to deep breathing and to the valsalva maneuver, the post - ganglionic quantitative sudomotor axon reflex test, and a tilt table test . Ras complete all autonomic nervous system testing with a trained investigator required only during the tilt table test . The methods of the autonomic nervous system laboratory have been previously described23 and will be reiterated here in brief . The cardiac response to deep breathing is a fairly pure measure of pulmonary afferent stretch receptor and cardiac parasympathetic efferent activities.24 the subject takes six full breaths per minute for 1 minute while an electrocardiogram records heart rate . The difference between inspiration (higher heart rate) and expiration (lower heart rate) is averaged for the five best breaths and compared to age - based norms . The valsalva maneuver is performed by asking the subject to blow against a pressure gauge holding 40 mmhg for 15 seconds with an open glottis (insured by a small leak in the connecting tubing) while continuous blood pressure, measured by digital plethysmography (nexfin monitor model 1; bmeye b.v ., amsterdam, the netherlands), and heart rate are recorded . Measurements include the highest heart rate at the end of the pressure holding period (phase ii) reflecting cardiac sympathetic function, the lowest heart rate after release (phase iv) reflecting cardiac parasympathetic function, and maintenance of diastolic pressure throughout phase ii reflecting vasomotor sympathetic function . Age - based norms are expressed as a ratio of the highest to lowest heart rates (valsalva ratio). The tilt - table test requires the subject to remain inclined at 70 degrees for 30 minutes preceded and followed by baseline blood pressure and heart rate readings taken each minute for 510 minutes . The subject is asked every few minutes for any standard orthostatic symptoms such as lightheadedness, nausea, diaphoresis, blurred or darkening vision, and fatigue, ranked on a nrs from 010 . Tilt results are interpreted as either normal, showing orthostatic hypotension (> 20 mmhg systolic or> 10 mmhg diastolic blood pressure drop in the first 3 minutes of tilt), postural tachycardia syndrome (> 30 beats per minute (bpm) rise in heart rate in the first 10 minutes of tilt in the presence of orthostatic symptoms and in the absence of a drop in blood pressure), or reflex syncope (an abrupt drop in pressure usually accompanied by a drop in heart rate that would have led to loss of consciousness had the subject not been reclined). The heart rate record is also analyzed for heart rate variability . During the tilt test, the gastric electrical activity (polygram net analysis package; medtronic, minneapolis, mn, usa) is recorded for 10 minutes with the patient in the supine position and then during the 30 minutes of head - up tilt . The quantitative sudomotor axon reflex test provides a specific measure of cholinergic sympathetic efferent small fiber function . In brief, a battery sourced current is driven for 5 minutes across a 10% solution of acetylcholine located in the outer chamber of a dual - chambered capsule applied to the skin . Sweat rate is detected through the change in humidity in the inner chamber of the same capsule . Since each sudomotor nerve innervates multiple sweat glands, the axon stimulated by the acetylcholine iontophoresis signals the other sweat glands and results in sweat output into the inner chamber.25 the remainder of visit 2 is performed in a standard examination room . A water load test26 is administered, which consists of recording the maximal volume of water a subject can consume in 5 minutes with comparison to normal values . Subjects classified as ic / bps, mpp, or family members then undergo a fibromyalgia examination based on the 1990 american college of rheumatology22 criteria, checking the 18 standard tender points applying 4 kg of pressure with the thumb, calibrated using an algometer every fourth point . An examination of the extremities (small fiber score) looking for generalized small (and large) fiber peripheral nerve dysfunction is performed assessing pin, temperature, vibration sensation, superficial and deep allodynia, distal muscle strength, and reflexes (figure 5). A pelvic neurologic examination27 is performed to evaluate dermatomes t12, l1, l2, s1, s2, s3, s4, and s5 for pin prick and vibration sensations . Subjects are compensated for their time and offered participation in other icepac substudies such as the trier social stress test study28 or an icepac sleep study investigating sleep disorders in women with ic / bps . Icepac plans to enroll 228 women aged 1880 years: 76 ic / bps subjects, 76 mpp subjects, 38 family member subjects (female siblings / parents / children of ic / bps patients), and 38 healthy controls . The mpp group was selected to determine if findings are specific to ic / bps or occur with other pelvic pain syndromes . Ic / bps was defined by at least 6 months of urgency, frequency, and bladder pain clearly linked to bladder filling and emptying . Mpp was defined by at least 3 months of chronic pelvic pain unrelated to bladder state and a minimum of two of five pelvic floor tender points scoring> 4/10 on a numeric rating scale (nrs) when examined applying 2 kg pressure with the index finger . The differing pain durations for subjects to be classified as ic / bps or mpp, though not optimally comparable, are required for two reasons: 1) these durations reflect the current definitions found in the literature, and 2) subjects with mpp often become diagnosed and treated, effectively reducing pain burden, before 6 months have elapsed leading to recruitment difficulties if mpp inclusion requires 6 months of recent pain . Family members of ic / bps subjects are excluded if they have any history of ic / bps, mpp, or chronic pelvic pain as they would then be indistinguishable from subjects with pelvic pain . Healthy controls must have no history, symptoms or signs of fibromyalgia, chronic fatigue syndrome, ic / bps, mpp, chronic pelvic pain, migraine headache, or any other putative ic / bps comorbid disorders and be age matched to within 3 years of an ic / bps subject . General exclusion criteria include: attempted, recent, or existing pregnancy, recurrent urinary tract infections in the last 12 months, pelvic or bladder neoplasm, major organ impairment, uncontrolled illness or unstable medical disorder, central or peripheral nervous system disorder associated with its own confounding autonomic and neurologic findings, drug / medical device or noninvasive treatment initiation (eg, bladder instillation, pelvic floor therapy) within 30 days, major surgical intervention (eg, cystoplasty, sacral neuromodulation therapy) within 120 days, use of hormones (except insulin, thyroid replacement, or oral contraceptives), opioid medications or allergy to bupivacaine, inability to stop all autonomic and gastrointestinal motility modifying agents prior to testing, any condition impairing ability to consent and comply with study procedures, or math / speech / needle phobia . All subjects sign an informed consent prior to undergoing any study procedures in accordance with the institutional review board of university hospitals case medical center in cleveland, oh, usa . The study administration is handled by the principal investigator (pi), co - pi, and project manager . Five satellite locations are used to screen and refer patients . To further increase recruitment, subcontracts were developed with summa health systems (akron, oh, usa) and the university of toledo medical center (toledo, oh, usa) to allow recruitment from other hospital systems located in the region . With a diverse group of investigators performing the screening visit, it was necessary to standardize the examination to eliminate procedural bias . A total of four independent screening examinations were performed with each investigator; the first two conducted by the icepac study pi while the trained investigator observed . After observing this process took place on four different days and with four different patients to establish examiner consistency . Additional rigor is brought to subject selection by requiring a structured screening examination, even if the referral came from a study investigator trained to perform the visit . Ca, usa), password protected database (figure 1) resides on an encrypted network at the medical center . Research assistants (ra) perform real - time entry of all registration, visit, and testing data that is internally validated and stored in the database . The icepac online survey system, developed specifically for this study, allows subjects to enter questionnaire responses into the database . The ra monitors responses in real time at a different terminal to validate subject response patterns, speed, and subject attention . Data are stored in the icepac research database and the icepac online survey system is backed up daily . Data stored within the two systems can be exported and analyzed using the desired analytic software package . Completion is anticipated in early 2015 with enrollment through december 2012 depicted in figure 2 . Subjects may contact icepac study staff or give permission for study staff to contact them and schedule a screening visit (visit 0). In the first year, a steady referral volume originated from a bimonthly interdisciplinary pelvic pain clinic, structured so that appropriate interested subjects could be consented, enrolled, and have their screening visit performed that day . Mothers, sisters, and daughters accompanying study subjects to their visits are directly solicited . In addition to flyers at satellite clinics and postings in internal university / hospital communications, the study is listed on researchmatch.com and clinicaltrials.gov . Investigators also guest lecture at regional ic support group meetings throughout northeast and central ohio . For example, initial inclusion criteria excluded mpp from the ic / bps group and excluded ic / bps from the mpp group to enable clean comparisons . The advisory board was concerned about recruitment and how realistic it might be to find patients with ic / bps who did not have mpp and recommended that the ic / bps group be allowed to have comorbid mpp, while keeping the mpp group clean (without ic / bps). Enrollment (not completed subjects) of the ic / bps group through december 2012 numbers 37, of whom 25 also have mpp . Had this change not been implemented, only twelve subjects would be enrolled while 25 would have been excluded . After informed consent, the initial standard medical evaluation includes a medical history, physical exam, pregnancy, and urine dipstick tests . Physical evaluation includes height, weight, lying and standing blood pressure and heart rate, body temperature, and body mass index . An ra leads each visit to ensure direct, in - person contact between clinical and study personnel.21 once the above information is obtained, a study investigator reviews subject information and performs a routine physical examination of the head, eyes, ears, nose, throat, heart, lungs, extremities, and abdomen and assesses neurologic function . Particular attention is paid to any neurologic findings (eg, neuropathy, parkinsonian features) that would require exclusion . . Figures 3 and 4 show the locations of points examined for tenderness over the abdominal musculature, the inguinal ligaments, adductor muscles, and the pelvic floor musculature . The abdomen, inguinal region, and adductors are examined by applying 3 kg of force using an algometer (model fdn-50; wagner instruments, greenwich, ct, usa). Both the force associated with the first pain experience and a pain score (nrs: 010) at 3 kg (or the maximum tolerated force) are recorded . Pelvic floor muscle examination is done using 2 kg finger pressure where the study investigator standardizes the pressure applied by the digit with the algometer prior to starting the examination . The vulvodynia examination involves moving a lubricated cotton - tipped applicator back and forth inside the vagina (reported as a pressure or pain sensation) followed by a standard six - point assessment of the vulvar mucosa . The subject is oriented to the sensation of pin and cotton on the thigh and asked to determine whether similar contact on the vulva is experienced as pin or cotton and to rank any pain on an nrs of 010 . A diagnosis of vulvodynia requires three or more points ranked at a pain nrs of four or more . The fibromyalgia examination is conducted per american college of rheumatology criteria22 using 4 kg of pressure applied by the thumb standardized against the pressure algometer at standard sites . The fibromyalgia examination is conducted at visit 0 only for healthy controls as fibromyalgia is exclusionary for healthy controls and at visit 2 for ic / bps, mpp, and family members . The ra records the subject pain ratings and study investigator comments pertaining to the examination . Based on history, examination, and referring physician records, subjects are grouped as ic / bps mpp, mpp alone, or healthy subject . If the subject qualifies for the study, the ra schedules additional study visits and the subject is sent home with a urine hat and 24-hour voiding diary to be completed before her next visit . Study ineligibility may lead to one of two actions: 1) the subject may qualify at a later date (ie, if subject had a recent procedure that requires a specific delay before enrollment), and will be contacted to return at the appropriate time; or 2) subject will be excluded from the study indefinitely . Subjects arrive with their completed 24-hour voiding diary having not voided in the prior hour . Subjects use a portable computer to complete the psychological and ohio dysautonomia (odysa) questionnaires40 on the icepac online survey system while the ra monitors progress and validates responses . The questionnaires listed in table 2 are administered in random order to neutralize any questionnaire order effect with the exception of the odysa, which is given last due to its length . The odysa questionnaire was developed over the last several years to query for the presence of symptoms suggestive of comorbid disorders such as chronic fatigue syndrome, fibromyalgia, raynaud s syndrome, complex regional pain syndrome, migraine headache, irritable bowel syndrome, cyclic vomiting syndrome, functional dyspepsia, syncope, and orthostatic intolerance . Subjects are informed that they are not required to answer all questions and may skip questions should they feel uncomfortable for any reason . The ra will verify missing questionnaire data with the subject to determine whether omission was intentional before proceeding forward with the study visit . Visit 1 also includes a 20 ml bladder instillation of a 0.75% bupivacaine solution performed on ic / bps and mpp subjects only . The local anesthetic solution is prepared by the university hospitals research pharmacy (university hospitals, cleveland, oh, usa) and dropped off at the procedure location . Since the intent of this procedure is to relate the change in bladder function to local anesthetic induced change in afferent processing, subjects undergo a baseline bladder ultrasound and uroflow (flopoint elite; verathon, bothell, wa, usa) measurement so that pre- and post - procedure volumes can be matched as closely as possible for an apples to apples comparison of detrusor and sphincter functions . Prior to receiving the bladder instillation, the investigator cleans the subject s urethra with three benzalkonium chloride swabsticks (aplicare, inc ., meriden, ct, usa), and then inserts a lubricated 8f pediatric catheter (c.r . The subject is asked to hold the solution in the bladder for a minimum of 60 minutes if possible . Subjects are asked to give pain ratings pre- and post - instillation . While waiting to void, subjects are given water to drink and the odysa questionnaire to complete . After 60 minutes of holding the solution, bladder volume is determined via ultrasound for comparison to the baseline volume reading . If the volume is reduced compared to baseline, more water is given and the bladder is subjected to ultrasound again after a suitable period of time has elapsed . Once the volume is approximately equal to that of the baseline recording (10%), a final uroflow is performed . Subjects who received an instillation are given a 3-day voiding diary to return at the final study visit and reminded which medications must be stopped prior to their next visit . At this visit, the investigator reviews medications the subject will need to temporarily discontinue / halt prior to the autonomic testing study visit (visit 2). Autonomic testing includes the cardiac responses to deep breathing and to the valsalva maneuver, the post - ganglionic quantitative sudomotor axon reflex test, and a tilt table test . Ras complete all autonomic nervous system testing with a trained investigator required only during the tilt table test . The methods of the autonomic nervous system laboratory have been previously described23 and will be reiterated here in brief . The cardiac response to deep breathing is a fairly pure measure of pulmonary afferent stretch receptor and cardiac parasympathetic efferent activities.24 the subject takes six full breaths per minute for 1 minute while an electrocardiogram records heart rate . The difference between inspiration (higher heart rate) and expiration (lower heart rate) is averaged for the five best breaths and compared to age - based norms . The valsalva maneuver is performed by asking the subject to blow against a pressure gauge holding 40 mmhg for 15 seconds with an open glottis (insured by a small leak in the connecting tubing) while continuous blood pressure, measured by digital plethysmography (nexfin monitor model 1; bmeye b.v . Measurements include the highest heart rate at the end of the pressure holding period (phase ii) reflecting cardiac sympathetic function, the lowest heart rate after release (phase iv) reflecting cardiac parasympathetic function, and maintenance of diastolic pressure throughout phase ii reflecting vasomotor sympathetic function . Age - based norms are expressed as a ratio of the highest to lowest heart rates (valsalva ratio). The tilt - table test requires the subject to remain inclined at 70 degrees for 30 minutes preceded and followed by baseline blood pressure and heart rate readings taken each minute for 510 minutes . The subject is asked every few minutes for any standard orthostatic symptoms such as lightheadedness, nausea, diaphoresis, blurred or darkening vision, and fatigue, ranked on a nrs from 010 . Tilt results are interpreted as either normal, showing orthostatic hypotension (> 20 mmhg systolic or> 10 mmhg diastolic blood pressure drop in the first 3 minutes of tilt), postural tachycardia syndrome (> 30 beats per minute (bpm) rise in heart rate in the first 10 minutes of tilt in the presence of orthostatic symptoms and in the absence of a drop in blood pressure), or reflex syncope (an abrupt drop in pressure usually accompanied by a drop in heart rate that would have led to loss of consciousness had the subject not been reclined). The heart rate record is also analyzed for heart rate variability . During the tilt test, the gastric electrical activity (polygram net analysis package; medtronic, minneapolis, mn, usa) is recorded for 10 minutes with the patient in the supine position and then during the 30 minutes of head - up tilt . The quantitative sudomotor axon reflex test provides a specific measure of cholinergic sympathetic efferent small fiber function . In brief, a battery sourced current is driven for 5 minutes across a 10% solution of acetylcholine located in the outer chamber of a dual - chambered capsule applied to the skin . Sweat rate is detected through the change in humidity in the inner chamber of the same capsule . Since each sudomotor nerve innervates multiple sweat glands, the axon stimulated by the acetylcholine iontophoresis signals the other sweat glands and results in sweat output into the inner chamber.25 the remainder of visit 2 is performed in a standard examination room . A water load test26 is administered, which consists of recording the maximal volume of water a subject can consume in 5 minutes with comparison to normal values . Subjects classified as ic / bps, mpp, or family members then undergo a fibromyalgia examination based on the 1990 american college of rheumatology22 criteria, checking the 18 standard tender points applying 4 kg of pressure with the thumb, calibrated using an algometer every fourth point . An examination of the extremities (small fiber score) looking for generalized small (and large) fiber peripheral nerve dysfunction is performed assessing pin, temperature, vibration sensation, superficial and deep allodynia, distal muscle strength, and reflexes (figure 5). A pelvic neurologic examination27 is performed to evaluate dermatomes t12, l1, l2, s1, s2, s3, s4, and s5 for pin prick and vibration sensations . Subjects are compensated for their time and offered participation in other icepac substudies such as the trier social stress test study28 or an icepac sleep study investigating sleep disorders in women with ic / bps . After informed consent, the initial standard medical evaluation includes a medical history, physical exam, pregnancy, and urine dipstick tests . Physical evaluation includes height, weight, lying and standing blood pressure and heart rate, body temperature, and body mass index . An ra leads each visit to ensure direct, in - person contact between clinical and study personnel.21 once the above information is obtained, a study investigator reviews subject information and performs a routine physical examination of the head, eyes, ears, nose, throat, heart, lungs, extremities, and abdomen and assesses neurologic function . Particular attention is paid to any neurologic findings (eg, neuropathy, parkinsonian features) that would require exclusion . . Figures 3 and 4 show the locations of points examined for tenderness over the abdominal musculature, the inguinal ligaments, adductor muscles, and the pelvic floor musculature . The abdomen, inguinal region, and adductors are examined by applying 3 kg of force using an algometer (model fdn-50; wagner instruments, greenwich, ct, usa). Both the force associated with the first pain experience and a pain score (nrs: 010) at 3 kg (or the maximum tolerated force) are recorded . Pelvic floor muscle examination is done using 2 kg finger pressure where the study investigator standardizes the pressure applied by the digit with the algometer prior to starting the examination . The vulvodynia examination involves moving a lubricated cotton - tipped applicator back and forth inside the vagina (reported as a pressure or pain sensation) followed by a standard six - point assessment of the vulvar mucosa . The subject is oriented to the sensation of pin and cotton on the thigh and asked to determine whether similar contact on the vulva is experienced as pin or cotton and to rank any pain on an nrs of 010 . A diagnosis of vulvodynia requires three or more points ranked at a pain nrs of four or more . The fibromyalgia examination is conducted per american college of rheumatology criteria22 using 4 kg of pressure applied by the thumb standardized against the pressure algometer at standard sites . The fibromyalgia examination is conducted at visit 0 only for healthy controls as fibromyalgia is exclusionary for healthy controls and at visit 2 for ic / bps, mpp, and family members . The ra records the subject pain ratings and study investigator comments pertaining to the examination . Based on history, examination, and referring physician records, subjects are grouped as ic / bps mpp, mpp alone, or healthy subject . If the subject qualifies for the study, the ra schedules additional study visits and the subject is sent home with a urine hat and 24-hour voiding diary to be completed before her next visit . Study ineligibility may lead to one of two actions: 1) the subject may qualify at a later date (ie, if subject had a recent procedure that requires a specific delay before enrollment), and will be contacted to return at the appropriate time; or 2) subject will be excluded from the study indefinitely . Subjects arrive with their completed 24-hour voiding diary having not voided in the prior hour . Subjects use a portable computer to complete the psychological and ohio dysautonomia (odysa) questionnaires40 on the icepac online survey system while the ra monitors progress and validates responses . The questionnaires listed in table 2 are administered in random order to neutralize any questionnaire order effect with the exception of the odysa, which is given last due to its length . The odysa questionnaire was developed over the last several years to query for the presence of symptoms suggestive of comorbid disorders such as chronic fatigue syndrome, fibromyalgia, raynaud s syndrome, complex regional pain syndrome, migraine headache, irritable bowel syndrome, cyclic vomiting syndrome, functional dyspepsia, syncope, and orthostatic intolerance . Subjects are informed that they are not required to answer all questions and may skip questions should they feel uncomfortable for any reason . The ra will verify missing questionnaire data with the subject to determine whether omission was intentional before proceeding forward with the study visit . Visit 1 also includes a 20 ml bladder instillation of a 0.75% bupivacaine solution performed on ic / bps and mpp subjects only . The local anesthetic solution is prepared by the university hospitals research pharmacy (university hospitals, cleveland, oh, usa) and dropped off at the procedure location . Since the intent of this procedure is to relate the change in bladder function to local anesthetic induced change in afferent processing, subjects undergo a baseline bladder ultrasound and uroflow (flopoint elite; verathon, bothell, wa, usa) measurement so that pre- and post - procedure volumes can be matched as closely as possible for an apples to apples comparison of detrusor and sphincter functions . Prior to receiving the bladder instillation, the investigator cleans the subject s urethra with three benzalkonium chloride swabsticks (aplicare, inc ., meriden, ct, usa), and then inserts a lubricated 8f pediatric catheter (c.r ., murray hill, nj, usa). The subject is asked to hold the solution in the bladder for a minimum of 60 minutes if possible . Subjects are asked to give pain ratings pre- and post - instillation . While waiting to void, subjects are given water to drink and the odysa questionnaire to complete . After 60 minutes of holding the solution, bladder volume is determined via ultrasound for comparison to the baseline volume reading . If the volume is reduced compared to baseline, more water is given and the bladder is subjected to ultrasound again after a suitable period of time has elapsed . Once the volume is approximately equal to that of the baseline recording (10%), a final uroflow is performed . Subjects who received an instillation are given a 3-day voiding diary to return at the final study visit and reminded which medications must be stopped prior to their next visit . At this visit, the investigator reviews medications the subject will need to temporarily discontinue / halt prior to the autonomic testing study visit (visit 2). Autonomic testing includes the cardiac responses to deep breathing and to the valsalva maneuver, the post - ganglionic quantitative sudomotor axon reflex test, and a tilt table test . Ras complete all autonomic nervous system testing with a trained investigator required only during the tilt table test . The methods of the autonomic nervous system laboratory have been previously described23 and will be reiterated here in brief . The cardiac response to deep breathing is a fairly pure measure of pulmonary afferent stretch receptor and cardiac parasympathetic efferent activities.24 the subject takes six full breaths per minute for 1 minute while an electrocardiogram records heart rate . The difference between inspiration (higher heart rate) and expiration (lower heart rate) is averaged for the five best breaths and compared to age - based norms . The valsalva maneuver is performed by asking the subject to blow against a pressure gauge holding 40 mmhg for 15 seconds with an open glottis (insured by a small leak in the connecting tubing) while continuous blood pressure, measured by digital plethysmography (nexfin monitor model 1; bmeye b.v ., measurements include the highest heart rate at the end of the pressure holding period (phase ii) reflecting cardiac sympathetic function, the lowest heart rate after release (phase iv) reflecting cardiac parasympathetic function, and maintenance of diastolic pressure throughout phase ii reflecting vasomotor sympathetic function . Age - based norms are expressed as a ratio of the highest to lowest heart rates (valsalva ratio). The tilt - table test requires the subject to remain inclined at 70 degrees for 30 minutes preceded and followed by baseline blood pressure and heart rate readings taken each minute for 510 minutes . The subject is asked every few minutes for any standard orthostatic symptoms such as lightheadedness, nausea, diaphoresis, blurred or darkening vision, and fatigue, ranked on a nrs from 010 . Tilt results are interpreted as either normal, showing orthostatic hypotension (> 20 mmhg systolic or> 10 mmhg diastolic blood pressure drop in the first 3 minutes of tilt), postural tachycardia syndrome (> 30 beats per minute (bpm) rise in heart rate in the first 10 minutes of tilt in the presence of orthostatic symptoms and in the absence of a drop in blood pressure), or reflex syncope (an abrupt drop in pressure usually accompanied by a drop in heart rate that would have led to loss of consciousness had the subject not been reclined). The heart rate record is also analyzed for heart rate variability . During the tilt test, the gastric electrical activity (polygram net analysis package; medtronic, minneapolis, mn, usa) is recorded for 10 minutes with the patient in the supine position and then during the 30 minutes of head - up tilt . The quantitative sudomotor axon reflex test provides a specific measure of cholinergic sympathetic efferent small fiber function . In brief, a battery sourced current is driven for 5 minutes across a 10% solution of acetylcholine located in the outer chamber of a dual - chambered capsule applied to the skin . Sweat rate is detected through the change in humidity in the inner chamber of the same capsule . Since each sudomotor nerve innervates multiple sweat glands, the axon stimulated by the acetylcholine iontophoresis signals the other sweat glands and results in sweat output into the inner chamber.25 the remainder of visit 2 is performed in a standard examination room . A water load test26 is administered, which consists of recording the maximal volume of water a subject can consume in 5 minutes with comparison to normal values . Subjects classified as ic / bps, mpp, or family members then undergo a fibromyalgia examination based on the 1990 american college of rheumatology22 criteria, checking the 18 standard tender points applying 4 kg of pressure with the thumb, calibrated using an algometer every fourth point . An examination of the extremities (small fiber score) looking for generalized small (and large) fiber peripheral nerve dysfunction is performed assessing pin, temperature, vibration sensation, superficial and deep allodynia, distal muscle strength, and reflexes (figure 5). A pelvic neurologic examination27 is performed to evaluate dermatomes t12, l1, l2, s1, s2, s3, s4, and s5 for pin prick and vibration sensations . Subjects are compensated for their time and offered participation in other icepac substudies such as the trier social stress test study28 or an icepac sleep study investigating sleep disorders in women with ic / bps . As of december 2012, data collection has been completed for 25 healthy controls, 33 ic / bps mpp, eight mpp, and three family members . Initially, the pi and co - pi were the main source of referrals, but this pattern was not sustainable once clinic populations were exhausted . Efforts at maintaining contact with investigators to encourage referrals have led to gradual referral growth across a broader group of referrers . Study investigators are kept up - to - date on study progress through an icepac investigator newsletter, which also serves as a reminder to refer . To date, the only adverse events have been associated with the bupivacaine instillation procedure . As a result, the investigators, guided by the icepac data safety monitoring board adopted a smaller, pediatric hydrophilic catheter and, since then, no further adverse events of any type have been reported . Studies involving chronic pain disorders such as ic / bps pose two very specific challenges . First, in the current era, most successful clinical translational studies on disorders involving chronic pain are interdisciplinary in design, requiring significant education, cross - training, and front - end work for the team to be successful . Md, usa) is currently funding much of the work on ic / bps through the multidisciplinary approach to the study of chronic pelvic pain (mapp) multisite network . Second, these populations have been difficult to recruit in large numbers.20 the purpose here is to present an approach to both of these challenges for the benefit of others who are performing related studies and spell out which strategies were and were not successful . The original proposal arose from a collaboration funded by the interstitial cystitis association of america between dr buffington and dr chelimsky on the familial characteristics of ic / bps and an interdisciplinary team seeing pelvic pain patients together in a clinic setting, with a set of questions regarding these patients . Disagreements on methods (eg, the best way to examine the pelvic floor musculature) were incorporated as questions to be answered by the grant . Thus, this study is noteworthy for its true interdisciplinary nature, from conception to implementation, and there was strong investment in the grant by the research team . Although such a process takes longer, the authors believe the design quality was higher, and the scientific questions posed were more clinically relevant . The board reflects the interdisciplinary composition nature of the research team and is comprised of a psychophysiologist with expertise in heart rate variability and stress responses, a pelvic pain neurologist, an urologist, a gynecologist specializing in pelvic pain and detailed vulvar examinations, a psychiatrist, and a sleep specialist . The board provided refinements to the study and helped validate that the project was capable of addressing important questions with an adequately sophisticated design . A simple issue pertained to the practicality of scheduling meetings for 20 busy surgeons and clinicians . This was initially addressed by scheduling monthly conference calls at an optimal time with topical discussions that were highly relevant and intellectually stimulating . An investigator newsletter was implemented as a means of maintaining investigator engagement and transparent communication . The collaboration of disciplines that usually do not understand each other s technical terms required significant education, with an initially steep learning curve . Cross - disciplinary training for standardization of pelvic floor, neurologic, and urologic examinations conducted during study visits was completed by each investigator . This was a highly rewarding process for investigators from varied disciplines, resulting in novel questions on each area driven by an entirely fresh perspective . Another set of challenges arose from sheer study size . A protocol comprised of multiple investigators from different departments and medical centers required multiple revisions in order to obtain institutional review board approval . Urologists and gynecologists have different views on methodology and the relative importance of different portions of the examinations . It took several months of re - evaluations and standardization to obtain a final protocol, a feat not possible without the guidance and expertise of the icepac study advisory board members . The number of investigators, of whom consensus was required, slowed attempts to modify the study . Exploration of new ideas or protocol modifications, such as assessment of sleep pattern and sleep disorder causality or measurement of stress and tight junction related cytokines in serum in subjects undergoing the trier social stress test, require more discussion and take longer to implement . As a result, however, the design is more likely to be embraced by specialists in diverse areas of medicine (eg, urologists, gynecologists). The number of physicians trained to perform study visits (which was the only way to recruit the large number of subjects proposed) required particular attention to investigator training (described in methods) and protocol standardization . To this end, attention was paid to protocol scripts, and most of these were designed to be read and controlled by the ra rather than the investigator, which minimizes protocol variability . For example, semi - quantitative tuning forks29 (us neurologicals llc, poulsbo, wa, usa) for the assessment of vibration sensation were introduced, the temperature of the hot water stimulus was standardized to 115f, and a digital algometer (model fdix 10; wagner instruments) to standardize the force used to assess pin sensation to 0.55 n (about 2 oz) were implemented as part of standard operating procedure . Selection of the psychological questionnaires required great care, ensuring that appropriate psychological constructs were evaluated while simultaneously limiting the time requirement burden on subjects and reducing the impact on statistical power of the number of variables employed . After extensive discussion and consideration of alternatives, the advisory board ultimately supported the selection of psychological proposed instruments . The psychological questionnaire set includes 313 questions and the odysa either 158 or 330 questions, depending on the subject s symptomatic history . Though all subjects have completed the question set to date, a small number of subjects have expressed concern about questionnaire time burden . Breaks are offered in the process and no time constraints are placed on subjects to complete the questionnaires . The database had to be accessible by subjects for entry but not for look - up, and specific layouts needed to remain inaccessible to some team members while accessible to others (eg, demographic and diagnostic information needed to be blinded to the investigator to eliminate bias). Using the filemaker server and database platform in cooperation with university hospitals information technology and solutions allowed the authors to design a database with all of these features, which may well be useful for other similar studies in the future . This level of sophistication though required the fulltime effort of a data manager for 3 years . As with all studies on pelvic pain, recruitment presents a challenge . In an effort to maintain study awareness, the pi, co - pi, and project manager visited each of the investigators to encourage active participation . Investigators are invited to annual advisory board meetings to encourage a shared sense of academic participation and monthly phone conferences were conducted . Advertisements were placed on several research subject recruitment websites and patient support organizations (as outlined in the methods section). Recruitment returns from the effort at the subject level far exceeded those from efforts at the investigator and provider level . Recurrent communication with eight interested providers and potential collaborators from neighboring institutions resulted in few referrals . In contrast, promoting icepac study information to patient support groups, both regional and national, resulted in higher enrollment than referrals alone . The study utilizes the autonomic laboratory and clinic rooms for subject examinations that are also employed by patients for neurology and urology clinics . Coordinating open times requires negotiation and reminders to hospital administration of the importance of the study in fostering clinical referrals . However, every effort is made to maintain an excellent working relationship with clinic staff and faculty, which results in excellent cooperation . When hospital staff turnover occurs, renewed educational efforts help replacement staff get up to speed on the study . Icepac has been designed to allow careful phenotyping of subjects, which affords the novel identification of potentially important patient subgroups . The study is exploratory in nature, collecting a broad and comprehensive array of data, and its conclusions should generate specific, testable hypotheses that form the basis for future studies . Moreover, icepac can be seen as a template for the study of other complex pain phenomena, such as gastrointestinal and other visceral and nonvisceral referred pain . As of december 2012, data collection has been completed for 25 healthy controls, 33 ic / bps mpp, eight mpp, and three family members . Initially, the pi and co - pi were the main source of referrals, but this pattern was not sustainable once clinic populations were exhausted . Efforts at maintaining contact with investigators to encourage referrals have led to gradual referral growth across a broader group of referrers . Study investigators are kept up - to - date on study progress through an icepac investigator newsletter, which also serves as a reminder to refer . To date, the only adverse events have been associated with the bupivacaine instillation procedure . As a result, the investigators, guided by the icepac data safety monitoring board adopted a smaller, pediatric hydrophilic catheter and, since then, no further adverse events of any type have been reported . Studies involving chronic pain disorders such as ic / bps pose two very specific challenges . First, in the current era, most successful clinical translational studies on disorders involving chronic pain are interdisciplinary in design, requiring significant education, cross - training, and front - end work for the team to be successful . In fact, the national institutes of health (bethesda, md, usa) is currently funding much of the work on ic / bps through the multidisciplinary approach to the study of chronic pelvic pain (mapp) multisite network . Second, these populations have been difficult to recruit in large numbers.20 the purpose here is to present an approach to both of these challenges for the benefit of others who are performing related studies and spell out which strategies were and were not successful . The original proposal arose from a collaboration funded by the interstitial cystitis association of america between dr buffington and dr chelimsky on the familial characteristics of ic / bps and an interdisciplinary team seeing pelvic pain patients together in a clinic setting, with a set of questions regarding these patients . Disagreements on methods (eg, the best way to examine the pelvic floor musculature) were incorporated as questions to be answered by the grant . Thus, this study is noteworthy for its true interdisciplinary nature, from conception to implementation, and there was strong investment in the grant by the research team . Although such a process takes longer, the authors believe the design quality was higher, and the scientific questions posed were more clinically relevant . The board reflects the interdisciplinary composition nature of the research team and is comprised of a psychophysiologist with expertise in heart rate variability and stress responses, a pelvic pain neurologist, an urologist, a gynecologist specializing in pelvic pain and detailed vulvar examinations, a psychiatrist, and a sleep specialist . The board provided refinements to the study and helped validate that the project was capable of addressing important questions with an adequately sophisticated design . A simple issue pertained to the practicality of scheduling meetings for 20 busy surgeons and clinicians . This was initially addressed by scheduling monthly conference calls at an optimal time with topical discussions that were highly relevant and intellectually stimulating . An investigator newsletter was implemented as a means of maintaining investigator engagement and transparent communication . The collaboration of disciplines that usually do not understand each other s technical terms required significant education, with an initially steep learning curve . Cross - disciplinary training for standardization of pelvic floor, neurologic, and urologic examinations conducted during study visits was completed by each investigator . This was a highly rewarding process for investigators from varied disciplines, resulting in novel questions on each area driven by an entirely fresh perspective . Another set of challenges arose from sheer study size . A protocol comprised of multiple investigators from different departments and medical centers required multiple revisions in order to obtain institutional review board approval . Urologists and gynecologists have different views on methodology and the relative importance of different portions of the examinations . It took several months of re - evaluations and standardization to obtain a final protocol, a feat not possible without the guidance and expertise of the icepac study advisory board members . The number of investigators, of whom consensus was required, slowed attempts to modify the study . Exploration of new ideas or protocol modifications, such as assessment of sleep pattern and sleep disorder causality or measurement of stress and tight junction related cytokines in serum in subjects undergoing the trier social stress test, require more discussion and take longer to implement . As a result, however, the design is more likely to be embraced by specialists in diverse areas of medicine (eg, urologists, gynecologists). The number of physicians trained to perform study visits (which was the only way to recruit the large number of subjects proposed) required particular attention to investigator training (described in methods) and protocol standardization . To this end, attention was paid to protocol scripts, and most of these were designed to be read and controlled by the ra rather than the investigator, which minimizes protocol variability . For example, semi - quantitative tuning forks29 (us neurologicals llc, poulsbo, wa, usa) for the assessment of vibration sensation were introduced, the temperature of the hot water stimulus was standardized to 115f, and a digital algometer (model fdix 10; wagner instruments) to standardize the force used to assess pin sensation to 0.55 n (about 2 oz) were implemented as part of standard operating procedure . Selection of the psychological questionnaires required great care, ensuring that appropriate psychological constructs were evaluated while simultaneously limiting the time requirement burden on subjects and reducing the impact on statistical power of the number of variables employed . After extensive discussion and consideration of alternatives, the advisory board ultimately supported the selection of psychological proposed instruments . The psychological questionnaire set includes 313 questions and the odysa either 158 or 330 questions, depending on the subject s symptomatic history . Though all subjects have completed the question set to date, a small number of subjects have expressed concern about questionnaire time burden . Breaks are offered in the process and no time constraints are placed on subjects to complete the questionnaires . The database presented some informatics challenges . With current privacy regulations and concerns, the database had to be accessible by subjects for entry but not for look - up, and specific layouts needed to remain inaccessible to some team members while accessible to others (eg, demographic and diagnostic information needed to be blinded to the investigator to eliminate bias). Using the filemaker server and database platform in cooperation with university hospitals information technology and solutions allowed the authors to design a database with all of these features, which may well be useful for other similar studies in the future . This level of sophistication though required the fulltime effort of a data manager for 3 years . As with all studies on pelvic pain, recruitment presents a challenge . In an effort to maintain study awareness, the pi, co - pi, and project manager visited each of the investigators to encourage active participation investigators are invited to annual advisory board meetings to encourage a shared sense of academic participation and monthly phone conferences were conducted . Advertisements were placed on several research subject recruitment websites and patient support organizations (as outlined in the methods section). Recruitment returns from the effort at the subject level far exceeded those from efforts at the investigator and provider level . Recurrent communication with eight interested providers and potential collaborators from neighboring institutions resulted in few referrals . In contrast, promoting icepac study information to patient support groups, both regional and national, resulted in higher enrollment than referrals alone . The study utilizes the autonomic laboratory and clinic rooms for subject examinations that are also employed by patients for neurology and urology clinics . Coordinating open times requires negotiation and reminders to hospital administration of the importance of the study in fostering clinical referrals . However, every effort is made to maintain an excellent working relationship with clinic staff and faculty, which results in excellent cooperation . When hospital staff turnover occurs, renewed educational efforts help replacement staff get up to speed on the study . Icepac has been designed to allow careful phenotyping of subjects, which affords the novel identification of potentially important patient subgroups . The study is exploratory in nature, collecting a broad and comprehensive array of data, and its conclusions should generate specific, testable hypotheses that form the basis for future studies . Moreover, icepac can be seen as a template for the study of other complex pain phenomena, such as gastrointestinal and other visceral and nonvisceral referred pain . The icepac study represents a comprehensive, interdisciplinary approach to understanding the autonomic and psychophysiologic characteristics of ic / bps . The study has proven feasible to date, although it is too early to report findings . The major obstacles have been by - products of the different perspectives and areas of expertise that a diverse group of investigators has brought, which, interestingly has also been one of the study s greatest strengths . That is, as perspectives have been shared and a common approach has been forged, each specialty has benefited by the input of the others . The investigators are hopeful that the findings of the icepac study will reflect the strength of this collaborative process.
Noise in schools deserves special attention, as appropriate learning situations depend on good acoustic conditions . Established by the brazilian association of technical standards (abnt), the standard nbr 10152 recommends that noise levels in schools should not exceed 50 db sound pressure level (spl) and remain below that of the human voice, which is 60 db (spl) at normal intensity1 . In the school environment, children are exposed to several types of noise, such as external noise, environmental noise, and noise generated in the classroom . Previous studies have shown that in children, noise impairs the academic performance related to memory, motivation, and reading ability2 . Thus, in this environment, students can develop difficulties in writing, reading, and maintaining attention and concentration, which can result in disciplinary problems2 . The presence of noise in the communication process often causes difficulties in speech perception and high levels of stress, even in people with normal hearing3 . Researchers have demonstrated that children are the most affected by background noise both in speech perception and in auditory comprehension4 . With this knowledge of the effects of noise on the learning process, it becomes necessary to measure the noise levels in the school environment in order to investigate the factors that may interfere with this process and propose educational and/or environmental modifications to minimize these adverse effects5 . High levels of background noise are common in the natural environment of children, and are a major contributing factor to learning problems . A study developed in kindergartens and schools demonstrated that children's voices produce considerable noise levels . Over an 8-hour period, the authors recorded average noise levels of 80.1 db (a) near the teacher's ear and 70.87 db (a) in the classroom . The maximum noise level near the teacher's ear was 112.55 db (a) and that in the classroom was 103.77 db (a)7 . Thus, the aim of this study was to evaluate the spl to which students are exposed in a municipal preschool . This study was conducted in a municipal preschool located in a suburb of the city of marlia, whose population is of low socioeconomic status . The project was first presented to the municipal secretary of education, and after receiving approval, it was carried out at the school that had agreed to the study . Are 4 classrooms, the principal's office, library, toilets and bathroons and courtyard; there is a covered court and a cafeteria on the second block . The classrooms are constructed from concrete blocks, have ceramic - tiled floors, padded ceilings, iron doors that open to the outside, and wooden doors that open to the inner courtyard; 2 rooms face the street and the other 2 face the park . The cafeteria walls are made of concrete blocks; it has a plastic ceiling with acoustic treatment and a ceramic - tiled floor . The school furniture consists of iron cabinets, tables, and chairs with iron legs, and these do not occupy a fixed position in the school . The spl measurement was performed on 4 different days over a period of 8 hours per day, totaling 1920 minutes . The measurement was carried out in 2 classes that attended school in the integral period . On the first 2 days, we followed up the activities of 26 children who were 5 years of age (preschool ii), and on the other 2 days, we followed 28 children who were 4 years old (preschool i). An audiologist performed the measurements using an audio dosimeter, monitoring the children's activities at school . These activities were held in different parts of the school, and most took place outdoors (court and park). The equipment used for this study was an sv 102 svantek audio dosimeter; the device was calibrated and checked before the beginning of each measurement according to the technical specification . A and with a slow response in order to monitor low levels and continuous sounds in the environment studied according to the recommendations of regulatory standard-15 (nr-15)8 and the fundacentro standard of occupational hygiene (nho-01)9 . Measurements were obtained for the following parameters: maximum (lmax), minimum (lmin) and equivalent noise level (leq). The equipment was programmed to operate at nps intervals (spl) between 40 and 140 db . For the offsetting, we used the values proposed in the nr-15 and nho-018 9 . In brazil, 2 standards deal with the measurement of noise and its harmful effects; they were created to establish the criteria for occupational noise exposure . 1 the limit of tolerance for continuous or intermittent noise, and the other is the nho-01, which provides criteria for the assessment of personal exposure to noise that are more accurate but does not have legal authority9 . Neither standard specifies changes in measurement parameters and analysis based on an open or enclosed environment . One difference between the 2 standards is the recommended rate of duplicity: the nr-15 states that it is equal to 5 db, while the nho-01 states that it is equal to 3 db . We used these 2 standards in this study, articulated with that advocated in the abnt standard nbr 101521 . The results were analyzed using descriptive statistics based on the spl measurement parameters: lmax, lmin and leq . Complementary analysis was performed to compare the measured values (as related to both the nho-01 and nr-15) for preschool i and ii; the mann whitney test was used, the significance level was 5% (p <0.05), and the confidence interval was constructed with 95% statistical confidence . There were differences in the spls measured according to the 2 standards . The noise intensity measured at the school ranged between 40.6 db (a) and 105.8 db (a) on the nr-15 and between 40.6 db (a) and 116.6 db (a) on the nho-01 (table 1). Legend: max - maximum; min - minimum; leq - equivalent noise level . When we analyzed table 1, it showed that according to the nr-15, leq was 73.9 db (a) and 75.5 db (a) in preschool i, and 76.1 db (a) and 82.1 db (a) in preschool ii . In this sample, the band intensity of a higher recurrence of spl was 5355 db (a) and 6580 db (a) in preschool i and 5357 db (a) and 7185 db (a) in preschool ii (figure 1); the mann whitney test used to compare the standards determined that there were no statistically significant differences (nr-15, p = 0.427; nho-01, p = 0.186). This suggests that despite the older children producing a higher spl than the younger children, quantitative analysis determined that this difference was not significant . The frequency spectrum of the spl measured in the octave bands was concentrated in the frequency range between 500 hz and 4000 hz (figure 2). Distribution of the sound pressure level measured at preschool i and ii according to frequency spectrum (octave bands). The activities performed by preschool i (chart 1) were related to the spl measurement (figure 3) during the 8-hour period . The spl varied according to the activity: painting and writing were quieter activities and free activities and games were noisiest; these activities were carried out in the classroom . The only time the spl was within the standards was during the childres nap time . The results demonstrated that most of the time, the noise level at school is higher than that recommended by the abnt and the world health organization1 10 . A study conducted in a school showed that the noise levels measured in the classrooms and the school yard were the same as that caused by heavy traffic, race cars, and subway trains, ranging from 80 db to 110 db10, and this shows that the measurements obtained in this study are not appropriate for the school environment, the physical and mental health of children in this learning phase, and for other school professionals11 . In this study, the average spl, determined from 4 days' measurement, was 73.9 db (a) and 75.5 db (a) in preschool i and 76.1 db (a) and 82.1 db (a) in preschool ii; these results are similar to those found in the literature . In other studies involving schools, the spls in classrooms ranged 4975 db (a), 59.571.3 db (a), 5987 db (a), and 71.196.2 db (a)12 13 14 15 . In daycare centers and schools, children's voices produce considerable levels of noise; the equivalent noise levels (leq) measured over 8 hours were 80.1 db (a) near the teachers' ears and 70.87 db (a) in the classroom . The lmax was 112.55 db (a) near the teachers' ears and 103.77 db (a) in the classroom7 . A study that measured the influence of external noise in an empty classroom obtained a leq of 56.2 db (a) when there was activity in only one classroom in the school and 63.3 db (a) when activity was carried out in another 3 classrooms16 . This difference in spls observed in the literature can be explained by the influence of different factors, such as equipment position, the number of children in the classroom and/or activity, type of activity performed, the environment acoustic characteristics, and school location . The noise levels in schools should not exceed 50 db (spl), remaining below the human voice, which is 60 db (spl) at normal intensity1 . Measurements in the classroom demonstrated that excessive noise is a more relevant issue than the poor acoustics of the room, and the levels of environmental noise are almost always higher than the 35 db (a) recommended by the abnt, even in empty rooms1 . The spl measured at the school in octave band was concentrated in the frequency range between 500 hz and 4000 hz, the frequencies that favor speech perception . This finding suggests the interference of spl in the understanding of speech due to the signal - to - noise ratio . Several studies have indicated that the contribution to the intelligibility of speech is specific to certain frequency bands, and speech sounds consist of low and high frequencies that vary continuously in intensity17 . For sounds below 500 hz, there is a concentration of 60% of the energy; however, only 5% contributes to speech intelligibility . At frequencies of 5001000 hz, the energy and intelligibility are around 35%, and finally, at frequencies above 1000 hz, only 5% of the acoustic energy is responsible for 60% of the intelligibility and information18 . Research has shown that children are the most affected by background noise, either in speech perception or in listening4 . Regarding the recommendations for noise in schools, we observe that concern has increased because noise from internal sources (conversations, furniture, and equipment) and external sources (traffic, movement of people, and proximity to urban centers) has increased . Thus, the teaching learning process suffers interference, as the environment does not favor concentration and understanding of speech19 . In this study, the spls in the classroom reached values above 80 db (a) according to the activity performed, where painting and writing were the quietest activities . During free activities periods and games that took place on the covered court and playground, the spl exceeded 90 db (a), and these were the noisiest activities in this sample . These findings contradict the recommendations endorsing the classroom - tolerated limit of 4050 db1 . In the literature, studies have reported that the spl depended on the activity performed in the classroom12 20 21 . In elementary schools, the noise levels measured were 44 db (a) when the children were silent, 56 db (a) when they were carrying out some activity in silence (silent reading), 65 db (a) when they were carrying out individual work in a noisy environment (conversation), and 7077 db (a) when group work was being done20 21 . Students' activities are a dominant source of noise in the classroom, even when they are quiet and well behaved . In this environment, any activity can increase the noise level by 510 db (a)19 . A recent study measured noise during recess, demonstrating that the noise was excessive during both periods (morning and afternoon), reaching maximum values of 88.7 db (a) in the morning and 102 db (a) in the afternoon15 . The authors stated that these peaks are caused by the objects falling or being used, furniture being moved, or students shouting . The peaks interrupted the teacher's activity and the student group lost its focus19 . In this study, the children of preschool ii, aged between 5 and 6 years, produced a higher level of noise than the younger children did . It has been reported that kindergarten rooms frequented by children aged 5 years were noisier than rooms frequented by high school students22 . We used 2 different standards (nr-15 and nho-01) to analyze the results and observed differences in the measurements obtained, and these differences were justified by the parameters used, for example, the duplicity rate of the dose . It is worth mentioning that the rules that deal with noise measurement and its harmful effects were created to establish criteria for occupational noise exposure . However, as there are no specific rules in brazil for noise measurement in schools, we decided to use these standards1 . The criteria established by the nho-01 are based on modern concepts and scientific and technical parameters, follow current international trends, but without the commitment of equivalence with the legal criteria . Thus, the results obtained and their interpretation when applying this standard may differ from those compared against the nr-15 . When we consider the high spls found in schools and their negative impact in this environment, it is essential to implement actions that aim to minimize this disadvantage . It is important to remember that a good acoustic design ensures efficient distribution of the desirable sounds, as well as the exclusion of unwanted noise (noise from the roof, floor, ceiling, and walls)23 . The high level of noise in the school environment was reported as a disturbing finding in a study because it impairs the academic activities of students . This problem goes beyond the perception of the discomfort caused by noise: it demands reflection about the physical layout of the school environment, classroom acoustics, and student and staff awareness of the noise generated at school24 . Researchers have stated that noise should be considered a risk factor in the school environment . Once the acceptable noise levels for classrooms are exceeded, it is necessary to reduce them within the legal and medical scope . Smaller classes built with acoustic materials and suitable furniture could be examples of immediate actions14 . Changes in students' attitudes, such as behavior in the classroom, will affect the noise level . A reduced noise level combined with treatment for the acoustic environment would produce a significant beneficial effect19 . The spls measured at the school were higher and exceeded the maximum permitted level according to the reference standards . Therefore, the implementation of actions that aim to minimize the negative impact of noise in this environment thus becomes essential.
Chronic periodontitis is an inflammatory disease initiated by microbial pathogens that elicit a host immune response with subsequent loss of connective tissue attachment and supporting alveolar bone . Although bacteria are the causal agents of periodontitis, individual susceptibility to disease may be influenced by systemic factors . Recently, estrogen deficiency has received increasing attention in relation to susceptibility to chronic periodontitis in postmenopausal women . The production of estrogens changes drastically at menopause, leading to osteoporosis in skeletal bones, characterized by the loss of bone mass and reduction of bone density, and with a consequent increase in bone fragility and susceptibility to fracture . Total skeletal mass reduction in postmenopausal women may include jawbones, particularly the mandible [69]. A number of studies have shown that bone changes in osteoporosis are associated with loss of periodontal attachment, loss of teeth, and height of residual ridge [1015]. Based on these findings, it has been hypothesized that osteoporosis may be a risk factor for the progression of periodontitis . Both osteoporosis and periodontitis, in fact, are bone resorptive diseases sharing common etiologic agents / risk factor (e.g., sex, cigarette smoking, alcohol consumption, systemic diseases, heredity) that may either affect or modulate the process of both diseases . In the past decade hrt was recognized as an effective treatment of menopausal signs and symptoms [1619]. This therapy leads to a reduction of bone mass loss, and therefore has a significant role in the primary and secondary prevention of postmenopausal osteoporosis [2022]. It has also been suggested that hrt may be beneficial in optimizing periodontal status in postmenopausal women . Some clinical studies showed that hrt had a positive effect on alveolar bone density and tooth retention [11,2529]. Similarly, estrogen administration in rats was found to prevent alveolar bone loss resulting from an estrogen - deficient state . Periodontal health in postmenopausal women taking hrt, however, has been addressed only in a limited number of studies . It has been reported that women treated with hrt exhibited lower gingival bleeding than estrogen deficient women, but conflicting results were found when the effects of hrt on attachment level and pocket depth were determined . The aims of this cross - sectional study were to assess the periodontal status of a group of postmenopausal women receiving hrt, and to evaluate the association between hrt and clinical measures of periodontal disease including attachment level, pocket depth and gingival bleeding . A total of 91 caucasian postmenopausal women, being at least 5 years past their last menstrual period (age range 50 to 62 years; mean agesd: 55.123.81), volunteered to participate in this clinical study . The women enrolled in the study were selected from a pool of 195 subjects attending the obstetrics and gynecology unit of the university of palermo medical center (palermo, italy) on the basis of the following criteria: being dentate with at least 9 natural teeth in the posterior sites (with the exclusion of third molars); having no history of early menopause (ie, occurring before age 45 years); having no cancer or active or chronic parathyroid diseases; and having no pharmacological history of steroidal or non - steroidal anti - inflammatory drug use or use of immunosuppressants . Subjects who were current smokers and those who had a surgically- or chemically - induced menopause no woman included in the study had received periodontal therapy and/or used antimicrobial mouthrinses in the preceding 6 months . Screening and selection of volunteers were carried out by a single investigator who explained the study and obtained witnessed and signed consent to participate . The study was performed between october 2005 and september 2008 at the department of oral sciences, university of palermo . The study design was approved by the local ethics committee and was found to conform to the requirements of the declaration of helsinki as adopted by the 18th world medical assembly in 1964 and subsequently revised . Women who reported current hrt supplementation (n=52) for at least 5 years were assigned to the hrt + group . The control group (hrt) (n=39) consisted of the remaining women . The mean age for both groups was similar, 55.673.36 (range 5062 years) for hrt+ group, and 54.384.26 (range 5062 years) for the control group . The following oral health variables were measured: plaque index (pi), recorded on 4 sites in each tooth (mesiobuccal, mid - buccal, distobuccal, mid - lingual); bleeding on probing (bop), recorded on 4 sites in each tooth (mesiobuccal, mid - buccal, distobuccal, mid - lingual); probing depth (pd) and clinical attachment level (cal) recorded on 6 sites in each tooth (mesiobuccal, mid - buccal, distobuccal, mesiolingual, mid - lingual and distolingual). Pd was measured from the free gingival margin (mg) to the base of the pocket . For cal assessment, according to ramfjord s technique, probing depth from the free gingival margin to the base of the pocket was measured; the distance from the gingival margin and the cemento - enamel junction (cej) was also recorded . The following considerations were observed when measuring cal: 1) calculus that obscured the cej or interfered with the correct placement of the probe was removed with a curette; 2) when the margin of restoration was apical to the cej, the position of cej was estimated using adjacent landmarks and dental anatomy; 3) when the cej could not be estimated, the examiner excluded the site; 4) when the natural tooth was missing, the site was excluded; 5) partially erupted teeth and root tips were excluded . Assuming a=0.05, the present design ensured a 93.6% chance of detecting a difference of 0.5 at a standard deviation of 0.67 . The data were analyzed for normality of distribution through the use of the kolmogorov - smirnov test . Since the data were normally distributed, an unpaired t - test was performed to determine differences in pi, pd and cal between the hrt+ group and the hrt (control) group . Analysis of covariance (ancova) was performed to further assess differences in bop while adjusting for relationship detected by the initial analyses . A total of 91 caucasian postmenopausal women, being at least 5 years past their last menstrual period (age range 50 to 62 years; mean agesd: 55.123.81), volunteered to participate in this clinical study . The women enrolled in the study were selected from a pool of 195 subjects attending the obstetrics and gynecology unit of the university of palermo medical center (palermo, italy) on the basis of the following criteria: being dentate with at least 9 natural teeth in the posterior sites (with the exclusion of third molars); having no history of early menopause (ie, occurring before age 45 years); having no cancer or active or chronic parathyroid diseases; and having no pharmacological history of steroidal or non - steroidal anti - inflammatory drug use or use of immunosuppressants . Subjects who were current smokers and those who had a surgically- or chemically - induced menopause no woman included in the study had received periodontal therapy and/or used antimicrobial mouthrinses in the preceding 6 months . Screening and selection of volunteers were carried out by a single investigator who explained the study and obtained witnessed and signed consent to participate . The study was performed between october 2005 and september 2008 at the department of oral sciences, university of palermo . The study design was approved by the local ethics committee and was found to conform to the requirements of the declaration of helsinki as adopted by the 18th world medical assembly in 1964 and subsequently revised . Women who reported current hrt supplementation (n=52) for at least 5 years were assigned to the hrt + group . The control group (hrt) (n=39) consisted of the remaining women . The mean age for both groups was similar, 55.673.36 (range 5062 years) for hrt+ group, and 54.384.26 (range 5062 years) for the control group . The following oral health variables were measured: plaque index (pi), recorded on 4 sites in each tooth (mesiobuccal, mid - buccal, distobuccal, mid - lingual); bleeding on probing (bop), recorded on 4 sites in each tooth (mesiobuccal, mid - buccal, distobuccal, mid - lingual); probing depth (pd) and clinical attachment level (cal) recorded on 6 sites in each tooth (mesiobuccal, mid - buccal, distobuccal, mesiolingual, mid - lingual and distolingual). Pd was measured from the free gingival margin (mg) to the base of the pocket . For cal assessment, according to ramfjord s technique, probing depth from the free gingival margin to the base of the pocket was measured; the distance from the gingival margin and the cemento - enamel junction (cej) was also recorded . The following considerations were observed when measuring cal: 1) calculus that obscured the cej or interfered with the correct placement of the probe was removed with a curette; 2) when the margin of restoration was apical to the cej, the position of cej was estimated using adjacent landmarks and dental anatomy; 3) when the cej could not be estimated, the examiner excluded the site; 4) when the natural tooth was missing, the site was excluded; 5) partially erupted teeth and root tips were excluded . Assuming a=0.05, the present design ensured a 93.6% chance of detecting a difference of 0.5 at a standard deviation of 0.67 . The data were analyzed for normality of distribution through the use of the kolmogorov - smirnov test . Since the data were normally distributed, an unpaired t - test was performed to determine differences in pi, pd and cal between the hrt+ group and the hrt (control) group . Analysis of covariance (ancova) was performed to further assess differences in bop while adjusting for relationship detected by the initial analyses . Mean pi, pd and cal for both hrt+ and hrt groups are shown in table 1 . Mean pi were significantly lower in hrt+ women than in hrt women (p<0.0001). Conversely, no significant differences were found for pd and cal between groups (p=0.8067 and p=0.1627, respectively). The percentage of gingival sites with positive bop was significantly lower in the hrt+ group compared to the control group (34.85% vs. 65.15%; p=0.0007) (table 1). Plaque accumulation was tested in ancova as a possible explanatory variable for the differences observed in gingival bleeding . The ancova showed that this covariate was significantly different between groups (p<0.0001) (data not shown). After the effect adjustments, no significant differences in gingival bleeding were found between hrt+ and hrt women (p=0.4677) (data not shown). No significant differences in women who smoked and those who used oral contraceptives were detected between hrt+ and hrt subjects (p=0.9999 and p=0.0845, respectively) (data not shown). The physiological changes associated with menopause can cause some women to experience uncomfortable symptoms such as hot flashes and night sweats, vaginal dryness and dyspareunia, disturbed sleep and irritability / depression . Moreover, estrogen deficiency arising from menopause, in association with age - related factors, has been shown to increase the risk of developing cardiovascular disease, including coronary heart disease and stroke, colorectal cancer and osteoporosis . Until recently, hrt was considered the single most effective treatment of menopausal symptoms and its use after the publication of the women s health initiative (whi) findings in 2002 and 2004, the use of hrt at menopause has become a matter of debate and its utility has been questioned . Recent analyses of the whi data and other randomized controlled trials, however, have suggested that the potential risks involved in taking hrt (increased risk of breast cancer, cardiovascular outcomes and stroke) may largely depend on the estrogen and progesterone / progestin formulation, dosage, mode of administration, patient s age, associated diseases, and duration of treatment [1618,4246]. Therefore, based on the current evidence, the intention, dose and regimen of hrt need to be individualized, based on the principle of choosing the lowest appropriate dose in relation to the severity of symptoms and age at onset of menopause . For early postmenopausal women, hrt may be the most effective treatment available for vasomotor and urinary / genital symptoms, and may be still considered a good therapeutic choice to prevent osteoporosis and cardiovascular risk [1618,20,46,47]. Moreover, the current evidence supports the use of hrt in women at the beginning of menopause and suffering from heard - to - bear vasomotor symptoms and disturbed sleep . In past years, various studies have been conducted to evaluate the effect of hrt in modifying the periodontal conditions in postmenopausal women due to a possible connection between osteoporosis and the progression or severity of periodontitis [2325,27,32,33]. Hrt was associated with a reduction of alveolar bone loss, but a number of studies failed to find an inverse correlation between alveolar bone density and severity of periodontal disease [4851]. Furthermore, some authors failed to demonstrate any beneficial effect of hrt on alveolar bone density / height . It has been suggested that estrogen may have an inhibitory effect on gingival inflammation by inhibiting mediators (il-1, tnf-, il-6, il-1, il-8) and cellular mechanism of inflammation (pmn recruitment, lymphocyte activation) [5457]. Similarly, estrogen supplementation may modulate the rate of breakdown of periodontal tissue through a mechanism involving down - regulation of matrix metalloproteinases (mmp-8 and mmp-13) and cytokines involved in bone resorption [4,5759]. Conflicting results exist on the effects of hrt on probing pocket depth and attachment level . Furthermore, the risk of tooth loss was found to be lower in women who used hrt than those who did not . Tooth loss, however, could not be used as a surrogate evaluation for periodontal disease, since reasons for tooth loss could include caries or trauma . Moreover, the extent of periodontal destruction around the remaining teeth was not taken into account in this analysis . The aim of this study was to evaluate the periodontal status of postmenopausal women and to determine the effect of hrt on standard clinical measurements of periodontal disease . In the present study, hrt+ women had lower inflammatory gingival scores than hrt women, as indicated by the lower percentage of bleeding sites (p=0.0007). The level of supragingival plaque accumulation was found to be significantly lower in hrt+ women than in hrt women (p<0.0001). To account for factors that are known to be associated with gingivitis, it was of great importance to adjust for the difference in plaque level in the final analysis between groups . The findings of initial statistical analysis were not confirmed after correcting for plaque accumulation by those women on hrt having less gingival bleeding (ancova, p=0.4677). Women taking hrt had fewer bleeding sites than did hrt women, but this finding may be related to the lower level of supragingival plaque than to the effect of hrt . These results are in contrast with previous reports linking the use of hrt with the reduction of bleeding sites . In those studies, the percent of gingival sites with bleeding was significantly lower in hrt+ women compared to hrt women, despite the levels of plaque accumulation . Cal is an important measure of periodontitis progression because of its relationship with alveolar bone loss . Due to the known beneficial effects of hrt on osteoporosis, it may be expected to significantly lower values for cal in the hrt+ group . Ronderos et al . Found the mean cal differences observed between postmenopausal females who reported the use of estrogen supplementation for more than 5 years and those who never used estrogens were significant, although quite small (1.74 vs. 1.56). Other previous studies reported lower values of cal in women using hrt, but the difference found between hrt+ and hrt patients was not significant . In the present study, no significant difference was detected in the mean pd between the 2 groups of women . This finding is in agreement with previous studies, with the exception of the study by lopez marcos et al ., who evaluated the differences in pd values between hrt+ and hrt groups at the beginning of the therapy and then revaluated over 6 months to 1 year after the beginning of the hrt . Lopez marcos et al . Reported the pd variable for patients not receiving hrt evolved to worse stages, whereas patients receiving hrt showed a significant improvement in pd . It must be noted, however, that these results cannot be compared with those of the present study because of the different study designs . Moreover, in the study of lopez marcos et al ., cal was not assessed and other clinical measures of periodontitis (dental pain of periodontal origin, gingival recessions) did not show significant improvement in the hrt+ group . Thus, the decrease of pd values in patients receiving hrt could be related to the reduction of gingival inflammation due to the estrogen action rather than to an effective gain of attachment . The findings of the present study indicate that, in postmenopausal women, long - term hrt was not associated with significant effects on periodontal status and clinical measures of periodontitis, thus suggesting that hrt may not confer protection against periodontitis . Periodontitis may be primarily related to the presence of plaque and to a lesser extent to hormonal changes such as estrogen deficiency . However, the possibility exists that the decreased estrogen levels associated with the postmenopausal period may contribute to the progression of periodontal disease by affecting the oral bone mass [3,1012,15,23,28,50]. Thus, postmenopausal women with periodontal disease should undergo periodical screening examinations in order to detect changes in their periodontal status and support them with periodontal treatment.
Pars plana vitrectomy (ppv) is a proven and basically safe procedure with a low incidence of complications [1, 2]. However, serious adverse events can and do occur, the most serious complications being endophthalmitis, hemorrhages and nonarteritic anterior ischemic optic neuropathy (naion), a potentially blinding condition . An investigation in a random sample of 5% of the american medicare beneficiaries over a period of 12 years (19942005) yielded an incidence of approximately 7% for postprocedural blindness after ppv without an appreciable trend over time . Whereas endophthalmitis is widely considered and investigated in the literature concerning post - ppv complications [1, 2, 3], the incidence of postprocedural loss of vision due to naion appears to be somewhat underreported . Following the concept of vascular occlusion as a key factor in sudden blindness, the conventional mainstay for the treatment of postsurgical loss of vision is the systemic administration of corticosteroids and anticoagulants, e.g. Acetylsalicylic acid [6, 7, 8]. However, there is no generally accepted, well - proven treatment for naion currently . In the past decade, a number of novel protein - based direct thrombin inhibitors became available for the treatment of diseases associated with undesired blood clotting . One of those agents is dabigatran etexilate, presently approved for the prophylaxis of venous thrombosis after hip or knee arthroplasty and stroke in patients with atrial fibrillation . After all conventional methods of reversing the visual loss in our patient had failed, we resorted to a therapeutic trial of dabigatran etexilate, and the results are reported here . A 46-year - old caucasian female underwent ppv of the right eye with endolaser treatment and c2f6 (hexafluoroethane) gas tamponade as per the current guidelines for retinal detachment . After the procedure, the vision of the treated eye was practically lost, and the patient was only able to distinguish hand movements . The afferent pupillary defect (apd) was positive, and perimetry revealed a severe loss of the visual field (fig . The administration of a conventional therapeutic regimen [consisting of prednisolone (100 mg / day for 3 days, 80 mg / day for 3 days, 60 mg / day for 3 days, 40 mg / day for 3 days, and 20 mg / day for 3 days) and acetylsalicylic acid (100 mg)] improved visual acuity only marginally to logmar 1,4 (fig . 3) with positive apd . Since pronounced corticosteroid side effects (sleeplessness, facial edema, restlessness, sweating and tachycardia) burdened the patient and the treatment showed practically no effect, we decided to try to improve her vision with the administration of dabigatran etexilate (2 110 mg), a novel direct thrombin inhibitor, 24 days after the initiation of the prednisolone / acetylsalicylic acid treatment . Promptly after the first administration, visual acuity improved to logmar 1,0 and continued to improve to logmar 0,4 (fig . Perimetry done 26 days afterwards showed a marked improvement in central sensitivity from 7 to 25 and 21 db, respectively; the nasal part of the visual field also showed an increase in sensitivity (fig . Strictly speaking, the diagnosis of naion requires the exclusion of arteritic alterations, usually by temporal artery biopsy . However, a sudden loss of vision after ocular surgery without signs of retinal detachment or other intraocular alterations strongly suggest ischemic neuropathy, and tentative diagnosis and treatment are warranted . Since naion is not a disease as such but rather the common endpoint of a large number of local and systemic conditions, there is no established standard therapy . However, systemic corticosteroids in combination with anticoagulation to reduce swelling and improve venous blood flow are basically accepted modalities . When this approach failed in the present case, we resorted to the off - label administration of a novel direct thrombin inhibitor, resulting in a dramatic recovery of visual function . Naion is known to show spontaneous remission in approximately 40% of the cases, but this assumption notwithstanding, improvement of blood flow is an accepted measure whose indication to preserve or restore vision is undisputed . Therefore, the striking improvement of vision after the administration of dabigatran etexilate in the present case may warrant a systematic clinical trial of a combination of corticosteroids and dabigatran etexilate in comparison with (for instance) warfarin as is common practice under different indications for anticoagulation [12, 13, 14]. However, when ophthalmologists consider the administration of dabigatran etexilate for naion, certain peculiarities and disadvantages of the drug (such as the lack of an antidote [12, 15]) need to be borne in mind to avoid potential hazards.
Cigarette smoking is the most important preventable cause of mortality all over the world . Also, it is responsible for many non - communicable diseases such as cancers and cardiovascular diseases . Moreover, cigarette smoking is the cause of half of the death of those who smoke for a long time . In the year 2000, about 5 million adults died as a result of cigarette consumption (about 12% of total deaths in the year 2000). It is estimated that this rate reaches 8.3 million per year by the year 2030, which 70% of these deaths will occur in developing countries . According to the who estimation, there are about 1.3 billion smokers worldwide that comprise one third of the world population over the age of 15 years . If this pattern of smoking remains unchanged, this rate will reach 2 billion by the year 2030 . Meysamie a and colleagues reported that prevalence of cigarette smoking is 23.4% and 1.4% in iranian males and females, respectively . Teachers and other groups like clergymen who can be role models, play an important role in persuasion or prevention of cigarette smoking among the youth . Also, as students will enter the society and play key roles such as physicians, engineers, and teachers and so on; studying their smoking behaviors is very important . Therefore, students are also role model for the younger, as well as being a representative of youth in the population . The rate and tendency toward smoking among students has increased as shown by several studies . For example, a national survey in the us demonstrated that during a 5-year period, the rate of smoking among students increased from 22% to 29% . Also, a study in iran found similar results showing that 5% of the female students in medical schools who were non - smokers in their first year of study became cigarette users in their seventh year of education . These rates among male students were 2% in the first and dramatically increased to 34% in the seventh year . Heydari et al . Also showed that prevalence of smoking was significantly higher in students in their last year of study compared with whom in the first year . In addition, several studies have demonstrated that prevalence of smoking was higher among students who had smoker teachers compared to those who had non - smoker . These imply the importance of study of prevalence of smoking in these groups and also their knowledge, attitude and practice on the matter . Since the clergymen in any religion are one of the most influential groups in the society, study of their smoking habits has been of interest and several studies looked at the prevalence of smoking in this group . For example, a study on buddhist monks demonstrated that prevalence of daily smoking was 12%, which was lower than general population . This study also showed that buddhist monks with no history of smoking had a better knowledge and attitude towards the hazards of smoking . However, there is no study about smoking status of clergymen in islamic countries including iran . The aim of this study is to estimate and compare the prevalence of smoking in 3 groups of male teachers, clergymen and university students and also their knowledge, attitude and prediction of future smoking . This is the first study in iran, which compares not only the prevalence of smoking but also evaluates knowledge, attitude and their future prediction of smoking and investigates inter - relationship in these 3 groups . University students, clergymen and teachers were studied in tehran, iran during 2009 . In this cross sectional study, the knowledge, attitude towards tobacco consumption and their prediction of smoking in the next 5 years of participants were asked by questionnaire . Since the understudy clergymen were all males, only males first, tehran islamic religious school and shahid beheshti university were randomly selected from the corresponding lists . Then, four medical and randomly four non medical faculties from the shahid beheshti university were selected . One class per grade (from grade 1 to 4) was also randomly selected in these faculties . Besides, in tehran islamic religious school one class per grade (from grade 1 to 5) was also selected randomly . The students and clergymen were all 18 - 25 years old . In each class, after explaining the aim of the study and also the confidentiality, all the students were invited to participate in the study . Male teachers (20 - 29 years) who thought boys in middle schools in tehran were also randomly selected . First, from the list of districts provided by the ministry of education and training 5 districts randomly selected . Third, in each school, on average, about 10 teachers were randomly selected . For calculation of the required number of subjects in each of 3 groups, the formula for sample size calculation for proportion was used . Considering p = 50%, = 0.05 and precision of 0.05, a minimum sample size of 385 was computed for each group . A total of 1,271 university students were enrolled (765 medical and 506 non - medical). Also, 549 clergymen and 551 teachers were randomly studied . Therefore, in all 3 groups, we examined a larger population than the calculated required number, which generally can increase the power and precision of the analysis . To examine knowledge and smoking status of the study subjects, a self - report questionnaire was adapted from the standard questionnaire of the global adult tobacco survey . This questionnaire evaluates age of smoking initiation, place of birth, history of smoking (one with consumption of at least 100 cigarettes was defined as a smoker person), smoking status at present, also knowledge about tobacco consumption (including 4 general knowledge multiple choice questions with 4 options), attitude towards tobacco consumption (4 multiple choice questions with 5 options) and contains one question about the probability of tobacco consumption in the next 5 years, which is presented in details by heydari et al . Considering the subjects total scores of knowledge and attitude, the answers were categorized into 2 groups of poor / inappropriate (no correct answer) and moderate or good / appropriate (at least one correct answer). The answer to the question about probability of smoking in the next 5 years was divided into 2 groups of yes or no . Data was entered and analyzed using spss (11.5) and stata (11.0). Chi - squared test and logistic regression were used for comparison of smoking status, knowledge, attitude, and probability of smoking in the next 5 years among the 3 groups . In this study, 1,271 students, 549 clergymen, and 551 teachers were interviewed in tehran during 2009 . As table 1 shows, 395 (31.1%) of students, (95% ci: 28.5%-33.6%) had a history of smoking more than 100 cigarettes . This rate was 21.9% (95% ci: 18.3 - 25.3%) among clergymen and 27.2% (95% ci: 23.4%-30.9%) among teachers . As presented in this table, the highest prevalence was seen among students and the lowest among clergymen (p <0.0001). Logistic regression showed that prevalence of smoking was significantly higher among students and teachers than clergymen (p <0.0001 and p = 0.04). However, the 3.9% difference in prevalence of smoking between students and teachers was not found significant (p = 0.09). Also, among the 3 groups, there was borderline difference in age of smoking initiation (p = 0.06). Neither, such difference was detected in terms of successful quit attempts, occasional smoking and daily cigarette consumption (p = 0.99). No significant difference was found in the amount of daily smoking (less than 10 cigarettes, 11 - 20 cigarettes and more than 20 cigarettes) between the 3 groups (p = 0.64). Smoking status of male students, teachers and clergymen in tehran there was a significant difference between the understudy groups in terms of their knowledge, attitude and probability of smoking in the next 5 years (p <0.0001) as presented in table 2 . Also, table 2 shows, 61.9% (787) of students had poor knowledge; whereas, this rate was 38.8% (213) among clergymen and 42.1% (232) among teachers . Inappropriate attitude (tendency) towards smoking was observed in 23.1% (294) of students, 10.2% (56) of clergymen and 12.7% (70) of teachers . In addition, 11.9% (151) of students, 5.8% (32) of clergymen and 7.3% (40) of teachers predicted that they will smoke cigarette in the next 5 years . It worth mentioning that the knowledge, attitude, and probability of smoking in the next 5 years of two groups of medical and non - medical students were not statistically significant (p = 0.29; p = 0.28; p = 0.30; data not shown), respectively . This was the reason that we combined these two groups of the students for comparisons between 3 groups . Knowledge, attitude and prediction of smoking in the next 5 years among male students, teachers and clergymen in tehran table 3 shows the odds ratio of smoking initiation in the understudy groups based on their level of knowledge, and attitude . Odds ratio of smoking cigarette was not significant in students with poor knowledge (or = 1.2; 95% ci: 0.9 - 1.6). Whereas, odds ratio of smoking cigarette in clergymen (or = 3.1; 95% ci: 2.0 - 4.6) and teachers (or = 2.7; 95% ci: 1.9 - 4.0) with poor knowledge was significantly higher than those with moderate or good level of knowledge . Also, in all 3 groups, the odds ratio of smoking cigarette was higher among those with inappropriate attitude compared to those with appropriate attitude towards smoking . This chance was significantly more in clergymen than teachers and was the lowest amongst students (p = 0.01; table 3). Likelihood of smoking in the next 5 years of male students, teachers and clergymen based on their knowledge and attitude in tehran in addition, when examining the effect of current smoking status on the likelihood of smoking cigarette in the next 5 years, the corresponding odds ratios for students, clergymen and teachers were 1.4, (95% ci: 0.98 - 2.0), 4.0 (95% ci: 1.9 - 8.2) and 2.9 (95% ci: 1.5 - 5.6) respectively, which were significantly different (p = 0.0001). The results of study of association between knowledge, attitude and prediction of smoking in the next 5 in three groups are presented in table 4 . As shown in this table, 25.9% (204) of students with poor level of knowledge had also inappropriate attitude towards smoking cigarette; whereas, only 15% (32) of clergymen and 17.2% (40) of teachers with poor knowledge had this attitude (p <0.0001). Also, 7.8% (61) of students with poor knowledge predicted that they may smoke cigarette in the next 5 years, where these rates were 3.8% (8) and 4.3% (10) among clergymen and teachers, respectively (p in addition, it was found that 20.4% (60) of students with inappropriate attitude predicted that they may smoke cigarette in the next 5 years however these were 28.6% (16) and 28.6% (20) in clergymen and teachers (p = 0.008). These finding revealed that although frequency of inappropriate attitude was higher among students, the chance of smoking in the next 5 years in this group was lower than clergymen and teachers . As it is stated the age rage of the students and clergymen were 18 to 25 years and of the teachers 20 to 29 years . When significant test was carried on grade (as a representative of age) of students and clergymen it was not significant (p = 0.37). Also, given the rage of age (20 to 29 years), the mean age of teachers is not generally far from the other 2 groups to alter the findings . The results of this study showed that prevalence of smoking was higher among students (31.1%) and teachers (27.2%) in comparison with clergymen (21.0%) and other males in general population (23.4%). Although, the lowest consumption was seen among clergymen, it was not significantly lower than general population (p = 0.40). Also, level of knowledge, attitude and prediction of smoking cigarette in the next 5 years were more favorable in teachers and clergymen . Although, whenever the range of age extended or the females are enrolled the findings could be different . In general, limited studies have compared smoking status in different groups in a community, although there are many researches focusing on a specific group of people . They evaluated 280 medical students in isfahan university of medical sciences and found that prevalence of smoking was 34% among male students who were in last year of their training . Another study conducted in saudi arabia showed a relatively similar prevalence of smoking among students of different majors . In this study, which was conducted on 202 medical and 300 non - medical students, they demonstrated that the rate of smoking was 27.8% and 39.5% among medical and non - medical students, respectively . Frisch et al . In malaysia examined the pattern of smoking, level of knowledge and attitude of 146 medical and nursing students towards smoking and found that only 11% of male students and none of the female students smoked which is much lower than ours . The level of knowledge and attitude were significantly lower in students compared with other groups in our study . However, other studies conducted in different countries demonstrated that level of knowledge and attitude of medical students towards smoking were more appropriate . A study conducted in the united kingdom on 181 dental students showed that more than 90% of dental students had moderate or good knowledge and more than 80% had an appropriate attitude towards smoking pizzo et al . In a study aiming to examine prevalence of smoking among dental students and their knowledge and attitude towards quitting showed that of 220 students 65% of students had appropriate knowledge and 87% had appropriate attitude towards smoking cessation activities . Although in their study, the level of knowledge and attitude of dental students were higher than our students, no significant difference was observed between prevalence of smoking . This indicates that appropriate knowledge and attitude alone cannot result in a proper behavior and other confounding factors like socioeconomic and family issues should also be taken into account ., in the netherlands examined knowledge, attitude and rate of smoking in 3 groups of medical students (725 subjects), residents (126 subjects) and psychology counselors (236 subjects) and found that prevalence of smoking among medical students and residents was lower than the general population; whereas, prevalence of smoking among counselors was not different from general population . They also found that counselors had poorer knowledge and more inappropriate attitude towards smoking compared to the other 2 groups . The results of glantz study on prevalence of smoking in comparison with general population were in contrast with ours, however he found similar association between knowledge, attitude and prevalence of smoking cigarette with our study . Limited studies have been conducted on the smoking status among clergymen of other religions and those available have been mostly performed on buddhist monks . A study conducted on 318 buddhist monks in cambodia showed that 44% were smokers; whereas, prevalence of smoking in cambodian general population was 65% . In addition, most monks had a poor knowledge about hazards of smoking but as the result of social stigma, prevalence of smoking among them was lower than the general population . Another study conducted on buddhist monks in laos showed that prevalence of smoking among them was about 12%, which is much lower than the neighboring countries like cambodia . This study also demonstrated that lao monks had a good knowledge about hazards of smoking . The results of these 2 studies were in accord with those of ours demonstrating that islamic clergymen and buddhist monks both had a lower prevalence of smoking than general population and also had an appropriate level of knowledge in this respect . In general, the majority of studies performed on teachers only studied the prevalence of smoking . Our study findings regarding high prevalence of smoking among teachers were in agreement with the findings of talay et al ., in turkey, and sorensen et al . In india . On the contrary, a study in bahrain on 1,140 teachers demonstrated that only 8.7% of bahraini teachers smoked, which was lower than their general population . They also reported that these teachers had acceptable level of knowledge about hazards of smoking . The results of this study revealed that clergymen and teachers with poor knowledge had lower chance for becoming a smoker . In all 3 groups, the odds ratio of smoking in those with inappropriate attitude was significantly different from those with appropriate attitude . However, this chance was not significantly different in clergymen than teachers . Also, it was found that smoking status had no significant effect on the probability of smoking in the next 5 years among students . However, for clergymen and teachers, likelihood of smoking in the next 5 years among current smokers was significantly different from non - smokers . In a study on 5,112 teachers in malaysia it also showed that teachers attitude affected their smoking status, which is in concord with our study findings . Another study conducted in bosnia on 273 physicians and nurses found a significant difference in their knowledge and attitude towards smoking . While, in each group, prevalence of smoking . Also found a significant relationship between prevalence of smoking and level of knowledge and attitude in each group of medical students, psychologists and medical residents . Preventing the initiation of smoking in the adolescents and decreasing the prevalence of smoking in adults are the most important methods for prevention of cancer and various diseases . These programs may include increased price of cigarettes, ban of smoking in public places, limiting cigarette advertisements, restricting tobacco advertising, and establishment of counseling and treatment centers for nicotine dependence . However, for implementation of such programs at the national level, a correct estimate of the prevalence of smoking in different social and occupational groups seems necessary . Cigarette consumption has increased among the youth of various social levels in the recent years . This study also showed that prevalence of smoking was higher among male students (which represents the youth in the community) than general population . Considering this increase, new strategies the strength of this study was looking at these 3 groups for the first time, having standard questionnaire, trained research staff and acceptable executive process . The weakness of the study was because the clergyman were male the other 2 groups were selected from males . Also, limiting the information on grades of the students and clergymen and age rage of teachers and not recording exact age of participants was of the limitations of the study . This study showed that prevalence of smoking among male students and teachers was higher than general population and clergymen, who smoked equally . Also, level of knowledge and attitude and prediction of future smoking in students were worse than teachers and clergymen, which is alarming.
The etiology and progression of various diseases are not necessarily influenced by biological factors only . For their understanding it is important to consider the complex interaction of physiological, psychological, behavioral, and social factors . The most accepted model of the disease is the biopsychosocial model, which distinguishes three groups of factors important for the development of a disease, such as biological, psychosocial and behavioral factors (1). Their interaction results in the susceptibility or resistance to disease, as well as in the appearance and/or progression of the disease . According to this model, the biological factors are the following: heritage, gender, age, exposure to toxins and injury . Psychosocial factors are related to the way of interpretation and reaction to life events and stressors . Behavioral factors reflect the lifestyle, including physical activity, and various habits such as alcohol drinking, cigarette smoking and drug use, as well as sexual behavior . The interaction of these three groups of factors in the etiology and progression of the disease takes place over an activation of a series of neuroendocrine and immune mechanisms . One of the components of this complex interaction may be the stress which is correlated to hereditary disposition for the disease manifestation . It is well known that stress is responsible for weakening the body defense mechanisms, especially the immune and endocrine systems . Malignant disease bears a major impact on the patients mental status due to the gravity of such a condition . A newly discovered malignant disease, as well as coping with such a situation is especially stressful acute event for patients responding through a repetitive activation mechanism, including deregulation of the hypothalamic - pituitary - adrenal axis (hpa) that has an adverse health consequence . More specifically, the entire neuroendocrine response to stress is interconnected to the excessive release of various hormones such are the pituitary vasopressin and growth hormone, glucocorticoids, the thyroid hormones, and pancreatic glucagon (2). Obvious sign of the endocrine system deregulation as a response to stress, is the change in circadian rhythm of serum cortisol production . In healthy individuals the level of serum cortisol is usually the highest in the morning before waking up and gradually lowered during the day . However, about 70% of patients with newly diagnosed cancer shows flattened circadian cortisol profile, as well as consistently high levels or irregular fluctuations in serum cortisol (3). The effect of stress onto immune and neuroendocrine system is mediated by a number of psychosocial factors . Recently, it is observed that optimism is a psychosocial factor of particular importance in the response to stress (4), having a direct positive impact on psychological and physical health (5 - 9). It is associated with a lower incidence of depression and anxiety, better functioning of the cardiovascular system, slower progression of the disease, and improved survival of the malignant disease, as well (5 - 9). In general, optimists tend to use active strategies aimed at coping with the stress, while pessimists use adverse coping strategies (10). Therefore, one may assume that optimism improves health condition by activating the immune system which allows better psychophysiological adaptation of the body (11). Results of the study investigating the influence of optimism onto the immune system have shown that optimists posses various indicators of cellular immunity (increased proliferation of lymphocytes, enhanced local immune reactions) (5, 12). Therefore, it seams that the serum level of stress hormone cortisol is relatively lower in optimistic person in comparison to the pessimistic one due to the former more successful coping with the stress (13), what probably contribute to a better functioning of the immune system . However, previous studies have not taken into account the impact of serum cortisol level to perceptive experience of optimism in persons coping with stressful situations caused by awareness of recently diagnosed malignant disease . The aim of this study is to investigate the correlation between the morning level of serum cortisol and perceptive experience of optimism in a selected group of patients with newly diagnosed cancer . The study was conducted on a cohort of patients with recently histologically verified diagnosis of malignant diseases of different organs and organic systems, which have responded to call for examination at the outpatient department of oncology, clinical university hospital mostar during the one - month period (december 2014) the study included 60 patients with newly established diagnosis of cancer (30 males and 30 females) in whom a malignant metastatic disease was found by different diagnostic methods . All participants agreed to participate in the study and signed a letter of informed consent . After confirmation of the diagnosis, patients were given a questionnaire consisting of socio - demographic questionnaire, and a scale for assessing optimism / pessimism . In all the morning cortisol level was measured and analyzed during the study all patients were treated with corticosteroid therapy and spironolactone . Those suffering from chushing s or addison s disease, as well as those with incompletely or incorrectly fulfilled questionnaires were excluded from the study . We assumed that the awareness of newly diagnosed cancer is a possible stress inducer for the patient, and as such may increase the level of serum cortisol . At the same time, the assumption of that awareness may also well affect the perceptive experience of optimism/ pessimism in every individual patient . A sociodemographic questionnaire contained demographic and general information of gender and age, the level of education, marital status, employment and economic status was used . To test the level of optimism / pessimism the croatian version of scales of optimism and pessimism was applied containing 14 particles divided into two charts (15). Six particles contained the scale for optimism assessment, while 8 contained the scale for pessimism . Each patient was asked to estimate the extent to which each particular statement was appropriate on a likert type scale of five degrees . The scale showed satisfactory reliability on a range from 0.74 to 0.77 for the scale of optimism and from 0.78 to 0.83 for the scale of pessimism . To determine the level of morning serum cortisol a fluorometric method utilizing delfia cortisol fluoroimunoessay was applied (16), using lkb wallace 1230 arcus fluorometer measuring device . The measurement method was based on a competitive antigen - antibody reaction between cortisol highlighted by fluorescing europium and cortisol aimed at places of specific monoclonal antibodies derived from mice . The measured fluorescence was inversely proportional to the level of serum cortisol in the samples of subjects . In all patients serum cortisol level was measured in the morning, between 7 and 10 a.m. to determine if the level of morning serum cortisol have any influence on patient s subjective experience of optimism, respondents were divided into two subgroups . Subjects whose result on the scale of optimism was greater than + 0.60 were allocated to a subgroup of highly optimistic (m = 4.64; sd = 0.20), while those whose result exceeded -0.60 were allocated to a subgroup of low - optimistic patients (m = 3.38; sd = 0.30). The same method was applied to test the differences in the level of morning serum cortisol between the two subgroups of pessimistic patients . Those whose result on the scale of pessimism was greater than + 0.60 were assigned to the subgroup of highly pessimistic (m = 3.67; sd = 0.23), while those whose result exceeded -0.60 were assigned to the subgroup low - pessimistic patients (m = 2.22; sd = 0.28) the mann - whitney u test was used for comparison of continuous variables due to the small sample size . A sociodemographic questionnaire contained demographic and general information of gender and age, the level of education, marital status, employment and economic status was used . To test the level of optimism / pessimism the croatian version of scales of optimism and pessimism was applied containing 14 particles divided into two charts (15). Six particles contained the scale for optimism assessment, while 8 contained the scale for pessimism . Each patient was asked to estimate the extent to which each particular statement was appropriate on a likert type scale of five degrees . The scale showed satisfactory reliability on a range from 0.74 to 0.77 for the scale of optimism and from 0.78 to 0.83 for the scale of pessimism . To determine the level of morning serum cortisol a fluorometric method utilizing delfia cortisol fluoroimunoessay was applied (16), using lkb wallace 1230 arcus fluorometer measuring device . The measurement method was based on a competitive antigen - antibody reaction between cortisol highlighted by fluorescing europium and cortisol aimed at places of specific monoclonal antibodies derived from mice . The measured fluorescence was inversely proportional to the level of serum cortisol in the samples of subjects . In all patients serum cortisol level was measured in the morning, between 7 and 10 a.m. to determine if the level of morning serum cortisol have any influence on patient s subjective experience of optimism, respondents were divided into two subgroups . Subjects whose result on the scale of optimism was greater than + 0.60 were allocated to a subgroup of highly optimistic (m = 4.64; sd = 0.20), while those whose result exceeded -0.60 were allocated to a subgroup of low - optimistic patients (m = 3.38; sd = 0.30). The same method was applied to test the differences in the level of morning serum cortisol between the two subgroups of pessimistic patients . Those whose result on the scale of pessimism was greater than + 0.60 were assigned to the subgroup of highly pessimistic (m = 3.67; sd = 0.23), while those whose result exceeded -0.60 were assigned to the subgroup low - pessimistic patients (m = 2.22; sd = 0.28). The mann - whitney u test was used for comparison of continuous variables due to the small sample size . The study group consisted of a sample of 60 patients, including 30 males and 30 females, aged 49 - 88 years (m = 62.68; sd = 8.67). In the entire sample, 20 (33.33%) patients completed primary school, 25 (41.66%) had a high school level of education, and 15 (25%) were college or university educated . Values of morning serum cortisol level were in the range between 5.80 and 698.50 (mdn = 242.85; q1-q3 = 83.75 to 372.45). There were within proper range in 36 patients (60.00%), were increased in one (1.66%), and decreased in 23 patients (38.33%). Basic demographic data (n = 60) level of morning serum cortisol the average value of morning serum cortisol level in the subgroup of optimistic patients was within the proper range (mdn = 262.00; q1-q3 = 197.50 to 376.00), as well as in the group of pessimistic ones (mares = 217.10; q1-q3 = 74.00 to 330.40). There was no statistically significant difference in the level of morning serum cortisol between optimistic and pessimistic subgroup of patients (z = -0.89; p = 0.37) (figure 1). Level of morning serum cortisol in subgroups of optimistic and pessimistic patients there was no statistically significant correlation between the level of morning serum cortisol and expressed optimism (r = 0.09; p> 0.05), as well as between the level of morning serum cortisol and expressed pessimism (r = 0.12; p>0.05) (figure 1). The aim of this study was to determine the relationship between the level of morning serum cortisol and perceived experience of optimism / pessimism in selected group of patients with de novo diagnosed cancer treated at the university clinical hospital mostar during the one - month period . The expectation of good or bad events to happen in the future is the simplest definition of optimism or pessimism (17). They are not clearly separated as a constant (e.g. A person may be optimistic in terms of job promotion, but pessimistic about getting married). Only a small number of persons show a systematic tendency to adhere onto one of the extremes of either optimism or pessimism . However, there are certain life events influencing a person to incline to a higher level of one of the perceived experience extremes . Our findings point out to the fact that the majority of patients did not emotionally react to stressful awareness about the newly diagnosed cancer, since in most of them (60%) the level of morning serum cortisol as an objective indicator of reaction to a stressful event, was not increased (table 2). Results of previous studies have shown that increased levels of serum cortisol are associated with a reduced resistance to infection and deranged immune system what may well contribute to stressful reaction (18, 19). It is characterized by cytokines over secretion contributing to inflammatory processes (21, 22). Such a reaction is also characterized by increased activity of adrenal gland secreting cortisol in large quantities which consequently enhances the secretion of cytokines . Therefore, it is to expect that perceived expression of optimism affecting the immune response may reduce the stress . However, our results do not support this, since the increased values of morning serum cortisol, as a possible indicator of respond to a stressful event, were not observed in the majority of patients in our series . Additionally, no statistically significant correlation between the level of morning serum cortisol and perceived expression of optimism / pessimism was recorded (p>0.05) (table 2, figure 1). Hence, most patients in our series did not react to the stress event by changing their mood . The possible explanation of this could be the fact that the study was conducted on a sample of patients with de novo discovered cancer who had not previously been exposed to the treatment of malignant disease or had not a metastatic disease (e.g. Brain metastases may affect the behavior and psychological status). Consequently, such patients had not been exhausted and frustrated by illness yet, and were just initially confronted with the awareness of newly discovered disease . Therefore, the impact of past experience and the environment were excluded as possible stressors in such patients (23). This group of patients had not been confronted by the extreme conditions of the prolonged disease that may well affected their mental status and provoke a stressful reaction (24 - 27). Our results partially support the affective model of correlation between stress and physiological changes (13). According to this model, optimistic mood is beneficial for the body only when the attempt to cope with stressful situations results in positive outcome . On contrary, in a case of failure to meet expectations (i.e., solution to problem), optimism can lead to a negative effect having an impact on the overall condition of the body consequently . Our results can also be regarded through the fact that containing the disease usually requires compliance between the perception of optimism and pessimism . Results of previous studies dealing with the perception of optimism / pessimism in cancer patients show a greater perceived level of optimism before the start of chemotherapy and increased perceived level of pessimism after chemotherapy in most patients (28, 29). Regarding the level of education, most of the sample consisted of patients with secondary school (41.66%), followed by those with primary school completed (33.33%). Regarding the employment status, the vast majority of patients were those retired and unemployed (79.99%) (table 1). Accordingly, most of them were of lower socioeconomic status and level of education, and their access to medical information or knowledge about the modern possibilities of cancer treatment was notably limited, which may have well affected their perception of the experience of optimism / pessimism (20). Having that in mind, we would like to underline that our results considering the assessment of perceived experience of optimism / pessimism in regard to a stressful event were ambivalent and dichotomized . Therefore, we can conclude that the perceived experience of optimism / pessimism was not necessarily affected by a stressful event, but was most likely related to personal character, as well as the patients level of education and socio - economic status . During the study certain methodological limitations became apparent primarily stemming from its retrospective character, relatively small number of patients and short period of research . Only the patients with newly diagnosed cancers were analyzed what may also present a certain methodological limitation of the study . Therefore, future research should take into consideration patients exposed to the consequences of malignant disease long duration having in mind the potential impact of therapeutic response to neuroendocrine changes caused by such a disease . The sample of patients of both genders was analyzed when assessing hormonal influence to perceived expression of optimism / pessimist . That may also present the study bias . Methodologically, it would be more appropriate to analyze one gender only, bearing in mind that different sex hormones, as a test variables, may have different effects on the immune system function affecting physiological changes . The study results did not confirm the effect of psychological status and the influence of physiological reaction to stressful condition, neither the impact of the level of cortisol to the perceived experience of optimism in selected groups of patients with newly diagnosed cancer . The results concerned with the perceptive experience of optimism / pessimism assessment were not a consequence of stress reaction but they were more correlated to general personal characteristics, the level of education, and socio - economic status of patients . The results do not confirm the impact of morning serum cortisol level onto physiological reactions to stressful conditions and situations in selected group of patients with de novo carcinoma . For further study it would be necessary to conduct a prospective research on a larger sample during a longer period.
Hyperthyroidism is commonly associated with atrial fibrillation (af), particularly in the elderly . We hereby report a case of patient with primary hypothyroidism presenting with af and pericardial effusion which resolved with levothyroxine therapy . He complained of chest pain which was substernal, nonradiating, and throbbing in nature . He smoked 10 cigarettes per day for past 25 years, and denied use of alcohol, caffeine, or drugs . Physical examination was unremarkable except for the irregular heart rate (approximately 130 beats per min) and muffled heart sounds on auscultation . Electrocardiogram [figure 1] confirmed af with rapid ventricular rate, which responded to initial treatment with metoprolol [figure 2]. Af with rapid ventricular rate normalization of af with metoprolol thyroid function tests revealed a sensitive thyroid stimulating hormone (tsh) concentration of 34.70 iu / ml (normal: 0.40 - 4.70 iu / ml), and thyroxine (t4) of 5.57 g / dl (normal: 8 - 12 g / dl) confirming primary hypothyroidism . Transthoracic echocardiography showed normal left ventricular systolic function (ejection fraction of 63%), decreased left ventricular diastolic compliance, and massive pericardial effusion (posterior 17 mm, anterior 13 mm). Right atrial and right ventricle showed 30% collapse during diastole, mild left ventricular hypertrophy was present with no regional wall motion abnormalities . Patient was treated with levothyroxine which lead to resolution of symptoms and restoration of normal sinus rhythm . Repeat echocardiography showed no collapse of right atrium and right ventricle during diastole) and mild pericardial effusion (11 mm circumferential). The most common cardiovascular signs and symptoms of hypothyroidism include bradycardia, mild hypertension (diastolic), narrow pulse pressure, cold intolerance, pericardial effusion, cardiomyopathy and fatigue . Hypothyroidism is often associated with electrocardiographic changes like bradycardia, right bundle branch block, flat or inverted t wave, qrs prolongation, qt prolongation, and infrequently ventricular arrhythmia, torsades de pointes . Treatment of hypothyroidism is well - documented to cause af due to inadvertent overdosing of levothyroxine . Although atrial arrhythmias are common and ventricular ectopy is rare in patients with hyperthyroidism, it is rarely associated with hypothyroidism . Af is seen in 5 - 15% patients of hyperthyroidism and may be the presenting feature . Increased chronotrophic activity due to increased thyroid hormones and increased sympathetic tone are the proposed underlying mechanisms . The physiological chronotropic response and normal tension of the heart muscle in diastolic phase depend on the action of triiodothyronine in the heart cells and its stimulating influence on na - k atpase and ca atpase in endoplasmic reticulum . Normal contractility is also related to triiodothyronine stimulated transcription of the myosin heavy - chain alpha gene and inhibition of the heavy - chain beta gene . Moreover, triiodothyronine acts on the cardiac muscle affects the number of beta adrenergic receptors and their sensitivity to catecholamines . Few case reports have demonstrated that hypothyroidism may cause a prolongation of the qt interval which predisposes the patient to ventricular irritability . The canadian registry of atrial fibrillation investigators reported that 1.5% of 726 patients with af had hypothyroidism over a period of 1.7 years . Studies have also reported that up to 8% of patients with atrial fibrillation were hypothyroid . Hypothyroidism is known to cause nodal defects, but the mechanism of af in hypothyroidism is not known . It is also not clear whether its presence is causally related or is a mere manifestation of an underlying unrecognized structural heart disease . However in our case, reversal of af with levothyroxine treatment negates underlying structural damage of the heart nans suggests causal relationship . Previous case reports have shown association of af with hypothyroidism but pericardial effusion was absent in those cases . This is possibly the first reported case of af and pericardial effusion in a case of hypothyroidism . Young patients with no evidence of organic heart disease may be started on a full replacement dose of thyroxine . Older patients or those with known or suspected ischemic heart disease, should initially be given about 25% of the anticipated replacement dose, and the dose should be increased gradually at 6 - 8 week intervals.
Graft versus host disease (gvhd) remains a major cause of morbidity and mortality post hematopoietic cell transplant (hct). The pathophysiology of acute gvhd involves priming of immune response by pre - transplant conditioning leading to tissue damage and induction of cytokine release, t cell activation and co - stimulation, alloreactive t cell expansion, differentiation and trafficking and destruction of target tissues by effector t cells (1). Four theories have been postulated based on experimental studies including thymic damage and defective negative selection of t cells generated from marrow progenitors after hct, aberrant production of transforming growth factor -, auto - antibody production, and deficiency of t - regulatory cells (2). The main mechanism of action of alkylator based conditioning regimens and ionizing radiation is induction of dna damage . This damage is repaired by the dna repair pathways (3). We have recently demonstrated that single nucleotide polymorphisms (snps) in the base excision repair (ber) pathway are significantly associated with transplant related mortality post allogeneic transplant (4). We further hypothesized that snps in the ber pathway can lead to altered repair (after conditioning induced tissue damage) and altered t cell function (secondary to thymic damage) and may be one of the pathways implicated in the pathophysiology of gvhd . The ber pathway was selected as it plays an important role in repairing damage caused by ionizing radiation and alkylating agents commonly used in conditioning regimens for hct . We analyzed 179 snps in 27 genes in the ber pathway in 470 recipients of allogeneic hct using alkylating agents and ionizing radiation based conditioning regimes for hematologic malignancies at university of minnesota, for association with acute and chronic gvhd . All consecutive patients who underwent an allogeneic hct from an hla - identical sibling donor, matched or mismatched unrelated donor (urd) or single umbilical cord blood (ucb) transplant for hematological malignancies from january 1, 1998 to december 31, 2007 were eligible (n=587). All patients received a conditioning regimen including an alkylating agent and/or ionizing radiation . This study was approved by the institutional review board at the university of minnesota and waiver of informed consent from individual patients was obtained for this study . Demographic and transplant related information regarding all patients undergoing a hct is prospectively entered in the university of minnesota bone marrow transplant database . This included patient and donor age at transplant, patient and donor gender, type of donor (related, urd or ucb), graft source (bone marrow versus peripheral blood stem cell versus cord blood), race, patient s underlying disease, disease status at transplant, hla matching between donor and recipient, conditioning intensity (myeloablative or reduced intensity), conditioning regimen used for transplant, gvhd prophylaxis, cytomegalovirus (cmv) serological status of recipient and donor prior to transplant, date of diagnosis and grade of acute gvhd, date of diagnosis and development of chronic gvhd, malignancy relapse and survival at time of last follow up . Hla - matching status for urd transplants was categorized as well matched, partially matched or mismatched based on classification proposed by weisdorf et al (5). Hla - matching status for cord blood transplants was based on antigen level hla - a, b and allele level hla - drb1 typing . Dna samples from patients were obtained from peripheral blood samples collected prior to undergoing hct . All patients with acute leukemia had no evidence of leukemic blasts at the time of obtaining blood for dna extraction . Dna was extracted from buffy coat using either the puregene dna extraction method (for samples collected prior to 2001) (gentra systems, minneapolis, mn) or the qiagen mini blood kit (all samples collected during or after 2001) (qiagen inc ., san jose, ca) as per manufacturer recommendations . All dna samples were collected and stored at 4c in the molecular diagnostics laboratory at university of minnesota medical center, fairview prior to use in the study . We used data from environmental genome project (6,7) to identify and select linkage disequilibrium (ld) tagsnps that had a frequency of 5% in the caucasian population in 27 ber genes . If genes did not have tagsnps information in the environmental genome project, we used hapmap data for caucasian populations to identify tagsnps that had 5% frequency in caucasian populations using the genome variation server software (http://gvs.gs.washington.edu/gvs/). We then supplemented this list with non - synonymous snps that were identified to be functionally important using three software programs; polyphen (8), sift (9) and snp3d (10). This approach allowed us to select 263 snps (210 tagsnps and 53 snps that may be functionally important) in 27 genes with known function in the ber pathway . All dna samples were genotyped using the sequenom iplex system at the biomedical genomics center at university of minnesota . Of these, 179 snps were successfully genotyped after assuring quality control by selecting only snps with call rates> 80% . High quality genotyping was also assured by only selecting samples with a concordance rate of 95% or greater (using 61 pairs of blinded duplicates) for further analysis . Hence 179 snps and 470 samples were analyzed . Among snps that were successfully genotyped (n=179) 80% were tagsnps (n=143) and 20% were functionally important snps (n=36). Detailed description of number of snps genotyped within individual genes is given in table 1 . We used data from environmental genome project (6,7) to identify and select linkage disequilibrium (ld) tagsnps that had a frequency of 5% in the caucasian population in 27 ber genes . If genes did not have tagsnps information in the environmental genome project, we used hapmap data for caucasian populations to identify tagsnps that had 5% frequency in caucasian populations using the genome variation server software (http://gvs.gs.washington.edu/gvs/). We then supplemented this list with non - synonymous snps that were identified to be functionally important using three software programs; polyphen (8), sift (9) and snp3d (10). This approach allowed us to select 263 snps (210 tagsnps and 53 snps that may be functionally important) in 27 genes with known function in the ber pathway . All dna samples were genotyped using the sequenom iplex system at the biomedical genomics center at university of minnesota . Of these, 179 snps were successfully genotyped after assuring quality control by selecting only snps with call rates> 80% . High quality genotyping was also assured by only selecting samples with a concordance rate of 95% or greater (using 61 pairs of blinded duplicates) for further analysis . Hence 179 snps and 470 samples were analyzed . Among snps that were successfully genotyped (n=179) 80% were tagsnps (n=143) and 20% were functionally important snps (n=36). Detailed description of number of snps genotyped within individual genes is given in table 1 . All statistical analyses were performed using sas software version 9.1 (sas institute, inc ., minor allele frequencies (maf) and hardy weinberg proportions of snps genotyped were estimated . Linkage disequilibrium among snps in the rfc1 gene was estimated using haploview software (12). Assuming an additive model for the snps (where each snp was treated as a continuous variable with the homozygous major, heterozygote and homozygous minor genotypes indicating 0, 1 or 2 copies of the minor allele being present), the association between each of these snps and acute and chronic gvhd was evaluated using a proportional hazards model with death as the competing risk as described by fine and gray (13) after adjustment for clinical covariates . Covariates included recipient age, race, donor type, diagnosis, disease status at transplant, gender mismatch, cmv serostatus of recipient and donor, stem cell source, conditioning regimen (myeloablative or reduced intensity) and gvhd prophylaxis . A p value 0.01 was considered to be significant to select a snp for multivariate analysis and individual snps that were significant were evaluated in a backward stepwise multiple regression model after adjustment for clinical covariates . One hundred and thirty five of 355 patients who were alive by day 100 developed chronic gvhd and were analyzed in a similar manner . Grade ii - iv acute gvhd was evaluated as a time dependant covariate in the model for chronic gvhd . The majority underwent myeloablative hct from an hla - identical sibling donor (n=231), 72% of the cohort were 21 years at the time of transplant and 86% of the cohort were caucasian . Acute leukemia (acute myeloid leukemia and acute lymphoid leukemia) (51%) was the most frequent diagnosis . Among 75 urd recipients, 27 (36%) of recipients received a transplant from a well matched donor, 36 (48%) from a partially matched donor and 10 (13%) from a mismatched donor . Insufficient data was available to categorize two patients . Among 99 ucb recipients, hla - matching status for ucb transplants was based on antigen level hla - a, b and allele level hla - drb1 typing . Of these, 47% were mismatched at a single locus (5/6), 43% were mismatched at 2 loci (4/6) and 9% received a 6/6 matched transplant . The cumulative incidence of grade ii - iv acute gvhd was 40.6% (95% ci 35.8 - 45.4%) and the cumulative incidence of chronic gvhd was 34% (95% ci 28.8 - 39.3%). The overall survival was 48.5% (95% ci 43.8 - 53.2%) at three years and 44.4% (95% ci 39.4 - 49.5%) at five years . Univariate analysis was performed by entering each snp in a model adjusted for all clinical covariates . In univariate analysis, three snps located in rfc1 gene (rs1057807, rs4975003 and rs6844176) were significantly associated with grade ii - iv acute gvhd (table 3a). However, all three snps were in strong linkage disequilibrium with each other (r 0.88) as shown in figure 1 . In multivariate analysis (table 4a), one snp (rs6844176) remained independently associated with a higher risk of grade ii - iv acute gvhd (rr 1.39, 95% ci 1.14 - 1.70, p=0.001). The model was also evaluated for interactions between snp and significant clinical co - variates . The snp, rs6844176, was significantly associated with higher risk of grade ii - iv acute gvhd in patients with relapse or primary induction failure at transplant (p=0.03), but not in those without relapse or primary induction failure (p=0.15). The cumulative incidence of grade ii - iv acute gvhd was 47% (95% ci 37 - 56.9%) in 115 patients with homozygous minor genotype versus 42% (95% ci 34.9 - 49.1%) in 219 patients with heterozygous genotype versus 32.3% (95% ci 24 - 40.7%) in 133 patients with homozygous major genotype (p = 0.06) (figure 2). The same three snps (rs1057807, rs4975003 and rs6844176) in rfc1 gene also showed similar but non significant association with grade iii - iv acute gvhd in univariate analysis (all p 0.06) (table 3b). As shown in table 4b, in multivariate analysis, the same snp (rs6844176) showed a trend towards a higher risk of grade iii - iv acute gvhd (p=0.09). In univariate analysis, one snp (rs1805410), located in the parp1 gene was significantly associated with a higher risk of chronic gvhd with a relative risk of 1.81 (95% ci 1.29 - 2.54, p=0.001) (table 3c). Other significant variables included year of transplant and prior grade ii - iv acute gvhd . The cumulative incidence of chronic gvhd was 50% (95% ci 20.8 - 79.2%) in 12 patients with homozygous minor genotype versus 42.9% (95% ci 31.5 - 54.3%) in 84 patients with heterozygous genotype versus 30.9 (95% ci 24.9- 36.9%) in 259 patients with homozygous major genotype (p=0.026) (figure 3). Univariate analysis was performed by entering each snp in a model adjusted for all clinical covariates . In univariate analysis, three snps located in rfc1 gene (rs1057807, rs4975003 and rs6844176) were significantly associated with grade ii - iv acute gvhd (table 3a). However, all three snps were in strong linkage disequilibrium with each other (r 0.88) as shown in figure 1 . In multivariate analysis (table 4a), one snp (rs6844176) remained independently associated with a higher risk of grade ii - iv acute gvhd (rr 1.39, 95% ci 1.14 - 1.70, p=0.001). The model was also evaluated for interactions between snp and significant clinical co - variates . The snp, rs6844176, was significantly associated with higher risk of grade ii - iv acute gvhd in patients with relapse or primary induction failure at transplant (p=0.03), but not in those without relapse or primary induction failure (p=0.15). The cumulative incidence of grade ii - iv acute gvhd was 47% (95% ci 37 - 56.9%) in 115 patients with homozygous minor genotype versus 42% (95% ci 34.9 - 49.1%) in 219 patients with heterozygous genotype versus 32.3% (95% ci 24 - 40.7%) in 133 patients with homozygous major genotype (p = 0.06) (figure 2). The same three snps (rs1057807, rs4975003 and rs6844176) in rfc1 gene also showed similar but non significant association with grade iii - iv acute gvhd in univariate analysis (all p 0.06) (table 3b). As shown in table 4b, in multivariate analysis, the same snp (rs6844176) showed a trend towards a higher risk of grade iii - iv acute gvhd (p=0.09). In univariate analysis, one snp (rs1805410), located in the parp1 gene was significantly associated with a higher risk of chronic gvhd with a relative risk of 1.81 (95% ci 1.29 - 2.54, p=0.001) (table 3c). Other significant variables included year of transplant and prior grade ii - iv acute gvhd . The cumulative incidence of chronic gvhd was 50% (95% ci 20.8 - 79.2%) in 12 patients with homozygous minor genotype versus 42.9% (95% ci 31.5 - 54.3%) in 84 patients with heterozygous genotype versus 30.9 (95% ci 24.9- 36.9%) in 259 patients with homozygous major genotype (p=0.026) (figure 3). The pathophysiology of the disease (especially chronic gvhd) remains to be fully defined . We found three snps in rfc1 genes to be significantly associated with grade ii - iv acute gvhd and one snp in the parp1 gene to be significantly associated with chronic gvhd . In our prior report (association between genetic variants in the ber pathway and outcomes after hct, bbmt), we have identified three snps in tdg, lig3 and mutyh genes (rs167715, rs3135974, rs3219463) to be associated with transplant related mortality (trm) in multiple regression analysis . These differ from the genetic variants identified in the current analysis, suggesting that the polymorphisms identified in the current analysis represent an association with occurrence of gvhd and not with mortality . Further analysis of trm showed that the association between the 3 snps (rs167715, rs3135974, rs3219463) and trm remained unchanged even after controlling for grade ii - iv acute gvhd as a time dependent co - variate (data not shown), indicating that these snps affect trm through mechanisms independent of gvhd . Base excision repair is the major dna repair pathway for repair of non - bulky damaged bases, abasic sites and single stranded breaks caused by ionizing radiation and alkylating agents (3). The three snps associated with grade ii - iv acute gvhd were all located in rfc1 gene . Though in multivariate analysis, only rs6844176 remained significantly associated with acute gvhd, all three snps (rs6844176, rs4975003 and rs1057807) were in strong ld, hence, it is likely that the snp with the strongest association may in fact be a surrogate for the other two snps strongly correlated and located in the region . The protein encoded by this gene is the large subunit of replication factor c, a dna - dependent atpase that is required for eukaryotic dna replication and repair . The protein acts as an activator of dna polymerases and promotes coordinated synthesis of both strands (14). These snps showed a similar (though not significant) association with grade iii - iv acute gvhd, possibly due to limited sample size when evaluating grade iii - iv acute gvhd . Parp1 (poly [adp - ribose] polymerase 1) gene encodes an enzyme that works by modifying nuclear proteins by poly adp - ribosylation (15). Parp1 also binds with single strand breaks through its n - terminal zinc fingers and recruits xrcc1, dna pol, and dna ligase iii in the short patch ber pathway; and recruits xrcc1, flap endonuclease 1, and dna ligase i in long - patch ber pathway (16). Parp-1 overactivation in response to extensive dna damage results in necrosis (17 - 20). In addition to inducing necrosis, parp-1 also has a profound modulatory effect on the inflammatory response . Parp-1 can form stable complexes with transcription factors such as p53 and ap-2 (21,22). Parp-1 can also act as a coactivator of nf - kb (21 - 23) and, therefore, may be involved in the induction of tnf-. Polymorphisms resulting in altered activity in this gene could modulate cellular necrosis and altered inflammatory response and hence be implicated in the pathogenesis of gvhd . These results also need to be confirmed in patients receiving non - alkylator based reduced intensity regimens where the observed higher risk associated with these snps should not be present . This analysis could not be performed in the current study as all conditioning regimens at our institution (myeloablative as well as reduced intensity) are alkylator based . Several studies have evaluated the impact of polymorphisms involving minor histocompatibility antigens, cytokine genes and innate immunity genes towards gvhd . A recent study reported a higher risk of acute gvhd when donor and recipient were mismatched for homozygous deletion of ugt2b17, a gene expressed in gvhd - affected tissues and giving rise to multiple histocompatibility antigens (24). Other minor histocomatibility antigens including hy, ha-1, ha-2 and ha-3 have been evaluated in the etiology of both gvhd and disease relapse (25 - 35). Polymorphisms in donor and recipient genes for cytokines have been demonstrated to be risk factors for gvhd . Tumor necrosis factor (tnf)-, interleukin 10 (il-10), interferon- (ifn) variants have correlated with gvhd in some, but not all, studies (36 - 39). Genetic polymorphisms of proteins involved in innate immunity, such as nucleotide oligomerization domain 2 and keratin 18 receptors, have also been associated with gvhd (40). These studies provide support to the hypothesis that tissue injury and resulting cytokine release are implicated in the pathogenesis of graft versus host disease . Polymorphisms in dna repair pathways in conjunction with other pathways could also be implicated by impeding or accelerating repair of injured tissue and hence affecting gvhd . This study represents the first analysis of snps in ber dna repair pathway towards acute and chronic gvhd . If confirmed, they represent an important step towards understanding the pathophysiology of gvhd as well as identifying subgroups at high risk for gvhd towards whom novel prophylactic strategies could be targeted.
Herbal plants have been used as medicines for thousands of years, and; some specific plants have been used for particular ailments . Medicinal plants are sources of raw materials for both traditional systems of medicine and modern medicine . These medicines are also in great demand in the developed world for primary health care because of their efficacy, safety and fewer lesser side effects . Traditionally, herbs and herbal products have been considered to be nontoxic and have been used by the general public and traditional medicinal doctors worldwide to treat a range of ailments . However, the fact that something is natural does not necessarily make it safe or effective . The active ingredients of plant extracts are chemicals that are similar to those in purified medications, and they have the same potential to cause serious adverse effects . Whilst the literature documents severe toxicity resulting from the use of herbs, on many occasions the potential toxicities of herbs and herbal products have not been recognized . Pistacia integerrima j. l. stewart ex brandis (pi) is a species of pistachio tree, commonly called zebrawood, native to asia . It is one of the important plants of indian traditional medicine and belongs to the family anacardiaceae . The phytochemical constituents of pi have been reported to be tannins, essential oils and resins . The oil contains alpha - pinene (25%), camphene (27%), di - limonene (4% 5%), 1:8-cineol (10%), caprylic acid (15%), alpha - terpineol (20%) and aromadendrene (4% 5%). The two triterpenic acids are ketocarboxylic and appear to be identical to the alpha and the beta acids [3, 4]. Pi is used for a variety of purposes in india, including timber, dye, and fodder; it is also used as a herbal remedy for many ailments including coughing, asthma, fever, vomiting, diarrhea, loss of appetite, nose bleeds, snakebites, and gastrointestinal and liver disorders [5 - 8]. Pi is reported to be useful as an anti- inflammatory, and an anti - diabetic agent and as a blood purifier [9 - 11]. Galls excrescences are formed by insects on the leaves, petioles and branches of plants . These leaf galls are harvested and used to make kakad shringi; a herbal medicine used to treat diarrhea in northern india . Pi leaf galls were collected in the month of july from the nadaun block of the hamirpur district, himachal pradesh . Ravindra pandey, department of natural products research, columbia institute of pharmacy, raipur, and a voucher specimen, i.e., leaf galls, with voucher number 0342, was deposited in the herbarium of the institute . The powdered material was soaked in methanol, distilled water, chloroform, ethyl acetate and n - hexane for one week and subjected to extraction until exhaustion of the plant material . Male wistar rats with weights in the range of 160 200 g were used for the experiments, which were carried out according to a protocol approved by the institutional animal ethics committee, columbia institute of pharmacy, raipur, chhattisgarh, india (1321/ac/10/cpcsea, dated- 01/28/2010). The animals were housed in polycarbonate cages in a room with a 12-hour day - night cycle, a temperature of 22 2c, and a humidity of 45% 64% . During the entire experimental period, animals were fed with a balanced commercial pellet diet (ashirwad industries, mohali, india) and were allowed ad libitum access to water and normal saline . The acute toxicity studies were conducted as per guideline 425 of the organization of economic and cooperation development (oecd), where a dose limit of 2,000 mg / kg of body weight was used . Animals were observed individually after dosing at least once during the first 30 minutes, periodically during the first 24 hours, with special attention given during the first 4 hours and daily thereafter, for a total of 14 days . Individual body weights were recorded once a week as well as on the day the experiment ended . Changes in skin, fur, eyes, mucous membranes secretions, excretions, and autonomic activity (e.g. Lacrimation, piloerection, pupil size, unusual respiratory pattern) were recorded, as were changes in gait, posture, and response to handling, as well as the presence of clonic or tonic movements . The sub - acute toxicity studies were conducted as per the guideline 407 of the oecd; this provides information on the possible health hazards likely to arise from repeated exposure over a relatively limited period of time . Four groups of animals were selected, group 1 being the normal control and groups 2, 3 and 4 being treated daily with pi at doses of 250, 500, and 1,000 mg / kg of body weight, respectively, for 28 days . All animals were monitored for toxic manifestations such as change in body weight and, mortality . After 28 days all surviving animals were fasted overnight, after which blood samples were collected for hematological and biochemical analyses . Animals were sacrificed after blood collection, and internal organ were removed and preserved in 10% formalin for histological examination . The hematology parameters measured for the sub - acute toxicity study of pi were white blood cell count (wbc), red blood cell count (rbc), hemoglobin (hb), hematocrit (hct), mean corpuscular volume (mcv), mean corpuscular hemoglobin (mch), mean corpuscular hemoglobin concentration (mchc), platelets (plt) and lymphocyte (lymp). Clinical biochemistry analysed to investigate the major toxic effects on tissues and specifically, the effects on the kidneys and the liver were performed on blood samples obtained from of all animals . Biochemical parameters measured for the sub - acute toxicity study of pi were glucose, albumin, urea, total protein (tp), serum glutamate oxaloacetate transaminase (sgot) and serum glutamate pyruvate transaminase (sgpt). Histological examinations were performed on the tissues, which had been preserved in 10% formalin solution . In this study, all data are expressed as means standard errors of the mean (sems). The results were analyzed statistically through graph pad prism 6.0 by using the twoway analysis of variance (anova), followed by the bonferroni post - test to calculate the level of significance . The number of animals was six (n = 6); statistically significant difference in the outcomes, when compared to the control group, were indicated as follows: p <0.05, p <0.01, p <0.001 . An investigation of acute toxicity is an initial step in the characterization of the biological effect of any substance and is necessary for conducting any biological experiment . No deaths or hazardous signs were recorded in the rats during the 14 days of observation after acute treatment by an oral route with pi at doses of 50, 300, and 2,000 mg / kg of body weight . In sub - acute toxicity investigation, no toxicity and no deaths were recorded during the 28 days of treatment by an oral route with pi in doses of 250, 500, and 1,000 mg / kg of body weight . No significant changes were observed in the body weights of the both control and the experimental groups of animals (figs . The hematological profiles of the animals revealed no significant change in any of the clinical parameters (tables 1,2). The mchcs for the experimental animals of both sexes were higher than those for the control animals, but the values were within the normal range, demonstrating the methanolic extract of pi exhibited no toxicity . During the biochemical analyses, all the parameters were in the normal range, and no significant changes were noted when the values of the parameters for the different dose groups were compared with the values for the control group . Slight variations were observed in parameters such as glucose (glu), urea, sgpt, sgot in the 1,000 mg / kg of body weight dose group, but the values were in the normal range (tables 3,4). The organs were found to be devoid of any sign of toxicity, and no significant changes in any of the organ weights were observed (tables 5,6). The histopathological examination of the kidney, lungs and liver were normal in both the control and the treated groups . The research protocol was envisaged and designed to evaluate the toxicity profile of methanolic extract of pi with a main focus on observing the normal physiological conditions of experimental animals after treatment the with extract . Thus, because of the advancement of research in this area, a wide range of parameters and experimental targets were studied to assess the overall profile of the pi extract to determine if any toxicity was present . The various hematological and biochemical parameters evaluated for the rats showed no abnormalities, and the values were within normal physiological limits and were comparable to the values in the vehicle - treated (control) animals . The pi extract is seen to have had no, toxic effect on any of the observed blood parameters, wbc, rbc, hb, hct, mch, mchc, plt and lymp, for the different dose levels . Regardless of the doses of the pi extract the blood parameters were within the normal range . In (fig . 2), small differences in the levels of the biochemical parameters sgpt and sgot can be seen . Higher doses of the pi extract, i.e. 500 and 1,000 mg / kg of body weight, both caused increase in the sgpt and the sgot levels, but these increases did not take the levels outside the normal range . Histopathological evaluation showed no adverse effects of pi extract on the dissected organs; swelling, atrophy, and hypertrophy were not observed . The results of the urine analysis showed no signs of toxicity in the urine; the parameters being within the normal range; creatinine, ph, color, quantity of urine . However, pus cells, sperms, bacteria, and ketone bodies were found, but rarely . No statistically significant differences were found in any of the parameters between the control and the treated groups with respect to various vital organs, and no visceral abnormalities were seen in any of the groups . All animals survived until the scheduled euthanasia and no significant gross pathological alterations were found in the internal organs . In summary, our acute and sub - acute toxicity studies of wistar rats revealed no toxicological symptoms or mortality at any of the dose levels of methanolic extract of pi used in this research . Daily treatments with pi at intervals of 24 hours in doses of 250, 500, and 1,000 mg / kg of body weigh p.o . Had no adverse effect on body weight . The various hematological and biochemical parameters evaluated in the rats showed no abnormalities, and the values were within the normal physiological limits and were comparable to the values for the vehicle - treated (control) animals . The methanolic extract of pi was found to be non - toxic based on the results of the oral acute and sub - acute toxicity tests performed on rats in this research . However, an evaluation of chronic toxicity is needed to determine the long - term safety of the extract . Values are expressed as means sems (number of animals, n = 6); and were significantly different at p <0.05, p <0.01, and p <0.001, when compared with the control group . Sems, standard errors of the mean; wbc, white blood cell; rbc, red blood cell, hb, haemoglobin; hct, hematocrit; mcv, mean corpuscular volume; mch, mean corpuscular haemoglobin; mchc, mean corpuscular hemoglobin concentration; plt, platelets; lymp, lymphocyte . Values are expressed as means sems (number of animals, n = 6); and were significantly different at p <0.05, p <0.01, and p <0.001, when compared with the control group . Sems, standard errors of the mean; wbc, white blood cell; rbc, red blood cell, hb, haemoglobin; hct, hematocrit; mcv, mean corpuscular volume; mch, mean corpuscular haemoglobin; mchc, mean corpuscular hemoglobin concentration; plt, platelets; lymp, lymphocyte . Values were expressed as means sems (n = 6) and were significantly different at p <0.05, p <0.01, and p <0.001, when compared with control group . Sems, standard errors of the mean; glu, glucose; tp, total protein; alb, albumin; sgpt, serum glutamate oxaloacetate transaminase; sgot, serum glutamate pyruvate transaminase . Values were expressed as means sems (n = 6) and were significantly different at p <0.05, p <0.01, and p <0.001, when compared with control group . Sems, standard errors of the mean; glu, glucose; tp, total protein; alb, albumin; sgpt, serum glutamate oxaloacetate transaminase; sgot, serum glutamate pyruvate transaminase . Values were expressed as means sems (n = 6) and were significantly different at p <0.05, values were expressed as means sems (n = 6) and were significantly different at p <0.05, p <0.01, and p <0.001, when compared with control group . N = 6) and were; significantly different at p <0.05, p <0.01, and p <0.001, when compared with the control group . Values are expressed as means sems (number of animals, n = 6) and were; significantly different at p <0.05, p <0.01, and p <0.001, when compared with the control group.
Pemphigus is an autoimmune blistering disease characterized by blisters and erosions on the skin or mucosal membranes or both . The two main types of pemphigus are pemphigus vulgaris (pv) and pemphigus foliaceus (pf). In most countries, pv accounts for about 70% of all cases of pemphigus, presenting with skin or mucosal symptoms or both . Pf, on the other hand, accounts for about 20% of cases in most countries, where there are not endemic forms of pf, and presents only with skin manifestations [1 - 3]. Because pemphigus is an autoimmune disease, immunosuppressive agents have been employed to control and manage the disease . Since the advent of systemic corticosteroids, the mortality associated with pemphigus has reduced from 90% to 10% and is now usually related to complications of treatment . Steroids are still the mainstay of treatment, usually used at high doses initially to get the disease under control and then in conjunction with a steroid - sparing agent for maintenance . Because of the side effects associated with long - term systemic corticosteroids such as hypertension, diabetes mellitus, osteoporosis, and ocular complications, a lot of the recent research in pemphigus has been directed at finding the optimal steroid - sparing agent . Though many treatments have been tried in the management of pemphigus, often demonstrating clinical benefit in individual case reports and case series, the evidence supporting their use has not been confirmed in rcts . This is due to the rarity of the disease in most countries where rcts have been performed and difficulty in recruiting patients, resulting in underpowered studies . A recent cochrane review comparing treatments for pemphigus found significant heterogeneity amongst the rcts with respect to the study designs, primary outcome measures, and therapeutic end - points . Such variation prevented the authors from performing direct comparisons and a meaningful meta - analysis . To solve this problem of variation between studies, a panel of international bullous experts convened on many occasions to form a consensus paper on the definitions of disease and therapeutic end - points for pemphigus . The goal of this consensus paper was to facilitate researchers and clinicians to design studies with similar study end - points so that even if an rct was underpowered, its data could be used in conjunction with other similar studies in a meta - analysis . It is hoped that in the coming years the rcts will incorporate the end - points and definitions from the consensus paper in their study designs so that meaningful comparisons and meta - analyses can be performed . This paper looks at the evidence from rcts that have assessed treatments for pemphigus . As mentioned above, systemic corticosteroids are employed as first - line treatment with lower doses used as maintenance . Though higher doses (120 mg / day) result in a more rapid control of disease than lower doses (60 mg / day), there is no evidence that the higher doses are beneficial in the long term . Therefore, it is recommended that 1 mg / kg per day be the initial dose for managing pemphigus . Steroid - sparing agents are introduced immediately if safe to do so (for example, after normal results from a thiopurine s - methyltransferase [tpmt] test). Once consolidation has been achieved in accordance with the consensus definitions for pemphigus (that is, disease progression has been halted), a slow standardized tapering of corticosteroid is commenced over about a 4-month period, which we term the werth taper . Steroid - sparing agents are employed to reduce the cumulative exposure and side effects associated with long - term steroid use . Such agents include azathioprine, mycophenolate mofetil, intravenous immunoglobulin (ivig), rituximab, cyclophosphamide, methotrexate, and cyclosporine . An rct comparing a combination of prednisolone plus azathioprine to prednisolone plus placebo in 56 patients with newly diagnosed pv found no statistically significant difference between the 2 groups after 1 year of treatment . The steroid - sparing effects of adjuvants were also demonstrated in another rct, which showed similar efficacy with azathioprine, mycophenolate mofetil (mmf), and intravenous cyclophosphamide . The steroid - sparing effect was demonstrated only when all three agents were pooled together as one group . Because of the similarities in efficacy and side effect profiles, clinicians often use azathioprine or mmf as first - line therapy . No study has been able to prove one to be more effective than the other [11 - 13]. Though mmf is a steroid - sparing agent that is safe and effective, a recent rct was unable to demonstrate clinical benefit in adding it to steroids in terms of outcome at one year, but in subanalysis it had benefits at other time points . Rcts to date have failed to show a beneficial effect of cyclosporine in the management of pemphigus . Remission and relapse rates were similar in all three groups, and there was no clear benefit of using a combination treatment . In fact, they noticed more side effects in the combination groups compared with using steroids alone . A multicenter rct comparing various doses of ivig found patients treated with a higher dose of ivig had a better outcome . Patients received one of three doses: 0 mg / kg per day (placebo infusion), 200 mg / kg per day, or 400 mg / kg per day . There was a dose - response relationship with more patients benefiting from the higher dose and objectively this correlated with lower desmoglein (dsg)-1 and dsg-3 autoantibody titers . The limitation of these studies was their short - term follow - up, so that relapse rates could be compared with other options . Rituximab, an anti - cd20 monoclonal antibody, is effective in recalcitrant pemphigus and is typically prescribed for patients who are unable to taper steroids without flare of their disease or in patients who are still flaring despite combination therapy (steroids + steroid - sparing agent). Rituximab is associated with a reduction in autoantibodies (dsg-1 and -3) and b cell depletion . The clinical benefits are noticed within 2 to 3 months of infusion and can last years . One study found that the combination of rituximab for 3-weeks and ivig for the fourth week followed by maintenance monthly rituximab and ivig results in rapid clinical resolution, steroid cessation, and prolonged remission . Another study found similar response and relapse rates with rituximab alone . Despite case reports suggesting a potential role for cyclophosphamide in pemphigus treatment, benefits have not been reproduced in rcts, not even for cyclophosphamide with pulses of dexamethasone randomized against prednisone with azathioprine . There are some issues with the design of this rct, with modifications of the cyclophosphamide treatment arm compared with the original protocol and timing of cyclophosphamide doses and cessation of treatment . In clinical practice, there is reservation from clinicians and patients using this medication given the potential long - term side effects of infertility, bladder cancer, and hemorrhagic cystitis, although these adverse effects have not been demonstrated in pemphigus rcts . Nevertheless, the lack of level 1 evidence and the potential harmful side effects make cyclophosphamide a second- or third - line steroid - sparing agent . It is typically not considered unless alternative therapies have failed and should not be used on young patients unless they were not planning on having further children . Hence, further evidence is required to attest to the benefit of this modality in treating pemphigus . Although the long - term efficacy of many of the therapies in pemphigus has not been evaluated in studies, it has been noted that 60% of patients with severe pemphigus treated with rituximab were in long - term remission of 6 years . In comparison, the remission rates for patients managed in the ratnam 5-year study were 36% (4/11) with a dose of 120 mg / kg per day and 9% (1/11) with a starting dose of 60 mg / kg per day . Rituximab has not been officially approved by the food and drug administration or european medicines agency for pemphigus, although there are reports of success with its off - label use . Ivig is approved for relapsing and recalcitrant pemphigus by medicare and the blood bank / official funding agencies of various countries and has also been approved by the therapeutics goods administration in australia . Systemic corticosteroids are the mainstay of treatment for pemphigus . Much of the recent research has been assessing the efficacy of steroid - sparing agents, most commonly azathioprine, mmf, rituximab, methotrexate, ivig, and cyclophosphamide . Although strong evidence in the form of rcts is lacking, it does not mean that these systemic treatments are ineffective . Because of the rarity of the disease, studies are often underpowered and fail to demonstrate a statistically significant difference between the active and control groups . The evidence to date indicates that adding an adjuvant to steroids has a significant steroid - sparing effect, reducing the cumulative exposure to steroids . Azathioprine and mmf are often considered first - line therapies for pv with good improvement . Rituximab is beneficial in patients who have poorly controlled disease despite high - dose steroids or steroid - sparing agents (or both) or are contra - indicated for receiving steroids . Ivig in short - term studies is effective for recalcitrant cases but its duration of treatment needs further investigation . As more studies incorporate the definitions of disease and therapeutic end - points of the recent consensus statement, it is hoped that valuable and meaningful meta - analyses will provide more definitive answers.
Participants were recruited in the dominiek savio institute, a service center for people with physical disabilities in belgium . The dominiek savio institute offers ambulatory, semi - residential, and residential services to children and adults who need support in the domains of living, education, and work . Participants of this study were included if they were diagnosed with a neurological condition resulting in a major physical disability (e.g., cerebral palsy, spina bifida, and traumatic brain injury). In order to achieve a homogenous sample, individuals with a medical condition that was progressive by nature (e.g., huntington s disease, neuromuscular diseases) were excluded from participation . This resulted in a sample of 65 adults (31 male; 34 female), representing the most common physical disabilities . Most participants were diagnosed with cerebral palsy (80%) followed by traumatic brain injury (15%) and spina bifida (5%). A total of 48% of the sample was diagnosed with an intellectual disability (iq - score lower than 70). Table 1demographic and background variables of the participants (n = 65)percentage (%) age 21 - 3012 31 - 4029 41 - 5040 51 - 6019primary disability cerebral palsy80 spina bifida5 traumatic brain injury15secondary disability intellectual disability48 deafness / hearing impairment6 blindness / visual impairment8 speech / language impairment46 psychiatric impairment19 cognitive impairments (e.g., apraxia, ataxia, amnesia)12intelligence level> 7152 567025 465511 36459 21353 demographic and background variables of the participants (n = 65) the supports intensity scale (sis) and the barthel index (bi) were administered according to the guidelines . Both scales were scored by caregivers who were familiar with the person for at least 3 months . For the sis, individuals were rated by staff workers who held an academic degree and had sufficient knowledge of the concept of the bi was rated by the personal assistant (pa) of each participant . For the bi, raters were assisted by the first author (e.g., instruction ofunclear items, verifying that all items were scored). Participants were recruited in the dominiek savio institute, a service center for people with physical disabilities in belgium . The dominiek savio institute offers ambulatory, semi - residential, and residential services to children and adults who need support in the domains of living, education, and work . Participants of this study were included if they were diagnosed with a neurological condition resulting in a major physical disability (e.g., cerebral palsy, spina bifida, and traumatic brain injury). In order to achieve a homogenous sample, individuals with a medical condition that was progressive by nature (e.g., huntington s disease, neuromuscular diseases) were excluded from participation . This resulted in a sample of 65 adults (31 male; 34 female), representing the most common physical disabilities . Most participants were diagnosed with cerebral palsy (80%) followed by traumatic brain injury (15%) and spina bifida (5%). A total of 48% of the sample was diagnosed with an intellectual disability (iq - score lower than 70). Table 1demographic and background variables of the participants (n = 65)percentage (%) age 21 - 3012 31 - 4029 41 - 5040 51 - 6019primary disability cerebral palsy80 spina bifida5 traumatic brain injury15secondary disability intellectual disability48 deafness / hearing impairment6 blindness / visual impairment8 speech / language impairment46 psychiatric impairment19 cognitive impairments (e.g., apraxia, ataxia, amnesia)12intelligence level> 7152 567025 465511 36459 21353 demographic and background variables of the participants (n = 65) the supports intensity scale (sis) and the barthel index (bi) were administered according to the guidelines . Both scales were scored by caregivers who were familiar with the person for at least 3 months . For the sis, individuals were rated by staff workers who held an academic degree and had sufficient knowledge of the concept of support which is also recommended by the sis manual (aaidd 2004). The bi was rated by the personal assistant (pa) of each participant . For the bi, raters were assisted by the first author (e.g., instruction ofunclear items, verifying that all items were scored). Evidence for the good psychometric properties of the instrument has been provided in both dutch and belgium samples (buntinx 2006; claes et al . The sis is composed of three separate areas in which support may be needed: life activities (57 items), medical conditions (16 items) and behavioral conditions (13 items). The domain of life activities is composed by 7 subscales: home living, community living, life - long learning, employment, health and safety, social activities, and protection and advocacy . For these subscales, ratings are made on a 5-points scale with regard to the frequency of support (ranging from none to hourly), the daily support time needed (ranging from none to 4 h or more) and the type of support (ranging from none to full physical assistance). Additionally, ratings in the areas of medical and behavioral conditions are assessed on a 3-points scale, ranging from no support, some support and extensive support needed . By summing up all scores on the subscales, a total raw score is derived . A dutch validated version of bi was used in order to measure the practical skills of the individuals included in our sample . The bi is a widely used and accepted instrument in clinical and scientific research to assess a range of functional abilities in activities of daily living (adl). The bi has been considered as the gold standard to measure adl - abilities (dijkstra et al . A total of ten domains of adl are rated by a primary caregiver on a scale ranging from (0) fully dependent to (3) fully independent . These domains of adl include: bowel control, bladder control, personal hygiene, toilet use, feeding, transfer, mobility, dressing, stair climbing, and bathing . The total score (ranging from 0 to 20) gives an indication of the care dependency of the person . The lower the scores, the more dependent the person is on care, and vice versa . The bi has been considered as a reliable and valid instrument to measure activities of daily living (adl) in people with neuromuscular and muscoskelatal disorders . 2006) internal consistency cronbach s alphas were calculated for both the sis subscales and the total sis scale to determine the internal consistency of the scales . A cronbach s alpha higher than .70 construct validity the measurement of construct validity is involved whenever a test is to be interpreted as a measure of some attribute or quality which is not operationally defined (cronbach and meehl 1955, p. 281).there are multiple validation procedures to determine the construct validity of a scale (arvey 1992). If correlations between subscales are in the moderate to high range (.4 .9), it is evidenced that the subscales measure the same overall construct (thompson et al . 2002).the second manner to examine construct validity is to correlate the sis subscale scores with the total score of the barthel index (bi). Moreover, one would expect a significant correlation between the sis and bi because they measure two related but different constructs, namely support needs and adaptive skills respectively (thompson et al . Therefore, we hypothesized that the correlation between the sis subscales and the bi would be in the moderate range (.4 to .6).a third procedure to determine the construct validity of the sis is to test whether there are expected differences among groups with different number of disabilities on total sis - scores . One would expect that persons with more disabilities have higher sis scores (indicating higher support needs) than persons with less disabilities . Therefore, three groups were composed according to the number of disabilities: a group with one disability (n = 20), a group with two disabilities (n = 30) and a group with three or more disabilities (n = 14). The group with one disability exclusively had a motor disability, whereas the other two groups had additional disabilities, such as a hearing, visual, speech / language, psychiatric or cognitive disabilities . A one - way analyses of variance (anova) was conducted to test our hypothesis that the sis total scores increased as the number of disabilities was higher . Internal consistency cronbach s alphas were calculated for both the sis subscales and the total sis scale to determine the internal consistency of the scales . A cronbach s alpha higher than .70 construct validity the measurement of construct validity is involved whenever a test is to be interpreted as a measure of some attribute or quality which is not operationally defined (cronbach and meehl 1955, p. 281).there are multiple validation procedures to determine the construct validity of a scale (arvey 1992). If correlations between subscales are in the moderate to high range (.4 .9), it is evidenced that the subscales measure the same overall construct (thompson et al . 2002).the second manner to examine construct validity is to correlate the sis subscale scores with the total score of the barthel index (bi). Moreover, one would expect a significant correlation between the sis and bi because they measure two related but different constructs, namely support needs and adaptive skills respectively (thompson et al . Therefore, we hypothesized that the correlation between the sis subscales and the bi would be in the moderate range (.4 to .6).a third procedure to determine the construct validity of the sis is to test whether there are expected differences among groups with different number of disabilities on total sis - scores . One would expect that persons with more disabilities have higher sis scores (indicating higher support needs) than persons with less disabilities . Therefore, three groups were composed according to the number of disabilities: a group with one disability (n = 20), a group with two disabilities (n = 30) and a group with three or more disabilities (n = 14). The group with one disability exclusively had a motor disability, whereas the other two groups had additional disabilities, such as a hearing, visual, speech / language, psychiatric or cognitive disabilities . A one - way analyses of variance (anova) was conducted to test our hypothesis that the sis total scores increased as the number of disabilities was higher . Internal consistency internal consistency coefficients were high and exceeded the criterion of .70 (see table 2): cronbach s alphas ranged from .71 for medical to .96 for life - long learning, and the cronbach alpha for the total sis was .98 . Thus, internal consistency was evidenced for both the subscales and the total sis scale . Table 2intercorrelations between sis subscales (n = 65)sis subscalehlcllllemph&ssocmedbehhl.95cl.62.95lll.47.78.96emp.46.65.71.94h&s.59.76.82.69.94soc.44.77.72.75.76.93med.74.63.52.55.58.46.71beh-.00-.02-.01-.01.16.05-.05.77significant at p<.01;hl home living, cl community living, lll life - long learning, emp employment, h&s health & safety, soc social activities, med medical, beh behaviorcoefficients on the diagonal are the cronbach s alphas intercorrelations between sis subscales (n = 65) * * significant at p<.01; hl home living, cl community living, lll life - long learning, emp employment, h&s health & safety, soc social activities, med medical, beh behavior coefficients on the diagonal are the cronbach s alphas construct validity first, to test the construct validity, the intercorrelations between the sis subscales were calculated . As can be seen in table 2, construct validity was present in 7 out of 8 subscales, as shown by the statistically significant intercorrelations . However, the subscale behavior did not significantly correlate with the other subscales (range .00.16). That is, the highest significant correlation was found between life - long learning and health and safety (.82), whereas, home living and social activities revealed the lowest significant correlation (.44). Thus, all sis subscales seemed to measure the same construct, namely support needs, with the exception of the behavior scale.second, sis subscale scores were correlated with the bi sum score (table 3). Four of the eight correlations between the sis subscales and the bi exceeded the criterion of .35, namely home living (-.78), community living (-.41), health and safety (-.41) and medical (-.70). The other four sis subscales (life - long learning, employment, social activities and behavior) did not correlate higher than .35 with the bi . Table 3correlations between sis subscales and the sum score of the bi (n = 65)bihl-.78cl-.41lll-.26emp-.29h&s-.41soc-.22med-.70beh-.03 * significant at p <.05; * * significant at p <.01hl home living, cl community living, lll life - long learning, emp employment, h&s health & safety, soc social activities, med medical, beh behaviorbi barthel indexfinally, we tested whether subgroups with different number of disabilities had different total scores on the sis . Our analysis revealed significant differences between groups in total sis scores, f(2,62) = 4.98, p <01, = .14 . Post - hoc comparisons with lsd indicated that the group with 1 disability (m = 242.0; sd = 72.8) required less support compared with the group with 2 (m = 291.1; sd = 86.3) and 3 or more disabilities (m = 329.6; sd = 87.5). Although the mean sis score was higher for participants in the group of 3 or more disabilities compared to the participants with 2 disabilities, the difference was not statistically significant . These results indicate that the sis discriminates between subgroups with different number of disabilities, which could be regarded as an indicator for construct validity . Correlations between sis subscales and the sum score of the bi (n = 65) * significant at p <.05; * * significant at p <.01 hl home living, cl community living, lll life - long learning, emp employment, h&s health & safety, soc social activities, med medical, beh behavior the present study investigated the internal consistency and the construct validity of the sis in a sample of people with physical disabilities . The cronbach s alphas were comparable to the coefficients reported in previous research of thompson and colleagues (2002) and buntinx et al . (2008) including people with intellectual disabilities, albeit that the cronbach s alphas of sis medical and sis behavior were somewhat lower in the present study . A lower internal coefficient of the behavior scale (.77) was found in the present study compared to research by thompson et al . (2008) (.98 and .86, respectively), both using samples of people with intellectual disabilities . In addition, the sis behavior subscale did not correlate significantly with other sis subscales . That is, most items of the behavior subscale refer to support needs of behaviors that are externalizing by nature (e.g., aggression and automutulation). In contrast, only two items (maintenance of mental health treatments and prevention of other serious behavior problems) are included that may capture more internalizing problems, such as depression and anxiety . It is possible that these externalizing behaviors are less relevant for people with physical disabilities . It is known from research that, in comparison to people without disabilities, individuals who are physically disabled have a higher risk to develop mood and anxiety disorders (mccoll and friedland 1993). Therefore, if support needs in people with physical disabilities are assessed, instruments should encompass a broader range of behavioral issues, including behaviors that are more relevant for individuals with physical disabilities . In order to investigate the construct validity of the sis, past research reveals that people with physical disabilities often have limitations in practical skills, such as toileting, bathing, and mobility (e.g., andrn and grimby 2000; balandin and morgan 1997). As balandin and morgan (1997) have suggested, these limitations may be accompanied by higher support needs in, for example, people with cerebral palsy . In accordance with this expectation, a moderate correlation was found between total sis scores and the bi . Overall, these results indicate that participants had more support needs as they had more limitations in practical skills . However, further analyses of the data revealed that the construct validity was evident in only four subscales of the sis . As was expected, a strong correlation was found between sis home living and bi, as the former typically requires such practical skills, as dressing and toileting . It was, however, hypothesized that limitations in practical skills would be also linked to support requirements in a range of life domains, as was suggested by some previous studies of support needs of people with physical disabilities (andrn and grimby 2000; balandin and morgan 1997). For example, stronger correlations were expected between bi - scores and life - long learning, employment, and social activities . For instance, it is reasonable that people with physical disabilities may also need assistance (in for example toileting or walking), while performing activities such as participating in educational activities (life - long learning) or participating in recreational activities (social activities). In addition, the correlations between the bi and community living and health and safety exceeded the minimum criterion .35 . However, these correlations were still lower than the correlations reported in a study with people intellectual disabilities of harries and colleagues (2005), who found higher correlations between these sis subscales and several subscales of the adaptive behavior scale (abs) and the inventory client and agency planning (icap) measuring practical skills (abs self - sufficiency, icap motor skills and icap personal living skills). Therefore, compared to previous research, this study reveals a weak relationship between limitations in practical skills and support needs in specific sis domains, and additionally, construct validity was evidenced in only four out of eight sis subscales . An explanation for the weak relationship between the bi and the sis subscales could be that the sis subscales might have underestimated the limitations of practical skills associated with physical disabilities . In the study of harries et al . (2005), in which scores of the abs, icap and sis section subscales were combined in an explorative factor - analysis, it was found that the sis support need scale and these adaptive behavior scales had the same underlying construct . Although initial analyses showed a strong association between sis subscales and the subscales of the abs and the icap, a three - factor solution showed that no sis subscales were present in the third factor, representing the practical dimension . The outcomes revealed that, considered in terms of the three adaptive behavior skill areas, the underlying construct related predominantly to the conceptual skills dimension the authors suggest that the raters used an individual s conceptual skills as a framework of reference when assessing support needs (p. 402). Although harries and colleagues (2005) do not further explain this suggestion, it may be that the frame of reference is a bias in the sis itself . It might be that support needs, as measured by the sis, are based more on the limitations in conceptual skills (e.g., cognition and language) rather than limitations in practical skills (e.g., mobility, bladder and bowel control). All subscales (except the behavior subscale) were intercorrelated in the moderate to high range, comparable to the outcome of buntinx et al . Moreover, the sis was able to discriminate between groups who varied in the number of disabilities . Specifically, the group of people with a physical disability and 2 or 3 or more additional impairments were rated as having higher support needs than people with only a physical disability . Thus, the analysis of the construct validity reveals that the sis measured the overall construct of support needs in the current sample . However, in contrast to the expectation that the sis subscales would be related to the bi, this construct is only slightly based on limitations in practical skills first most of the participants in the sample were diagnosed with cerebral palsy and only a small proportion consisted of people with spina bifida and tbi . Subgroups consisting of people with spina bifida and tbi were too small to conduct separate analyses . Future research is needed to investigate whether these groups differ in the nature of support needs . For example, many people with spina bifida may need support related to bladder and bowel control and shunt - related problems (oi et al . 1996). In addition, people with tbi often need support in the behavioral domain (soo et al . Therefore, future research of the sis should take into account other settings, such as ambulatory and semi - residential services . However, people with cerebral palsy often experience a decline in functional status and health status at a young age (hemsley et al . (2002) argue, support needs are proposed to be dynamic, which indicates that they change across settings, across situations, and over time (p. 392). For this reason, equally important, in order to consider the changing nature of support needs in people with a physical disability, research should also focus on longitudinal assessments on individuals . In summary, the present research was the first attempt to measure the psychometric properties of the sis in people with physical disabilities . Although there are some indications that the sis may be useful assessing support needs in people with physical disabilities, the sis might not take sufficiently into account the limitations in practical skills of these people . For people with physical disabilities, future revisions of the sis should take into consideration limitations in practical skills in a variety of support domains as measured by the sis . First most of the participants in the sample were diagnosed with cerebral palsy and only a small proportion consisted of people with spina bifida and tbi . Subgroups consisting of people with spina bifida and tbi were too small to conduct separate analyses . Future research is needed to investigate whether these groups differ in the nature of support needs . For example, many people with spina bifida may need support related to bladder and bowel control and shunt - related problems (oi et al . In addition, people with tbi often need support in the behavioral domain (soo et al . 2007), as they often exhibit externalizing behaviors (ducharme 1999). Therefore, future research of the sis should take into account other settings, such as ambulatory and semi - residential services . However, people with cerebral palsy often experience a decline in functional status and health status at a young age (hemsley et al . (2002) argue, support needs are proposed to be dynamic, which indicates that they change across settings, across situations, and over time (p. 392). For this reason, equally important, in order to consider the changing nature of support needs in people with a physical disability, research should also focus on longitudinal assessments on individuals . In summary, the present research was the first attempt to measure the psychometric properties of the sis in people with physical disabilities . Although there are some indications that the sis may be useful assessing support needs in people with physical disabilities, the sis might not take sufficiently into account the limitations in practical skills of these people . For people with physical disabilities, future revisions of the sis should take into consideration limitations in practical skills in a variety of support domains as measured by the sis
First described in 1910, purtscher s retinopathy is seen in severely traumatized patients and is characterized by sudden visual loss (purtscher 1912). The characteristic ophthalmoscopic findings are multiple areas scattered throughout the posterior pole of superficial retinal whitening, which appear as focal areas of retinal arteriolar occlusion on fluoresceinangiography (grass 1997). Similar clinical findings have been reported in association with childbirth (blodi et al 1990; shaikh et al 2003), and have been termed purtschers - like retinopathy . The visual prognosis in purtschers - like retinopathy after childbirth is guarded, and to date, there is no definitive treatment . However, there are encouraging reports of visual recovery in patients with purtscher s retinopathy receiving high dose intravenous corticosteroid therapy (atabay et al 2003). We report a patient with purtschers - like retinopathy following childbirth who received a sub - tenon s capsule injection of triamcinolone with subsequent increase in visual acuity and decrease in retinal swelling . Ten days after an emergent caesarian section for severe preeclampsia, rh immunization, and fetal anemia, a 24 year - old primigravida primiparus patient presented with complaints of decreased vision in both eyes, right greater than left . There were no other systemic abnormalities such as elevated liver enzymes, low platelets or other hematologic abnormalities . Dilated fundus examination revealed bilateral purtschers - like retinopathy (figures 1a, 1b), with widespread areas of macular ischemia and edema, as confirmed by optical coherence tomography (figures 2a, 2b). Of note are the superficial areas of high intensity signal, indicative of retinal ischemia . The central thickness in the right eye was 272 microns, and in the left 239 microns . A sub - tenon s injection of 0.5 cc of triamcinolone (40 mg / cc) was given in the right eye on day 15 after delivery . At one week following the injection, her visual acuity was unchanged and her intraocular pressure was normal . She noted a marked improvement in the vision in her right eye . On examination a her acuity had improved to 20/60 in the right eye and 20/20 in the left, with normal intraocular pressures . Her fundus examination showed marked improvement, with most of the superficial ischemic areas resolving . Repeat optical coherence tomography in both eyes (figures 3a, 3b) demonstrated a reduction in the edema of the right eye by 30% from baseline, whereas the left, untreated eye showed a reduction in swelling of 14% . Her visual acuity remained 20/60 in the right eye and 20/20 in the left eye . Nearly a century ago otmar purtscher described a case of visual loss in a severely traumatized patient whose exam showed multiple superficial retinal hemorrhages and white patches throughout the posterior pole . Since that time, similar findings have been associated with other conditions including compressive chest injuries, acute pancreatitis, fat embolism, retro - bulbar anesthesia, connective tissue diseases (grass 1997), and childbirth (blodi et al 1990; shaikh et al 2003). The pathogenesis of purtschers - like retinopathy post - partum is unknown, but may be related to arteriolar obstruction by complement induced leukoemboli produced during parturition (blodi et al 1990). Similar clinical findings have been reported in the setting of amniotic fluid embolism . However, in the absence of a patent foramen ovale or pulmonary arteriovenous - shunts, it is unlikely that amniotic emboli are the direct cause of the observed retinal arteriolar obstructions . Other investigators have theorized that subclinical amniotic fluid emboli may activate complement and induce granulocyte microemboli, which could occur on both sides of the pulmonary capillary bed . The visual recovery of postpartum patients with purtschers - like retinopathy is varied (blodi et al 1990; shaikh et al 2003). Of the four patients described by blodi, three enjoyed significant improvement in central acuity, another case of purtscher - like retinopathy has been described in a patient with hellp syndrome during antepartum . Generally purtscher - like retinopathy has a favorable prognosis but this case resulted in permanent loss of vision (stewart et al 2007). Currently, there is no definitive treatment for postpartum purtschers - like retinopathy . In vivo, corticosteroids have been shown efficacious in inhibiting complement - induced granulocyte aggregation (hammerschimidt et al 1979). Clinically, there are two reports of visual recovery after high dose, intravenous corticosteroid therapy in post - traumatic patients (atabay et al 1993). The case presented here is unique in that the patient had bilateral, asymmetric purtschers - like retinopathy post - partum, with quantitative oct improvement following unilateral local steroid therapy.
The study was performed at a farm in bursa, situated in northwest turkey, at 408 north latitude, 298 east longitude and an altitude 149 m above sea level during an 80-day period . This study was approved by the ethical committee at the university of uludag, bursa, turkey . Eighteen saanen goats, ages 34 years, were used in this study . The live weight, body condition score and milk yields of the goats were determined as follows: mean standard errors; 45.13 2.2 kg; bcs, 3.72 0.3 arbitrary units; and my, 1.50 kg / day . The goats were housed with their kids in a sheltered outdoor pen with straw bedding . All goats grazed on pasture between 9 am and 5 pm and had access to water ad libitum . The goats were also given alfalfa hay [dry matter (89.42%), cp - crude protein (16.50%), ether extract (1.39%), ndf - neutral detergent fiber (58.85%), adf - acid detergent fiber (52.42%), adl - acid detergent lignin (11.40%), nfc - non - fibrous carbohydrates (14.62%), ash (8.64%), ca - calcium (1.35%) and p - phosphorus (0.12%)] ad libitum in the morning and evening . On postpartum days 20, 35, 50, 65 and 80, venous blood samples were collected from the goats via jugular punctures into vacutainers (venoject, terumo, leuven, belgium) containing edta as an anticoagulant and tubes with no anticoagulant after a fasting time of 3 hr . Within 30 min, the blood samples were centrifuged at 1,500 g for 10 min at 4c, and the serum and plasma were harvested and stored at 20c until the day of the analysis . Two milk samples of 60 ml (one at the morning milking and one at the evening milking) were also individually collected in a plastic vial on the same days as the blood samples . The first collection occurred on day 20 post - parturition to avoid a collection of colostrum . The milk samples were kept at 4c until the milk quality and composition analyses were conducted . For hormonal analyses, the milk samples were vortexed; aliquots (500 ml) of whole milk were obtained (into 1.5 ml eppendorf tubes, eppendorf, hamburg, germany) and frozen at 20c until analysis . The milk samples were analyzed for their fat, lactose, protein, solids - non - fat (snf), total solid (ts), freezing point depression (fpd), density, acidity, free fatty acids (ffa), casein with infrared reflectance spectroscopy (rev - milkoscan ft1, foss electric, hillerd, denmark) and scc using a somatic cell counter (fts / fcm combi 400, bentley, chaska, mn, u.s.a .) Within 24 hr . For microbial analyses, the raw milk samples were immediately diluted in sterile pbs (1 ml in 9 ml) and then homogenized in a vortex mixer, and serial 10-fold dilutions were made for colony countings . Aliquots of 0.1 ml of selected dilutions were plated for aerobic mesophilic colony counts using casein - peptone glucose yeast extract agar plates (pca: plate count agar, 1.05463.0500, merck, darmstadt, germany) followed by incubation at 37c for 24 hr . A pair of plates containing de man - rogosa - sharpe medium (mrs agar, 1.10660.0500, merck) was used . After inoculation, each plate was incubated in an anaerobic chamber using anaerogenic jars (an0035a, oxoid, basingstoke, hants, u.k .) With an anaerobic pack (cn0020c, oxoid) at 37c for 48 hr . Plates containing 30300 colonies were selected, and representative colonies of each morphotype previously characterized as lactobacilli were enumerated . Non - spore - former rods, gram - positive and catalase - negative isolates were regarded as lactobacilli and calculated for each sample . The milk samples were thawed overnight in the refrigerator and vortexed continuously to ensure sample uniformity . Skim milk was prepared by centrifuging 500 ml of whole milk at 16,000 g at 4c for 5 min . Milk and plasma adiponectin were measured using a commercially available goat - specific sandwich enzyme - linked immunosorbent assay (elisa) kit (goat adiponectin elisa kit; hangzhou eastbiopharm co., ltd ., yile road, china) in an automated microplate reader (x808, biotek el, winooski, vt, u.s.a . ). A goat resistin sandwich elisa kit (goat resistin elisa kit; hangzhou eastbiopharm co., ltd .) Was used to measure the resistin in the milk and plasma samples . The milk and plasma leptin levels were measured by sandwich elisa using a goat - specific elisa kit (goat leptin elisa kit; hangzhou eastbiopharm co., ltd . ). The plasma crp level was also measured using a commercially available goat - specific elisa kit (hangzhou eastbiopharm co., ltd . ). Serum total protein, cholesterol and total lipid concentrations were determined with commercial kits (ref t528 - 480; ref c507 - 480 and t526 - 480, respectively, teco diagnostics, anaheim, ca, u.s.a .) Following the manufacturer s instructions and using a spectrophotometer (uv 1601, shimadzu, kyoto, japan). The sensitivity, milk and serum intra - assay coefficients of the variation were 0.11 g / ml, 6% and 8% for adiponectin, 0.12 ng / ml, 5% and 6% for resistin, 0.27 ng / ml, 6.7% and 8% for leptin, and 0.26 g / ml, 4% for crp . Changes at different time points were determined using repeated measures test for gaussian distributed variables and friedman test for non - gaussian distributed variables . The data are given as the means sem (standard error of the mean). P values less than 0.05 were considered statistically significant in all tests, and p value with bonferroni correction was used for multiple comparisons (=0.01). The study was performed at a farm in bursa, situated in northwest turkey, at 408 north latitude, 298 east longitude and an altitude 149 m above sea level during an 80-day period . This study was approved by the ethical committee at the university of uludag, bursa, turkey . Eighteen saanen goats, ages 34 years, were used in this study . The live weight, body condition score and milk yields of the goats were determined as follows: mean standard errors; 45.13 2.2 kg; bcs, 3.72 0.3 arbitrary units; and my, 1.50 kg / day . The goats were housed with their kids in a sheltered outdoor pen with straw bedding . All goats grazed on pasture between 9 am and 5 pm and had access to water ad libitum . The goats were also given alfalfa hay [dry matter (89.42%), cp - crude protein (16.50%), ether extract (1.39%), ndf - neutral detergent fiber (58.85%), adf - acid detergent fiber (52.42%), adl - acid detergent lignin (11.40%), nfc - non - fibrous carbohydrates (14.62%), ash (8.64%), ca - calcium (1.35%) and p - phosphorus (0.12%)] ad libitum in the morning and evening . On postpartum days 20, 35, 50, 65 and 80, venous blood samples were collected from the goats via jugular punctures into vacutainers (venoject, terumo, leuven, belgium) containing edta as an anticoagulant and tubes with no anticoagulant after a fasting time of 3 hr . Within 30 min, the blood samples were centrifuged at 1,500 g for 10 min at 4c, and the serum and plasma were harvested and stored at 20c until the day of the analysis . Two milk samples of 60 ml (one at the morning milking and one at the evening milking) were also individually collected in a plastic vial on the same days as the blood samples . The first collection occurred on day 20 post - parturition to avoid a collection of colostrum . The milk samples were kept at 4c until the milk quality and composition analyses were conducted . For hormonal analyses, the milk samples were vortexed; aliquots (500 ml) of whole milk were obtained (into 1.5 ml eppendorf tubes, eppendorf, hamburg, germany) and frozen at 20c until analysis . The milk samples were analyzed for their fat, lactose, protein, solids - non - fat (snf), total solid (ts), freezing point depression (fpd), density, acidity, free fatty acids (ffa), casein with infrared reflectance spectroscopy (rev - milkoscan ft1, foss electric, hillerd, denmark) and scc using a somatic cell counter (fts / fcm combi 400, bentley, chaska, mn, u.s.a .) Within 24 hr . For microbial analyses, the raw milk samples were immediately diluted in sterile pbs (1 ml in 9 ml) and then homogenized in a vortex mixer, and serial 10-fold dilutions were made for colony countings . Aliquots of 0.1 ml of selected dilutions were plated for aerobic mesophilic colony counts using casein - peptone glucose yeast extract agar plates (pca: plate count agar, 1.05463.0500, merck, darmstadt, germany) followed by incubation at 37c for 24 hr . A pair of plates containing de man - rogosa - sharpe medium (mrs agar, 1.10660.0500, merck) was used . After inoculation, each plate was incubated in an anaerobic chamber using anaerogenic jars (an0035a, oxoid, basingstoke, hants, u.k .) With an anaerobic pack (cn0020c, oxoid) at 37c for 48 hr . Plates containing 30300 colonies were selected, and representative colonies of each morphotype previously characterized as lactobacilli were enumerated . Non - spore - former rods, gram - positive and catalase - negative isolates were regarded as lactobacilli and calculated for each sample . The milk samples were thawed overnight in the refrigerator and vortexed continuously to ensure sample uniformity . Skim milk was prepared by centrifuging 500 ml of whole milk at 16,000 g at 4c for 5 min . Milk and plasma adiponectin were measured using a commercially available goat - specific sandwich enzyme - linked immunosorbent assay (elisa) kit (goat adiponectin elisa kit; hangzhou eastbiopharm co., ltd ., yile road, china) in an automated microplate reader (x808, biotek el, winooski, vt, u.s.a . ). A goat resistin sandwich elisa kit (goat resistin elisa kit; hangzhou eastbiopharm co., ltd .) Was used to measure the resistin in the milk and plasma samples . The milk and plasma leptin levels were measured by sandwich elisa using a goat - specific elisa kit (goat leptin elisa kit; hangzhou eastbiopharm co., ltd . ). The plasma crp level was also measured using a commercially available goat - specific elisa kit (hangzhou eastbiopharm co., ltd . ). Serum total protein, cholesterol and total lipid concentrations were determined with commercial kits (ref t528 - 480; ref c507 - 480 and t526 - 480, respectively, teco diagnostics, anaheim, ca, u.s.a .) Following the manufacturer s instructions and using a spectrophotometer (uv 1601, shimadzu, kyoto, japan). The sensitivity, milk and serum intra - assay coefficients of the variation were 0.11 g / ml, 6% and 8% for adiponectin, 0.12 ng / ml, 5% and 6% for resistin, 0.27 ng / ml, 6.7% and 8% for leptin, and 0.26 g / ml, 4% for crp . Changes at different time points were determined using repeated measures test for gaussian distributed variables and friedman test for non - gaussian distributed variables . The data are given as the means sem (standard error of the mean). P values less than 0.05 were considered statistically significant in all tests, and p value with bonferroni correction was used for multiple comparisons (=0.01). The milk and plasma concentrations of the adipokines, milk composition and quality characteristics of the lactating goats on days 20, 35, 50, 65 and 80 postpartum are shown in table 1table 1.milk and plasma concentrations of adiponectin, leptin, resistin, crp, serum total protein, cholesterol and lipid concentrations, milk composition and quality parameter levels on lactating days 2080 of saanen goats (n=18)20 day35 day50 day65 day80 daymilk parametersmilk adipokinesmilk adiponectin (g / ml)2.4 0.23.2 0.43.6 0.23.7 0.23.9 0.2milk resistin (ng / ml)5.2 0.45.4 0.55.9 0.45.8 0.26.5 0.4milk leptin (ng / ml)7.6 0.511.0 0.89.0 0.38.6 0.28.6 0.3milk composition fat (%) 4.4 0.24.5 0.24.5 0.24.8 0.04.6 0.0protein (%) 3.4 0.03.3 0.13.5 0.13.6 0.13.7 0.1snf (%) 8.9 0.18.8 0.18.9 0.09.0 0.19.2 0.1ts (%) 13.3 0.213.1 0.213.4 0.213.9 0.413.2 0.2fpd (c)0.5 0.00.5 0.00.5 0.00.5 0.00.5 0.0density (kg / m)1,029.9 0.51,028.2 0.61,029.7 0.41,028.2 0.81,032.7 0.5acidity (sh)6.1 0,16.5 0.16.4 0.16.4 0.26.4 0.1ffa (meq / l)0.4 0.00.4 0.00.5 0.00.4 0.00.3 0.0casein (%) 2.6 0.02.6 0.02.7 0.02.8 0.02.9 0.0scc (10/ml)441.0 23.4303.7 16.5543.7 42.5686.7 47.7236.1 25.7total aerobic colony (10/ml)32 941 2.432 8.137 1.320 1.4lactobacillus (10/ml)1.1 0.21.3 0.41.5 0.80.22 0.10.13 0.05blood parametersplasma adiponectin (g / ml)26.2 4.227.8 4.530.8 2.133.0 3.028.8 4.0plasma resistin (ng / ml) 32.9 5.230.7 4.932.7 5.529.8 5.233.6 6.0plasma leptin (ng / ml)43.7 6.754.2 6.553.5 6.654.6 7.350.3 4.8plasma crp (mg / l)2.4 0.32.5 0.32.5 0.22.6 0.32.7 0.4serum total protein (g / l)57 2.060 2.165 2.463 2.258 1.1serum cholesterol (mmol / l)1.8 0.01.6 0.01.3 0.11.4 0.01.2 0.0serum total lipid (g / l)1.3 0.01.6 0.01.8 0.02.1 0.12.2 0.0a) significantly (p<0.01) different from the observed values for 20 post - partum lactation days . Data are given as the mean standard error .. non - significant differences in milk and plasma resistin, crp, total protein, milk fat, lactose, ts, fpd, scc, the total aerobic colony count and lactobacilli were observed on days 20, 35, 50, 65 and 80 postpartum (table 1). Lactating goats had significantly higher milk adiponectin levels on days 50 (p<0.003), 65 (p<0.002) and 80 (p<0.002) postpartum than on day 20 (table 1). The milk leptin levels were lower on day 20 than on days 35 (p<0.005), 50 (p<0.008), 65 (p<0.01) and 80 (p<0.01; table 1). The plasma adiponectin levels on days 50, 65 and 80 were higher (p<0.002, p<0.001 and p<0.01, respectively) than those on day 20 (table 1). The plasma leptin levels were lower on day 20 than on days 35 (p<0.01), 50 (p<0.01), 65 (p<0.01) and 80 (p<0.01; table 1). The serum cholesterol levels on day 20 were higher than those on days 35 (p<0.01), 50, 65 and 80 (p<0.000), and the serum total lipid levels on day 20 were lower than those on days 35 (p<0.000), 50, 65 and 80 (p<0.000; table 1). The percentage of milk protein was higher on days 65 (p<0.01) and 80 (p<0.000) than on day 20 (table 1). Milk snf and density levels were higher on day 80 than on day 20 (p<0.02 and p<0.000; table 1). Milk acidity levels were lower on day 20 than on days 35 (p<0.001), 50 (p<0.005), 65 (p<0.000) and 80 (p<0.000) postpartum (table 1). Milk ffa level was lower on day 80 than on day 20 postpartum (p<0.01; table 1). The goats had a significantly lower milk casein level on day 20 than on days 50 (p<0.01), 65 (p<0.000) and 80 (p<0.000; table 1). A) significantly (p<0.01) different from the observed values for 20 post - partum lactation days . A correlation analysis revealed a positive correlation between milk concentrations of adiponectin, leptin and resistin (p<0.05; table 2table 2.interrelationships between milk adiponectin, leptin and resistin concentrations and the relationships of milk adiponectin, leptin and resistin with plasma levels and plasma crp, serum total protein, cholesterol and lipid concentrations in lactating goatsmilk adiponectinrmilk resistinrmilk leptinrplasma adiponectinrplasma resistinrplasma leptinrplasma crprserum total proteinrserum cholesterolrserum total lipidrmilk adiponectin-0.500.490.550.580.480.480.280.200.15milk resistin 0.50 - 0.490.540.590.490.480.370.080.17milk leptin0.490.49 - 0.640.680.630.590.160.230.14a) p<0.05, b) p<0.01 . ). There were also positive correlations between the milk and plasma concentrations of these three adipokines (table 2). Milk adiponectin level positively correlated with plasma adiponectin, leptin and resistin levels (p<0.05; table 2). Milk resistin level positively correlated with plasma adiponectin (p<0.05), leptin (p<0.01) and resistin levels (p<0.05; table 2). Milk leptin level also positively correlated with plasma adiponectin and resistin levels (p<0.01; table 2). There was also a positive correlation between plasma crp level and milk leptin and resistin (p<0.05) concentrations and an inverse correlation between milk adiponectin and plasma crp concentrations (table 2). There was no correlation between milk concentrations of these adipokines and serum total protein, cholesterol and total lipid levels (table 2). A significant negative correlation was noted between milk adiponectin level and its scc (p<0.05), whereas no relationship was found between milk adiponectin level and its composition parameters (table 3table 3 . The relationships of goat milk adiponectin, leptin and resistin concentrations with milk quality and compositionfatrlactoserproteinrsnfrtsrfpdrdensityracidityrffarcaseinrsccrtotal aerobic colonyrlactobacillusrmilk adiponectin0.220.270.330.020.240.010.030.050.160.360.470.140.07milk resistin 0.010.020.190.220.090.010.300.550.000.250.020.290.02milk leptin 0.210.100.170.380.070.000.380.300.240.130.330.290.01a) p<0.05 . ). Non - significant correlations were observed between milk resistin and leptin concentrations and milk components, scc, total aerobic colony and lactobacillus count (table 3). A) p<0.05, b) p<0.01 . The 20-, 35-, 50-, 65- and 35-day body weight and bcs of goats were 42.5 1.6, 43.00 2.1, 44.50 2.4, 45.65 2.5 and 50.00 2.3 kg, and 3.31 0.1, 3.57 0.2, 3.62 0.2, 3.94 0.4 and 4.20 0.4, respectively and not statistically different . Non - significant correlations were observed between milk adipokine concentrations and body weights and bcs . This is the first report of the adiponectin and resistin concentrations in the milk of saanen goats . Leptin gene expression in the mammary gland of alpine goats was reported by bonnet et al . . Leptin concentrations were also previously reported in the milk of mixed - parity boer and boer crossbred meat - type goats by whitley et al . . In this study, we measured the leptin levels in lactating saanen goats and confirmed the presence of leptin in goat milk . Our data indicate that goat milk and plasma adiponectin and leptin concentrations increased, whereas no changes were observed in the resistin levels during a lactation period of 2080 days . The observed increase in the milk adiponectin concentration during days 2080 of the lactation period has also been reported in humans by ilcol et al ., weyermann et al ., bronsky et al . And martin et al . In good accordance with previous reports on humans, the adiponectin concentration in goat milk correlated positively with plasma adiponectin levels . The significant association between milk and plasma adiponectin concentrations indicates that circulating adiponectin is likely to be the major source of milk adiponectin . The mammary gland is not a meaningful source of adiponectin, its expression being 0.05% that of adipose tissue . The concentrations of leptin in goat milk and plasma were lower on day 20 than on days 35, 50, 65 and 80 days . These results are similar to those reported in mixed - parity boer and boer crossbred meat - type goats . The presence of a significant association between milk and plasma leptin concentrations during days 20 to 80 of lactation indicates that circulating leptin may be the major source of milk leptin . The observed relationship between milk and plasma leptin concentrations during days 20 to 80 of lactation has also been reported in humans by ucar et al . And ilcol et al . . As the number of lactation days increased from 20 to 80, non - significant differences were observed in the milk and plasma resistin concentrations of saanen goats . . Demonstrated that milk resistin concentrations were highest in colostrum, decreased rapidly during postpartum days 414 and remained low during postpartum days 15180 . The positive correlation between these three adipokine concentrations in goat milk in the current study during days 20 to 80 of lactation is also in good accordance with a previous observation in cord blood, milk and blood [14, 18, 40]. However, an inverse relationship between the resistin concentrations and both the leptin and adiponectin concentrations in milk and plasma was observed in some previous studies on humans [28, 29]. These differences between the results of the current study and those of ilcol et al . [28, 29] may be due to changes in regulatory mechanisms and factors for circulating adiponectin, leptin and resistin concentrations in goats and humans . Our results show that the circulatory concentrations of these three adipokines are interrelated in days 20 to 80 of the lactation period of saanen goats . It appears that the changes in the milk and plasma adiponectin concentrations coincide with changes in the plasma leptin and resistin concentrations . Adiponectin, leptin and resistin hormones are secreted biologically active forms into milk and may transiently regulate the activities of various tissues until the endocrine system of the neonate begins to function . These bioactive milk peptides also play important roles, such as energy intake and systemic and local imflammatory status . [5, 15, 33]. At this point, another important focus of this study was a positive correlation between crp and these three adipokines . Crp, a marker of systemic inflammation, was known as a stimulator of monocytes and macrophages [31, 34]. There were a positive correlation between the crp and leptin and resistin concentrations in goat milk and an inverse correlation between crp and milk adiponectin, consistent with previous studies in humans [14, 28, 39]. It not only regulates t - cell proliferation and activation but also influences cytokine production from t lymphocytes [9, 16]. Furthermore, ble et al . Demonstrated a direct crp - stimulatory activation of leptin, independent of il-6 or other proinflammatory cytokines in humans . The inverse relationship between crp and milk adiponectin in this study is in strong accordance with previous studies on humans that report that proinflammatory factors suppress the adiponectin production of adipocytes [21, 25, 26, 34, 42]. Resistin, mononuclear cells and macrophages, other major sources of circulating resistin, have also been implicated in the inflammatory response of humans . In good accordance with recent studies on human milk [11, 14, 23], we observed that plasma crp correlated positively with milk resistin . Scc is recognized as a reliable indicator of animals udder health (local inflammation) and milk quality and changes in their milk composition . The milk somatic cells include leucocytes, neutrophils, macrophages, lymphocytes, erythrocytes and epithelial cells . Moreover, a high scc is directly related to inverse effects on human health, including poor farm hygiene, antibiotic residues and the presence of pathogenic bacteria and toxins in milk [27, 35]. The inverse relationship between adiponectin and scc or crp may be related to the fact that adiponectin gene expression is decreased by oxidative stress or a pro - inflammatory state . In this study, no relation was observed between these three adipokines and the total aerobic colony count, which represents the total amount of viable microorganisms that could grow aerobically on plate - count agar, and the lactobacillus count . Lactobacilli, non - pathogen microorganisms, may possess potentially therapeutic properties, including anti - inflammatory and anti - cancer activities . Protective anti - tumor and anti - cancer effects of some strains of these bacteria were demonstrated in mice . A recent study reported that there may be a relationship between lactobacilli and the health of bovine udders . In the current study, we did not find a relationship between lactobacilli and these milk adipokines . We also determined whether the milk levels of leptin, adiponectin and resistin are related to the milk composition of lactating goats . However, no correlation was observed between the milk concentrations of these major adipokines and milk composition . In conclusion, the current study is the first to show adiponectin and resistin concentrations in the milk of saanen goats during days 20 to 80 of the lactation period . The data from the current study show interrelationships between the milk concentrations of adiponectin, leptin and resistin and significant positive relationships between the milk and plasma concentrations of these three major adipokines during days 20 to 80 of the lactation period in goats . The concentrations of leptin and resistin in goat milk are also positively related to the plasma crp concentrations, whereas the milk adiponectin concentration is inversely related to the plasma crp concentration and milk ssc . The findings in this study indicate a possible role of these three adipokines in the inflammatory status of goat milk, but more in - depth analyses are necessary to determine the mechanism and to better define their function.
Twelve - month remission is defined as time to 365 days of continuous seizure freedom . Second treatment failure is defined as withdrawal of a treatment, or addition of a drug, which may be due to inadequate seizure control, unacceptable adverse events, or both . The methods for the sanad trial have been published elsewhere . In summary, patients were eligible for inclusion if, in the previous year, they had a history of at least 2 clinically definite unprovoked seizures and they were at least 5 years old . Patients were recruited into sanad arm a if the recruiting clinician considered carbamazepine to be the optimal standard treatment option . Patients were then allocated to start treatment with carbamazepine, gabapentin, lamotrigine, oxcarbazepine, or topiramate . Patients were eligible for inclusion in arm b if the recruiting clinician regarded valproate the standard treatment option . One protocol was used for both arms a and b. our approach was similar to that published previously, and our list of potential prognostic factors included the following: sex, history of at least one febrile seizure (associated with fever but without evidence of intracranial infection or defined cause), first - degree relative with epilepsy, age at first treatment failure, time on randomized (first) treatment, neurologic insult, total number of tonic - clonic seizures ever at first treatment failure, reason for first treatment failure (inadequate seizure control or adverse effects), seizure type, epilepsy type, eeg result at entry into the sanad trial, and ct or mri result at entry into sanad . Randomized drug was also considered as a prognostic factor to determine whether the outcomes were influenced by first drug . Patients were classified as having neurologic insult if they had learning disabilities (a history of requiring a remedial or additional teacher in more than 2 subjects, or who underwent a statement of their education needs, or attended a special school) or neurologic deficit (localizing neurologic signs resulting in functional impairment). Eeg was classified as normal, not done, nonspecific abnormality, or epileptiform abnormality (focal or generalized spikes or spike and slow - wave activity). Epilepsy type was classified as focal, generalized, or unclassified with the unclassified category representing uncertainty between focal - onset and generalized - onset seizures . Analyses, adjusted for multiple variables using cox proportional hazards modeling, determined variables associated with a greater likelihood of achieving the outcomes . Variable centering was used to diminish multicollinearity: binary independent variables were coded + 1/2 and 1/2 rather than 1 and 0; categorical independent variables were dummy - coded as usual, but instead of coding each response as 1 and 0, the values 1 1/m and 1/m were used, where m is the number of categories . Parsimonious multivariable models were produced with variable selection via backward elimination with akaike information criterion . All continuous variables were investigated using log and fractional polynomial transformations; selection was made via the akaike information criterion . Continuous variable results are presented as post hoc defined categorical variables with categories chosen according to knot positions for a spline model fit to the data . Schoenfeld residual plots and incorporation of time - dependent covariate effects were used to investigate the proportional hazards assumption of the cox model . Kaplan - meier curves were produced to show the unadjusted time to 12-month remission and time to second treatment failure after a first treatment failure . The discriminatory power and predictive accuracy of the models were assessed, as a method of internal validation, by the c statistic . This measures the proportion of patient pairs in which the predictions and outcomes are concordant . To assess the effect of factors on the different reasons for second treatment failure, subgroup analyses were performed: factors that predict the failure outcome were considered for patients whose first treatment failed due to inadequate seizure control and for patients whose first treatment failed due to unacceptable adverse effects . The sanad trial received appropriate multicenter and local ethics and research committee approvals, and was managed according to the medical research council's good clinical practice guidelines . Patients gave informed written consent to inclusion and to long - term follow - up . Outcomes are time to 12-month remission and time to second treatment failure, both measured from date of first treatment failure due to inadequate seizure control or unacceptable adverse events . Twelve - month remission is defined as time to 365 days of continuous seizure freedom . Second treatment failure is defined as withdrawal of a treatment, or addition of a drug, which may be due to inadequate seizure control, unacceptable adverse events, or both . The methods for the sanad trial have been published elsewhere . In summary, patients were eligible for inclusion if, in the previous year, they had a history of at least 2 clinically definite unprovoked seizures and they were at least 5 years old . Patients were recruited into sanad arm a if the recruiting clinician considered carbamazepine to be the optimal standard treatment option . Patients were then allocated to start treatment with carbamazepine, gabapentin, lamotrigine, oxcarbazepine, or topiramate . Patients were eligible for inclusion in arm b if the recruiting clinician regarded valproate the standard treatment option . Our approach was similar to that published previously, and our list of potential prognostic factors included the following: sex, history of at least one febrile seizure (associated with fever but without evidence of intracranial infection or defined cause), first - degree relative with epilepsy, age at first treatment failure, time on randomized (first) treatment, neurologic insult, total number of tonic - clonic seizures ever at first treatment failure, reason for first treatment failure (inadequate seizure control or adverse effects), seizure type, epilepsy type, eeg result at entry into the sanad trial, and ct or mri result at entry into sanad . Randomized drug was also considered as a prognostic factor to determine whether the outcomes were influenced by first drug . Patients were classified as having neurologic insult if they had learning disabilities (a history of requiring a remedial or additional teacher in more than 2 subjects, or who underwent a statement of their education needs, or attended a special school) or neurologic deficit (localizing neurologic signs resulting in functional impairment). Eeg was classified as normal, not done, nonspecific abnormality, or epileptiform abnormality (focal or generalized spikes or spike and slow - wave activity). Epilepsy type was classified as focal, generalized, or unclassified with the unclassified category representing uncertainty between focal - onset and generalized - onset seizures . Analyses, adjusted for multiple variables using cox proportional hazards modeling, determined variables associated with a greater likelihood of achieving the outcomes . Variable centering was used to diminish multicollinearity: binary independent variables were coded + 1/2 and 1/2 rather than 1 and 0; categorical independent variables were dummy - coded as usual, but instead of coding each response as 1 and 0, the values 1 1/m and 1/m were used, where m is the number of categories . Parsimonious multivariable models were produced with variable selection via backward elimination with akaike information criterion . All continuous variables were investigated using log and fractional polynomial transformations; selection was made via the akaike information criterion . Continuous variable results are presented as post hoc defined categorical variables with categories chosen according to knot positions for a spline model fit to the data . Schoenfeld residual plots and incorporation of time - dependent covariate effects were used to investigate the proportional hazards assumption of the cox model . Kaplan - meier curves were produced to show the unadjusted time to 12-month remission and time to second treatment failure after a first treatment failure . The discriminatory power and predictive accuracy of the models were assessed, as a method of internal validation, by the c statistic . This measures the proportion of patient pairs in which the predictions and outcomes are concordant . To assess the effect of factors on the different reasons for second treatment failure, subgroup analyses were performed: factors that predict the failure outcome were considered for patients whose first treatment failed due to inadequate seizure control and for patients whose first treatment failed due to unacceptable adverse effects . The sanad trial received appropriate multicenter and local ethics and research committee approvals, and was managed according to the medical research council's good clinical practice guidelines . Patients gave informed written consent to inclusion and to long - term follow - up . Figure 1 shows the flow of the 2,627 patients recruited into arms a and b of the sanad trial . After a first treatment failure, 147 patients did not start another aed . These patients were included in the analysis of time to 12-month remission but excluded from the analysis of time to second treatment failure . Of these patients, 130 had withdrawn from their randomized treatment because of unacceptable adverse events, and 17 had withdrawn because of inadequate seizure control . Carbamazepine, gabapentin, lamotrigine, oxcarbazepine, and topiramate were randomized drugs in arm a. lamotrigine, topiramate, and valproate were randomized drugs in arm b. for this reason, the numbers randomized varied across the drugs . In addition, oxcarbazepine was only added to arm a midway through the trial, hence fewer patients were randomized to it . A total of 1,065 patients were included in the analysis of time to 12-month remission, of whom 535 had a 12-month remission . Nine hundred twenty - eight patients were included in the analysis of time to second treatment failure, of whom 356 had a second treatment failure . Characteristics of patients included in time to 12-month remission analysis are summarized in table 1 . Patient characteristics for patients with a first treatment failure table e-1 (on the neurology web site at neurology.org) summarizes the treatments that patients were switched to after the first failure . After treatment failure on carbamazepine, oxcarbazepine, or valproate, the most likely treatment switch was to lamotrigine . In patients for whom gabapentin, lamotrigine, and topiramate failed, the kaplan - meier curve for time to 12-month remission after a first treatment failure for any reason can be seen in figure e-1 . Approximately 30% of patients failing their first treatment achieved 12-month remission immediately after the first failure . At 5 years, overall, 70% of patients achieved a 12-month remission: 65% with a first failure due to inadequate seizure control and 80% with a first treatment failure due to unacceptable adverse events . Results for the parsimonious multivariable model for time to 12-month remission after first treatment failure are summarized in table 2 (see table e-2 for regression coefficients and standard errors .) The c statistic for the model was 0.6 . This means that, for a random pair of patients, the probability of the patient who achieved 12-month remission first having the shorter predicted probability of achieving 12-month remission is 60%, which suggests low predictive utility . Multivariable results for time to 12-month remission after first treatment failure initial aed was not significant univariately and was not included in the multivariable model . Patients whose first treatment failed due to unacceptable adverse events were more likely to achieve 12-month remission after a first treatment failure than those whose treatment failed due to inadequate seizure control . Twelve - month remission was more likely in men than in women, more likely in patients older than 45 years than those younger than 11 years, and more likely for patients with a shorter duration of treatment with the first aed . The occurrence of tonic - clonic seizures (primary or secondary generalized) on first aed was associated with a lower probability of subsequent 12-month remission . The combination of seizure types that patients had experienced on entry to the sanad trial was also of prognostic importance: 12-month remission was more likely in patients with generalized tonic - clonic seizures than in those with focal and secondary generalized seizures, while the latter were more likely to have a 12-month remission than those with focal seizures without secondary generalization . To illustrate the range of remission rates predicted by the multivariable model, figure 2 shows estimates of the proportion of patients achieving 12-month remission 1 and 3 years after first treatment failure . Patients were assumed to be male, to have no neurologic insult, and to have spent 6 months on the randomized treatment at treatment failure . The other variables were altered according to categories of interest (e.g., age as 10 and 40 years). T - c: number of tonic - clonic seizures before first treatment failure; reason: first treatment failure reason (isc = inadequate seizure control; uae = unacceptable adverse events); s. type: seizure type (scgtc = simple or complex partial with secondary generalized tonic - clonic seizures; gen . T - c = generalized tonic - clonic seizures only); ct / mri (norm = normal result; ab = abnormal result). The kaplan - meier curve for time to second treatment failure after a first for any reason can be seen in figure e-2 . Of patients whose first treatment failed, approximately 20% had another treatment failure by 6 months and approximately 25% by 1 year . At 3 years, overall, approximately 40% had a second treatment failure, while 45% with a first failure due to inadequate seizure control and 30% with a treatment failure due to unacceptable adverse events had a second treatment failure by 3 years after a first treatment failure . The first is for time to second treatment failure irrespective of the reason for first treatment failure (inadequate seizure control or adverse events). This model includes number of tonic - clonic seizures before first failure, ct / mri results, and reason for first failure . This means that, for a random pair of patients, the probability of the patient who had a second treatment first having the shorter predicted probability of second treatment failure is 60%, which suggests low predictive utility . Once again multivariable results for time to second treatment failure after first treatment failure the second model is for patients with a first failure due to inadequate seizure control and the third for patients with a first failure due to adverse events . As might be anticipated, these models are quite different . The model including patients with a first failure due to inadequate seizure control includes age and ct / mri results, and has a c statistic of 0.6, suggesting low predictive utility . The model including patients with a first failure due to adverse effects includes number of tonic - clonic seizures before first treatment failure and eeg, and has a c statistic of 0.6, suggesting low predictive utility . Risk estimates for stratified groups of patients whose first treatment failed due to unacceptable adverse events can be seen in table e-6 . The kaplan - meier curve for time to 12-month remission after a first treatment failure for any reason can be seen in figure e-1 . Approximately 30% of patients failing their first treatment achieved 12-month remission immediately after the first failure . At 5 years, overall, 70% of patients achieved a 12-month remission: 65% with a first failure due to inadequate seizure control and 80% with a first treatment failure due to unacceptable adverse events . Results for the parsimonious multivariable model for time to 12-month remission after first treatment failure are summarized in table 2 (see table e-2 for regression coefficients and standard errors .) The c statistic for the model was 0.6 . This means that, for a random pair of patients, the probability of the patient who achieved 12-month remission first having the shorter predicted probability of achieving 12-month remission is 60%, which suggests low predictive utility . Multivariable results for time to 12-month remission after first treatment failure initial aed was not significant univariately and was not included in the multivariable model . Patients whose first treatment failed due to unacceptable adverse events were more likely to achieve 12-month remission after a first treatment failure than those whose treatment failed due to inadequate seizure control . Twelve - month remission was more likely in men than in women, more likely in patients older than 45 years than those younger than 11 years, and more likely for patients with a shorter duration of treatment with the first aed . The occurrence of tonic - clonic seizures (primary or secondary generalized) on first aed was associated with a lower probability of subsequent 12-month remission . The combination of seizure types that patients had experienced on entry to the sanad trial was also of prognostic importance: 12-month remission was more likely in patients with generalized tonic - clonic seizures than in those with focal and secondary generalized seizures, while the latter were more likely to have a 12-month remission than those with focal seizures without secondary generalization . To illustrate the range of remission rates predicted by the multivariable model, figure 2 shows estimates of the proportion of patients achieving 12-month remission 1 and 3 years after first treatment failure . Patients were assumed to be male, to have no neurologic insult, and to have spent 6 months on the randomized treatment at treatment failure . The other variables were altered according to categories of interest (e.g., age as 10 and 40 years). T - c: number of tonic - clonic seizures before first treatment failure; reason: first treatment failure reason (isc = inadequate seizure control; uae = unacceptable adverse events); s. type: seizure type (scgtc = simple or complex partial with secondary generalized tonic - clonic seizures; gen . T - c = generalized tonic - clonic seizures only); ct / mri (norm = normal result; ab = abnormal result). The kaplan - meier curve for time to second treatment failure after a first for any reason can be seen in figure e-2 . Of patients whose first treatment failed, approximately 20% had another treatment failure by 6 months and approximately 25% by 1 year . At 3 years, overall, approximately 40% had a second treatment failure, while 45% with a first failure due to inadequate seizure control and 30% with a treatment failure due to unacceptable adverse events had a second treatment failure by 3 years after a first treatment failure . The first is for time to second treatment failure irrespective of the reason for first treatment failure (inadequate seizure control or adverse events). This model includes number of tonic - clonic seizures before first failure, ct / mri results, and reason for first failure . This means that, for a random pair of patients, the probability of the patient who had a second treatment first having the shorter predicted probability of second treatment failure is 60%, which suggests low predictive utility . Once again, type of initial aed was not significantly associated with the outcome . Multivariable results for time to second treatment failure after first treatment failure the second model is for patients with a first failure due to inadequate seizure control and the third for patients with a first failure due to adverse events . As might be anticipated, these models are quite different . The model including patients with a first failure due to inadequate seizure control includes age and ct / mri results, and has a c statistic of 0.6, suggesting low predictive utility . The model including patients with a first failure due to adverse effects includes number of tonic - clonic seizures before first treatment failure and eeg, and has a c statistic of 0.6, suggesting low predictive utility . Risk estimates for stratified groups of patients whose first treatment failed due to unacceptable adverse events can be seen in table e-6 . Numerous factors contribute to the multivariable model for 12-month remission, highlighting the heterogeneity of epilepsy, but also highlighting the prognostic importance of information collected in routine clinical practice . The model is able to stratify patients, and the estimates for 12-month remission rates could be used in routine clinical practice to inform likely outcomes . The model published here has a number of similarities to the model for time to 12-month remission from randomization in sanad . Unsurprisingly, reason for first treatment failure is of prognostic importance as is duration of first treatment . Early treatment failure is more likely to be due to adverse effects, so duration of first treatment and reason for first treatment failure are likely to be correlated, but nonetheless, both factors were included in the multivariable model . While broad epilepsy type (focal vs generalized) was not included in the multivariable model, this was, in part, accounted for by seizure type, which was included . Also, the occurrence of tonic - clonic seizures (focal or generalized in onset) on first treatment was prognostic as was age . The eeg result was not associated with 12-month remission, which is surprising because eeg abnormality was found to be associated with seizure recurrence risk in other studies . The most likely explanation is that the eeg data used were collected at entry into sanad . Future studies assessing outcome after a first treatment failure need to undertake eegs at that time point to assess their prognostic importance . We also found that 12-month remission was more likely in men than in women, which was also established when the sanad arm a data were modeled for time to 12-month remission from initiating treatment (randomization). This finding remains mostly unexplained because there was no significant difference in the way men and women were dosed, and it is unclear whether this finding represents differences in the way that men and women are managed, or whether this represents an underlying important biological difference between the sexes that influences drug response . A study in children also found sex to be significant; the authors showed that discontinuation of aeds in seizure - free children was less likely to succeed if the patient was female, had an abnormal neurologic examination, seizure onset of less than 120 months, and had focal seizures . It is important to note that first aed was not included in the model, highlighting that clinical factors have a more important impact on outcome than choice of first drug . This should not be surprising because differences found among drugs have been small and drug development programs have retreated to finding noninferiority as opposed to superiority for new treatments . For time to second treatment failure after a first treatment failure, we have produced 3 models . The first examines time to a second treatment failure irrespective of the reason for a first treatment failure . The models assessing subgroups according to reason for first treatment failure give quite different results . The sanad trial was not designed to address the question considered here . Although patients were followed up regardless of outcome, it is possible that data collection for the outcomes examined in this report may not have been as complete or accurate as for the primary outcomes in the trial . Some have criticized the fact that sanad recruited a heterogeneous group of patients rather than specific seizure types or epilepsy syndromes; however, the strength of this approach is illustrated in this report and in our previous reports modeling data from sanad . Sanad was an unblinded trial, which could have influenced outcome assessment; for example, decisions as to whether a treatment had failed, although examination of dosing data indicates that reasonable doses were tried before a decision was made that treatment had failed . While randomized controlled trials are the best methodology for assessing treatment effects, they might recruit a selected population, which might bias estimates of prognosis . Participants were seen predominantly by neurologists experienced at identifying and classifying seizures, but a further challenge in outpatient - based studies of seizures and epilepsy is that seizures are reported to the clinician by the patient and it is possible that patients underreport the occurrence of seizures . Validating patient reporting in an outpatient population with infrequent seizures is difficult and to date has not been done . The predictive ability of the models presented within this report is low, as illustrated by the low c statistics for each model . While there is increasing interest in stratified medicine and pharmacogenetics, it remains unknown as to whether genetic factors might account for some of the unexplained variability in our predictive models . In the future, they may help to improve the predictive accuracy of the models . The models presented here are the first to consider chance of remission and risk of second treatment failure after a first treatment failure . While we have presented a number of models that may inform patient counseling and treatment decisions, ideally these models require validation in other similar datasets, although few such datasets exist . In addition, the mechanisms by which the clinical factors identified in this report influence outcome remain poorly understood and require further assessment . This article presents the first report of prognostic modeling for time to 12-month remission and time to second treatment failure, both after a first treatment failure . Our results highlight the heterogeneity of outcome in epilepsy and the complex interplay among the factors that influence it . Patients with differing risks of 12 months of remission and treatment failure could be identified at the point in time when the initial aed treatment failed . Results will improve outcome prediction for patients, and allow better stratification of patients, including the identification of patients more likely to have poor treatment outcome for whom more intensive follow - up may be required . Similarly, the models may also aid in the identification of patients with poorer seizure control outcomes who might be eligible to participate in future trials of new treatments, for example surgical treatments such as deep brain stimulation, which might carry greater risk than drug treatment . This report presents independent research funded by the national institute for health research (nihr) under its programme grants for applied research programme (grant rp - pg-0606 - 1062). The views expressed are those of the author(s) and not necessarily those of the nhs, the nihr, or the department of health.
Varicella zoster virus (vzv) disease is one of the most frequent infectious complications after allogeneic hematopoietic stem cell transplantation (allo - hsct); during the first year, its incidence ranges from 13 to 55% (1). Although cutaneous herpes zoster is the most common clinical form of reactivation, allo - hsct recipients may present with fatal systemic dissemination (1,2). Among the various types of vzv infection, infections of the central nervous system (cns), especially meningitis and encephalitis, are only rarely reported; however, they represent severely life threatening conditions and may compromise the patient's quality of life (3). We herein report a case of post - transplant vzv meningitis and myelitis that developed after the cessation of immunosuppressant therapy, which was successfully treated with the intravenous administration of foscarnet . A 42-year - old chinese man with myelodysplastic syndrome (mds, raeb-2) underwent cord blood transplantation (cbt) from a japanese donor in october 2011 . The conditioning regimen consisted of total - body irradiation (tbi) (12 gy), cyclophosphamide (total dose, 120 mg / kg), and cytarabine (total dose, 12 g / m). Prophylaxis against graft - versus - host disease (gvhd) consisted of cyclosporine (csa) and a short course of methotrexate . Acyclovir (acv) (1,000 mg / day, orally) was administered from day -7 to 35 as prophylaxis against herpes virus . This was maintained at a reduced dose of 200 mg / day until day 213 . The patient's serum immunoglobulin g (igg) levels remained within the normal limits, and his peripheral post - transplant leukocyte counts remained within the normal range . On day 241 after cbt, the patient presented with blisters on his face and on day 245, a herpes zoster rash developed on his face, body, and extremities . The patient was clinically diagnosed with a systemic vzv infection and intravenous acv (5 mg / kg three times a day) was promptly administered . The cutaneous lesions were reduced on the 8th day after the initiation of acv treatment, and the treatment was then switched to oral valaciclovir . However, the patient developed a high fever, paralysis of the lower extremities, ischuria, neck stiffness, and spinal automatism on the second day of valaciclovir treatment . The patient's cerebrospinal fluid (csf) showed an increased number of mononuclear cells (77/l), an elevated protein level, and a normal glucose level . The enzyme immunoassay (eia) values in the patient's csf and serum were 2.56 and 13.5, respectively, for vzv - igg, and 5.32 and 3.90 for vzv - igm . Vzv - dna was not detected in a polymerase chain reaction (pcr). At 5.3, the presentation of spinal automatism, paralysis of the lower extremities and ischuria led to a diagnosis of vzv meningitis, myelitis, and radiculitis . Intravenous acv was resumed at an increased dose (10 mg / kg, three times a day), on the 12th day after the initial diagnosis of the vzv infection . Magnetic resonance imaging (mri) of the thoracic vertebrae and the lumbosacral spinal cord on days 6 and 7 after the resumption of acv, respectively, revealed no evident abnormalities . Seventeen days after the resumption of acv, a high mononuclear cell count (69/l) was still present in the patient's csf, and the patient's paralysis and ischuria showed no improvement . Acv was then switched to foscarnet (90 mg / kg, twice a day) on day 20 after the initial diagnosis . After 12 days of foscarnet treatment, the patient showed a complete recovery from ischuria and was able to walk by himself . The patient's csf showed a significantly decreased cell count, and foscarnet was discontinued after 51 days of treatment . On day 25 after the discontinuation of foscarnet therapy, the vzv - igm level in the patient's csf dropped to negative value of 0.78, whereas the vzv - igg level in the patient's csf rose to 7.53; in contrast, the value at time of the patient's diagnosis was 2.56 . The patient has been in complete remission without recurrent neurological symptoms for 3.5 years since transplantation . The long - term administration of acv after transplantation has been recommended to reduce the risk of vzv reactivation (1). A large retrospective study showed that the prophylactic administration of acv for 1 year reduced the incidence of vzv disease, and that the incidence was further decreased by the continuation of prophylaxis in patients who remained on immunosuppressive drugs (4 - 7). However, the cumulative incidence of vzv disease after the cessation of long - term acv is reported to be approximately 28.4% at 1 year (8), suggesting that further studies are required to evaluate the optimal duration of low - dose acv prophylaxis . Our patient had a normal peripheral blood lymphocyte count and serum immunoglobulin levels; thus, we discontinued prophylaxis with low - dose acv after the cessation of csa, which may have been associated with the reactivation of vzv . Furthermore, one report described the case of a patient without any known risk factors who developed vzv meningoencephalitis at 22 months after hsct following the cessation of immunosuppressants and prophylactic treatment with low - dose acv (9). These rare experiences suggest that vzv meningitis is a complication that may occur in any allo - hsct recipient at any time after transplantation . The initial symptoms of vzv meningitis and myelitis in post - transplantation patients vary and may include dermatomal zoster before the onset . Leveque et al . (10) reported two recipients who developed meningitis without skin manifestations . In contrast, fukuno et al . (11) described a bone marrow transplantation recipient in whom vzv meningoencephalitis occurred suddenly at 21 days after the completion of acv therapy for a localized cutaneous vzv infection . Our patient's disseminated skin lesions developed first, and his neurological symptoms became obvious as the skin rash disappeared after acv therapy . Thus, cns infections should always be considered when cns symptoms emerge without skin lesions or develop after a cutaneous vzv infection . Although we could not detect vzv dna in this patient's csf, the patient's csf was positive for anti - vzv igm and igg, which was helpful in establishing the diagnoses of vzv meningitis and myelitis . The detection of anti - vzv antibodies in the csf appears to have greater sensitivity in the diagnosis of vzv infections of the nervous system, than the detection of viral dna . Reported that vzv - dna positivity and the detection of antibodies in the csf can dramatically change during the clinical course of a viral infection (12). In this report, 0% and 61% of the csf samples that were collected within the first 7 days after the onset of rash were positive for anti - vzv antibodies and vzv dna, respectively however, after 7 days the rate of anti - vzv antibody - positive samples increased to 83%, while the rate of vzv dna - positive samples decreased to 25% . In our present case, csf sampling was performed on day 15 after the onset of rash, which was a relatively late time point . We hypothesize that the vzv dna in the csf decreased to an undetectable level while the csf became antibody - positive . Thus, both assays are recommended in the assessment of csf samples in order to accurately diagnose vzv infections (13). Vaccination may help decrease the risk of reactivation . Although the data on the safety and efficacy of live - attenuated varicella vaccines in allo - hsct recipients are limited (14,15), no serious adverse events were reported in a previous study involving 110 adult allo - hsct patients (16). Thus, the guidelines recommend varicella vaccination at 2 or more years after transplantation in allo - hsct patients without active chronic gvhd or ongoing immunosuppressive therapy (evidenced - based rating: ciii) (17,18). However, even at 2 years after hsct, 30 - 40% of the patients are considered to be ineligible for vaccination (19,20). For these recipients, the continuation of acv treatment for an extended period of time may be necessary to decrease the incidence of serious vzv reactivation . Intravenous acv (10 mg / kg, every 8 hours), is the recommended treatment for vzv infections of the cns (21). However, acv activation is dependent on intracellular virus - encoded thymidine kinase (tk), which implies that tk - deficient vzv strains are resistant to acv . Described a case in which a patient with vzv encephalitis was successfully treated with the addition of foscarnet to acv (22). The pharmacological action of foscarnet is tk - independent, which enables the elimination of acv - resistant vzv (23). In our case, acv appeared to be insufficient for improving the patient's neurological symptoms, and the patient was then successfully treated when acv was switched to foscarnet, suggesting that an acv - resistant vzv strain was involved in the patient's meningitis . It is possible that the strain of vzv that caused the meningitis was the same strain as that which caused the cutaneous infection, and the present patient might have been a late responder to acv . However, several reports have shown that the interval between the initiation of acv treatment and clinical improvement ranged from 3 to 9 days in patients with zoster- or varicella - induced myelitis (24 - 27). The paralysis and ischuria of the present patient showed no improvement during the 17 days in which he received a sufficient dose of intravenous acv, and the number of mononuclear cells in the patient's csf showed a minimal decrease . We therefore hypothesized that the strain of vzv that was responsible for the patient's meningitis was acv - resistant and that it was unlikely that the patient was a late responder to acv, and decided to switch the therapy to foscarnet . In conclusion, we described the case of a patient with vzv meningitis, radiculitis and myelitis after the cessation of immunosuppressant therapy and long - term acv prophylaxis . Vzv cns infections may be severe life threatening events and have the potential to compromise a patient's quality of life . Thus, when initial acv therapy is found to be insufficient for the treatment of vzv infections in transplant recipients under long - term acv prophylaxis, physicians should immediately consider changing to second line therapies, such as foscarnet . Further investigation is necessary to develop optimal prophylactic strategies and effective vaccination schedules may be needed to eradicate post - transplant vzv disease.
Endothelial dysfunction is an early predictor of cardiovascular disease [13], and might be the causal pathological mechanism of a variety of metabolic diseases, also referred to as the common soil hypothesis . Endothelial function has been shown to be impaired in patients with coronary artery disease, type ii diabetes mellitus, hypertension, obesity, renal failure, and hypercholesterolemia [59]. It is conceivable that improvement of endothelial function will be an important target in the treatment of these conditions . Therefore, availability of methodology that can be used to reliably assess the effects of (pharmacological) treatments on endothelial function is of critical importance . Endothelial dysfunction is commonly described as the inability of the artery to sufficiently dilate in response to an appropriate endothelial stimulus . It can be assessed by measurement of the arterial pulse wave at a finger artery or by the measurement of flow - mediated dilation (fmd) of the brachial artery after occlusion of the blood flow . Although the exact mechanisms causing fmd are not entirely known, the main mechanism inducing fmd is thought to be an increase in shear stress, leading to the release of nitric oxide from endothelial cells which causes blood vessel dilation . Currently, fmd is assessed clinically in a noninvasive manner using high - resolution ultrasound of the brachial artery . The technique is widely used and has been shown to be a suitable tool to assess endothelial dysfunction . However, the method has several disadvantages: it is operator dependent, and as fmd is measured at one arm only, there are no possibilities to correct for potential measurement - induced changes in the systemic hemodynamics, such as those resulting from alterations in the autonomous nervous system tone . To overcome these problems, the endopat was developed . This device allows non - invasive measurement of vasoreactivity without the disadvantages of conventional ultrasound measurement . The endopat detects plethysmographic pressure changes in the finger tips caused by the arterial pulse and translates this to a peripheral arterial tone (pat). Endothelium - mediated changes in vascular tone after occlusion of the brachial artery are reflecting a downstream hyperemic response, which is a measure for arterial endothelial function . Measurements on the contralateral arm are used to control for concurrent nonendothelium - dependent changes in vascular tone . In addition, the endopat provides a measure for arterial stiffness: the augmentation index (ai). In theory, the endopat could be a useful device in clinical research as the test is easy to perform, not operator - dependent, and with comprehensive automatic analysis . In a group of 89 adult patients suffering from chest pain, peripheral arterial tone correlated positively with fmd . In the framingham study, a significant inverse relation was observed between endothelial function as determined by the endopat (endoscore or reactive hyperemia index, rhi) and multiple cardiovascular risk factors (male sex, body mass index, total / hdl cholesterol, diabetes, smoking, and lipid - lowering treatment). The endoscore was reported to be significantly decreased in patients with coronary artery disease, hypertension, hyperlipidemia, diabetes, glucose intolerance, and tobacco users (group sizes of 15 to 70 subjects) [12, 1418]. Several endopat studies have demonstrated an improvement in endothelial function as a result of lifestyle modification (smoking cessation, and dietary change) [1922] or prolonged pharmacological intervention [23, 24]. However, there is only limited information on the performance of the endopat for repeated measurements in a relatively short time frame . This information is pertinent as in many clinical (pharmacology) studies repeated measures are performed in populations consisting of 6 to 12 subjects . Therefore, we performed a series of experiments to investigate the feasibility of the endopat to evaluate acute changes in endothelial function and arterial stiffness with repeated measurements and to assess the discriminating power of the endopat in different populations . First, we investigated the variability of endothelial function and arterial stiffness, as measured by the endopat, in patients with chronic kidney failure on three different days . Endothelial function, as assessed by high - resolution ultrasound, is known to be severely impaired in this patient population, despite intensive treatment (3060% reduction) [2528]. In addition, we measured endothelial function and arterial stiffness in patients with diabetes mellitus type 2, another patient population with a strongly reduced endothelial reactivity as determined using conventional techniques (3035% reduction) [2931]. Finally, we investigated the capability of the device to detect changes in endothelial function induced by two acute and robust interventions (smoking and glucose administration) in healthy volunteers . Cigarette smoking acutely impairs endothelial function in healthy volunteers by causing oxidative stress and reducing the production of nitric oxide due to the free radicals present in cigarette smoke [2, 32]. Also high blood glucose levels lead to an attenuated endothelial function, as has been demonstrated by plethysmography and high - resolution ultrasound [33, 34]. The experiments were approved by the medical ethics committee of leiden university medical center (lumc). Endothelial function and arterial stiffness were assessed in 6 renal patients (creatinine clearance between 30 and 70 ml / min) and 16 patients with diabetes mellitus type 2 (8 using metformin and 8 using metformin plus sulfonylurea). Intervention studies were performed in apparently healthy males and females, not using any medication . In all experiments, subjects were fasted for at least 3 hours before endopat measurements . Reactive hyperemia index (rhi), which is a measure for endothelial function, and augmentation index (ai), which is a measure for arterial stiffness, were assessed using the endopat 2000 device (itamar medical, israel). Both measures were calculated using a computerised automated algorithm (software version 3.1.2) provided with the device . Briefly, the subjects were in supine position for a minimum of 20 minutes before measurements, in a quiet, temperature - controlled (2124c) room with dimmed lights . The subjects were asked to remain as still as possible and silent during the entire measurement period . Each recording consisted of 5 minutes of baseline measurement, 5 minutes of occlusion measurement, and 5 minutes postocclusion measurement (hyperemic period). The occlusion pressure was at least 60 mmhg above the systolic blood pressure (minimally 200 mmhg, and maximally 300 mmhg). Endothelial function and arterial stiffness were investigated in six patients with chronic kidney failure (subject characteristics in table 1, glomerular filtration rate was estimated by calculation of creatinine clearance using a 24-hour urine collection). All measurements were performed in the morning . Per subject, 3 measurements were performed, separated by one to two weeks . Patients were allowed to use medication needed for their medical condition, except for corticosteroids and erythropoietic medication within one month before study participation . Endothelial function and arterial stiffness were investigated in 16 patients with diabetes mellitus type 2 (subject characteristics in table 2). All subjects were on oral antidiabetics to control glucose metabolism: 8 subjects were using metformin, and 8 subjects were using metformin plus sulfonylurea . Per subject, two endopat measurements were performed: one time during continuation of the antidiabetic therapy and one time after two weeks of therapy discontinuation, with the sequence randomized . Patients were allowed to use medication needed for their medical condition, except for medication known to affect glucose homeostasis (other than biguanides and sulphonylurea), anti - inflammatory drugs, nonselective beta blockers, oral anticoagulants, and systemic glucocorticoids or other immunosuppressive drugs . Six nonsmoking female subjects (mean age 23 3 years) participated in the oral glucose intervention study part . After the baseline endopat measurement was performed, an oral glucose solution (75 g glucose in 300 ml) was consumed within 4 minutes . At 30 minutes and 90 minutes after the oral glucose consumption six male cigarette smoking subjects (mean age 32 10 years) participated in this study part . Subjects refrained from smoking until at least 2 hours before the start of the study . After a baseline measurement was performed, the participants smoked a cigarette (tar 10 mg, nicotine 0.8 mg and carbon monoxide 10 mg) within 4 minutes . At 30 minutes and 90 minutes after smoking unpaired t - tests were used to compare rhi and ai between healthy volunteers and patients and between diabetic patients using metformin only and patients using metformin plus sulfonylurea, while paired t - tests were used to compare rhi and ai between diabetic patients who continued their medication and patients who discontinued their medication . The intervention experiments were carried out in groups of 6 healthy volunteers; a sample size based on the observed intraindividual variability in rhi and the level of impairment of endothelial function determined by conventional techniques (high - resolution ultrasound, plethysmography) in intervention studies as reported in literature . Our experiments were powered such that a group size of 6 would have 80% power to detect a 25% change in baseline rhi using a 2-sided alpha of 5% . Paired t - tests were used to compare the difference in rhi between baseline and the postintervention measurements, which was considered to be statistically significant when p value <0.05 . To assess the performance of the endopat, we investigated the variability of endothelial function (rhi) and arterial stiffness (ai) in patients with chronic kidney failure on three different days, separated by one to two weeks . Average rhi over three days was 2.9 1.4 (table 3). For most patients, the rhi values exceeded a value of 2 (range: from 1.7 to 5.5). Official reference values for rhi are not available, but in general rhi values below 2 are categorized as endothelial dysfunction, whereas higher rhi values are considered normal or improved endothelial function (itamar product information). The average intra - individual variability for the rhi was 13% (ranging from 1% to 29% for individuals, data not shown). This is in line with the expectation, as normal arterial stiffness is defined by an ai between 30% and 10%, increased arterial stiffness by an ai between 10% and 10%, and abnormal arterial stiffness by an ai above 10% . The mean intra - individual coefficient of variation was 37% (ranging from 13% to 67%, data not shown). These data indicate that whereas endothelial function is a relatively stable measure over a longer period of time, arterial stiffness as determined by the endopat is rather variable . Next, we measured endothelial function and arterial stiffness in patients with diabetes mellitus type 2, 8 subjects using metformin and 8 subjects using metformin plus sulfonylurea . Endothelial function and arterial stiffness were determined during continuation of the antidiabetic therapy and after two weeks of therapy discontinuation . Arterial stiffness, as determined by ai, was not different between patients using metformin or metformin plus sulfonylurea or between patients continuing and discontinuing antidiabetic medication (table 4: 5.9 9.4 versus 9.0 13.0 and 14.3 18.8 versus 16.3 16.0, resp . ). However, rhi was significantly higher in patients using a combination of metformin plus sulfonylurea, compared to patients using metformin only (table 3: 2.5 0.7 versus 1.8 0.3 in patients continuing therapy and 2.7 1.1 versus 1.8 0.4 in patients discontinuing therapy; p = 0.02 and 0.04 resp . ). The increasing effect of sulfonylurea treatment on rhi was independent on continuation or discontinuation of the use of antidiabetics . Finally, we investigated the capability of the endopat to detect changes in endothelial function induced by two acute interventions in healthy volunteers . Neither the oral glucose load nor the smoking intervention resulted in significant effects on endothelial function (figure 1). For the glucose intervention, the difference in rhi from baseline measurement was 0.08 0.50 (95% ci, confidence interval: from 0.44 to 0.60) for the 30 min assessment and 0.44 0.86 (95% ci: from 0.46 to 1.34) for the 90 min assessment . For the smoking intervention, the difference in rhi from baseline measurement was 0.49 0.92 (95% ci: from 0.47 to 1.46) for the 30 min assessment and 0.39 0.53 (95% ci: from 0.16 to 0.95) for the 90 min assessment . Ai and rhi were compared between the investigated patient groups and the healthy volunteer group . As expected, ai was higher in renal patients compared to healthy subjects (table 4: 26.1 13.9 in patients versus 6.0 14.2 in healthy volunteers, p = 0.001). Ai was also higher in diabetic patients compared to healthy subjects, independent of type of oral antidiabetics (metformin or metformin plus sulfonylurea) or continuation or discontinuation of therapy (table 4: 5.9 9.4, 9.0 13.0, 14.3 18.8, and 16.3 16.0, resp ., in patients versus 6.0 14.2 in healthy volunteers, 0.01 <p <0.05). However, there was no difference in rhi between the renal patients and the healthy volunteers (table 3: 2.9 1.4 in patients versus 1.8 0.5 in healthy volunteers, p = 0.15). Furthermore, rhi values did not differ between diabetic patients using metformin and healthy volunteers (table 3: 1.8 0.3 in patients continuing therapy and 1.8 0.4 in patients discontinuing therapy versus 1.8 0.5 in healthy volunteers). Rhi was significantly higher in diabetic patients using a combination of metformin plus sulfonylurea compared to healthy volunteers (table 3: 2.5 0.7 in patients continuing therapy and 2.7 1.1 in patients discontinuing therapy; p = 0.04 and 0.01 resp . Versus healthy volunteers). Endothelial dysfunction is present in several systemic pathological conditions [59], associated with considerable morbidity and mortality . As a consequence, endothelial dysfunction is expected to gain interest as potential target for (pharmaceutical) intervention within the coming years . Currently, endothelial function is assessed mainly by high - resolution ultrasound of the brachial artery . However, this technique has important practical limitations: it is strongly operator - dependent, and it offers no correction for autonomous activation of the nervous system, as vascular dilation is only studied in one arm . To overcome these problems, the endopat was developed, allowing noninvasive measurement of endothelial function via assessment of reactive hyperemia . Although in several studies the endopat appeared to be feasible to demonstrate improvement of endothelial function as a result of lifestyle modification or pharmacological intervention [1924], the information in literature on the performance of the endopat in intervention trials is limited . Therefore, we performed a series of experiments to investigate the feasibility of the endopat to evaluate acute changes in endothelial function with repeated measurements and to assess the discriminating power of the endopat for endothelial function and arterial stiffness in different populations . We assessed the variability of endothelial function (by rhi) and arterial stiffness (by ai), as measured by the endopat, in patients with impaired renal function on three different days . Next, we measured endothelial function and arterial stiffness in patients with diabetes mellitus type 2 . Finally, we investigated the applicability and feasibility of the endopat to detect changes in endothelial function in healthy volunteers after interventions known to be associated with robust acute changes in endothelial function in an adequately powered experiment . Generally, augmentation index, calculated from carotid, aortic, or radial artery pressure waves using conventional techniques, is a reliable and reproducible measure to define arterial stiffness . However, the influence of variables such as heart rate and vasomotor tone of the arterial system can affect the variability of the technique . We demonstrated that when using the endopat, the intra - individual variability in ai was substantial over a longer period of time (cv: coefficient of variation, 37%). This indicates that arterial stiffness as determined by the endopat is also not a stable measure, which limits its usefulness to assess the effects of (pharmacological) interventions . Arterial stiffness as measured by the endopat was higher in renally impaired patients with vascular disease compared to healthy subjects . This is in line with reports in literature in patient populations: compared to healthy volunteers, arterial stiffness is increased in a variety of pathological conditions, such as coronary artery disease, metabolic syndrome, and chronic kidney disease [3739]. Compared with arterial stiffness, rhi proved to be a more stable measure (cv 13%). Surprisingly, endothelial function, as determined by reactive hyperemia index, was not impaired in the renal patient group . Importantly, observed rhis in the patient population were scattered over a broad range, covering both endothelial dysfunction (rhi <2) and exceptionally good endothelial function (rhi> 3). Given the fact that all subjects were renally impaired and treated for hypertension, it is very unlikely that 4 out of 6 patients had an (exceptionally) good endothelial function . Obviously, all patients used medication with pertinent effects on endothelial function (table 1: statins, ace inhibitors, and calcium channel blockers), but literature data suggest that despite optimal (cardiovascular) therapy, a considerable increased risk for cardiovascular morbidity in this population still exists . Importantly, although most chronic kidney disease patients use antihypertensive medication and other drugs that could affect endothelial function (statins, potassium, and ace inhibitors), they still exhibit a significantly impaired endothelial function as demonstrated by laser doppler flowmetry (32% reduction). Interestingly, gordon et al . Reported that pulse contour analysis obtained by finger plethysmography, which is comparable with the endopat methodology, may not be suitable to measure endothelial function in subjects with extensive coronary artery disease, as no effect of administration of strong vasodilators (salbutamol and nitroglycerin) could be observed . We investigated whether the endopat could discriminate in vascular function between healthy volunteers and patients with diabetes mellitus type 2 . As expected, arterial stiffness was higher in diabetic patients compared to healthy subjects, irrespective of treatment with oral antidiabetics . However, endothelial function (as measured by the endopat) was not impaired in diabetic patients using metformin compared to healthy volunteers, neither during continuation of treatment nor after two weeks of treatment discontinuation . This is contrasting with literature, which demonstrates that endothelial function, measured using conventional techniques (endothelium - dependent flow - mediated dilatation of the brachial artery, by ultrasound), is substantially impaired in diabetic patients (reduction of endothelial function versus healthy controls or subjects with coronary artery disease without diabetes ranging from 27% to 43%) [2931]. This discrepancy could not be explained by an effect of treatment with oral antidiabetics, as rhi was assessed both during treatment continuation and after a two - week period of treatment discontinuation . Rhi was significantly increased in patients using a combination of metformin plus sulfonylurea, compared to healthy volunteers and to patients using metformin only . This stimulating effect of sulfonylurea treatment on rhi was still observed after two weeks of treatment discontinuation, implicating a long - lasting effect of sulfonylurea on endothelial function . This is remarkable as the general point of view is that the use of pancreatic -cell - specific sulfonylurea (i.e., glimepiride, as used by 6 out of 8 diabetic subjects in our study) does not affect endothelial function [4345]. Possibly, endothelial function as measured by the endopat (rhi) is a physiologically different process than endothelial function as measured by conventional techniques such as high - resolution ultrasound (endothelium - dependent fmd). The exact nature of this difference is currently unknown, and should be investigated in detail before the endopat can be considered a useful tool in drug development or clinical practice . We evaluated the performance of the endopat to detect the effects of two different acute interventions on rhi in healthy subjects . The literature shows that fmd decreases by 4065% after smoking one cigarette, which is detected directly after smoking and lasts for 1 hour [2, 32, 46, 47]. Also hyperglycaemia, induced by the administration of a standardised oral glucose load, has been reported to acutely lead to a 2545% impairment of endothelial function, as assessed by fmd or forearm blood flow plethysmography [33, 34, 48]. However, we were unable to replicate these findings on endothelial function using the endopat, demonstrating that the device is currently not suitable to detect acute changes in endothelial function after different robust interventions . There could be several explanations for our findings . In the automated analysis, the endopat software uses a fixed time frame during the hyperemic response to calculate the rhi . Inspection of the data and manual analysis of the rhi showed that the maximal hyperemic response does not always occur in the same time period after occlusion (data not shown), an observation that is supported by literature . For example, the time course of fmd is strongly influenced by age: comparison of young and older subjects indicates that the time frame to reach maximal vasodilatation after occlusion is significantly prolonged in older subjects . This may be remedied by refinement of the endopat software to allow for interindividual differences in hyperemic time course . Although inter - individual differences in hyperemic time course is a potentially confounding factor when using the automatic analysis, manual analysis of our data did not result in significantly different findings (data not shown). There are some indications that endothelial function is subject to a circadian rhythm, with a lower reactive hyperemic response in the morning, but this is not unambiguously supported [5154]. In fact, the presumed circadian variability is probably more related to changes in physical activity, blood pressure and shear stress, and changes in plasma lipids . Whatever the explanation may be, our experiments were performed within a short fixed time frame of maximally 2 hours, in a fasted condition and in complete rest, thereby reducing the influence of these confounding factors . As a consequence, it is unlikely that circadian variability has influenced our measurement outcomes . Finally, it is possible that previous experiments using ultrasound or plethysmography to assess the acute effect of an intervention on endothelial function are flawed because measurements were performed (in the majority of the cases) in the vasculature of one arm only, and thus relatively uncontrolled for concomitant systemic hemodynamic changes . We are well aware that the group sizes of our intervention experiments were small and that no formal control groups were included . However, the experiments were sufficiently powered to detect intervention - induced changes in endothelial function at effect sizes that are reported in literature using fmd or forearm blood flow plethysmography . In conclusion, whereas the reactive hyperemia index (a measure for endothelial function), as determined by the endopat, is rather stable over time, the augmentation index (a measure for arterial stiffness) showed substantial intra - individual variability, limiting its value for evaluation of (pharmacological) interventions . Surprisingly, the endopat did not demonstrate differences in endothelial function between healthy volunteers and renally impaired patients with known vascular disease or diabetic patients . In the latter patient group, an unexplained improving effect of sulfonylurea on reactive hyperemia index was demonstrated by the endopat . This could indicate that endothelial function as measured using the endopat might be physiologically different from endothelial function as measured by conventional techniques . Furthermore, the endopat was not useful to detect the effect of robust interventions on endothelial function while the experiments were adequately powered . Taken together, our findings suggest that the endopat is at present not suitable to assess (changes in) endothelial function and arterial stiffness in populations with sizes that are commonly employed in clinical pharmacology studies.
The clustering of cardiovascular risk factors that includes central adiposity, hypertension, hyperglycemia, and high triglycerides (tg) with low high density lipoprotein cholesterol (hdl - c) levels is termed the metabolic syndrome (ms). Ms is known to strongly predict the long - term risk of diabetes and cardiovascular disease (cvd). Adipose tissue products are reported to affect systemic metabolism; among these are adiponectin, leptin, plasminogen activator inhibitor-1 (pai-1), resistin, inflammatory cytokines, and angiotensinogen . Adiponectin has recently attracted much attention with particular emphasis on the role of adiponectin in the regulation of insulin sensitivity and the development of insulin resistance . Plasma levels of adiponectin have also been reported to be significantly reduced in obese humans . Moreover, plasma adiponectin levels have been shown to be decreased in patients with type-2 diabetes mellitus (t2 dm), cvd, hypertension, and ms.[69] adiponectin activates adenosine mono - phosphate activated protein kinase and peroxisome proliferator activated receptor- in the liver and skeletal muscle, thereby stimulating phosphorylation of acetyl - coa carboxylase, fatty acid oxidation, thus decreasing tissue triglyceride (tg) content in muscle and liver . The expression levels of adipor1/r2 are also decreased in obesity, which reduces adiponectin sensitivity and finally leads to insulin resistance, the so - called vicious cycle . Adiponectin was demonstrated to strongly inhibit the expression of adhesion molecules, including intracellular adhesion molecule-1, vascular cellular adhesion molecule-1, and e - selectin . Thus, various studies have highlighted the potential antidiabetic, antiatherosclerotic and anti - inflammatory properties of adiponectin . Decreased levels of plasma adiponectin are associated with increased body mass index (bmi), decreased insulin sensitivity, less favorable plasma lipid profiles, increased levels of inflammatory markers and increased risk for the development of cvd . Therefore, adiponectin levels hold great promise for use in clinical application, serving as a potent indicator of underlying metabolic complications . Plasma pai-1 levels are elevated in obesity and insulin resistance, are positively correlated with features of the ms, and predict future risk for type 2 diabetes and cvd . Thus, pai-1 may contribute to the development of obesity and insulin resistance and may be a causal link between obesity and cvd. [1113] there are few studies which have evaluated adipokines in indian population. [1417] hence, we studied adiponectin and pai-1 levels and their correlation with various parameters in subjects with ms . This study was carried out at the department of endocrinology of a tertiary care center and details are provided in our previous publication in this journal . Subjects with age 30 years and 50 years (to exclude all postmenopausal women) were screened for the presence of ms according to international diabetes federation (idf) criteria as follows: central obesity (waist circumference males> 90 cm, females> 80 cm) plus any two of the following: raised triglycerides (> 150 mg / dl), reduced hdl - c (<40 mg / dl in men and <50 mg / dl in women), raised blood pressure (systolic 130 mm hg or diastolic 85 mm hg), raised fasting plasma glucose (fpg) (100 mg / dl). Age- and sex - matched healthy subjects were screened for the absence of ms . Only those cases with waist circumference below the idf criteria and absence of at least three of the four parameters a total of 50 drug - nave subjects with ms (25 males and 25 females) and 24 controls (12 males and 12 females) were included in the study . Subjects with hepatic disease, renal disease, other endocrine diseases, alcoholism, infectious diseases or receiving any medications were excluded from the study . Body fat measurement was done using inbody composition analyser - biospacer manufactured by m / s biodex medical systems inc . It measured waist hip ratio (whr), body fat mass (bfm), percent body fat (pbf) and basal metabolic rate (bmr). Fasting blood samples were drawn for the estimation of fpg, renal and hepatic parameters, a1c, lipid profile, highly sensitive c - reactive protein (hscrp) and fibrinogen . One aliquot of the sample was frozen at 80c for the measurement of plasma insulin, adiponectin and pai-1 . Adiponectin was measured with avibion human adiponectin (acrp30) elisa commercial kits supplied by orgenium laboratories business unit, finland, as per manufacturer's instructions . It had an assay range of 0.18515 ng / ml and a sensitivity of <0.3 ng / ml . Intra - assay precision was 10% and inter - assay precision was 12% . Pai-1 was measured with human pai-1 elisa (ea-0207) supplied by signosis biosignal capture (sunnyvale, ca, usa), as per manufacturer's instructions . It had an assay range of 0.320 ng / ml and a sensitivity of <0.79 ng / ml . Intra - assay and inter - assay precision was 15% . The homa model was used to calculate insulin resistance and insulin insensitivity . The formulae are as follows: where fi = fasting insulin in iu / ml and g = fasting glucose in mmol / l . The study was approved by the ethics committee of army hospital (research and referral), delhi cantt, and all subjects gave written informed consent . Statistical analysis was carried out using epi info 3.5.3 (cdc; atlanta; usa). If barlett's chi - square test for equality of population variances was <0.05, then kruskal wallis test was applied . This study was carried out in 50 cases of ms and 24 normal healthy controls . Basal characteristics of the cases and controls are shown in table 1 (also given in our previous publication). There were 37 (74%) cases with t2 dm and 13 (26%) cases with impaired glucose tolerance . Tg total cholesterol (tc) low density lipoprotein (ldl) and very low density lipoprotein (vldl) were significantly higher and hdl was significantly lower among cases than in controls . Most of the cases (28.56%) had four features of ms, followed by cases with all features (16.32%), and 6 (12%) cases had three features of ms [table 1]. Basic characteristics of cases and controls subjects with ms had significantly lower adiponectin levels than controls (4.01 2.24 vs. 8.7 1.77 g / ml; p <0.0001) [table 1]. There was no difference in adiponectin levels between sexes (5.23 3.12 vs. 5.71 2.65 g / ml; p = 0.49). Adiponectin levels according to the number of metabolic abnormalities in univariate regression analysis, adiponectin was negatively associated with age, bmi, bfm and pbf, and positively associated with bmr . Among the various parameters of ms, adiponectin was negatively associated with all parameters, except hdl - c with which it was positively associated . Adiponectin showed strong negative association with inflammatory markers (crp, fibrinogen) and procoagulant marker (pai-1). Adiponectin was positively associated with insulin secretion (homa - s) and negatively associated with insulin resistance (homa - ir) [table 2]. Univariate regression analysis of adipokines among all subjects multiple regression analysis showed that among the metabolic parameters, whr, fpg and tg maintained negative association with adiponectin even after adjustment for all metabolic variables . However, hdl and hypertension lost significance during multiple regression analysis [table 3]. Only bmi remained negatively associated with adiponectin when adjusted for anthropometric parameters, e.g. Bmr, bfm, and percent body fat, in multiple regression analysis [table 4]. Bmr showed positive association when adjusted with bmi, but lost significance when bfm was added . Similarly, pai-1 levels showed strong negative association with adiponectin [figure 2] even after adjustment with other parameters like homa - ir, crp, and fibrinogen [table 5]. Multivariate regression analysis of adipokines with metabolic parameters among all subjects multivariate regression analysis of adipokines with anthropometric parameters among all subjects correlation between adiponectin and pai-1 among all subjects multivariate regression analysis of adipokines with other parameters among all subjects receiver operating characteristic (roc) curve analysis revealed best prediction value of adiponectin at 6.7 g / ml with a sensitivity of 83%, specificity of 86%, accuracy of 85%, positive predictive value of 74%, negative predictive value of 84% and positive and negative likelihood ratios of 5.95 and 0.19, respectively (roc 0.934, se 0.0277, 95% ci = 0.8790.988). Subjects with ms had significantly higher pai-1 levels than controls (53.85 16.45 vs. 17.35 4.45 ng / ml; p <0.0001) [table 1]. There was no difference in pai-1 levels between sexes (8.59 4.42 vs. 8.21 4.44 ng / ml; p = 0.71). Pai-1 according to the number of metabolic abnormalities in univariate regression analysis, pai-1 was positively associated with bmi, bfm and pbf, and negatively associated with bmr . Among the various parameters of ms, pai-1 was positively associated with all parameters of ms, except hdl with which it was negatively associated . Pai-1 showed strong positive association with inflammatory markers (crp, fibrinogen), insulin resistance (fasting plasma insulin and homa - ir) and total and ldl cholesterol, but had strong negative association with adiponectin [table 2]. Multiple regression analysis of various metabolic parameters showed that whr and tg maintained positive association with pai-1 even after adjustment for all metabolic variables . However, hdl, fpg and hypertension lost significance during multiple regression analysis [table 3]. Only pbf remained positively associated with pai-1 when adjusted for anthropometric parameters, e.g. Bmr, bfm, and bmi, in multiple regression analysis [table 4]. Similarly, pai-1 levels showed strong positive association with fibrinogen even after adjustment with other parameters like homa - ir, crp, and fibrinogen [table 5]. Roc curve analysis revealed best prediction value of pai-1 at 25.0 ng / ml, with a sensitivity of 92%, specificity of 96%, accuracy of 95%, positive predictive value of 92%, negative predictive value of 96% and positive and negative likelihood ratios of 22.9 and 0.08, respectively (roc 0.975, se 0.0178, 95% ci = 0.9421.009). Subjects with ms had significantly lower adiponectin levels than controls (4.01 2.24 vs. 8.7 1.77 g / ml; p <0.0001) [table 1]. Adiponectin levels decreased with increasing number of metabolic abnormalities [figure 1]. There was no difference in adiponectin levels between sexes (5.23 3.12 vs. 5.71 2.65 g / ml; p = 0.49). Adiponectin levels according to the number of metabolic abnormalities in univariate regression analysis, adiponectin was negatively associated with age, bmi, bfm and pbf, and positively associated with bmr . Among the various parameters of ms, adiponectin was negatively associated with all parameters, except hdl - c with which it was positively associated . Adiponectin showed strong negative association with inflammatory markers (crp, fibrinogen) and procoagulant marker (pai-1). Adiponectin was positively associated with insulin secretion (homa - s) and negatively associated with insulin resistance (homa - ir) [table 2]. Univariate regression analysis of adipokines among all subjects multiple regression analysis showed that among the metabolic parameters, whr, fpg and tg maintained negative association with adiponectin even after adjustment for all metabolic variables . However, hdl and hypertension lost significance during multiple regression analysis [table 3]. Only bmi remained negatively associated with adiponectin when adjusted for anthropometric parameters, e.g. Bmr, bfm, and percent body fat, in multiple regression analysis [table 4]. Bmr showed positive association when adjusted with bmi, but lost significance when bfm was added . Similarly, pai-1 levels showed strong negative association with adiponectin [figure 2] even after adjustment with other parameters like homa - ir, crp, and fibrinogen [table 5]. Multivariate regression analysis of adipokines with metabolic parameters among all subjects multivariate regression analysis of adipokines with anthropometric parameters among all subjects correlation between adiponectin and pai-1 among all subjects multivariate regression analysis of adipokines with other parameters among all subjects receiver operating characteristic (roc) curve analysis revealed best prediction value of adiponectin at 6.7 g / ml with a sensitivity of 83%, specificity of 86%, accuracy of 85%, positive predictive value of 74%, negative predictive value of 84% and positive and negative likelihood ratios of 5.95 and 0.19, respectively (roc 0.934, se 0.0277, 95% ci = 0.8790.988). Subjects with ms had significantly higher pai-1 levels than controls (53.85 16.45 vs. 17.35 4.45 ng / ml; p <0.0001) [table 1]. Pai-1 levels increased with increasing number of metabolic abnormalities [figure 3]. There was no difference in pai-1 levels between sexes (8.59 4.42 vs. 8.21 4.44 ng / ml; p = 0.71). Pai-1 according to the number of metabolic abnormalities in univariate regression analysis, pai-1 was positively associated with bmi, bfm and pbf, and negatively associated with bmr . Among the various parameters of ms, pai-1 was positively associated with all parameters of ms, except hdl with which it was negatively associated . Pai-1 showed strong positive association with inflammatory markers (crp, fibrinogen), insulin resistance (fasting plasma insulin and homa - ir) and total and ldl cholesterol, but had strong negative association with adiponectin [table 2]. Multiple regression analysis of various metabolic parameters showed that whr and tg maintained positive association with pai-1 even after adjustment for all metabolic variables . However, hdl, fpg and hypertension lost significance during multiple regression analysis [table 3]. Only pbf remained positively associated with pai-1 when adjusted for anthropometric parameters, e.g. Bmr, bfm, and bmi, in multiple regression analysis [table 4]. Similarly, pai-1 levels showed strong positive association with fibrinogen even after adjustment with other parameters like homa - ir, crp, and fibrinogen [table 5]. Roc curve analysis revealed best prediction value of pai-1 at 25.0 ng / ml, with a sensitivity of 92%, specificity of 96%, accuracy of 95%, positive predictive value of 92%, negative predictive value of 96% and positive and negative likelihood ratios of 22.9 and 0.08, respectively (roc 0.975, se 0.0178, 95% ci = 0.9421.009). Ms is known to strongly predict long - term risk of diabetes and cvd, and has also been reported to be associated with increased morbidity and mortality . It is becoming increasingly common in the united states and worldwide, and is emerging as the dominant risk factor for cvd in asia . The ms represents a combination of risk determinants, which include atherogenic dyslipidemia, elevated blood pressure, elevated glucose, a prothrombotic state, and a proinflammatory state . In obese persons, adipose tissue products are reported to affect systemic metabolism; among these are adiponectin, leptin, inflammatory cytokines, pai-1, resistin, and angiotensinogen . In this study, we evaluated 50 subjects with ms (25 males and 25 females) and 24 controls (12 males and 12 females). We have used here idf criteria as it provides ethnic - specific criteria for central obesity . All cases had significantly higher whr, bmi bfm and pbf than controls in both the sexes, which is similar to asian indian obesity phenotype . Low adiponectin levels have been reported in most of the studies on ms among people of various age groups, ethnicity and gender. [14152127] however, one study reported higher adiponectin levels in ms and another found low adiponectin level which was statistically not significant . There was negative graded response of adiponectin levels with metabolic abnormalities [figure 1]. Adiponectin was negatively related with age, bmi, bfm and pbf, whr, fpg, hypertension, tg, tc, hscrp, fibrinogen, homa - ir and pai-1, and positively related with bmr, hdl and homa - s in the present study . Similar associations have been reported in the literature. [17263135] however, certain differences were observed between the present study and other studies . In this study, adiponectin showed no relation with fasting insulin levels, as also observed by one study from south india, whereas others have reported negative correlation . We have observed negative correlation of cholesterol with adiponectin, similar to that reported by bilgili et al . But others found no relation of adiponectin with tc ., did not observe any relation between adiponectin and hscrp in post - pubertal asian indian adolescents, as seen by us . Multiple regression analysis of the metabolic parameters showed whr, fpg and tg to have an independent negative association with adiponectin even after adjustment for all metabolic variables . Yang et al ., observed positive association of hdl with adiponectin in multiple regression analysis . However, in our study, hdl and hypertension lost significance during multiple regression analysis . Ku et al ., reported correlation between serum adiponectin and bmi, triglyceride, hdl - c and fasting glucose in multiple regression analysis . In the present study, only bmi remained negatively associated with adiponectin when adjusted for anthropometric parameters, e.g. Bmr, bfm, and pbf, in multiple regression analysis . Jung et al ., showed significant negative correlation of adiponectin levels with percent body fat, lipid profile and homa - ir . Bmr showed positive association when adjusted with bmi, but lost significance when bfm was added . Similarly, pai-1 levels showed strong negative association with adiponectin even after adjustment with other parameters like homa - ir, crp, and fibrinogen . Bilgili et al ., also found an inverse relationship between plasma adiponectin and pai-1 (r = 0.653, p <0.001). Roc curve analysis revealed best prediction value at 6.7 g / ml, with a sensitivity of 83%, specificity of 86%, and accuracy of 85% . Mohan et al ., also reported similar adiponectin levels (5.0 g / ml for males and 6.5 g / ml for females) in a study from south india . However, studies from japan have suggested lower cut - off point (4 g / ml) of serum adiponectin level for the diagnosis of ms . Seino et al ., also suggested that measuring adiponectin may be effective for evaluating the presence of ms in nondiabetic subjects through analysis of area under the curve of roc curves . Subjects with ms had significantly higher pai-1 levels than controls, which is similar to that reported in many studies in the literature. [13263945] however, pai-1 level was higher in the present study than that reported from other ethnic populations . Indian population has higher pai-1 compared to african population, which is explained by the increased frequency of pai-1 4 g allele . Pai-1 was positively associated with bmi, bfm and pbf, and negatively associated with bmr . Among the various parameters of ms, pai-1 was positively associated with all parameters of ms, except hdl with which it was negatively associated . Pai-1 showed a strong positive association with inflammatory markers (hscrp, fibrinogen), insulin resistance (fasting plasma insulin, homa - ir) and total and ldl cholesterol, but had strong negative association with adiponectin . Tg and whr were independently associated with pai-1 even after adjustment for all metabolic variables in multiple regression analysis ., also found waist circumference as the strongest independent predictor of pai-1 . However, hdl, fpg and hypertension lost significance during multiple regression analysis . Only pbf remained positively associated with pai-1 when adjusted for anthropometric parameters, e.g. Bmr, bfm, and bmi, in multiple regression analysis . Similarly, pai-1 levels showed a strong positive association with fibrinogen even after adjustment with other parameters like homa - ir, crp, and adiponectin . Roc curve analysis revealed the best prediction value at 25.0 ng / ml, with a sensitivity of 92%, specificity of 96%, accuracy of 95%, and positive predictive value of 92% . Other studies have also made similar observation that pai-1 is an independent determinant of ms in multivariate logistic regression analysis . Surprisingly, we have found higher cut - off value for adiponectin and lower cut - off value for pai-1 for diagnosis of ms . The primary limitation of the present study is its cross - sectional design and the inherent possibility that genetic and/or lifestyle factors may have influenced the results of our group comparisons . However, in an effort to minimize the influence of lifestyle behaviors, we studied subjects of similar age who were non - smokers, who were not currently taking medication that could influence inflammatory and oxidative markers (i.e. Statins), and who did not differ in habitual physical activity . In addition, we used strict inclusion criteria to eliminate the confounding effects of underlying cardiovascular and metabolic disease . In the present study, subjects with ms had higher bmi, bfm and percent body fat, which is reflected in lower level of adiponectin and higher level of pai-1 . Also, they had increased insulin resistance and decreased insulin secretion compared to healthy controls . Subjects with ms were associated with higher hscrp level, emphasizing low - grade systemic inflammatory state . All these factors were interdependent and associated with other cardiovascular risk factors . Although the knowledge on pathogenesis and its association with metabolic risk factors such as obesity, hypertension, and cardiovascular risk is increasing day by day, the challenge is to translate research findings into substantial clinical improvements for patients . Demographic and epidemiological evidence indicates that unless an effective preventive strategy is developed, there will be a sharp increase in the global prevalence of cardiometabolic risk factors including diabetes and ms . Lifestyle measures have been shown to improve insulin resistance, insulin secretion and various components and effects of ms,[14951] and hence there is an urgent need for public health measures to prevent the ongoing epidemic of diabetes and cvd.
In india, 23.9 lakh people were living with hiv / aids (plha) in 2009 and children under 15 years accounted for 3.5% of all infections . According to who / unaids estimates, 450,000 children were receiving antiretroviral therapy (art) and more than 2 million children still needed art in 2010 . Zidovudine (azt), being an important component of standard regimen for first - line art in children, is widely used for managing pediatric hiv . As more and more children are exposed to this drug, the range of adverse reactions can also be expected to expand . Nail pigmentation with azt is a well - documented occurrence in adults, especially dark - skinned individuals ., we report a case of zidovudine - induced nail pigmentation in a 12-year - old boy . In december 2011, a 12-year - old boy was brought by guardians to dermatology opd for nail pigmentation involving all fingernails . About 4 years back, art was started for him with stavudine - based regimen (12 mg stavudine + 60 lamivudine + 100 mg nevirapine) because of too low hemoglobin level . But after improvement in hemoglobin level, he has been shifted to zidovudine - based regimen (zidovudine 300 mg + lamivudine 150 mg + nevirapine 200 mg) since last 1 year . After 3 months of initiating the new regimen, he noticed bluish - brown discoloration of thumbnails that gradually spread to other fingernails [figure 1a and b] and grew in intensity over time [figure 1c and d]. There was no history of trauma, use of coloring agents, any triggering factor, or abnormal skin or mucosal pigmentation . (a) pigmentation involving all nails (december 2011); (b) thumbnail involvement (december 2011); (c) increased pigmentation in all nails (march 2012); (d) increased pigmentation in thumbnails (march 2012) on examination, he was averagely built, nourished, and fully immunized . Local examination revealed diffuse bluish - brown discoloration of all fingernails, but it was more marked in thumbnails . Nails were brittle with loss of lunulae and periungual changes [figure 1c and d]. The patient and guardians were counseled about harmless nature of this adverse drug reaction (adr) and he is receiving the same regimen at present . Nail pigmentation with zidovudine was first described by furth and kazakis in two black patients in whom progressive hyperpigmentation of all fingernails developed . Since then, several such case reports have been published from various parts of the world. [68] but all these patients were adults, and we did not come across any case report on pediatric patients . Though our patient was receiving three antiretroviral drugs, zidovudine was thought to be the most likely cause of nail pigmentation, as pigmentation developed after 3 months of initiating zidovudine - based regimen . The causality assessment by naranjo algorithm showed that this adr was probable with zidovudine . In previous studies, patients taking zidovudine had noticed nail changes in 48 weeks or even after 56 months. [1011] dark - skinned individuals are at higher risk of this adverse effect and it appears to be reversible and dose dependant . Nail pigmentation occurs in variety of medical conditions and is also associated with use of several drugs, especially chemotherapeutic agents . The pattern of nail pigmentation may be transverse bands, longitudinal bands, or diffuse discoloration . Histopathologic findings of nail biopsy show deposits of brown pigmented granules containing melanin throughout the epidermis . As more patients receive zidovudine, it is important to alert patients about nail pigmentation . Though it is harmless and reversible, psychological aspects of this noticeable side effect may hamper adherence and efficacy of therapy . This may also lead to unnecessary investigations and treatment for misdiagnosis such as cyanosis and melanoma . Physicians should also focus on preventing adverse effects and distinguishing serious adrs from self - limiting adrs in order to manage prejudiced and fearful patients with available art.
Several chemoprotective properties of lycopene on prostate cancer have been proposed, including potent antioxidant properties, decreased lipid oxidation, inhibition of cancerous cell proliferation at the g0-g1 cell cycle transition, and protection of lipoproteins and dna [1, 2]. These mechanistic studies have stimulated the examination of lycopene and its primary source, tomato products, on risk of prostate cancer . However, studies on lycopene and tomato intake and prostate cancer incidence have yielded mixed results . The study of this relationship has been complicated by unique and challenging epidemiologic considerations in the measurement of lycopene and on the influence of prostate - specific antigen (psa) screening on prostate cancer incidence and progression . As with all epidemiologic studies, this paper briefly describes the methodology essential for conducting studies on the association between lycopene and prostate cancer incidence and provides an updated review of studies of lycopene and tomato products with prostate cancer risk . Lycopene is a carotenoid devoid of vitamin a activity . The major source by far, particularly in western populations, is tomato and tomato products; a few other foods such as watermelons and pink grapefruit also contain lycopene . In epidemiologic studies, approaches to assess an individual's lycopene intake or status include studies that estimate intake of lycopene (based on reported intake of foods and food content of lycopene from food composition databases), studies that assess tomato product intake as a surrogate of lycopene intake, and studies that measure lycopene levels in the serum or plasma . An issue that is not unique for lycopene, but perhaps of special importance for this carotenoid, is the variable absorption of lycopene from different food sources . In particular, cooking in an oil medium substantially enhances bioavailability of lycopene in the intestine because lycopene is highly bound to plant source matrices and is highly lipophilic . The measure of lycopene in the serum has theoretical advantages of accounting for absorption and not relying on study participants' food recall and accuracy of food composition tables . On the other hand, serum studies have frequently relied on a single measure, and how well a single measurement reflects long - term intake is not entirely clear . Also, since lycopene comes largely from tomato sources, circulating lycopene level may be acting as a surrogate of tomato product intake, and other components of tomatoes may account for any observed association with cancer risk . Finally, a population that consumes overall low levels of lycopene or similar levels of lycopene across individuals may result in insufficient contrast between high and low consumers . Psa release into the serum occurs with tissue breakdown between the prostate gland lumen and capillaries . The original purpose of the psa measurement was to monitor prostate cancer progression and recurrence . The food and drug administration approved psa testing for monitoring disease status in men with prostate cancer in 1987 and expanded its use to diagnosing prostate cancer in 1992 . This approval was followed by professional society guidelines that supported the use of psa testing for prostate cancer screening . Consequently, psa became widely used as a screening test in the united states and increasingly in other countries . As a screening modality, the sensitivity and specificity of psa varies based on the cut - off . For example, a psa level of 3 ng / ml has a sensitivity of 32% for detecting any prostate cancer and 68% for high - grade prostate cancer and a specificity of 85% . If this level were increased to 4 ng / ml the sensitivity would decrease to 21% for any prostate cancer and 51% for high grade prostate cancer but specificity would improve to 91% . Elevated serum psa may precede invasive carcinoma by a minimum of 510 years . Thus, psa testing enabled earlier detection of prostate cancer . The rate of first - time psa testing was strongly correlated with prostate cancer incidence rates . With the onset of psa for screening, prostate cancer incidence increased and peaked in 1992 and declined thereafter . Prior to widespread psa use for screening, prostate cancer diagnosis was largely prompted by physical exam findings of an enlarged prostate or symptoms ranging from urinary incontinence to more advanced spinal cord compression and bony pain from metastasis; therefore, prostate cancer was mostly detected in relatively advanced stages . Invasive carcinoma prevalence increases with age: 2% for men in their 30 s compared with 64% for men in their 70s . One - third of men under age 80 will have prostate cancer detected on autopsy . The lifetime risk of prostate cancer is 16% while the risk of mortality from prostate cancer is 2.9% . Thus a psa screening era beginning in 1988, fda approved in 1992, and peaking between 1992 and 1998 has been referred to as a period in which prostate cancers diagnosed by serum psa alone encompassed a variety of stages of prostate cancers, including clinically indolent cancers [4, 7]. In addition to diagnosing biologically indolent cancers, psa elevation occurs with benign conditions including benign prostatic hypertrophy, prostatitis, subclinical inflammation, ejaculation, digital rectal exams (potentially performed just prior to patients having their psa lab drawn), perineal trauma, prostatic infarction, urinary retention, biopsy, and transurethral resection of the prostate . The influence of psa on prostate cancer mortality has been controversial, with randomized trials not yielding a clear answer . However, undoubtedly psa screening has caused an increase in the number of indolent cancers being treated aggressively and ultimately led to increased morbidity from side effects of treatment . The majority of newly diagnosed prostate cancers were clinically localized and unlikely clinically significant to involve aggressive medical and surgical therapy such as radical prostatectomy with radiation ablation intended to cure early - stage cancers . For these reasons, in 2011 the united states preventive services task force recommended against psa screening for prostate cancer regardless of age, race / ethnicity, and family history . Beyond the clinical consequences, psa screening has altered the landscape of prostate cancer epidemiology . Many more cancers are diagnosed, including a substantial proportion of relatively indolent cancers, and the cancers are diagnosed earlier in their natural history, often before evidence of aggressive behavior is manifested . Thus, depending on at what stage and on what subtype of prostate cancer a risk factor may be acting, the relationship between this risk factor and prostate cancer risk may differ in populations exposed or not exposed to widespread psa screening . By increasing the heterogeneity in prostate cancers being diagnosed, psa screening has added complexity to the epidemiologic study of prostate cancer . A number of randomized clinical trials have examined lycopene and prostate cancer progression and mortality in men diagnosed with prostate cancer . The randomized studies have been small and inconclusive . In a double - blind randomized placebo - controlled trial, 105 african american male veterans recommended for biopsy to detect prostate cancer were administered tomato sauce containing 30 mg / day of lycopene or placebo over 21 days . Psa and lycopene levels were measured, and the group randomized to lycopene had an increase in serum lycopene and decrease in psa while the placebo group had the reverse, with a decrease in serum lycopene and increase in psa . This study did not report a significant decrease in prostate cancer risk for individuals administered lycopene, but the study duration of 21 days was likely inadequate to significantly influence prostate cancer risk . One study reported a decline in psa in the lycopene as well as placebo group after 1 month of intervention but return to baseline psa levels for both groups after 4 months of followup . In general, the clinical trials have been considerably limited by size, length of study duration, and other methodological issues and do not provide strong support or refutation of an association between lycopene and prostate cancer risk . Prospective and nested case control studies have been published previously in qualitative [13, 14] and quantitative reviews . In a meta - analysis of prospective studies up to 2003, high intake of raw but not cooked tomatoes was associated with a decreased risk of prostate cancer (relative risk (rr) 0.71, 95% confidence interval (ci): 0.570.87). Subsequent cohort studies on dietary lycopene intake [16, 17] have not reported significant inverse associations with prostate cancer risk . However, these studies were conducted in the post - psa era that likely encompassed a heterogeneous group of prostate cancers that included latent and incident cancers . Among prospective dietary studies, four [1821] of six cohorts report an inverse relationship between lycopene or tomato consumption and prostate cancer incidence . The largest and only study with multiple assessments of diet was conducted in the health professionals follow - up study (hpfs) [18, 19]. The hpfs first reported an inverse association between lycopene intake in 1986 with prostate cancer diagnosed between 1986 and 1992: rr for high versus low quintile of intake = 0.79 (95% ci: 0.640.99, ptrend = 0.04). High intake of tomato - based products was associated with a 35% decreased risk of total prostate cancer (rr 0.65, 95% ci: 0.440.95) and 53% decreased risk of advanced stage prostate cancer (rr 0.47, 95% ci: 0.221.00; ptrend = 0.03). The hpfs analysis was updated for prostate cancer cases between 1992 and 1998 using cumulative average updated intakes (i.e., averaging intake from all the dietary questionnaires up to the time period of risk) of lycopene from 1986 to 1998 with a similar inverse association detected: rr = 0.83 (95% ci: 0.700.98, ptrend = 0.02). The hpfs assessed dietary intake every four years, and the timing of intake in relation to period of risk for prostate cancer was assessed . When baseline lycopene intake in 1986 was evaluated for prostate cancer cases during the entire follow - up period, however, statistically significant inverse associations were found when using the questionnaire closest in time to the time period of risk (rr for high versus low lycopene intake = 0.84, 95% ci: 0.740.96, ptrend = 0.02) and cumulative average updated lycopene intake (rr for high versus low lycopene intake = 0.84, 95% ci: 0.730.96, ptrend = 0.003). Alternatively, a single measurement of dietary intake at baseline may not be the best measurement to reflect the potential impact of lycopene in altering prostate carcinogenesis, compared with multiple updated dietary measurements . Individual tomato products were examined in relation to prostate cancer risk, and the strength of the association corresponded to association of the food item with serum lycopene levels, which were concurrently available in the hfps . For example, tomato sauce, the most bioavailable form of lycopene, was most strongly related to decreased prostate cancer risk (rr for 2 servings / week versus <1 serving / month = 0.77, 95% ci: 0.660.90), followed by tomato and pizza but not tomato juice . There was an even stronger association for advanced prostate cancer: rr for 2 servings / week versus <1 serving / month of tomato sauce = 0.65 (95% ci: 0.420.99, ptrend = 0.02). A similar magnitude decrease in prostate cancer was reported in the california seventh day adventist cohort between 1974 and 1982 for men with high tomato consumption . High intake of tomatoes was associated with a statistically significant 40% decreased risk of prostate cancer (rr 0.60, 95% ci: 0.370.97). In another study, a 50% lower risk of prostate cancer was reported for high compared with low tomato consumption in us men between 1987 and 1990: rr 0.50 (95% ci: 0.300.90, ptrend = 0.03), but few details were provided . Dietary cohort studies that did not report associations with prostate cancer incidence frequently had lower lycopene and tomato intake compared with studies that report an association . A dietary cohort study based in the netherlands between 1986 to 1992 did not report an association between tomato intake and prostate cancer incidence . While this cohort took place between the same time period as the initial hpfs analysis, tomato consumption was low compared with the hpfs . In addition, consumption of tomato - based products, which contain more bioavailable lycopene, was not specifically addressed . A diet - based cohort study of individuals in the prostate, lung, colorectal, and ovarian screening trial examined intakes of lycopene and top food sources of lycopene but did not find inverse associations for lycopene, raw tomatoes, canned tomatoes, or other processed tomato products (ketchup, tomato sauce, pizza, lasagna, tomato and vegetable juice, chili) with total or nonadvanced prostate cases . Predominately white men (90.7%) enrolled in this study between 1993 and 2001 received baseline psa screening or digital rectal examination and completed annual questionnaires . Men with a psa level> 4 ng / ml or digital rectal examination concerning for prostate cancer were referred to their medical provider for further diagnostic evaluation and staging of prostate cancer . The majority (92%) of prostate cancers nonadvanced disease (gleason score <7 or stage i or ii) comprised 61% of total prostate cancer cases and was not associated with total lycopene intake or lycopene from processed foods . Greater consumption of spaghetti / tomato sauce and pizza was associated with decreased incidence of advanced disease but did not reach statistical significance (rr 0.81, 95% ci: 0.571.16 and rr 0.79, 95% ci: 0.561.10, respectively). The association of tomato products with advanced but not nonadvanced prostate cancer suggests a possible stronger role for lycopene in advanced disease . Limitations of this study include the assessment of lycopene intake from a single baseline measurement . In addition, intake for all but raw tomatoes was low in this population, with no more than two servings per week (mean total lycopene intake 11,511 and standard deviation 8,498 g / d). Further, a large portion of prostate cancer cases were diagnosed by initial psa screening, and total prostate cancers reflected a heterogeneous mix of mostly nonadvanced prostate cancer cases . Dietary lycopene was not reported to have an association with prostate cancer risk in a prospective study from the prostate cancer prevention trial . The pcpt originated as a randomized trial of finasteride but was converted to a prospective observational study . Men with an abnormal digital rectal examination or psa level 4 ng / ml or greater were encouraged to receive a prostate biopsy . At the final study year this resulted in the inclusion of incidental cases of prostate cancer that contributed to the substantial 24.8% of prostate cancer cases diagnosed in men originally randomized to the control group . The majority of cancers were localized and detected by screening or incidentally discovered, and it is possible that low - grade cancers have different characteristics from high - grade cancers . In addition, it may be necessary to assess lycopene through simple updated or cumulative average updated intakes rather than a single baseline measurement . A number of studies have examined serum or plasma lycopene from biobanks in relation to subsequent prostate cancer risk . The studies were typically nested case control in design; incident cases and matched cancer - free controls over the follow - up period were identified, and serum or plasma lycopene was measured in the banked biospecimens . In a meta - analysis of prospective studies up to 2003, high serum lycopene levels were associated with significant decreased risk of prostate cancer: rr = 0.78 (95% ci: 0.611.00). Subsequent studies on serum lycopene levels conducted in the post - psa era [2328] have not reported significant inverse associations with total prostate cancer risk . One of the earliest studies to report an inverse association between serum lycopene and prostate cancer risk was a nested case control study of 103 prostate cancer cases matched with 103 controls among 25,802 male residents of washington county, md who donated blood in 1974 . A nonsignificant 50% reduction in prostate cancer risk was reported (or 0.50; 95% ci: 0.201.29). Two of the largest nested case control studies reported inverse associations between plasma lycopene and prostate cancer risk [30, 31]. Plasma lycopene levels were higher in these multicentered us cohorts compared with other studies, which may reflect the higher education level in these populations . A nested case control study within the physicians' health study, a randomized, placebo - controlled trial of aspirin and -carotene, assessed incident prostate cancer cases in 578 men compared with 1294 age- and smoking - status - matched controls . Men with higher plasma lycopene had a borderline significant decreased risk of prostate cancer (highest quintile rr = 0.75; 95% ci: 0.541.06; ptrend = 0.05). There was a significantly greater decreased risk for aggressive (high stage or high grade) prostate cancer: highest quintile plasma lycopene, rr = 0.56 (95% ci: 0.340.91; ptrend = 0.05). These associations were not confounded by covariates including age, smoking status, body mass index, physical activity, alcohol intake, multivitamin use, or plasma total cholesterol level . In a nested case control study within the prospective hpfs cohort, 450 incident cases of prostate cancer diagnosed between 1993 and 1998 were matched with 450 controls by age, time, month, season, and year of blood donation . A nonsignificant inverse association was reported for plasma lycopene and risk of prostate cancer: rr for highest versus lowest quintile, 0.66 (95% ci: 0.381.13). This association was statistically significant for men older than 65 years at time of plasma donation: rr for highest versus lowest quintile, 0.47 (95% ci: 0.230.98), but was not observed for younger men . Serum lycopene was recently assessed in a nested case control study within the prostate cancer prevention trial (pcpt). There was no association between serum lycopene and prostate cancer incidence, but incidentally diagnosed prostate cancer cases by end - of - study biopsies were analyzed alongside prostate cases diagnosed by screening . In a reanalysis that included only cancers diagnosed from abnormal screening the cancers assessed by end - of - study biopsy were relatively static (e.g., no psa elevation or sign of clinical progression) during the study period, so may not be appropriately considered as several other serum lycopene studies reported nonsignificant inverse associations [2325, 27] or no association [26, 32] with prostate cancer risk . However, these studies were conducted in the post - psa era that likely encompassed a heterogeneous group of prostate cancers that included latent and incident cancers . As with the pcpt, an association with lycopene could be missed . In the large european study (epic) by key et al ., a statistically significant inverse association was observed for cases diagnosed at an advanced stage . In this study, men in the highest versus lowest quintile of lycopene level had a rr of 0.40 (95% ci: 0.190.88). Several studies retrospectively examined the association between tomatoes, tomato - based products or lycopene, and prostate cancer risk, with mixed results . In a meta - analysis of case control studies through 2003, high intakes of raw tomatoes, cooked tomatoes, and lycopene were not associated with decreased prostate cancer risk . A strong inverse dose - response relationship between lycopene intake and histopathologically confirmed lycopene intake was assessed using a reproducible and validated 130-item food frequency questionnaire for elderly men in china . For lycopene intakes of 16093081, 30814917, and> 4917 g / d, the rrs of prostate cancer compared with lycopene intake <1609 g / d were 0.47 (95% ci: 0.250.86), 0.40 (95% ci: 0.210.77), and 0.17 (95% ci: 0.080.39), respectively . The rrs reported for lycopene and prostate cancer in this study were stronger than some prior studies . This study also examined green tea and vegetable and fruit intake and reported strong, significant inverse associations for all these associations . The incidence of prostate cancer is lower in developing countries such as china, compared with western countries . In china psa screening while further information and stratification based on prostate cancer grade and staging were not provided in this study, the lower prevalence of psa screening practices in china compared with the usa suggests prostate cancer cases in this cohort were more likely to be at advanced stages . The strong association between lycopene and probable advanced prostate cancer suggests a role for lycopene in influencing risk of aggressive cancer . A significant inverse association between tomato intake and prostate cancer was similarly reported in a case control study of 617 canadian men with prostate cancer and 636 age - matched controls conducted between 1989 and 1993 . The rr of prostate cancer was 0.64 (95% ci: 0.450.91) for tomato intake> 73 g / day compared with <24 g / day . There was no significant association reported for lycopene intake and prostate cancer . In a case control study of 130 prostate cancer cases in iranian men, tomato consumption of greater than 100 g / week was nonsignificantly inversely associated with decreased prostate cancer risk (rr 0.45; 95% ci: 0.092.12). Food intake was assessed based on the past two months of intake, and tomato intake questions included tomato extract and dressing . However, it is unclear whether this tomato group included both raw and processed tomatoes . An additional study reported a nonsignificant inverse association between dietary lycopene and prostate cancer risk while several reported no association [3840]. Three case control studies of plasma lycopene reported strong inverse associations with histopathologically confirmed prostate cancer [4143]. One study of non - hispanic caucasian men used high - pressure liquid chromatography (hplc) to examine plasma lycopene isoforms . Cis - lycopenes 2 through 5 individually and in sum as total cis - lycopene and trans - lycopene were not associated with prostate cancer risk . This study suggests the structural type of lycopene measured may influence the ability to detect an association, as one cis isomer but not total cis- or trans - lycopene was associated with decreased prostate cancer risk . However, a study in the hpfs found that the isomers were highly correlated with each other, making any specific effects difficult to distinguish . The multicentered case control third national health and nutrition examination survey (nhanes iii) of u.s . Caucasian and african american men aged 4079 years reported a significant inverse association between serum lycopene and aggressive prostate cancer (highest compared with lowest quartile rr = 0.37; 95% ci: 0.150.94; ptrend = 0.04) and nonsignificant association between serum lycopene and prostate cancer (highest compared with lowest quartile rr = 0.65; 95% ci: 0.361.15; ptrend = 0.09). Caution should be used in interpreting results from case control plasma or serum studies because the cancers could possibly be influencing lycopene level, resulting in reverse causation . This paper focused on prostate cancer incidence that may or may not have been detected by initial psa screening and highlights differences in the association with lycopene based on prostate cancers initially screened with psa testing compared with cancers diagnosed in more advanced stages . Elevated psa may be attributed to a number of benign factors, including the highly prevalent benign prostatic hypertrophy in older men, and should not be used in isolation along with single serum measurements for the diagnosis of prostate cancer . Randomized interventions of lycopene and prostate cancer risk have been limited in scope, and some used psa as an endpoint [10, 11]. Thus, trials do not provide strong support either for or against a causal association . The epidemiologic literature on lycopene intake or level and prostate cancer based on observational studies has been inconsistent overall . One potential explanation is that there was a relative over - reporting and publishing of positive studies in the earlier years, followed by a correction of this publication bias as the hypothesis grew in interest and null studies were published . If so, then it may be concluded that there is unlikely to be a causal connection between lycopene intake and risk of prostate cancer . An alternative possibility is that the earlier studies were conducted largely before the onset of psa screening, where diagnosis of prostate cancer usually implied a period of increasing aggressive behavior leading to the diagnosis . Thus, the exposure was linked to the development of aggressive behavior in cancers with biologic potential to progress . In the psa era, 19921998 with peak in 1992 following fda approval as a screening test for prostate cancer, the diagnosis of prostate cancer is not typically linked to aggressive behavior [4, 7]. An example of this phenomenon may be the subgroup of cancers in the pcpt that were diagnosed at end of study biopsy . There was a high prevalence of undiagnosed prostate cancer, even among the youngest group of men in the study (5559 years), which suggests that most of the cancers eventually diagnosed during the study period were present at baseline . Throughout the 7-year followup, the cancers diagnosed at end - of - study biopsy showed no evidence of clinical or biochemical progression . Prior studies have shown that most cancers, even many with high - grade gleason scores, do not progress over prolonged time, and it is well established that only a fraction of prostate cancers result in the most advanced and clinically significant stage and mortality . Thus, the majority of these cancers was likely present at the onset of the study and may be considered static cancers . In fact, when reanalyzed as a case - only study, higher serum lycopene levels in the pcpt appeared to be inversely associated preferentially with cancers that showed evidence of progression relative to cancers that showed no indication of progression . In modeling two patterns of prostate cancer progression, one with low lycopene exposure and rapid tumor growth that reaches a threshold psa level for clinical diagnosis and the second with high lycopene exposure and slow progression, the latter may be diagnosed at a much later time through an incidental random biopsy rather than psa . Thus, asymptomatic cancers diagnosed at the end - of - study by biopsy may signify cancers that were inhibited rather than incident cancer . Thus, a possible interpretation is that high levels of lycopene may have inhibited some existing cancers to undergo progression . Some evidence supports the premise that psa screening and type of tumor endpoint are critical . For example, the hpfs was analyzed before and after peak psa testing in the early 1990s . Before psa testing (19861992) tomato sauce intake was inversely associated with prostate cancer incidence and stronger for advanced stage cancers . While the association for total prostate cancer incidence was attenuated during the psa era (19921998), the association with metastatic prostate cancer persisted . In addition, in the large epic study serum lycopene level was inversely associated with risk of advanced stage prostate cancer but not nonadvanced prostate cancer . As discussed above, studies based on intake are limited by the assessment of intake, food composition databases, and differences in bioavailability . Future studies may be improved by better taking into account bioavailability differences among diverse foods . Prospective studies are preferable to avoid various biases, such as recall bias, or reverse causation in studies of circulating lycopene . With increasing use of psa, it is becoming increasingly difficult to examine advanced stage prostate cancer, at least in some populations . Examining potential mediators or markers of aggressive behavior in tumor tissue may be another useful approach in the further study of lycopene and prostate cancer risk.
Common causes of bronchopleural fistula (bpf) are lung resection, thoracic surgery, thoracic trauma, pulmonary koch's, rupture of lung abscess and rupture of emphysematous bullae, as was seen in this case . Bpf is an important cause of morbidity and mortality and its management depends on various factors like size of fistula, respiratory reserve of the patient, associated diseases and general condition of the patient . Bpfs, which are small in size or are due to minor parenchymal leaks, usually close spontaneously whereas large bpf, those arising from the major bronchi or causing respiratory compromise usually require intervention in the form of bronchoscopic closure, video - assisted thoracic surgery (vats), muscle flap closure, decortication, lobectomy, pneumonectomy and thoracoplasty . Many times, a combination of techniques and/or multiple interventions are required . Various flaps used for the closure of bpf and reported in the literature are intercostal muscle flap, pericardial flap, latissimusdorsi muscle flap, serratus anterior muscle flap, rectus abdominis muscle flap and omentum . The intercostal muscle flap, as was used in this case, is easy to harvest, causes no functional disability, has adequate vascularity, has adequate length to reach most of the sites and is harvested through the same incision used for thoracotomy . Bronchoscopic techniques used for the closure of bpf include application of glue, gelfoam and/or stents; these techniques are usually successful when the size of the fistula is small . Large bpf and those associated with entrapped lung or empyema thoracis are managed with surgery . A 50-year - old male patient, a known case of copd, presented with the features of bpf on the right side for 1 month . The patient was a chronic smoker and did not give any history suggestive of pulmonary koch's or any other associated disease apart from copd . The patient had sudden - onset breathlessness and chest pain 1 month before, which was diagnosed as spontaneous pneumothorax, and an intercostal drain was inserted but even after 1 month of all conservative measures, the lung remained collapsed [figure 1a] and there was a large air leak in the intercostal drain; negative suction on the intercostal drain was also not effective . Ct chest revealed collapsed and entrapped lung [figure 1b and c], with surgical emphysema of the subcutaneous tissues due to rupture of the emphysematous bullae on the right side along with presence of emphysematous bullae on the left upper lobe . Surgical repair was planned as with all the conservative measures, the lung remained collapsed and the air leak persisted . The patient was emaciated and weak and was pre - operatively optimized with a high - protein diet, multivitamins, bronchodilators, incentive spirometry and antibiotics for another week before surgery . General anesthesia was given using double - lumen endotracheal tube and supplemented with thoracic epidural analgesia and invasive arterial pressure and central venous pressure monitoring were also performed . The right posterolateral approach was chosen, intercostal muscle flap was harvested and part of the fifth rib was resected . The lung was found completely entrapped in a fibrous peel [figure 2a] and decortication of the thickened visceral peel was performed from the entire right lung [figure 2b] and inferior pulmonary ligament was also ligated and divided . The site of the bpf was localized in the segmental bronchus to apical segment of the right upper lobe and closure of the fistula with polypropylene 40 sutures was performed and reinforced with intercostal pedicled muscle flap [figure 2c]. There were multiple small unruptured bullae present near the site of the bpf, and they were also closed with polypropylene 40 sutures . The repair site was tested for air leak after pouring saline in the thoracic cavity and after ensuring no major air leak, two intercostal drains were inserted and standard thoracotomy closure was carried out . The patient was extubated in the operating room and deep breathing exercises were started from the first post - operative day to keep the lungs expanded . Chest roentgenogram on the second post - operative day [figure 3a] revealed partial re - expansion of the lung along with presence of residual space in the upper zone . With continued chest physiotherapy and respiratory exercises, there was complete re - expansion of the lung with obliteration of the remaining space in the upper zone [figure 3b]. Histopathological examination of the resected visceral peel revealed non - specific inflammation without any evidence of granuloma formation or dysplasia and cultures were sterile . (a) pre - operative chest roentgenogram showing collapsed right lung with intercostal tube in situ . (b) pre - operative computed tomography of the chest in the axial section showing collapsed and entrapped right lung . (c) pre - operative ct chest in the sagittal section showing collapsed and entrapped right lung (a) intraoperative photograph showing collapsed and entrapped right lung . (c) intra - operative photograph showing use of intercostal muscle flap for closure of bronchopleural fistula (a) post - operative chest roentgenogram showing lung expansion on the second post - operative day . (b) post - operative chest roentgenogram showing expanded right lung on the 10th post - operative day after removal of the intercostal drain bpf is commonly associated with empyema or empyema develops subsequently if management of bpf is delayed . In this case, pleural fluid and sputum culture were sterile and total and differential leukocyte counts were within the normal range, probably because the patient was on antibiotics . This case is reported to highlight the advantages of intercostal muscle flap for repair of bpf and typical presentation of entrapped lung and its management . Vats is now - a - days commonly used for the management of early - stage empyema before the development of thickened peel . Closure of bpf through vats may be performed using pleural or pericardial flaps and/or application of glue . Open surgery is usually required for late stages of empyema and for muscle flap closure of bpf . Lobectomy or even pneumonectomy may be required in cases of bpf with complete destruction of the underlying lobe or lung, respectively, with or without the use of muscle flaps . Acute bpf due to dehiscence of bronchial stump after lung resection like pneumonectomy or lobectomy is a serious condition and requires urgent drainage of the pleural space along with intervention for closure of bronchial opening . The intervention can be either through bronchoscopic techniques using gel foam or glue or in unsuccessful cases through surgical approach by revision of the bronchial stump along with the use of muscle flaps . Thoracoplasty can be used in some cases where there is recurrence of bpf after muscle flap repair, but the procedure leads to reduction of pulmonary function and chest wall deformity . Sometimes the bpf is associated with empyema or infected pleural space; even in those cases, use of intercostal muscle flaps is associated with favorable outcome because of the good vascularity and autologus nature of the flap thereby increasing the chances of healing . Free flaps have also been described in cases like redo surgery where pedicled flaps have already been used or are of insufficient length . Use of intercostal muscle flap is an easy and effective technique for the repair of bpf.

Subsets and Splits

No community queries yet

The top public SQL queries from the community will appear here once available.