Split (1)

train · 133k rows

text stringlengths 0 868k
Traumatic spondylolisthesis of the lumbosacral junction is a rare injury with just over 100 cases found in the literature since it was first described over 70 years ago and fewer than 20 cases presented over the last 10 years.1 lumbosacral dissociation refers to the translocation of the l5 over the s1 vertebrae . A classification system for the different causes of spondylolisthesis has been developed and includes dysplastic, isthmic, degenerative, traumatic, and pathologic causes.2 3 4 most of these refer to changes in the vertebrae that occur over time due to genetic, mechanical, or pathologic processes that lead to an olisthesis of a superior vertebra over an inferior vertebra . Traumatic spondylolisthesis specifically refers to anterior or posterior displacement of the vertebrae following acute high - energy trauma to the pelvis or spine . Of the l5s1 diskal spondylolisthesis injuries reported in the literature, most involve dislocation in the anterior direction, with fewer than 10 cases reported in the posterior direction.1 5 6 7 two cases are presented with a dislocation at the l5s1 junction . The first case is an anterior dislocation following a crush injury, and the second is posterior dislocation resulting from an automobile accident . A 49-year - old man was sleeping on a loading dock while intoxicated and was crushed by a semitruck . He was taken to a local emergency department where he was evaluated and released to jail without an injury diagnosis . He was then brought to our institution by ambulance from jail complaining of low back pain, left hip pain, and left thigh pain, with decreased perianal and penile sensation but no urinary incontinence . Rectal tone was absent, with a normal bulbocavernosus reflex, but he was otherwise neurologically intact . The initial radiographs showed bilateral l5s1 facet joint fractures with grade 2 l5s1 anterolisthesis, as well as l4 and l5 spinous and transverse process fractures (fig . 1). Computed tomography (ct) confirmed the anterior dissociation of the lumbar spine from the sacrum (fig . (a, b) anteroposterior and lateral lumbar radiographs revealing bilateral l5s1 facet joint fractures with a grade 2 l5s1 anterolisthesis and l4l5 spinous process and transverse process fractures . (a) axial computed tomography image showing l5s1 bilateral facet fractures and l5 spinous process fracture . (b) sagittal computed tomography showing l5s1 anterolisthesis . The patient was urgently taken to the operating room where he was found to have a complete disruption of the right l5 superior facet through the pars interarticularis as well as a left - sided fracture dislocation at the l5s1 level . He also had significant disruption of the interspinous ligament between l5 and s1 with fractures noted at the l5 lamina . A wide decompression with diskectomy was performed, ensuring that both the l5 and s1 nerve roots were free of compression . The anterior end plate and disk were sheared and displaced posteriorly and they impinged upon the roots and exiting cauda equina . L5 and s1 were instrumented with pedicle screws . The l5s1 interspace was gently distracted, and a transforaminal lumbar interbody fusion was performed . 3). A satisfactory reduction of the l5 vertebral body was obtained, and fusion was completed with decortication, local autograft, allograft, and demineralized bone matrix . (a) anteroposterior fluoroscopic intraoperative image showing bilateral screws and rods . (b) perianal sensation was intact, but rectal tone remained absent . A 23-year - old woman presented after a high - speed motor vehicle accident . She was a restrained rear seat passenger wearing both lap and shoulder belts, without loss of consciousness, and she was able to self - extricate from the vehicle . On arrival, she complained of back pain with tingling in the buttocks and posterior thighs, but she was initially discharged home . She was called back to the emergency room within 2 hours, when the final read of her ct scan demonstrated retrolisthesis of l5 on s1 with a small anterior fracture along the end plate of l5 and s1 and narrowing of the disk space (fig . Subsequent magnetic resonance imaging demonstrated disruption of the posterior ligamentous complex and disk disruption with a collection of fluid in her facet joints (fig . 5). A traumatic posterior l5s1 spondylolisthesis was confirmed, and its instability likely responsible for the neurologic symptoms . (a, b) sagittal and axial magnetic axial imaging showing l5s1 retrolisthesis, bilateral facet subluxation, interspinous ligament injury, and l5s1 traumatic disk herniation with significant narrowing of the spinal canal . . There was a complete transverse disruption of the posterior midline fascia in a typical tension failure injury of the posterior structures . The traumatic dissection was completed from the spinous processes to the level of the ligamentum flavum and dura . Instrumentation of the l5 and s1 pedicles occurred, and a diskectomy and a posterior lumbar interbody fusion were performed . (a, b) anteroposterior and lateral radiographs showing intact rods and screws fusing the l5s1 levels . A 49-year - old man was sleeping on a loading dock while intoxicated and was crushed by a semitruck . He was taken to a local emergency department where he was evaluated and released to jail without an injury diagnosis . He was then brought to our institution by ambulance from jail complaining of low back pain, left hip pain, and left thigh pain, with decreased perianal and penile sensation but no urinary incontinence . Rectal tone was absent, with a normal bulbocavernosus reflex, but he was otherwise neurologically intact . The initial radiographs showed bilateral l5s1 facet joint fractures with grade 2 l5s1 anterolisthesis, as well as l4 and l5 spinous and transverse process fractures (fig . 1). Computed tomography (ct) confirmed the anterior dissociation of the lumbar spine from the sacrum (fig . (a, b) anteroposterior and lateral lumbar radiographs revealing bilateral l5s1 facet joint fractures with a grade 2 l5s1 anterolisthesis and l4l5 spinous process and transverse process fractures . (a) axial computed tomography image showing l5s1 bilateral facet fractures and l5 spinous process fracture . (b) sagittal computed tomography showing l5s1 anterolisthesis . The patient was urgently taken to the operating room where he was found to have a complete disruption of the right l5 superior facet through the pars interarticularis as well as a left - sided fracture dislocation at the l5s1 level . He also had significant disruption of the interspinous ligament between l5 and s1 with fractures noted at the l5 lamina . A wide decompression with diskectomy was performed, ensuring that both the l5 and s1 nerve roots were free of compression . The anterior end plate and disk were sheared and displaced posteriorly and they impinged upon the roots and exiting cauda equina . L5 and s1 were instrumented with pedicle screws . The l5s1 interspace was gently distracted, and a transforaminal lumbar interbody fusion was performed . 3). A satisfactory reduction of the l5 vertebral body was obtained, and fusion was completed with decortication, local autograft, allograft, and demineralized bone matrix . (a) anteroposterior fluoroscopic intraoperative image showing bilateral screws and rods . (b) she was a restrained rear seat passenger wearing both lap and shoulder belts, without loss of consciousness, and she was able to self - extricate from the vehicle . On arrival, she complained of back pain with tingling in the buttocks and posterior thighs, but she was initially discharged home . She was called back to the emergency room within 2 hours, when the final read of her ct scan demonstrated retrolisthesis of l5 on s1 with a small anterior fracture along the end plate of l5 and s1 and narrowing of the disk space (fig . Subsequent magnetic resonance imaging demonstrated disruption of the posterior ligamentous complex and disk disruption with a collection of fluid in her facet joints (fig . A traumatic posterior l5s1 spondylolisthesis was confirmed, and its instability likely responsible for the neurologic symptoms . (a, b) sagittal and axial magnetic axial imaging showing l5s1 retrolisthesis, bilateral facet subluxation, interspinous ligament injury, and l5s1 traumatic disk herniation with significant narrowing of the spinal canal . Traumatic hemorrhage with edema in the soft tissues was noted . There was a complete transverse disruption of the posterior midline fascia in a typical tension failure injury of the posterior structures . The traumatic dissection was completed from the spinous processes to the level of the ligamentum flavum and dura . Instrumentation of the l5 and s1 pedicles occurred, and a diskectomy and a posterior lumbar interbody fusion were performed . (a, b) anteroposterior and lateral radiographs showing intact rods and screws fusing the l5s1 levels . Traumatic spondylopelvic dissociation through the l5s1 disk space is a rare entity, with roughly 100 cases reported since it was first described by watson - jones in 1940.1 8 9 10 translation may be anterior or posterior; however, posterior traumatic dislocations are rarer, with only 10 cases reported in the literature.11 12 the lumbosacral articulation is itself a solid complex of bony and ligamentous restraints, which include the l5s1 disk complex, the posterior facets, the iliolumbar ligamentum, and robust posterior musculature rendering it resistant to injury.11 watson - jones suggested that the mechanism for anterior dislocation involves hyperextension.10 13 however, most authors consider the mechanism of anterior spondylopelvic dissociation to be a combination of hyperflexion with compression, although the exact pathophysiology is still controversial.8 9 14 15 16 some authors argue that anterior dislocation results from lateral hyperflexion and rotation, and others report that this type of dissociation is purely a result of the direct trauma vectors.17 18 19 posterior dislocations are thought to result from posterior translation of the vertebrae on a fixed pelvis.18 this mechanism would result in disruption of the posterior column and posterior ligamentous structures . Often the fractures are minimal, as the bony elements are moving away from one another . The final resting place of the spine and pelvis do not always represent the force vectors encountered during the actual accident . A posterior spondylolisthesis has been attributed to a combination of shear forces in the anterior direction and hyperextension due to high - energy trauma impact trauma to the posterior pelvis.5 case 2 involves a patient in a motor vehicle accident, therefore a combined injury is likely . Early recognition of a spondylopelvic dissociation is often difficult, and initial diagnosis can be wrong.14 15 16 as a result of the high - energy mechanism, 50 to 88% of cases have associated transverse process fractures.9 the presence of transverse process fractures should increase the suspicion for spondylopelvic dissociation.8 9 15 16 on an anteroposterior radiograph, helpful signs include obliquity of l5 on the sacrum and transverse process fractures.11 on lateral radiographs, increased interspinous distance, spondylolisthesis, l5 on s1 kyphosis, and a narrow anterior disk space height are suggestive of dissociation . Ct may reveal the empty facet sign and empty or perched facets on axial cuts.11 15 certainly a high index of suspicion should be made for any patient involved in a significant injury with back pain with or without neurologic symptoms . In these cases, lumbosacral dissociation is a three - column injury and is considered unstable.11 20 neurologic deficits are present in approximately one third of cases with bilateral l5s1 injury, and these patients should be treated with surgical urgency.13 pure cauda equina syndrome is rarely found.9 for patients without neurologic deficits, magnetic resonance imaging should be completed to assess the severity of the lesion and to decide whether or not the canal needs to be explored.6 13 although ct scans independently give no direct information on the integrity of the disks and ligaments, widened facet joints or avulsion fractures may suggest ligamentous disruption.9 open reduction and internal fixation using pedicle screws is considered the standard of treatment for this injury.9 16 it is safest to perform the reduction intraoperatively where the canal can be explored to ensure there are no bone or disk fragments.13 because this is a three - column injury, anterior support may be necessary to ensure stability . For more complex or extensive l5s1 injuries, additional fixation, including pelvic or iliosacral fixation, may be necessary.16 21 22 some authors had advocated a trial of nonoperative management, but most patients in the literature who have been treated conservatively eventually required surgery.3 11 23 24 final prognosis is typically determined by the preoperative neurologic status.18 only three cases of posterior traumatic lumbosacral dissociations have been reported to date.12 posterior dislocations are theoretically more commonly associated with neurologic injury as the bony ring is often left intact, more readily causing impingement.4 6 they are also more likely to occur in the setting of more severe traumatic disruption and therefore lead to more neurologic compression . Anterior dislocations, which often have bony fractures, can self - decompress the spine and allow the room necessary for the neural elements . In our case examples, the anterior translation resulted in a disk / end plate herniation, which is likely responsible for the continued neurologic injury in the patient with the l5s1 anterior spondylolisthesis . The posterior spondylolisthesis in case two initially presented with worsening neurologic symptoms but did not sustain any long - term neurologic injury, likely due to rapid reduction and fixation . Traumatic dissociation through the l5s1 disk level is a rare injury that has two major injury patterns: anterior spondylolisthesis or posterior spondylolisthesis . Both represent a three - column injury that dissociates the pelvis from the spine and requires surgical stabilization . Because it is a rare injury, it can easily be missed without appropriate radiographic examination and a high index of suspicion . Commentary on: traumatic spondylopelvic dissociation: a report of two cases of spondylolisthesis at l5s1 and review of literature france for their contributions by bringing to our readers' attention this important albeit rare severe injury entity . In this day and age it seems near impossible that such major injuries are still missed, yet we have two such cases here . The insightful discussion of dr . France points out two of the major potential problems faced by many emergency departments around the world: disruption of the usual trauma algorithm by rushing patients to urgent care outside of the customary sequence time pressures to process patients toward a final disposition although most trauma centers around the globe have reasonably ready access to ct scanners which allows for easy diagnosis of lumbopelvic trauma the real challenge lies in getting this relatively simple diagnostic test completed . Thoughts on how to counter these two problems have been formulated but have not been formally implemented as protocol formats or been studied in a peer - reviewed setting . The intuitive answer to handling patients who were not beneficiaries of a completed trauma workup due to life- and/or limb - saving procedures are best managed by tagging them as trauma incomplete and maintaining them in such a status until a formal secondary trauma survey has been completed . Electronic medical records can be helpful to keep reminding the providers of the need to finalize such a secondary trauma survey . The time pressure issue is probably best addressed by implementing ct scans instead of plain radiography in trauma assessments . Of course, the area of interest has to be part of the screening protocol, and a quality interpretation should involve not just a radiologist but a knowledgeable clinician involved in the care of the patient . Finally, a quality improvement system that constructively reviews missed cases and looks to implement changes would be a desirable institutional enhancement.
The increasing prevalence of methicillin - resistant staphylococcus aureus (mrsa) to newer antibacterial agents, in both community and healthcare settings, is a serious worldwide concern as therapeutic options are limited . Hence, there is a need for new antimicrobials possessing potent activity against this pathogen . Bacterial fatty acid biosynthesis (fasii) is a relatively new and unexploited target for antimicrobial treatment of s. aureus.1 afn-1252, a potent inhibitor of staphylococcal enoyl - acyl carrier protein (enoyl - acp) reductase (fabi), a critical enzyme required for bacterial fasii, is being developed by affinium pharmaceuticals, inc . (toronto, on, canada), in both oral and intravenous formulations, for the treatment of s. aureus infections . In vitro,, with typical minimum inhibitory concentration (mic90) values of 00080015 mg / l, up to 3 log reductions in bacterial viable count over 24 hours and low potential for resistance development.24 murine studies indicate a long elimination half - life 57 hours and excellent efficacy in models of infection.5,6 pharmacokinetic studies in man indicate the potential for once or twice daily dosing.7 the objective of this study was to utilize an in vitro pharmacodynamic model simulating human pharmacokinetics to evaluate potential therapeutic regimens of afn-1252 against s. aureus, including both methicillin - susceptible s. aureus (mssa) and mrsa . Bacterial s. aureus isolates utilized were atcc 29213, a standard reference mssa and s186, a clinical mrsa isolate obtained from the bloodstream of an infected patient at the buffalo veterans affair health system of western new york ., were prepared in 100% dimethyl sulphoxide and diluted at least 100-fold in mueller hinton broth (difco laboratories, detroit, mi, usa) supplemented with calcium (25 g / ml) and magnesium (125 mg / l) for mics determinations8 and use in the in vitro pharmacodynamic model . Bacterial quantification of all samples was determined using tryptic soy agar with 5% sheep blood (becton - dickinson, mississauga, on, canada). The in vitro pharmacodynamic model was as previously described.8 human pharmacokinetic profiles of afn-1252 were based on phase 0 studies.9 simulated therapeutic regimens of afn-1252 were based on free drug area under the concentration time curve to mic ratio over mic (fauc / mic) as detailed in table 1 . The initial bacterial inoculum was adjusted spectrophotometrically to achieve a final concentration of 10 colony - forming units / ml . Bacterial samples were taken at 0, 2, 4, 6, 8, 24, 28, 32, and 48 hours and the viable counts were determined . To investigate the impact of escalating exposures on selection of resistant isolates, samples taken at 0, 24, and 48 hours were also plated on tryptic soy agar containing 4 and 6 mics of afn-1252 to detect and amplify resistant subpopulations . Bacterial s. aureus isolates utilized were atcc 29213, a standard reference mssa and s186, a clinical mrsa isolate obtained from the bloodstream of an infected patient at the buffalo veterans affair health system of western new york ., were prepared in 100% dimethyl sulphoxide and diluted at least 100-fold in mueller hinton broth (difco laboratories, detroit, mi, usa) supplemented with calcium (25 g / ml) and magnesium (125 mg / l) for mics determinations8 and use in the in vitro pharmacodynamic model . Bacterial quantification of all samples was determined using tryptic soy agar with 5% sheep blood (becton - dickinson, mississauga, on, canada). The in vitro pharmacodynamic model was as previously described.8 human pharmacokinetic profiles of afn-1252 were based on phase 0 studies.9 simulated therapeutic regimens of afn-1252 were based on free drug area under the concentration time curve to mic ratio over mic (fauc / mic) as detailed in table 1 . The initial bacterial inoculum was adjusted spectrophotometrically to achieve a final concentration of 10 colony - forming units / ml . Bacterial samples were taken at 0, 2, 4, 6, 8, 24, 28, 32, and 48 hours and the viable counts were determined . To investigate the impact of escalating exposures on selection of resistant isolates, samples taken at 0, 24, and 48 hours were also plated on tryptic soy agar containing 4 and 6 mics of afn-1252 to detect and amplify resistant subpopulations . The afn-1252 mics for mssa 29213 and mrsa s186 were both 0008 g / ml . The activity of afn-1252 in the in vitro pharmacodynamic model is shown in fig . D . For all dosage regimens, reductions in viable count over the first 6 hours were generally 12 logs and maximal reductions in viable count (e.g. 2 to 3 logs) generally achieved at fauc / mic of 100200 . Greater reductions in viable count were observed with q12h regimens than corresponding q24h regimens, against both mssa 29213 and mrsa s186 at 24 and 48 hours . The greatest reductions in viable count against mssa 29213 and mrsa s186 were approximately 4 logs, achieved by 450 mg q12h (fauc / mic = 1875) dosing at 28 hours . Further analysis of the pharmacodynamic responses revealed an excellent correlation in the hill model10,11 between log reduction in viable count and fauc / mic fits (r values 09980999). Afn-1252 did not develop resistance at any time point throughout the 48-hour experiment as no growth was present on afn-1252-containing agar . In vitro pharmacodynamic model experiments of (a) afn-1252 q24h versus atcc 29213, (b) afn-1252 q12h versus atcc 29213, (c) afn-1252 q24h versus mrsa s186 and (d) afn-1252 q12h versus mrsa s186 . Fabi is the sole form of enoyl - acp reductase present in s. aureus, s. epidermidis, and other staphylococci . No alternative enzyme or rescue pathway, e.g. Exogenous fatty acids, for fabi in staphylococci has been identified suggesting that fabi is essential to cell viability in staphylococcus spp and therefore has the potential to become a significant new target for the treatment of staphylococcal infections.4 afn-1252 is a highly potent and specific inhibitor of fabi with exquisite activity against staphylococci in extensive mic studies,24 and superior activity to linezolid in the mrsa murine thigh lesion model.5 pharmacokinetic studies in human volunteers indicate a good safety profile and the potential for once or twice a day dosing.7 rate of kill studies demonstrate that afn-1252 typically achieves a 12 log reduction in viable count within 24 hours and therefore is not bacteriostatic but does not meet the clsi criteria of bactericidal.12 other studies have also indicated that afn-1252 can achieve a> 2 log reduction in bacterial count over more than 24 hours4 and hence its action may be best described as slowly bactericidal. Although other triclosan - based fabi inhibitors cg400462, cg400549,13 and mut05639914 are under investigation, they appear to be less potent than afn-1252 and are less advanced . In this current investigation, we studied the bactericidal activity and pharmacodynamics of afn-1252, using an in vitro pharmacodynamic model, against two strains of s. aureus to determine optimal therapeutic regimens including comparisons of once and twice daily dosing . As a result of these studies, the pharmacodynamic profile of afn-1252 was adequately characterized with the fauc / mic well related to antibacterial killing, which is also in agreement with what others have shown.15 twice daily dosing achieved marginally greater reductions in bacterial viable counts than once daily dosing, approaching the clsi definition of bactericidal . . It will be interesting to perform further pharmacokinetic / pharmacodynamic studies using hollow fibre and animal infection models to see if this affects the degree of bactericidal activity.
The attack on the world trade center had the potential to overwhelm new york's health services . Initial estimates spoke of 10,000 people in each of the two towers, all of them either killed or injured . Local hospitals prepared for the worst, and in the first few hours there were hundreds of patients with crush injuries and burns . Horror and sadness has now been replaced by anger, fear, and the determination to be better prepared next time . This determination not only exists in politics but also in health care, and as with all attempts to enforce change there needs to be a period of collecting opinions and data . In this issue of critical care, there is a series of nine articles offering varied perspectives of the events of 11 september 2001 . Louis cook is an advanced life support coordinator with the fire department of new york . On page 301, he describes how the fire department of new york took charge, set up command and control, and then had to evacuate, replace lost personnel, and resume control after the tower collapsed . " This was a monumental task ", writes cook, " given the psychological impact of the event " . The command and control center was also staffed by the new york police department and, on page 304, the deputy chief surgeon, charles martinez, describes his experiences, including the part he played in helping police to ensure surrounding buildings were not " used by terrorists to launch a subsequent attack...with the specific aim of harming the rescue effort " . The article, co - authored by dario gonzalez, medical director for clinical affairs of the fire department of new york, concludes that, while the incident was dramatic, the lessons to be learnt " are the same as those from previous disasters " . On page 307, j david roccaforte of bellevue hospital, only 2.5 miles (4 km) from the world trade center, tells us how they reacted from how they triaged " as well as could be expected " to how it was " difficult to anticipate needs " . Donald b chalfin, an attending intensivist at maimonides medical center, new york, offers on page 310 his eye witness observations of the attack as he sat in the city's traffic . " Like so many other physicians..." he writes, " i was paralyzed knowing that i was unable to give help..." . On page 312, david crippen draws on his experience of the 1988 earthquake in armenia to suggest that, while specialized search and rescue teams may be useful, " a more cost - effective approach [would be] to teach life supporting first aid to the general public " . But whoever intervenes, whether it be medical personnel or the general public, there is potential psychological sequela post - traumatic stress disorder . Jeffrey hammond and jill brooks state, on page 315, that treating post - traumatic stress disorder has " only a marginal effect ", and that early intervention, in the form of critical incident stress management, can " limit the establishment of maladaptive and disruptive cognitive or behavioral patterns ", both in health personnel and victims . Ron simon and sheldon teperman of the jacobi medical center, new york, were part of the hospital's disaster committee and offer some straight - talking criticism of the city's reaction . " The lack of communication probably resulted in more problems than all other factors combined ", they say, going on to suggest that " time, effort, and resources were wasted...because of lack of direction and information " (page 318). At the time of writing, on page 321, vlad kvetan suggests that, while new york absorbed the blow of the world trade center attack well, " major stress was placed on...biohazard resources " . He suggests that because the internet has disseminated sophisticated information about bioterrorism, comprehensive guidelines on managing all kinds of outbreaks, from anthrax to smallpox, are needed . Finally, in the concluding article on page 323, kenneth mattox questions to what extent we are prepared, or can be prepared, for the unexpected, and whether the bureaucrats behind health care have the ability to make those preparations . The frameworks for multifaceted care required during disasters can only be created, he points out, " by leaving egos and personal agendas at the front door and working for a common benefit " . We hope this 10-part series of articles in critical care facilitates the opinion and data collecting that is required before changes in disaster preparedness can be enforced . The series is dedicated to the first responders fire, police, and medical personnel who attended the world trade center disaster of 11 september 2001 . They did not hesitate to place themselves in harm's way to rescue the innocent, and without their efforts many more would have perished . The authors acknowledge david crippen's assistance in the creation of this 10-part review series . This article, and the series it is part of, is dedicated to the first responders fire, police and medical personnel who attended the world trade center disaster of 11 september 2001 . They did not hesitate to place themselves in harm's way to rescue the innocent, and without their efforts many more would have perished.
Primary amenorrhea is usually the result of a genetic or anatomic abnormality . In young women with primary amenorrhea, it is commonly caused by x - chromosome aberrations such as in turner syndrome, but individuals with a normal chromosome complement and ovarian dysgenesis also exist . A 35-year - old female patient presented to our medical outpatient department with complaints of palpitation and chest pain of 6 months duration . Patient had paroxysmal episodes of palpitations that lasted few minutes, resolved spontaneously, and were not associated with exertion or other aggravating factors . Patient had chest pain that was retro - sternal, intermittent not related to exertion and resolved spontaneously . Menstrual history revealed that she never attained menarche . On examination she had dolicocephaly, arachnodactyly, high arched palate, she was tall statured [height 165 cm; figure 1], her arm span (176 cm) was more than her height, arachnodactyly [figure 2], reduced upper to lower body segment ratio (0.83), and she had positive wrist and thumb sign . Patient had underdeveloped rudimentary breasts (tanner stage 2), sparse pubic hair (tanner stage 1), and absent axillary hair . Cardiovascular examination revealed mid - systolic click with a late systolic murmur, other systems were essentially normal . Her blood glucose, renal function tests, liver function tests, and serum electrolytes were within normal limits . Echocardiogram echo / doppler revealed prolapse of anterior mitral leaflet, mitral regurgitation and normal left ventricular systolic function . She had low levels of estrogen (estradiol-10 pg / ml; normal 15 - 200 pg / ml), serum testosterone (0.16 pg / ml, normal 0.6 - 6.8 pg / ml), and progesterone (0.56 ng / ml). She had elevated levels of gonodotropins, follicle - stimulating hormone (fsh) (101.3 serum prolactin (12 ng / ml, normal 0 - 20 ng / ml) and thyroid function tests (free t4 - 9.2 mcg / dl, normal 4.6 to 11.2 mcg / dl; tsh-3.49mu / l, normal 0.4 - 5.0 marfanoid habitus: tall stature, height 165 cm; arm span to height ratio of 1.067; upper segment to lower segment ratio of 0.83 arachnodactyly with high metacarpal index mci list of investigations that contributed in diagnoses of primary amenorrhea perrault and his colleagues in 1951 published the first report on two sisters with gonadal dysgenesis and with additional sensorineural deafness . Hypothesized that there is a form of ovarian dysgenesis that is inherited as an autosomal recessive, female - limited disorder . Neurologic data are available on 14 of 21 girls; 7 of 14 had neurologic abnormalities . They concluded that high incidence of neurologic anomalies suggest that ataxia or mental retardation may not be just coincidental findings, but pleiotropic manifestations of perrault syndrome . Reported on two sporadic and two familial new cases with sensorineural hearing impairment and ovarian dysgenesis, which are the cardinal signs of perrault syndrome in females . Reported on two pairs of sisters with gonadal dysgenesis and deafness, cerebral, and ocular involvement who developed a progressive, severe sensory, and motor neuropathy . Based on the clinical observations of known patients; two forms of ps may be distinguished: one apparently non - progressive form and another with apparently progressive axonal - cerebellar degeneration . Nishi et al . Reviewed 21 patients from the literature, added ataxic gait, pes equinovarus, nystagmus, limited extraocular movements to the spectrum of neurologic defects in ps . Absence of deafness in a patient with xx female gonadal dysgenesis (xx - gd) does not rule out perrault syndrome because the patients could develop deafness much later, at an older age . Most patients had moderate to severe sensorineural deafness with mutism among patients with early onset of deafness . The findings of abnormal body proportions noted in our patients have been previously reported by jacob et al . In their observation of two siblings with perrault syndrome with marfanoid habitus . The pathogenetic basis for the ps is still unclear . Studied a small family of mixed european ancestry includes two sisters with well - characterized perrault syndrome . Whole - exome sequencing of genomic dna from one of these sisters revealed exactly one gene with two rare functional variants: hsd17b4 . Further studies on other families are awaited to confirm the homogeneity of the genetic defect and the underlying molecular defect . These issues were discussed with our patient . During the follow up visits, we noticed depression and suicidal tendencies . After a comprehensive psychiatric evaluation, she was diagnosed with major depression and was put on anti - depressant medication . We did not advice any therapy for mitral valve prolapse as the prognosis in asymptomatic patients with nonsustained arrhythmias and structurally normal hearts is quite good . Thus, the potential deleterious effects of drug therapy probably outweigh any risk from the arrhythmia in this setting . Similarly, no antibiotic prophylaxis or anti - thrombotic prophylaxis was suggested as present guidelines recommends endocarditis prophylaxis for patients only at the highest risk . Perrault syndrome is a rare cause of primary amenorrhea or ovarian dysgenesis, but should be considered in a female child with deafness / mutism . Several reported cases have some form of neurologic deficit but our patient did not have any obvious neurological signs or symptoms, but she had marfanoid habitus, an association that was described only once in the literature . The marfanoid features could be considered as a part of extended phenotype of perrault syndrome.
The ductus arteriosus develops from the distal portion of the left sixth aortic arch and connects the main pulmonary trunk to the descending aorta . It runs in a posterior - anterior, inferior - superior, and leftward direction from the aorta to the pulmonary artery . Patent ductus arteriosus (pda) is a common congenital heart defect, and the incidence of isolated pda in full - term infants is about 1 in 2000, accounting for approximately 5% to 10% of all types of congenital heart disease . Pda can be closed via such different modalities as video - assisted thoracoscopic surgery, conventional surgery with division and suture, and transcatheter closure by interventional catheterization . Small pdas (<1 - 2 mm) can be closed safely with cook detachable (flipper) coils or gianturco with minimal mortality and morbidity and excellent results . The amplatzer ductal occluder (ado), which was introduced in 1997, is recommended for pdas with sizes larger than 2 mm . An antegrade approach via venous line is required for the occlusion of pda using the ado . Rates of complete closure are as high as 99.7%, as was confirmed during a long - term follow - up study . During the procedure, the device is pushed with a delivery cable until it reaches the tip of the delivery sheath in the descending aorta under fluoroscopy . The sheath is gently pulled to deploy the aortic disk, and the cable delivery sheath and device are subsequently pulled as one unit under lateral fluoroscopy until the retention disk is positioned at the ductal ampulla . At this stage by using fluoroscopy, the tracheal air column can be used as a landmark from the previous aortogram to position the device . Also, a tugging sensation can be felt with the pulse of the aorta . By comparing the tracheal air column and the narrowest diameter of the pda from the diagnostic aortogram, the operator can retract the delivery sheath with only a slight tension on the cable and deploy the device . After the confirmation of the correct deployment of the ado by aortography, the device can be released by screwing the cable . Some complications such as device embolization, narrowing of the aortic artery area, and left pulmonary stenosis have been previously described . One of the most critical complications of pda closure by ado is device embolization, frequently seen due to the undersizing of the ado or incorrect positioning of the ado in the pda . Accordingly, having a practical landmark for the correct positioning of the device into the pda could reduce complications after device deployment . One of the best guides for the correct positioning of the ado is aortography after ado deployment in the descending aorta . Be that as it may, in some procedures, there is no arterial line and aortography cannot be performed until the ado is released . So the question remains as to when we can release the ado safely . In this article, we describe for the first time a sign that was extremely helpful during our use of the ado for the closure of pda . The study protocol was approved by the ethics committee of iran university of medical sciences . This retrospective study recruited all patients scheduled to undergo pda transcatheter closure between september 2009 and september 2012 in rajaie cardiovascular, medical and research center . The inclusion criteria were comprised of age <15 years, body weight> 5 kg, conical pda, and narrowest size of the pulmonary end of the pda 2 mm in lateral view aortograms . The exclusion criteria consisted of other complex diseases requiring surgery, other pda shapes rendering it suitable for coiling, very small pdas, and near or systemic pulmonary hypertension . The clinical characteristics of the patients including age, sex, and weight were recorded . During cardiac catheterization, angiographic and catheterization data such as the size of the narrowest diameter of the pda and the type of the pda in lateral view aortograms, pulmonary artery pressure, and fluoroscopy time were obtained . The antegrade procedure via venous line under general anesthesia was recommended for all the patients . The course of the venous catheter was from the inferior vena cava to the right atrium, right ventricle, and pulmonary artery . After the estimation of the size of the pda via lateral view aortography, a device size at least 2 mm greater than the narrowest size of the pda at the pulmonary end was chosen . An appropriate sheath was positioned in the descending aorta, and the ado reached the tip of the delivery sheath by pushing the delivery cable . Next, all of the sheath, delivery cable, and ado were pulled together in order to position the retention disk at the ductal ampulla . In some patients, there was no arterial line and the ado was positioned in the pda by pulling the sheath and tensing the cable . At this time in some of our patients, the continuity between the cable, sheath and ado was broken signifying the correct deployment of the ado . Echocardiography was done during the procedure before releasing the ado and the day after the procedure as well as one month and six months postprocedurally by using a ge vivid 3 echocardiographic machine . The patients were assessed for residual pda, left pulmonary artery stenosis, and descending aorta stenosis intraprocedurally via echocardiography . In the case of the presence of significant complications, two hundred thirty - seven patients underwent pda transcatheter closure between september 2009 and september 2012 . The study population comprised 130 female and 107 male patients . Two patients had protrusion of the ado into the aortic artery but had no significant stenosis; these patients did not have coarctation of the aorta on follow - up . In one of our patients, the ado protruded into the left pulmonary artery; this artery had no obstruction on follow - up . Transcatheter closure of pda is an established and safe method of treatment with no mortality and significant morbidity . In our study, transcatheter closure was performed in 237 patients under general anesthesia and the pda size ranged from 2.1 mm to 6.2 mm . There was no mortality, and there were minimal intraprocedural complications inasmuch as none of the patients had device embolization or vascular complications . The closure rate in our patients was greater than 99.7%, which is comparable to the rates reported in some other studies . Two of our patients had ado protrusion into the aortic artery . On follow - up, however, there was no significant stenosis or other complications . If the ado protrudes into the descending aorta without significant coarctation of the aorta or if less than 50% of the aortic area is obstructed, long follow - up without other procedures is needed . As the patient grows older and this complication necessitates long follow - up periods, but this type of stenosis tends to diminish as the patient grows older . Nonetheless, if left pulmonary stenosis leads to the reduction or obstruction of the left pulmonary artery flow, other alternative treatment modalities such as surgery and use of other devices should be taken into consideration . We herein introduce a sign, which can be useful for the correct deployment of the ado . Figure 1 illustrates a normal conical pda in a lateral view aortogram . As is shown in figure 2, during the procedure and before complete deployment (i.e. When the device is pulled into the ductal ampulla), the device, delivery cable, and delivery sheath have continuity with each other in a curved line . The retention disk of the ado is placed in the ductal ampulla, and the other segments of the ado are positioned in the narrow segment of the pda . After pulling the cable delivery sheath and the device as one unit under lateral fluoroscopy, the delivery sheath is pulled into the pulmonary artery and the distal end of the ado is placed in the pulmonary artery at the narrowest part of the pda . When there is correct deployment, only the delivery sheath is pulled into the pulmonary artery and the continuity between the cable and the device is broken . This angulation is created by the angle between the pda and the pulmonary artery (figure 3). This figure shows an ado positioned in the pda with its retention disk placed in the ductal ampulla . The narrow segment of the device is also positioned in the junction between the pda and the pulmonary artery, and the distal end of the device is in the pulmonary artery . The continuity between the cable and the delivery sheath is broken by a sharp angle between the ado and the cable . During the procedure and before the release of the ado, echocardiography is performed to investigate the possible presence of coarctation of the aorta and left pulmonary artery stenosis . At this point in time, the operator knows that the ado is positioned in the correct site (especially in the absence of an arterial line) and he can release the ado safely . If the ado is positioned in other sites, the sign described herein cannot be observed . In our study, more than 85% of the patients, who underwent pda closure by ado, had a positive sign, which denotes the reliability of this sign . The relatively small sample size and duration may be the major limitations of the present study . We herein introduced a new sign, which can assist in the correct deployment of the ado during pda closure . To our knowledge, the existing literature lacks signs similar to what we describe here . This sign, especially in the absence of an arterial line for post - pda aortography, can help the operator release the ado safely.
Trauma to the popliteal arteries resulting in pseudoaneurysm formation is rarely encountered outside the setting of wartime surgery [1, 2]. Popliteal pseudoaneurysms (pps) account for <4% of all popliteal artery aneurysms, and hence experience of their management in individual centres is limited [35]. The diagnosis of pp may also be delayed due to long - time interval between the initial trauma and symptom onset . We present the case of a large pp causing acute limb ischaemia to a 37-year - old man . An otherwise healthy 37-year - old man presented with acute limb ischaemia of recent onset . His past medical history was significant for smoking as well as a previous gunshot wound to the right lower limb 12 years previously that required fasciotomies . Diagnostic work - up included an arterial duplex scan of the right lower limb, which demonstrated a 5.5 cm 5.2 cm aneurysm of the right popliteal artery and the lack of flow in the right anterior tibial and peroneal arteries . A ct angiogram was subsequently undertaken to establish the morphology of the aneurysm for preoperative planning, which confirmed the diagnosis but also demonstrated a large number of pellets in the soft tissues surrounding the right knee in keeping with the history of previous gunshot injury to the area . Poor opacification of the right anterior tibial and peroneal arteries was also demonstrated, suggestive of thrombosis or embolization secondary to the popliteal aneurysm . Angiography, via an antegrade right femoral approach, showed a false aneurysm of the popliteal artery at the knee joint level . A 6 mm 25 mm viabahn (gore) covered stent was deployed to exclude the pseudoaneurysm, and a thrombolysis catheter was left in situ in the below - knee popliteal artery (fig . 1). Thrombolysis was started using alteplase at a rate of 1 mg / h, with a concurrent infusion of heparin 400 iu / h via the arterial sheath, as per local protocol . Figure 1:a digital subtraction angiogram of the right popliteal artery demonstrating the pseudoaneurysm, pre- (a) and post- (b) stenting . A digital subtraction angiogram of the right popliteal artery demonstrating the pseudoaneurysm, pre- (a) and post- (b) stenting . A repeat angiogram after 24 h of thrombolysis demonstrated improved patency while at 48 h excellent patency of the infragenicular vessels was seen (fig . 2), and the patient was subsequently discharged on dual - antiplatelet and statin therapy . A follow - up arterial duplex performed at 6 weeks post discharge demonstrated excellent patency of the stent graft and infragenicular arteries . Figure 2:a digital subtraction angiogram at presentation (a) and after 48 h of continuous alteplase thrombolysis (b) demonstrating the improved patency of the infrapopliteal arteries . A digital subtraction angiogram at presentation (a) and after 48 h of continuous alteplase thrombolysis (b) demonstrating the improved patency of the infrapopliteal arteries . Pps are a clinical entity that is rarely encountered in civilian medicine, and account for <4% of all aneurysms of the popliteal artery [1, 2]. Its development is considered to be secondary to the formation of a thick fibrous pseudosac following arterial wall injury and haematoma organization . This rather slow process may explain the usual delay in diagnosis which may range from days to years, with a median delay of 1.5 months . In our case, the delay in diagnosis was 12 years after the gunshot wound . The usual presentation is that of a painful, pulsatile mass that may have given rise to complications that may threaten limb function or viability, including thrombotic and embolic events . A wide range of options exist for the management of pps, including open surgical repair and endovascular treatment options . Surgical methods include the resection of the pseudoaneurysm with interposition grafting, ligation and bypass and primary arterial repair without grafting . Finally, aneurysm resection and primary end - to - end anastomosis can be considered for small aneurysms . The limiting factor, however, is the amount of perianeurysmal fibrosis and chronic inflammatory changes that are frequently encountered and hinder the safe performance of open surgical repair [1, 6]. In this case, we elected to proceed with an endovascular repair . The reasons were 2-fold: on one hand, the previous gunshot injury and the subsequent fasciotomies had led to significant deformity of the patients lower limb, while the amount of scarring would make access to the popliteal artery difficult, thus not favouring an open surgical repair . On the other hand, the distal anterior tibial and peroneal artery thrombosis would require thrombolytic therapy and thus, the endovascular approach was considered more appropriate . The false aneurysm was excluded with the covered stent prior to starting thrombolysis in order to eliminate the risk of distal embolization of thrombus from within the false aneurysm into the calf arteries during thrombolysis . Endovascular repair has been shown to be a safe and efficient way of treating pps associated with lower morbidity and shorter hospital stay . Careful patient selection, however, is warranted, as increased risk of early occlusion has been reported, and hence may render this approach less desirable [7, 8]. Covered stent placement was considered appropriate in this case in order to enable thrombolysis, which would not have been possible immediately after open surgical bypass . It is unclear whether stenting in this case will be the definitive treatment, as due to the young age of the patient and the anatomical location of the stenting, stenosis or occlusion of the stent is likely in the future . To this end, the patient has been put on a surveillance programme and will be followed up closely . A short covered stent (25 mm) was used to avoid compromising future graft anastomotic sites . Thus, the endovascular treatment offered in this case was efficient in dealing with both the acute ischaemia secondary to thrombosis as well as the aneurysm itself in the short term . On the other hand, the presence of a stent does not preclude open surgery in the future, preferably in an elective setting, and this is the approach the patient selected having being informed of his options . This case report demonstrates the efficiency of stenting in the acute management popliteal artery pseudoaneurysms with encouraging early radiological and clinical outcomes.
Classic bladder exstrophy (be) is a rare malformation of the genito - urinary tract affecting 1:50,000 - 1:100,000 live births . The surgical reconstruction of the be - epispadias complex has evolved significantly during the last 50 years but is still challenging for the most experienced pediatric urologists, surgeons, and orthopedists . The upper tracts are almost always normal in the neonates with classic be before abdominal wall, posterior urethral, and bladder closure . The upper tract changes or deterioration of renal function almost always occurs after reconstructive surgery . The objectives of treatment are to achieve a secure closure of the bladder, pelvis, and the abdominal wall; preservation of renal function; urinary continence and creation of functional and cosmetically appealing genitalia . Grady and mitchell have described complete repair of classic be with the combination of bladder closure and epispadias repair at birth . However, the modern staged repair of exstrophy is still considered the gold standard . This involves bladder closure shortly after birth, followed by epispadias repair at 6 - 12 months of age and bladder neck reconstruction at 4 - 5 years of age . To assess the success of staged reconstruction of the be and its effect on the upper urinary tract, we have analyzed the renal function and continence in 30 between 1994 and 2013, 30 patients with be have been managed at our institute in various stages of repair, 7 were females and 23 were male patients . Of 30 patients 27 patients underwent primary repair and 3 patients were referred for secondary be closure . Twenty - one children presented before 1 year of age; four neonates presented before 72 h of birth, in whom bladder closure was done without osteotomy with hip spica only . Three of these patients, who were operated without osteotomy, had bladder dehiscence, hence have undergone secondary repair with bilateral anterior iliac osteotomy and immobilization with external fixators (efs). Eight patients presented before 3 months of age; all underwent primary bladder closure with bilateral anterior iliac osteotomy and immobilization with hip spica . Nine patients presented between 4 months and 1 year of age, all were operated with primary or secondary exstrophy repair with bilateral anterior iliac osteotomy and immobilization with efs . Two of these children referred with bladder dehiscence, had primary repair with posterior iliac osteotomy; hence, secondary exstrophy repair was carried out with bilateral anterior iliac osteotomy . Eight children presented between 1 and 5 years of age and one child presented at 9 years of age; all underwent bladder closure with bilateral anterior iliac osteotomy and immobilization with efs . The mean and median age of exstrophy repair was 1.25 years and 4 months, respectively . One patient had failure and six had penopubic or urethro - cutaneous (uc) fistulae . The average age at the time of epispadias repair was 5 years (212 years). The triangular flaps of the bladder were incorporated into the bladder instead of de - epithelializing, and using these to buttress the bladder neck repair . Thirteen children have undergone guy leadbetter bladder neck reconstruction, eleven males and two females . Eight children are continent for more than 2 h with good nocturnal continence; one female child needs clean intermittent self - catheterization (cisc) every 34 h for bladder emptying . Two other children also have undergone augmentation cystoplasty and are on cisc every 34 h. one male child, who underwent exstrophy reconstruction at 9 years of age, has surprisingly developed continence after epispadias repair only . Interestingly, one female child who presented at 3 years of age with good bladder plate was operated with bilateral cephalo - trigonal ureteric reimplantation, trigonal tubularization, and bladder and abdominal wall closure with bilateral anterior iliac osteotomy is continent for 3 h after single - stage repair only [figures 1 and 2]. Female exstrophy child with good bladder plate micturating cystourethogram showing good bladder capacity the average age at the time of bladder neck repair was 8 years (416 years) and the mean bladder capacity at the time of repair was 100 ml (80200 ml). Thirty patients have undergone primary or secondary bladder closure, four neonates presenting before 72 h of life were operated without osteotomy, three of these developed dehiscence . Hence, following this all children were operated with bilateral anterior iliac osteotomy either with hip spica in infants <3 months and efs in all children older than 3 months [table 1]. Primary bladder exstrophy repair / secondary bladder exstrophy repair eighteen children have undergone modified cantwell ransley epispadias repair, one had a failure and was successfully repaired again . Six children had uc fistula postoperatively; three healed spontaneously and three required repair [table 2]. Cantwell - ransley epispadias repair thirteen patients have undergone all stages of be repair; nine are continent for more than 2 h, and four children are continent for <2 h. one child is continent after single - stage repair; another child has developed continence after epispadias repair only . One child with failed bladder neck repair and two children whose bladder capacity was <80 ml have undergone augmentation cystoplasty . Hence, out of 17 patients; 14 are socially continent with good nocturnal continence . Two children, who had undergone augmentation cystoplasty, have developed chronic renal failure and are on hemodialysis . These changes resulted from progressive hydronephrosis due to bladder outlet obstruction after bladder closure in one female patient and after urinary diversion in another male child . Five patients developed bladder calculi after be or epispadias repair, and have developed renal scarring . These patients who developed renal scarring following closure had one or more documented febrile urinary tract infections . Four patients who are coming for regular follow - up have still not developed adequate bladder capacity and are awaiting continence procedure [table 3]. The modern staged approach to be reconstruction has undergone significant changes since it was first advocated by jeffs and cendron as quoted by gearhart . However, the goal of upper tract preservation, obtaining urinary continence, and achievement of satisfactory functional and cosmetic external genitalia remains same . Nonetheless, this success is associated with some risk to the upper urinary tract . Usually, these complications are seen after failed initial closure, which can be categorized as complete dehiscence, bladder prolapse, and outlet obstruction . In our series, three neonates who were operated without osteotomy had bladder dehiscence; other 27 children who were operated with bilateral anterior iliac osteotomy did not have bladder dehiscence . The most critical support for osteotomy is that it allows tension free closure, which prevents subsequent dehiscence and organ prolapsed . Studies from europe and north america have shown that patients requiring repeat closure after failed attempt are less likely to have undergone osteotomy at initial closure . Children operated before 3 months of age had primary bladder closure with bilateral anterior iliac osteotomy and immobilization with hip spica . In indian summers, it is difficult to maintain hygiene and avoid wound infection in hip spica . Bhatnagar incorporates triangular flaps after urethral lengthening in the bladder repair; we also incorporate these triangular flaps for the bladder repair . This not only helps in utilizing bladder tissue for enhancing the bladder capacity but also improves the results of surgery with regard to urinary continence . The patients with outlet obstruction after initial closure are at risk of hydronephrosis, severe reflux, pyelonephritis, and renal scarring . One female child with outlet obstruction developed renal scarring and is on hemodialysis . In a review by baker et al . Of exstrophy database, 29 boys and 12 girls were found to have posterior urethral obstruction after closure in the neonatal period . In our patients, the most common method of presentation was urinary tract infection seen in eight patients; of these five had bladder calculi due to intersymphyseal stitch erosion into bladder and one presented with urinary retention . Now we prefer to use dexon suture for pubic symphyseal closure rather than prolene suture . Have revealed an acceptable risk of renal deterioration with 14.7% of patients developing renal deterioration over a follow - up of 12.7 years . These authors suggest that most significant factors in the development of upper tract scarring after bladder closure are one or more febrile urinary tract infections, failure to use prophylactic antibiotics after bladder closure and presence of progressive hydronephrosis . In baker et al . Series, 22% had upper tract deterioration, including two with chronic renal insufficiency . In our series also, three patients (10%) have developed renal deterioration . The above statistics clearly suggest that in an infant or child with be, a febrile urinary infection should warrant a renal and bladder ultrasound to rule out hydronephrosis, hydroureter, and to assess bladder emptying . Since all patients with exstrophy have various degree of reflux, all should receive chemoprophylaxis . The prophylaxis should be continued until ureteric reimplantation and bladder neck reconstruction performed and reflux cured and appropriate bladder emptying proven on ultrasound . The development of hydronephrosis after bladder neck repair can be due to ineffectual bladder emptying, a small inelastic bladder that is not capable of handling increasing volume of urine over time or ureteral obstruction secondary to reimplantation . This can occur any time after repair, hence the importance of constant regular follow - up evaluations . In our series also, one child developed altered renal function due to small inelastic bladder not capable of handling the increasing volume of urine . Although modified staged reconstruction is being performed at many institutes, grady and mitchell have proposed total reconstruction consisting of the bladder and urethral closure with penile disassembly in the newborn period . However, 50% of these patients required ureteric reimplantation after newborn period for febrile urinary tract infections . Baradaran et al . Also stipulate that delayed primary repair of exstrophy does not compromise the rate of bladder growth . However, children born with smaller templates will have overall smaller capacities and are less likely to undergo bladder neck reconstruction . While bladder prolapse and dehiscence have been recognized as major complications of primary be repair, posterior urethral outlet obstruction after bladder closure puts bladder and upper tracts at risk and markedly decreases the success rate of modern techniques of staged reconstruction . Therefore, whichever treatment modality is chosen for the newborn with be; modern type of staged reconstruction, bladder, and urethral closure by penile disassembly in the newborn or urinary diversion, follow - up must be careful and into and including adulthood . In our experience, the modern staged repair offers a low risk of renal scarring with acceptable continence opportunity with acceptable cosmetic appearance of external genitalia in the males and females.
Plasmodium vivax accounts worldwide for an estimated 7080 million cases of malaria per year . In some countries such as brazil, p. vivax was responsible for approximately 79% of the 389,736 cases of the disease reported in 2001 . . They can be useful for the individual diagnosis or for the patients' follow - up after specific antimalaria treatment . Also, this method is time consuming and requires trained personnel . In attempts to overcome these problems these tests detect specific proteins such as hrp2, a histidine rich protein 2, or pldh, lactate dehydrogenase, in unfractionated blood of patients with malaria . However, these assay do not differentiate p. vivax from plasmodium malariae or plasmodium ovale infections, and vary in their sensitivity and specificity (reviewed in reference). Molecular diagnosis by pcr is described as the most sensitive and specific method for plasmodium detection . Genus- and species - specific primers have been used to amplify plasmodium ssrrna genes of the four human malaria parasites and to detect mixed infections [4 - 6]. However, this methodology is costly and requires trained personnel for its implementation . Detection of antibodies by immunofluorescence or elisa has been used for seroepidemiology of malaria . However, in the case of p. vivax, the difficulty of blood stage cultivation has been hindering the use of these methodologies . Production of recombinant proteins through the techniques of genetic engineering may provide sufficient p. vivax blood stage antigen(s) for the establishment of specific serological assays . In the course of immuno - epidemiological studies using recombinant proteins based on the sequence of the merozoite surface protein-1 (msp1) of p. vivax, we found that a recombinant protein representing the 19 kda region of msp1 (msp119) was highly immunogenic during natural infection in humans . This recombinant protein was recognized by antibodies of a large fraction of brazilian individuals recently exposed to p. vivax . This observation was subsequently confirmed in studies performed in korea, where more than 90% of p. also important was the observation that the p. vivax msp119 gene displays very limited allele polymorphism in different regions of the world that does not restrict recognition by human antibodies . Together, these results suggested that it could be possible to develop an elisa using a single recombinant protein based on the p. vivax msp119 . This relatively simple and inexpensive technique could be of great applicability for epidemiological studies, the screening of blood donors and the serological diagnosis of malaria caused by p. vivax . In the present study three purified recombinant proteins produced in e. coli (gst - msp119, his6-msp119 and his6-msp119-padre) and one in pichia pastoris (ymsp119-padre) were compared for their ability to be recognized by igg antibodies of individuals with patent p. vivax infection . Serological evaluation was performed with serum samples collected from individuals living in areas endemic for malaria in the north of brazil and compared to serum samples from individuals never exposed to p. vivax malaria . Sera from 430 individuals were used in this study, of which 200 were from patients with patent p. vivax malaria and 230 from persons not exposed to p. vivax malaria (negative controls). The blood samples from p. vivax patients were collected in the state of par, in the north of brazil, in areas endemic for malaria: 103 from belm, 21 from marab, 20 from itaituba, 20 from tailndia, 36 from igarap - au . These samples were obtained between january 1996 and july 1999 with informed consent of all individuals and kept at -20c . The 230 individuals non - exposed to p. vivax malaria included: (i) 49 donors to blood banks in the city of so paulo, an area where malaria is not endemic (negative controls); (ii) 108 blood bank donors with unrelated infectious diseases, detected serologically; among them 21 with chagas disease, 21 with syphilis, 19 with hbv, 21 with hcv, 14 with htlv and 12 with hiv; (iii) 10 individuals positive for antinuclear antibodies (ana) and 10 for rheumatoid factors (rf); (iv) 53 individuals living in distinct areas in west africa where malaria caused by plasmodium falciparum is endemic: a) 26 adults without clear symptoms of malaria or other infectious disease from senegal (n = 19) and gambia (n = 7), b) seven children from gambia during patent infection by p. falciparum, c) 20 malaria immune adults from ghana . Silvia di santi (superitendncia de controle de endemias, sucen, so paulo). The recombinant proteins used in the present study represent amino acids 16161704 of the msp-1 (belem strain) of p. vivax . These proteins were expressed in e. coli (gst - msp119, his6-msp119 and his6-msp119-padre, ref . The generation of the plasmids and expression / purification of the recombinant proteins produced in e. coli or pichia pastoris were performed as described in references 15 and 16, respectively . Human igg antibodies against msp119 the amount of recombinant protein gave the same od492 when we used an anti - msp119 mab . Fifty l of each solution were added to each of 96 well plates (high binding, costar). After overnight incubation at room temperature (rt), the plates were washed with pbs - tween (0.05%, v / v) and blocked with pbs - milk (5% w / v) for two hours at 37c . Serum samples were diluted 1:100 in this same solution and 50 l of each sample was added to each well in duplicate . After incubation for two hours at rt and washes with pbs - tween, 50 l a solution containing peroxidase - conjugated goat anti - human igg (fc specific) diluted 1:10,000 (sigma) were added to each well . The enzymatic reaction was developed by the addition of 1 mg / ml of o - phenylenediamine (sigma) diluted in phosphate - citrate buffer, ph 5.0, containing 0.03% (v / v) hydrogen peroxide, and was stopped by the addition of 50 l of 4 n h2so4 . Plates were read at 492 nm (od492) with an elisa reader (slt spectra, slt labinstruments, austria). The individual values of od492 obtained for the recombinant proteins of msp119 were corrected by subtraction of the individual values of od492 obtained against glutathione s - transferase (gst). Od492 from different samples were plotted using computer graphics software (graphpad prism, version 3.0, san diego, california). Cutoff values of each recombinant protein in elisa were calculated as the mean od492 of sera from 49 blood donors plus five standard deviations (sd). The values for sensitivity and specificity were estimated as described with microscopy used as the gold standard . The kruskal - wallis test was used to test the significance of differences between the group values . Sera from 430 individuals were used in this study, of which 200 were from patients with patent p. vivax malaria and 230 from persons not exposed to p. vivax malaria (negative controls). The blood samples from p. vivax patients were collected in the state of par, in the north of brazil, in areas endemic for malaria: 103 from belm, 21 from marab, 20 from itaituba, 20 from tailndia, 36 from igarap - au . These samples were obtained between january 1996 and july 1999 with informed consent of all individuals and kept at -20c . The 230 individuals non - exposed to p. vivax malaria included: (i) 49 donors to blood banks in the city of so paulo, an area where malaria is not endemic (negative controls); (ii) 108 blood bank donors with unrelated infectious diseases, detected serologically; among them 21 with chagas disease, 21 with syphilis, 19 with hbv, 21 with hcv, 14 with htlv and 12 with hiv; (iii) 10 individuals positive for antinuclear antibodies (ana) and 10 for rheumatoid factors (rf); (iv) 53 individuals living in distinct areas in west africa where malaria caused by plasmodium falciparum is endemic: a) 26 adults without clear symptoms of malaria or other infectious disease from senegal (n = 19) and gambia (n = 7), b) seven children from gambia during patent infection by p. falciparum, c) 20 malaria immune adults from ghana . Silvia di santi (superitendncia de controle de endemias, sucen, so paulo). The recombinant proteins used in the present study represent amino acids 16161704 of the msp-1 (belem strain) of p. vivax . These proteins were expressed in e. coli (gst - msp119, his6-msp119 and his6-msp119-padre, ref . The generation of the plasmids and expression / purification of the recombinant proteins produced in e. coli or pichia pastoris were performed as described in references 15 and 16, respectively . The amount of recombinant protein gave the same od492 when we used an anti - msp119 mab . Fifty l of each solution were added to each of 96 well plates (high binding, costar). After overnight incubation at room temperature (rt), the plates were washed with pbs - tween (0.05%, v / v) and blocked with pbs - milk (5% w / v) for two hours at 37c . Serum samples were diluted 1:100 in this same solution and 50 l of each sample was added to each well in duplicate . After incubation for two hours at rt and washes with pbs - tween, 50 l a solution containing peroxidase - conjugated goat anti - human igg (fc specific) diluted 1:10,000 (sigma) were added to each well . The enzymatic reaction was developed by the addition of 1 mg / ml of o - phenylenediamine (sigma) diluted in phosphate - citrate buffer, ph 5.0, containing 0.03% (v / v) hydrogen peroxide, and was stopped by the addition of 50 l of 4 n h2so4 . Plates were read at 492 nm (od492) with an elisa reader (slt spectra, slt labinstruments, austria). The individual values of od492 obtained for the recombinant proteins of msp119 were corrected by subtraction of the individual values of od492 obtained against glutathione s - transferase (gst). Od492 from different samples were plotted using computer graphics software (graphpad prism, version 3.0, san diego, california). Cutoff values of each recombinant protein in elisa were calculated as the mean od492 of sera from 49 blood donors plus five standard deviations (sd). The values for sensitivity and specificity were estimated as described with microscopy used as the gold standard . The kruskal - wallis test was used to test the significance of differences between the group values . Four recombinant proteins obtained as earlier described in references 15 and 16 (table 1) were used . Sds - page analysis of each recombinant protein revealed a single band of the expected molecular weight after coomassie blue or silver staining (data not shown). An igg survey of the serum samples of individuals with patent p. vivax infection patients showed that the values of positivity were quite similar with the four recombinant antigens employed . Ninety to 93.5% of the 200 serum samples tested were positive for igg with the recombinant proteins based on the msp119 . When we compared the od492 values from serum samples of p. vivax infected individuals, we observed that values obtained for the recombinant proteins his6-msp119 and his6-msp119-padre were significantly higher than those obtained for gst - msp119 (fig . 1, p <0.01, kruskal - wallis test). On the other hand, no statistically significant difference was observed among values obtained by the comparison of the recombinant proteins his6-msp119, his6-msp119-padre and ymsp119-padre, or gst - msp119 and ymsp119-padre (p> 0.05, kruskal - wallis test). Distribution of od492 data for 200 sera from individuals with patent malaria infection caused by p. vivax . The symbols represent the reactivity of each serum sample tested in duplicate at 1:100 dilution against the indicated recombinant proteins . The horizontal line inside the drops for each recombinant protein represents the cut - off values (0.127, 0.170, 0.198 and 0.500 for gst - msp119, his6-msp119, his6-msp119-padre and ymsp119-padre, respectively). Sera from the few individuals who tested negative towards all four recombinant proteins were also tested for the recognition of recombinant proteins representing the n - terminal region of p. vivax msp1, msp3 (c - terminal) or msp3(n and c - terminal and entire protein, references 19 and 20). All of them failed to recognize any of the recombinant protein tested (data not shown). However, we detected antibodies igm anti - msp119 in 90% (9/10) of these igg negative individuals . If we consider the results of detection of antibodies igg and igm for msp119, the sensitivity of the assay was of 99.5% . These 10 individuals were primo - infected and therefore the presence of igm but not igg may reflect a delay in the immunoglobulin class switch . From the 200 individuals that we evaluated, one hundred and one of them had specific igg for the recombinant proteins that we tested . Only 10 were negative for igg and, as mentioned above, 9 of them had specific igm . The specificity of the assay using recombinant p. vivax antigens was examined with 230 serum samples from individuals without previous history of p. vivax malaria, including individuals exposed to p. falciparum malaria, individuals with unrelated diseases or healthy individuals . Due to limitations on the volume of each sample available, sera from african individuals exposed to p. falciparum for the calculation of the specificity of the assay using the recombinant protein his6-msp119 the results that was obtained did not include sera from african individuals . The specificity values determined with sera from healthy individuals and sera from individuals with other infectious diseases, were 98.3% (gst - msp119), 97.7% (his6-msp119and his6-msp119-padre) and 100% (ymsp119-padre). In figure 2, we compared the od492 values from serum samples of p. vivax infected individuals, individuals exposed to p. falciparum and individuals with unrelated diseases . Distribution of the od492 data for sera from individuals with patent p. vivax malaria, from individuals exposed to p. falciparum, from individuals with unrelated diseases or healthy controls . The symbols represent the reactivity of each serum sample tested in duplicate at 1:100 dilution against the indicated recombinant proteins . The abbreviations are as follow: a) pv= individuals with p. vivax malaria (n = 200), b) pf= individuals from areas where p. falciparum malaria is endemic (n = 53), c) cha = individuals with chagas disease (n = 21), d) syp = individuals with syphilis (n = 21), e) hbv = individuals with hepatitis b (n = 19), f) hcv= individuals with hepatitis c (n = 21), g) htlv = individuals with htlv (n = 14), h) hiv= individuals with hiv (n = 12), i) ana = individuals positive for antinuclear antibodies (n = 10), j) rf = individuals positive for rheumatoid factors (n = 10), l) healthy = healthy individuals (n = 49). Sera from african individuals exposed to p. falciparum were tested only against recombinant protein his6-msp119 . The horizontal line inside the drops for each recombinant protein represents the cut - off values (0.127, 0.170, 0.198 and 0.500 for gst - msp119, his6-msp119, his6-msp119-padre and ymsp119-padre, respectively). Four recombinant proteins obtained as earlier described in references 15 and 16 (table 1) were used . Sds - page analysis of each recombinant protein revealed a single band of the expected molecular weight after coomassie blue or silver staining (data not shown). An igg survey of the serum samples of individuals with patent p. vivax infection patients showed that the values of positivity were quite similar with the four recombinant antigens employed . Ninety to 93.5% of the 200 serum samples tested were positive for igg with the recombinant proteins based on the msp119 . When we compared the od492 values from serum samples of p. vivax infected individuals, we observed that values obtained for the recombinant proteins his6-msp119 and his6-msp119-padre were significantly higher than those obtained for gst - msp119 (fig . 1, p <0.01, kruskal - wallis test). On the other hand, no statistically significant difference was observed among values obtained by the comparison of the recombinant proteins his6-msp119, his6-msp119-padre and ymsp119-padre, or gst - msp119 and ymsp119-padre (p> 0.05, kruskal - wallis test). Distribution of od492 data for 200 sera from individuals with patent malaria infection caused by p. vivax . The symbols represent the reactivity of each serum sample tested in duplicate at 1:100 dilution against the indicated recombinant proteins . The horizontal line inside the drops for each recombinant protein represents the cut - off values (0.127, 0.170, 0.198 and 0.500 for gst - msp119, his6-msp119, his6-msp119-padre and ymsp119-padre, respectively). Sera from the few individuals who tested negative towards all four recombinant proteins were also tested for the recognition of recombinant proteins representing the n - terminal region of p. vivax msp1, msp3 (c - terminal) or msp3(n and c - terminal and entire protein, references 19 and 20). All of them failed to recognize any of the recombinant protein tested (data not shown). However, we detected antibodies igm anti - msp119 in 90% (9/10) of these igg negative individuals . If we consider the results of detection of antibodies igg and igm for msp119, the sensitivity of the assay was of 99.5% . These 10 individuals were primo - infected and therefore the presence of igm but not igg may reflect a delay in the immunoglobulin class switch . From the 200 individuals that we evaluated, one hundred and one of them had specific igg for the recombinant proteins that we tested . Only 10 were negative for igg and, as mentioned above, 9 of them had specific igm . The specificity of the assay using recombinant p. vivax antigens was examined with 230 serum samples from individuals without previous history of p. vivax malaria, including individuals exposed to p. falciparum malaria, individuals with unrelated diseases or healthy individuals . Due to limitations on the volume of each sample available, sera from african individuals exposed to p. falciparum the calculation of the specificity of the assay using the recombinant protein his6-msp119 the results that was obtained did not include sera from african individuals . The specificity values determined with sera from healthy individuals and sera from individuals with other infectious diseases, were 98.3% (gst - msp119), 97.7% (his6-msp119and his6-msp119-padre) and 100% (ymsp119-padre). In figure 2, we compared the od492 values from serum samples of p. vivax infected individuals, individuals exposed to p. falciparum and individuals with unrelated diseases . Distribution of the od492 data for sera from individuals with patent p. vivax malaria, from individuals exposed to p. falciparum, from individuals with unrelated diseases or healthy controls . The symbols represent the reactivity of each serum sample tested in duplicate at 1:100 dilution against the indicated recombinant proteins . The abbreviations are as follow: a) pv= individuals with p. vivax malaria (n = 200), b) pf= individuals from areas where p. falciparum malaria is endemic (n = 53), c) cha = individuals with chagas disease (n = 21), d) syp = individuals with syphilis (n = 21), e) hbv = individuals with hepatitis b (n = 19), f) hcv= individuals with hepatitis c (n = 21), g) htlv = individuals with htlv (n = 14), h) hiv= individuals with hiv (n = 12), i) ana = individuals positive for antinuclear antibodies (n = 10), j) rf = individuals positive for rheumatoid factors (n = 10), l) healthy = healthy individuals (n = 49). Sera from african individuals exposed to p. falciparum were tested only against recombinant protein his6-msp119 . The horizontal line inside the drops for each recombinant protein represents the cut - off values (0.127, 0.170, 0.198 and 0.500 for gst - msp119, his6-msp119, his6-msp119-padre and ymsp119-padre, respectively). Due to the difficulties in cultivating blood stages of p. vivax, serological diagnosis of patent p. vivax malaria can best be accomplished with the use of recombinant proteins . In the present study, we compared for purified recombinant proteins produced in e. coli or in pichia pastoris in their ability to be recognized by igg antibodies of brazilian individuals with patent p. vivax infection . Our study demonstrated that, for the brazilian population, an elisa using a single recombinant protein based on the p. vivax msp119 kda can serve as the basis for the development of a sensitive serological test that can be used for epidemiological studies, screening blood donors and diagnosis of p. vivax malaria . So far, we do not have an estimate of the timing required after mosquito bite for the appearance of specific antibodies . To be accurate, nevertheless, we were able to determine that from the 111 primo - infected individuals that we evaluated, 101 (90.9%) had specific igg to msp119 . This information is important and suggests that igg antibodies specific for msp119 are suitable for testing individuals who are traveling or have traveled for the first time through malaria endemic areas . On the other hand, the persistence of the igg antibodies specific for msp119 is still a matter that has to be further evaluated . In previous studies we determined that the antibody titers decreased relatively rapidly after treatment . An important observation from our study was the fact that sera from african individuals naturally exposed to p. falciparum failed to cross - react with the recombinant protein his6-msp119 (figure 2). As a control, 39 of these sera were also tested against a recombinant protein derived of the msp-2 of p. falciparum . The lack of cross - reactivity may have several implications and should be further evaluated in the light of the current knowledge that both msp119 share similarities in their predicted tertiary structures . For epidemiological studies, for the screening of blood donors and the serological diagnosis of p. vivax nevertheless, the absence of cross - recognition of p. vivax msp119 by antibodies from p. falciparum - exposed individuals has may also have immunological consequences at the level of acquired immunity and vaccine development in areas where both malarias are prevalent . Detailed studies will be required to determine whether sera from p. vivax infected individuals also fail to recognize recombinant proteins representing the p. falciparum msp119 . Recently, a direct sandwich elisa to detect antibodies against the c - terminal region of msp-1 was proposed as a potential diagnostic method for plasmodium vivax exposed individuals from korea . This assay showed a high sensitivity (99.5%) indicating that recombinant proteins containing the c - terminal region of p. vivax msp-1 may be used in individuals from different parts of the world . It is also important to mention that it is very likely that serological detection of p. vivax malaria can be further improved by several distinct strategies . We are currently trying to improve the detection level by the combined use of other recombinant proteins based on the sequence of other blood stage antigens of p. vivax such as the plasmodium vivax merozoite surface proteins-3 and, apical membrane antigen-1 and the duffy binding protein . Also, we are developing a chemiluminescent enzyme - linked immunosorbent assay that may greatly improve the sensitivity, eliminating the few false negative and false positive samples we had . Finally, our results support the notion that recombinant proteins based on the p. vivax msp119 kda can be useful for the development of a rapid immunochromatographic assay for field studies, small laboratories and blood banks (reviewed in references 3 and 27). Our study demonstrated that for the brazilian population, an elisa using a single recombinant protein based on the p. vivax msp119 can serve as the basis for the development of a valuable serological assay for the detection of p. vivax malaria . Ocf participated in the design of the study and the supply of the serum samples from blood bank donors and drafted the manuscript . Iss conceived of the study and participated in all aspects of its design, execution, coordination and manuscript preparation . This work was supported by a grant from the fundao de amparo a pesquisa do estado de so paulo (fapesp). Mhcr, mmr and iss are supported by fellowships from conselho nacional de desenvolvimento cientfico e tecnolgico (cnpq). Silvia di santi for kindly providing the sera from individuals from west africa, dr.
The definition of congenital heart block for the purposes of this review will be the presence of conduction system disease of any form, which is diagnosed on or before 28 days of life . The incidence of congenital heart block has been estimated from several studies to be about 1 in 22,000 live births.1 although this is clearly an uncommon disorder, it may be associated with high mortality and morbidity and therefore requires a high index of suspicion for early diagnosis and aggressive therapy when appropriate . Aggressive therapy can be defined as offering the prenatal use of dexamethasone or the other maternal drugs, fetal pacing, or early delivery . There are no data on the appropriateness of aggressive therapy, but our recent paper2 implies it may improve hydrops in the sickest fetuses . Secondly, we will spend some time discussing the unique subtype of congenital heart block, that which occurs in the absence of major structural anomalies and which is associated with maternal autoimmune antibodies . The commonest forms of congenital heart disease associated with heart block include left atrial isomerism, often with an accompanying atrioventricular septal defect, as well as levo transposition of the great arteries . When diagnosed in the postnatal period, approximately one - third of cases of congenital conduction system disease have associated structural disease . In utero, diagnosis of congenital heart block is associated with structural heart disease in approximately one half of the cases.1 there is a higher association of congenital heart block occurring with congestive heart failure in utero, and thus a poorer prognosis . The outlook for patients with congenital heart block depends largely on the presence or absence of underlying structural heart disease, as well as the rate of ventricular activation and the presence or absence of congestive heart failure . If the heart block is diagnosed as a bradycardia during the fetal period, there is a very high rate of fetal and neonatal loss . Prenatal risk factors for mortality prenatally depend on the presence of structural heart disease and a heart rate less than a critical value, frequently quoted as 55 bpm . The presence of hydrops fetalis or other signs of physiologic disturbance in cardiac function, are very poor prognostic signs . In severe cases, there has been as high as an 85% mortality rate in the neonatal period . According to the jaeggi paper3, mortality in complete atrioventricular block in the fetus was 43% (13 out of 15 total deaths were fetal); in the neonatal stage was 6%; and in children there were none . In fetal hydrops if the fetal heart rate (fhr) was less than 55bpm, the majority died (9 out of 15). According to the kertesz paper1, in various series of fetal congenital complete atrioventricular block,, only 14% survived the neonatal period compared to 85% survival of the autoimmune isolated congenital complete atrioventricular block . If the congenital heart block is first diagnosed in the newborn period, presumably the higher risk fetuses have not survived, and therefore the prognosis is somewhat better . Once again, the presence or absence of underlying structural heart disease often determines the outcome . The survival rate in newborns with congenital heart block and no structural heart disease is about 85% . If the congenital heart block first presents beyond the newborn period, the outlook for survival is improved . These patients are unlikely to have severe structural heart disease, and the survival rate is much higher than 85% . Such children, however, still almost always require pacemaker implantation as well as treatment for any underlying structural heart disease . Finally, some patients are first diagnosed with their presumably congenital conduction system disease in later childhood or adulthood . Such patients are unlikely to have structural heart disease and they tend to have a good prognosis after pacemaker implantation . However, it must be remembered that they might present with severe life threatening events as their first manifestation of bradycardia, and they seem to have a late risk of developing left ventricular dilation and mitral insufficiency, presumably from longstanding bradycardia or immunological damage to the heart . Several studies have attempted to elucidate the risk factors for the requirement of pacemaker implantation in patients with congenital heart block.1 it is fairly well accepted that a mean resting heart rate below a determined number for the age group could be an indication to place a pacemaker . This is frequently quoted as a 55 bpm in the newborn period and gradually decreases with advancing age . Here we give some examples of electrocardiograms displaying varying degrees of heart block (figures 14). It is also well accepted that any symptomatic bradycardia requires pacemaker implantation, and it should be recognized that this may be either a sudden presentation or simply limited exercise capability . In addition, the presence of significant structural congenital heart disease is felt to be an indication to pace a patient with congenital heart block . Some studies have suggested that a prolonged qtc interval or a wide qrs escape rhythm with complex ventricular ectopy may warrant the use of pacemaker therapy . Electrocardiogram showing first degree atrioventricular block (pr= 160 msec, heartrate= 170 bpm) in a newborn . Electrocardiogram showing second degree atrioventricular block (mobitz type ii) with progressive pr prolongation leading to dropped beats . Electrocardiogram showing third degree heart block with atrioventricular dissociation and slow ventricular rate (atrial rate is 150, ventricular rate is 85 bpm). Electrocardiogram showing third degree heart block (atrioventricular dissociation with atrial rate of 170 bpm) and ventricular pacemaker capturing at 125 bpm . It is sometimes difficult to determine if the child is having symptomatic bradycardia, because children will limit their exertion based on their symptomatology . Echocardiograms may be helpful also to determine progressive loss of systolic function of the ventricle with increasing heart size and the development of mitral regurgitation . The congenital heart block associated with neonatal lupus is considered a form of passively acquired autoimmune disease in which maternal autoantibodies to the intracellular ribonucleoproteins ro (ss - a) and la (ss - b), cross the placenta and injure the previously normal fetal heart . Other manifestations of neonatal lupus may include the presence of skin rashes, liver abnormalities determined biochemically and abnormalities in the cellular elements of the blood including various cytopenias.2 while the non - cardiac manifestations of neonatal lupus are generally transient and resolve at approximately the time that the maternal antibodies are cleared from the infant's circulation at several months of age, the conduction system disease is essentially irreversible . Neonatal lupus is usually diagnosed in the presence of a slow heart rate discovered in a fetus or newborn in the absence of associated structural cardiac abnormalities . Maternal serum testing subsequently reveals antibodies to ro and/or la, usually evaluated by elisa testing . While the mother may have systemic lupus or other autoimmune diseases such as sjogren's syndrome, approximately half of the women at the time of diagnosis are asymptomatic . In utero, the peak onset of the diagnosis of bradycardia is between 18 and 24 weeks of gestation, corresponding to the window of opportunity about six weeks after effective placental transport of maternal igg antibodies begin . While the precise mechanism is unknown it is presumed that anti - ro / la antibodies directly or indirectly cause the cardiac damage . The degree of heart block may vary from first degree to third degree block, but most cases diagnosed in utero present with a least second degree or more advanced block . There is a high mortality rate, particularly in fetuses diagnosed in utero with hydrops, and it is approximately 20% . Of all cases that have been recognized with congenital heart block, current data show that approximately two - thirds of these patients will have a pacemaker placed before reaching adulthood (see table 1). Autoimmune congenital heart block statistics2 in those cases of autoimmune conduction system disease due to neonatal lupus, the bradycardia alone is not always the full extent of disease . Recently, there has been the recognition of a relatively high incidence of the development of late cardiomyopathy leading to heart failure, death or transplantation despite successful pacemaker implantation (table 1).34 as referenced in the moak paper4, late cardiomyopathy is associated with immune - related congenital heart block in 5 - 11% of cases . Clinical deterioration of cardiac function was seen up to 9.3 years . In our experience, other organ systems may be involved in the newborn as well, including the characteristic neonatal rash which appears generally as annular lesions, mostly on the face, particularly around the eyes and is photosensitive (figure 5). In addition, on serum testing, some of the newborns with maternal autoantibodies will have various low levels of red blood cell counts, white blood cell counts, and platelets . Top shows 2d - directed m - mode echocardiogram of a newborn with a normal shortening fraction as the ventricle contracts in systole . The interventricular septum and the left ventricular posterior wall thicken toward each other during systole . Bottom shows 2d - directed m - mode echocardiogram of a newborn showing a very poorly contractile, dilated ventricle . The occurrence rate of neonatal lupus has been estimated at approximately 2 to 3% in all pregnancies born to women with anti - ro or anti - la antibodies . The recurrence rate in a mother with antibodies who has a previous child who was affected, is approximately 18%.5 the mechanism of causation of neonatal lupus is not completely understood but evidence points to the fetus beginning life with a normal cardiac structure and conduction system . At approximately 12 weeks of gestation, maternal igg antibodies against ro and la intracellular ribonuclear proteins are actively transported across the placenta and are thought to bind specific cells of the fetal conduction system . There is also an element of maturation of the fetal immune system involved in the development of fetal immune disease . The majority of cases of congenital heart block, diagnosed in utero are detected by either auscultation or routine obstetrical ultrasound in low risk pregnancies . The diagnosis is confirmed by the performance of maternal fetal monitoring (mfm) and a fetal echocardiogram with doppler techniques (figures 610). In the past the purpose of the fetal echocardiogram is to determine the level of block and also to rule out major associated structural lesions of the heart, such as left atrial isomerism with or without atrioventricular septal defects, and ventricular inversion, which are structural diseases associated with the presence of heart block without antibodies . The fetal echocardiogram is also able to detect any associated myocarditis by looking for the presence of decreased contractility on fetal echocardiogram as well as any secondary changes of cardiac enlargement, tricuspid regurgitation, pericardial effusion, or the development of hydrops fetalis (figure 11). Lower tracing is uterine contractions . Note slow fetal heart rate (fhr) of 80 - 115 bpm . Bottom shows fetal lvot doppler with measurement of mechanical pr interval, from onset of mitral a wave (nadir of flow between the e wave and the a wave, when e and a are not distinctly separated) to the onset of aortic flow . X axis= time in seconds; y axis= velocity in meters / second . Fetal doppler pr interval shows 1st degree heart block with the addition of profound sinus bradycardia (fetal heart rate of 60 bpm). Long pause between the onset of the atrial contraction and onset of ejection time (pr interval). Fetal doppler pr interval shows wenckebach mobitz type i, a type of 2nd degree heart block . The pr intervals become progressively longer (top right and bottom left), with a non - conducted pr interval (bottom right) top shows fetal doppler pr interval with 3rd degree heart block . Spectral doppler labeled a symbolizes a rapid atrial rate moving about 3 times as fast as ventricular rate seen below the baseline . Bottom shows m - mode of ventricle and atrium in 3rd degree heart block with slow ventricular rate versus rapid atrial rate . . Transverse section of fetal thorax displaying 4 chamber view of heart surrounded by pleural and pericardial effusions . With increasing prenatal care and use of ultrasound technology in pregnancy, increasing numbers of cases of autoimmune congenital block are being diagnosed between 18 and 24 weeks of gestation . Unfortunately, although these babies are at high risk for morbidity and mortality, guidelines are not well established nor based on definite scientific evidence . Based on the assumption that treatment for identified heart block in utero may be effective if it can reduce a generalized inflammatory insult and lower the titer of maternal autoantibodies, several prenatal therapeutic protocols have been utilized . These include the use of adrenocorticosteroids, which are not metabolized by the placenta, principally dexamethasone . Some researchers have also attempted plasmapheresis and the use of maternal alpha adrenergic agents.2 our therapeutic approach to a fetal diagnosis of congenital heart block is as follows.2 if the heart block is already third degree and has been present for more than three weeks, we feel that an attempt at reversing this complete heart block is futile, and therefore we provide serial echocardiographic and obstetrical follow - up but no therapy is initiated . If, however, the third degree heart block has been recently diagnosed, we offer the patient a therapeutic course of dexamethasone 4 mg . If there has been no change in fetal status, we taper the course and discontinue it . On the other hand, if the fetus conduction system disease has improved to second degree block or better, then we continue dexamethasone until delivery and subsequently taper in the mother . If the fetus presents with alternating second and third degree block, we again offer dexamethasone at 4 mg orally daily for a six - week period of time . If the conduction system disease progresses to third degree block then we taper the drug and stop it . But if there has been improvement to second degree or better, we continue the steroids until delivery and taper thereafter . If the fetus is discovered to have only second degree or a simply prolonged mechanical pr interval (first degree block),6 then we offer the mother dexamethasone 4 mg . Orally daily until delivery and taper her dose after that . On the other hand, if this early block progresses to permanent third degree block, we will taper the steroid if third degree block has been present for six weeks or longer . Occasionally, the fetal congenital heart block is associated with early signs of myocarditis and fetal hydrops . In such a case, we again offer dexamethasone at 4 mg orally daily until improvement of the hydrops fetalis per se, and then taper . Some studies have suggested7 that in severely hydropic fetuses there may be some benefit to daily dexamethasone at 4 mg . Other varied therapies in such cases of hydrops have included plasmapheresis, maternal terbutaline, digoxin, diuretics or direct fetal pacing . There has been no long - term survival from these desperate measures, and therefore if the lungs are mature at this point, we would advise early delivery . These include the glucocorticoid associated risks of increased infection, loss of bone density, diabetes, hypertension and cataracts . The fetal risks of maternal steroids include oligohydramnios, intrauterine growth retardation and adrenal suppression . There is also some suggestion of a risk to the developing fetal brain when exposed to steroids . Some questions have arisen as to the appropriate use of prophylactic therapy in the pregnancy with a high - risk mother, such as those women with very high titers of the antibodies or a previous child with neonatal lupus . We feel that there is no support for the initiation of immune modulating treatment as a pre - emptive strike prior to the development of fetal conduction system disease . It is clearly advantageous to provide close fetal follow - up for monitoring the patient at risk for congenital heart block in the presence of maternal autoantibodies . We recommend that all women with anti - ro antibodies be evaluated by serial fetal echocardiograms . Particularly high - risk groups appear to be those women with very high titers of anti - ro and anti - la antibodies, as well as those with previously affected pregnancies . We have recently developed a new technique in fetal echocardiography that allows us the possibility to detect the first possible changes of fetal conduction system disease, that is, the presence of first degree heart block in the fetus . In this case, the overall fetal heart rate will still be normal, but our new non - invasive doppler technique can measure the mechanical pr interval in the absence of an electrocardiogram from the left ventricular outflow tracing . This will allow the earlier diagnosis and the possibility of very early treatment, which may be able to reverse the disease.68 for this reason, we strongly suggest weekly fetal echocardiograms with doppler for pregnancies at risk . Supportive treatment for low output or congestive heart failure can clearly be offered as well as pacemakers for babies with significant bradycardia, such as those with a heart rate less than 55 bpm . Although we recognize that the newborn serum contains maternal antibody titers, we have no real data on immune modification of the newborn after birth . Similarly, we cannot comment on the fact that anti - ro and anti - la antibodies have been detected in maternal breast milk . We do know that neonates at risk for developing lupus rashes should be protected from sun exposure, but otherwise treatment is fairly conservative with the use of topical corticosteroids . The liver enzyme abnormalities and blood count irregularities are usually self - limited and require no specific treatment . The risk of a baby born with neonatal lupus syndromes developing active lupus in the future, is small and probably related to the genetic inheritance of the risk of developing rheumatic diseases rather than the maternal antibodies themselves . Women with serum titers of anti - ro antibody carry a 3% risk of having a child with neonatal lupus syndrome . If she has a prior experience with affected fetuses, her risk rises to about 18%.5 therefore, we believe that all women at risk with antibodies present, should be closely followed during the pregnancy with serial echocardiograms, specifically looking for the earliest signs of conduction system disease such as pr interval prolongation by doppler . Although prophylactic therapy is not indicated at the present time, if manifestations of congenital heart block develop, we have established empiric treatment guidelines . Neonatal lupus congenital heart block has a fairly high morbidity and mortality but we believe that the outcome can be improved with early diagnosis and aggressive therapy . Those patients whose congenital heart block is associated with structural heart disease have a higher morbidity and mortality, which is determined more by the underlying structural congenital heart disease than it is by the need for a pacemaker per se.
Esophageal squamous cell carcinoma (escc) is the sixth and fourth most common cancer in the world and in the developing countries, respectively, and also the second most frequent cause of cancer mortality in iran (1, 2). According to the latest medical reports, the highest rate of escc is in asia, in the so - called esophageal cancer belt which is extended from iran to china (3). Despite the advances in the diagnosis and treatment of escc, the rate of escc mortality has not yet improved (4, 5), reflecting the late detection of the disease and poor understanding of the cellular and molecular mechanisms for initiation and development of escc (6, 7). Tumor progression and development process is mediated by deregulation of different signaling pathways as well as mutual interactions between cancerous and normal cells (8). Different studies have introduced the role of specific molecules such as cd44 family in tumor progression . Cd44 family is consisted of cell adhesion glycoproteins on the cell surface (9, 10). Cd44 is a single chain glycoprotein consisting of 4 functional domains including a preserved n - terminal extracellular domain, a non - preserved membrane proximal region, a preserved trans - membrane and a cytoplasmic tail domain . The distal extracellular domain is primarily responsible for the binding of hyaluronic acid (ha), while the proximal extracellular domain is the variable region, which can be different in various cd44 isoforms due to alternative splicing of cd44 mrna (11). The cytoplasmic tail of cd44 molecules exhibits a protein motif, which interacts with cytoskeletal proteins and other intracellular signaling molecules (12). The human cd44 gene is located on the short arm of chromosome 11 at a position described as 11p13 (13), consisting of 20 exons . Although exons 1 to 5 and 16 to 20 are constant and splice together to make cd44s, the 10 variable exons (also called v1-v10) will be spliced and enclosed in nursing insertion site between exons number five and sixteen . Previous studies have shown that in some cancers cd44 isoforms, cd44s and cd44v3 could play a major role in cancer invasion and metastasis (15 - 18). The expression of cd44v3 is related to advanced pathological stage and poor prognosis in colorectal cancer and plays an essential role in its invasion and metastasis (19). In this study, we retrospectively evaluated the level of cd44 mrna expression (its standard form and v3 variant) and its correlation with different clinicopathological features of patients with escc . Fresh tumoral and distant tumor - free esophageal tissues were obtained from fifty patients with escc through surgery at the imam reza and the omid hospitals of mashhad university of medical sciences, iran . None of patients received any therapeutic interference such as chemo - therapy or radiation, prior to sampling . After dissection, the samples were directly treated in rnalater solution (qiagen, hilden, germany) and transferred to 20 c till rna extraction . The ethics committee of mashhad university of medical sciences approved the study and enrolled patients formally declared their consent to be recruited in the study . Histopathological characteristics of the neoplasmic samples, such as size, location, and grade of differentiation were recorded . All tumoral tissues were also confirmed histologically to ensure that they contain at least 70% tumor cells (20). Rna was extracted from the normal and tumoral samples, using the rneasy mini kit (qiagene, hilden, germany). Synthesis of cdna was performed with oligo dt using first - strand synthesis kit (fermentas, lithuania) according to the manufacture s procedure . Expressional analysis of cd44s and cd44v3 was performed in triplicate reactions through a comparative threshold cycle / sybr in experienced methodology (genet bio, korea) in a real - time thermal cycler (stratagenemx3000p, la jolla, ca) using the primer sequences described in table 1 . Comparative real - time pcr was carried out using sybr green pcr master mix containing 6-carboxyl - x - rhodamine (rox) as a reference dye . The sub - sequent thermal cycling program was applied: 10 min at 95 c as initial denaturation step, followed by 40 cycles of 15 sec at 95 c, 10 sec at 60 c and 1 min at 72c . Data was normalized for glyceraldehyd 3-phosphat dehyrogenase (gapdh) expression as an internal control by means of comparative threshold cycle method . Pcr reactions were accomplished in a 20 l total volume with 400 ng of cdna, 10 l sybr green pcr master mix (genet bio, korea), (nuclease - free water, and 0.6 l forward and reverse primers (10 pmol). Over two - fold increase in mrna expression was considered as overexpression, whereas minus two - fold decrease was considered as underexpression . Primer sequences used for comparative real - time pcr the statistical analysis was performed using spss 16.0 statistical package (spss, il, us). The associations between cd44s / cd44v3 mrna expression levels and different clinicopathological aspects were analyzed by 2 squared test . All p values were two - tailed and p- values <0.05 were considered statistically significantly . Fresh tumoral and distant tumor - free esophageal tissues were obtained from fifty patients with escc through surgery at the imam reza and the omid hospitals of mashhad university of medical sciences, iran . None of patients received any therapeutic interference such as chemo - therapy or radiation, prior to sampling . After dissection, the samples were directly treated in rnalater solution (qiagen, hilden, germany) and transferred to 20 c till rna extraction . The ethics committee of mashhad university of medical sciences approved the study and enrolled patients formally declared their consent to be recruited in the study . Histopathological characteristics of the neoplasmic samples, such as size, location, and grade of differentiation were recorded . All tumoral tissues were also confirmed histologically to ensure that they contain at least 70% tumor cells (20). Rna was extracted from the normal and tumoral samples, using the rneasy mini kit (qiagene, hilden, germany). Synthesis of cdna was performed with oligo dt using first - strand synthesis kit (fermentas, lithuania) according to the manufacture s procedure . Expressional analysis of cd44s and cd44v3 was performed in triplicate reactions through a comparative threshold cycle / sybr in experienced methodology (genet bio, korea) in a real - time thermal cycler (stratagenemx3000p, la jolla, ca) using the primer sequences described in table 1 . Comparative real - time pcr was carried out using sybr green pcr master mix containing 6-carboxyl - x - rhodamine (rox) as a reference dye . The sub - sequent thermal cycling program was applied: 10 min at 95 c as initial denaturation step, followed by 40 cycles of 15 sec at 95 c, 10 sec at 60 c and 1 min at 72c . Data was normalized for glyceraldehyd 3-phosphat dehyrogenase (gapdh) expression as an internal control by means of comparative threshold cycle method . Pcr reactions were accomplished in a 20 l total volume with 400 ng of cdna, 10 l sybr green pcr master mix (genet bio, korea), (nuclease - free water, and 0.6 l forward and reverse primers (10 pmol). Over two - fold increase in mrna expression was considered as overexpression, whereas minus two - fold decrease was considered as underexpression . The statistical analysis was performed using spss 16.0 statistical package (spss, il, us). The associations between cd44s / cd44v3 mrna expression levels and different clinicopathological aspects were analyzed by 2 squared test . All p values were two - tailed and p- values <0.05 were considered statistically significantly . Fifty patients including 24 males (48%) and 26 females (52%) enrolled in this study . The surgical samples were obtained before any other treatment ensuring that the histopathological characteristics of the samples were not affected with the therapeutic interference . The patients mean age and standard deviation at the time of diagnosis was 61.7312.14 years (ages ranged from 30 to 87 years). Samples were dissected from middle (25 of 50), lower (22 of 50) or upper (3 of 50) regions of the esophagus . Most tumor samples (48 of 50) were in stages ii or iii of tumor growth, and only two samples were in stage i. based on the histopathological analyses, 8 tumor samples (16%) were classified as poorly differentiated, whereas 10 (20%) and 32 (64%) specimen were well and moderately differentiated, respectively . Furthermore, 21 of the tumors (42%) had metastasized to the lymph nodes . Correlations between cd44 isoforms s and v3 genes expression and clinicopathological characteristics of the esophageal squamous cell carcinoma patients we analyzed cd44s and cd44v3 mrna expressions in fifty tumor samples compared to their paired non - neoplastic esophageal epithelium by quantitative real time - pcr . The y - axis displays fold change of gene expression, and the x - axis demonstrates the number of patients . A two - fold increase in gene expression in tumor samples was considered to be overexpressed state, whereas a minus two - fold decrease was considered as underexpression . The average was thought as neither change nor normal expression significant overexpression of cd44s and cd44v3 mrna was observed in 13 (26.0%, p=0.03) and 11 (22.0%, p=0.007) specimens, respectively . The minimum and maximum levels of mrna expression fold change for cd44s were -3.96 and 13.80 fold, respectively (meansd, 1.222.59), while these levels for cd44v3 were -5.53 and 11.30 fold (0.852.89). Eight samples (16.0%) showed overexpression of both genes, whereas 34 samples (68.0%) showed normal or under expression of both cd44v3 and cd44s genes (table 3). Association between cd44s and cd44v3 gene expression there is a significant correlation between cd44s and cd44v3 mrna expression among escc specimens (p=0.002). By analyzing concomitant gene expression, we found that the samples with high level of cd44v3 gene expression, also expressed high level of cd44s (figure 2). Regression plot representing correlation between cd44s / cd44v3 genes expression (p=0.002) to estimate the impact of cd44s and cd44v3 mrna expression on clinicopathological features, we analyzed the correlation between cd44s and cd44v3 expression and various clinicopathological variables (table 2). A significant correlation was detected between the expression of both genes and the depth of tumor invasion (p=0.001). Furthermore, expression of both genes was significantly correlated to the stage of tumor progression (p=0.03). Another valuable significant correlation was revealed between cd44s and cd44v3 genes expression and the grade of tumor differentiation (p=0.033). In fact, 2 of 13 (15.38%) tumor samples, which overexpressed cd44s and 3 of 11 (27.27%) tumor samples, which overexpressed cd44v3 were well differentiated (wd), indicating the early expression of these genes in the process of dedifferentiation . In addition, expression of both genes was significantly associated with the lymph node metastasis (p=0.04). Five of 13 cd44s overexpressed tumors (38.46%) and 6 of 11 cd44v3 overexpressed tumors (54.54%) did not show any metastasis to the lymph nodes, while 2 of 13 cd44s overexpressed tumors (15.38%) and 1 of 11 cd44v3 overexpressed tumors (9.09%) had lymph node metastasis . Overexpression of both genes was significantly higher in males (p=0.03) in comparison to females (cd44s: meansd: 1.843.08 and 0.631.91, respectively and cd44v3: 1.152.76 and 0.553.04, respectively). Cd44v3 mrna expression was inversely correlated to the depth of tumor invasion (p=0.015). Five of 11 tumors (45.45%), which overexpressed cd44v3 were t1, and 6 of 11 (54.54%) tumors that overexpressed cd44v3 were t2 . There were no significant associations between cd44s and cd44v3 expressions alone and other clinicopathological variables such as age and tumor size (p>0.05). We analyzed cd44s and cd44v3 mrna expressions in fifty tumor samples compared to their paired non - neoplastic esophageal epithelium by quantitative real time - pcr . The y - axis displays fold change of gene expression, and the x - axis demonstrates the number of patients . A two - fold increase in gene expression in tumor samples was considered to be overexpressed state, whereas a minus two - fold decrease was considered as underexpression . The average was thought as neither change nor normal expression significant overexpression of cd44s and cd44v3 mrna was observed in 13 (26.0%, p=0.03) and 11 (22.0%, p=0.007) specimens, respectively . The minimum and maximum levels of mrna expression fold change for cd44s were -3.96 and 13.80 fold, respectively (meansd, 1.222.59), while these levels for cd44v3 were -5.53 and 11.30 fold (0.852.89). Eight samples (16.0%) showed overexpression of both genes, whereas 34 samples (68.0%) showed normal or under expression of both cd44v3 and cd44s genes (table 3). There is a significant correlation between cd44s and cd44v3 mrna expression among escc specimens (p=0.002). By analyzing concomitant gene expression, we found that the samples with high level of cd44v3 gene expression, also expressed high level of cd44s (figure 2). To estimate the impact of cd44s and cd44v3 mrna expression on clinicopathological features, we analyzed the correlation between cd44s and cd44v3 expression and various clinicopathological variables (table 2). A significant correlation was detected between the expression of both genes and the depth of tumor invasion (p=0.001). Furthermore, expression of both genes was significantly correlated to the stage of tumor progression (p=0.03). Another valuable significant correlation was revealed between cd44s and cd44v3 genes expression and the grade of tumor differentiation (p=0.033). In fact, 2 of 13 (15.38%) tumor samples, which overexpressed cd44s and 3 of 11 (27.27%) tumor samples, which overexpressed cd44v3 were well differentiated (wd), indicating the early expression of these genes in the process of dedifferentiation . In addition, expression of both genes was significantly associated with the lymph node metastasis (p=0.04). Five of 13 cd44s overexpressed tumors (38.46%) and 6 of 11 cd44v3 overexpressed tumors (54.54%) did not show any metastasis to the lymph nodes, while 2 of 13 cd44s overexpressed tumors (15.38%) and 1 of 11 cd44v3 overexpressed tumors (9.09%) had lymph node metastasis . Overexpression of both genes was significantly higher in males (p=0.03) in comparison to females (cd44s: meansd: 1.843.08 and 0.631.91, respectively and cd44v3: 1.152.76 and 0.553.04, respectively). Cd44v3 mrna expression was inversely correlated to the depth of tumor invasion (p=0.015). Five of 11 tumors (45.45%), which overexpressed cd44v3 were t1, and 6 of 11 (54.54%) tumors that overexpressed cd44v3 were t2 . There were no significant associations between cd44s and cd44v3 expressions alone and other clinicopathological variables such as age and tumor size (p>0.05). Escc is an extremely invasive tumor of the gastrointestinal system, and novel prognostic, diagnostic and therapeutic modalities are immediately required . These requirements can lead to explore key markers involved in the development and progression of the escc . In this study, we analyzed mrna expression of the stem cell markers cd44s and cd44v3 in tumoral and adjacent non - tumoral tissues of fifty patients with escc . Previous studies have shown that the specific molecular structure of each isoform can influence the cell behavior uniquely . The isoforms vary according their position of n / o - linked glycosylation modification, which exist in the extracellular domain . Changing in these positions influences the affinity of isoforms with various ligands, leading to different modulations of intracellular signaling pathway (21). Several studies have shown the overexpression of cd44 and its variants in variety of malignancies . It has been shown that the expression of this gene and its isoforms is increased significantly in different malignant tissues including breast cancer (22), leukemic hematopoiesis (23), head and neck squamous cell carcinoma (17), oral cancer (24) and barrett s esophagus (25). Takahashi et al have shown that there is a significant correlation between cd44 and grade of tumor cell differentiation in prostate cancer (26). In this study, we also observed overexpression of cd44s (26%) and cd44v3 (22%) in escc patients . Many studies have shown the correlation between cd44 variants gene expression and depth of tumor cells invasion and metastasis in human cancers (27). Although wang et al have illustrated that the expression of cd44v3 has a direct correlation with tumor invasion in head and neck cancer (17), nonetheless, suzuki et al have described that decreased expression of cd44v3 and v6 is associated with depth of tumor invasion in lung cancer (28). This may be due to specific physiological state of esophagus and micro environment of tumor cells . We showed that the simultaneous increased expression of cd44s and cd44v3 genes was associated with clinical features of escc patients . Further detailed studies on a large patient population are required to elucidate the exact role of cd44s and its variants expression to introduce a specific marker for prognosis of esophageal carcinoma.
E. coli strain bearing hairpin loop extensions in phylogenetically - variable, surface - accessible loops of 16s rrna in helix 44 and 23s rrna in helix 101 were used to purify 70s ribosomes . 3-dye labeled dna oligonucleotides (labeled with cy3b or bhq-2) complementary to the mutant ribosome hairpins can then be used to label the ribosomes . Translation factors (if2, ef - tu, ef - g, ef - ts), s1, and fluorescently labeled cy5-ef - g, were prepared as described previously for our single - molecule experiments . A semi - purified mix of all aminoacyl - trna synthetases (aars) was prepared from e. coli s30 extract . Total or (lys, val, phe, or some combination) aminoacyl - trnas were prepared by incubating total e. coli trna (sigma - aldrich) with all amino acids (minus lys, val, phe or some combination for mixes) together with the aars mix for 30 min at 37c in a buffer consisting of tris - hcl (50 mm, ph 7.5), kcl (50 mm), mgcl2 (10 mm), and -me (3 mm), complemented with atp (2 mm), phosphoenol pyruvate (pep, 10 mm), pyruvate kinase (pk, 50 g / ml), myokinase (mk, 2 g / ml) and inorganic pyrophosphatase (ppiase, 10 g / ml). Aa - trnas were thereafter purified by phenol extraction, ethanol precipitation, and gel filtration (micro bio - spin columns with bio - gel p-6 in tris buffer, bio - rad), and finally stored in small aliquots in 80c . Phe-(cy5)trna and lys-(cy5)trna were labeled with cy5-nhs (ge lifesciences) at acpu at position 47, purified as previously described, and aminoacylated as above . Val-(cy3)trna was labeled with cy3-maleimide (ge lifesciences) at su at position 8, purified and aminoacylated as above . All mrnas had 5-biotin followed by a 5'-utr and shine - dalgarno sequence derived from gene 32 of the t4 phage (sequence described previously), an aug start codon, followed by the sequence of interest (as indicated in the figures). All experiments were conducted in a tris - based polymix buffer consisting of 50 mm tris - acetate (ph 7.5), 100 mm potassium chloride, 5 mm ammonium acetate, 0.5 mm calcium acetate, 5 mm magnesium acetate, 0.5 mm edta, 5 mm putrescine - hcl and 1 mm spermidine . 3'-dye labeled dna oligonucleotides (labeled with cy3b or bhq-2) complementary to the mutant ribosome hairpins were ordered from trilink . Right before each experiment, purified 30s and 50s ribosomal subunits (final concentration = 1 m) were mixed in 1:1 ratio with the 3 dye - labeled oligonucleotides specific for the hairpin extensions in each subunit for 37c for 10 min and then at 30c for 20 min in a tris - based polymix buffer system . 30s pre - initiation complexes (pics) were formed as described by incubating the following at 37 c for 5 minutes: 0.25 m cy3b-30s, pre - incubated with stoichiometric s1, 1 m if2, 1 m fmet - trna, 1 m mrna, and 4 mm gtp to form 30s pics in the polymix buffer . Before use, we pre - incubate a smrt cell v3 from pacific biosciences (menlo park, ca, usa), a zero - mode waveguide (zmw) chip, with a 1 mg / ml neutravidin solution in 50 mm tris - acetate ph 7.5 and 50 mm kcl at room temperature for 5 minutes . The cell is then washed with buffer 6 (50 mm tris - acetate ph 7.5, 100 mm potassium chloride, 5 mm ammonium acetate, 0.5 mm calcium acetate, 5 mm magnesium acetate, and 0.5 mm edta). After washing, 40 l of buffer 6 is left in the cell to keep the cell surface wet . We then dilute the 30s pics with our tris - based polymix buffer containing 1 m if2 and 4 mm gtp down to 10 nm pic concentration . The diluted pics are then loaded into the smrt cell at room temperature for 3 minutes to immobilize the 30s pics into the zmw wells . We wash away excessive unbound material with our tris - based polymix buffer containing 1 m if2, 4 mm gtp, 1 mm trolox, and a pca / pcd oxygen scavenging system (2.5 mm 3,4-dihydroxybenzoic acid and 250 nm protocatechuate deoxygenase). After washing, 20 l of the fresh washing mix were added to the cell to keep the surface wet and to prevent exposure of the immobilized dye labeled biomolecules to oxygen . We formed ternary complexes (tcs) between total charged e. coli trnas and ef - tu(gtp) as described . Total or (aa) aminoacyl - trnaef - tugtp ternary complexes were pre - formed by incubating (2 min at 37c) the aa - trnas with five - fold excess of ef - tu, gtp (1 mm), pep (3 mm) and ef - ts (40 m) in polymix . The ternary complexes (1 ~ 6 m) were added to bhq-50s (200 nm), ef - g (80 ~ 480 nm), if2 (1 m), gtp (4 mm), 2.5 mm trolox, and the oxygen scavenging system (pca / pcd) to form a delivery mix in polymix buffer . Many of the experiments are done at 1 m ternary complexes and 80 nm ef - g (chosen to have well - defined, detectable fret transition signals), unless indicated otherwise . Before starting an experiment, the smrt cell is loaded into a modified pacbio rs sequencer . At the start of the elongation experiment, the instrument illuminates the smrt cell with a green laser and then delivers 20 l of a delivery mixture onto the cell surface at t ~ 10 sec . Translation experiments using labeled trnas are performed in the same way as ribosome cy3b / bhq conformational fret experiments with the following differences . Total trna mixture was charged with all amino acids except the trna amino acid we wish to observe . The resulting mix of all charged trnas except trna of interest that remains uncharged was used to form ternary complexes . For example, we will form a ternary complex with phe-(cy5)trna and (phe) aa - trna . The delivery mix contains: 200 nm bhq-50s, 1 m if2, 80~320 nm ef - g, 1~3 m total trna aa ternary complexes, 200 nm aa-(cy3/cy5)trna ternary complexes, 4 mm gtp, 1 mm trolox, and the pca / pcd oxygen scavenging system in the tris - based polymix buffer . All experiments are performed at 200 nm labeled - trna ternary complexes . During the experiment, the experiments involving trna transit of cy3-trna (200 nm) and cy5-trna (200 nm) are done the same way, except the ribosomes were not labeled and a vallys aa - trna (3 m) mixture is used with 80 ~ 320 nm ef - g . Cross - correlation experiments between our ribosome cy3b / bhq conformational fret signal and our ef - g binding signal are conducted exactly as above but with a different delivery mix and laser illumination . The delivery mix for the cross - correlation experiment contains: 200 nm bhq250s, 1 m if2, 80 ~ 240 nm cy5-ef - g, 1 ~ 3 m total trna ternary complexes, 4 mm gtp, 1 mm trolox, and the pca / pcd oxygen scavenging system in tris - based polymix buffer . The data presented in figure 4 are performed at 80 nm cy5-ef - g and 1 m total trna ternary complexes . All single - molecule fluorescence experiments were conducted using a commercial pacbio rs sequencer that we modified to allow the collection of single - molecule fluorescence intensities from individual zmw wells about 130 nm in diameter in 4 different dye channels corresponding to cy3, cy3.5, cy5, and cy5.5 . The rs sequencer has two lasers for dye excitation at 532 nm and 632 nm . In all experiments, data was collected at 10 frames per second (100 ms exposure time) for 8 minutes . The energy flux of the green laser is 0.48 w/m and the red laser is at 0.22 w/m . Data analyses for all experiments are conducted with matlab (mathworks) scripts written in - house . Briefly, traces from the zmw wells are initially selected based on fluorescence intensity, fluorescence lifetime, and the changes in intensity . Filtered traces exhibiting intersubunit fret or single - molecule binding signals are then selected for further data analysis . The fret states are assigned as previously described based on a hidden markov model based approach and visually corrected . All lifetimes were fitted to a single - exponential distribution using maximum - likelihood parameter estimation in matlab . E. coli strain bearing hairpin loop extensions in phylogenetically - variable, surface - accessible loops of 16s rrna in helix 44 and 23s rrna in helix 101 were used to purify 70s ribosomes . 3-dye labeled dna oligonucleotides (labeled with cy3b or bhq-2) complementary to the mutant ribosome hairpins can then be used to label the ribosomes . Translation factors (if2, ef - tu, ef - g, ef - ts), s1, and fluorescently labeled cy5-ef - g, were prepared as described previously for our single - molecule experiments . A semi - purified mix of all aminoacyl - trna synthetases (aars) was prepared from e. coli s30 extract . Total or (lys, val, phe, or some combination) aminoacyl - trnas were prepared by incubating total e. coli trna (sigma - aldrich) with all amino acids (minus lys, val, phe or some combination for mixes) together with the aars mix for 30 min at 37c in a buffer consisting of tris - hcl (50 mm, ph 7.5), kcl (50 mm), mgcl2 (10 mm), and -me (3 mm), complemented with atp (2 mm), phosphoenol pyruvate (pep, 10 mm), pyruvate kinase (pk, 50 g / ml), myokinase (mk, 2 g / ml) and inorganic pyrophosphatase (ppiase, 10 g / ml). Aa - trnas were thereafter purified by phenol extraction, ethanol precipitation, and gel filtration (micro bio - spin columns with bio - gel p-6 in tris buffer, bio - rad), and finally stored in small aliquots in 80c . Phe-(cy5)trna and lys-(cy5)trna were labeled with cy5-nhs (ge lifesciences) at acpu at position 47, purified as previously described, and aminoacylated as above . Val-(cy3)trna was labeled with cy3-maleimide (ge lifesciences) at su at position 8, purified and aminoacylated as above . All mrnas had 5-biotin followed by a 5'-utr and shine - dalgarno sequence derived from gene 32 of the t4 phage (sequence described previously), an aug start codon, followed by the sequence of interest (as indicated in the figures). All experiments were conducted in a tris - based polymix buffer consisting of 50 mm tris - acetate (ph 7.5), 100 mm potassium chloride, 5 mm ammonium acetate, 0.5 mm calcium acetate, 5 mm magnesium acetate, 0.5 mm edta, 5 mm putrescine - hcl and 1 mm spermidine . 3'-dye labeled dna oligonucleotides (labeled with cy3b or bhq-2) complementary to the mutant ribosome hairpins were ordered from trilink . Right before each experiment, purified 30s and 50s ribosomal subunits (final concentration = 1 m) were mixed in 1:1 ratio with the 3 dye - labeled oligonucleotides specific for the hairpin extensions in each subunit for 37c for 10 min and then at 30c for 20 min in a tris - based polymix buffer system . 30s pre - initiation complexes (pics) were formed as described by incubating the following at 37 c for 5 minutes: 0.25 m cy3b-30s, pre - incubated with stoichiometric s1, 1 m if2, 1 m fmet - trna, 1 m mrna, and 4 mm gtp to form 30s pics in the polymix buffer . Before use, we pre - incubate a smrt cell v3 from pacific biosciences (menlo park, ca, usa), a zero - mode waveguide (zmw) chip, with a 1 mg / ml neutravidin solution in 50 mm tris - acetate ph 7.5 and 50 mm kcl at room temperature for 5 minutes . The cell is then washed with buffer 6 (50 mm tris - acetate ph 7.5, 100 mm potassium chloride, 5 mm ammonium acetate, 0.5 mm calcium acetate, 5 mm magnesium acetate, and 0.5 mm edta). After washing, 40 l of buffer 6 is left in the cell to keep the cell surface wet . We then dilute the 30s pics with our tris - based polymix buffer containing 1 m if2 and 4 mm gtp down to 10 nm pic concentration . The diluted pics are then loaded into the smrt cell at room temperature for 3 minutes to immobilize the 30s pics into the zmw wells . We wash away excessive unbound material with our tris - based polymix buffer containing 1 m if2, 4 mm gtp, 1 mm trolox, and a pca / pcd oxygen scavenging system (2.5 mm 3,4-dihydroxybenzoic acid and 250 nm protocatechuate deoxygenase). After washing, 20 l of the fresh washing mix were added to the cell to keep the surface wet and to prevent exposure of the immobilized dye labeled biomolecules to oxygen . We formed ternary complexes (tcs) between total charged e. coli trnas and ef - tu(gtp) as described . Total or (aa) aminoacyl - trnaef - tugtp ternary complexes were pre - formed by incubating (2 min at 37c) the aa - trnas with five - fold excess of ef - tu, gtp (1 mm), pep (3 mm) and ef - ts (40 m) in polymix . The ternary complexes (1 ~ 6 m) were added to bhq-50s (200 nm), ef - g (80 ~ 480 nm), if2 (1 m), gtp (4 mm), 2.5 mm trolox, and the oxygen scavenging system (pca / pcd) to form a delivery mix in polymix buffer . Many of the experiments are done at 1 m ternary complexes and 80 nm ef - g (chosen to have well - defined, detectable fret transition signals), unless indicated otherwise . Before starting an experiment, the smrt cell is loaded into a modified pacbio rs sequencer . At the start of the elongation experiment, the instrument illuminates the smrt cell with a green laser and then delivers 20 l of a delivery mixture onto the cell surface at t ~ 10 sec . Translation experiments using labeled trnas are performed in the same way as ribosome cy3b / bhq conformational fret experiments with the following differences . Total trna mixture was charged with all amino acids except the trna amino acid we wish to observe . The resulting mix of all charged trnas except trna of interest that remains uncharged was used to form ternary complexes . For example, we will form a ternary complex with phe-(cy5)trna and (phe) aa - trna . The delivery mix contains: 200 nm bhq-50s, 1 m if2, 80~320 nm ef - g, 1~3 m total trna aa ternary complexes, 200 nm aa-(cy3/cy5)trna ternary complexes, 4 mm gtp, 1 mm trolox, and the pca / pcd oxygen scavenging system in the tris - based polymix buffer . All experiments are performed at 200 nm labeled - trna ternary complexes . During the experiment, the smrt cell is illuminated with both a green and a red laser . The experiments involving trna transit of cy3-trna (200 nm) and cy5-trna (200 nm) are done the same way, except the ribosomes were not labeled and a vallys aa - trna (3 m) mixture is used with 80 ~ 320 nm ef - g . Cross - correlation experiments between our ribosome cy3b / bhq conformational fret signal and our ef - g binding signal are conducted exactly as above but with a different delivery mix and laser illumination . The delivery mix for the cross - correlation experiment contains: 200 nm bhq250s, 1 m if2, 80 ~ 240 nm cy5-ef - g, 1 ~ 3 m total trna ternary complexes, 4 mm gtp, 1 mm trolox, and the pca / pcd oxygen scavenging system in tris - based polymix buffer . The data presented in figure 4 are performed at 80 nm cy5-ef - g and 1 m total trna ternary complexes . All single - molecule fluorescence experiments were conducted using a commercial pacbio rs sequencer that we modified to allow the collection of single - molecule fluorescence intensities from individual zmw wells about 130 nm in diameter in 4 different dye channels corresponding to cy3, cy3.5, cy5, and cy5.5 . The rs sequencer has two lasers for dye excitation at 532 nm and 632 nm . In all experiments, data was collected at 10 frames per second (100 ms exposure time) for 8 minutes . The energy flux of the green laser is 0.48 w/m and the red laser is at 0.22 w/m . Data analyses for all experiments are conducted with matlab (mathworks) scripts written in - house . Briefly, traces from the zmw wells are initially selected based on fluorescence intensity, fluorescence lifetime, and the changes in intensity . Filtered traces exhibiting intersubunit fret or single - molecule binding signals the fret states are assigned as previously described based on a hidden markov model based approach and visually corrected . All lifetimes were fitted to a single - exponential distribution using maximum - likelihood parameter estimation in matlab . Frameshifting have been proposed to occur at each of the steps: (1) during accommodation of the a - site trna, (2) subsequent to accommodation, but prior to peptide bond formation, (3) during trna hybrid - state intermediates, (4) during translocation, and (5) at the start of the next found of elongation . (b) the ribosome starts each round of elongation in the nonrotated state . In this locked state, the p - site trna is stably bound in the classical state, preserving the reading frame of the mrna . Upon a - site trna selection and peptide bond formation, the 30s subunit rotates 3~10 counterclockwise with respect to the 50s subunit to the rotated state (pre - translocation). State permits trna motions and the trna can fluctuate freely between the classical state and hybrid state, thus facilitating translocation of trna and movement of ribosome by one codon over mrna . Peptide - bond formation also triggers spontaneous fluctuations of the l1 stalk between open and closed conformations as well as spontaneous rotations in ribosome conformations . Ef - g then catalyzes translocation, and the ribosome returns to the nonrotated state (post - translocation). To monitor the rotational state of the ribosome in real time, we employed fret between the small (30s) and large (50s) subunits . The 30s subunit was site - specifically labeled with cy3b on helix 44, and a nonfluorescent quencher, bhq-2, was placed on helix 101 of 50s subunit . Reagent delivery of bhq-50s, trna ternary complex, and ef - g to surface immobilized cy3b-30s pre - initiation complexes in zmws results in if2-guided 70s assembly during initiation and establishment of fret between the two ribosomal subunits: upon subunit joining, the green (cy3b) intensity drops, which is followed by alternating low - high - low intensities each alternating cycle corresponds to the ribosome translating a single codon, with the two intensity states consistent with the two rotational states of the ribosome: the low intensity state (high fret) defining the nonrotated (locked) ribosome conformation and the high intensity state (low fret) the rotated (unlocked) conformation . (c) during each cycle of elongation, the ribosome selects the aminoacyl - trna in a ternary complex with ef - tu - gtp, and positions the trna in the a site . Upon a - site trna accommodation, translocation moves a- and p - site trna - mrna complexes to the e and p site respectively, catalyzed by the ef - g . The compositional dynamics of trna and ef - g on the ribosome, here defined as the relative timing of their arrival and departure during elongation, can be observed by labeling the trna or ef - g with cy3 or cy5 . Cy5/cy3-trna arrival to the surface immobilized ribosomes is marked by a red / green fluorescent pulse . Each productive trna binding event results in a fluorescence pulse that lasts as a ribosome translates 2 codons beginning with arrival of trna in the a - site, continuing through trna translocation to the p - site, arrival of a - site trna to the next codon, a second round of translocation, and ending with spontaneous dissociation of trna from the e site . To track trna and ef - g dynamics on translating ribosomes at near - physiological concentrations of fluorescent factors (0.1 1 m), we used zmws to detect hundreds of individual ribosomes (d) substituting the traditional fret acceptor, cy5, with bhq-2 allowed the use of cy5 to label other translation components for correlation studies . The cy3b intensity reports on the conformational state of the ribosome, while cy5 pulses indicate arrival, occupancy, and departure of ribosomal ligands . (a) histogram of the fraction of ribosomes translating to a particular codon for the dnax 1 frameshift mrna, with a schematic . Many of the ribosomes translate up to 12 codons where the 0 frame stop codon is, though a large percentage of ribosomes translate up to 9 codons, where the 1 frame stop codon is . There are also ribosomes that stall at codon 7, limited by cy3b photobleaching or end of movie (8 minutes) from the long rotated state pause . Interestingly, there are also a significant number of ribosomes that stall at codon 8 (see extended data fig . 10 for discussion). By parsing the number of ribosomes that translate beyond codon 9 and up to codon 9, the frameshifting percentage can be calculated (75%). However, since non - frameshifted ribosomes may terminate early, this would lead to a slight over - estimate of the frameshifting percentage (3~10%). The frameshifting efficiency has been independently confirmed using a cy5-trna score, as described below . (b) a uuc(phe) codon is introduced in the 1 frame downstream of the slippery site . Frameshifting can be scored by an appearance of a cy5 (red) pulse with cy5-trna in addition to the cy3b / bhq conformational fret signal . (c) using the cy5-trna as a score to confirm frameshifting, we get the same dynamics and lifetimes: the nonrotated state lifetimes remain constant at each codon, and the rotated state lifetime increases 10-fold at codon lys7 at the slippery sequence . (d) by using the cy5-trna as a score, we can parse the rotated state lifetimes into ribosomes that frameshifted and ribosomes that did not frameshift . We also get the same results as figure 1: non - frameshifted ribosomes translate through the frameshift sequence seemingly unaffected; frameshifted ribosomes exhibit the characteristic long - rotated state pause at codon lys7 . The mrna consists of the same sequence as the wild - type dnax frameshift sequence, but with the sequence after the uga stop codon in the 0 frame in the hairpin deleted . (b) nonrotated and rotated state lifetimes in the presence of 80 nm ef - g and 1 m trnatot . (c) mrna sequence of the no shine - dalgarno (no sd) mutant . The mrna consists of the same sequence as the wild - type dnax frameshift sequence, but with the original internal shine - dalgarno sequence gggagc mutated to aggcgc, decreasing the rrna - mrna interaction energy from 3.00 kj / mol to 0.06 kj / mol . (d) nonrotated and rotated state lifetimes in the presence of 80 nm ef - g and 1 m trnatot . (e) frameshifting percentages of the no sd and no hp mutant . Without the shine - dalgarno sequence, frameshifting percentage drops by half . Without the hairpin, frameshifting percentage drops to a quarter of the wild - type sequence . This indicates that both the internal shine - dalgarno sequence and the hairpin are required for efficient frameshifting, confirming that the hairpin and internal sd are stimulatory elements for frameshifting . These stimulatory elements may present a barrier and tension to translocation that is a prerequisite for efficient frameshifting . (a) translation of a short linear mrna, 6(fk), in the presence of 80 nm ef - g and 1 m trnatot, with an example trace . Ribosomes translate <12 codons are due to photobleaching of the cy3b dye, or non - processive ribosomes . The small number of ribosomes that translate beyond codon 12 are likely errors in our statistical analysis or read - through of the stop codon . (d) translation of a phe - lys sequence preceded by an internal shine - dalgarno sequence (same sd sequence used in the dnax frameshift mrna of this study) in the presence of 80 nm ef - g and 1 m trnatot, with an example trace . (f) there is an increase in rotated state lifetime at codon 5 ~ 7 . There is an increase in the rotated state lifetimes 3~4 fold over 3~5 codons downstream of the sd - like sequence, while the non - rotated state lifetime remains unaffected . The internal sd - like sequences may base pair with the 3 end of the 16s rrna and slow down ribosomes in the pre - translocation state, echoing several work done previously by tracking ribosome movement and ribosome profiling . (g) translation of a phe - lys sequence followed by a hairpin (same hairpin used in the dnax frameshift mrna of this study) in the presence of 80 nm ef - g and 1 m trnatot, with an example trace . There is an increase in rotated state lifetime at codon 5, exactly 3 codons before the start of the hairpin, placing the ribosome directly at the first encounter of the hairpin . The relative position also matches where we see the long - rotated state pause during frameshift . This echoes the work done by tinoco et al . Where they showed the ribosome is capable of translating through the secondary structure through two mechanisms: ribosome translocating when encountering an open - state junction, occurring naturally or induced by the ribosome, or mechanically unwinding by the ribosome when encountering a closed - state junction . When the ribosome encounters an open - state junction, translation proceeds at a constant rate; however, when a closed - state junction is encountered, the ribosome actively unwinds the secondary structure, resulting in a slight waiting time for translocation, after which the hairpin is biased by the ribosome into an open - state and translation occurs normally . The shunt to either pausing in the rotated state (which leads to uncoupled translocation) or normal translation during frameshifting is likely due to this mechanism . (a) example trace and schematic of a ribosome translating the dnax frameshift mrna at much higher factor concentrations (6 m trnatot and 480 nm ef - g). (b) frameshifting efficiency does not depend on ef - g and trnatot concentrations . (c) increasing the trnatot and ef - g concentrations two - fold (from 1 m trnatot and 80 nm ef - g to 2 m trnatot and 160 nm ef - g) decreases both the rotated state lifetime and nonrotated state lifetimes . The lifetime of the long rotated state pause at codon lys7 is also decreased by half, indicating that ef - g and/or trna interacts with the ribosome in that state . (d) increasing the trnatot concentration (from 1 m to 3 m) while keeping ef - g concentrations constant decrease the non - rotated state lifetimes 3-fold as expected . The rotated state lifetimes remain the same except for codon lys7; this is expected because the rotated state lifetime depends only on concentration of ef - g . Unexpectedly, the rotated state lifetime at codon lys7 is also slightly decreased, suggesting a linkage between trna and ef - g dynamics at that long rotated - state stall . This echoes our results in figure 2 that trna (trna in this case) samples the uncoupled rotated - state after translocation, and the trna sampling and accommodation may help to re - establish the ribosome s reading frame and reverse - rotate subsequently . Thus, increasing trna concentrations (especially trna in this case) will decrease the long rotated - state lifetime . (e) increasing the ef - g concentration (from 80 nm to 240 nm) while keeping trnatot concentration constant decreases the rotated state lifetime 3-fold . The nonrotated state lifetime, which depends on the trna concentration, remains the same . However, the decrease in the rotated lifetime at codon lys7 is only around 2-fold, rather than 3-fold as expected . This echoes our result in figure 2 as well as part (b) above, suggesting that trna sampling also plays a role at this codon . (f) increasing the ef - g and trnatot concentrations further to 6 m trnatot and 480 nm ef - g further decreases the rotated and nonrotated state lifetimes . However, the rotated state lifetime at codon lys7 remains the same when compared with 2 m trnatot and 160 nm ef - g . The long trna sampling events observed in figure 2 may be contributing to the long rotated state lifetime at codon lys7 . (a) example trace of a ribosome translating the a21ga24 g mutant mrna in the presence of 80 nm ef - g and 1 m trnatot (b) histogram of the fraction of ribosomes translating to a particular codon for the dnax 1 frameshift a21ga24 g mrna . Most of the ribosomes translate up to 12 codons where the 0 frame stop codon is . The buildup of ribosomes stalled at codon 9 present during frameshifting disappears . By parsing the number of ribosomes that translate beyond codon 9 and up to codon 9, the long stall at lys7 is decreased with the slippery site mutant, suggesting that the extra - long pause is indeed a result of frameshifting . The slight increase in lifetime at lys7 is due to the effects of the hairpin and internal shine - dalgarno sequence . (d) a uuc(phe) is introduced in the 1 frame downstream of the slippery site of the a21ga24 g mutant, similar to above . (e) the nonrotated state lifetime and rotated - state lifetime match with our results using codon counting (see above). In the absence of frameshifting, there is still an increase in rotated state lifetime at codon lys7, due to the increased energy barrier to translocation by the hairpin and internal shine - dalgarno sequence, though this increased lifetime is still much less than the lys7 rotated state lifetime during frameshifting . (f) using cy5-trna as a score for frameshifting, frameshifting percentage matches with our previous results . The slippery sequence a21ga24 g mutant decreases frameshifting percentage down to background levels . (a) the 3 nucleotides upstream of the slippery sequence (gca(ala)) is mutated to gua(val) (named the c20u mutant) so that e - site trna dynamics can be observed during frameshifting since trna can be labeled with cy3-maleimide (see figure 2). This allows us to estimate the time to translocation during the long rotated - state pause at codon lys7, since translocation of the cy3-trna from the p - site to the e - site leads to rapid departure of the trna and disappearance of the cy3 signal . The nonrotated state and rotated state lifetimes, as well as frameshifting percentages, are consistent with what we have observed before for the wild - type sequence . (b) trna - trna fret between the cy3-trna in the p site and the incoming cy5-trna at lys7 in the a site at the slippery sequence . The trnas are in a hybrid state upon encountering of hairpin and engagement with the internal shine - dalgarno sequence . After translocation, the cy3-trna departs from the ribosome, resulting in a disappearance of fret . After translocation and uncoupling with ribosome reverse - rotation, the now p - site trna is likely in a hybrid, or distorted (a) example trace of cy5-trna transit during translation of the dnax frameshift mrna, indicating the definition of pulse lifetime and time between pulse . (b) the time between trna pulse and lifetime of each pulse for the first three lys codons are consistent with what is expected, and decrease expectedly with the increase of ef - g concentration and trnatotal(lys) concentration ([cy5-trna]= 200 nm). The time between pulse for the first lys pulse corresponds to the decoding of the first codon lys1 of the mrna after 50s subunit joining to the immobilized 30s, which is short as expected and does not depend on factor concentration . The second lys pulse has a longer time between pulse, corresponding to the ribosome translating four codons from lys1 to lys5 . The third pulse has a slightly shorter time between pulse, corresponding to the ribosome translating from codon lys5 to lys7 . The lifetimes for the first two pulses are short, since the ribosomes decode and translocate the corresponding codons normally . The lifetime for the third pulse at codon lys7 is long, corresponding to the ribosome at the long rotated - state pause during frameshifting . (c) mean number of additional trna sampling pulses to the long rotated - state pause at codon lys7, sampling lifetimes, and sampling arrival times, at various concentrations of ef - g and trnatot ([cy5-trna] = 200 nm) for ribosomes translating the dnax 1 wild - type frameshifting sequence . There is a mean number of ~2.3 sampling trna pulses, which remains constant at the various factor concentrations . There seems to be an interplay (competition) between ef - g and the other trnas on trna sampling . Increasing the concentration of other factors increase the arrival time for trna, probably because they are all competing for the ribosomal a site . Number of molecules analyzed, from left to right, n = 179, n = 212, n = 180, n = 162 . (d) the time between trna pulse and lifetime of each pulse for the first three lys codons are the same for the wild - type aag sequence and the aag(aaa) mutant sequence . (e) by translating the aag(aaa) mutant in the presence of cy5-trna, we see similar dynamics as the dnax wild - type sequence . Cy5-trna samples the a site at codon lys8 after uncoupled translocation at the frameshift site . The fraction of ribosomes exhibiting> 4 trna pulses are the same for the wild - type sequence and the aag(aaa) mutant . The mean number of trna sampling pulses, the mean arrival time, and the mean lifetimes of the sampling pulses to the long rotated - state stall are the same for the aag(aaa) mutant and the dnax wild - type sequence . (a) example traces of cy5-trna (red) sampling to the a - site phe8 codon during the long rotated - state pause correlated with cy3b / bhq conformational fret signal (green) for the aag(uuu) mutant . (b) by translating the aag(uuu) mutant in the presence of cy5-trna (red) and correlating with the cy3b / bhq conformational fret signal (green), we can observe the fraction of ribosomes exhibiting only 1 cy5-trna pulse or> 1 cy5-trna pulse sampling to the long rotated state pause at codon lys7 . There is a significant number of ribosomes exhibiting> 1 cy5-trna pulse even when there is only one phe codon, suggesting that even without frameshifting, many of the ribosomes still pause in an uncoupled rotated state at lys7, where trna samples the exposed uuu codon in the a site . (c) the arrival time of the first trna sampling to the long stalled codon for wild - type mrna (with cy5-trna) and aag(uuu) with cy5-trna are the same . Although frameshifting in principle could occur through an incomplete + 2 translocation with weakened codon - anticodon - ribosome interactions and the final reading - frame determined through the lys8 trna sampling in the 1 frame, our data support + 3 translocation that weakens codon - anticodon - ribosome interactions followed by trna sampling and accommodation that defines the reading frame and shifts 1 through effects of the hairpin and internal - sd interaction . For + 2 translocation, we would expect to see trna sampling to both 1 frame and the 0 frame of a - site codon . For the aag(uuu) mutant, trna will sample the 0 frame u25u26u27, while trna will sample the 1 frame a24u25u26 . Since, cy5-trna arrival times and lifetimes for sampling to the aag(uuu) mutant match cy5-trna arrival times and lifetimes for the wild - type sequence, there is likely no competition between trna and trna suggesting that the auu codon is not initially exposed for trna sampling . Furthermore, for the + 2 model, we would not expect a aag(uuu) mutation to lead to a decrease in frameshifting efficiency . Thus, our results favor a + 3 translocation followed by a 1 shift driven by sampling, accommodation and base - pairing stability . Unfortunately, our single - molecule assay is blind to the actual movement of the ribosome on the mrna, so the details of this mechanism will require further exploration . (d) mean sampling lifetime and mean sampling arrival time for cy5-trna to the phe8 codon for the aag(uuu) mutant . The arrival time and lifetime are the same as cy5-trna sampling to the lys8 codon for the dnax wild - type sequence . (e) example trace for cy5-trna transit through the dnax frameshift mrna aag(uuu) mutant . For the aag(uuu) mutant, we see only three lys pulses, as expected, since the fourth lys codon (lys8) is mutated to a phe codon . Most of the ribosomes (~80%) exhibit only three cy5-trna pulses, indicating that the additional cy5-trna sampling pulses we saw characteristic of frameshifting are indeed sampling to the lys8 codon . The time between pulses are consistent with both the wild - type sequence and aag(aaa) mutant . The lifetime of the third pulse (at lys7) is long, consistent with the long pause at that codon . (f) example trace for cy5-trna transit through the dnax frameshift mrna aag(aac) mutant . For the aag(aac) mutant, we see mostly only three lys pulses (~75%) since the fourth lys codon (lys8) is mutated to a asn codon . This further argues against the + 2 translocation model (see part (c)). For + 2 translocation, we would expect to see long lys - trna sampling to the 1 frame aaa codon, which is not observed significantly . The additional cy5-trna pulses have a shorter lifetime and longer arrival time when compared with the translation of the wild - type mrna, suggesting that these pulses are non - cognate sampling to the aac codon in the 0 frame or sampling unstably to the aaa codon in the 1 frame . Even though our data supports a + 3 translocation followed by a 1 slippage, multiple frameshifting pathways probably occurs . (a) two different protein products are possible after 1 frameshifting, dependent on whether peptide bond formation occurs during sampling in the 1 or 0 frame . For the first scenario, trna sampling to the last three nucleotides of the slippery sequence (yyz) redefines the ribosome in the 1 frame (yyy), after which the trna dissociates to leave an empty a - site codon . After the long rotated state is reverse - rotated by ef - g, trna decodes that codon normally, creating a frameshift product denoted by xxy - yyy . For the second scenario, peptide bond formation occurs after slippage of trna into the 1 frame; peptide - bond formation occurs slowly, since the p- and a - site trnas would likely not be positioned correctly in the rotated ribosomal conformation . Ef - g would then normally and rapidly resolve the newly - created a / p hybrid state and the ribosome reverse - rotates . In this case (b) histogram of the fraction of ribosomes translating to a particular codon for the dnax 1 frameshift aag(uuu) mrna, with a schematic . Since the frameshifting percentage for the aag(uuu) sequence is low, we see that most of the ribosomes translate up to 12 codons where the 0 frame stop codon is . Though, there is a significant number of ribosomes that translate to 11 codons (~25%), compared to ~5% for our previous experiments . There are two possible scenarios for trna sampling to the long rotated - state pause to codon phe8 . In the first case, the trna defines the reading frame and falls off, after which the ribosome resolves itself through the action of ef - g, followed by the normal decoding of phe codon at codon 8 . In this case, we get 12 cycles of low - high - low fret intensity, and hence 12 codons translated by our signal . In the second case, the trna defines the reading frame, followed by slow peptide bond formation . After peptide bond formation, the ribosome returns to the canonical hybrid and rotated state, for which ef - g then catalyzes reverse rotation . In this case, one low - high - low fret cycle is missed, so we count 11 codons translated by our signal . (c) example traces of cy5-trna (red) sampling to the long rotated - state pause at codon lys7 correlated with cy3b / bhq conformational fret signal (green), showing the two possible scenarios for trna sampling . Case 1 (as described in part (a)) leads to correlation of trna arrival and ribosome rotation after the long rotated state pause whereas case 2 leads to overlap of a trna pulse with the reverse - rotation of the long pause . Both scenarios occur when translating the aag(uuu) mutant, with ~58% of ribosomes for case 1 and 42% for case 2 . For the 2 case, the time between the last cy5-trna arrival and the ribosome reverse - rotation is 27.2 s, much longer than the 7.7 s during normal decoding and translocation, suggesting a slow peptidyltransfer reaction . Our results provide a possible explanation for why heterogeneous frameshifting products are observed in many frameshifting systems.
Isolated post - prandial hyperglycemia (pphg), as occurs in impaired glucose tolerance (igt), has been shown to double the risk for cardiovascular (cv) mortality . Pphg also appears to be the rate limiting factor for achieving optimal glycemic control in t2 dm . The magnitude and time of the peak plasma glucose (pg) depends on a variety of factors, including the timing, quantity and composition of the meal . In non - diabetic individuals, pg peaks about 60 minutes after the start of a meal, rarely exceeds 140 mg / dl, and returns to pre - prandial levels within 2 3 hours . Observed that in diabetics with hba1c<7%, 80% had pppg>200 mg/ dl and 17% had fpg>126 mg / dl, whereas in individuals with hba1c>8%, the corresponding figures were 100% (pp) and 99% (fasting). Found that the relative contribution of pppg was higher (70%) in patients with fairly good control of diabetes (hba1c <7.3%) and decreased progressively (30%) with worsening diabetes (hba1c>10.2%). Decreases in ppg accounted for nearly twice the decrease in hba1c compared with decreases in fpg . There are different targets for pppg control: <180 mg/ dl (ada); <140 mg / dl (aace); idf target is 145 mg / dl (plasma) and 160 mg / dl (capillary). Plasma 1,5 anhydro glucitol (1,5 ag) best reflects 2 h ppg of the previous 2 weeks . The harmful effects of pppg are related to ros and mediated by pkc, age, polyol and hexoseamine pathway . Have shown that pppg appears to have a linear relation with cvd, even across the non - diabetic range . In decoda, 2 h ppg was superior to fpg in predicting premature cvd mortality . In a recently published meta - analysis, the pooled relative risk for cvd was 1.18, representing a 1% increase in hba1c in persons with t2 dm [figure 1 and 2]. Controlling pphg has been demonstrated to improve myocardial flow and function.pphg and oxidative stress, inflammation, and endothelial dysfunction: treating post - prandial hyperglycemia can improve oxidative stress, inflammation, endothelial dysfunction, and thrombosis.pphg and cimt: carotid intima media thickness (cimt) was significantly increased in the top quintile of 2 h pppg (148 200 mg / dl).pphg and micro - vascular complications: pphg had a stronger correlation with the incidence of diabetic microangiopathy compared with hba1c levels.pphg and cognitive function: exaggerated ppg excursions are associated with a derangement of both global, executive and attention functioning.pphg and cancer: pphg and factors known to promote post - meal hyperglycemia are implicated in the development of cancer . Have shown that pppg appears to have a linear relation with cvd, even across the non - diabetic range . In decoda, 2 h ppg was superior to fpg in predicting premature cvd mortality . In a recently published meta - analysis, the pooled relative risk for cvd was 1.18, representing a 1% increase in hba1c in persons with t2 dm [figure 1 and 2]. Pphg and oxidative stress, inflammation, and endothelial dysfunction: treating post - prandial hyperglycemia can improve oxidative stress, inflammation, endothelial dysfunction, and thrombosis . Pphg and cimt: carotid intima media thickness (cimt) was significantly increased in the top quintile of 2 h pppg (148 200 mg / dl). Pphg and micro - vascular complications: pphg had a stronger correlation with the incidence of diabetic microangiopathy compared with hba1c levels . Pphg and cognitive function: exaggerated ppg excursions are associated with a derangement of both global, executive and attention functioning . Pphg and cancer: pphg and factors known to promote post - meal hyperglycemia are implicated in the development of cancer . Contribution of pphg to hba1c mechanisms of pphg - induced harmful effects a variety of both non pharmacologic and pharmacologic therapies should be considered to target ppg . Therapies which are available for pphg include agi, glinides, short - acting su (glipizide), and rapidly acting human insulins/ insulin analogues and biphasic (pre - mixed) insulins / insulin analogues, dpp4 inhibitors, and glp -1 derivatives . One of the earlier studies to show that targeting pphg has the potential to improve clinical outcome was done by de veciana et al . Who found that pregnant women with gdm requiring insulin therapy did better when pppg rather than fpg was used to guide management . Reported that insulin aspart reduced pp oxidative stress more effectively than regular insulin in patients with t2 dm . Found a highly significant correlation between pppg, excursions and age in t1 dm subjects . In a small study, once daily glipizide gits, twice - daily immediate - release glipizide, or thrice - daily nateglinide resulted in equivalent control of pppg in type 2 dm . In a seminal study organized by the campanian post - prandial hyperglycemia study group, the reduction in cimt was associated with changes in pphg but not fasting hyperglycemia, and those who had the greatest reduction in pphg had the greatest cimt regression . In this study, repaglinide was more effective in blunting the ppg peak and showed greater cimt regression and greater reduction in il 6 and crp compared with glyburide . The stop niddm trial, in patients with igt, found a 49% rr reduction for any cv event in patients treated with acarbose over a mean follow up of 3.3 years ., there was a significant 35% rr reduction for any cv event and 64% rr reduction for myocardial infarction with acarbose . There may be enhancement of post - prandial glucose control and some diminution of fasting glucose control with shorter acting glp 1 receptor agonist (exenatide bid) compared to longer - acting agonist (exenatide once weekly, liraglutide). 2 h pppg decreased by a mean 76 mg / dl when patients switched from sitagliptin to exenatide (and increased by 73 mg / dl when the reverse switch was made). Post - prandial glucose after supper and breakfast were significantly lower in t2 dm taking vildagliptin (100 mg/ day) than those taking sitagliptin (100 mg / day) who had lower glucose level after dinner . Rizzo et al . Reported that reductions in oxidative stress and markers of inflammation were greater in t2 dm patients taking vildagliptin than those taking sitagliptin . There is currently a lack of direct randomized clinical trial evidence that correcting post - meal hyperglycemia improves clinical outcomes . The heart 2d study, assigned t2 dm patients to prandial (lispro) and basal (nph or glargine) strategy, did not show a beneficial effect of preferentially treating pphg in reducing further cv events in people with diabetes who had an acute mi . A recent post - hoc analysis, however, suggested that older patients may have a lower risk for a subsequent cv event . Pphg makes a significant contribution to overall glycemia reflected in the hba1c level, and blood glucose lowering therapy should preferentially choose an agent, which specifically lowers ppg . Pphg and cv mortality: studies by levitan et al . Have shown that pppg appears to have a linear relation with cvd, even across the non - diabetic range . In decoda, 2 h ppg was superior to fpg in predicting premature cvd mortality . In a recently published meta - analysis, the pooled relative risk for cvd was 1.18, representing a 1% increase in hba1c in persons with t2 dm [figure 1 and 2]. Controlling pphg has been demonstrated to improve myocardial flow and function.pphg and oxidative stress, inflammation, and endothelial dysfunction: treating post - prandial hyperglycemia can improve oxidative stress, inflammation, endothelial dysfunction, and thrombosis.pphg and cimt: carotid intima media thickness (cimt) was significantly increased in the top quintile of 2 h pppg (148 200 mg / dl).pphg and micro - vascular complications: pphg had a stronger correlation with the incidence of diabetic microangiopathy compared with hba1c levels.pphg and cognitive function: exaggerated ppg excursions are associated with a derangement of both global, executive and attention functioning.pphg and cancer: pphg and factors known to promote post - meal hyperglycemia are implicated in the development of cancer . Have shown that pppg appears to have a linear relation with cvd, even across the non - diabetic range . In decoda, 2 h ppg was superior to fpg in predicting premature cvd mortality . In a recently published meta - analysis, the pooled relative risk for cvd was 1.18, representing a 1% increase in hba1c in persons with t2 dm [figure 1 and 2]. Pphg and oxidative stress, inflammation, and endothelial dysfunction: treating post - prandial hyperglycemia can improve oxidative stress, inflammation, endothelial dysfunction, and thrombosis . Pphg and cimt: carotid intima media thickness (cimt) was significantly increased in the top quintile of 2 h pppg (148 200 mg / dl). Pphg and micro - vascular complications: pphg had a stronger correlation with the incidence of diabetic microangiopathy compared with hba1c levels . Pphg and cognitive function: exaggerated ppg excursions are associated with a derangement of both global, executive and attention functioning . Pphg and cancer: pphg and factors known to promote post - meal hyperglycemia are implicated in the development of cancer . A variety of both non pharmacologic and pharmacologic therapies should be considered to target ppg . Therapies which are available for pphg include agi, glinides, short - acting su (glipizide), and rapidly acting human insulins/ insulin analogues and biphasic (pre - mixed) insulins / insulin analogues, dpp4 inhibitors, and glp -1 derivatives . One of the earlier studies to show that targeting pphg has the potential to improve clinical outcome was done by de veciana et al . Who found that pregnant women with gdm requiring insulin therapy did better when pppg rather than fpg was used to guide management . Reported that insulin aspart reduced pp oxidative stress more effectively than regular insulin in patients with t2 dm . Found a highly significant correlation between pppg, excursions and age in t1 dm subjects . In a small study, once daily glipizide gits, twice - daily immediate - release glipizide, or thrice - daily nateglinide resulted in equivalent control of pppg in type 2 dm . In a seminal study organized by the campanian post - prandial hyperglycemia study group, the reduction in cimt was associated with changes in pphg but not fasting hyperglycemia, and those who had the greatest reduction in pphg had the greatest cimt regression . In this study, repaglinide was more effective in blunting the ppg peak and showed greater cimt regression and greater reduction in il 6 and crp compared with glyburide . The stop niddm trial, in patients with igt, found a 49% rr reduction for any cv event in patients treated with acarbose over a mean follow up of 3.3 years ., there was a significant 35% rr reduction for any cv event and 64% rr reduction for myocardial infarction with acarbose . There may be enhancement of post - prandial glucose control and some diminution of fasting glucose control with shorter acting glp 1 receptor agonist (exenatide bid) compared to longer - acting agonist (exenatide once weekly, liraglutide). 2 h pppg decreased by a mean 76 mg / dl when patients switched from sitagliptin to exenatide (and increased by 73 mg / dl when the reverse switch was made). Post - prandial glucose after supper and breakfast were significantly lower in t2 dm taking vildagliptin (100 mg/ day) than those taking sitagliptin (100 mg / day) who had lower glucose level after dinner . Rizzo et al . Reported that reductions in oxidative stress and markers of inflammation were greater in t2 dm patients taking vildagliptin than those taking sitagliptin . There is currently a lack of direct randomized clinical trial evidence that correcting post - meal hyperglycemia improves clinical outcomes . The heart 2d study, assigned t2 dm patients to prandial (lispro) and basal (nph or glargine) strategy, did not show a beneficial effect of preferentially treating pphg in reducing further cv events in people with diabetes who had an acute mi . A recent post - hoc analysis, however, suggested that older patients may have a lower risk for a subsequent cv event . Pphg makes a significant contribution to overall glycemia reflected in the hba1c level, and blood glucose lowering therapy should preferentially choose an agent, which specifically lowers ppg.
The extraordinary physical and functional properties of dna and rna have led to extensive investigation into their suitability for use in many fields including therapeutics, diagnostics, chemistry, nanotechnology, and molecular computation (reviewed in refs (1 and 2)). In pursuit of these endeavors, researchers exploit both natural and contrived properties of nucleic acids, including interstrand and intrastrand hybridization, strand displacement, binding of ligands to aptamers, and catalysis by nucleic acid enzymes . In general, nucleic acid enzymes are composed of single strands of either dna (deoxyribozymes or dnazymes) or rna (ribozymes) that are organized into domains required for enzymatic activity (catalytic core domains) and for substrate recognition (substrate binding domains). Dnazymes and ribozymes are capable of catalyzing a broad range of chemical reactions including cleavage, ligation, phosphorylation, and deglycoslyation of rna or dna (reviewed in ref (3)). Catalytic nucleic acids, sometimes in combination with aptamers, have been studied extensively for their capacity to provide the basis for biosensors (reviewed in refs (15)). Many strategies use nucleic acid sequences that include an intact catalytic core but have reduced enzymatic potential due to weakened association of the enzyme with its substrate (reviewed in ref (4)). In such designs, the presence of the target analyte induces a conformation change that increases substrate binding affinity and catalytic activity . For example, the target may disrupt an inhibitory hairpin structure(6) or it may bind to the enzyme and substrate, thus strengthening their interaction. (7) the disadvantage of this approach lies in the potential for low - level catalytic activity in the absence of the target analyte under low stringency conditions . An alternative and inherently safer strategy involves dividing the catalytic core between multiple oligonucleotides that are capable of combining to form active enzymes . Such oligonucleotides have been discovered by extensive re - engineering or in vitro evolution of ribozymes (reviewed in refs (8 and 9)) or by rational design utilizing specific tertiary structures within dnazymes such as guanine quartets(10) or stemloops. (11) for example, kolpashchikov(11) chose the e6 dnazyme for splitting because it contained a nonconserved stemloop that was thought to be required for structural, but not catalytic, function . In this report we describe a general approach for deriving partial catalytic core sequences from nucleic acid enzymes, which can then be incorporated into partial enzymes (partzymes) useful for assembly into mnazymes . In contrast to previous studies, our strategy does not necessarily require knowledge of, or exploitation of, predicted or observed structural or functional domains . We demonstrate our approach by engineering multiple partzyme pairs incorporating various sequences derived by splitting catalytic domains from two different nucleic acid enzymes, known as the 1023 and 817 dnazymes. (12) while each partzyme is inherently inactive, when they are combined in the presence of an assembly facilitator, they may associate and form a catalytically active, multicomponent nucleic acid enzyme (mnazyme). Mnazymes have numerous applications, including use as biosensors, as exemplified below where the target nucleic acids to be detected served as the assembly facilitators . However, assembly facilitators may also be synthetic and/or have multiple components, as shown in examples where mnazymes allowed the creation of molecular switches and cascades . It is the modular nature of mnazymes that imparts the enormous flexibility and functionality, which in turn increases the versatility of nucleic acid enzymes . Mnazymes are multicomponent nucleic acid enzymes that are assembled, and therefore catalytically active, only in the presence of an assembly facilitator (figure 1). These enzymes are composed of multiple partial enzymes, or partzymes, which self - assemble in the presence of assembly facilitators and form active mnazymes that catalytically modify substrates to produce products . Figure 1 provides an example of the components of an assembled mnazyme capable of recognizing and cleaving a substrate in the presence of an assembly facilitator . The partzymes have multiple domains including sensor arms that bind to the assembly facilitator or target; substrate arms that bind the substrate; and partial catalytic core sequences that, upon assembly, combine to provide a complete catalytic core (figure 1). Mnazymes can be designed to recognize a broad range of input assembly facilitators including, for example, different target nucleic acid sequences . In response to the presence of the assembly facilitator the assembly facilitator may be a target nucleic acid present in a biological or environmental sample . In such cases, the detection of mnazyme activity is indicative of the presence of the target in the sample . This mnazyme was composed of partzymes a and b, each of which contained a substrate arm, a partial catalytic core, and a sensor arm that can bind to an assembly facilitator, such as a target nucleic acid molecule . The assembly facilitator provided the input that directed the assembly of partzymes into an mnazyme with a functional catalytic core capable of cleaving multiple substrates into products thus providing an output . If the substrate is labeled on each side of the cleavage site with a fluorophore (f) and a matched quencher (q), then cleavage can be monitored by an increase in fluorescence . The partial catalytic core modules in the following examples were engineered by splitting the catalytic core of the unimolecular dna enzymes known as the 1023 and the 817 dnazymes. (12) the general strategy we developed to engineer mnazymes from dnazymes is illustrated in figure 2 . Many dnazymes have similar structures: a catalytic core flanked by substrate arms that can be tailored to hybridize to a range of substrates . To engineer a new mnazyme from a dnazyme, positions are identified within the dnazyme catalytic core at which it can be split, so that each partial portion of the catalytic core can be distributed between two oligonucleotides (candidate partzymes a and b). Partzymes are designed such that the sequence from 5 to 3 of candidate partzyme a contains (i) one sensor arm portion capable of binding to an assembly facilitator molecule, (ii) one partial catalytic core portion derived from the dnazyme, and (iii) one substrate binding arm portion; and candidate partzyme b contains (i) one substrate binding arm portion capable of binding adjacent to candidate partzyme a on the same substrate sequence, (ii) one partial catalytic core portion that contains the remaining bases from the catalytic core of the dnazyme that were not incorporated into the candidate partzyme a, and (iii) one sensor arm portion capable of binding to the same assembly facilitator as candidate partzyme a and in a position adjacent to partzyme a (figure 2). Many dnazymes have a catalytic core flanked by substrate binding arms . To engineer mnazymes, sites for splitting the catalytic core of the dnazyme are selected, and then candidate partzymes a and b incorporating sensor arms are designed . Candidate partzyme pairs a and b may be tested by mixing them with a substrate and assembly facilitator and then assessing the level of catalytic activity . A series of paired a and b candidate partzymes can be screened to determine whether they exhibit catalytic activity . Candidate partzyme pairs are assessed by mixing them with suitable substrates and assembly facilitators and then ascertaining the degree of catalytic activity, if any . Once active partzyme pairs have been identified, their partial catalytic cores can be incorporated into a range of new partzymes, which can be tailored for recognition of other assembly facilitators (e.g., new targets) and/or other substrates . The protocol for engineering mnazymes from dnazymes is illustrated in the following example where partzymes, based on the 1023 dnazyme,(12) were engineered and used as components for mnazymes, referred to here as type mz1 . The sequence of the complete catalytic core domain of this dnazyme is shown in table 1 . A control 1023 dnazyme (dz1), which was capable of cleaving a chimeric dna / rna substrate designated sub2i - fb, was synthesized . Substrate sub2i - fb was labeled with a fluorophore (fam) and quencher (black hole quencher) on either side of the cleavage site . The 1023 catalytic core was then split at a number of positions (table 1) and candidate partzyme pairs were synthesized such that candidate partzyme b contained bases from g1 to the split position, and candidate partzyme a contained bases from the split position to a15 . Candidate partzymes were designed to hybridize to both an assembly facilitator dna oligonucleotide, af - ro5, and the substrate, sub2i - fb (table s1, supporting information). Partzyme pairs were incubated in the presence of af - ro5 and sub2i - fb with 50 mm mgcl2 and the change in fluorescence, indicative of cleavage of the substrate, was monitored over time to provide a measurement of kobs (figure s1, supporting information). Partzyme pair core sequences based on the 1023 dnazyme are designated mz1, with candidate partzyme sequences designated ag . N represents a dna base, and x and y denote the positions with respect to the complete catalytic core of the dnazyme that are split upon incorporation into candidate partzymes a and b, respectively . Kobs values were obtained by fitting a hyperbolic function (by use of prism version 4.0, graphpad software inc .) To the fluorescence versus time data (figure s1, supporting information). The results (table 1; figure s1, supporting information) indicated that the most suitable sites for splitting the 1023 catalytic core to generate useful partial core pairs were between c7 and t8 (mz1c) and between t8 and a9 (mz1d). Partzymes based on splitting the core between a9 and c10 (mz1e) showed activity, albeit reduced compared to the mz1c and mz1d splits, and other candidate pairs showed little activity . The kobs values for control 1023 dnazyme and for mz1c and mz1d partzyme designs were comparable . To confirm that the mnazyme cleaves the substrate in a similar fashion to the original dnazyme, figure 3a shows a polyacrylamide gel demonstrating cleavage of the radiolabeled dna / rna chimeric substrate sub2-fb by both a 1023 dnazyme and an mnazyme (mz2c) engineered as described above . Cleavage of radiolabeled and fluorescent substrates by catalytic nucleic acids and use of mnazymes in the detection of target nucleic acids . (a) polyacryamide gel electrophoresis showing uncleaved radiolabeled substrate (lane 1) and cleavage products of this substrate following incubation with a dnazyme (lane 2) and an mnazyme (lane 3). Test reactions contained partzyme a (ro4aa/1) and partzyme b (ro4ba/1) in the presence of af - ro4 or in the absence of an assembly facilitator (no af). Control reactions contained partzyme a only with af - ro4 (control 1); partzyme b only with af - ro4 (control 2); mutated partzyme a with partzyme b and af - ro4 (control 3); or partzymes a and b with a noncomplementary oligonucleotide af - ro5 (control 4). (c) use of mz1d mnazymes to determine the limit of detection of a target assembly facilitator by the isothermal direct detection protocol . Test reactions contained ro3ad/2-p, ro3bd/2-p, and sub2i - fb, with either various concentrations of target af - ro3 (750, 500, 250, 50, 10, or 5 pm) or no assembly facilitator (no af). (d) mnazymes were used to monitor the accumulation of amplicons during pcr amplification of the k - ras gene from human genomic dna (5-fold dilutions from 100 ng to 32 pg). The calibration curve generated from this plot had an r = 0.999 and an efficiency of 94% . To demonstrate the generality of our approach for engineering mnazymes from dnazymes, the process was repeated and additional mnazymes based on variants of the 817 dnazyme(12) were produced; they are designated here as mz2 mnazymes (tables s2 and s3, supporting information). Similar to mz1 mnazymes, the activity of mz2 mnazymes was influenced by the location of the core split (figure s2, supporting information). To further analyze mnazyme activity, partzymes were synthesized to contain partial catalytic core sequences based on the 817 dnazyme variant 1 (mz2a), along with substrate arms complementary to a substrate (from ref (13)), referred to here as sub1i - fb . Incubation of partzymes a and b in the presence of the complementary assembly facilitator af - ro4 resulted in the formation of active mz2a mnazymes that cleaved sub1i - fb, resulting in an increase in fluorescence over time (figure 3b). Control reactions, which lacked either partzyme b (control 1) or partzyme a (control 2) or which lacked the assembly facilitator and had an irrelevant noncomplementary oligonucleotide (control 4), did not show an increase in fluorescence . This confirmed that the increase in fluorescence was due to catalytic activity of the mnazymes and was dependent on the hybridization and assembly of the partzymes with the assembly facilitator and that the partzymes, either alone or as a pair, had no catalytic activity until they were assembled into mnazymes on the assembly facilitator . To further confirm that the mechanism for generation of fluorescence was cleavage of sub1i - fb by the mnazymes, a c to t mutation was introduced into the partial catalytic core within an mz2a partzyme a. this base is the equivalent of the c nucleotide at position 11 within the complete catalytic core domain and has been reported to be crucial for enzymatic activity of the 817 dnazyme. (14) when this mutation was incorporated into partzyme a, the catalytic activity of the mnazyme was abolished (control 3, figure 3b), consistent with a similar mechanism of catalysis between the dnazyme and mnazymes derived from it . Finally, the lack of any activity of the oligonucleotide complexes containing this mutated partzyme confirms that the increase in fluorescence generated by the active mz2a mnazymes is indeed due to cleavage of the substrate and is not due to a beacon-like effect caused by hybridization of the partzyme substrate - binding arms to the substrate . The kinetics of mnazymes were analyzed, with the mz1d core split as an example, and compared to those of the 1023 dnazyme on which the mz1 series was based . Both enzymes had identical substrate binding arm sequences and were designed to cleave substrate sub2i - fb . Turnover was compared by measuring kcat, that is, the amount of substrate converted to product per unit of time . Kinetic studies measured kcat and km values for the mnazyme as approximately 28 min and 95 nm, respectively . In comparison, the kcat and km of the dnazyme were approximately 80 min and 140 nm, respectively . Kcat / km was 2.9 10 min m for the mnazyme and 5.6 10 min m for the dnazyme . Together these data demonstrate that an mnazyme can function as a true enzyme capable of multiple turnover with only slightly decreased efficiency compared to the dnazyme on which it is based . Further, similar to dnazymes, the rate of cleavage by mnazymes was shown to be dependent on many factors including temperature, length of the substrate binding arms, and the constituents and concentration of buffer . The arm length of various substrates was optimized to allow cleavage by mnazymes under various conditions, including those compatible with real - time polymerase chain reaction (pcr). By way of example, measurement of kobs of the substrate sub2i - fb over a broad temperature range showed an optimum at around 50 c (figure s3, supporting information). In this example the number of bases in the substrate binding arms was 11 and 10 for the a and b partzymes, respectively . Analysis of other mnazymes showed that the optimal temperature decreased as the lengths of substrate arms decreased, consistent with faster product dissociation of shorter oligonucleotides at lower temperatures (data not shown). Santoro and joyce(12) demonstrated that the rate of catalysis of the 1023 dnazyme is also dependent upon the concentration of divalent cations . Additional experiments confirmed that the rate of catalysis by this mnazyme was similarly dependent on the concentration of mg . The catalytic rate of this mnazyme increased approximately linearly with increasing concentrations over the range of 0100 mm mg, after which the rate reached a plateau (data not shown). Mnazymes can be used as tools for direct detection of target nucleic acids in a protein - free, isothermal, fluorescent format . The limit of detection of such an assay was assessed in a series of three experiments with mz1d partzymes, which were designed to assemble in the presence of the target af - ro3 and cleave sub2i - fb . At 52 c the mnazyme assay could discriminate 5 pm of target assembly facilitator from the background signal (measured by the absence of target) (figure 3c). This corresponds to approximately 125 amol or 7.5 10 copies of the target nucleic acid sequence in a 25 l reaction . Changes in fluorescence following cleavage of sub2-fb allowed real - time detection and quantification of the k - ras gene from human genomic dna (figure 3d). In the absence of genomic dna, fluorescence did not increase . A standard curve was generated by plotting the log of the initial dna concentration of a serial dilution of genomic dna against the threshold cycle, resulting in a linear plot with a correlation coefficient of 0.999 and a pcr efficiency of 94% . Signal was detected in reactions containing as little as 32 pg of genomic dna, corresponding to approximately 10 copies of the target gene, demonstrating the high sensitivity of mnazyme detection coupled with real - time pcr . Many variations of the basic mnazyme design, some of which involve using additional component oligonucleotides beyond those illustrated in figure 1, have been shown to form active mnazymes (figure 4) and provide further functionalities and utility . One possible variation incorporates a partzyme with a truncated sensor arm that requires hybridization of a stabilizer arm adjacent to it on the target to facilitate formation of an active mnazyme (figure 4a i). This type of mnazyme structure can be exploited to discriminate two targets differing by a single base (figure 5a). In the following example, the sensor arm of one partzyme was truncated and contained only five bases, all of which were fully complementary to an assembly facilitator (af - xdc). A second oligonucleotide (af - xdt) was identical to af - xdc with the exception that a thymine replaced a cytosine, thus resulting in a single mismatch with respect to the truncated partzyme sensor arm . A stabilizer arm, fully complementary to the adjacent sequence of both af - xdc and af - xdt, was added to the reaction . In the presence of the partzymes, the stabilizer arm, and the fully matched target af - xdc, mnazyme activity resulted in cleavage of the substrate sub2i - fb (figures 4a i and 5a omission of the stabilizer arm from this reaction resulted in no cleavage, demonstrating this oligonucleotide was essential for formation of active mnazymes incorporating the partzyme with the truncated sensor arm (figures 4a ii and 5a ii). When the partzymes and the stabilizer arm were incubated with the mismatched target af - xdt, no mnazyme activity was evident, consistent with the capacity of mnazymes to discriminate between two sequences differing by only a single base (figures 4a iii and 5a iii). Together these data demonstrate that active mnazymes, which incorporate partzymes with truncated sensor arms, are formed only when the stabilizer arm is present and the assembly facilitator is fully matched to the sensor arms . Absence of the stabilizer arm and/or the presence of a mismatch in the assembly facilitator within the region that hybridizes to the truncated sensor arm results in an inactive complex . The following abbreviations indicate oligonucleotides in this figure: sa, stabilizer arm; af, assembly facilitator; af - mut, mutated assembly facilitator; afc, assembly facilitator component; ai, assembly inhibitor; s, substrate; pz, partzyme pair; s1p, cleavage product of substrate 1 . Af - mut indicates a sequence that is identical to af with the exception of a single base difference . Numbers are used to indicate the presence of more than one of any of the above elements in a particular series of complexes indicated in this figure . For example, the substrate s1 can also function as an ai and in such cases the second function is indicated in brackets . Similarly, once s1 is cleaved, one of its products (s1p) can function as afc2 . While some oligonucleotide complexes represent active mnazymes (a i, b i, and c i and ii), others are catalytically inactive (a ii and iii, b ii and iii, and c iii). (a) detection of a single base difference by use of a partzyme, xdbd/2-p, that has a truncated five - base sensor arm in combination with the stabilizer arm, xdsa - p . Reactions also contained xdsa - p in the presence of either (i) fully matched target (af - xdc), (iii) mismatched target (af - xdt), or (iv) no assembly facilitator . An additional control reaction (ii) contained fully matched target (af - xdc) but lacked the stabilizer arm (xdsa - p). (b) demonstration of active mnazymes requiring two assembly facilitator components and inactive complexes incorporating inhibitor sequences . In addition, reactions also contained (i) assembly facilitator components afc1-ro1 and afc2-ro1, (ii) no afc2-ro1, (iii) afc1-ro1 and assembly inhibitor ai (sub6-trb), or (iv) no assembly facilitator components . Reactions contained the components of the initiating mnazyme (ro5ad/6-p, ro5bd/6-p, and sub6-trb) and the cascading mnazyme (ro1ad/2-p, ro1bd/2-p, sub2i - fb, and afc1-ro1). In addition, reactions either contained target af - ro5 (i, ii) or lacked target (iii, iv), and fluorescence of either texas red (i, iii) or fam (ii, iv) was monitored over time . Mnazymes can also be designed so that the formation of an active enzyme depends upon the presence of multiple assembly facilitator components (afc), any one of which can be used to switch the enzyme from the on state (active mnazyme) to an off state (inactive complex) or vice versa . Further, inclusion of assembly inhibitor oligonucleotides can result in formation of alternative inactive complexes that incorporate and sequester mnazyme components, including partzymes . Structures incorporating two assembly facilitator components, afc1-ro1 and afc2-ro1, were shown to facilitate active mnazyme formation followed by cleavage of the substrate sub2i - fb and a resultant increase in fluorescence (figures 4b i and 5b omission of one of the assembly facilitators, afc2-ro1, from this reaction resulted in inactive complexes (figures 4b ii and 5b ii). An assembly inhibitor oligonucleotide (ai) was tested that incorporated one domain equivalent to the sequence of one assembly facilitator component (afc2-ro1) plus a second domain containing noncomplementary bases appended to the termini at the junction with the other assembly facilitator component (afc1-ro1) (figure 4b iii). Incubation of the partzymes, one assembly facilitator component (afc1-ro1), and the assembly inhibitor oligonucleotide (sub6) again produced inactive complexes that were unable to cleave the substrate (figure 5b iii). These alternate structures could function as a molecular switch that is on when afc2-ro1 completes the formation of an active mnazyme and is off when the assembly inhibitor binds in its place, forming an inactive complex . Reactions were set up to contain partzymes and a substrate for both an initiating mnazyme (ro5ad/6-p, ro5bd/6-p and sub6-trb) and a cascading mnazyme (ro1ad/2-p, ro1bd/2-p, and sub2i - fb) plus a first assembly facilitator component, afc1-ro1, required for the active state for the cascading mnazyme . Reactions either contained or lacked the target, af - ro5 . In the presence of the target, the initiating mnazyme was formed, which cleaved the first substrate sub6-trb, resulting in an increase in texas red fluorescence (figures 4c i and 5c i). Cleavage of sub6-trb by the initiating mnazyme produces a cleavage product (s1p) that is one of two facilitator components required to direct assembly of the cascading mnazyme . The cascading mnazyme then cleaved the second substrate sub2i - fb, causing an increase in the fluorescence of fam (figures 4c ii and 5c ii). As such, an increase in fluorescence of both texas red and fam is indicative of the presence of the target af - ro5 in the reaction . In the absence of target sequence, no significant increase in fluorescence of either texas red or fam was observed over time (figure 5c iii and iv). In its intact state, uncleaved sub6-trb would bind to one of the partzymes of the cascading mnazyme and function as an assembly inhibitor oligonucleotide directing formation of inactive complexes (schematic in figure 4c iii). This paper describes mnazymes, which are a powerful type of nucleic acid enzyme, with increased versatility and functionality that stems from the multiple components that make up these modular enzymes . The specific mnazymes characterized here are dna enzymes that comprise partial enzymes or partzymes, each of which lacks part of the sequence necessary for catalysis . Partzymes combine to form catalytically active enzymes only in the presence of one or more assembly facilitators . Active mnazymes catalyze substrate modification, thus producing an output signal . When the assembly facilitator is a target nucleic acid, modification of the substrate produces a signal that heralds the presence of the target in the sample . Kinetic analysis established that mnazymes are capable of multiple turnover: for each target molecule present, multiple substrate molecules are modified and this results in signal amplification . The kcat values observed for both the dnazyme and mnazyme in this study are on the order of 10-fold higher than the maximum kcat reported for a dnazyme by santoro and joyce. (12) several factors, such as the use of higher ph and temperature, may have contributed to this result; however, the most significant contributor is likely due to differences in the composition of the substrates used in the studies . Santoro and joyce(12) observed that kcat was highly dependent on the specific base composition of the substrate, and ota et al. (15) demonstrated that a specific dnazyme cleaved a dna / rna chimeric substrate with an enhanced rate compared to its all rna counterpart . The substrate used in kinetic studies by santoro and joyce was an in vitro - transcribed rna substrate selected because it corresponded to the start codon within the hiv target . In contrast, our kinetic studies used a dna / rna chimeric substrate that was selected by screening hundreds of different substrate sequences for those that afforded faster turnover rates . A subset of substrates was chosen as the basis for a series of generic substrates, each of which can be incorporated into single or multiplexed mnazymes assays for detection of a broad range of targets . A general strategy for engineering new mnazymes based on dnazymes we demonstrated the generality of this approach by deriving mnazymes from 1023 and 817 dnazymes. (12) mnazymes were found to have similar properties to the dnazymes from which they were engineered . For example, these mnazymes were shown to be true enzymes capable of multiple turnover at a rate that is dependent on both the concentration of magnesium ions and the reaction temperature . Like protein enzymes, dnazyme catalysis is highly dependent on tertiary structure formation, and factors that impact this even subtly can have a profound influence on the catalytic rate . Therefore, it is remarkable that mnazymes have enzyme activity comparable to that of dnazymes when their fundamental differences in structure are considered . This is particularly true for mnazymes based on the 1023 dnazyme, which has no apparent stemloop or other tertiary structures within the catalytic core . Such structures could theoretically promote the formation of an active mnazyme catalytic core by supporting association and/or stabilization of partial catalytic domains when the complete dnazyme core has been split between two partzymes . For example, the presence of the structural stemloop within the parent e6 dnazyme most likely contributes to the association of component oligonucleotides that constitute the binary deoxyribozyme developed by kolpashchikov. (11) while the enzymes exemplified in our paper all cleave nucleic acid substrates, recent work in our laboratory has extended this repertoire by deriving an mnazyme capable of ligation (data not shown). Furthermore, the strategy described here could be applied to derive new mnazymes from either dnazymes or ribozymes, which could have a broad range of catalytic functions . Much of the power of mnazymes comes from the modularity imparted by component partzymes . In practice, partzymes can be synthesized to have sensor arms that hybridize to any target nucleic acid of interest and substrate arms that hybridize to any one of a series of generic substrates . Examples in this report have used various combinations that incorporated seven partial core sequence pairs, five target binding sequences, and three substrate binding sequences to produce 12 different mnazymes . Further, the use of generic substrates as probes provides multiple advantages regardless of the application for which mnazymes are being used . In particular, the use of generic substrates in protocols allowing target detection confers reliable, consistent performance regardless of the target sequence . Further, their use reduces assay development time, lowers the cost of goods, and eliminates substrate waste since any excess can be used for the next system . Mnazymes have functionalities useful for a range of biotechnical applications, especially molecular diagnostics, where demand is increasing for point - of - care assays and technologies with higher throughput, sensitivity, and specificity . In two demonstrations of utility described here, we reported the use of mnazymes in an isothermal, protein - free assay for direct detection of nucleic acids . The assay detected approximately 125 amol of target in 2 h by fluorescence monitoring in a format compatible with analysis on any general - purpose fluorometer . The ability of this mnazyme to detect a low concentration of target was superior to that reported for the e6 binary deoxyribozyme,(11) which only detected 1 nm after 30 h. our mnazyme detection strategy provides a simple, inexpensive protocol suitable for detecting targets present at a high copy number in a point - of - care setting . This isothermal mnazyme protocol could also produce a colorimetric readout if combined with an approach such as that published by lui and lu. (18) however, methods that use either dnazymes or split dnazymes to produce a colorimetric readout have the disadvantage that they are not capable of multiplex analysis of more than one target in a single reaction chamber . In alternative detection strategies, mnazymes can be linked to various target amplification technologies including real - time pcr . To date, no binary or split dnazymes have been described as being capable of functioning at the elevated temperatures (50 c) required for pcr . We demonstrated the use of mnazyme real - time pcr to quantify a target gene present in genomic dna and detected as little as 10 copies . The method is highly sensitive and has enhanced specificity compared to other real - time pcr protocols since two partzymes and two pcr primers are required to bind for amplification and detection . A series of generic substrates has been successfully used in multiplex mnazyme real - time pcr assays that simultaneously quantified five rna transcripts. (20) furthermore, multiplex mnazyme real - time pcr was also used to follow an rna transcript (oz1 rna) and a control transcript in an international phase ii gene therapy clinical trial,(21) demonstrating the robustness and utility of the technology in a clinical setting . Mnazymes are highly versatile enzymes encompassing a range of structures with variant oligonucleotide composition and structure . For example, mnazymes may incorporate elements such as partzymes with truncated sensor arms and stabilizer arm oligonucleotides, and/or they may require multiple assembly facilitator components for functionality . This further broadens their range of utility to encompass applications such as base - sensitive biosensor elements and computational switches (reviewed in ref (2)). Partzymes with truncated sensor arms, together with stabilizer arms, are particularly useful for detection of sequence variations including mutations and single nucleotide polymorphisms (snps). In this report, detection of a single base change was dependent upon hybridization at 46 c between a five - base truncated sensor arm and a target . It is likely that the truncated sensor arm and the adjacent stabilizer arm synergistically cooperated by coaxial helix stacking to complete the complex . The position within the sensor arm and the specific mismatch both influence the degree of discrimination . Many authors have reported that certain mismatches, for example, c - a or g - a, have a greater destabilizing effect on duplexes than others such as g - t . Experiments to date indicate these rules are also useful for predicting mismatches between a target assembly facilitator and a partzyme sensor arm that result in inactive complexes . While the experiments reported in this study used an isothermal, direct detection format, we have since used partzymes with truncated arms for mutation and snp detection in an mnazyme real - time pcr (data not shown). In another example, mnazyme structures were formed with the use of multiple assembly facilitator component oligonucleotides, all of which were required for enzyme activity . Switch-like effect such that the absence of an assembly facilitator component, and/or the presence of an assembly inhibitor, prevented formation of an active enzyme and resulted in catalytically inactive or off complexes . In contrast, the presence of all abutting assembly facilitator components resulted in catalytically on mnazymes . Combining the functions of an mnazyme that is ready to receive input and produce output along with the ability to be turned off and on provides the basis of molecular switches and provides useful components of nucleic acid cascades . These structures can be used for transducing signals, facilitating molecular computation, and/or providing structural elements useful for bioengineering nanoscale machines . Our laboratory has exploited mnazyme structures to develop cascade protocols that may be linked to any isothermal mnazyme assay to increase the sensitivity of target detection and/or amplify the signal . The cascade strategy employed here is controlled by a molecular switch where an initiating mnazyme controls the formation of a second cascading mnazyme . The target - dependent assembly of the initiating mnazyme is required to produce an essential component of the cascading mnazyme, and thus the initiating mnazyme is a molecular switch to turn the cascading mnazyme on . While it was useful to label the two substrates with different fluorophores to provide evidence of both stages of the cascade in this example, labeling both substrates with the same fluorophore would be advantageous in an analytical setting, as this would increase the degree of signal amplification afforded for each target molecule . This study demonstrates the power of mnazymes, which are inherently more versatile than the antecedent dnazyme on which they were based . In general, dnazymes or ribozymes recognize and modify a target substrate; however, the separation of target recognition from substrate modification in the mnazyme design affords increased flexibility and functionality . Further, our study discloses a general method for generating new mnazymes from other nucleic acid enzymes . Mnazymes use stable nucleic acid components and this will facilitate simple, fast, and cost - effective methods for the detection of targets . Mnazymes are a powerful class of enzyme that can be activated by the input of any specific synthetic or biological nucleic acid to produce an amplified output, which can be generic in nature . Furthermore, their activity can be switched on or off by the presence or absence of other nucleic acid sequences, and they can be linked in series to produce a molecular cascade or signal transducer . The extraordinary properties of mnazymes confers potential for their integration into diverse devices such as diagnostic biosensors, molecular computers, and/or nanoscale machines . Reactions contained a bulk mix consisting of 0.2 m each of partzyme a and partzyme b, pcr buffer ii (applied biosystems), and 25 mm mgcl2, (unless stated otherwise). In addition, reactions may also have contained a stabilizer, an assembly facilitator or assembly facilitator component(s), mutated assembly facilitator, or no assembly facilitator (no af control reaction). The total volume of each reaction was 25 l . Reactions were incubated at various, constant temperatures in a smartcycler system thermocycler (cepheid), and fluorescence was monitored over time . A substrate - only reaction was performed to enable subtraction of the background level of fluorescence from the reactions . Results in all figures are the averages from replicates and were plotted by use of excel (version 11). Mnazyme activity was monitored by cleavage of a dual - labeled nucleic acid substrate composed of dna (uppercase) and rna (lowercase) bases . Underlined bases indicate the position of a 6-fam (f) or texas red (tr) moiety on the 5 side of the rna bases and the black hole quencher moiety (b) on the 3 side of the rna bases . Sub2 was either end - labeled (sub2-fb, aaggtttcctcguccctgggca) or internally labeled (sub2i - fb, aaggtttcctcguccctgggca). The substrate used for studies of mz2 mnazymes was sub1i - fb, which was internally labeled (actcactataggaagagatg). Partzyme sequences used in these experiments are displayed such that the bases shown underlined form part of the catalytic core of the assembled mnazyme, bases shown in boldface type hybridize with the assembly facilitator, and bases shown in italic type hybridize to the substrate . Indicates 3 phosphorylation of the partzyme, which prevents extension when partzymes are used in conjunction with pcr . The assembly facilitators (af) af - ro3 (cagtgacttcacatggggcaatggcaccagcacgggcagcagctggc), af - ro4 (gccattgtcgaacacctgctggatgaccagc), and af - ro5 (gaaggtgtaatccgtctccacagacaaggccaggactcgtttg) and assembly facilitator component (afc) afc1-ro1 (acttccaggtcgccctgtcttccctgagc) were homologous to sequence from the human rplp0 gene (nm_001002). The assembly facilitator af - xdt (tgccccctcaccctcacgaaggtatacagacagatggacatccagttggtga) was homologous to the human plxnb1 gene (nm_002673), and af - xdc (tgccccctcaccctcacgaaggcatacagacagatggacatccagttggtga) was homologous to the mutant a5359g(22) of the human plxnb1 gene . Reactions were performed in triplicate and were monitored in real time at 9 s intervals for 15 min at 55 c by the isothermal direct detection method (see above) with the modification of 50 mm mgcl2 . Test reactions for mz1 candidate partzyme pairs (ag series; see table s1 in supporting information) each contained 0.2 m af - ro5 or no assembly facilitator . Substrate sub2-fb (1 m) was 5 end - labeled in 10 ci [-p]atp (perkin - elmer), 1 pnk buffer, and 1 unit of polynucleotide kinase (new england biolabs) at 37 c for 30 min . The reaction contained 1 immobuffer (bioline), 50 mm mgcl2, 5 nm labeled sub2-fb, and either 100 nm 1023 deoxyribozyme (dz1) or 100 nm mnazyme [100 nm each of ro5ac/2-p (caaacgagtcctggccttgtcttacaacgagaggaaacctt - p), ro5bc/2-p (tgcccagggaggctagcgtggagacggattacaccttc - p), and af - ro5] or no enzyme . The reactions were stopped by adding formamide loading dye containing 100 mm ethylenediaminetetraacetic acid (edta). Upon completion of the reactions, the uncleaved substrate and cleavage products of the deoxyribozyme and the mnazyme were resolved by electrophoresis on a 16% denaturing polyacrylamide gel . Reactions reported in figure 3b were monitored at 36 s intervals for 1 h at 40 c by the isothermal direct detection method (see above) with the modifications of 50 mm mgcl2 and 50 mm tris hcl (ph 9.0 at 25 c). Test reactions also contained sub1i - fb, ro4aa/1 (gctggtcatccagcagcggtcgaaatagtgagt), and ro4ba/1 (catctcttctccgagcgtgttcgacaatggc) in the presence of 0.2 m af - ro4 or in the absence of an assembly facilitator (no af). Control reactions included ro4aa/1 with 0.2 m af - ro4 (no partzyme b, control 1); ro4ba/1 with 0.2 m af - ro4 (no partzyme a, control 2); mutated partzyme a (ro4aa/1mut gctggtcatccagcagcggttgaaatagtgagt) with ro4ba/1 and 0.2 m af - ro4 (control 3); and ro4aa/1 and ro4ba/1 with 0.2 m af - ro5 (control 4). Three independent experiments were performed, with each reaction done in triplicate and monitored in real time at 18 s intervals for 15 min at 55 c . The isothermal direct detection method (see above) was used with the modifications of 50 mm mgcl2 and various concentrations of sub2i - fb (either 1000, 750, 500, 250, 200, 150, or 100 nm). Mnazyme test reactions used the mz1d split (table s1 in supporting information) and contained 1 m ro5ad/2-p, 1 nm ro5bd/2-p, and 1 m af - ro5 (equivalent to a maximum concentration of assembled mnazyme of 1 nm). The 1023 dnazyme reaction contained 1 nm dz1 . To enable the conversion of fluorescence data into reaction velocities, a standard curve was generated from a range of concentrations (1000, 500, 250, 125, 62.5, or 31.1 nm) of totally cleaved substrate . The michaelismenten equation was fitted to the data generated from the enzymatic reactions (by use of prism version 4.0, graphpad software inc .) To derive the enzymatic parameters vmax and km . The kobs values were obtained by fitting a hyperbolic function (by use of prism version 4.0, graphpad software inc .) To the fluorescence versus time data . Reactions in figure 3c were performed in duplicate and were monitored at 72 s intervals for 2 h at 52 c by the isothermal direct detection method . All reactions contained ro3ad/2-p (agctgctgcccgtgctggtgacaacgagaggaaacctt - p), ro3bd/2-p (tgcccagggaggctagctccattgccccatgtgaagtca - p), and sub2i - fb . Test reactions contained various concentrations of target af - ro3 (750, 500, 250, 50, 10, or 5 pm) or no assembly facilitator (no af). Human genomic dna extracted from the im9 cell line (american type culture collection) was used as template for amplification of the k - ras gene (nt_009714.16). Real - time pcr amplification and quantification of the target sequence the cycling parameters were 95 c for 10 min, followed by 5 cycles of 95 c for 30 s and 55 c for 60 s, and followed by 40 cycles of 95 c for 30 s and 53 c for 60 s. the reactions contained 40 nm forward primer (5k - ras tagtgtattaaccttatgtgtgac) and 200 nm of each reverse primer (3k - ras aatgattctgaattagctgtatc), k - rasad/2-p (taaacttgtggtagttggagacaacgagaggaaacctt), k - rasbd/2-p (tgcccagggaggctagctctggtggcgtaggcaagagtgcc), and sub2-fb, 8 mm mgcl2, 10 units of rnasin (promega), 1 immobuffer (bioline), 2 units of immolase (bioline), and either genomic dna template (100 ng, 20 ng, 4 ng, 800 pg, 160 pg, or 32 pg) or no dna (h2o). Reactions in figure 5a were performed in duplicate and were monitored at 72 s intervals for 2 h at 46 c by the isothermal direct detection method . All reactions contained xdad/2-p (actggatgtccatctgtctgacaacgagaggaaacctt - p), xdbd/2-p (tgcccagggaggctagcttatgc - p), and sub2i - fb . Reactions also contained 0.2 m xdsa - p (cttcgtgagggtgag - p) in the presence of either 10 nm af - xdc or 10 nm af - xdt or no assembly facilitator . An additional control reaction contained 10 nm af - xdc but lacked xdsa - p . Reactions in figure 5b were performed in duplicate and were monitored at 36 s intervals for 1 h at 47 c by the isothermal direct detection method . All reactions contained ro1ad/2-p (gctcagggaagacagggcgacctgacaacgagaggaaacctt - p), ro1bd/2-p (tgcccagggaggctagctgaagtcgaggcgtgat), and sub2i - fb . In addition, reactions also contained either 0.2 m afc1-ro1 and afc2-ro1, or 0.2 m afc1-ro1, or 0.2 m each of afc1-ro1 and assembly inhibitor ai (sub6-trb), or no assembly facilitator components . Reactions in figure 5c were performed in duplicate, and fluorescence of both texas red and fam were monitored at 36 s intervals for 1 h at 48 c by the isothermal direct detection method . Reactions contained the components of the initiating mnazyme, ro5ad/6-p (caaacgagtcctggccttgtctacaacgagaggcgtgat - p), ro5bd/6-p (ctgggaggaaggctagctgtggagacggattacaccttc - p), and sub6-trb, and the cascading mnazyme (ro1ad/2-p, ro1bd/2-p, sub2i - fb, and 0.2 m afc1-ro1). In addition, reactions either contained 10 nm target af - ro5 or lacked target.
Uremia related, non -traditional risk factors, such as inflammation, oxidative stress, dyslipidemia, vascular calcification alterations in calcium and phosphorus (p) metabolism, have been proposed to play a central role (2). Elevated plasma beta2 microglobulin (2 m), is a well - known characteristic of chronic renal failure . Predialysis serum 2 m level predicted mortality and increase of 2 m clearance during hd was associated with improved outcomes (3). The source of the elevated serum 2 m in hemodialysis patients, has not been explained absolutely . There is controversy as to whether elevated levels are caused predominantly by increased synthesis, the use of membranes in hemodialysis with different clearance capacities, or diminished renal elimination . Use of middle and high - flux biocompatible membranes was shown to be associated with a notable reduction 2 m (4). The surface of lymphocytes and monocytes are particularly rich in 2 m, the latter being synthesized to large amounts by lymphocytes and regulated by interferons and proinflammatory cytokines (5), which might explain the pathophysiological role in atherosclerosis . But remains to be further clarified if 2 m is solely a marker of inflammation or if it has a direct pathogenic effect and if other yet unknown confounders may influence 2 m levels (6). The uremic state is associated with an altered immune response, and intermittent stimulation by endotoxins originating from the dialysis water supply and artificial vein grafts or bio incompatibility caused the increased circulating inflammatory proteins, such as c - reactive protein (crp) (7), produced by the liver, mainly in response to interleukin -6 (il-6). Hemodialysis patients, exhibit significant alterations in lipoprotein metabolism, which in their most advanced form result in the development of severe dyslipidemia . Lipid disorders stem largely from dysregulation of high density lipoprotein (hdl) and triglyceride - rich lipoproteins metabolism . The down regulation of the expression of several genes along with the changes in the composition of lipoprotein particles and the direct inhibitory effect of various uremic toxins on the enzymes involved in lipid metabolism, represent the most important pathophysiological mechanisms underlying the development of hypertriglyceridemia (8). Several mechanisms, working in concert, may underlie the reduction in hdl levels, which is usually indicative of impaired reverse cholesterol transport . Thus, uremic patients exhibit decreased levels of apolipoproteins ai and aii, diminished activity of lecithin - cholesterol acyl - transferase, as well as increased activity of cholesteryl ester transfer protein that facilitates the transfer of cholesterol esters from hdl to triglyceride - rich lipoproteins, thus reducing the concentration of hdl (8). Lipoprotein(a) [lp(a)] is an independent risk factor for clinical events attributed to atherosclerotic cardiovascular disease in chronic hemodialysis . Lp(a) levels are frequently elevated in hd patients (9) and are considered a major risk factor for cardiovascular disease (10). Secondary hyperparathyroidism, is one of the major complications of patients in chronic hemodialysis (11). Parathyroid hormone (pth) starts to rise very early in the course of kidney disease . As disease progresses, plasma levels of vitamin d and calcium begin to decline, thus contributing to greater secretion of pth . In addition, the retention of phosphate further increases pth secretion independent of calcium and vitamin d levels . Previous studies have supported the view that high pth serum levels in uremic patients may cause deleterious effects in myocardium metabolism and function (12). The aim of this study is to investigate the association of 2-m with inflammatory markers, dyslipidemia and mineral disorders in high - flux membrane hemodialysis patients . In study were included 40 patients, undergoing maintenance high - flux membrane hemodialysis treatment in the clinical centre in prishtina, for a period longer than 6 months . A) based in patient s history, angina, possible myocardial infarction, cerebrovascular events, infective diseases and cancer, were excluded . In all patients, 2-m, crp, il-6, triglycerides, cholesterol, ldl, hdl, lp(a), pth, calcium, triglycerides, cholesterol, hdl, ldl, calcium, phosphorus and albumin were measured by biochemical analysis; b) the assay of -2 microglobulin is based on a latex enhanced immunoturbidimetric method . C) crp was determined by the turbidimetric method, il-6 with enzyme linked immunosorbent immunoassay (elisa), lipoprotein (a) with immunoturbidimetric method depth with a chemiluminometric immunoassay; d) twenty - four healthy subjects (12 women and 12 men, aged 56.08 12.34 years) served as controls . Serum concentration of 2 m, crp, il-6, triglycerides, lp(a), p and pth in hemodialysis patients were significantly higher than in controls (19.84 2.23 mg / l vs 2.11 1.0 mg / l, p<0.001; 39.75 29.7 mg / l vs 16.25 3.78mg / l, p<0.001; 3.06 1.08 pg / ml vs 0.35 0.3 pg / ml, p <0.001; 3.17 1.28 mmol / l vs 1.19 0.38 mmol / l, p<0.001; 40.25 12.98 mg / dl vs 24.33 8.51 mg / dl, p<0.001; 1.9 0.6 mmol / l, p<0.001; 137.35 50.7 pg / ml vs 46.56 28.64 the concentration of hdl and serum albumin was significantly lower (1.14 0.34 vs 1.52 0.35 mmol / l, p<0.001; 34.83 3.89 g / l vs 40.5 3.94 g / l, p<0.001 (table 1). We did not find any difference in cholesterol, ldl and calcium levels between two groups (4.0 1.11mmol / l vs 4.26 0.16 mmol / l, p=0.16; 2.90 1.14 mmol / l vs 2.41 0.57 mmol / l, p<0.05; 2.2 0.24 mmol / l vs 2.26 0.25 mmol / l, p = 0.11 (table 1). Biochemical parameters in hemodialysis patients and controls 2 m was inversely associated with hdl, albumin and calcium concentration (r = -0.73, p <0.001; r = -0.53, p <0.001; r = -0.50, p <0.01 (table 2), whereas positively was associated with triglycerides, p and pth (r= 0.69, p <0.001; r= 0.53, p <0.001; r=0.58, p <0.05 (table 2). The patients with high 2 m values, simultaneously had higher lp(a) concentrations, but we did not observe significant correlation (r=0.28 (table 2). We also found low positive correlation of 2 m with age (r=0.46, p <0.001 (table 2). 2 m levels were upper in patients with high crp levels, but there was no significant relationship between crp or il-6 and 2 m (r= 0.11, p <0.001; r= 0.23, p <0.001 (table 2). There was no correlation of 2 m with cholesterol and ldl cholesterol (r = 0.13, p <0.001; r = 0.18, p <0.001 (table 2). Positive correlation exists between crp and il-6 (r=0.94, p <0.001 (table 2). Albumins correlated negatively with il-6 and lpa (r = -0.60, p <0.001; r=-0.72, p<0.005 (table 2). Correlation between serum 2 m levels with selected biochemical parameters during the follow - up period of three years, 6 out of 40 patients had died, from cardiovascular events . Significant correlation exists between b2 m and glomerular filtration rate even when renal function was only slightly impaired . Liabeuf, et al, reported plasma 2 m level to be a predictor of cardiovascular events and mortality in patients with different stages of chronic kidney disease (14). We examined the impact of 2 m on some cardiovascular risk factors in high - flux membrane hemodialysis patients . A correlation between an inflammatory response during hemodialysis and elevated serum 2 m has been described (15). Compared with the controls, hd patients exhibited marked elevation of serum 2 m, crp and il-6 (19.84 2.23 mg 29.7mg / l vs 16.25 3.78mg / l, p<0.001; 3.06 1.08 pg / ml vs 0.35 0.3 pg / ml, p <0.001 (table 1). But we found no relationship between crp or il-6and 2 m (r= 0.11, p <0.001; r= 0.23, p <0.001 (table 2) when high - flux membranes are used . (16, 17, 18). Even in studies, where the low flux membranes were used our findings suggested that plasma b2 m level is directly correlated with some metabolic and cardiovascular risk factors . Triglycerides start to increase in early stages of chronic kidney disease and show the highest values in dialysis patients . Hemodialysis patients presented increased triglycerides compared with controls (3.17 1.28 mmol / l vs 1.19 0.38 mmol / l, p<0.001 (table 1). We find significant positive correlation between triglycerides and 2 m levels (r= 0.69, p <0.001 (table 2). Hdl concentrations exhibited significant reduction in patients compared to controls (1.14 0.34 vs 1.52 0.35 mmol / l, p<0.001 (table 1). Serum 2 m concentrations were inversely associated with hdl (r = -0.73, p<0.001 (table 2). Supporting, linear regression analysis confirmed the negative impact of 2 m concentrations on hdl level . Lp(a) start increasing early during the course of chronic kidney disease and becomes pronounced with increasing severity of disease . Lp(a) levels were significantly higher in patients than in controls (40.25 12.98 mg / dl vs 24.33 8.51 mg / dl, p<0.001 (table 1), which confirm that kidney have an important role in lp(a) metabolism . The patients with high 2 m values, simultaneously had higher lp(a) concentrations but we did not observe high correlation (r=0.28, p<0.05 (table 2). The negative correlation of lp(a) with albumin (r=-072, p<0.005 (table 2), suggests that the mechanism behind the increased lp(a) levels may be related to the protein losses, perhaps via an increased synthesis rate of apolipoprotein (a) in the liver or via decreased lp(a) catabolism in hd patients . We found a significant indirect relationship between 2 m and albumin (r=-0.53, p<0.001 (table 2). This correlation may be used to identify the patients at high risk, from cardiovascular disease (22). Mineral and bone disorder is a growing health care concern associated with secondary hyperparathyroidism, mineral abnormalities, and increased risk of cardiovascular disease (23). In hemodialysis patients, concentrations of pth and p were significantly higher compared with controls (137.35 50.7 pg / ml vs 46.56 28.64 pg / ml, p<0.001; 1.9 0.6 mmol / l vs 1.26 0.33 calcium levels were lower in patients compare with controls, but with no significant difference (2.2 0.24 mmol / l vs 2.26 0.25 mmol / l, p = 0.11 (table 1). Mineral and bone disorders are associated with accelerated atherosclerosis (24), which is an important cause of cardiovascular death in chronic hemodialysis (25). In this study, serum concentration of 2 m positively correlated with p and pth (r= 0.53, p <0.001; r=0.58, p <0.05 (table 2), whereas negatively with calcium (r = -0.50, p <0.01 (table 2), which proves that 2 m has direct impact in mineral disorders and cardiovascular risk in hd patients . It has been suggested that the predictive value of serum 2 m concentration is superior to that provided by established prognostic factors for mortality, such as glomerular filtration, cystatin c and crp (26). During the follow - up period of three years, 6 out of 40 patients had died from cardiovascular events . Even if there was no correlation of 2 m with inflammation, in high - flux membrane hemodialysis patients, our finding indicates that 2 m might have an important role in the development of cardiovascular diseases.
Gastric cancer is the fourth leading cause of cancer deaths worldwide (1) and the third in china (2). Missed preoperative diagnosis of intra - abdominal metastases, including peritoneal dissemination and intraperitoneal free cancer cells, is among the leading cause of poor prognosis, surgical failure and futile laparotomy . Therefore, accurate preoperative staging, especially through improved diagnostic accuracy of peritoneal dissemination and intraperitoneal free cancer cells, is particularly important for alternative treatment strategies and prognostic evaluations . As an alternative of laparotomy, diagnostic laparoscopy has been suggested to effectively detect peritoneal diseases and can be used to collect peritoneal lavage fluid for cytology examination with minimal invasion . However, diagnostic laparoscopy plays a currently undefined role in gastric cancer staging due to controversy regarding its indications . National comprehensive cancer network (nccn) guidelines recommend laparoscopic staging for patients with t3 and/or n+ if they are considered for surgical resection without preoperative therapy; european society for medical oncology (esmo) guidelines recommend laparoscopic staging for patients with ib - iii gastric cancer; and japanese gastric cancer association (jgca) guidelines mention only laparoscopy prior to neoadjuvant chemoradiotherapy (3 - 5). In china, most gastric cancer patients present with advanced disease stages; however, a consensus on the role of diagnostic laparoscopy still has not been established because of the lack of direct evidence (6). The aim of this study was to provide an assessment of the detection rate of intra - abdominal metastasis using diagnostic laparoscopy in gastric cancer patients, and investigate the clinical risk factors of intra - abdominal metastasis before exploratory operation to determine the indications of diagnostic laparoscopy for patients with gastric cancer in china . Between september 2011 and september 2013, a prospective study of pretherapeutic diagnostic laparoscopy was performed on consecutive gastric cancer patients in the department of gastrointestinal surgery at the peking university cancer hospital (figure 1). Basic algorithm for selection and treatment of patients with locally advanced gastric cancer . Patients meeting the inclusion criteria were enrolled, and the following data were recorded: basic information, including age, gender, height, body weight and weight loss; and clinical information, including results of endoscopy, computed tomography (ct), endoscopic ultrasound (eus) and result of blood test . More specifically, borrmann type, proportion of the tumor in relation to circumference of the stomach (<1/4, 1/4 to <1/2, 1/2 to <3/4, and 3/4) and portions of stomach (cardia, fundus, body and antrum) were determined by endoscopy; t stage, n stage, tumor depth, basal diameter and basal area were from eus; and serosal invasion, enlarged lymph node, and tumor depth were measured by ct . Tumor markers [carcinoembryonic antigen (cea), carbohydrate antigen 19 - 9 (ca19 - 9), ca72 - 4, and ca242] were determined by blood test . We adopted a ct criteria described by jin woong kim to measure serosal invasion on ct . Specifically, when an irregular or nodular outer margin of the outer layer and/or a dense band - like perigastric fat infiltration was visualized, serosal invasion was suspected (7). Depth of invasion was measured using ct slices as shown in figure 2 . To maintain consistency of degree of distension, a gas distension method was used during ct scan (8). Measurement of the depth of invasion on ct . Measurement of the depth, the basal diameter and basal area are shown in figure 3 . Lymph nodes were considered positive for metastasis if they were equal to or larger than 8 mm in the short - axis diameter under eus (9). (a) depth and basal diameter; (b) basal area . This study is conducted in accordance with the declaration of helsinki and ethical guidelines for clinical research, and has been approved by the institutional review boards of peking university cancer hospital . The inclusion criteria included: 1) histologically confirmed diagnosis of primary gastric carcinoma; 2) abdominal enhanced spiral ct and eus showed a clinical stage of ct2 - 4n0 - 3m0; 3) fit for radical gastrectomy or neo - adjuvant treatment; and 4) agree to have diagnostic laparoscopy . The exclusion criteria included: 1) unfit for laparoscopic operation or general anesthesia (suspicious abdominal adhesions, severe cardiopulmonary disease, etc . ); 2) underwent emergency surgery to relieve obstruction, bleeding or perforation; or 3) preoperative examination shows signs of metastasis, including peritoneal thickening, ascites, distant lymph node enlargement, etc . A 10-mm disposable trocar (observing hole) was inserted into the sub - umbilicus, and a 30 telescope was used . Another 10-mm trocar and a 5-mm trocar (operating hole) were inserted into the right and left upper quadrants, respectively . Prior to any manipulation, 250 ml of warm normal saline was infused into the subphrenic space, subhepatic space, omentum, bilateral paracolic sulci and the pouch of douglas . Care was taken to avoid direct contact of the irrigation with the primary tumor . At least 100 ml of fluid was aspirated from the subphrenic space, subhepatic space and pouch of douglas . Subsequently, a systematic inspection of the abdominal cavity was performed clockwise from the right quadrant . Patients without macroscopic peritoneal dissemination (p) and with negative cytology results (cy) were defined as having negative diagnostic laparoscopy results (dl), which means there are no intra - abdominal metastases . And patients with peritoneal dissemination, which was confirmed by frozen pathology (p+) or free cancer cells in the peritoneal lavage (cy+), were defined as having positive diagnostic laparoscopy results (dl+). To determine the clinical risk factors as predictors for gastric cancer patients with intra - abdominal metastasis before exploratory operation, a split - sample method was applied . The patient cohort was divided randomly into 2 groups: 3/4 for a training set and 1/4 for a testing set . In the training set, the clinical characteristics of the dl and dl+ patients were compared using the independent samples group t - test and chi - squared test . To determine the risk factors, all variables found to be significant by univariate analysis were assessed by binary logistic regression analysis (method: backward wald, probability for stepwise: 0.5 for entry, 1.0 for removal). The receiver operating characteristic (roc) curve and area under the curve (auc) analyses were used to determine sensitivity, specificity and corresponding cut - off values of each factor . In the testing set, all patients were classified according to their number of risk factors determined by training set, and the sensitivity and specificity of different combinations of factors were calculated to predict the metastasis . All statistical analyses were carried out using the ibm spss statistical (version 20.0; ibm corp . Between september 2011 and september 2013, a prospective study of pretherapeutic diagnostic laparoscopy was performed on consecutive gastric cancer patients in the department of gastrointestinal surgery at the peking university cancer hospital (figure 1). Basic algorithm for selection and treatment of patients with locally advanced gastric cancer . Patients meeting the inclusion criteria were enrolled, and the following data were recorded: basic information, including age, gender, height, body weight and weight loss; and clinical information, including results of endoscopy, computed tomography (ct), endoscopic ultrasound (eus) and result of blood test . More specifically, borrmann type, proportion of the tumor in relation to circumference of the stomach (<1/4, 1/4 to <1/2, 1/2 to <3/4, and 3/4) and portions of stomach (cardia, fundus, body and antrum) were determined by endoscopy; t stage, n stage, tumor depth, basal diameter and basal area were from eus; and serosal invasion, enlarged lymph node, and tumor depth were measured by ct . Tumor markers [carcinoembryonic antigen (cea), carbohydrate antigen 19 - 9 (ca19 - 9), ca72 - 4, and ca242] were determined by blood test . We adopted a ct criteria described by jin woong kim to measure serosal invasion on ct . Specifically, when an irregular or nodular outer margin of the outer layer and/or a dense band - like perigastric fat infiltration was visualized, serosal invasion was suspected (7). Depth of invasion was measured using ct slices as shown in figure 2 . To maintain consistency of degree of distension, a gas distension method was used during ct scan (8). Measurement of the depth of invasion on ct . Measurement of the depth, the basal diameter and basal area are shown in figure 3 . Lymph nodes were considered positive for metastasis if they were equal to or larger than 8 mm in the short - axis diameter under eus (9). This study is conducted in accordance with the declaration of helsinki and ethical guidelines for clinical research, and has been approved by the institutional review boards of peking university cancer hospital . The inclusion criteria included: 1) histologically confirmed diagnosis of primary gastric carcinoma; 2) abdominal enhanced spiral ct and eus showed a clinical stage of ct2 - 4n0 - 3m0; 3) fit for radical gastrectomy or neo - adjuvant treatment; and 4) agree to have diagnostic laparoscopy . The exclusion criteria included: 1) unfit for laparoscopic operation or general anesthesia (suspicious abdominal adhesions, severe cardiopulmonary disease, etc . ); 2) underwent emergency surgery to relieve obstruction, bleeding or perforation; or 3) preoperative examination shows signs of metastasis, including peritoneal thickening, ascites, distant lymph node enlargement, etc . A 10-mm disposable trocar (observing hole) was inserted into the sub - umbilicus, and a 30 telescope was used . Another 10-mm trocar and a 5-mm trocar (operating hole) were inserted into the right and left upper quadrants, respectively . Prior to any manipulation, 250 ml of warm normal saline was infused into the subphrenic space, subhepatic space, omentum, bilateral paracolic sulci and the pouch of douglas . Care was taken to avoid direct contact of the irrigation with the primary tumor . At least 100 ml of fluid was aspirated from the subphrenic space, subhepatic space and pouch of douglas . Subsequently, a systematic inspection of the abdominal cavity was performed clockwise from the right quadrant . Patients without macroscopic peritoneal dissemination (p) and with negative cytology results (cy) were defined as having negative diagnostic laparoscopy results (dl), which means there are no intra - abdominal metastases . And patients with peritoneal dissemination, which was confirmed by frozen pathology (p+) or free cancer cells in the peritoneal lavage (cy+), were defined as having positive diagnostic laparoscopy results (dl+). To determine the clinical risk factors as predictors for gastric cancer patients with intra - abdominal metastasis before exploratory operation, a split - sample method was applied . The patient cohort was divided randomly into 2 groups: 3/4 for a training set and 1/4 for a testing set . In the training set, the clinical characteristics of the dl and dl+ patients were compared using the independent samples group t - test and chi - squared test . To determine the risk factors, all variables found to be significant by univariate analysis were assessed by binary logistic regression analysis (method: backward wald, probability for stepwise: 0.5 for entry, 1.0 for removal). The receiver operating characteristic (roc) curve and area under the curve (auc) analyses were used to determine sensitivity, specificity and corresponding cut - off values of each factor . In the testing set, all patients were classified according to their number of risk factors determined by training set, and the sensitivity and specificity of different combinations of factors were calculated to predict the metastasis . All statistical analyses were carried out using the ibm spss statistical (version 20.0; ibm corp . From september 2011 to september 2013, 249 patients with histologically confirmed gastric carcinoma underwent diagnostic laparoscopy with peritoneal cytology examination as a routine pretreatment workup, 70.7% of whom are males, with a median age of 57.6 (range: 2981) years . On the basis of ct and eus findings, 13 (5.2%) patients were found to have clinical stage i disease, 64 (25.7%) were stage ii disease, and 172 (69.1%) were stage iii disease . For t stage, 15 (6.0%) patients were t2, 65 (26.1%) were t3 and 169 (67.9%) were t4 . As for n stage, 53 (21.3%) patients were n0, and 196 (78.7%) were n+ . From the diagnostic laparoscopy findings, 14 (5.6%) of the 249 patients had visible peritoneal dissemination only, which was confirmed by frozen pathology, 17 (6.8%) had free cancer cells in the peritoneal lavage only and 20 (8.0%) had both metastases . In total, 51 (20.5%) patients were dl+ and 198 were dl. Among the dl+ patients, 42 underwent hyperthermic intraperitoneal chemotherapy (hipec) followed by palliative chemotherapy after diagnostic laparoscopy, and 9 underwent palliative surgery . Among the dl patients, 101 underwent radical d2 gastrectomy, and 97 underwent neoadjuvant chemotherapy . The split sample method was used, and the 249 patients were divided into two sets using random sampling: 3/4 (187 patients) as a training set for developing predictive factors of metastasis and 1/4 (62 patients) as a testing set for validating these factors . The clinical characteristics were compared between the dl+ and dl patients (table 1). In the training set, 38 (20.3%) patients were dl+, and 149 patients were dl. Ca72 - 4 expression, proportion of the tumor in relation to the circumference of the stomach, tumor - occupied stomach portions, borrmann type, depth of tumor invasion on ct and depth of tumor invasion on eus were found to be significant in our univariate analyses . Next, all these factors were evaluated by multivariate analysis . Among these factors, multivariate analysis indicated that the depth of tumor invasion on ct scan and tumor - occupied stomach portions are predictive factors of metastasis (table 2). Clinicopathologic features of dl+ and dl patients (univariate analysis, training set) predictive factors of metastasis (multivariate analysis, training set) from an roc curve (figure 4, 5 and table 3), the highest youden index (0.217 and 0.270, respectively) was obtained when the depth of tumor invasion on ct was cut off at 21 mm (auc: 0.668, p<0.01) and tumor - occupying portions of the stomach were cut off between 1 and 2 (auc: 0.676, p<0.01). Roc for the prediction of intra - abdominal metastasis by the depth of tumor invasion found by ct scans . Roc for the prediction of intra - abdominal metastasis by the tumor occupying portions of stomach . Prediction of intra - abdominal metastasis by the depth of tumor invasion found by ct scans and the tumor - occupied portions of stomach (training set) in the testing set, 55 patients (among 62 patients) with complete clinical data included 10 (18.2%) dl+ patients and 45 dl patients . All these patients were classified according to their number of independent risk factors for a dl+ status: 26 had no risk factors, 17 had only one risk factor and 2 had two risk factors . When the patients were divided into groups by those with no risk factors and those with at least one risk factor, the sensitivity and positive predictive value (ppv) for detecting intra - abdominal metastasis were 90.0% and 32.1%, respectively . When the patients were divided into groups by those with no risk factors or only one risk factor and those with two risk factors, the sensitivity and ppv were 40.0% and 66.7%, respectively (table 4). Indications for diagnostic laparoscopy based on the number of independent risk factors (testing set) (%) from september 2011 to september 2013, 249 patients with histologically confirmed gastric carcinoma underwent diagnostic laparoscopy with peritoneal cytology examination as a routine pretreatment workup, 70.7% of whom are males, with a median age of 57.6 (range: 2981) years . On the basis of ct and eus findings, 13 (5.2%) patients were found to have clinical stage i disease, 64 (25.7%) were stage ii disease, and 172 (69.1%) were stage iii disease . For t stage, 15 (6.0%) patients were t2, 65 (26.1%) were t3 and 169 (67.9%) were t4 . As for n stage, 53 (21.3%) patients were n0, and 196 (78.7%) were n+ . From the diagnostic laparoscopy findings, 14 (5.6%) of the 249 patients had visible peritoneal dissemination only, which was confirmed by frozen pathology, 17 (6.8%) had free cancer cells in the peritoneal lavage only and 20 (8.0%) had both metastases . In total, 51 (20.5%) patients were dl+ and 198 were dl. Among the dl+ patients, 42 underwent hyperthermic intraperitoneal chemotherapy (hipec) followed by palliative chemotherapy after diagnostic laparoscopy, and 9 underwent palliative surgery . Among the dl patients, 101 underwent radical d2 gastrectomy, and 97 underwent neoadjuvant chemotherapy . The split sample method was used, and the 249 patients were divided into two sets using random sampling: 3/4 (187 patients) as a training set for developing predictive factors of metastasis and 1/4 (62 patients) as a testing set for validating these factors . The clinical characteristics were compared between the dl+ and dl patients (table 1). In the training set, 38 (20.3%) patients were dl+, and 149 patients were dl. Ca72 - 4 expression, proportion of the tumor in relation to the circumference of the stomach, tumor - occupied stomach portions, borrmann type, depth of tumor invasion on ct and depth of tumor invasion on eus were found to be significant in our univariate analyses . Next, all these factors were evaluated by multivariate analysis . Among these factors, multivariate analysis indicated that the depth of tumor invasion on ct scan and tumor - occupied stomach portions are predictive factors of metastasis (table 2). Clinicopathologic features of dl+ and dl patients (univariate analysis, training set) predictive factors of metastasis (multivariate analysis, training set) from an roc curve (figure 4, 5 and table 3), the highest youden index (0.217 and 0.270, respectively) was obtained when the depth of tumor invasion on ct was cut off at 21 mm (auc: 0.668, p<0.01) and tumor - occupying portions of the stomach were cut off between 1 and 2 (auc: 0.676, p<0.01). Roc for the prediction of intra - abdominal metastasis by the depth of tumor invasion found by ct scans . Roc for the prediction of intra - abdominal metastasis by the tumor occupying portions of stomach . Prediction of intra - abdominal metastasis by the depth of tumor invasion found by ct scans and the tumor - occupied portions of stomach (training set) in the testing set, 55 patients (among 62 patients) with complete clinical data included 10 (18.2%) dl+ patients and 45 dl patients . All these patients were classified according to their number of independent risk factors for a dl+ status: 26 had no risk factors, 17 had only one risk factor and 2 had two risk factors . When the patients were divided into groups by those with no risk factors and those with at least one risk factor, the sensitivity and positive predictive value (ppv) for detecting intra - abdominal metastasis were 90.0% and 32.1%, respectively . When the patients were divided into groups by those with no risk factors or only one risk factor and those with two risk factors, the sensitivity and ppv were 40.0% and 66.7%, respectively (table 4). Indications for diagnostic laparoscopy based on the number of independent risk factors (testing set) (%) the highest rates of gastric cancer in the world occur in eastern asia, and china accounts for approximately 40% of the worldwide gastric cancer burden . Thus, the accuracy of clinical staging is crucial . In the present study, 20.5% of cm0 gastric cancer patients were identified to have peritoneal dissemination or free cancer cells by diagnostic laparoscopy . This finding suggests that pretherapeutic diagnostic laparoscopy with cytology examination should be strongly recommended for gastric cancer patients, especially those with related risk factors . 10) performed diagnostic laparoscopy on 657 patients with minimal symptoms and no definite m1 disease, and m1 disease was detected in 23% of patients with this method . In this study, only 65 patients were examined by high - quality spiral ct scans for staging . Although all the patients were examined by high - quality spiral ct scans in our study, the metastasis detection rate was not much different . Therefore, diagnostic laparoscopy cannot be replaced by high - quality imaging techniques . Kaiser et al . (11 - 13) also reported similar metastasis detection rates for resectable m0 gastric cancer patients (20.6%, 24.7% and 23.0%, respectively). It is widely accepted that peritoneal dissemination spreads from the tumor to the serosa, but in our 51 dl+ patients, we also found 2 ct2n0 patients who had free cancer cells, 3 ct3n0 patients who had free cancer cells and 2 ct3n0 patients who had visible peritoneal dissemination . (13) reviewed patients who underwent diagnostic laparoscopy and laparotomy in the same period, respectively, and showed that there was no significant difference in the rate of intra - abdominal metastasis (45.2% vs. 35.5%, p=0.299; 20.6% vs. 20.8%, p=0.977). (15) demonstrated that the collection of peritoneal lavage fluid for cytology during laparoscopy has the same value as its collection during laparotomy . Osorio et al . (13) compared the results of patients who underwent either diagnostic laparoscopy or laparotomy and were not submitted to any additional surgical procedure due to intra - abdominal spread . The patients who underwent diagnostic laparoscopy had a lower morbidity (11.8% vs. 50.0%), lower mortality (0% vs. 16.7%), shorter hospital stay (6.3 d vs. 15.3 d), greater chance for recovery until fit for chemotherapy (64.7% vs. 33.3%) and longer survival (11.6 months vs. 4.8 months). Consequently, diagnostic laparoscopy and laparotomy exploration have similar contributions to the assessment of intra - abdominal metastasis and peritoneal lavage cytology . However, in diagnostic laparoscopy, the entire abdominal cavity can be magnified and easily accessed . Thus, it is easier to find any tiny peritoneal nodules that are located in the subphrenic space or pouch of douglas, areas that are difficult to evaluate even by laparotomy . However, a low detection rate is a problem for diagnostic laparoscopy . From our present results, almost 80% of cases researchers are trying to identify proper indications to narrow the potential candidates for diagnostic laparoscopy . 10) reported that tumor location [gastroesophageal junction (gej) or whole stomach] and a lymphadenopathy of 1 cm were independent, significant risk factors for m1, and m1 was not detected in any patient with neither risk factor . (14) reported that tumor location involving three stomach portions; macroscopic types 3, 4 or 5; and positive lymph node metastasis to all three factors are significantly correlated with either peritoneal metastasis or positive cytology . Our study also found similar risk factors: tumor - occupied 2 portions of stomach and depth of tumor invasion on ct 21 mm (measurements of stomach wall thickness were made when the stomach was well distended during the ct scan). (16) also showed similar results in their study of 236 gastric cancer patients . In our testing set, only one m1 disease was detected in patients with neither risk factor . For the patients who had at least one of these two identified independent risk factors, the sensitivity, ppv and negative predictive value were 90.0%, 32.1% and 96.3%, respectively . According to these results, if we performed diagnostic laparoscopy with cytology examination for the selected patients according to the risk factors, the detection rate would be increased by up to 10%, and only approximately 2% of patients would be missed in preoperative diagnosis of intra - abdominal metastases . However, we continue to recommend diagnostic laparoscopy with cytology examination for all advanced gastric cancer patients . Another critical problem is the lack of an accepted treatment protocol after diagnostic laparoscopy . We now have a multimodal therapy plan that includes neoadjuvant chemotherapy, neoadjuvant chemoradiotherapy and hipec . Therefore, the request for improvement in the accuracy of treatment has been met . In our study, we chose hipec and systemic chemotherapy to treat the patients with peritoneal dissemination or free cancer cells in the peritoneal lavage . Seven of the 10 patients showed a negative metastasis after this preoperative treatment and then underwent gastrectomy . Nakagawa et al . (17) reported that preoperative chemotherapy induced the downstaging of gastric cancer in 11 (61.1%) of the 18 patients in their study, with positive cytology from diagnostic laparoscopy . Several studies (17 - 19) used diagnostic laparoscopy as a staging procedure prior to considering patients for neoadjuvant chemotherapy or chemoradiation . The selection of patients, proper treatment regimens, combination treatments with or without intraperitoneal chemotherapy and the type of surgery after chemotherapy remain controversial . Cytoreductive surgery (crs) and hipec are indicated for gastric cancer with peritoneal disease that is completely or significantly resectable (20). Staging laparoscopy is very useful in detecting unsuspected peritoneal seeding and in differentiating between localized peritoneal seeding and disseminated carcinomatosis . In japan and korea, crs and hipec are used with palliative or curative intent and for prophylactic treatment in gastric cancer patients (21). However, the treatment of carcinomatosis from gastric cancer by peritonectomy and hipec has globally demonstrated worse long - term results than the treatment of peritoneal carcinomatosis from other cancers (22). Our preliminary data suggest that diagnostic laparoscopy is necessary for the clinical diagnosis of gastric cancer patients . Depth of tumor invasion and tumor - occupied portions of stomach are predictive factors of intra - abdominal metastasis . This work was supported by grants supporting the research program of early diagnosis, standardized treatment and therapy effect evaluation of gastric cancer (no.
Posttraumatic avascular necrosis (avn) of the scaphoid is a common complication probably due to the precarious blood supply . The rate of incidence is about 13% to 40% and almost all are seen in the proximal fragment [2, 3]. Careful review of the literature revealed six cases of distal avn in three studies [4, 5, 6]. The diagnosis of avn of the scaphoid is made by combining the mri findings with direct observation of the punctuate bleeding during the operation . However, the diagnosis of avn is suspicious in these cases, as mri investigation had been performed in one case and preoperative bleeding was observed in the other . Here, we report four new cases, all with the correlation of mri and punctuate bleeding . The series consisted of four patients aged 29, 33, 53 and 57 years . All had a history of scaphoid fracture following a fall on an outstretched hand 35 years ago, and all had been treated by casting before . Radiographic examination revealed suspected areas, such as sclerosis and/or cystic changes, on the distal pole of the scaphoid (figure 1) and mri views were identical with avn of the distal pole, showing hyperintense changes (figure 2). Tourniquet was deflated in order to observe punctuate bleeding; it was observed in three cases and the patients were treated by bone grafting and wire fixation (figure 3) in the remaining, there was no punctuate bleeding despite drilling and the scaphoid was excised and radial advancement osteotomy (figure 4) was performed . Treated by bone grafting and wire fixation . Scaphoid was excised and radial advancement osteotomy . All patients were evaluated by quick disabilities of shoulder, arm, and hand score 711 years after the operation by telephone interview . According to this score, 11 questions related to daily living posttraumatic avn of the scaphoid occurs as a result of impairment of the vascular supply to the involved bone fragment . Several studies had demonstrated a strikingly poor blood supply to the proximal pole, particularly in comparison with the abundant supply to the distal two - thirds of the scaphoid [1, 2]. Review of the literature revealed six cases in three reports [4, 5, 6]., avn in the distal fragment occurs if the volar vessel is damaged and the fracture line is distal to the line of entry of the dorsal vessels . Another explanation maybe the anomalous different vascularization of the distal pole [5, 6, 9]. The diagnosis of avn of the scaphoid was made by combining the mri findings with direct observation of the punctuate bleeding during the operation . However, there is no such approach in the previously described cases [4, 5, 6]. In the case of sherman et al ., mri was not available and there was no chance to observe bleeding, as the patients had refused surgical treatment . Similarly, in the case of the garg et al ., although mri suggested avn, the patient had been treated conservatively, so there was no chance for punctuate bleeding, and the fracture united . The diagnosis is also suspicious in this case as no correlation was possible and the fracture had healed . According to herbert, avn means irreversible necrosis or death of bone and healing is impossible . Only one case had been operated . In this case, the authors had confirmed avn by the pinning attempt that had failed . There seems no such method for the diagnosis of avn, so the diagnosis is again in doubt . In our opinion, all these cases should be labeled as suspected avn . In three of our cases, although preoperative mri suggested avn (figure 2), punctuate bleeding was observed during the operation and all were treated by pinning and grafting and healed uneventfully . In those cases, the appearance of avn was probably due to the normal marrow of bone that has not been established yet, but bleeding was observed due to revascularition . In the remaining case, mri suggested avn along with lack of punctuate bleeding and scaphoid was excised and radial advancement osteotomy was performed . In conclusion, all six cases reported before [4, 5, 6], and three of our cases that were treated by pinning and had healed, were not real avn or the diagnosis was doubtful . So our fourth case seems to be a unique case of distal pole avn of the scaphoid in the literature.
The diagnosis of rabies is not very difficult when associated with the classical features of excitations or phobias (aerophobia, hydrophobia). But it can be quite challenging when presented as acute flaccid paralysis (afp). We report here two cases of paralytic rabies who received four doses of postexposure (grade iii dog bite) vaccination without rabies immunoglobulin . Paralytic rabies occurring after postexposure antirabies vaccination creates a diagnostic dilemma as vaccine - induced gbs becomes a distinct possibility . A ten year - old boy presented with sudden weakness of both lower limbs for two days . He also had a history of fever, vomiting, and back pain for three days . His past history elicited an incident of an unprovoked bite by a street dog in his right hand (grade iii) three weeks back . Four doses of purified chick embryo cell (pcec) antirabies vaccine were administered according to schedule in the deltoid, starting from the day of the bite . The patient had complained of back pain, but there was no typical history of pain, tingling, numbness at the site of the bite, hydrophobia, or behavioral changes . His temperature was 39.5c, pulse rate was 110/min, blood pressure 100/70 mm hg, respiratory rate 30/min, and spo2 96% . Neurological examination detected grossly reduced muscle tone and power (lower limb 2/5, upper limb 3/5) with areflexia (both superficial and deep tendon reflexes were absent) in all four limbs and the trunk along with urinary incontinence . The failure to administer rig after the grade iii bite favored a provisional diagnosis of paralytic rabies was made even though the classical symptoms of rabies were absent . Although rare with the modern cell culture vaccines, the possibility of vaccine - induced gbs was also considered . Laboratory investigations showed hemoglobin: 11.5 g / dl, white cell count: 70000/cu.mm (neutrophil: 58%, lymphocyte: 40%, eosinophil: 2%), platelet count: 1,90000/cu.mm . Cerebrospinal fluid analysis showed cell count: 10/cu.mm (all lymphocytes), protein: 50 mg / dl, and sugar: 80 mg / dl (no albumino - cytological dissociation). The electrophysiological test designed to identify features of demyelination (slowing of nerve conduction velocity with marked prolongation of distal latencies and occasional conduction block), was inconclusive . Serum electrolytes were normal na: 136 meq / l, k: 5 meq / l . Liver function, renal function tests, and repeat csf examination on the 7 day were unremarkable . Conservative management was started but rapid progression of paralysis occurred over the next two days . Intravenous immunoglobulin (2 g / kg / total dose) was given over 12 hours for the sake of caution, but there was no improvement and the patient succumbed on the 10 day of onset of the disease . Due to inadequate stool collection by the afp surveillance worker, all the documents were sent to the national expert committee (national polio surveillance project) as a special case . They classified the case as being nonpolio and as paralytic rabies . A six year - old girl presented with sudden onset of quadriparesis for one day, preceded by fever, myalgia, and vomiting for four days . There was also a history of a dog bite in her right upper arm (grade iii bite) three weeks back . The child was given the pcec vaccine as per schedule in the deltoid and received a total of four doses before the development of any symptoms . The patient was treated conservatively, but the clinical features and the progression of disease was similar to the first case, except for the presence of myoedema, a striking feature of rabies . In spite of good supportive measures, she expired on the 12 day of disease onset . Results of laboratory investigations on the 11 day of the illness were also quite similar to the first case . Neutralizing antibodies to rabies virus were detected in both serum and csf by the rapid fluorescent focus inhibition test (rffit). A ten year - old boy presented with sudden weakness of both lower limbs for two days . He also had a history of fever, vomiting, and back pain for three days . His past history elicited an incident of an unprovoked bite by a street dog in his right hand (grade iii) three weeks back . Four doses of purified chick embryo cell (pcec) antirabies vaccine were administered according to schedule in the deltoid, starting from the day of the bite . The patient had complained of back pain, but there was no typical history of pain, tingling, numbness at the site of the bite, hydrophobia, or behavioral changes . His temperature was 39.5c, pulse rate was 110/min, blood pressure 100/70 mm hg, respiratory rate 30/min, and spo2 96% . Neurological examination detected grossly reduced muscle tone and power (lower limb 2/5, upper limb 3/5) with areflexia (both superficial and deep tendon reflexes were absent) in all four limbs and the trunk along with urinary incontinence . The failure to administer rig after the grade iii bite favored a provisional diagnosis of paralytic rabies was made even though the classical symptoms of rabies were absent . Although rare with the modern cell culture vaccines, the possibility of vaccine - induced gbs was also considered . Laboratory investigations showed hemoglobin: 11.5 g / dl, white cell count: 70000/cu.mm (neutrophil: 58%, lymphocyte: 40%, eosinophil: 2%), platelet count: 1,90000/cu.mm . Cerebrospinal fluid analysis showed cell count: 10/cu.mm (all lymphocytes), protein: 50 mg / dl, and sugar: 80 mg / dl (no albumino - cytological dissociation). The electrophysiological test designed to identify features of demyelination (slowing of nerve conduction velocity with marked prolongation of distal latencies and occasional conduction block), was inconclusive . Serum electrolytes were normal na: 136 meq / l, k: 5 meq / l . Liver function, renal function tests, and repeat csf examination on the 7 day were unremarkable . Conservative management was started but rapid progression of paralysis occurred over the next two days . Intravenous immunoglobulin (2 g / kg / total dose) was given over 12 hours for the sake of caution, but there was no improvement and the patient succumbed on the 10 day of onset of the disease . Due to inadequate stool collection by the afp surveillance worker, all the documents were sent to the national expert committee (national polio surveillance project) as a special case . A six year - old girl presented with sudden onset of quadriparesis for one day, preceded by fever, myalgia, and vomiting for four days . There was also a history of a dog bite in her right upper arm (grade iii bite) three weeks back . The child was given the pcec vaccine as per schedule in the deltoid and received a total of four doses before the development of any symptoms . The patient was treated conservatively, but the clinical features and the progression of disease was similar to the first case, except for the presence of myoedema, a striking feature of rabies . In spite of good supportive measures, she expired on the 12 day of disease onset . Results of laboratory investigations on the 11 day of the illness were also quite similar to the first case . Neutralizing antibodies to rabies virus were detected in both serum and csf by the rapid fluorescent focus inhibition test (rffit). There are two forms of human rabies: i) the well - known encephalitic (furious) and ii) the paralytic (dumb) rabies . The encephalitic form starts with fever, malaise, pharyngitis, and paraesthesia at the site of the bite followed by the classical neurological symptoms of hydrophobia, aerophobia, agitation, hypersalivation, and seizures . This is followed by paralysis and coma; death is usually due to respiratory failure . The second clinical form of rabies, paralytic (dumb) or guillain - barr - like, is characterized by progressive paralysis without an initial furious phase . Even though the paralytic rabies is unfamiliar to health care providers, 2030% of rabies victims present in this manner . Paralytic rabies is more common after rabid vampire bat bites and in persons who have received postexposure vaccination . Distinction of paralytic rabies from gbs may be difficult, although individuals with gbs usually do not have urinary incontinence, which is common in rabies . In our two cases, fever at the onset of disease, the absence of albumin - cytological dissociation, even repeat csf examination and persistent urinary incontinence was against the diagnosis of vaccine - induced gbs . Different sites of neural involvement and possibly different neuropathogenetic mechanisms may explain the clinical diversity in human rabies . It is unclear whether weakness results from the involvement of anterior horn cells or of motor nerve fibers . Most likely, peripheral nerve dysfunction, due to demyelination, contributes to the weakness seen in paralytic rabies . On the other hand, progressive focal denervation starting at the bitten segment, was evident in furious rabies, even in the absence of demonstrable weakness . Intense inflammation of the spinal nerve roots was observed to a greater extent in paralytic rabies patients . Inflammation was mainly noted in the spinal cord segment corresponding to the bite in all cases . However, central chromatolysis of the anterior horn cells could be demonstrated only in furious rabies patient . In both patients, ncv findings revealed features of demyelination which may occur in paralytic rabies as well as in gbs . Studies conducted in the us by the center for disease control and prevention (cdc) have documented that a regimen of one dose of rig and five doses of the human diploid cell culture vaccine (hdcv) over a period of 28 days was safe and induced an excellent antibody response in all recipients . Clinical trials with rabies vaccine adsorbed (rva) and purified chick embryo cell (pcec) vaccine have also demonstrated immunogenicity equivalent to that of hdcv . Many individuals did not receive immunoglobulin where indicated and some of them received the vaccine in the gluteal region instead of in the deltoid . Although both of our patients had grade iii dog bite for which rig is strongly recommended, they only received the vaccine in the deltoid region without rig . Neurological reactions following newer vaccine administration have been extremely rare . After millions of vaccinations worldwide, three guillain - barr type paralytic reactions have been described, and all cases recovered completely . If our patients had vaccine - induced gbs, definitely they were improved by good supportive measures . During the early stages of paralytic rabies, notable signs include myoedema, particularly in the region of the chest, deltoid muscles, and thighs . However, this phenomenon, a brief, unpropagated, localized muscle contraction that appears in response to percussion with a tendon hammer, is not a confirmatory sign of paralytic rabies but was present in our 2 case . If there is an inadequate stool sample with residual paralysis, death of the patient, or loss to follow - up at the time of afp surveillance, the case is referred to the national expert committee (national polio surveillance project) review for final classification as nonpolio afp or compatible with poliomyelitis . In our first case, there was inadequate stool sampling, so it was reviewed by the expert committee and declared to be paralytic rabies.
Hd begins gradually with mood disturbances, increasing involuntary movements (chorea), and cognitive impairment, finally leading to dystonia and severe dementia . The first symptoms typically appear in mid -life (late fourth and fifth decade); however, there are also juvenile and late - onset cases . Within 15 to 20 years after its onset mood abnormalities often start appearing a few years before movement dysfunction, which comprises both involuntary as well as impaired voluntary movements . Chorea is observed in -90% of all hd patients and increases during the first 10 years of the illness, while dystonia is infrequent in the early symptomatic period but becomes prominent at the late stages of the illness . Hd is classified into five pathological grades, ranging from microscopically undetectable abnormalities of patient brains to extensive atrophy . All grades exhibit a loss of brain weight (up to 30%) resulting from neuronal cell death . The extent of neuronal cell death is directly related to the severity of disease . In the basal ganglia, the specific progressive atrophy in these brain regions is associated with reactive astrocytosis . Within the striatum there is selective loss of medium spiny g aba (y - arninobutyric acid)-ergic neurons, which project into the pallidum forming the indirect striatopallidal pathway . In addition to atrophy in the striatum, extensive neuronal cell loss also occurs in the deep layers of the cerebral cortex, white matter, hippocampus, amygdala, and thalamus . The human hd gene is located in the chromosomal region 4pl6.3 and was isolated by positional cloning approaches . It contains 67 exons and encodes the huntingtin protein of 3144 residues with a molecular mass of about 350 kd . The mutation underlying hd is an unstable cag trinucleotide repeat expansion in the first exon of the gene . It ranges from 6 to 37 units in healthy individuals, and 38 to 180 units in hd patients.- the cag repeat is translated into a polyglutamine stretch, which is conserved in vertebrates, containing 7 glutamines in the mouse and only 4 in the puffer fish, but is absent from the drosophila protein . The predicted huntingtin protein sequence is highly conserved between human, mouse, and puffer fish, but shows no significant homology with other proteins in databases . The only functional motives that have been discovered are a putative leucine zipper and a heat repeat . Heat repeats consist of two hydrophobic a - helices and were found in proteins involved in cellular transport processes . We have found that the huntingtin interacting protein- 1 (hip1) associates with the heat repeat . However, whether this sequence motive is essential for protein - protein interaction remains to be determined . Hip1 has been identified using the yeast two - hybrid system . The predicted amino acid sequence of hip1 exhibits significant similarity to cytoskeleton proteins, suggesting that hip1 and the huntingtin protein play a functional role in the cell filament networks and/or vesicle trafficking . For example, hip1 is homologous to the yeast protein sla2p, which associates with the membrane cytoskeleton and plays a functional role in endocytosis . Recently, colocalization of hip1 and huntingtin with clathrin - coated vesicles in mammalian cells has been described, suggesting that both proteins also play a functional role in endocytosis in higher eukaryotes ., this hypothesis is substantiated by the finding that huntingtin and its associated protein, huntingtin - associated protein-1 (hap1), are transported along microtubules in axons . Furthermore, direct binding of hap1 with pl50glued of the dynactin complex, which is critical for retrograde movement of vesicles along microtubules, has been described . Together these findings indicate that a protein complex consisting of the proteins hip1, hap1, and huntingtin is functionally involved in endocytosis and retrograde transport of clathrin - coated vesicles along microtubules . However, additional cell biology and biochemical studies will be necessary to address this hypothesis in more detail . Using the yeast two - hybrid system we have also demonstrated that the sh3-containing grb2-like protein sh3gl3 associates with huntingtin . This protein is preferentially expressed in brain and testis and selectively interacts with the proline - rich region in huntingtin, which is located immediately downstream of the polyglutamine tract . The sh3gl3 protein, as well as its homologous proteins sh3gl1 and sh3gl2, belongs to a novel sh3-containing protein family . Members of this family contain the sh3 domain at the c - terminus that is evolutionarily conserved and drives protein - protein interactions through proline - rich ligands . In the central nervous system, these proteins play a major role in the signal transduction from membrane receptors and the regulation of the exocytic / endocytic cycle of synaptic vesicles . Thus, enhanced binding of sh3gl3 to huntingtin with a polyglutamine sequence in the pathological range (eg, 50 glutamines) could result in dysregulation of the endocytic / exocytic cycle in mammalian cells . In order to address the functional role of huntingtin, hip1, and sh3gl3 in synaptic vesicle transport in more detail, the homologous mouse genes were mapped and cloned.- the generation of hip1 and sh3gl3 knockout as well as transgenic animal models will help elucidate the normal function of huntingtin and may also help to understand the key steps in the pathogenesis of hd . In order to study the effect of an elongated polyglutamine sequence on neuronal dysfunction and neurodegeneration in vivo, mangiarini et al generated the first hd transgenic mice . In these animals, exon 1 of the human hd gene carrying a cag repeat of 115 to 156 units was expressed under the control of the hd promoter . Strikingly, expression of the mutant huntingtin fragment resulted in the development of a progressive neurological phenotype very similar to hd, including tremor, epileptic seizures, involuntary movements, and cell loss . This indicates that expression of a truncated huntingtin fragment with a polyglutamine sequence in the pathological range is sufficient for the development of a neurological phenotype with characteristic features of hd . Davies et al observed that these transgenic animals developed pronounced neuronal intranuclear inclusions (nils) containing huntingtin and ubiquitin prior to the development of the neurological phenotype, indicating that formation of nils is a prerequisite for the development of neuronal dysfunction in hd . Within the last few years, several other laboratories have confirmed the appearance of nils using different transgenic mouse models of hd.- full - length huntingtin protein as well as truncated versions of the protein with a polyglutamine sequence in the pathological range (40 - 150 glutamines) were expressed in mice under the control of different promoters . The majority of these studies suggest that the formation of nils is correlated with the appearance of progressive neuronal dysfunction and toxicity . Thus, it is reasonable to assume that reduction of inclusion body formation and huntingtin aggregation may have a beneficial effect on disease progression in hd patients . Using a conditional mouse model of hd, yamamoto et al demonstrated that blocking the expression of mutant huntingtin protein in neurons resulted in the disappearance of inclusions and the behavioral phenotype . Therefore, reduction of hd protein expression in patients and/or stimulation of natural clearance mechanisms could be effective therapeutic strategies for hd . Apart from nils, inclusion bodies with aggregated huntingtin protein were recently detected in axons and axon terminals of striatal neurons . The formation of these aggregates is likely to affect specific neuronal functions such as axonal transport and neurotransmitter release or uptake in axon terminals . Therefore, the deposition of mutant huntingtin protein in the terminals of striatal neurons, which are affected most in hd, may contribute to the selective neuropathology of hd . After the discovery of nils in brains of transgenic animals, similar structures were detected in postmortem brains of hd patients . Immunohistochemical studies showed that they are most abundant in the striatum and the cerebral cortex, the areas most affected by hd . In the striatum, inclusions were found in the medium spiny neurons that are selectively lost during hd . Nils in patient brains are detected by antibodies directed against the n - terminus of huntingtin, but not by antibodies that recognize the c - terminus of the protein, indicating that a truncated n - terminal huntingtin fragment rather than the full - length protein is present in the nils of patients . Like the nils in transgenic animals, these results suggest that the truncated huntingtin protein present in the inclusion bodies is ubiquitinated but cannot be degraded by the proteasome system . Ultrastructural studies revealed that nils in patient brains contain aggregated huntingtin protein with a fibrillar and granular morphology . It remains unclear to date whether the formation of nils, dystrophic neurites, or neuropil aggregates is the cause or merely a consequence of neurodegenerative disorders . Using neuronal cell culture model systems and transgenic animals, saudou et al and klement et al presented evidence that the formation of inclusion bodies could be nontoxic or even beneficial to neuronal cells . They showed that overexpression of disease proteins with a polyglutamine sequence in the pathological range is toxic for neuronal cells, but inclusion formation does not contribute to toxicity . However, using cell culture as well as transgenic animal model systems in the presence of more physiological amounts of mutant huntingtin, cell death was observed only after fibrillar structures had formed . We therefore propose that formation of aggregates and subsequently of inclusion bodies is a key step in the development of late - onset progressive neurodegenerative disorders . We have developed a number of in vitro and in vivo strategies to address this issue, the creation of a drug screen assay being one of them . We found that hd exon 1 protein fragments with polyglutamine tracts in the pathological range (> 37 glutamines), but not with a polyglutamine tract in the normal range (20 - 32 glutamines), form high - molecular - weight protein aggregates ., electron micrographs of these aggregates revealed a characteristic fibrillar or ribbon - like morphology, reminiscent of scrapie prion rods and the -amyloid fibrils found in alzheimer's disease . The fibrillar structures are thought to result from the polyglutamine sequences acting as polar zippers . Perutz proposed that expansion of polyglutamine repeats beyond a critical length of 41 glutamines may lead to a phase change from random coils to hydrogen - bonded hairpins that self - assemble into insoluble protein aggregates . Our in vitro experiments with glutathione s- transferase (gst)-hd exon 1 fusion proteins support this hypothesis, suggesting that the structural transition caused by expansion and required for aggregate formation occurs between 32 to 37 glutamines . Polyglutamine tracts with 37 or more glutamines readily self - assemble into insoluble protein aggregates, whereas polyglutamine tracts with less than 32 glutamines did not show any evidence of fibril formation . Interestingly, it has been shown that the pathological range of the polyglutamine sequence in hd is between 38 to 41 glutamines, with no hd case reported with fewer than 38 glutamines, nor any individual with more than 41 glutamines having remained unafflicted by hd . The threshold for the formation of insoluble huntingtin fibrils in vitro is remarkably similar to the pathological threshold in hd . Jarrett and lansbury proposed that the self - assembly of -amyloids into fibrillar structures in alzheimer's disease occurs by a nucleation - dependent mechanism . We found that the formation of amyloid -like huntingtin fibrils in vitro and in vivo critically depends on polyglutamine repeat length, protein concentration, and time . Furthermore, huntingtin aggregation can be seeded by preformed fibrils, suggesting that fibrillogenesis in hd, as in alzheimer's disease, is caused by nucleation - dependent polymerization . Our findings that the assembly of huntingtin aggregates requires the formation of a nucleus and is time- and protein concentration - dependent may account for the late onset and progressive phenotype in hd . Although fibril formation occurs within hours in the in vitro system, it may take years in neuronal cells of hd patients . The concentration of mutant huntingtin in medium spiny neurons, which are affected most in hd, is unknown, but it is likely to be much lower than that used in the in vitro aggregation assays . Thus, we suggest that the lag time during which huntingtin dinners, trimers, and oligomers are formed in vivo is significantly elongated in hd patients . For the identification of huntingtin aggregation inhibitors, we have developed a rapid and sensitive filter retardation assay, which is suitable for the highthroughput screening of drugs that prevent aggregate formation . This assay is based on the finding that hd exon 1 aggregates are insoluble in sodium dodecyl sulfate (sds) and are retained on a cellulose acetate filter, whereas monomelic forms of the hd exon 1 protein do not bind to this filter membrane . The captured aggregates are then detected by simple immunoblot analysis using a specific anti - huntingtin antibody . Using the filter retardation assay, we first tested a number of known inhibitors of -amyloid, prp, and microtubule fibril formation for their effect on huntingtin aggregation in vitro . We found that congo red, thioflavine s, chrysamine g, and direct fast yellow inhibited hd exon 1 protein aggregation in a dose - dependent manner, whereas other potential inhibitors of -amyloid formation, such as thioflavine t, gossypol, melatonin, and rifampicin, had little or no effect on huntingtin aggregation . Furthermore, we found that the monoclonal antibody 1c2, which specifically recognizes the elongated polyglutamine stretch in huntingtin, and the heat shock proteins hsp70 and hsp40 are potent inhibitors of huntingtin aggregation ., interestingly, the addition of heat shock proteins to in vitro aggregation reactions shifts the self - association pathway of huntingtin from fibrillar to amorphous aggregation . This suggests that in vivo chaperones may have the potential to transform toxic fibrillar aggregates into nontoxic aggregates, which can then be degraded by the ubiquitin / proteasome system . Thus, small molecules that activate a heat shock response in neurons may be effective in delaying the onset and progression of hd . However, additional research using in vitro and in vivo model systems will be required to show whether an increase in chaperone levels in neurons is a viable therapeutic strategy . Drugs that bind to the mutant huntingtin protein should delay the onset and progression of hd . The future challenge will be to find small chemical compounds that have reasonable brain permeability, and per se are nontoxic to neuronal cells . In order to find such compounds, we have performed high - throughput screening using an automated filter retardation assay . Within the last year we have tested more then 180 000 different chemical compounds and identified about 700 small molecules that prevent huntingtin aggregation in vitro . We were able to reduce aggregate formation in mammalian cells; as a consequence, cytotoxicity was lowered . This is a very important finding, because it shows for the first time that there is a direct link between the process of aggregate formation and disease . The next challenge will be to test these substances in transgenic animals for their ability to cross the blood - brain barrier, to dissolve neuronal inclusions or prevent their formation, and to reduce neurodegenerative symptoms . Since the identification of the gene for huntington's chorea in 1993, this would represent a major milestone in hd research and also in molecular medicine generally, because for the first time a causal therapy for an inherited disease would be within reach . It would also have positive implications for functional genomics, because it would be the first time the strategy of finding a gene with a positional cloning approach and subsequent functional analysis and characterization of the pathogenetic mechanism had been able to lead to a causal therapy of an illness.
During 20002010 in chobe district, botswana, we performed 38 necropsies on macroscopically tb - positive mongooses, of which 18 were further evaluated and tb was confirmed by histopathologic examination . An in - depth histologic evaluation was performed on a subsample of 8 of these animals from the 2008 outbreak . The most striking feature identified in the sick mongooses was anorexia, followed by nasal distortion and, less commonly, erosions of the nasal planum with involvement of the hard palate . For 7 of the 8 tb - positive animals examined intensively, histologic examination detected unequivocal tb lesions in the skin of the nose and the anterior nasal mucosa . Our findings suggested entry of the organism through erosions on the nasal planum, perhaps in association with abrasions, which might occur during foraging . Such lesions were present in the hairless parts of the nose tip of most tb - infected mongooses . Furthermore, granulomatous inflammation and mycobacterial organisms were found in the dermis of the skin directly below these erosions . Inflammation and organisms were present in some cases in the nasal mucosa, but erosion was not found . This finding is consistent with pneumonic tb being present in only a few advanced cases of disseminated tb . Histologically, the tb pneumonia was determined to be hematogenous rather than bronchogenous (i.e., by inhalation); thus, no evidence for aerosol transmission was found . Rather, pathogen invasion appears to have occurred through the nasal planum of the mongoose, and hematogenous or lymphatic spread through the body was a strikingly unique feature of this particular m. tuberculosis complex organism . Samples from histologically positive mongooses were positive by pcr for the mpb70 target, is6110 element, and 16s rdna, indicating that the infective organism was a member of the m. tuberculosis complex (3,4). Samples were further evaluated with an m. tuberculosis complex specific multiplex pcr (5), which provided distinct results, differing clearly from those for other members of the m. tuberculosis complex (table 1). * determined by pcr amplification (5). Rd, region of difference; rd1, m. bovis bcg specific rd1; rd1, m. microti specific rd1; rd2, m. pinnipedii specific rd2; p, present; a, absent . The gyrb gene (encoding for gyrase b) sequence, used to identify m. tuberculosis complex member specific sequence single - nucleotide polymorphisms (snps) (6), identified the position of the organism as being situated between dassie bacillus and m. africanum subtype 1(a) and showed no detectable new snps (figure 2, panel a). Amplification of rd701 and rd702 and lack of snps in rpob and hsp65 genes demonstrated that this organism was not a member of the m. africanum subtype 1(a) sublineage (6,11) (figure 2, panel a). A) schematic of the phylogenetic relationships among mycobacterium tuberculosis complex species, including newly discovered m. mungi, based on the presence or absence of regions of difference (gray boxes) as well as specific single - nucleotide polymorphisms (white boxes), modified from (7). B) spoligotype of m. mungi compared with representative spoligotypes from other m. tuberculosis complex species (810). Three markers were evaluated to definitively exclude the organism from being dassie bacillus: n - rd25 deletion, rd1 deletion, and snp 389 in the gene rv0911 (6). The n - rd25 amplification gave the right product for the presence of a deletion in this region, and further sequencing confirmed that it contained a deletion in the same position as n - rd25; however, sequencing of rv0911 showed no snp at position 389, indicating that this organism was not dassie bacillus . As a final test, we amplified the rd1 region but were unable to amplify a product from the mongoose isolates . We redesigned primers to amplify a smaller region of different diagnostic sizes (248 bp when rd1 is deleted and 318 bp when rd1 is intact) but still had no amplification . This finding indicates that the rd1 region is deleted in this organism but that the deletion is larger than that of the dassie bacillus . We then used spoligotyping analysis (12) to further evaluate mongoose samples and identified a unique spoligotype pattern with no known matches in the international spoligotyping database spoldb4 (9) or the m. bovis this pattern was constant during 20002009 in different mongoose troops and locations (table a1). This unique spoligotyping pattern will enable identification of m. mungi in future tb surveillance programs . For these same isolates, the full set of 24 mycobacterial interspersed repetitive unit variable number tandem repeats (13) identified a pattern that was unique compared with others in the international database at www.miru-vntrplus.org (table 2). Evidence of multiple m. mungi substrains circulating between years and within social groups (6601b and 6600b) in the same outbreak year (table 2) suggests complexity in m. mungi transmission and potential evolution of the organism over the past decade . * miru, mycobacterial interspersed repetitive unit; vntr, variable number tandem repeats; db, dassie bacillus; m. a., m. africanum; ob, oryx bacillus; m. p., m. pinnipedii; m. t., m. tuberculosis;, not applicable . Gray shading highlights differences between the mycobacterium tuberculosis complex species and m. mungi as well as variation within m. mungi samples evaluated . M. africanum west african 2 strain 8163/02 (st181), m. microti strain 287/99 (st539), m. pinnipedii strain 7739/01, m. caprae strain 5358/99 (st647), and m. bovis strain 8490/00 (st482) data from www.miru-venterplus.org . This newly identified mycobacterial pathogen has many unique ecologic characteristics that set it apart from other members of the m. tuberculosis complex . First, it causes high numbers of deaths of banded mongooses, threatening local extinction of smaller social groups . Second, rather than having a primary respiratory transmission route with direct transmission between individuals, as is characteristic of other m. tuberculosis complex species, m. mungi appears to infect banded mongooses by means of a nonrespiratory route through the nasal planum, suggestive of environmental transmission . Third, the time from clinical presentation to death for affected mongooses is generally short (23 months) compared with that for other m. tuberculosis complex pathogens (more chronic infection, can take years to progress to death). Acute illness and high mortality rates, as seen in banded mongooses with m. mungi infection, have been associated with extremely isolated human communities newly exposed to tb (14). Conventional laboratory culture, biochemical testing, and a limited molecular evaluation were insufficient for differentiating m. mungi from m. tuberculosis (2). Organism differentiation required an extensive suite of additional molecular assessments not available at that time, thus underscoring the difficulty of diagnosing m. tuberculosis complex agents correctly and the inability of most national health laboratories to do so . The fact that new host - adapted m. tuberculosis complex species continue to be identified illustrates the diversity within the m. tuberculosis complex and stresses the need for sensitive techniques for species differentiation . The identification of this previously unknown pathogen within the m. tuberculosis complex identifies new concerns for human and animal health and illustrates the continuing scope of the threat posed by tb pathogens.
The most commonly used materials for bone implants are metals (such as titanium, ti) and polymers (such as ultra high molecular weight polyethylene). Numerous problems exist with these implants such as (i) insufficient prolonged bonding between the implanted material and juxtaposed bone (kaplan et al 1994a, 1994b; buser et al 1999; webster 2001), (ii) different mechanical properties between bone and the implant leading to stress shielding (kaplan et al 1994a, 1994b; webster 2001), and (iii) wear debris generated at articulating surfaces of orthopedic implants that may lead to cell death (kaplan et al 1994a, 1994b). It has been speculated that nano - structured materials can increase orthopedic implant efficacy since it is well known that the nanometer scale is the length scale that most of the body s natural materials possess . For example, hydroxyapatite, the major inorganic component of bone, exists predominantly as platelet - or rod - shape crystals about 25 nm in width and 50 nm in length . Type i collagen, the major organic component of bone, has fibrils 300 nm in length, 0.5 nm in width, and has a periodicity of 67 nm (park and lakes 1992). Therefore, it is reasonable to consider that osteoblasts (or bone - forming cells) will be more accustomed to nano - structured surfaces compared to currently used nano - smooth implant surfaces . Such problems with promoting new bone growth next to implant surfaces are made only more complex for patients with bone cancer (both primary bone cancer and metastasized bone cancers). For example, it is estimated that 2,380 people will be diagnosed with bone and joint cancers and 1,470 people will die from primary bone and joint cancers in 2008 in the us (american cancer society 2008). Primary bone cancer is rare but bone cancer as a result of the metastasis from other organs (such as the lungs, breasts and the prostate) is very common (miller and webster 2007). Thus, the number of patients affiliated with bone cancer is much higher when considering the statistics of cancer metastasis . For these reasons, the main goal of this study was to introduce a new biomaterial naturally found in the human body that has chemopreventive properties for orthopedic implants: elemental selenium . The first goal in this effort was to create nano - structured roughness on such materials and to determine bone cell responses on such nano - structured selenium materials . Selenium shots (amorphous, metals basis, spherical and/or semi - spherical 24 mm in diameter; alfa asear, ward hill, ma) were pressed into cylindrical compacts (0.635 cm radius and 0.2 cm thickness) at 1000 psi for 2 minutes using a uniaxial compacting hydraulic press (carver, inc ., the compacts were then chemically treated with 1n naoh for either 10 or 30 min . After etching, selenium compacts were washed with excessive deionized water to remove the naoh that remained on the selenium compacts . Surfaces of untreated selenium compacts as well as selenium compacts treated with 1n naoh for 10 and 30 min were visualized (without a conductive coating) using a scanning electron microscope (sem, leo 1530vp fe-4800) with an accelerating voltage from 3 to 10 kv . Energy dispersive x - ray spectroscopy (eds, leo 1530) was used to determine the surface chemistry of the compacts . To investigate osteoblast adhesion on selenium compacts, human osteoblast - like cells (bone - forming cells; crl-11372 american type of culture collection, population numbers 1415) in dulbecco s modified eagle media supplemented with 10% fetal bovine serum (hyclone) and 1% penicillin / streptomycin (hyclone) were seeded at a density of 3500 cells / cm and placed in an incubator under standard cell culture conditions (37c, 5% co2, 95% humidified air) for 24 h. importantly, this is an immortalized cell line which has been used widely in experiments involving orthopedic applications since previous studies have demonstrated that when cultured under similar conditions as described in the present study, these cells secrete bone - related proteins and deposit calcium containing mineral (miller and webster 2007). Louis, mo), stained with 4,6-diamidino-2-phenylindole (dapi) (sigma) and counted under fluorescence microscopy (zeiss axiovert 200 m light microscope) in five random fields which were averaged for each compact . Data were collected and statistical comparisons were assessed using a one - tailed student t - test . The sem images of the selenium compacts (untreated and treated with naoh for different time periods) revealed various surface roughness . Untreated surfaces (figure 1 image a) possessed mostly micron rough surface features while those treated with 1n naoh for different time periods created submicron (figure 1 image b) and nano - rough (figure 1 image c) surface features on selenium . In particular, biologically inspired surface roughness increased with increasing naoh treatment time periods . As the etchant, naoh is believed to dissolve the oxide layer on the surface of the selenium compacts creating submicron and nanometer features at increasing times . Chemical etching is a very common, inexpensive, and simple method used to modify the surface properties (eg, topography, chemistry, roughness, wettability, etc .) Of biomaterials . Chemical etching can be used for a wide range of biomaterials from metals, ceramics, to polymers . For example, etching titanium with hcl followed by naoh has led to the formation of uniform micrometer featured surfaces that increased the formation of hydroxycarbonated apatite when exposed to a simulated body fluid (jonasova et al 2004). Moreover, etching poly (lactic - co - glycolic acid) (plga) films using naoh has created biologically inspired nanometer surface feature dimensions to promote the functions of numerous cells . For example, this nanometer plga structured surface was shown to promote bladder smooth muscle cell functions compared to conventional, micrometer - structured plga after 1, 3, and 5 days of culture (thapa et al 2003). In addition, feldspathic porcelain etched in 5% hydrofluoric acid was shown to promote the bonding strength between orthodontic brackets and ceramic crowns when compared to those treated by mechanical roughening with fine diamond burs or sandblasting (schmage et al 2003). Clearly, chemical etching can be an inexpensive effective way to transform nano - smooth surfaces into nano - rough surfaces for a wide range of materials to promote their biological performance . Importantly, eds profiles of the compacts used in the present study revealed that the chemistry of the selenium compacts remained unaffected after treatment in 1n naoh (figure 2). Moreover, table 1 lists the weight percentages of selenium and sodium for each compact . The results showed trace amounts of sodium on the surfaces of selenium compacts treated with 1n naoh . This indicated that chemical etching (ie, using 1n naoh for up to 30 min) only changed the surface roughness, not the surface chemistry of the selenium compacts . The ability to change an implant s surface roughness and/or topography without altering its chemistry is of great interest since, when fabricating implant materials, it is crucial not to induce any potential harmful chemistry changes . In this study, selenium compact chemistry remained unaltered after treatment with 1n naoh for up to 30 min . When these substrates were used as substrates for culturing osteoblasts, after 1 day, significantly increased cell densities were observed on the increasing nano - rough surfaces (ie, compacts treated with 1n naoh for 10 and 30 min) (figures 3, 4). Especially, the compacts treated with 1n naoh for 30 min, which had the largest amount of nanometer surface features, had the highest osteoblast density . However, although closer, these selenium compacts (ie, compacts treated with 1n naoh for 30 min) had osteoblast densities lower than that of titanium . Future studies will need to utilize greater times and/or concentrations of naoh etching to determine if osteoblast adhesion can be matched between selenium and titanium . Moreover, future studies will need to examine primary osteoblast cells (since that was not accomplished here) as well as the multitude of cancerous cells that can cause bone cancer . It has been shown that increased nanometer surface roughness promotes osteoblast functions (from adhesion to the deposition of calcium containing mineral) (webster et al 1999, 2000a, 2000b; webster 2001; webster and ejiofor 2004). The results of this study showed a similar trend of increased healthy osteoblast densities after 1 day of culture on selenium with increased nanometer surface roughness . The significance of these results is also the introduction of a new chemistry to the orthopedic community particularly geared at inhibiting bone cancer regrowth: selenium . Selenium has been shown to have chemo - preventive effects in numerous reports (combs and combs 1986; clark et al 1991, 1998; combs and gray 1998; navarro - alarcon and lopez - martinez 2000; zhuo et al 2004; wei et al 2004). However, the mechanisms of selenium - based chemoprevention are complex and incompletely understood (combs 2001). By imparting nano features onto selenium compacts, the objective of this study was to create a material that promotes healthy osteoblast functions since evidence has already been provided concerning its role in inhibiting cancer growth . In the present study, healthy osteoblast adhesion was shown to be enhanced on nano - rough selenium compacts when compared to micro - rough selenium compacts . However, it has been shown that nano - roughness effectively increased the initial absorption of proteins (such as fibronectin and vitronectin) which mediate subsequent cell adhesion (webster et al 2000b, 2001; khang et al 2007). In particular, particle boundaries on other material (ti, ti6al4v, and cocrmo) surfaces were shown to be active regions for such protein adsorption (webster and ejiofor 2004). Nano - structured surfaces clearly offer more particle boundaries when compared to micron - structured surfaces for promoting initial protein adsorption events . In another recent study, elemental selenium nanoclusters were coated on conventional titanium substrates to create nano - structured surfaces . These surfaces were shown to promote healthy osteoblast functions after 1 day of culture and, importantly, inhibit cancerous osteoblast cell functions after 3 days of culture (sarin et al 2008). In the present study, nano - structured selenium surfaces were created by a different method: chemically etching selenium bulk compacts . The approach used in this study is simpler than the coating method used (which involved selenium chemical precipitation) and can eliminate the influence of titanium in the interaction with osteoblasts since selenium coatings in that previous study did not completely cover the underlying titanium . However, considering the toxicity of selenium at high levels (whanger et al 1996), the use of selenium compacts may be problematic concerning how much selenium is exposed to the body leading to possible toxic effects . Future studies need to clearly investigate this possible toxicity as well as cancerous bone cell functions on these selenium compacts . This study provided techniques to create nano - structured roughness without altering chemistry on selenium compacts for anti - cancer orthopedic applications . Since previous studies have shown greater osteoblast functions on nano - structured compared to conventional ceramics, metals, polymers, and composites, the ability to create nano - structured roughness on selenium compacts is promising for increasing bone cell functions, while inhibiting the return of bone cancer.
Schistosomiasis is a parasitic disease caused by the digenetic trematodes of the genus schistosoma members which are commonly known as blood flukes . Schistosoma haematobium was discovered by theodore bilharz in 1851 during autopsy at kasr el ainy hospital . In 1915, schistosomiasis comes after malaria among parasitic diseases as regards the number of people infected and those at risk of infection . There are two major forms of schistosomiasis intestinal and urogenital - caused by five species of the parasite . Intestinal schistosomiasis is caused by four species namely: schistosoma mansoni (s.mansoni), s. japonicum, s. mekongi and s. intercalatum . S. mansoni is the most prevalent species being endemic in 55 countries e.g. Arab peninsula, egypt, libya, sudan, sub - saharan africa, brazil, some caribbean islands, suriname and venzuela . S. japonicum is endemic in china, indonesia and the philippines while s. mekongi prevails in several districts of cambodia and the lao peoples democratic republic and s. intercalatum prevails in rain forest areas of central africa . On the other hand, s. haematobium which is the causative agent of urogenital schistosomiasis is endemic in 53 countries in africa and the middle east . In the absence of accurate epidemiological data, estimates must still be used to determine the possible burden of infection due to schistosomiasis . On the basis of extrapolating the national prevalence data obtained from the world atlas of schistosomiasis and applying it to 1995 population estimates, it was calculated that about 625 million people would be at risk and 193 million would be infected . Based on these calculations, 85% of the estimated number of infected people are in the african continent . Although successful control projects have been implemented in the last 50 years, yet neither the number of endemic countries nor the estimated number of people infected or at risk of infection were reduced . The radiological examination also strongly suggested that the calcified bladders in two other mummies were due to s. haematobium infection . The use of an immunodiagnostic test, the elisa, led to the diagnosis of the earliest case of human schistosomiasis (s. haematobium) which occurred more than 5000 years ago in an egyptian adolescent . Elisa also identified s. haematobium infection in two mummies aged 3000 and 4000 years . Scott, 1937, was the first to describe the pattern of s. haematobium and s. mansoni infection throughout egypt fig . 1 . His conclusions were based on two series of data which seemed to harmonize fairly well . The first were data obtained from 2 million samples collected by the endemic diseases section of the public health departments . The second were the results of examination of samples from 40,000 persons in a house to house survey done under scott s direct supervision . On the basis of the distribution of the human schistosomes, scott divided egypt into four regions (the first region is the northern and eastern parts of the delta, the second is the southern part of the delta while the third and fourth parts are in the nile valley south of cairo . The third part is areas with perennial irrigation system and fourth part is areas with basin irrigation). In the first three regions about 60% of the rural population the northern and eastern parts of the delta, s. mansoni also infected 60% of the population, while about 85% had either one or both species . In the second region, the southern part of the delta, s. mansoni infected not more than 6%, although the intermediate host, the biomphlaria alexandrina snail, seemed to be as abundant as in the first region . No topographic, hydrographic or demographic differences between these regions could be noted, although the line of demarcation was very sharp as far as the prevalence of the parasite was concerned . The third and fourth regions were in the nile valley south of cairo and there, the snail intermediate host of s. mansoni had never been found . In the third region where perennial irrigation was used s. haematobium only was found and its prevalence was 60% . In the fourth region -areas with basin irrigation scott observed that the snails were much more abundant where perennial irrigation furnished canals and ditches containing water throughout the year while with basin irrigation most of the breeding places were alternatively swept by the annual flood and desiccated in the hot summer . This led him to conclude that the change in the system of irrigation in upper egypt was responsible for the increase in s. haematobium infection rate from 5% to 60% . Furthermore, azim, 1935 and khalil and azim, 1938 demonstrated the impact of converting the basin irrigation system to perennial irrigation in upper egypt on the transmission of schistosomiasis haematobium . Similarly, el zawahry reported that the construction of the perennial irrigation system in old nubia led to a remarkable increase in s. haematobium infection rate . After scott s survey, several studies were conducted to estimate the pattern of schistosomiasis transmission in one or more governorates of egypt [1419]. Twenty years after scott s study, wright reported the distribution of both species of schistosomes based on data which originated from another survey carried out by the egyptian ministry of health using the same methods employed by scott and in the same villages which he had surveyed, but involving 124,253 persons taken by random sampling . Comparing the data obtained with those of scott s, changes in the pattern of the two species were observed . However, s. mansoni had increased in giza and s. haematobium had decreased in upper egypt except in sohag, qena and aswan where there was a dramatic increase in these three governorates due to conversion to the perennial irrigation system . Furthermore, in 1977, studies conducted in eight villages in qalubeia governorate reported obvious changes in the pattern of transmission of schistosomiasis prevalence during the previous two decades . The prevalence of s. haematobium showed a marked decrease contrary to s. mansoni which showed a relative increase . These findings led to the design of two cross - sectional surveys of the population of the nile delta in 1983 and 1990 . The two surveys included the study of 71 villages, one village from each of the 71 districts comprising the eight governorates of the nile delta . When the data of 1983 survey was compared with scott s data, a slight increase in the overall s. mansoni prevalence from 33% in 1935 to 39% in 1983 one governorate, menofeia, had a sharp increase in the prevalence (from 3% to 20%) which accounted for most of the change . The authors attributed the overall increase in prevalence in 1983 to the use of more sensitive diagnostic tests . The relative sensitivity of the diagnostic techniques used in the two surveys must be considered . Scott used the stoll and hausheer dilution technique while the kato technique was used in the 1983 study . The effective amount of stools examined was 5 mg in 1935 study as compared to the 43 mg in 1983 study . The authors (cline et al .) Of 1983 study believed that if the dilution technique was used in their study, the infection rate would have been much lower than 39% . On the other hand, there was a striking decrease in s. haematobium prevalence from 56% to 5% in all governorates of the delta which could not be attributed to diagnostic sensitivity . The results of the survey in1990 demonstrated a 38% decrease in the overall prevalence of s. mansoni infections in the nile delta governorates since the 1983 study . On the other hand, s. haematobium infections have continued to disappear from the delta showing a 40% decrease in prevalence during the same period ., 1993 attributed the changes in prevalence of both species of schistosomal infections to the advent and the increasing availability of the safe and effective anti - schistosomal drug, praziquantel in addition to the dissemination of information about schistosomiasis through the mass media . As regards the middle and upper egypt governorates, it is obvious that there was consistent reduction in the prevalence of s. haematobium except in the most southern three governorates, sohag, qena and aswan . Consequently, the national schistosomiasis control program has formulated objectives to prevent the further spread of s. mansoni in upper egypt . In 1990, an extensive national house to house survey similar to the one conducted by scott in 1935 was conducted to investigate the prevalence and intensity of infection with schistosome species, the prevalence and magnitude of morbidity caused by schistosomiasis, the changing pattern of distribution of s. mansoni and s. haematobium and the determinants of infection and morbidity . A random sample of the rural inhabitants of nine governorates selected as representative of each area (upper and lower egypt) and of governorates with both high and low infection rates . Although the study was conducted over a period beginning in 1990 and ending in 1994, yet the results were published in 2000 except for kafr el sheikh (kes) governorate which was published in 1995 . As regards lower egypt, the five governorates; kes, gharbeia, menoufeia, qalubia and ismailia, where s. mansoni is endemic, showed a prevalence rate ranging from 17.5% to 42.9% with an average of 36.45% [22,2731]. S. haematobium on the other hand, was rare in these governorates; ismailia had the highest infection rate of 1.8% while qalubia had the lowest (0.08%). In upper egypt governorates, where s. haematobium is endemic, s. mansoni was rare being consequential in fayoum only, which had a prevalence of 4.3% . Although this survey did not include giza, yet another study carried out in one of the villages of this governorate indicated that the estimated prevalence of s. haematobium was 7.4% which was in accord with the results of other areas of middle and upper egypt [3436]. On the other hand, the prevalence of s. mansoni was unusually high amongst the villagers (33.7%) and exceptionally high amongst the primary school children (57.7%) of the same village . In conclusion, the study of the nine governorates of egypt confirmed the already documented change in the pattern of transmission of both species of schistosome infection in upper and lower egypt . The change from basin to perennial irrigation was the result of the construction of the aswan high dam . Since both these factors played a vital role regarding the situation of schistosomiasis infection, they will be discussed in details under separate topics later . The aswan high dam was constructed on the river nile, 7 km south of aswan . The designs of the dam were completed in 1959 and its construction began in 1960 . Temporary closure of the nile in 1965 was instituted till the building of the dam was completed in 1967 and by 1970 all 12 turbines were in operation . The effect of aswan high dam on the prevalence of schistosomiasis has aroused a lot of controversy . He even stated that there is evidence that the high incidence of the human blood fluke (schistosomiasis or bilharziasis) in the area may well cancel out the benefits the construction of the dam may yield . This increase in schistosomiasis prevalence was attributed to reclamation of new land and conversion of the basin irrigation system to the perennial . Furthermore, in 1977, malek stated other reasons for the increase in schistosomiasis transmission . His study indicated that, at least in some sections of the lower nile, ecological changes as a consequence of the dam were enhancing the transmission of the disease . In addition to the abundance of the snail intermediate host in the nile, the absence of silt and decrease in water current velocity in the lower nile would have given higher chance for the miracidia to come in contact with the snails and for the cercaria to infect humans . The same author reported that human activities in and near the nile water had increased considerably throughout the year because of the low, clean and slow water . Another significant factor in the ecology of the snail host living in the irrigation canals in the nile delta is the elimination of the winter closure because clearance of the canals -during this period - from the flood silt deposited in their beds was not needed anymore . Such an adverse and disastrous factor which used to affect the snail population will be absent after the high dam construction, thus leading to flourishing of the breeding of snails in the nile delta canals with increase in schistosomiasis transmission . Another study conducted in some villages in upper egypt close to the dam reported an increase in the prevalence rate of schistosomiasis haematobium among some inhabitants of these villages . In contradiction to the previous conclusions, other scientists reported that the construction of the aswan high dam did not cause an increase in schistosomiasis prevalence . In 1978, miller et al . Conducted an environmental and epidemiological survey on 15,329 rural egyptians who were selected from three major geographical regions of egypt (nile delta, middle egypt and upper egypt) in addition to the resettled nubian population . Prevalence of either or both species of schistosomiasis was 42.1% in the north central delta region . In middle egypt which spreads from beni suef and assiut governorate, prevalence in the study sites of upper egypt varied according to the location of the village . In desert villages, the prevalence of s. haematobium was very low (4.1%) compared to the prevalence in agricultural villages (24.8%). There was sufficient historical and current data to firmly disregard any role of the aswan high dam in causing an increase in schistosomiasis in rural egypt . They also reported that all available data pointed to an overall decrease of both s. haematobium and s. mansoni rather than increase and this included the resettled nubia . However, there was an indication that the distribution of s. mansoni is expanding southwards . They attributed the reported reduction in the prevalence to the improvement in the domestic water supply to villages, the development and delivery of proper health care in addition to the increase in the general awareness among the population at risk of how to avoid infection and how to get treatment . As regards transmission of schistosomiasis in lake nasser, infection with s. haematobium was prevalent among the fishermen working there . The prevalence of detected s. haematobium infection at entry to the lake declined from 67% in both 1974 and 1975 to 18% in 1980 and 20% in 1981 . This was attributed to the widespread use of metrifonate in upper egypt beginning in 1975 . As regards s. mansoni infection, the snail intermediate host of s. haematobium (bulinus truncatus) was present in abundance; some of them were infected with s. haematobium . On the other hand, biomphlaria alexandrina, (the intermediate host of s. mansoni) was detected in only one site at the northern tip of the lake, but none of them was infected . The egyptian ministry of health installed mobile units to examine and treat all pupils at a large number of elementary, primary and secondary schools thus stopping the disease in early childhood . The number of these units increased from 6 in 1924 to 56 in 1933 with the number of annual treatments increasing from nearly 47000 to 311000 . In 1926, the first planned control scheme was started at dakhla oasis . It comprised treatment of about a third of the population with tarter emetic in addition to application of copper sulfate for 96 h to all irrigation canals . Regular surveys in the early 1930s failed to detect snails and none of the 70 children born after the last mollusciciding in 1929 was infected at 1936 survey . Until mid eighties of the last century, the strategy for schistosomiasis control -recommended by the who aimed at reducing transmission by diminishing the snail population . As this method became effective, morbidity in the human population was slowly reduced and in the long term, the complete eradication of the parasite might have been achieved . In 1984, a major change in the strategy became possible with: (a) recognition that morbidity of schistosomiasis was directly related to the prevalence and intensity of infection, both being high in the 1014 years age group . (c) the development of new antischistosomal drug (praziquantel) which is safe and effective against the three important human schistosome species . At present, the main objective of control is to reduce or eliminate morbidity or at least serious disease . All schistosomiasis control projects carried out in egypt followed the same strategy recommended by the who . All programs conducted before 1984 aimed at transmission control and the main activity was based on snail control which might be supplemented by antibilharzial treatment . The following control projects were implemented during the period from 1953 to 1985 .qaliub project (19531954): snail control using copper sulfate.qalubeya project (19531959): mass treatment using tartar emetic.warrak el arab project (19531959): snail control using sodium pentachlorophenate.egypt 049 project (19611969): snail control using niclosamide.iflaka project (19621966): mass treatment using astiban.giza project (shimbari 1970): mass treatment using hycanthone.fayoum project (1969): chemotherapy and snail control using niclosamide .middle egypt control program: started in 1977, implemented in beni suif, menia and assiut north of dairut).upper egypt control program: started in 1980, implemented in assiut south of dairut, sohag, qena and aswan . Qaliub project (19531954): snail control using copper sulfate . Middle egypt control program: started in 1977, implemented in beni suif, menia and assiut north of dairut). Upper egypt control program: started in 1980, implemented in assiut south of dairut, sohag, qena and aswan . Middle and upper egypt control projects were the largest of those conducted in egypt . They covered about two million irrigated feddans and a total population of more than 12 million people . Extensive land reclamation with installation of the drainage has been carried out in different parts of the area . The project was divided into three phases: (1) intensive phase; 3 years . (2) consolidation phase; 3 years . (3) maintenance phase . The intensive phase involved: (a) area wide application of niclosamide for three times / year . (b) chemotherapy for infected individuals, metrifonate (bilarcil), three doses with 14 days apart . In 1988 praziquantil was used for treatment . Impact of the projects: an international evaluation team, in 1985, showed that since the initiation of control intervention, the overall prevalence of schistosomiasis haematobium of about 30% in the middle egypt project area, determined in 1977, had been reduced to approximately 8.5% . Furthermore, the detailed data reported by the ministry of health showed a continuous downward trend in prevalence rates . But significant re - infections were reported among school children particularly in young age groups during the summer season indicating that appreciable transmission was continuing in the project area . Although it was apparent that a large measure of control had been achieved since intervention began, the results showed some upward trends in prevalence of infection during the maintenance phase . National schistosomiasis control program (nscp) in the nile delta: this project started in 1997 and was based on the morbidity control strategy adopted by the who in 1984 . Mass treatment was offered without prior diagnosis to all school children 618 years old and to all inhabitants of villages where s. mansoni prevalence among outpatients of rural health units was 20% . Furthermore, focal mollusciciding using niclosamide was applied on water courses with high snail density or harboring infected snails . In addition, health education campaigns and capacity building through training of personnel working in rural health units or involved in snail control activities were applied . As the program progressed, and s. mansoni prevalence decreased, the threshold for mass chemotherapy was changed to 10% in 1999, 5% in 2000 and 3.5% in 2002 to 3% in 2003 . The records of ministry of health reported that in 1996 before the application of mass chemotherapy campaign; 168 villages had prevalence> 30%, 324 villages had prevalence 2030% and 654 villages had prevalence 1020% . By the end of 2010, in the whole country only 20 villages had prevalence more than 3.5% and none had prevalence more than 10% . At present, a multi - sectoral approach is adopted . This aims at interrupting transmission and achieving elimination through wider integration of the present strategy with other interventions such as mass chemotherapy campaigns for school - age children and populations in hot spot areas together with improvement of health awareness, social mobilization, snail control within the activities of the primary healthcare system, and environmental sanitation . The strategy adopted for control differs according to the epidemiological setting . In newly developed areas with no transmission and no autocthonous cases, surveillance and routine screening is done . In villages where schistosomiasis prevalence is <3%, active population screening, monitoring after treatment, snail control and water and sanitation are done . On the other hand, in villages with active transmission and a prevalence> 3%, mass treatment, snail control and clean water and sanitation are stressed . Although it is well documented that schistosomiasis haematobium was endemic in ancient egypt, yet the first detailed study describing its pattern of prevalence was carried out in 1937 by scott . He reported that schistosomiasis was highly prevalent in both the nile delta and the nile valley south of cairo in districts where the perennial irrigation system was used . The highest prevalence was recorded in the northern and eastern parts of the delta where 85% of the population was infected with either one or both species of the parasite . On the other hand, s. mansoni infection was very low in the southern part of the delta and completely absent from the nile valley south of cairo whether basin or perennial irrigation system were used . After scott s study, several large scale surveys were conducted to estimate the pattern of schistosomiasis infection . In general, in the nile delta governorates there was a gradual reduction in the overall prevalence of s. mansoni infection while s. haematobium prevalence continued to decrease till it disappeared completely . In middle and upper egypt governorates, there was a consistent reduction in the prevalence of s. haematobium infection except in sohag, qena and aswan following the construction of the high dam where basin irrigation was converted to perennial irrigation system . At present, the ministry of health and population records indicate that by the end of 2010 only 20 villages in the whole country showed prevalence more than 3.5% and none had more than 10% . The great success in controlling schistosomiasis in egypt is achieved through the implementation of several control programs which adopted the same strategy recommended by the who.
The two main and comprehensive goals of health provision are promotion of quality of a healthy life and prolonging it, and deletion of health disturbing factors ., it was believed that neonates and infants either could not feel pain or felt it less than adults due to incomplete development of their nervous system . Meanwhile, it has been found that the pain - conducting fibers are formed in the fetal period, and term neonates are sensitive to pain and experience it like infants and children . On an average, the neonates admitted in the neonatal intensive care unit (nicu) experience 115 painful procedures during their 16-day stay in this ward, of which 79.2% are administered no dedicational and non - dedicational sedative methods . In about 2.1% of these procedures, the neonates receive sedative medications, in 18.2% of the procedures, they receive non - dedicational sedation, and in 20.8% of the cases, they receive both dedicational and non - dedicational interventions . The procedure conducted most frequently among neonates in the nicu is heel stick (56%). Pain in neonates, if not treated, leads to immediate and long - term complications . The immediate complications include intraventricular hemorrhages and high mortality in the nicu, long - term response to pain, and poor responses to stimulants . Long - term complications include learning problems, reduction of concentration, lack of adaption with new situations, and mood changes in neonates and children . If not managed, pain and tension in neonates can disturb their sleep condition, growth and development, nutrition tolerance, and even vital signs such as respiration, heart rate (hr), bp, and o2 saturation . Further education and better detection of pain signs are essential for the health care personnel due to the short- and long - term complications of the uncontrolled pain among neonates . Prevention of these destructive effects may also help in reduction of hospitalization period and costs . Neonates can be relieved of pain through non - dedicational methods such as intake of oral sucrose, non - nutritive sucking, breast feeding, mother infant skin touch, and music during the procedures . Among the effective methods of pain relief in neonates is playing a melody which can act as a tool for distracting the neonates and enhancing the secretion of endorphins . Playing a melody on a piano and recorded lullaby voice results in rapid return of the hr and behavioral and facial reactions due to pain to the baseline values . Studies on the effect of music on neonatal physiological responses concluded that music is effective on hr increase and changes of respiratory rate . Reported a significant difference in neonates hr during removal of a needle as well as in the first 5 min after heel stick . A study in the nicu showed no notable changes in neonates hr after playing music compared to before it . Taking into consideration the destructive and numerous effects of pain on neonates various physiological systems, as well as the existence of controversial results regarding the sedative effects of music therapy, and the importance of pain management and prevention of numerous and irreversible complications in neonates, the researcher investigated the effect of melody on the physiological responses of heel stick pain in neonates which is among the most frequent painful procedures done on them . This is a quasi - experimental study conducted for 5 months in the nicu of alzahra hospital in isfahan, iran . Sampling was by consecutive convenient sampling, and the subjects comprised 50 neonates meeting the inclusion criteria, who were assigned to study and control groups through random allocation . The neonates in the group of melody (study) and the neonates in the control group were selected on the first and second days of the study, respectively . Inclusion criteria were gestational age of 34 weeks, being hospitalized in the ward (inpatient hospitalization), not receiving o2 before and during the study, intact hearing ability (through startle test), proper neonatal consciousness, and administration of no other painful procedures before conducting the intervention . Exclusion criteria were parents not willing to continue participating in the study or a need for oxygen therapy in the neonates due to any reason during the intervention and no success in the first heel stick trial . Researcher conducted the intervention after obtaining consent form the neonates parents and explaining the study goals and method . The tool adopted in this study was a questionnaire to record the personal characteristics and a form of physiological signs record including hr, respiratory rate / min, and atrial o2 saturation percentage in the neonates . Neonates hr and atrial o2 saturation were monitored by a saadat monitoring device connected to the neonates, which was calibrated monthly by medical equipments engineers of the hospital . The melody adopted was the piece golden dreams played on piano with no lyrics . In the intervention group, the melody was played on an mp3 player laid at a distance of 1 m from neonates cot with a sound intensity of 65 db . It was played 3 min before the heel stick was administered until 3 min after the end of the procedure by an experienced nurse (voice intensity was measured by a db meter device). Then, the neonates heels were disinfected by alcohol disinfection cotton and the lancet was inserted from the lateral side of the heel, and the researcher measured and recorded the neonatal physiological responses (pulse, atrial o2 saturation, and respiratory rate) by saadat monitoring device 3 min before, during, and after the heel stick, respectively . In the control group, all variables (physiological responses) were evaluated and recorded in time points similar to the study group . The obtained data from both groups were entered into a computer and analyzed by chi - square, repeated measure analysis of variance (anova), and independent t - test using spss 15 . Informed consent was obtained from participants and the study has confirmation of ethics committee of isfahan university of medical sciences (no 391316). Informed consent was obtained from participants and the study has confirmation of ethics committee of isfahan university of medical sciences (no 391316). Results showed that most of the subjects were males (58%), and the chi - square test showed no significant difference between the two groups (p> 0.05). Independent t - test showed no significant difference in some demographic characteristics (gestational age, birth weight, current weight, and neonates age) of the subjects in the two groups (p> 0.05). Repeated measure anova showed a significant difference in hr in the melody and control groups at different time points (p <0.05) [table 1]. Least significant difference (lsd) post hoc showed a significant difference in the means of hr during and before intervention, and during and after intervention in the melody group (p <0.05). It also showed a significant difference in the means of hr during intervention and before intervention (p <0.05), but not at other time points (p> 0.05). Independent t - test showed no significant difference in the means of hr in the melody and control groups before intervention (p = 0.69), during intervention (p = 0.87), and after intervention (p = 0.42). Repeated measure anova also showed no significant difference in atrial o2 saturation at various time points in the melody group (p> 0.05), but the difference was significant in the control group (p <0.05) [table 2]. Lsd post - hoc test showed that the difference before and after intervention had a significance level of 0.05 . Independent t - test showed no significant difference in the means of atrial o2 saturation between the melody and control groups before intervention (p = 0.12), during intervention (p = 0.37), and after intervention (p = 0.63). Repeated measure anova showed a significant difference in respiratory rate at various time points in the melody and control groups (p <0.05) [table 3]. Lsd post - hoc test showed a significant difference in the means of respiratory rate before and during intervention, and during and after intervention in the melody group (p <0.05). It also showed a significant difference in the means of respiratory rate before and during intervention, and before and after intervention in the control group (p <0.05). Independent t - test showed no significant difference in the means of respiratory rate in the melody and control groups before (p = 0.96), during (p = 0.69), and after (p = 0.87) intervention (p> 0.05). Comparison of means of neonates heart rate in the two groups at various time points comparison of means of neonates o2 saturation in the two groups at various time points comparison of means of neonates respiration rate in the two groups at various time points results showed that the means of hr and respiratory rate were higher during intervention compared to before and after intervention in the melody group . The increase in mean pulse during administration of the procedure was higher in the control group compared to the melody group . Means of respiratory rate showed an increase both in the study and control groups, although the increase remained longer after ending the procedure in the control group compared to the study group . Keith et al . Also reported that music positively affected hr and respiratory rate and could balances these values, which is in line with the findings of the present study . Our obtained results showed no significant difference in the means of atrial o2 saturation at various time points in the melody group, possibly due to the type of selected melody, music, or length of the played music . For instance, standly applied a piece of music containing lullaby sang by a woman, and in the study of karimi et al . Several other studies, like the study of collabra on the effect of music on premature neonatal physiological responses, showed that music had no effect on the neonates atrial o2 saturation, respiratory rate, and hr . Karimi et al . Also showed no effect of music on hr and atrial o2 saturation, which is consistent with the findings of the present study . In addition, obtaining no significant difference in neonatal physiological responses before, during, and after intervention in the study and control groups (p> 0.05) may be due to the type of selected melody or the low number of the subjects, as the difference may become significant with a higher sample size . In general, the findings of the present study showed that playing a melody causes a balance in the neonatal physiological responses including respiratory rate and hr during heel stick . Therefore, a melody is recommended to be played for neonates during administration of painful procedures, to prevent the destructive effects of pain . Our obtained results showed that playing music is an efficient intervention to maintain balance in neonates respiratory rate and hr during administration of painful procedures . These findings reveal the importance of the application of music in the caring of neonates . Music therapy decreases the negative effects of treatment procedures and playing musical melodies is a cost - effective and convenient independent nursing intervention which does not need a physician's visit and extra staff, and is not so time consuming.
We analyzed culture - positive cases of mdr tb reported to the california tb registry from january 1, 2004, through december 31, 2007 . California state law (health and safety code title 17 2505) requires reporting of all verified cases of tb, submission of all m. tuberculosis isolates to local public health laboratories, and submission of all mdr m. tuberculosis isolates to the california department of public health microbial diseases laboratory . Testing for first- and second - line drug susceptibilities was performed at local laboratories or at the microbial diseases laboratory by using bactec 460 (becton dickinson diagnostic instruments, sparks, md, usa), mgit 960 (becton dickinson), or the agar proportion method . Some isolates were forwarded to the centers for disease control and prevention (cdc; atlanta, ga, usa) for additional second - line drug testing or for confirmation of drug resistance . Patients were included in the study if mdr m. tuberculosis was identified on> 1 isolate . Demographic and clinical information for all patients with mdr tb was abstracted from state tb surveillance forms (report of a verified case of tuberculosis), which have high validity (18). All protocols were approved by the california committee for the protection of human subjects and university of california, san francisco, committee for the protection of human subjects . For each isolate, genomic dna was extracted from solid media (lowenstein - jensen slants, middlebrook 7h10 or 7h11 agar), liquid media (bactec 12 b or mgit [becton dickinson]), or smear - positive sputum sediments . A real - time pcr assay with 6 molecular beacon probes was performed by using an iq5 icycler instrument (bio - rad, hercules, ca, usa) to screen for mutations associated with isoniazid and rifampin resistance (19). Two molecular beacons that targeted katg (codon 311317) and the inha promoter were used to detect isoniazid resistance conferring mutations, and 4 molecular beacons that targeted the core region of rpob were used to detect rifampin resistance conferring mutations . Isolates with mutations in katg detected by the wild - type probe were further tested with another molecular beacon that specifically targeted katg s315 t (agc acc). When molecular beacon analysis did not show katg s315 t or -c15 t inha promoter mutations, the entire fura - katg locus (h37rv: 21536262156657, 3,031 bp) was sequenced as described (6). Sequence data were generated by using abi bigdye v3.1 dye terminator sequencing chemistry and the abi prism 3730xl capillary dna analyzer (applied biosystems, foster city, ca, usa) at the genomic core facility, university of california, san francisco (www.genomics.ucsf.edu/sequencing/index.aspx), and were analyzed with clustalw (www.ebi.ac.uk/tools/clustalw/index.html). Spacer oligonucleotide typing (spoligotyping) and mycobacterial interspersed repetitive unit (miru) typing were performed in accordance with the centers for disease control and prevention universal genotyping program procedures (20). Spoligotyping was performed by using luminex - based methods to detect 43 known spacer sequences in the direct repeat locus (21). A capillary sequencer, ceq 8000 (beckman, fullerton, ca, usa), was used to analyze the number of repeated sequences at each of the 12 loci . Is6110-based restriction fragment length polymorphism (rflp) genotyping was performed following standardized methods (23). Rflp patterns were compared by using bioimage whole band analyzer software version 4.2.1 (bioimage corp ., ann arbor, mi, usa) (24). Rflp patterns with <20 identical bands, or> 20 bands and differing by no more than a single band, were considered matched . Is6110 rflp band assignment was edited by 2 independent readers, and the cluster assignment was confirmed visually spoligotype families h, lam, and t, x, s were considered to be of euro - american lineage; beijing of east - asian lineage; eai of indo - oceanic lineage; and cas of east african - indian lineage (5). Cases were defined as clustered if> 2 isolates from cases reported during the study period shared the same miru and spoligotype, matched is6110 rflp, and had specific drug resistance conferring mutations for isoniazid and rifampin . Clustering was assumed to represent both transmission of m. tuberculosis and progression to active disease, leading to secondary case generation within the period of the study . Cases not in a cluster were considered to be the result of reactivation of latent infection . Patients with the earliest case report date within a cluster were regarded as index cases . The proportion of clustered mdr tb cases was analyzed as the number of clustered cases divided by the total number of culture - positive cases that occurred during the study period . Because of limited sample size, the independent effects of katg s315 t and phylogeographic lineage on clustering were estimated by using exact logistic regression methods . Refugee status and refugee resettlement during the study period could bias our results in that overrepresentation of ethnic groups or geographic locations with a high prevalence of particular strain - specific factors (phylogeographic lineage or drug - resistance mutations) could confound the association under study . To examine this influence and potential clustering of tb cases within households or communities related to refugee resettlement, sensitivity analysis was conducted by reestimation of study results after excluding 1) patients immigrating from refugee settings within the past 3 years and 2) the single largest patient cluster, which accounted for 40% of all clustered cases . In a separate analysis, standard logistic regression was used to estimate the effect of katg s315 t and phylogeographic lineage on sputum smear positivity, again controlling for refugee status . Odds ratios (ors) and 95% confidence intervals (cis) were calculated to measure associations of interest . Categorical data (e.g., sex, foreign vs. us birth, homelessness) were compared by using fisher exact tests . The wilcoxon rank - sum test was used to determine differences in the distribution of continuous variables (e.g., age, time from entry into the united states to tb diagnosis). Interaction between the independent variables was assessed separately for each factor by stratification and statistical testing (breslow - day with the tarone correction and zelen test), with p<0.2 assumed to indicate the presence of interaction . Analyses were performed by using stata 10 (statacorp ., college station, tx, usa) and statexact 8 (cytel software corp ., cambridge, ma, usa). For each isolate, genomic dna was extracted from solid media (lowenstein - jensen slants, middlebrook 7h10 or 7h11 agar), liquid media (bactec 12 b or mgit [becton dickinson]), or smear - positive sputum sediments . A real - time pcr assay with 6 molecular beacon probes was performed by using an iq5 icycler instrument (bio - rad, hercules, ca, usa) to screen for mutations associated with isoniazid and rifampin resistance (19). Two molecular beacons that targeted katg (codon 311317) and the inha promoter were used to detect isoniazid resistance conferring mutations, and 4 molecular beacons that targeted the core region of rpob were used to detect rifampin resistance conferring mutations . Isolates with mutations in katg detected by the wild - type probe were further tested with another molecular beacon that specifically targeted katg s315 t (agc acc). When molecular beacon analysis did not show katg s315 t or -c15 t inha promoter mutations, the entire fura - katg locus (h37rv: 21536262156657, 3,031 bp) was sequenced as described (6). Sequence data were generated by using abi bigdye v3.1 dye terminator sequencing chemistry and the abi prism 3730xl capillary dna analyzer (applied biosystems, foster city, ca, usa) at the genomic core facility, university of california, san francisco (www.genomics.ucsf.edu/sequencing/index.aspx), and were analyzed with clustalw (www.ebi.ac.uk/tools/clustalw/index.html). Spacer oligonucleotide typing (spoligotyping) and mycobacterial interspersed repetitive unit (miru) typing were performed in accordance with the centers for disease control and prevention universal genotyping program procedures (20). Spoligotyping was performed by using luminex - based methods to detect 43 known spacer sequences in the direct repeat locus (21). A capillary sequencer, ceq 8000 (beckman, fullerton, ca, usa), was used to analyze the number of repeated sequences at each of the 12 loci . Is6110-based restriction fragment length polymorphism (rflp) genotyping was performed following standardized methods (23). Rflp patterns were compared by using bioimage whole band analyzer software version 4.2.1 (bioimage corp ., ann arbor, mi, usa) (24). Rflp patterns with <20 identical bands, or> 20 bands and differing by no more than a single band, were considered matched . Is6110 rflp band assignment was edited by 2 independent readers, and the cluster assignment was confirmed visually . The phylogeographic lineage of strains was determined from spoligotyping results . Spoligotype families h, lam, and t, x, s were considered to be of euro - american lineage; beijing of east - asian lineage; eai of indo - oceanic lineage; and cas of east african - indian lineage (5). Cases were defined as clustered if> 2 isolates from cases reported during the study period shared the same miru and spoligotype, matched is6110 rflp, and had specific drug resistance conferring mutations for isoniazid and rifampin . Clustering was assumed to represent both transmission of m. tuberculosis and progression to active disease, leading to secondary case generation within the period of the study . Cases not in a cluster were considered to be the result of reactivation of latent infection . Patients with the earliest case report date within a cluster were regarded as index cases . The proportion of clustered mdr tb cases was analyzed as the number of clustered cases divided by the total number of culture - positive cases that occurred during the study period . Because of limited sample size, the independent effects of katg s315 t and phylogeographic lineage on clustering were estimated by using exact logistic regression methods . Refugee status and refugee resettlement during the study period could bias our results in that overrepresentation of ethnic groups or geographic locations with a high prevalence of particular strain - specific factors (phylogeographic lineage or drug - resistance mutations) could confound the association under study . To examine this influence and potential clustering of tb cases within households or communities related to refugee resettlement, sensitivity analysis was conducted by reestimation of study results after excluding 1) patients immigrating from refugee settings within the past 3 years and 2) the single largest patient cluster, which accounted for 40% of all clustered cases . In a separate analysis, standard logistic regression was used to estimate the effect of katg s315 t and phylogeographic lineage on sputum smear positivity, again controlling for refugee status . Odds ratios (ors) and 95% confidence intervals (cis) were calculated to measure associations of interest . Categorical data (e.g., sex, foreign vs. us birth, homelessness) were compared by using fisher exact tests . The wilcoxon rank - sum test was used to determine differences in the distribution of continuous variables (e.g., age, time from entry into the united states to tb diagnosis). Interaction between the independent variables was assessed separately for each factor by stratification and statistical testing (breslow - day with the tarone correction and zelen test), with p<0.2 assumed to indicate the presence of interaction . Analyses were performed by using stata 10 (statacorp ., college station, tx, usa) and statexact 8 (cytel software corp ., cambridge, ma, usa). During the study period, 11,395 cases of tb were reported in california, of which 9,037 (79%) had positive cultures . Of these, of the 141 (2%) incident mdr tb cases, 123 (87%) had isolates available for miru, spoligotyping, and is6110 rflp analysis . Isolates unavailable for genotyping (n = 18) were more often from los angeles county; other demographic and clinical characteristics were similar to those of analyzed cases . Twenty - five mdr m. tuberculosis isolates were aggregated in 8 clusters (1 cluster of 10 cases, 1 cluster of 3 cases, and 6 clusters of 2 cases) for an overall cluster proportion of 20% (25/123). Excluding the 8 index cases, 14% (17/123) of all cases were considered to have resulted from recent transmission and rapid progression to disease (secondary cases). Within clusters, a median of 3 months elapsed between successive secondary cases (range 020 months). Of the 123 total cases, 113 (92%) occurred among foreign - born patients, with more than half (56%) occurring among immigrants from mexico, philippines, the people s republic of china, or vietnam (table 1). Seven of 8 index cases occurred either in mexican immigrants (3/8) or recent refugees from thailand, lao people s democratic republic, or india (4/8). Median time from patient arrival in the united states to tb diagnosis was approximately twice as long for clustered as for nonclustered cases (4.3 years vs. 2.4 years) and 3 times as long for cases in mexican - born persons as for cases in persons from other countries (7.3 years vs. 2.3 years). * mdr tb, multidrug - resistant tuberculosis; or, odds ratios; ci, confidence interval; iqr, interquartile range; afb, acid - fast bacilli . Ors describe the association between the characteristic of interest and mdr tb case - clustered status . Afghanistan (1), burma (1), cambodia (5), ethiopia (1), indonesia (1), mongolia (1), nepal (1), peru (2), south korea (5), and ukraine (1). #nonclustered cases: cervical lymph node (5), bone (1), other (1); clustered cases: pleural (1). * * culture positive after> 8 months of treatment; limited to pulmonary tb patients who were alive at diagnosis and had an initial positive sputum culture . Younger persons were more likely than older persons to harbor strains involved in mdr tb clusters (table 1). Hiv infection was unusual in this patient population; only 3 (4%) of 75 patients with known hiv status were hiv - infected . Twenty - eight percent (35/123) of patients reported a history of active tb; this proportion did not vary between clustered and nonclustered cases (p = 0.75). Time to culture negativity (2.4 vs. 2.8 months, p = 0.95), treatment failure, or death did not differ between clustered and nonclustered cases (p = 0.57) among 105 (85%) of 123 cases for which data were available . Seventy - five percent of mdr m. tuberculosis strains harbored the isoniazid resistance conferring mutation katg s315 t, including all (100%) clustered strains (table 2). When we controlled for strain lineage and refugee status, katg s315 t was inversely associated (or 0.28, 95% ci 0.090.89, p = 0.03) with sputum smear positivity (table 3). Most rifampin resistance conferring mutations were found between positions 529 and 534 of the rpob gene, likely indicative of the serine to leucine substitution at position 531 (s531l) of the rpob gene (27). The association between this mutation and clustering did not reach statistical significance (or 2.2, 95% ci 0.87.4; p = 0.16). * mdr tb, multidrug - resistant tuberculosis; s315 t, serine - to - threonine substitution at position 315 . Novel mutations detected: y413stop, t314 t (silent), w161 g, d61e (fur a), r145p, p325l, and v633f . Inha promoter mutation was concomitant with 4/91 (4%) isolates harboring the katg s315 t and 2/8 (25%) isolates with katg mutations other than s315 t . No mutations detected by molecular beacons; sequencing was not possible for these isolates because of degraded dna . Rifampin resistance conferring mutations were not detected by the molecular beacon assay for 4 isolates . * mdr tb, multidrug - resistant tuberculosis; s315 t, serine - to - threonine substitution at position 315; or, odds ratio; ci, confidence interval . Mdr m. tuberculosis isolates were distributed among east - asian (47%), euro - american (30%), indo - oceanic (20%), and east african indian (3%) phylogeographic lineages . Lineage could not be established for 11 cases . On univariate analysis, east - asian strain lineage was associated with clustering (table 4), but not with adverse outcome (death or treatment failure). Mdr, multidrug - resistant tuberculosis; or, odds ratio; ci, confidence interval . Clustering was independently associated with katg s315 t (or 11.2, 95% ci 2.2-; p = 0.004) and refugee status (or 6.0, 95% ci 1.236.2; p = 0.03) in exact multivariate analyses in which strain lineage and sputum smear positivity were controlled for (table 5). The estimated association between katg s315 t and case clustering did not appreciably change in sensitivity analyses that excluded either all recently arrived refugees or the single largest patient cluster . * mdr tb, multidrug - resistant tuberculosis; or, odds ratio; ci, confidence interval . In this 4-year population - based molecular epidemiologic study, transmission followed by secondary case generation contributed to 14%, or 1 of every 7, mdr tb cases in california . Clustered cases occurred more often among younger persons and persons who had emigrated from mexico and refugee settings in southeast asia . In addition, pathogen - specific factors were associated with clustering of mdr tb cases, independent of traditional clinical and demographic risk factors . The proportion of mdr tb cases attributed to transmission in california was higher than that reported by other investigators in most low incidence settings (2832). The largest clusters in our study resulted from mdr tb outbreaks in california after resettlement of hmong refugees in 20052006 (33) and resettlement of tibetan refugees in 20012006 . The associations between pathogen - specific factors and case clustering could be due to regional differences in strain prevalence and preferential migration of persons with specific strains to california . We attempted to control for these factors by using highly stringent criteria to define clustered cases and by adjusting for refugee status in our multivariate model . However, without detailed contact information and contact tracing, we cannot be certain of the extent to which transmission or progression to active disease occurred within or outside california . Given that most clustered cases occurred among persons residing in the united states for> 3 years and that us - born persons were involved in 3 of 8 clusters, at least some proportion of mdr tb transmission is likely to have occurred in california . This observation suggests that although most mdr tb cases in the united states are related to the migration of persons already infected with drug - resistant m. tuberculosis, a small but notable proportion may be due to ongoing transmission . Heterogeneity in the reproductive success of drug - resistant m. tuberculosis is now well established (34,35). In this study, the katg s315 t mutation was the only isoniazid resistance conferring mutation found among clustered mdr tb cases . The high prevalence of katg s315 t among mdr strains (12,14,3638) and the association of this mutation with increased secondary case generation among isoniazid - monoresistant strains (6,7) have been documented . We report that the katg s315 t isoniazid resistance conferring mutation retains an independent effect on clustering of mdr tb cases despite the presence of mutations that confer resistance to additional drugs . In particular, secondary case generation did not significantly vary according to site of rpob mutations that confer rifampin resistance, which supports the hypothesis that these are no - cost mutations or that compensatory mutations commonly exist (39). The katg s315 t mutation is thought to preserve fitness through the relative preservation of catalase - peroxidase production (9), although whether this mutation is associated with different clinical phenotypes is unknown . In this study, we noted an inverse association between presence of the katg s315 t mutation and sputum smear positivity . In addition, the katg s315 t mutation was associated with case clustering, independent of sputum smear status . These findings suggest that the katg s315 t mutation may preserve the ability of m. tuberculosis to transmit and cause secondary cases through mechanisms unrelated to conventional indices of disease severity, such as the presence of abundant acid - fast bacilli in sputum . First, mdr tb in california is occurring predominantly among patients who were not born in the united states, with some cases from recent transmission and rapid progression to disease . Our study suggests that in california, younger persons and persons who have emigrated from mexico and from refugee settings may be at higher risk for transmitting mdr m. tuberculosis . Likewise, our findings reinforce the need for giving priority to screening and prevention activities in immigrant communities and us investment in international tb control (40). Second, if our results are verified in other settings, tb - control programs should consider pathogen - specific factors such as isoniazid resistance conferring mutations when planning the intensity of contact investigation and secondary case - finding activities . First, our estimates of case clustering are imprecise because of the limited number of mdr tb cases observed during the study period . However, these estimates are the best currently available, given that the data make up the largest population - based tb registry in the united states . Second, although our definition of genotypic clustering was highly rigorous, the lack of detailed epidemiologic information precluded confirmation of transmission within california . Third, because our study did not include pan - susceptible or isoniazid - monoresistant strains, we cannot comment directly on mdr m. tuberculosis pathogenicity relative to these groups . Lastly, our analyses implicitly assume independence of outcome events, and household or community - level factors potentially associated with clustering were not available . Future studies should be designed so that statistical methods can be used that are able to accommodate the possible effects of within - household clustering . We found a substantial proportion of mdr tb cases and case clustering in california among non us - born persons, and the katg s315 t mutation was independently associated with clustering . Validation of these findings in larger cohorts and in different population settings may have crucial public health consequences.
Globally, alcohol use causes 1.8 million or 3.2% of all deaths and accounts for 4.0% of the disease burden . The disease burden related to alcohol use is especially great among low - income and middle - income populations and countries, where alcohol consumption is increasing and injury rates are high due to limited implementation of public health policies and prevention strategies . A critical aspect of alcohol use is pre - teen alcohol initiation, which worsens adverse health outcomes among youth . Epidemiological studies in western countries have examined the association between early alcohol initiation and problems related to alcohol among youth, but data is lacking to study such associations in most developing countries . Pre - teen alcohol use is of paramount concern to public health as it has been associated with alcohol dependence, substance use and criminal activity, unintentional injuries, unplanned and unprotected sex, involvement in physical fights, and suicidal ideation and attempts . Literature on pre - teen alcohol initiation have identified gender, age, monthly income, living arrangement, attitude toward alcohol use, perceived susceptibility of alcohol use, perceived self - efficacy, peer drinking, relatives drinking, accessibility of alcohol around university, accessibility of alcohol around community, exposure to anti - alcohol campaign, exposure to alcohol advertising, and ownership of alcohol promotional items as significant correlates of alcohol use . The risk of alcohol use among youth in low - income countries is a vital public health concern . In africa, alcohol use is related to poverty, road traffic crashes, sexual intercourse among adolescents, unprotect sex, and psychological distress . To exacerbate the conditions, heavy episodic drinking is prevalent among young adults in several african countries . For example, more than one in every three zambian adolescents have ever drunk alcohol, and uganda has been noted as having the highest alcohol per capital consumption in the world . The current study uses nationally representative samples to examine the associations between pre - teen alcohol use initiation and drinking problems among zambian and ugandan youth . The study controls for demographic characteristics and other potential confounding variables that have been linked to alcohol use, substance use or suicidal behaviors . The current study is based on the global school - based student health survey (gshs), developed and supported by the world health organization in collaboration with the united nations children's fund, the united nations educational, scientific, and cultural organization, the joint united nations programme on hiv / aids, and with technical assistance from the centers for disease control and prevention . The goal of the gshs is to provide data on health behaviors and relevant risk and protective factors among students across all regions served by the united nations . Country specific questionnaires, fact sheets, public - use data files, documentation and reports are publicly available from the centers for disease control and prevention and the world health organization and have been described elsewhere . In brief, the gshs consists of a self - administered questionnaire, administered primarily to students 1316 years of age . The survey uses a standardized scientific sample selection process, common school - based methodology, and a combination of core questionnaire modules, core - expanded questions, and country - specific questions . Data were collected from zambian students (n=2257) in 2004 and from ugandan students (n=3215) in 2003 . 80% for uganda, and student response rate were 75% for zambia and 76% for uganda, yielding an overall response rates of 70% for zambia and 69% for uganda . Irb approvals was obtained from georgia state university to conduct these analyses . In uganda, prior to asking any of the alcohol - related questions, participants were instructed to think of alcohol to include drinking tonto, mwenge, crude, waragi, kasese, lira lira, uganda waragi, whisky, bond 7, tyson, malwa, kwete, komek, bell beer, special, pilsoner, club, chairman (esb), eagle, and citizen and that drinking alcohol does not include drinking a few sips of church wine for religious purposes . Similarly, students in zambia were given the following instructions when responding to the alcohol - related questions to include drinking mosi, castle, katata, kachasu, or katubi and that drinking alcohol does not include drinking a few sips of wine for religious purposes . The outcome measure was problem drinking, defined as the number of times the students had a hang - over, felt sick, got into trouble with family or friends, missed school, or got into fights due to alcohol use . The measure was assessed on a 4-item scale ranging from 0 times to 10 or more times . Responses to either outcome measure were dichotomized to reflect none versus any problem drinking behavior . The main independent variable was alcohol initiation before or at age 13 years old, which was measured by students' response on their age at which they had their first drink of alcohol other than a few sips . The 7-item scale ranged from never drinking to initiating drinking at 16 years of age or older . The analyses controlled for the following potential confounders: current alcohol use, bullying victimization, sadness, lack of friends, missing school, lack of parental monitoring, and illicit drug use . Each preceding variable was dichotomized to reflect none versus any involvement or exposure to the particular factor measured . Table 1 describes each measure and its prevalence within each country among students age 14 and older . Table 1variable description and prevalence of factors examined.variable namevariable descriptionzambia n=2257 weighted% uganda n=3215 weighted% early alcohol use initiationstudents who were 13 years or younger when they had their first drink of alcohol other than a few sips.36.4%21.6%problem drinkingstudents who ever had a hang - over, felt sick, got into trouble with family or friends, missed school, or got into fights, as a result of drinking alcohol.45.1%21.5%current alcohol usestudents who had at least one drink containing alcohol on one or more days during the past 30 days.42.6%24.1%bullying victimizationstudents who were bullied on one or more days in the past 30 days.63.1%44.3%sadnessstudents who felt so sad or hopeless almost every day for two weeks or more in a row that they stopped doing their usual activities during the past 12 months.53.3%51.4%no friendsstudents who have no close friends.15.7%14.7%missed schoolstudents who missed classes or school without permission on one or more days during the past 30 days.58.5%46.4%no parental monitoringstudents whose parents or guardians really knew what they were doing with their free time in the past 30 days.35.2%29.8%illicit drug usestudents who used drugs during their life. 36.7%31.0%the types of drugs included in the questions differed in the two countries . In uganda the question was asked as follows during your life, how many times have you used drugs, such as marijuana (njaga or bangi) or opium (njaye) or sniffed aviation fuel? In zambia the question was asked as follows: during your life, how many times have you used marijuana or hashish (also called daga, ibange, mbanje, or chamba)? The types of drugs included in the questions differed in the two countries . In uganda the question was asked as follows during your life, how many times have you used drugs, such as marijuana (njaga or bangi) or opium (njaye) or sniffed aviation fuel? In zambia the question was asked as follows: during your life, how many times have you used marijuana or hashish (also called daga, ibange, mbanje, or chamba)? Logistic regression analyses were conducted to identify odds of alcohol initiation 13 years old after controlling for sex, age, current alcohol use, bully victimization, sadness, lack of friends, missing school, lack of parental monitoring, and illicit drug use . Logistic regression analyses were also computed to determine the associations between alcohol initiation 13 years old and problem drinking . Model 2 included variables from model 1 along with bully victimization, sadness, lack of friends, missing school, lack of parental monitoring, and illicit drug use . For variables where the amount of missing data exceeded five percent, a dummy category is created to reflect the missing data and thereby including nearly all participants in the analyses rather than omitting them using the default listwise deletion used in the logistic regression computation . While no statistical findings or associations are reported on the missing data, the odds ratio would be interpreted as the risk for the outcome for those with missing data relative to the reference category . Analyses were conducted with the sas 9.1 and sudaan 10.0 statistical software packages to accommodate the sampling design, and produce weighted estimates . In uganda, prior to asking any of the alcohol - related questions, participants were instructed to think of alcohol to include drinking tonto, mwenge, crude, waragi, kasese, lira lira, uganda waragi, whisky, bond 7, tyson, malwa, kwete, komek, bell beer, special, pilsoner, club, chairman (esb), eagle, and citizen and that drinking alcohol does not include drinking a few sips of church wine for religious purposes . Similarly, students in zambia were given the following instructions when responding to the alcohol - related questions to include drinking mosi, castle, katata, kachasu, or katubi and that drinking alcohol does not include drinking a few sips of wine for religious purposes . The outcome measure was problem drinking, defined as the number of times the students had a hang - over, felt sick, got into trouble with family or friends, missed school, or got into fights due to alcohol use . The measure was assessed on a 4-item scale ranging from 0 times to 10 or more times . Responses to either outcome measure were dichotomized to reflect none versus any problem drinking behavior . The main independent variable was alcohol initiation before or at age 13 years old, which was measured by students' response on their age at which they had their first drink of alcohol other than a few sips . The 7-item scale ranged from never drinking to initiating drinking at 16 years of age or older . The analyses controlled for the following potential confounders: current alcohol use, bullying victimization, sadness, lack of friends, missing school, lack of parental monitoring, and illicit drug use . Each preceding variable was dichotomized to reflect none versus any involvement or exposure to the particular factor measured . Table 1 describes each measure and its prevalence within each country among students age 14 and older . Table 1variable description and prevalence of factors examined.variable namevariable descriptionzambia n=2257 weighted% uganda n=3215 weighted% early alcohol use initiationstudents who were 13 years or younger when they had their first drink of alcohol other than a few sips.36.4%21.6%problem drinkingstudents who ever had a hang - over, felt sick, got into trouble with family or friends, missed school, or got into fights, as a result of drinking alcohol.45.1%21.5%current alcohol usestudents who had at least one drink containing alcohol on one or more days during the past 30 days.42.6%24.1%bullying victimizationstudents who were bullied on one or more days in the past 30 days.63.1%44.3%sadnessstudents who felt so sad or hopeless almost every day for two weeks or more in a row that they stopped doing their usual activities during the past 12 months.53.3%51.4%no friendsstudents who have no close friends.15.7%14.7%missed schoolstudents who missed classes or school without permission on one or more days during the past 30 days.58.5%46.4%no parental monitoringstudents whose parents or guardians really knew what they were doing with their free time in the past 30 days.35.2%29.8%illicit drug usestudents who used drugs during their life. 36.7%31.0%the types of drugs included in the questions differed in the two countries . In uganda how many times have you used drugs, such as marijuana (njaga or bangi) or opium (njaye) or sniffed aviation fuel? In zambia the question was asked as follows: during your life, how many times have you used marijuana or hashish (also called daga, ibange, mbanje, or chamba)? The types of drugs included in the questions differed in the two countries . How many times have you used drugs, such as marijuana (njaga or bangi) or opium (njaye) or sniffed aviation fuel? In zambia the question was asked as follows: during your life, how many times have you used marijuana or hashish (also called daga, ibange, mbanje, or chamba)? Logistic regression analyses were conducted to identify odds of alcohol initiation 13 years old after controlling for sex, age, current alcohol use, bully victimization, sadness, lack of friends, missing school, lack of parental monitoring, and illicit drug use . Logistic regression analyses were also computed to determine the associations between alcohol initiation 13 years old and problem drinking . Model 2 included variables from model 1 along with bully victimization, sadness, lack of friends, missing school, lack of parental monitoring, and illicit drug use . For variables where the amount of missing data exceeded five percent, a dummy category is created to reflect the missing data and thereby including nearly all participants in the analyses rather than omitting them using the default listwise deletion used in the logistic regression computation . While no statistical findings or associations are reported on the missing data, the odds ratio would be interpreted as the risk for the outcome for those with missing data relative to the reference category . Analyses were conducted with the sas 9.1 and sudaan 10.0 statistical software packages to accommodate the sampling design, and produce weighted estimates . The prevalence of problem drinking and other factors examined in both zambia and uganda are presented in table 1 . Results from logistic regression indicate that early alcohol use initiation was most strongly associated with current alcohol use in zambia (aor=6.78; 95% ci: 4.2810.76) and in uganda (aor=14.37; 95% ci: 14.3720.06) (table 2). Moreover there were no differences by sex in terms of reporting pre - teen drinking initiation in either country . In uganda, missed school without excuse and also lack of parental monitoring were significant factors associated with early alcohol use . Table 2multivariate associations between sex, age, alcohol risk factors and early alcohol use initiation among students 14 years of age and older in zambia and uganda.alcohol use initiationzambiaugandaaor (95%ci)aor (95%ci)sex boys1.12 (0.821.52)1.24 (0.911.68) girls1.001.00age 141.56 (1.112.19)1.64 (1.102.45) 151.14 (0.801.62)1.36 (1.051.76)> 161.001.00current alcohol use6.78 (4.2810.76)14.37 (10.2920.06)bully victimization1.30 (0.921.84)1.15 (0.831.59)sadness0.84 (0.631.12)0.99 (0.771.28)no friends1.22 (0.771.96)0.84 (0.461.54)missed school1.20 (0.861.68)1.41 (1.081.85)no parental monitoring1.03 (0.781.39)1.71 (1.222.39)illicit drug use1.18 (0.931.51)0.99 (0.641.54)aor, adjusted odds ratios including all variables listed in the table . Logistic regressions were also conducted to determine the associations between alcohol use initiation, other factors and problem drinking using two separate models . Model 1 included sex, age, and alcohol initiation before age 13 . In zambia, in model 1, boys had significantly lower risk than girls for problem drinking (aor=0.69; 95% ci: 0.49 0.97), age 14 was a significant risk factor for problem drinking (aor=1.57; 95% ci: 1.04 2.37) compared to age 16, and alcohol initiation before age 13 was a significant risk factor for problem drinking (aor=2.66; 95% ci: 2.11 3.34). In uganda, in model 1, alcohol initiation before age 13 was the only risk factor for problem drinking (aor= 2.97; 95% ci: 2.34 3.77) (table 3). Table 3multivariate associations between sex, age, early alcohol use initiation and problem drinking among students 14 years of age and older in zambia and uganda.problem drinkingzambiaugandaaor (95%ci)aor (95%ci)model 1model 2model 1model 2sex boys0.69 (0.49 0.97)0.72 (0.540.98)1.03 (0.801.32)0.88 (0.691.14) girls1.001.001.001.00age 141.57 (1.04 2.37)1.83 (1.172.84)0.91 (0.661.26)1.18 (0.841.66) 151.09 (0.79 1.49)1.09 (0.721.64)0.95 (0.711.28)1.02 (0.751.40)> 161.001.001.001.00initiation age <132.66 (2.11 3.34)1.28 (1.021.61)2.97 (2.343.77)1.48 (1.111.98)current alcohol use5.01 (3.527.12)3.45 (2.594.60)bully victimization2.09 (1.413.08)1.42 (1.081.85)sadness1.26 (1.011.57)1.57 (1.301.89)no friends0.78 (0.521.19)0.74 (0.471.16)missed school2.25 (1.58 3.21)1.44 (1.111.89)no parental monitoring1.01 (0.711.42)1.19 (0.891.59)illicit drug use3.06 (2.184.30)3.90 (2.825.39)aor, adjusted odds ratios including all variables listed in the table . Model 2 of the logistic regression analysis included sex, age, alcohol initiation before age 13, current alcohol use, bully victimization, sadness, no friends, missing school, no parental monitoring, and illicit drug use . Results show that after controlling for these risk factors, alcohol initiation was significantly associated with problem drinking (aor= 1.28; 95% ci: 1.02 1.61; aor= 1.48; 95% ci: 1.111.98) in zambia and uganda, respectively . Other significant factors associated with problem drinking current alcohol use, experience with bully victimization, sadness, missing school, and illicit drug use were significant risk factors for problem drinking among youth in both zambia and uganda . This study examined the association between preteen alcohol initiation and problem drinking among youth in zambia and uganda . The results show that early alcohol use is a significant risk factor for problem drinking among zambian and ugandan youth after controlling for potential environmental confounders ., that have found that early alcohol use is associated with risk - taking and other behavior and mental health problems in adolescence as well as later in life in . Moreover in this study, current alcohol use, experience with bully victimization, sadness, missing school, and illicit drug use were significant risk factors for problem drinking among youth in both zambia and uganda . These findings suggest that other risky behaviors are accompanying behaviors related to drinking, which need to be incorporated in multi - component interventional strategies to reduce substance use among zambian and ugandan youth . This study also found that problem drinking is a greater risk among zambian girls than boys, which is supported by a previous study on zambian youth that reported higher prevalence of drinking alcohol among girls than boys . Generally, current alcohol use is more common among boys than girls; therefore, this finding calls for possible sex - specific research and intervention to reduce drinking behavior and problems among girls in zambia . Our study noted that youth in zambia and uganda experience similar risk factors for problem drinking . Moreover, the study found that alcohol problem is associated with several environmental risk factors that need to be targeted through interventional strategies . The findings of the study urges the need for multi - component intervention to reduce pre - teen alcohol use because alcohol use in africa has been linked to poverty and risky sexual practices, which worsen already dire social and personal conditions . Also, including or amplifying strategies to increase protective factors, such as school attendance, parental or guardian connectedness, peer support at school, and parental supervision are critical in preventing adverse health outcomes among african youth . There are several limitations that should be considered when interpreting the findings of this study . The study is based on self - reported data of students in zambia and uganda . Therefore, the findings cannot be generalized to youth who are not attending school or other populations . The surveys were administered in 2003 and 2004, hence the findings do not reflect any changes that may have taken place, such as policies and strategies that affect pre - teen alcohol use after the surveys were conducted . Also, the findings are based on cross - sectional analysis, and temporal relationships cannot be determined nor can causality be inferred . Other factors may be related to alcohol use among youth, such as mental health and physical and sexual violence, that were not included in the analysis . Lastly, several variables had a substantial amount of missing data and the missing - indicator method was applied to include participants with partially missing data in the analyses . Such method, while commonly used, may have biased some of the regression coefficients and impacted the findings . Few investigations have examined the impact of early alcohol use initiation on problem drinking among youth in sub - saharan africa ., indicate that early alcohol use initiation is a significant problem, and the current analyses underscore that early alcohol use initiation is a significant public health problem also in zambia and uganda . While studies conducted primarily in the u.s . Provide important information about the relationship between early alcohol use initiation and problem drinking, analyses conducted in different countries and settings are needed to provide additional perspectives and context to potential cultural and regional differences that impact early substance use and its consequences . In this study, comparisons of two nationally representative samples of youth in zambia and uganda highlight similarities and differences in the associations between early alcohol use and problem drinking . These findings, placed into context, can assist the development and implementation of prevention and intervention strategies that seek to reduce the harmful consequences of early alcohol use among vulnerable youth . Meanwhile, our findings support increased efforts to develop and implement evidence - based interventions to prevent and reduce early alcohol use initiation among vulnerable populations with high levels of current alcohol use.
Late - onset alzheimer s disease (load) typically begins with the onset of symptoms after the age of 60 years and evolves slowly from mildly impaired memory to severe cognitive loss . At death, the most frequent pathological manifestations in the brain include extracellular -amyloid protein (a) in diffuse and neuritic plaques and intracellular deposits of hyperphosphorylated tau protein, a microtubule assembly protein, in the form of neurofibrillary tangles . An estimated 4.5 million americans have load . The annual incidence of load increases from 1% at the age of 6070 years to 1030% at 85 years and older . As the us population ages, it is expected that the number of load cases will increase to 16 million 20 million by 2050, with one in 45 americans affected [3, 4]. A critical barrier to lessening the impact of this disease is the limited development of drugs to prevent or treat load, which is mostly attributable to incomplete characterization of the basic underlying pathologic mechanisms . Determining which genes and gene networks contribute to load risk would reveal basic pathogenic mechanisms, highlighting key proteins and pathways for drug development (druggable targets), and inform the development of genetic testing methods for identifying those at greatest risk of load when preventive measures become available . In recent years, the genetic analysis of load has focused on identification of common variants through genome - wide association studies (gwas) and has identified several novel susceptibility genes implementing specific pathways in the disease . This article reviews these studies, discusses their potentials and limitations, and provides suggestions for future research . The primary sources of the studies addressed in this review were full - text articles and abstracts published in english in the pubmed database between 2010 and february 2013 . Alzheimer s disease, gene, genetics, epigenetics, endophenotype, and genome - wide association study . The abstracts retrieved were read to identify studies addressing the topics included in this review . The studies were read in their entirety to assess their appropriateness for inclusion in this article . A family history of dementia is one of the most important risk factors for load [5, 6]. Families multiply affected by load are at increased risk of dementia, but the distribution of secondary cases is not consistent with mendelian inheritance . Load is more frequent among monozygotic twins than dizygotic twins [79], and first - degree relatives of patients with load have approximately twice the expected lifetime risk of developing the disease . Heritabilities of 5879% for load indicate that in spite of progress made in identifying the underpinnings of the disease, a substantial fraction of load is attributable to unknown genetic factors . For more than a decade, only one genetic risk factor, the apoe 4 allele, located on chromosome band 19q13, was an unequivocally established susceptibility apolipoprotein e (apoe) is a lipid - binding protein and is expressed in humans as three common isoforms coded for by three alleles, 2, 3, and 4 . A single apoe 4 allele is associated with a twofold to threefold increased risk; having two copies is associated with a fivefold or more increased risk . In addition, each inherited apoe 4 allele lowers the age at onset by 67 years [1118]. Apoe 4 is also associated with lower cognitive performance, in particular the memory domain, is associated with mild cognitive impairment [1922], and is associated with progression from mild cognitive impairment to dementia [1929]. Although the population attributable risk of apoe 4 is estimated at 2050%, the presence of 4 is neither necessary nor sufficient for development of the disease . In ethnic groups other than non - hispanic whites, at the beginning of the century, thousands of candidate - gene - based association studies aiming to identify additional susceptibility loci were performed, but only one gene, the sortilin - related receptor (sorl1), which is implicated in intracellular trafficking of amyloid precursor protein (app), could be consistently replicated in independent datasets and implicated in the disease . The main reasons for these inconsistencies between studies are sample heterogeneity with differences in linkage disequilibrium (ld) patterns and allele frequencies, and small sample sizes, leading to limited power to detect small or moderate effect sizes . In the past 5 years, technological advances in high - throughput genome - wide arrays have allowed the hypothesis - free simultaneous examination of thousands to millions of polymorphisms across the genome, and large collaborative efforts capitalizing on this technology have significantly advanced knowledge of the genetic underpinnings of load and the pathways involved by identifying several novel risk loci . The first set of studies identified clu, picalm, cr1, and bin1 as susceptibility loci [3335]. Clusterin (clu), also known as apolipoprotein j, is a lipoprotein highly expressed in both the periphery and the brain . Clu is also hypothesized to act as an extracellular chaperone that influences a aggregation and receptor - mediated a clearance by endocytosis . Unlike for apoe, there are no known coding variants that account for the observed genetic association to clu, suggesting that genetic variation in expression levels may be responsible for the altered risk of load . Bin1 (amphiphysin ii) is a member of the bin1/amphiphysin / rvs167 (bar) family of genes that are involved in diverse cellular processes, including actin dynamics, membrane trafficking, and clathrin - mediated endocytosis which affect app processing and a production or a clearance from the brain . Phosphatidylinositol - binding clathrin assembly protein (picalm) is also involved in clathrin - mediated endocytosis and recruits clathrin and adaptor protein complex 2 to sites of vesicle assembly . It has binding sites for complement factors c3b and c4b and is involved in clearing immune complexes containing these two proteins . Since a oligomers can bind c3b, cr1 may participate in the clearance of a. cr1 may also play a role in neuroinflammation, which is a prominent feature in alzheimer s disease . Interestingly, clu may play a role in this process as an inhibitor . In summary, this first set of gwas identified loci mainly clustering in four pathways, namely, immune response, app processing, lipid metabolism, and endocytosis / intracellular trafficking.table 1major alzheimer s disease (ad) genome - wide association studies (gwas) performedstudyethnic groupsample sizegenes identified outside apoe regionlambert et al . Caucasianstage 1: 2,032 ad cases; 5,328 controls clu, cr1 stage 2: 3,978 ad cases; 3,297 controlsharold et al . Caucasianstage 1: 3,941 ad cases; 7,848 controls clu, picalm stage 2: 2,023 ad cases; 2,340 controlsseshadri et al . Caucasianstage 1: 3,006 ad cases; 4,642 controls bin1, xoc3l2/bloc1s3/mark4, clu, picalm stage 2: 2,032 ad cases; 5,328 controlsstage 3: 3,333 ad cases; 6,995 controlsnaj et al . [44]caucasianstage 1: 8,309 ad cases; 7,366 controls ms4a4a, cd2ap, cd33, epha1, cr1, clu, bin1, picalm stage 2: 3,531 ad cases; 3,565 controlshollingworth et al . [43]caucasianstage 1: 6,688 ad cases; 13,685 controls abca7, ms4a6a / ms4a4e, epha1, cd33, cd2ap stage 2: 4,896 ad cases; 4,903 controlsstage 3: 8,286 ad cases; 21,258 controlslee et al . Caribbean hispanic549 ad cases; 544 controls clu, picalm, bin1, cugbp2, loci on 2p25.1; 3q25.2; 7p21.1; 10q23.1reitz et al . [59]african american1,968 ad cases; 3,928 controls abca7, intergenic locus on 5q35.2 major alzheimer s disease (ad) genome - wide association studies (gwas) performed the second set of large gwas identified additional susceptibility genes (cd33, ms4a4a / ms4a4e / ms4a6e cluster, abca7, cd2ap, and epha1) [43, 44]. In line with the pathways identified by the first set of gwas, all of these five loci are likely involved in the immune system, whereas abca7 is in addition involved in lipid metabolism and app processing (table 2). The cd33 gene encodes a protein that is a member of a family of cell - surface immune receptors that bind extracellular sialylated glycans and signal via a cytoplasmic domain called the immunoreceptor tyrosine inhibitory motif [45, 46]. Cd33 has primarily been studied in the peripheral immune system, where it is expressed on myeloid progenitors and monocytes and also in the brain . In the periphery the ms4a4a / ms4a4e / ms4a6e locus is part of a cluster of 15 ms4a genes on chromosome 11 and encodes proteins with multiple membrane - spanning domains that were initially identified by their homology to cd20, a b - lymphocyte cell - surface molecule . Little is known about the function of ms4a4a gene products; however, like cd33, ms4a4a is expressed on myeloid cells and monocytes and likely has an immune - related function . Epha1 encodes a member of the ephrin family of cell - surface receptors which interact with ephrin ligands on adjacent cells to modulate cell adhesion, migration, and axon guidance and synapse formation and plasticity . Although there is a substantial body of research on the function of ephrin receptors in general, little is known about the epha1 gene product . Like other ephrin receptors, it regulates cell morphology and motility and early work implicated this receptor in regulating vascular morphogenesis and angiogenesis . Epha1 knockout in mice results in abnormal tail and reproductive tract development, but no effects on the brain . Consistent with this notion, in mice, expression is restricted to epithelial tissue . In humans, epha1 is expressed by cd4 t lymphocytes, monocytes, intestinal epithelium, and colon . Combined with the lack of evidence for brain expression, this may suggest that, like cd33, cr1, and ms4a4/ms4a6e, the role of the epha1 gene product in alzheimer s disease may be mediated though the immune system . The cd2-associated protein gene (cd2ap) encodes a scaffolding protein that binds directly to actin, nephrin, and other proteins involved in cytoskeletal organization . In the immune system, cd2ap is required for synapse formation in a process that involves clathrin - dependent actin polymerization . Abca7 is an integral transmembrane atp - binding cassette (abc) transporter belonging to the abc family of proteins that mediate the biogenesis of high - density lipoprotein with cellular lipid and helical apolipoproteins . It binds apolipoprotein a - i and functions in apolipoprotein - mediated phospholipid and cholesterol efflux from cells . In addition, abca7 affects the transport of other important proteins, including app, through the cell membrane and is involved in host defense through effects on phagocytosis by macrophages of apoptotic cells .table 2major pathways identified by gwaspathwaygeneamyloid pathway apoe, sorl1, clu, cr1, picalm, bin1, abca7 immune system / inflammation clu, cr1, epha1, abca7, ms4a4a / ms4a6e, cd33, cd2ap lipid transport and metabolism apoe, clu, abca7 synaptic cell functioning / endocytosis clu, picalm, bin1, epha1, ms4a4a / ms4a6e, cd33, cd2ap major pathways identified by gwas in these large - scale gwas performed in non - hispanic whites of european ancestry, the most strongly associated single - nucleotide polymorphisms (snps) at each locus other than apoe demonstrated population attributable fractions between 1.0 and 8.0%, with effect sizes ranging from an odds ratio of 1.16 to an odds ratio of 1.20, i.e., much smaller than for apoe . In the largest gwas performed to date in caribbean hispanics, associations in clu, picalm, and bin1 were replicated and several additional loci on 2p25.1, 3q25.2, 7p21.1, and 10q23.1which could be replicated in an independent cohort of non - hispanic whites of european ancestry from the national institute on aging late - onset alzheimer s disease family study (nia - load)were observed . Finally, in the largest gwas of african americans performed, reitz et al . [interestingly, in contrast to all gwas loci identified in caucasians, in african americans the abca7 locus had an effect size as strong as that of apoe 4 (i.e., a 7080% increase in risk compared with a 1020% increase in risk through the gwas loci observed in whites). Although this finding may represent a winner s curse (i.e., inflation of the estimated effect in a discovery set in relation to follow - up studies) and needs to be confirmed by independent studies in african americans and functional methods, it may have major implications for developing targets for genetic testing, prevention, and treatment in this ethnic group if proven true . In addition, this study confirmed apoe as a susceptibility gene in this ethnic group, evidence for which prior to this study had been inconsistent across studies, and also replicated cr1, bin1, epha1, and cd33 . For more than a decade, only one genetic risk factor, the apoe 4 allele, located on chromosome band 19q13, was an unequivocally established susceptibility apolipoprotein e (apoe) is a lipid - binding protein and is expressed in humans as three common isoforms coded for by three alleles, 2, 3, and 4 . A single apoe 4 allele is associated with a twofold to threefold increased risk; having two copies is associated with a fivefold or more increased risk . In addition, each inherited apoe 4 allele lowers the age at onset by 67 years [1118]. Apoe 4 is also associated with lower cognitive performance, in particular the memory domain, is associated with mild cognitive impairment [1922], and is associated with progression from mild cognitive impairment to dementia [1929]. Although the population attributable risk of apoe 4 is estimated at 2050%, the presence of 4 is neither necessary nor sufficient for development of the disease . In ethnic groups other than non - hispanic whites, at the beginning of the century, thousands of candidate - gene - based association studies aiming to identify additional susceptibility loci were performed, but only one gene, the sortilin - related receptor (sorl1), which is implicated in intracellular trafficking of amyloid precursor protein (app), could be consistently replicated in independent datasets and implicated in the disease . The main reasons for these inconsistencies between studies are sample heterogeneity with differences in linkage disequilibrium (ld) patterns and allele frequencies, and small sample sizes, leading to limited power to detect small or moderate effect sizes . In the past 5 years, technological advances in high - throughput genome - wide arrays have allowed the hypothesis - free simultaneous examination of thousands to millions of polymorphisms across the genome, and large collaborative efforts capitalizing on this technology have significantly advanced knowledge of the genetic underpinnings of load and the pathways involved by identifying several novel risk loci . The first set of studies identified clu, picalm, cr1, and bin1 as susceptibility loci [3335]. Clusterin (clu), also known as apolipoprotein j, is a lipoprotein highly expressed in both the periphery and the brain . Like apoe clu is also hypothesized to act as an extracellular chaperone that influences a aggregation and receptor - mediated a clearance by endocytosis . Unlike for apoe, there are no known coding variants that account for the observed genetic association to clu, suggesting that genetic variation in expression levels may be responsible for the altered risk of load . Bin1 (amphiphysin ii) is a member of the bin1/amphiphysin / rvs167 (bar) family of genes that are involved in diverse cellular processes, including actin dynamics, membrane trafficking, and clathrin - mediated endocytosis which affect app processing and a production or a clearance from the brain . Phosphatidylinositol - binding clathrin assembly protein (picalm) is also involved in clathrin - mediated endocytosis and recruits clathrin and adaptor protein complex 2 to sites of vesicle assembly . It has binding sites for complement factors c3b and c4b and is involved in clearing immune complexes containing these two proteins . Since a oligomers can bind c3b, cr1 may participate in the clearance of a. cr1 may also play a role in neuroinflammation, which is a prominent feature in alzheimer s disease . Interestingly, clu may play a role in this process as an inhibitor . In summary, this first set of gwas identified loci mainly clustering in four pathways, namely, immune response, app processing, lipid metabolism, and endocytosis / intracellular trafficking.table 1major alzheimer s disease (ad) genome - wide association studies (gwas) performedstudyethnic groupsample sizegenes identified outside apoe regionlambert et al . Caucasianstage 1: 2,032 ad cases; 5,328 controls clu, cr1 stage 2: 3,978 ad cases; 3,297 controlsharold et al . Caucasianstage 1: 3,941 ad cases; 7,848 controls clu, picalm stage 2: 2,023 ad cases; 2,340 controlsseshadri et al . Caucasianstage 1: 3,006 ad cases; 4,642 controls bin1, xoc3l2/bloc1s3/mark4, clu, picalm stage 2: 2,032 ad cases; 5,328 controlsstage 3: 3,333 ad cases; 6,995 controlsnaj et al . [44]caucasianstage 1: 8,309 ad cases; 7,366 controls ms4a4a, cd2ap, cd33, epha1, cr1, clu, bin1, picalm stage 2: 3,531 ad cases; 3,565 controlshollingworth et al . [43]caucasianstage 1: 6,688 ad cases; 13,685 controls abca7, ms4a6a / ms4a4e, epha1, cd33, cd2ap stage 2: 4,896 ad cases; 4,903 controlsstage 3: 8,286 ad cases; 21,258 controlslee et al . Caribbean hispanic549 ad cases; 544 controls clu, picalm, bin1, cugbp2, loci on 2p25.1; 3q25.2; 7p21.1; 10q23.1reitz et al . [59]african american1,968 ad cases; 3,928 controls abca7, intergenic locus on 5q35.2 major alzheimer s disease (ad) genome - wide association studies (gwas) performed the second set of large gwas identified additional susceptibility genes (cd33, ms4a4a / ms4a4e / ms4a6e cluster, abca7, cd2ap, and epha1) [43, 44]. In line with the pathways identified by the first set of gwas, all of these five loci are likely involved in the immune system, whereas abca7 is in addition involved in lipid metabolism and app processing (table 2). The cd33 gene encodes a protein that is a member of a family of cell - surface immune receptors that bind extracellular sialylated glycans and signal via a cytoplasmic domain called the immunoreceptor tyrosine inhibitory motif [45, 46]. Cd33 has primarily been studied in the peripheral immune system, where it is expressed on myeloid progenitors and monocytes and also in the brain . In the periphery the ms4a4a / ms4a4e / ms4a6e locus is part of a cluster of 15 ms4a genes on chromosome 11 and encodes proteins with multiple membrane - spanning domains that were initially identified by their homology to cd20, a b - lymphocyte cell - surface molecule . Little is known about the function of ms4a4a gene products; however, like cd33, ms4a4a is expressed on myeloid cells and monocytes and likely has an immune - related function . Epha1 encodes a member of the ephrin family of cell - surface receptors which interact with ephrin ligands on adjacent cells to modulate cell adhesion, migration, and axon guidance and synapse formation and plasticity . Although there is a substantial body of research on the function of ephrin receptors in general, little is known about the epha1 gene product . Like other ephrin receptors, it regulates cell morphology and motility and early work implicated this receptor in regulating vascular morphogenesis and angiogenesis . Epha1 knockout in mice results in abnormal tail and reproductive tract development, but no effects on the brain . Consistent with this notion, in mice, expression is restricted to epithelial tissue . In humans, epha1 is expressed by cd4 t lymphocytes, monocytes, intestinal epithelium, and colon . Combined with the lack of evidence for brain expression, this may suggest that, like cd33, cr1, and ms4a4/ms4a6e, the role of the epha1 gene product in alzheimer s disease may be mediated though the immune system . The cd2-associated protein gene (cd2ap) encodes a scaffolding protein that binds directly to actin, nephrin, and other proteins involved in cytoskeletal organization . In the immune system, cd2ap is required for synapse formation in a process that involves clathrin - dependent actin polymerization . Abca7 is an integral transmembrane atp - binding cassette (abc) transporter belonging to the abc family of proteins that mediate the biogenesis of high - density lipoprotein with cellular lipid and helical apolipoproteins . It binds apolipoprotein a - i and functions in apolipoprotein - mediated phospholipid and cholesterol efflux from cells . In addition, abca7 affects the transport of other important proteins, including app, through the cell membrane and is involved in host defense through effects on phagocytosis by macrophages of apoptotic cells .table 2major pathways identified by gwaspathwaygeneamyloid pathway apoe, sorl1, clu, cr1, picalm, bin1, abca7 immune system / inflammation clu, cr1, epha1, abca7, ms4a4a / ms4a6e, cd33, cd2ap lipid transport and metabolism apoe, clu, abca7 synaptic cell functioning / endocytosis clu, picalm, bin1, epha1, ms4a4a / ms4a6e, cd33, cd2ap major pathways identified by gwas in these large - scale gwas performed in non - hispanic whites of european ancestry, the most strongly associated single - nucleotide polymorphisms (snps) at each locus other than apoe demonstrated population attributable fractions between 1.0 and 8.0%, with effect sizes ranging from an odds ratio of 1.16 to an odds ratio of 1.20, i.e., much smaller than for apoe . In the largest gwas performed to date in caribbean hispanics, associations in clu, picalm, and bin1 were replicated and several additional loci on 2p25.1, 3q25.2, 7p21.1, and 10q23.1which could be replicated in an independent cohort of non - hispanic whites of european ancestry from the national institute on aging late - onset alzheimer s disease family study (nia - load)were observed . Finally, in the largest gwas of african americans performed, reitz et al . [interestingly, in contrast to all gwas loci identified in caucasians, in african americans the abca7 locus had an effect size as strong as that of apoe 4 (i.e., a 7080% increase in risk compared with a 1020% increase in risk through the gwas loci observed in whites). Although this finding may represent a winner s curse (i.e., inflation of the estimated effect in a discovery set in relation to follow - up studies) and needs to be confirmed by independent studies in african americans and functional methods, it may have major implications for developing targets for genetic testing, prevention, and treatment in this ethnic group if proven true . In addition, this study confirmed apoe as a susceptibility gene in this ethnic group, evidence for which prior to this study had been inconsistent across studies, and also replicated cr1, bin1, epha1, and cd33 . The recent gwas for load using large numbers of cases and controls identified several novel susceptibility loci that are biologically plausible, cluster in specific pathways, and have significantly advanced the understanding of the pathogenic mechanism underlying the disease . Common to all novel loci in non - hispanic whites of european ancestry is the modest effect size with odds ratio ranging from 1.1 to 1.5 leaving the apoe 4 allele by far the strongest risk factor . In contrast, in the largest gwas performed to date in african americans, the abca7 locus was observed to have an effect size similar to that of apoe (7080% increase in risk). The population attributable risk of each of the non - apoe loci is estimated to be 18% . However, this estimate will change with elucidation of the number, allele frequencies, and risk effects of the true functional variants at each locus, and the detection of additional common and rare risk variants and patterns of epistasis . Replication in independent datasets if possible across different ethnic groups and functional validation of the loci identified by gwas is crucial for several reasons . First, gwas are not designed to identify the specific causative variants, but rather are designed screen the genome, capitalizing on the ld between genotyped snps and the potentially causative variants . As ld can extend over large intervals, the true genetic effectors may be located considerably far away from the snp showing the disease association, limiting the ability to detect true associations from gwas . The development of high - throughput genotyping arrays, which have increased the number of genotyped markers to several millions, has decreased this problem to some extent, but not entirely, depending on the ld pattern in the region . Second, signals selected on the basis of statistical significance thresholds in underpowered settings are often subject to the winner s curse (bias away from the null in the estimated effect of a newly identified allele on disease) [6163], and replication can help produce a more accurate, unbiased estimate of the genetic effect of a locus . Third, the probability that an observed association truly exists depends on the power to detect the association, which in turn is a function of minor allele frequency, effect size, sample size, and the observed p value . The distribution of effect sizes of true associations in complex diseases is unknown, but it is likely that most of the large effects in load gwas have been identified, whereas most of the smaller effects remain to be discovered . The significance threshold needed to preserve the genome - wide type i error rate in studies of individuals with european ancestry is estimated at 5 101 10 [64, 65]. This threshold is even lower in ethnic groups with greater genetic diversity such as hispanics, africans, and african americans and, consequently, most individual gwas do not have enough power to distinguish false positives from false negatives . Finally, replication in a population with different environmental or genetic backgrounds may if assessed in a population with a lower extent of ld such as africans help narrow down the location of the causative variant . However, when the aim is to replicate an observed association, it has to be kept in mind that there are several reasons for the observation of no association, including differences in allele frequencies or ld patterns across populations, or allelic or locus heterogeneity . There are several additional approaches that can address some of these issues inherent to gwas . Reclassifying sample subjects into more homogeneous subgroups, for example, based on endophenotypes, gene - based association studies, which consider association between a trait and all markers within a gene rather than each marker individually, can be more powerful than traditional individual - snp - based gwas . For example, if a gene contains more than one causative variant, then several snps within that gene might show marginal levels of significance that are often indistinguishable from random noise in the initial gwas results . If the effects of all snps in a gene are combined into a test statistic and correction is made for ld, the gene - based test might be able to detect these effects . Similarly, genome - wide haplotype - based association studies can characterize loci not detected by univariate analyses . Such gene - based or haplotype - based analyses led to the discovery of nars2, frmd6, and frmd4a as susceptibility loci [66, 67], the latter of which is immediately adjacent to gab2 . Identification and examination of regions with runs of homozygosity (i.e., excess burden of homozygous markers) can help identify recessive causative genes . Evidence is accumulating that a substantial part of the missing genetic variability could be due to epistatic effects or gene environment interactions . Thus, exploration of gene gene and gene environment interactions can identify novel variants not detected by individual testing of snps . However, such studies require large samples sizes and/or large effect sizes to achieve adequate power . Although the latest gwas arrays include dense snp maps of several million snps with minor allele frequency down to 1% and novel functional exonic variants that were identified through sequencing of thousands of exomes, they are limited in their ability to detect associations with variants not tagged by the genotyped snps . In addition, they are limited in their ability to identify structural variants or rare variants with minor allele frequency of less than 1% . However, both rare and structural variants are increasingly recognized as being implicated in complex disease . In fact, two recent studies that performed genome sequencing followed by imputation of identified variants in independent datasets implicated the triggering receptor expressed on myeloid cells 2 gene (trem2) in alzheimer s disease by identifying a causative rare missense mutation (rs75932628) resulting in an r47h substitution affecting the gene s anti - inflammatory function [69, 70]. Additional sequencing studies identified rare causative variants in the nicastrin gene (ncstn) encoding an obligatory component of the -secretase complex involved in splicing of app as well as clu . Although individual rare variants may have an effect size large enough to cause disease, the accumulation of several rare variants each with small or modest effect sizes may cross the susceptibility threshold . Ongoing and future large - scale next - generation whole exome or whole genome sequencing techniques will fill this gap and further provide the means to identify the specific causative variants in the genes / regions identified by gwas . Although appropriate algorithms for the statistical and bioinformatic analysis of sequencing data, in particular for whole genome sequencing data and whole exome or whole genome sequencing data derived from families, still need to be developed and implemented, the recent identification of rare variants in clu, ncstn, and trem2 in load that also cluster in amyloid processing and immune - response / inflammation pathways and were missed by the gwas but identified by sequencing studies clearly belie the common disease common variant hypothesis and prove the necessity of approaches with the ability to detect rare variants [69, 70, 71, 72]. Once causative variants are identified, functional studies can assess the pathogenic effects of the variants and characterize the molecular pathways in which they are involved or with which they interact, further implicating the gene in the disease and potentially providing targets for effective intervention . Over the past 10 years, studies capitalizing on high - throughput genome technologies have significantly advanced knowledge of the genetic underpinnings of load . Gwas have identified several susceptibility genes, and sequencing studies have identified specific causative variants in these genes, but have also provided invaluable evidence for an involvement of rare variants in this complex disease, overturning the common disease ongoing and future large - scale next - generation sequencing approaches (both hypothesis - driven and hypothesis - free) are likely to disentangle a significant part of the missing heritability of load, and have the potential to identify targets for genetic testing, prevention, and treatment.
Providing anaesthesia for tte is always a challenge for the anaesthesiologists because of intraoperative need for one - lung ventilation and its associated problems . Post - operative pulmonary complications in the early post - operative period can lead to increased morbidity and mortality . Pulmonary complications can also occur due to surgical issues that may mislead the perioperative team and result in unnecessary and avoidable interventions . We would like to share our experience of two cases that underwent tte and developed acute respiratory distress in the post - operative period . A 39-year - old woman, known case of oesophageal carcinoma, was scheduled for tte with extended two - field lymphadenectomy with gastric pull - up with cervical neck oesophago - gastric anastomosis and feeding jejunostomy . She had history of hypertension since 4 years and controlled on amlodipine (10 mg) and atenolol (50 mg). The anaesthetic management and monitoring were as per institutional protocol and was administered epidural and general anaesthesia . As a part of operative procedure, she was shifted to intensive care unit (icu) for post - operative monitoring and analgesia . Her oxygen saturation decreased from 97% to 84% over h in spite of oxygen supplementation with hudson mask . On auscultation, air entry was decreased on the right side and the percussion note was tympanic . She was put on oxygen at 15 l / min through venturi mask (fio2 0.60). The respiratory distress was only partially relieved and the air leak from the icd continued . Due to on - going respiratory distress, the patient's trachea was intubated . Hence, we suspected air leak from the cervical drain and it was decided to remove the cervical drain and suture the defect . A 56-year - old man, case of carcinoma mid - oesophagus underwent tte with extended two - field lymphadenectomy with gastric pull - up and oesophago - gastric anastomosis in neck . The patient developed respiratory distress and air leak through right icd and saturation decreased to 86% despite oxygen supplementation . It was decided to conduct bronchoscopy . Before bronchoscopy, we observed bubbles (air leak) from neck drain site . On removal of corrugated neck drain and resuturing the neck wound, air leak stopped and there was no further respiratory distress . A 39-year - old woman, known case of oesophageal carcinoma, was scheduled for tte with extended two - field lymphadenectomy with gastric pull - up with cervical neck oesophago - gastric anastomosis and feeding jejunostomy . She had history of hypertension since 4 years and controlled on amlodipine (10 mg) and atenolol (50 mg). The anaesthetic management and monitoring were as per institutional protocol and was administered epidural and general anaesthesia . As a part of operative procedure, she was shifted to intensive care unit (icu) for post - operative monitoring and analgesia . Her oxygen saturation decreased from 97% to 84% over h in spite of oxygen supplementation with hudson mask . On auscultation, air entry was decreased on the right side and the percussion note was tympanic . She was put on oxygen at 15 l / min through venturi mask (fio2 0.60). The respiratory distress was only partially relieved and the air leak from the icd continued . Due to on - going respiratory distress, the patient's trachea was intubated . Hence, we suspected air leak from the cervical drain and it was decided to remove the cervical drain and suture the defect . A 56-year - old man, case of carcinoma mid - oesophagus underwent tte with extended two - field lymphadenectomy with gastric pull - up and oesophago - gastric anastomosis in neck . The patient developed respiratory distress and air leak through right icd and saturation decreased to 86% despite oxygen supplementation ., we observed bubbles (air leak) from neck drain site . On removal of corrugated neck drain and resuturing the neck wound, air leak stopped and there was no further respiratory distress . Our two cases reveal a rare cause of respiratory distress and air leak in patients who underwent tte . In these cases, slipped chest drains, lung parenchymal injury, tracheobronchial injury are well - documented causes of post - operative air leak and subsequent respiratory distress and pneumothorax . Only two cases of pneumothorax associated with neck drains have been described . In both the cases, air leak was seen following transhiatal oesophagectomy . In our cases, air leak and subsequent pneumothorax were seen after tte . To the best of our knowledge, there is no literature suggesting air leak / respiratory distress following tte and subsequent improvement after removal of neck drain . After oesophagectomy, apart from icd, corrugated neck drain insertion is an acceptable technique . During tte, pleura were opened and gastric pull - up is done thus creating a communication between thorax and neck . Generally, this is not a problem because the stomach tube seals the communication between the chest and the neck and the negative intrathoracic pressure is not transmitted to the neck . However, in certain situations, the corrugated drain may provide ample space for sucking atmospheric air during patient's spontaneous respiratory efforts which creates negative intrathoracic pressure . The performance of extended lymphadenectomy, especially in the upper mediastinum may result in a wider communication between the chest and the neck . The communication between the chest and neck might then transmit negative intrathoracic pressure to the neck . If the defect size is larger than two - third of tracheal diameter, the air will preferential enter through this defect leading to pneumothorax . Use of corrugated neck drain may also precipitate emphysema of neck and thus may compromise the airway as well . The possible causes of post - operative pneumothorax after thoracotomy and oesophagectomy include lung parenchymal leak / injury, bronchopleural fistula, ruptured bullae and malpositioned chest drains . The airway injury (bronchus and lung) during the surgery may lead to continuous air leak through chest drain or cause surgical emphysema of the face and neck . Furthermore, ensuring the absence of air leak from lung before closure of thoracotomy incision needs to be emphasised . Chest drains may occasionally slip out in the post - operative period which can normally be recognised by identifying the tube fenestrations outside the thorax . In our case air leak from lung parenchymal injury usually settles spontaneously in 1 - 2 days post - operatively . Alternative drainage systems or avoidance of neck drains may be considered to prevent this complication . We also emphasise on the need for careful monitoring of respiratory status in patients having corrugated neck drain after tte.
Patients with stroke show various muscle abnormalities, including a combination of denervation, disuse, remodeling, and spasticity1 . Abnormal gaits cause flexion and extension synergy patterns due to compensatory actions of muscles, etc ., on the unaffected side, impairment of proprioceptive sensibility, and abnormal coordination of stiffened muscles of the lower limb3 . As a substitute of stair climbing exercise, inclined treadmill walking training, which is aimed at improving these gait disorders, is being considered as an essential means for indoor and outdoor movements of the disabled, the elderly, or pregnant women who are unable to use stairs4 . However, rhea et al.5 stated that treadmill walking training, compared with walking on flat ground, is characterized by a shorter step length . Oh, kim, and woo6 argued that treadmill walking training has negative effects on gait asymmetry . Sensory elements play an important part in compensating for these weaknesses7, and rhythmic auditory stimulation (ras) can be used as a complementing intervention8 . In this intervention, the external auditory sense of rhythms generates rhythmic and more symmetrical alternate movements in the lower limbs of stroke patients who show gait asymmetry6, 9 . Existing studies have not shown consistent results regarding the effects of treadmill walking training on the gait of stroke patients . In particular, with regard to balance and gait, which are essential for the activity and participation of stroke patients, there are no systematic studies showing the effects of inclined treadmill walking training with ras thus far . Therefore, the purpose of this study was to identify the effects of inclined treadmill walking training with ras on balance and gait in stroke patients . The study population included 30 patients diagnosed with stroke at b hospital located in gangwon - do, south korea who provided written consent and understood the purpose of this experiment . They were randomly assigned to three groups of 10 subjects each: the inclined treadmill with ras training group (experimental group 1, g1), the inclined treadmill without ras training group (g2), and the only treadmill training group (g3). This study was approved by the institutional review board of the korea national university of transportation (approval no . The subjects in each group walked on a treadmill (s23 t; taeha mechatronics, republic of korea). For g1, ras was additionally applied using a metronome (fretway metro, fretway, usa). Regarding treadmill speed for g1, g2, and g3, the patients most favorite speed was adopted in the first week, and this speed was increased by 5% in the second week . An additional 5% increase was made in the third week and no increase was made in the fourth week . Although a treadmill incline of 10% was set in the second and third weeks, this increase was not applied for those who were unable to perform treadmill walking at this inclination . For the beat of the metronome in g1, the subjects cadence measured using a wireless three - axis accelerometer was applied in the first week6 . This beat was increased by 5% increments in the second and third weeks, without any change in the fourth week9 . Each group performed its respective training five times a week over a 4-week period . The timed up and go (tug) test and the berg balance scale (bbs) test were performed to measure the subjects balance ability . For the measurement of their gait ability, spatiotemporal gait abilities such as walking speed, cadence, single limb support of the affected side (sls), and symmetric index (si) were measured using the 6-minute test (6mwt) and the wireless three - axis accelerometer (g - walk; bts s.t.a ., italy). Pasw 18.0 was used for statistical analysis . Chi - squared test and kruskal - wallis h test were performed to test homogeneity between the two groups, and the results showed that the two groups were homogeneous (table 1table 1.general characteristics of the subjectsg1g2g3gender (m / f)6/46/35/4age (yrs)50.8 14.456.3 7.161.2 13.0height (cm)167.8 10.1165.7 8.8160.8 9.6weight (kg)69.8 10.962.3 11.165.8 7.4onset (months)16.4 10.3 13.6 8.517.1 8.4diagnosis (h / i)7/35/44/5hemiside (rt / lt)6/43/64/5 m: male, f: female, h: hemorrhage, i: infarction, rt: right, lt: left). Wilcoxon signed rank test was used to examine changes in the dependent variables within each group, and kruskal - wallis h test was used to compare changes between the two groups . Mann - whitney u test with bonferroni correction was used for post - hoc comparisons . M: male, f: female, h: hemorrhage, i: infarction, rt: right, lt: left comparison of the variables before and after the experiment within each group showed statistically significant improvements in all variables except for the tug in g3 (p<0.05; table 2table 2.comparison of change in balance and gait between the three groupsg1g2g3pre - trainingpost - trainingpre - trainingpost - trainingpre - trainingpost - trainingtug (sec)32.6 12.330.00 12.3 * 28.2 9.326.8 9.131.2 6.330.6 6.2bbs (score)34.6 6.742.4 6.8 * 36.7 6.740.7 6.137.7 8.340.1 8.16mwt (sec)109.5 35.3130.6 35.2 * 120.5 34.5135.3 34.080.6 39.090.0 40.9speed (m / s)1.2 0.61.5 0.7 * 0.9 0.51.0 0.51.1 0.61.2 0.6cadence (s / m)85.5 23.399.4 20.1 * 85.4 24.090.7 23.164.1 29.267.7 28.6sls (%) 24.3 8.341.9 8.2 * 31.6 9.338.9 7.333.3 7.037.2 8.3si0.5 0.20.7 0.2 * 0.4 0.30.5 0.30.4 0.30.6 0.3tug: timed up and go test; bbs: berg balance scale; 6mwt: 6 m walking test; cadence: steps / min; sls: single limb support; si: symmetric index . Mean standard deviation, * intra - group, statistically significant at p<0.05, statistically significant compared with g1 at p<0.05, statistically significant compared with g2 at p<0.05). With regard to group differences, g1 showed statistically significant higher improvements in all variables when compared with g2 and g3, and g2 exhibited statistically significant higher improvements in the tug, bbs, 6mwt, walking speed, and si when compared with g3 (table 2). Tug: timed up and go test; bbs: berg balance scale; 6mwt: 6 m walking test; cadence: steps / min; sls: single limb support; si: symmetric index . Mean standard deviation, * intra - group, statistically significant at p<0.05, statistically significant compared with g1 at p<0.05, statistically significant compared with g2 at p<0.05 the study showed that g1 was more effective than g2 and g3 in improving balance and gait . Previous studies have reported that repetitive rhythms combined with movements of patients with central nerve system damage were effective in improving their ability to perform exercises9,10,11,12,13 . In addition, repetitive rhythms enhanced coordination and improved gait because of improved movements in the pelvis and the shoulder girdle14 . In the present study, g1 showed statistically significant higher improvements in the tug and bbs when compared with g2 and g3, whereas g3 did not exhibit statistically significant differences within the group . This result suggests that the training for g1 was more effective than that for g2 or g3 in improving the balance in stroke patients . In addition, regarding gait, g1 showed statistically significant higher improvements in all variables when compared with g2 and g3, and g2 exhibited statistically significant higher improvements in 6mwt, walking speed, and si when compared with g3 . All three groups showed improvements in gait endurance, which can be attributed to the effects of task - specific training for 30 minutes a day . Rhythms affect brain activities through encoding and, thus, can provide the feedback of nerve roots and generate instinctive movements16 . The more effective outcome in balance, gait speed, and cadence could be due to improvements in sls following the ras - induced rhythmical walking . Thaut et al.17 reported that the application of treadmill walking training with ras in stroke patients led to statistically significant improvements in gait symmetry . This result is in agreement with that of the present study . For the route of ras, as the body subconsciously responds to the signals of rhythms, unlike the general auditory route, these signals are transmitted to the cerebral cortex through the supraspinal auditory system18 . Therefore, improvements in balance and gait could have been more significant in the present study . However, our study had a limitation in that the study sample was small and included only patients with stroke who were capable of walking . Therefore, the results of this study cannot be generalized for all stroke patients . Thus, future longer - term studies with a larger sample size should be conducted.
Topiramate is a sulfamate - substituted monosaccharide, used in the treatment of epilepsy, depression, migraine, and neuropathic pain . Secondary angle closure glaucoma due to topiramate is well recognized and has been related to supraciliary effusions and forward rotation of ciliary processes . Furthermore, the medication is associated with drug - induced myopia, due to anterior displacement of the iris - lens diaphragm . In most cases, this secondary angle closure glaucoma and myopic shift resolves rapidly with discontinuation of the medication and management of intraocular pressure (iop) with topical therapy . A 36-year - old caucasian female presented to the emergency department with a one - day history of severe headache, abdominal pain, and decreased vision in the left eye (os). The patient reported that she had been suffering from headaches for the past 11 months, for which she was being treated by a neurologist . During previous headache episodes, she experienced decreased vision in either eye and a frontal headache centered around or behind the affected eye lasting 810 hours . Her medical history was significant for crohn s disease, migraines, erosive gastritis, and kidney stones . Her medications included mesalamine, sumatriptan, topiramate (prescribed 10 months prior by neurologist), dexlansoprazole, oxycodone / acetaminophen, ondansetron, and promethazine . On examination, visual acuity was 20/30 in the right eye (od) and count fingers at 6 inches os . Iop via tono - pen (tono - pen avia tonometer, reichert technologies, depew, ny, usa) was 31 mmhg od, and 53 mmhg os . Anterior segment examination os revealed mild conjunctival injection, diffuse microcystic edema of the cornea, and a narrow anterior chamber with 12 + pigmented cells . Gonioscopy revealed appositionally closed angles bilaterally, which did not open with goniocompression os, and opened with a plateau iris configuration (double hump sign) od . Undilated funduscopic examination findings were asymmetric with a cup - disc ratio of 0.3 od, and 0.7 os . Topical therapy was initiated with brimonidine / timolol and dorzolamide ophthalmic drops . While iop od improved to 18 mmhg the patient had a history of kidney stones, therefore oral and intravenous carbonic anhydrase inhibitors were avoided . The patient was also advised to discontinue use of topiramate . While the mechanism of acute angle closure was thought to be secondary to topiramate use, underlying chronic angle closure could not be ruled out given the history of repeated episodes of vision loss during headaches, even prior to initiation of topiramate and the advanced cupping of the optic nerve os . Ultrasound biomicroscopy was not available, therefore, based on the clinical examination (gonioscopy), plateau iris angle closure was suspected while recognizing that secondary angle closure from ciliary body effusion may also be a factor . Therefore, in addition to advising discontinuation of topiramate, a laser peripheral iridotomy (pi) was performed os with reduction in iop to 22 mmhg os . Twelve hours later, visual acuity was 20/30 od, and 20/70 os with iop of 09 mmhg od, and 34 mmhg os, despite the discontinuation of topiramate and the use of topical bimatoprost and brimonidine / timolol . Gonioscopy revealed plateau iris configuration with patent iridotomies and an open angle od, but peripheral anterior synechiae with a closed angle despite goniocompression os . At this time because the patient was visiting from out of state and had to return home immediately, follow - up with a glaucoma specialist was arranged . At the patient s initial consultation with the glaucoma specialist 2 days later, visual acuity was 20/20 od, and 20/40 os with an iop of 12 mmhg od, and 50 mmhg os . The plan was to proceed with a trabeculectomy the following day, however, this was postponed as the patient was admitted to the hospital for a flare - up of her crohn s disease . Throughout her hospitalization, iop remained well controlled in the range of 1012 mmhg ou without topical medications od, and on topical bimatoprost, brimonidine / timolol and dorzolamide os . One day after the patient was discharged from the hospital, she was found to have elevated iop 53 mmhg os with a patent iridotomy . The following day, the iop was elevated again to 51 mmhg os and the patient underwent an urgent trabeculectomy with mitomycin c os . Postoperatively, the patient s visual acuity os returned to 20/20 and iop os was controlled with trabeculectomy in the range of 0910 mmhg . Banta et al1, sanka et al2, and rhee et al3 were among the first to report cases of secondary angle closure glaucoma associated with the use of topiramate in 2001 . They described uveal effusions, ciliary process swelling, and forward displacement of the iris - lens diaphragm leading to myopic shift and secondary angle closure glaucoma . By 2003, they found that 85% of cases of topiramate associated secondary angle closure glaucoma occurred within the first 2 weeks of treatment . There were 17 reports of acute bilateral myopia (up to 8.75 diopters), and vision returned to normal within a few days to a few weeks of discontinuation of topiramate . Management of topiramate induced secondary angle closure glaucoma based on fraunfelder et al4 included: 1) prompt discontinuation of topiramate, as iop decreases rapidly after the medication is stopped; 2) maximal medical therapy (oral medications and aqueous suppressants), and avoiding topical miotics in order to avoid relative pupillary block . Furthermore, laser pi was not found to be beneficial if glaucoma was only associated with topiramate . Topiramate induced secondary angle closure glaucoma has been found to resolve within 2448 hours of discontinuation of the mediation, while the myopia resolves within 12 weeks.5 we present the case of a 36-year - old caucasian female with plateau iris configuration, acute onset angle closure, and acute angle closure superimposed on chronic angle closure in the setting of topiramate use . While it is difficult to prove the exact etiology of her angle closure without ultrasound biomicroscopy, which we did not have the luxury of obtaining during this patient s acute attack, it is presumed that her topiramate use may have contributed to the acute attack . Her acute change in vision in a previous emmetropic eye and improvement in visual acuity with discontinuation of the medication support this assumption . Regardless of the mechanism, this case raises a few notable points: 1) the multifactorial etiology of some forms of angle closure; 2) the prescription of topiramate in eyes with underlying narrow angles; and 3) the possibility of delayed secondary angle closure with topiramate use . Our patient did not have a prior ophthalmology examination diagnosis of narrow angles or angle closure glaucoma, but had clinical symptoms of angle closure which preceded the topiramate use, and clinical findings including narrow angles (plateau iris od) and chronic angle closure os, which suggests multiple etiologies as an underlying mechanism for angle closure . Follow - up examination od revealed a more open, narrow, non - occludable angle with a patent pi off topiramate but with a plateau iris configuration, which could explain the presenting angle closure od, while the 360 degree peripheral anterior synechiae os (likely from chronic intermittent angle closure episodes) explains the persistent elevated iop and permanently closed angle os . Finally, topiramate use could have further contributed to the angle closure precipitating the attack by a ciliary body effusion that led the patient to present to our emergency department . Of note, this patient was on other systemic medications with anticholinergic properties which could further contribute to her risk of angle closure . Her case highlights the often multifactorial nature of angle closure glaucoma that can indicate multiple therapeutic interventions . In this patient s case, while topiramate induced secondary angle closure was one suspected mechanism, a peripheral iridotomy was also warranted based on other clinical findings (plateau iris) and to help rule out aqueous misdirection once the topiramate was discontinued . Furthermore, when plateau iris is identified on gonioscopy but the patient is asymptomatic with a normal iop, we typically attempt laser pi first . We find that this will often open up the angle and resolve the occludability . If, however, the peripheral iridotomy fails to open up the angle or the patient is symptomatic or develops elevated iop, we would then perform peripheral iridoplasty . The multifactorial nature of this patient s angle closure also raises the question of whether this patient was a suitable candidate for topiramate therapy and whether her underlying narrow occludable angles should have been a relative contraindication to this drug . It suggests that perhaps, baseline ophthalmic examination with gonioscopy should be performed on all individuals being considered for topiramate therapy . Finally, our patient had been receiving topiramate therapy for roughly 10 months, far longer than the average timeframe of 2 weeks post - initiation of therapy to induce secondary angle closure glaucoma, and by taking into account her history we suspect the patient was having angle closure symptoms prior to commencing topiramate . Only one such report exists by czyz et al7 who reported a delayed onset of topiramate induced angle closure glaucoma, 262 days after initiation of therapy, which resolved with topical aqueous suppressants and discontinuation of topiramate . This finding suggests that patients on topiramate should be monitored and counseled regarding angle closure beyond the initial 24 weeks after initiation of therapy . While angle closure secondary to topiramate therapy has been widely recognized as a potential side effect of this medication, our report suggests that perhaps baseline ophthalmic examination should be performed prior to initiation of therapy, and that findings of narrow occludable angles should be a relative contraindication to treatment with this medication . Patients with angle closure symptoms could be mistaken by non - ophthalmologists as suffering from migraines . Further analysis of combined - mechanism angle closure is warranted to elucidate whether exclusion of patients with narrow angle glaucoma from topiramate treatment would reduce the occurrence of this side effect.
The benzimidazole nucleus is commonly present in a large number of natural products as well as pharmacologically active compounds . It shows a wide spectrum of biological and pharmacological properties such as antifungal, antimicrobial, anthelmintic [4, 5], antiviral [6, 7], topoisomerase inhibition and anticancer activities . Some of their derivatives are marketed as antifungal drug (carbendazim), anthelmintic drug (mebendazole and thiabendazole), antipsychotic drug (pimozide) and antiulcer agent (omeprazole). Owing to their interesting pharmacological properties, the most common method is direct condensation of 1,2-phenylenediamine and carboxylic acids [14, 15] or their derivatives, that require strong acidic conditions and sometimes need high temperature or the use of microwave . The other synthetic route involves a two - step procedure that includes the cyclo - dehydrogenation of aniline schiff's bases, which are often generated in situ from the condensation of 1,2-phenylenediamines and aldehydes, followed by oxidation with stoichiometric amount of oxidants, such as mno2, oxone, nahso3 [21, 22], i2/ki / k2co3/h2o or catalytic use of can and aikit-5 . More recently, there are very few reports involving solid supported catalyzed reaction for synthesis of benzimidazole derivatives . Jacob et al . Synthesized 1,2-disubstituted benzimidazoles by silica supported zncl2 catalyst that was found to be of poor yield . Patil et al . Developed a method for synthesis of 2-alkyl benzimidazoles using silica supported hbf4 . Paul and basu described the synthesis of 1,2-disubstituted benzimidazoles by using silica gel soaked with fe2(so4)3xh2o . Recently, kumar et al . Reported silica supported hclo4 catalyzed synthesis of benzimidazoles . Periodic acid is an easily available hypervalent iodine reagent which is used in the oxidation of various functional groups [32, 33]. However, there are no reported efforts for the synthesis of benzimidazoles by using periodic acid . In this paper, we report an efficient and facile synthesis of 2-aryl benzimidazoles by using silica supported periodic acid (h5io6-sio2) as a catalyst (scheme 1). Further, all synthesized derivatives were screened for anticancer activity against two cancer cell lines, namely, mcf7 and hl60 . Herein, we used unprecedented silica supported periodic acid (h5io6-sio2) as catalyst for synthesis of 2-aryl benzimidazole derivatives . In our initial experiments, we choose 1,2-phenylenediamine (1 mmol) and m - nitrobenzaldehyde (1 mmol) as a model reaction for optimization of catalyst and reaction conditions . The use of 20 mol% of h5io6 catalyst supported on silica resulted in 95% of desired product, 5 g in 15 min at room temperature (table 1, entry 1). Inferior yields were obtained on lowering the catalyst loading at room temperature (table 1, entries 2 and 3). Even, on increasing temperature, the yield was not improved (table 1, entries 6 to 8). In control experiments, the poor yields were found in the absence of h5io6 (table 1, entries 5 and 10) at room temperature and 60c even after prolonged time (10 h). Further, the reactions were carried out with only h5io6 without silica support at room temperature and 60c (table 1, entries 4 and 9) where the yield was not found to be more than 35% . These results confirmed that h5io6 supported on silica significantly increased the efficacy of catalysts which may be attributed to the increase in available surface area . Thus, we found optimized conditions as the 1,2-phenylenediamine (1 mmol), aldehyde (1 mmol) and h5io6 (0.20 mmol supported on silica) in acetonitrile (acn) at room temperature . Feasibility of the methodology was examined for a series of aryl / heteroaryl aldehydes bearing electron donating as well as electron withdrawing groups under the optimized reaction conditions and corresponding products were obtained in good to excellent yields (table 2). Presence of electron withdrawing group in aldehyde system fastened the reaction (entries 5f5h) while opposite effect was observed for electron donating substituents and hindered aldehydes (entries 5b and 5h). We have not observed any remarkable change in the reaction time for the different substituted diamines . The reaction underwent smoothly even with aldehyde bearing two functional groups (entries 5c, 5h, 6c & 7c) and afforded corresponding products in good yields (entry 5h). The reaction was carried out with substituted 1,2-phenylenediamine (entries 6a6e and 7a7c) and afforded 2,5-substituted benzimidazoles in moderate to good yields . Using these reaction conditions exclusively formation of 2-substituted benzimidazoles thus, table 2 illustrates generality and efficiency of this method for the synthesis of benzimidazoles . We have also extended same methodology for the synthesis of bisbenzimidazole (8) derivative by using 1,2-phenylenediamine, aryl aldehyde (2: 1) affording compound 8 in 80% yield (scheme 2). Although the exact mechanism is not clear, a proposed mechanism for the formation of benzimidazole is shown in scheme 3 . The actual oxidant is h5io6-sio2 and not sio2 as confirmed by our controlled experiments (table 1). All the synthesized benzimidazoles were tested for their anticancer activity against two cell lines mcf7 (human breast adenocarcinoma) and hl60 (human promyelocytic leukemia) by mtt colorimetric assay using cisplatin as a standard anticancer drug . The benzoyl substituted benzimidazole (7a7c) showed the highest potency against two cell lines, while carboxyl substituted compounds (6a and 6b) were moderately potent (with the exception of 6c), as compared to unsubstituted benzimidazole (5a5c). Dichloro derivatives (5c and 6c) exhibited more activity as compared to monochloro derivatives (5d and 6d) against mcf7 and hl60 . Substitution of nitro group (5e5 g) showed moderate and mostly similar effect for the given cell lines . Compound 5b with phenolic oh group (ic50 27.63 m for mcf7 and 28.68 m for hl60) was comparable to 5h (ic50 29.67 m for mcf7 and 26.52 m for hl60) which has additional methoxy group at p - position . Replacing ring carbon of benzene ring with nitrogen atom as in 5i (ic50 30.42 m) showed better activity against mcf7 when compared with 5a (ic50 35.67 m), but same compound did not show substantial difference in activity against hl60 . Bis - benzimidazole (8) was found to be more active for mcf7 (ic50 17.45 m) than hl60 (ic50 30.69 m). All the tested compounds are found to be more effective against both cell lines as compared to cisplatin . We have developed a short and efficient method for the synthesis of 2-aryl benzimidazoles from 1,2-phenylenediamines and aryl aldehydes using h5io6-sio2 as catalyst . The mild reaction condition, low cost, easy workup procedure and good to excellent yields as well as the scope for using wide substrates make our methodology a valuable contribution to the existing processes for synthesis of benzimidazole derivatives . Among 18 derivatives, newly synthesized 5-substituted derivatives exhibited excellent activity against mcf7 and hl60 cell lines . The current study provides better insight into the designing of more potent anticancer agents in the future . Thin - layer chromatography (tlc) was performed using 0.25 mm silica gel coated plates . Column chromatography was performed using the hexane: ethylacetate solvent and silica gel (60120 meshes). H nmr (300 mhz) and c nmr (75 mhz) spectra were recorded on varian mercury instrument with dmso - d 6 or d2o as the solvents . Chemical shifts were reported in unit (ppm) with reference to tms as an internal standard, and j values were given in hertz . Ir spectra were recorded on a shimadzu ftir 8400 spectrophotometer in kbr disc and expressed in cm . Elemental analysis was carried out with thermo - electron corporation chns analyzer flash - ea 1112 . Two cancer cell lines, mcf7 (human breast adenocarcinoma) and hl60 (human promyelocytic leukemia), were obtained from national center for cell sciences, india . Mcf7 was cultured in dmem medium while hl60 cells were cultured in a humidified atmosphere (37c, 5% co2) in rpmi1640 medium supplemented with 10% fetal bovine serum . Test compounds were evaluated for anticancer activity against two cancer cell lines using cisplatin as standard anticancer drug . The compounds were evaluated in vitro at a concentration range of 10 m to 100 m . 100 l of cell suspension (5 10 cells) were plated in 96-well plates and allowed to attach for 24 h. the compounds were dissolved in 0.5% dmso . Cells were exposed in triplicate wells to these derivatives at various concentrations for 48 h. after 48 h, 20 l mtt (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) solution (5 mg / ml) was added to each well . After 1 h of incubation, the solution was centrifuged for 5 min under 4000 rpm, and the medium was discarded carefully . The formazan precipitate was dissolved in dmso (200 l), then shaken by oscillator . The absorbance at 570 nm was determined on a microplate reader (bio - rad model 3350, japan). The absorbance values were used to calculate% inhibition at various concentrations and ic50 values . H5io6 (2.50 g, 10.96 mmol) was dissolved in 15 ml of hot water (70c) in a 50 ml round - bottomed flask . To the hot solution was added silica gel (230400 meshes, 10 g) with vigorous stirring . The resultant h5io6 (resultant mixture contains 20 wt% of h5io6) supported with silica gel was dried in oven at 100c for 12 h to obtain a white free flow powder . A mixture of 1,2-phenylenediamine (108 mg, 1.0 mmol), m - nitrobenzaldehyde (151 mg, 1.0 mmol) in acetonitrile (3.0 ml) was taken, and h5io6 (45 mg, 20 mmol% supported on silica 210 mg) was added at room temperature . After completion of the reaction (monitored by tlc), filter the reaction mixture over celite . The filtrate was evaporated under vacuum and subsequently dried to afford crude product which was purified by column chromatography using hexane / ethylacetate as eluent to afford pure benzimidazole 5 g (227 mg, 95%). A mixture of 1,2-phenylenediamine (216 mg, 2.0 mmol), p - phthalaldehyde (134 mg, 1.0 mmol) in acetonitrile (3.0 ml) was taken, and h5io6 (90 mg, 40 mol% supported on silica 420 mg) was added at room temperature . After completion of the reaction (monitored by tlc), the reaction mixture was filtered over celite . The filtrate was evaporated under vacuum and subsequently dried to afford crude product which was purified by column chromatography using hexane / ethylacetate as eluent to afford pure benzimidazole 8 (250 mg, 80%). White solid; mp 291293c; (lit . [21, 22] mp 290 - 291c); ir (cm, kbr): 3044, 1622, 1587, 1537, 1458, 1439, 1407, 1312, 1274; h nmr (300 mhz, dmso - d 6): 12.91 (brs, 1h), 8.15 (d, j = 7.0 hz, 2h), 7.557.47 (m, 5h), 7.19 (brs, 2h); c nmr (75 mhz, dmso - d 6): 151.2, 143.7, 134.9, 130.1, 129.8, 128.9, 126.4, 122.4, 121.6, 118.8, 111.3; (found: c, 80.39; h, 5.18; n, 14.38 . Cal for c13h10n2: c, 80.42; h, 5.19; n, 14.42%). [21, 22] mp 236 - 237c); ir (cm, kbr): 3327, 3057, 2332, 1635, 1280, 1037, 840, 729; h nmr (300 mhz, dmso - d 6): 13.21 (brs, 2h), 8.07 (d, j = 7.7 hz, 1h), 7.67 (brs, 2h), 7.287.40 (m, 3h), 6.997.06 (m, 2h); c nmr (75 mhz, dmso - d 6): 158.0, 151.7, 131.6, 126.2, 122.7, 119.0, 117.1, 112.5; (found: c, 74.25; h, 4.78; n, 13.31 . Mp 275 - 276c); ir (cm, kbr): 3368, 3297, 1558, 1431, 1369, 1265, 1132, 735; h nmr (300 mhz, dmso - d 6): 12.90 (brs, 1h), 7.537.71 (m, 5h), 7.207.29 (m, 2h); c nmr (75 mhz, dmso - d 6): 146.7, 143.1, 135.0, 134.0, 132.3, 130.5, 128.3, 122.8, 121.6, 119.2, 111.6; (found: c, 59.33; h, 3.05; n, 10.62 . Cal for c13h8cl2n2: c, 59.34; h, 3.06; n, 10.65%). 287289c); ir (cm, kbr) 3433, 3055, 1427, 1273, 1091, 829, 744; h nmr (300 mhz, dmso - d 6,): 13.00 (brs, 1h), 8.23 (d, j = 8.2 hz, 2h), 7.63 (d, j = 8.5 hz, 2h), 7.54 (d, j = 5.9 hz, 2h), 7.21 (brs, 2h); c nmr (75 mhz, dmso - d 6): 150.2, 143.7, 134.5, 129.1, 129.0, 128.1, 122.4, 118.9, 111.5; (found: c, 68.27; h, 3.95; n, 12.21 . Cal for c13h9cln2: c, 68.28; h, 3.97; n, 12.25%). [21, 22] mp 299301c); ir (cm, kbr): 3335, 2912, 1602, 1514, 1435, 1340, 1103, 856, 746; h nmr (300 mhz, dmso - d 6): 13.39 (brs, 1h), 8.388.27 (m, 4h), 7.61 (s, 2h), 7.227.20 (m, 2h); c nmr (75 mhz, dmso - d 6): 148.8, 147.5, 142.7, 135.9, 127.2, 124.1, 124.0, 122.8; (found: c, 65.25; h, 3.75; n, 17.52 . Cal for c13h9n3o2: c, 65.27; h, 3.79; n, 17.56%). 208210c); ir (cm, kbr): 3410, 3078, 2686, 1525, 1348, 1078, 972, 746; h nmr (300 mhz, dmso - d 6): 13.07 (brs, 1h), 7.968.04 (m, 2h), 7.837.89 (m, 1h), 7.727.78 (m, 1h), 7.607.63 (m, 2h), 7.237.26 (m, 2h); c nmr (75 mhz, dmso - d 6): 148.9, 147.2, 132.5, 131.4, 130.8, 130.8, 128.6, 124.2, 122.4, 119.1, 111.5; (found: c, 65.26; h, 3.74; n, 17.53 . Cal for c13h9n3o2: c, 65.27; h, 3.79; n, 17.56%). Yellow solid; mp 205207c; (lit . [21, 22] mp 205 - 206c); ir (cm, kbr): 3371, 3088, 1587, 1518, 1473, 1429, 1346, 1274; h nmr (300 mhz, dmso - d 6) 13.29 (s, 1h), 9.01 (s, 1h), 8.60 (d, j = 7.6 hz, 1h), 8.32 (d, j = 7.9 hz, 1h), 7.84 (t, j = 7.9 hz, 1h), 7.72 (d, j = 7.3 hz, 1h), 7.58 (d, j = 7.4 hz, 1h), 7.25 (t, j = 6.7 hz, 2h); c nmr (75 mhz, dmso - d 6): 148.9, 148.2, 143.5, 134.9, 132.3, 131.6, 130.5, 124.0, 123.1, 122.0, 120.7, 119.1, 111.5; (found: c, 66.26; h, 3.75, n; 17.55 . Cal for c13h9n3o2: c, 65.27; h, 3.79; n, 17.56%). Yellow solid; mp: 218220c; ir (cm, kbr): 3273, 2926, 1500, 1450, 1265, 1033, 910, 736; h nmr (300 mhz, dmso - d 6): 12.65 (s, 1h), 9.31 (s, 1h), 7.527.63 (m, 4h), 7.137.19 (m, 2h), 7.05 (d, j = 8.2 hz, 1h), 3.85 (s, 3h); c nmr (75 mhz, dmso - d 6): 151.5, 149.3, 146.6, 139.9, 122.8, 121.6, 117.9, 114.4, 113.7, 112.0, 55.6; (found: c, 69.91; h, 4.99; n, 11.65 . Cal for c14h12n2o2: c, 69.99; h, 5.03; n, 11.66%). Yellow solid; mp 218220c; ir (cm, kbr): 3057, 2667, 1595, 1444, 1315, 1280, 1122, 850, 744, 615; h nmr (300 mhz, dmso - d 6): 13.11 (brs, 1h), 8.72 (d, j = 4.8 hz, 1h), 8.33 (d, j = 8.1 hz, 1h), 8.02 (t, j = 7.7 hz, 1h), 7.497.69 (m, 3h), 7.217.24 (m, 2h); c nmr (75 mhz, dmso - d 6): 151.2, 150.1, 148.3, 138.3, 125.6, 123.6, 122.0, 116.2; (found: c, 78.80; h, 4.60; n, 21.51 . Cal for c12h9n3: c, 78.83; h, 4.65; n, 21.52%). White solid; mp 301303c; ir (cm, kbr): 3405, 1680, 1621, 1450, 981, 770; h nmr (300 mhz, dmso - d 6): 13.18 (brs, 1h), 12.79 (brs, 1h), 8.19 (m, 3h), 7 . 84 (d, j = 8.5 hz, 1h), 7.63 (d, j = 15.2 hz, 1h), 7.587.48 (m, 3h); c nmr (75 mhz, dmso - d 6): 193.2, 167.8, 153.5, 134.5, 130.4, 129.5, 129.2, 129.0, 128.5, 126.7, 124.6, 123.6, 117.1, 114.6; (found: c, 70.55; h, 4.24; n, 11.72 . Cal for c14h10n2o2: c, 70.58; h, 4.23; n, 11.76%). White solid; mp 301303c; ir (cm, kbr): 3319, 3059, 1681, 1633, 1491, 1261, 1130, 748; h nmr (300 mhz, dmso - d 6): 13.43 (brs, 1h), 12.84 (brs, 2h), 8.27 (brs, 1h), 8.10 (d, j = 7.2 hz, 1h), 7.90 (brs, 1h), 7.72 (brs, 1h), 7.43 (t, j = 7.4 hz, 1h), 7.07 (d, j = 8.6 hz, 2h); c nmr (75 mhz, dmso - d 6): 168.3, 158.0, 153.9, 132.9, 132.0, 129.1, 127.3, 125.5, 124.6, 120.1, 117.6, 112.8; (found: c, 66.16; h, 3.93; n, 10.09 . Cal for c14h10n2o3: c, 66.14; h, 3.96; n, 11.02%). White solid; mp 304306c; ir (cm, kbr): 3171, 1915, 1668, 1622, 1433, 1315, 779; h nmr (300 mhz, dmso - d 6): 13.12 (brs, 1h), 12.64 (brs, 1h), 8.288.17 (m, 1h), 7.88 (d, j = 7.6 hz, 1h), 7.727.57 (m, 4h); c nmr (75 mhz, dmso - d 6): 167.7, 167.3, 134.9, 134.6, 132.6, 132.3, 130.0, 129.7, 128.4, 128.1; (found: c, 54.71; h, 2.59; n, 9.14 . Cal for c14h8cl2n2o2: c, 54.75; h, 2.63; n, 9.12%). White solid; mp 194196c; ir (cm, kbr): 3090, 2821, 1907, 1676, 1624, 1425, 1319, 1026, 947, 835, 731; h nmr (300 mhz, dmso - d 6): 13.30 (brs, 1h), 12.77 (brs, 1h), 8.19 (m, 3h), 7.84 (brs, 1h), 7.65 (m, 3h); c nmr (75 mhz, dmso - d 6): 167.8, 152.4, 135.0, 129.1, 128.4, 128.4, 124.7, 123.8, 122.4, 119.9; (found: c, 61.65; h, 3.31; n, 10.25 . Cal for c14h9cln2o2: c, 61.66; h, 3.33; n, 10.27%). Yellow solid; mp 272274c; ir (cm, kbr): 3338, 2949, 1699, 1604, 1514, 1348, 1213, 853, 774; h nmr (300 mhz, dmso - d 6,): 13.38 (s, 2h), 8.39 (s, 4h), 8.20 (s, 1h), 7.86 (d, j = 8.1 hz, 1h), 7.69 (d, j = 8.1 hz, 1h); c nmr (75 mhz, dmso - d 6): 168.0, 151.5, 148.4, 142.3, 139.5, 135.4, 131.8, 128.9, 128.0, 125.6, 124.5, 117.9, 115.3; (found: c, 59.32; h, 3.15; n, 14.81 . Cal for c14h9n3o4: c, 59.37; h, 3.20; n, 14.84%). Yellow solid; mp 221 - 222c; ir (cm, kbr): 3375, 3061, 1645, 1572, 1321, 902, 707; h nmr (300 mhz, dmso - d 6): 13.30 (s, 1h), 8.20 (d, j = 6.2 hz, 2h), 7.94 (brs, 1h), 7.767.54 (m, 10h); c nmr (75 mhz, dmso - d 6): 195.5, 138.0, 132.0, 130.9, 130.4, 129.4, 129.0, 128.3, 126.6, 124.2; (found: c, 80.43; h, 4.65; n, 9.31 . Cal for c20h14n2o: c, 80.52; h, 4.73; n, 9.39%). Light yellow solid; mp 227229c; ir (cm, kbr): 3298, 3057, 1919, 1726, 1614, 1450, 1294, 981, 786; h nmr (300 mhz, dmso - d 6): 12.91 (brs, 2h), 8.10 (d, j = 8.1 hz, 1h), 8.08 (brs, 1h), 7.817.75 (m, 4h), 7.69 (m, 1h), 7.58 (m, 2h), 7.42 (m, 1h), 7.087.02 (m, 2h); c nmr (75 mhz, dmso - d 6): 196.5, 158.0, 154.3, 138.3, 133.0, 132.8, 131.9, 130.0, 129.0, 127.4, 135.3, 120.2, 117.7, 113.0; (found: c, 76.41; h, 4.42; n, 8.88 . Cal for c20h14n2o2: c, 76.42; h, 4.49; n, 8.91%). White solid; mp 164166c; ir (cm, kbr): 3059, 1734, 1651, 1431, 1317, 970,788; h nmr (300 mhz, dmso - d 6): 13.29 (brs, 1h), 8.05 (brs, 1h), 7.74 (m, 3h), 7.707.64 (m, 5h), 7.58 (t, j = 7.6 hz, 2h); c nmr (75 mhz, dmso - d 6): 195.7, 148.9, 137.8, 134.8, 132.6, 132.0, 129.9, 129.4, 128.3, 120.0; (found: c, 65.38; h, 3.25; n, 7.70 . Cal for c20h12cl2n2o: c, 65.41; h, 3.29; n, 7.63%). White solid; mp 245247c; ir (cm, kbr): 3061, 1626, 1440, 1317, 1118, 966, 846, 740; h nmr (300 mhz, dmso - d 6): 13.01 (brs, 2h), 8.33 (s, 4h), 7.61 (s, 4h), 7.23 - 7.20 (m, 4h); c nmr (75 mhz, dmso - d 6): 150.3, 138.9, 130.7, 127.0, 122.6, 115.1; (found: c, 77.31; h, 4.54; n, 17.98 . Cal for c20h14n4: c, 77.40; h, 4.55; n, 18.05%).
. First introduced laparoscopic surgery in the field of urology, progress in laparoscopic radical surgery has been remarkable in urologic oncology . Advances in surgical instruments and techniques have made incision, resection and coagulation easier, enabling the application of this procedure to be extended up to radical prostatectomy . Laparoscopic radical prostatectomy (lrp) has been widely used as a minimally invasive surgery since its introduction by schuessler et al . . The advantages of lrp include decreased postoperative pain, earlier return to daily activities due to minimally invasive surgical wound, shorter hospital stay, decreased blood loss, earlier recovery of potency and an oncological outcome similar to that of open radical prostatectomy (orp). . Demonstrated that lrp is beneficial in the preservation of the urethral sphincter and nerves due to the wide surgical field, resulting in the restoration of continence and potency . Recently, laparoendoscopic single - site (less) surgery, by which surgical instruments can be introduced through a single incision, has improved the esthetic outcome and has replaced conventional laparoscopic surgery . We report herein our initial experience and reason for conversion of less radical prostatectomy (lessrp), using a homemade single - port device, to conventional lrp, with a schematic surgical illustration . The patient complained of frequency intervals of 1 - 2 h and nocturia of 3 times per night . Before this presentation, digital rectal examination had revealed bilateral enlargement of the prostatic lobes . Under a clinical diagnosis of benign prostate hyperplasia after medical treatment, his serum prostate - specific antigen was 4.11 ng / ml, which was a 4-fold increase from the baseline prostate - specific antigen . He underwent a 12-core transrectal ultrasonography (trus)-guided prostate biopsy, which showed a localized prostate cancer (pca) with a gleason score of 7 (3 + 4) in the bilateral peripheral zones . Magnetic resonance imaging for tumor staging revealed benign prostate hyperplasia and hematoma due to trus - guided biopsy, and bone scintigraphy displayed no bony metastasis . We decided to perform a radical prostatectomy under a diagnosis of localized pca (clinical stage t2cn0m0). Informed consent was obtained after a complete description of the various surgical procedures including orp, lrp, robot - assisted lrp (ralrp) and lessrp using a homemade single - port device . Under general anesthesia, the operator stood on the left side of the operating table, and 2 assistants stood on the right side . After a 3-cm vertical skin incision was made in a crease just superior to the umbilicus, dissection was performed up to the peritoneum . A homemade single - port device was prepared using a small alexis wound retractor (applied medical, rancho, santa margarita, calif ., usa) and a powder - free surgical glove (triplex p - free glove, km healthcare, guri, korea). After the wound retractor was inserted through the incision site, the ring of the wound retractor was covered with a 6/2 surgical glove, which was rolled over around the ring, and the glove was forced to completely touch the abdominal wall . After cutting out 3 fingers of the glove, two 12-mm trocars and one 5-mm trocar were fixed with 1 - 0 silk suture material . In a steep trendelenburg position, a 30-degree 10-mm rigid laparoscope was introduced into the center trocar, and the other 2 trocars were used for flexible laparoscopic instruments (laparoangle, cambrige endo, framingham, mass ., usa) and conventional rigid instruments . Lessrp was performed using the homemade single - port device in the same manner as conventional lrp (fig . An additional 12-mm port was created by cutting out another finger of the surgical glove because there was interference between the flexible laparoscopic instruments during vesicourethral anastomosis after the resection of the prostate and seminal vesicle (fig . However, since the working space for the anastomosis and adequate angles between the instruments was not maintained, another two 12-mm transcutaneous ports were created above the anterior superior iliac spine on both sides, so that the procedure was converted to conventional lrp (fig . When a cystography performed 7 days after surgery showed no urine leakage, the catheter was removed . 4), and the pathological examination of the surgical specimen revealed pca with a gleason score of 7 (3 + 4) reflecting prostatic cancer invasion (pt3a). Until now, the patient has been healthy for nine months postoperatively and treated with gnrh agonists and antiandrogens . However, this method has the disadvantages of difficulty in maintaining the surgical field, intraoperative bleeding, postoperative pain / thromboembolism / incontinence / erectile dysfunction and increased hospitalization . To solve these problems of orp however, lrp has the disadvantages of a longer operation time and the necessity for good familiarity with the surgical procedure . The disadvantages of ralrp are the requirement of an expensive da vinci robotic system (intuitive surgical, mountain view, calif ., usa) and a high surgeon's fee compared to orp or lrp in korea . Previous studies have proposed that the lrp may aid in the fine dissection of neurovascular bundles and facilitate a higher quality of watertight vesicourethral anastomosis . Recent operations have been directed toward scar - free procedures, and thus new terms, natural orifice translumenal endoscopic surgery (notes) or less have been coined . Less surgery, a laparoscopic surgery through a single incision site, was proposed as a new term after the 2008 laparoendoscopic single - site surgery consortium for assessment and research (lesscar). In the field of urology, rane et al . Reported the first case of less nephrectomy using an r - port (advanced surgical concepts, dublin, ireland) at the 2007 world congress of endourology meeting . Thereafter, many surgeons have applied this technique to various urological diseases and have reported its usefulness and safety . . Stated that less simple prostatectomy using an r - port is more difficult than the conventional laparoscopic procedure with a total operation time of 120 min . Reported 4 cases of lessrp using a uni - x single laparoscopic port system (pnavel systems, morganville, n.j . They reported a mean operation time of 285 min, a mean estimated blood loss of 287 ml and a mean duration of catheter placement of 14 days . In our lessrp using a homemade single - port device together with lrp, the operation time was 610 min, and the estimated blood loss was approximately 600 ml . First, it does not allow the laparoscope and instruments to be moved freely in a limited space . Third, the long distance between the homemade single - port device and the symphysis pubis is also a problem in suturing . For those reasons, we could not perform precise vesicourethral anastomosis and converted to conventional lrp in the current case . It is thought that, although our technique may require a greater learning curve than conventional lrp and may increase operation time, new flexible or multifunctional laparoscopic instruments will make lessrp feasible and easier.
Steven johnson syndrome (sjs) is characterized by sudden onset of erosion of mucous membranes (predominantly oral mucosa, lips, and conjunctivae) with widespread blistering of the skin involving up to 10% of the body surface area . Trimethoprim - sulfamethoxazole (tmp / smx) is a widely prescribed antimicrobial for the management of several uncomplicated infections . In immunocompetent persons, the adverse reactions to tmp / smx occur in approximately 1 - 3% of persons . In contrast, in hiv - infected population, a much higher incidence of adverse reactions has been reported with frequencies ranging from 40 - 80% . We report a hiv - infected man who developed sjs while receiving tmp / smx therapy . A 33-year - old male presented with complaints of intermittent low grade fever for two months, cough with expectoration for one and half month, loss of weight, and appetite for one month . The patient was afebrile with a pulse rate of 92/min, respiratory rate of 30/min and blood pressure of 120/70 mmhg . Investigations revealed: hemoglobin 9.2 gm / dl, total leucocyte count 7500/cumm with an absolute lymphocyte count of 1500/cumm, platelet count of 2.1 lac / cumm and erythrocyte sedimentation rate of 76 mm at the end of 1 hr . Hiv - elisa was positive . In view of the clinical presentation and investigations, a diagnosis of pneumocystis jirovecii pneumonia (pcp) was considered and the patient was started on tmp / smx doubles strength two tablets thrice daily . After ten days of starting tmx / smx therapy, the patient developed high grade fever, redness and pricking sensation in eyes, and burning sensation in throat . Within the next 48 hours he developed blepharitis, conjunctival congestion, erythema of the eyelids, and oral mucosal erosions [figure 1]. Painful, erythematous, maculopapular, and vesicular lesions appeared all over the body including genitals [figure 2]. There were multiple ulcerations in the buccal mucosa, floor of the mouth, and ventral surface of the tongue . The patient was hemodynamically stable with a pulse rate of 102 per / min and a blood pressure of 110/80 mmhg . The alanine aminotransferase and aspartate aminotransferase levels were 250u / l (10 - 40u / l) and 155u / l (10 - 35u / l), respectively . The patient was treated aggressively with intravenous dexamethasone 6 hourly, intravenous fluids, prophylactic antibiotics, anti - allergic drugs and local treatment of lesions . Re - epithelialization of the previously sloughed areas occurred and the general condition of the patient remained satisfactory . He was discharged after a month by which time the skin had healed with post - inflammatory hypopigmentation . Desensitization to tmp / smx was not attempted and the patient was discharged on dapsone prophylaxis for pcp . Clinical photograph showing conjunctival congestion, erythema of the eyelids, and blepharitis clinical photograph showing cutaneous lesions all over the body with oral mucosal erosions tmp / smx is commonly used for the treatment and prophylaxis of pneumocystis jirovecii pneumonia (pcp) in hiv - infected patients . In addition to its efficacy in preventing pcp, tmp / however, the administration of tmp / smx is hampered by the high incidence of hypersensitivity reactions in these patients . The most common adverse reactions include nausea, vomiting, anorexia, dermatological reactions such as pruritis, urticaria and less commonly steven johnson syndrome (sjs), neutropenia, exfoliative dermatitis, erythema multiforme and toxic epidermal necrolysis . A pubmed search using the keywords trimethoprim - sulfamethoxazole and steven johnson syndrome and human immunodeficiency virus revealed less than ten cases being reported in literature till date . The increased incidence of adverse reactions to tmp / smx in hiv - infected patients is due to the hydroxylamine derivative of sulphamethaxazole, i.e., sulphamethaxazole hydroxylamine . The deficiency of glutathione enzyme in hiv - infected patients results in a decreased capacity to scavenge these hydroxylamine derivatives . In vitro, it has been found that as compared to cd8 cells, purified cd4 cells are more resistant to the sulphamethaxazole hydroxylamine . In hiv infection, the depletion of cd4 cells leaves a greater proportion of circulating t - cells as the more susceptible cd8 subset . In addition, the immune dysfunction observed in hiv - infected patients, i.e., the polyclonal b - cell activation, polyclonal gammopathy, and decreased t - suppressor cell functions leads to an exaggerated humoral immune response to smx or its metabolites . Other factors such as viral load and concurrent medications may also increase cell sensitivity to reactive metabolites . It is not clear whether the adverse reactions to tmp / smx merely indicate or also induce progression of hiv disease . Veenstra et al . Found that patients with adverse reactions to tmp / smx have a more rapid decline in cd4 cell counts and rapid progression to aids and death . In patients with non life - threatening adverse reactions (e.g., fever, rash), rapid or slow oral desensitization to tmp / smx can be attempted . However, in patients with severe life threatening adverse reaction to tmp / smx, alternative drug like dapsone, pentamidine, or atovaquone should be given for pcp prophylaxis . Those who do not tolerate or have recurrent pcp infections despite alternative therapy could be subjected to a trial of desensitization to tmp - smx under close supervision . This case illustrates a clinically important and life threatening adverse effect of tmp / smx in hiv - infected patients . Due to the high incidence of such hypersensitivity reactions
A study on serologic and molecular characterization of denv isolates was initiated in january 2005 at the fundao de medicina tropical do amazonas (fmtam). Parasite - negative patients who had clinical symptoms of malaria were invited to participate in the study . Each patient received essential information and signed a consent form approved by the fmtam ethical committee . All serum samples were collected during the acute phase of illness and tested for denv infection by using 3 methods . The first method was virus culture, for which serum samples were placed on the aedes albopictus cell line c6/36 grown in leibovitz-15 medium containing 5% fetal bovine serum, followed by viral antigen identification with type - specific monoclonal antibodies in an indirect immunofluorescence assay (8). The second method was detection of immunoglobulin m antibodies to denv by an elisa on serum samples from patients> 7 days after onset of symptoms (9). Pcr (rt - pcr) protocol on the basis of that described by lanciotti et al . Briefly, viral rna was extracted by using the qiaamp viral rna mini kit (qiagen, valencia, ca, usa), and reverse transcription was conducted on 5 l of extracted rna with superscript iii (invitrogen, carlsbad, ca, usa) and random primers . After incubation for 1 h at 50c, 2 l of each cdna was subjected to pcr amplification with d1 and d2 primers for 35 cycles consisting of 1 min at 94c, 1 min at 55c, and 1 min at 72c, and a final extension for 10 min at 72c . A second round of amplification was conducted with 10 l (diluted 1:100) of the first amplicon, a mixture of type - specific reverse primers (ts1ts4), and the conserved forward primer d1 . Denv-4 was detected in 3 samples (am750, am1041, and am1619) by virus culture or rt - pcr . It was identified as a co - infecting virus with denv-3 in isolate am750; samples am1041 and am1619 represented single denv-4 infections (table). To confirm these results, generated amplicons were cloned into a ta vector (invitrogen), and> 3 colonies for each sample were sequenced in both directions by using the bigdye terminator cycle sequence kit (applied biosystems, foster city, ca, usa). Denv-3 and denv-4 nucleotide sequences obtained were subjected to a basic local alignment search tool (blast) (www.ncbi.nlm.nih.gov/) analysis that used the megablast algorithm optimized for highly similar sequences . Using this approach, we obtained sequences with identities ranging from 95% to 99% for denv-3 and 94% to 98% for denv-4 for isolates am750-d3, am750-d4, and am1619 . Eu127898 (am750-d3), eu127899 (am750-d4), and eu127900 (am1619). * igm, immunoglobulin m; m - pcr, multiplex typing pcr described by lanciotti et al . (10); s - pcr, single serotype - specific primer pcr; d, dengue serotype; blast, basic local alignment search tool; ns, not sequenced . Isolate am750 is from a person with a co - infection; different clones were sequenced . The 3 denv-4positive samples were obtained from patients who lived and worked in manaus and reported no travel history for> 15 days before onset of symptoms . These samples were obtained during another study that identified 62 denv - positive samples from january 2005 through june 2007 (24 denv-2, 35 denv-3, and the 3 denv-4 cases in our study) among 128 samples tested from patients in 14 municipalities in amazonas . Since its introduction into the western hemisphere in 1981, denv-4 has been associated with dengue fever and only sporadically associated with serious cases of dhf or dss (1). A study in colombia found more dhf patients infected with denv-2 than with denv-3 or denv-4 (11). Conversely, another study showed an association of denv-4 with an epidemic of dhf that occurred in mexico in 1984 (12). There are many host (and perhaps viral) factors in dengue infections that may lead to development of dhf . On the basis of the antibody - dependent enhancement hypothesis, the most important factors would be those generated by the patient s immune response upon secondary infections (13). The 3 isolates reported in our study were from patients with no travel history, which indicates that denv-4 is present in manaus . Detection of denv-4 in brazil co - circulating with other denv serotypes endemic to this country represents an increased risk for dhf or dss because many persons have been sensitized by previous dengue infections but are not protected against infection with denv-4 . The first report of denv-4 in brazil was in the state of roraima in 1982 . Since that time, no other isolate of denv-4 has been reported in any part of brazil (14,15). The resurgence of denv-4 in the amazon region of brazil most likely resulted from the proximity of brazil to denv-4endemic countries (venezuela and colombia). Additional genotyping studies are being conducted to verify this assumption and to obtain information on dengue epidemiology in brazil . Our study documents the detection of denv-4 in manaus, amazonas, and the first isolation of this serotype in brazil in 25 years . These findings reinforce the need for continual epidemiologic studies and use of classic and molecular approaches in the surveillance of emerging or reemerging diseases.
Dental caries is the single most prevalent chronic childhood disease worldwide, and it causes significant economic loss due to heavy expenses of dental treatment . During the past two decades many industrialized countries have experienced a dramatic reduction in the prevalence of dental caries and this is ascribed to improved changing living conditions, adoption of healthy lifestyles, improved self - care practices, effective use of fluorides and establishment of preventive oral care programs while increasing levels of dental caries has been observed in developing countries . Petersen has observed that at the population level, oral health outcomes are related to distal socioenvironmental factors and characteristics of the oral health services available . In addition to the use of oral health services, proximal modifiable risk behaviors such as oral hygiene practices, dietary habits, tobacco use and excessive consumption of alcohol were found . Across countries and oral health systems, the existence of a social gradient (economic characteristics and educational background) in dental caries prevalence was found . The prevalence of dental caries in 5-year - old children in india has been reported to be 50% which is comparatively lower than many other parts of asia . It has been reported that few developing countries recently introduced school based oral health education and preventive programmes aimed at improving oral health behavior and status of the child population and inspiring results were observed from such health projects that have been conducted in indonesia, brazil, madagascar and china . In india, unlike other developing countries no oral health education or preventive programs are in action, the only attempt in the field of oral health at national level was the national oral health survey that has been conducted in different states . Based on the results, some variation was observed in oral health status and behavior between the urban and rural population along with variation among the states where population of rajasthan presented better oral health status than other states . Thus, the present study intended to assess the dental caries experience in deciduous dentition of 6 year old urban and rural schoolchildren of udaipur district and to evaluate the influence of socio behavioral characteristics on dental caries experience . Ethical approval for conducting the present cross sectional survey was obtained from ethical committee of darshan dental college and hospital . Prior permissions were taken from the district education officer for conducting the survey in selected schools . Verbal consent was obtained prior to examination from each subject and parent (mother or father) provided the proxy informed written consent on behalf of school children . This survey is part of a large survey conducted on 6 and 12-year - old schoolchildren of udaipur district . To facilitate collection of representative sample, a combination of multistage and cluster sampling procedure was executed . At first stage, four rural areas and four urban areas were selected randomly from 8 rural and 4 urban panchayat samithis, respectively . Later at second stage, four schools (two primary schools and two upper primary schools) in the each selected location were selected randomly (two each for boys and girls). In regions where there were no separate schools for boys and girls, thus a total sample of 875 first standard children participated in the study, selected from a total of 16 primary schools . Subjects present on the days of the survey were included while physically challenged and systemically ill children were excluded . Clinical examination was conducted by a single investigator under adequate illumination and dmft (decayed, missing, and filled teeth) index was used to evaluate dental caries . In order to minimize the intra examiner variability, 10% subjects who underwent the clinical examinations were randomly selected in each school by the recorder for repeated examinations . Kappa co - efficient for intra - examiner reliability was found to be 92% for dmft . Socio - demographic information such as name, age, gender, place of residence, occupation and education of the parents in addition to information on oral health practices (tooth cleaning practices, use of oral hygiene aids, use of tooth paste and dental visiting habits) was collected prior to clinical examination by personal interviews carried out by investigator himself . Occupation and education status of parents was classified according to occupation and education components of kuppuswamy scale . Statistical package for social sciences (spss 15.0, inc . Unpaired t - test and one way anova were used to evaluate the significant differences in means between two and three or more groups respectively . Binomial multiple logistic regression analysis was executed to assess the influence of various independent variables on the dental caries occurrence . The independent variables that were significant in bivariate analysis were categorized as; gender (boys and girls), location (rural and urban), parent's occupation (professional or semi professional, unskilled or unemployed and other occupations), parent's education (> 10 years of education, 1 - 10 years of education and illiterate), brushing frequency (sometimes or never and more than once a day) and dental visit (never been and had been to dentist at least once during lifetime). The effect of each independent variable was assessed adjusting for all other variables in the model . Among the selected sample of 875 school children, 461 and 412 belonged to urban and rural locations respectively while 463 were boys and 412 were girls . The caries prevalence and mean caries experience of 6-year - old children was found to be 58.9% and 1.69 (1.99) respectively as illustrated in table 1 . There was a significant difference for the caries prevalence between the genders with greater proportion of boys (62.2%) experiencing caries than girls (55.1%), decayed component constituted a major contribution in the total caries experience . Dental caries prevalence and experience of 6-year - old schoolchildren according to location of residence and gender statistical analysis revealed significant differences for mean number of filled teeth between the locations of residence . Though insignificant, mean dmft among rural subjects (1.79) was greater than the urban individuals (1.60) while it was greater in boys (1.77) than girls (1.60). Tables 2 and 3 display the caries experience in relation to parent's occupation and education respectively . Children whose fathers were professionals (1.25) experienced the lowest caries in contradiction to skilled (2.50). Children of semi - professional (1.00) and unskilled (2.23) mothers had lowest and highest caries experience, respectively . When parent's level of education was considered highest caries experience was observed among children of fathers (2.92) and mothers (2.82) who completed primary school education . Lowest mean dmft was among children of fathers who had a professional or honors degree and graduate or post - graduate mothers . One way anova revealed significant differences between the parent's occupation and level of education for filled component of dmft . Mean caries experience in primary dentition of 6-year - old children according to parent's occupation mean caries experience in primary dentition of 6-year - old children according to parent's level of education table 4 documents the frequencies of oral health practices and statistically significant differences were observed by location and gender for most of the practices . Percentage distribution of 6-year - old school children according to various oral health practices in relation to location and gender among the urban children, 75% reported that they cleaned their teeth at least once daily against 63.7% of rural children . Barely half (53.2% and 54.3%) of the 6-year - old children said that they used toothbrush and toothpaste when they cleaned their teeth and only 7.8% children claimed of brushing twice or more than twice daily . Among the urban children who cleaned their teeth, 61% used tooth brush in comparison to 44.4% of rural children . There was significant difference between genders and location of residence for tooth paste usage, 60.5% of urban against 56.4% rural and 53.6% boys against 55.1% girls . Rural children visited the dentist less often than the urban children (p <0.05) and 93.3% of children had never been to dentist . Logistic regression analysis was employed to determine the influence of various socio - behavioral variables on dental caries [table 5]. Only those independent variables that had a significant influence on the dental caries occurrence are presented in the table . Parent's occupation and level of education also played an important role, children of professional or semi professional parents and those who have completed at least 10 years of education were less likely to demonstrate caries . The association between oral hygiene practices and caries occurrence was evident, subjects who cleaned their teeth at least once a day were less likely to have caries than those who cleaned their teeth rarely or never (or = 1.43; ci-1.13 - 1.81). Moreover, children those who never visited a dentist were almost one half times more likely to have dental caries than those who had been to dentist sometime in their life (or = 1.49, ci-1.17 - 1.89). Logistic regression analysis with presence or absence of caries as dependent variable and various socio - behavioral predictors as independent variables among 6-year - old schoolchildren of udaipur district the present study provides epidemiological data regarding dental caries experience in primary dentition of 6-year - old urban and rural schoolchildren of udaipur district, which helps in planning preventive programmes for this population . In addition, emphasis was given to assess the effect of socio - behavioral risk factors on dental caries experience . The survey was not conducted on a national scale and therefore, the data are not representative of the whole country . However, the sample is considered to be representative of the school children from whole district as the study population was randomly recruited from all the divisions of the district . Thus, future studies are recommended for assessment of dental caries and its related factors among non - school going children of the district . School children of first standard have been selected for the present study considering that the children of the first grade would be 6 or 7 years of age . The who recommended index age is 5 and the reason for recommending 5 years is that it is the age of interest in relation to caries in the primary dentition, which may exhibit changes over a shorter time span and it is the age when children begin primary school . However, it has been suggested by who that ages 6 or 7 can be used in countries where school entry is late . The mean dmft accounted to 1.69 approximating the mean dmft value of 5-year - old children of the whole nation (1.8) but is greater than caries experience observed by a previous survey in udaipur region (0.4) and rajasthan state (0.7), however it is much lesser than the mean dmft of 3.51 among chennai school children . There was a significant difference for the caries prevalence between the genders with greater proportion of boys experiencing caries than girls, similar results were observed in previous studies from india and this difference had been attributed to parents exhibiting preferential behavior towards boys in india. [1618] though insignificant, caries experience was higher in children living in rural than urban areas in harmony with the previous studies . And this may be explained by differences in dental care habits, social norms and dental attitudes . However, urban school children had significantly greater filled teeth in contrast to no filled teeth in their rural counterparts . This is in accordance to a recent study from north russia where urban school children had significantly greater filled teeth than rural ones . This difference in filled teeth between the regions might be due to the greater accessibility of dental care in urban than the rural areas . Parent's occupation significantly altered caries status with children of those parents in better occupations experienced lesser caries and comparable results were observed in a past study . Moreover, similar findings were observed among 5 to 15-year - old school going children of chidambaram in india where children of low socioeconomic status experience greatest caries . Parent's level of education significantly influenced the caries experience, a review of risk factors for dental caries in young children associated low father's and mother's education with high caries prevalence . The proportion of children claiming of brushing twice or more than twice daily was 7.8% which is very less when compared to children of jordan and portugal . Very few children paid dental visits and 93.3% had never been to a dentist, which is worse than 58% among chinese children . Rural children visited the dentist much less often than the urban children (p <0.05) in agreement with 6-year - old children of portugal ., suggested that urban centers facilitate access to toothbrushes and toothpaste and the use of these hygiene measures are considered a sign of modern life style . Consequently, 6-year - old urban children used tooth brush and tooth paste significantly more than rural individuals . The proportion of 6-year - old children with caries was 58.9% in the present study which is in accordance to the 50% of the national data . The most important predictors for caries occurrence were place of residence, gender, parent's level of education and brushing frequency . Thus, caries was related to many socio - behavioral factors in agreement with the previous studies. [2830]
After approval was granted by the clinical research center and ethics committee, records of all patients with the diagnosis of crps were reviewed . A total of 5 patients were identified, but only 4 patients agreed to undergo t2 and t3 rf sympathectomy after receiving an explanation of the risks and benefits of the procedure . The 4 patients were all male and all presented with total unilateral upper limb paralysis . The brachial plexus injuries involved were, in all cases, the result of motor vehicle accidents . The diagnosis of crps was based on the international association for the study of pain (iasp) diagnostic criteria . Stellate ganglion blockades had been administered but were not found to provide satisfactory pain relief . All patients were subsequently offered diagnostic t2 ganglion blockade, followed by rf sympathectomy of t2 and t3 ganglia . Both the diagnostic block and rf sympathectomy were performed with the patient in the prone position . The diagnostic block was performed at t2 level and an adequate volume of local anesthetic and dye was injected to ensure that spread of the local anesthetic reached t3 level . Under fluoroscopic guidance, the t2 vertebral body was identified in an anteroposterior view . In order to square the t2 vertebral body, the fluoroscope was obliqued at approximately 20 toward the ipsilateral side and was then rotated approximately 20 in a cephalad direction . The skin entry point was at the lateral edge of the t2 vertebral body just cephalad to the third rib . From surface anatomy, the skin entry point was kept within 4 cm from the spinous process to reduce the risk of pneumothorax . A 25 gauge, 10 cm spinocan needle (b. braun, melsungen ag, germany) was advanced toward the lateral border of the t2 vertebral body above the third rib in a tunnel view . With the aid of lateral, anteroposterior, and oblique fluoroscopic views, the needle was further advanced with the needle sliding along the lateral aspect of the vertebral body . The final location of the needle tip was at the posterior third of the vertebral body and midline in cephalocaudad relation in lateral view (fig . 1). Once satisfactory placement of the needle tip was achieved, 0.5 to 1 ml of ommipac 240 mg / ml was injected . The dye was observed to spread up and down the thoracic vertebral column, in both the anteroposterior and lateral views . A total of 5 ml of levobupivacaine 0.25% with triamcinolone acetate 40 mg was then injected . The diagnostic block was considered effective if a greater than 75% reduction in vas (visual analogue scale) pain score for the whole upper limb was achieved for at least 6 hours . For rf sympathectomy, a 22 gauge, 10 cm curved, sharp rf insulated needle with an active tip of 10 mm and cosman g4 rf generator (cosman medical, inc ., burlington, ma, usa) were used . Needle entry was performed and the final placement of the needle tip was located as per the technique described previously . Once the correct position was confirmed, a 10 cm csk - tc10 electrode was introduced through the rf needle . Before lesioning, a sensory (at 50 hz, up to 0.6 v) and motor (at 2 hz, up to 1.2 v) test stimulation was performed to verify the location . If the patient experienced no dermatome - related sensation and had no intercostal muscle contractions, the needle positions were deemed satisfactory . Prior to lesioning, a total of levobupivacaine 0.25% 3 ml and triamcinolone acetate 40 mg were injected . Two lesions were made with the needle angled in the medial - cephalad and medial - caudad directions to increase the lesion area . The rf lesioning settings were set for 60 seconds at 80. the rf procedure was performed at both the t2 and t3 levels in this manner . All patients experienced greater than 75% pain relief after diagnostic block at the t2 level and rf sympathectomy . At the 6-month follow - up, all patients were still experiencing more than 50% pain relief compared to their pain score prior to rf sympathectomy (table 2). At the time the study was conducted, the mean duration of follow - up was 7.5 months . All of the study patients underwent only one rf sympathectomy, except for patient 1, who underwent another rf sympathectomy 9 months later . After the second rf sympathectomy, patient 1 experienced a pain relief effect similar to that of the previous procedure . All patients were able to decrease their oral analgesic dosage by more than 50% during the course of follow - up (table 3). Neuropathic pain secondary to brachial plexus injury is one of the most severe types of pain experienced . The treatment for crps involves a multidisciplinary approach combining pain management, psychological treatment and support, and rehabilitation, in order to control pain and to restore limb function and prevent complications, e.g., contractures and osteoporosis . Before crps begins to develop, early surgical repair of injured brachial plexus has shown promising results in both pain reduction and functional recovery . This is also true for spinal cord stimulation, as various reports have shown favorable outcomes of spinal cord stimulation in the management of crps . However, expertise in brachial plexus surgical repair and spinal cord stimulation is not widely available, as in our institution . Rehabilitation in patients with brachial plexus injury is often hampered by the development of crps . Early diagnosis and treatment of crps has been shown to result in better treatment outcomes . While there is no curative treatment for crps, sympathetic blockade is found to be effective in controlling pain by decreasing abnormal hyperactive sympathetic tone . A comprehensive understanding of the anatomy of the upper limb sympathetic system is crucial in the management of crps secondary to posttraumatic brachial plexus injury . With considerable anatomical variations in the sympathetic supply to the upper limb, and also with the existence of the nerve of kuntz, conclusions concerning the efficacy of stellate ganglion blockade, especially as a long - term treatment for crps, sympathetic ganglion cell bodies that supply the upper limbs originate in the intermediolateral horn of the spinal cord from level t2 to t8 ., they ascend cephalad and synapse with postganglionic fibers, primarily in t2, but also in t3, in the stellate ganglia and in the middle cervical ganglia . By blocking both ganglia which are the crucial synaptic stations, this could explain the reasonable efficacy of rf sympathectomy in controlling upper limb crps in the present study, even at 6 months post - sympathectomy . Besides crps, thoracic sympathectomy has been used for treatment of neuropathic pain in the thorax or upper abdominal viscera, pain related to herpes zoster or postherpetic neuralgia, and phantom breast pain after mastectomy . Other indications include vascular insufficiency leading to ischemia, raynaud's disease, buerger's disease, and frost injuries of the upper limbs . Additional non - pain related conditions which are indications for thoracic sympathectomy include hyperhidrosis and facial flushing . Despite a lengthy literature search, only a few studies were identified describing upper thoracic sympathectomy for severe crps . In one study, agarwal - kozlowski et al . Demonstrated that significant pain reduction was achieved by using computed tomography - guided catheter injection of 80.75% ethanol . The spread of ethanol might cover a wider area of neurolysis with a higher success rate, but the spread would not be predictable . Thus, unwanted destruction or irritation of surrounding structures might occur . In another study, in a series of twenty - four patients with sympathetically mediated pain, herz et al . This technique, however, was invasive and subjected patients to surgical complications, which were mentioned in the study . Thoracoscopic sympathectomy gained wide acceptance among surgeons and was claimed to be less invasive than the open technique . Both open and endoscopic approaches require surgical expertise, which might not be available in every institution . In addition, both approaches pose a significant challenge to anesthetists and subject patients to surgical complications . As for the percutaneous technique, wilkinson performed 148 rf sympathectomies in patients with various conditions, with symptomatic pneumothorax occurring in 6 patients . The drawbacks of this procedure are the procedurerelated complications and the difficulty in achieving correct placement of the needle tip in a relatively crowded thoracic region . This complication, however, could be minimized by keeping the needle entry point within 4 cm from the spinous process and advancing the needle with the " hugging the vertebral body " technique . Besides pneumothorax, injury to the intercostal nerve is also a possible complication, if sensory and motor stimulations were not performed adequately prior to rf lesioning . With further advancements in imaging techniques, e.g., ct scan and fluoroscopy with cone - beam ct, more precise sympathectomies with fewer complications should be achievable in the near future . Successful sympathectomy is usually accompanied by temperature elevation of the ipsilateral limb . As this report was not planned for research or publication purposes initially, no objective thermographic measurement of limb temperature was done, but all respondents reported experiencing noticeable elevation in limb temperature . Considerable anatomical variation in the sympathetic supply to the upper limb has been observed, which may explain the high incidence of recurrence of pain in the upper limb after thoracic sympathectomy . Crps is a collection of various types of pain, with sympathetically mediated pain being the major component . Thus, although sympathectomy might result in a significant reduction in pain, it would not completely eradicate all of the pain, as observed in the present study . This case series illustrates the success of percutaneous t2 and t3 rf sympathectomy via the multimodal approach to chronic pain management in controlling the pain suffered by patients with crps secondary to brachial plexus injury . When surgical repair of the brachial plexus and spinal cord stimulation are not available, percutaneous t2 and t3 rf sympathectomy could be considered in patients with type ii crps.
Malignant melanoma is an aggressive skin cancer accounting for about 4.5% of all new cancer cases and 1.7% of all cancer deaths in the united states . Malignant melanoma can metastasize to various sites including, but not limited to, the brain, lung, and gastrointestinal tract . Intra - thoracic metastases in malignant melanoma most commonly present as multiple or solitary pulmonary nodules and rarely as isolated pleural effusions . Though there are few reported cases of recurrent malignant melanoma presenting with isolated pleural effusion, what makes our case intriguing, is its presentation in the context of coexisting chronic lymphocytic leukemia (cll). A 65-year - old caucasian woman presented in march 2007 with a 3-month history of painless left - sided cervical lymphadenopathy . She denied any associated fevers, chills, loss of weight, dyspnea, dysphagia, or any other symptoms . The patient's surgical history was pertinent for a completely resected stage ia melanoma over the left shoulder 16 years before this presentation . Physical exam revealed enlarged and non - tender cervical and axillary lymph nodes without splenomegaly . A complete blood picture showed a white blood cell count of 14.7 103/l, an absolute lymphocyte count of 7.35 103/l, hemoglobin of 13.8 g / dl, a platelet count of 258 103/l, and lactate dehydrogenase of 291 u / l . Flow cytometry of the peripheral blood demonstrated a monoclonal lymphocyte population expressing cd5, cd19, cd20, cd24, cd43, and cd52 with lambda light chain restriction and no increase in cd34-positive blasts . Based on the above findings, the patient was diagnosed with rai stage i cll and placed under observation . Two years after her initial diagnosis, the patient presented with progressive dyspnea, associated with pleuritic chest pain and a 20 lbs weight loss over a period of 3 months . Physical examination revealed increased axillary and cervical lymphadenopathy and decreased breath sounds over the right lung . White blood cell count was noted to be 53.4 103/l, and she had an absolute lymphocyte count of 40.7 103/l . The pleural fluid analysis was consistent with an exudative effusion, with increased atypical lymphocytes . The majority of the lymphocytes were cd4 + t - lymphocytes (cd4:cd8 in a ratio of 15: 1), but polymerase chain reaction failed to show any clonal t - cell receptor- or t - cell receptor- gene rearrangements . Secondary to rapid reaccumulation of pleural fluid, increasing lymphadenopathy, and rapid doubling time of lymphocyte count, the decision to treat symptomatic cll was made . Chemotherapy with pentostatin, cyclophosphamide, and rituximab did not result in any meaningful clinical response . As the patient's pleural effusion was refractory to cll treatment, video - assisted thoracoscopic surgery was performed, which demonstrated diffuse nodular thickening of both visceral and parietal layers of the pleura (fig . A biopsy of these lesions revealed enlarged cells with an increased nuclear - cytoplasmic ratio and pleomorphic nuclei with occasional cherry red nucleoli (fig . Electron microscopy revealed type ii melanosomes with cross - striated lattice in an enclosed membrane (fig . 1e), type iii melanosomes with increased deposition of electron - dense melanin, and type iv melanosomes with highly electron - dense melanin (fig . Computed tomography of the chest revealed extensive lobulated tumor lining the entirety of the right parietal pleural surface without any evidence of parenchymal involvement . The patient's medical condition rapidly declined, and she ultimately succumbed to death before initiation of any therapy . Cll is a low - grade lymphoproliferative state characterized by the accumulation of functionally incompetent monoclonal b - lymphocytes . Immunosuppression in cll is hypothesized to be a result of immunosuppressive factors released by the neoplastic b cells that downregulate t - cell function . Loss of chain and costimulatory molecule cd28 on t - cell lymphocytes along with reduced il-4 and ifn- expression by cd4 + t cells in patients with cll also seem to play a role in the t - cell dysfunction in cll . The immune system plays a crucial role in immunosurveillance against malignant transformation and tumor propagation and, hence, t - cell dysregulation and dysfunction in cll patients increase their risk of recurrent or secondary malignancies . In several retrospective studies involving patients with cll, increased incidence of secondary cancers like kaposi sarcoma, head and neck cancer, lung cancer, and malignant melanoma was noted [7, 8]. Reported that the overall risk of any second - incident cancer in cll patients was higher than in the general population (second - incident cancer: 2.17, 95% ci 2.072.27), and the risk of melanoma was found to be 7.74 times that of the general population (95% ci 6.858.72). Hence, prompt detection and treatment of the malignant melanoma are crucial in patients with cll . Metastases to various viscera have been known to occur even after the resection of the original tumor . However, isolated pleural metastasis with pleural effusion as a metastatic recurrence is very rare . In a series of 130 patients with malignant melanoma and thoracic complications, 15% were found to have pleural effusions, and less than 3% had isolated and unilateral pleural effusion . Only a handful of cases with recurrent isolated metastatic pleural involvement presenting after a prolonged period after resection of the primary lesion were reported, with the longest reported progression - free survival being 14 years [12, 13]. In our patient, isolated pleural metastases were noted 16 years from the complete resection of the skin lesion . Computed tomography of the chest may aid in the diagnosis of pleural metastasis by demonstrating thickened pleura and parenchymal involvement . Positron emission tomography may also aid in the detection of fdg - avid pleural metastasis . Thoracentesis, unless contraindicated, should be considered in all cases of suspected malignant pleural effusions . Effusions in malignant melanoma are relatively richer in cd8 + than in cd4 + t - lymphocytes . In our case, the majority of the cells in the pleural effusion expressed cd4 +, and only 12% of the lymphocytes expressed the markers expressed by tumor cells . The latter can be explained by the deficient migratory capacity of the b - cll cells, which might have led to a relative enrichment of reactive t cells . Video - assisted thoracoscopic surgery and pleural biopsy may be useful for diagnosis and to perform molecular studies . Concomitant history of cll, pleural fluid studies suggestive of cll, and a distant history of malignant melanoma made the diagnosis challenging in our patient . We speculate that immune dysregulation associated with cll could have led to recurrence of melanoma in our case . Our case underlines the importance of having a suspicion for malignant melanoma in patients presenting with isolated pleural effusion, especially in the setting of an underlying lymphoproliferative disorder and a previous history of melanoma.
Cervical spinal cord diseases are common neurological disorders in dogs . The severity of these disorders can be graded into five levels based upon the following clinical signs: grade 1, neck pain; grade 2, ambulatory tetraparesis (or hemiparesis); grade 3, non - ambulatory tetraparesis (or hemiparesis); grade 4, tetraplegia; and grade 5, tetraplegia without deep pain . Conservative therapies are noninvasive and include medication, rehabilitation, and confinement . Surgical treatments such as decompression and fixation are considered invasive . The choice of treatment depends on the severity of the disease, condition of the dog, and economic considerations . Certain dogs need surgery, whereas some owners choose to try noninvasive therapy such as acupuncture (ap). However, there is no standard protocol and the underlying chinese medical theories about the existence of meridians, qi deficiency, and qi stagnation, which are most commonly encountered in cervical spinal deficiency, have yet to be confirmed scientifically . The ap protocol utilized depends on the diagnosis according to traditional chinese veterinary medicine (tcvm) and veterinarians' experiences . There are many commonly used ap points (acupoints) for cervical spinal disorders, including local points (acupoints around the lesion) and distant points (acupoints distal to the lesion). In this study, we sought to simplify the points and standardize the protocol for treating different levels of cervical neurological deficits . The specific purpose of this study was to evaluate the effects of new ap protocols for the treatment of cervical spinal cord diseases in 19 dogs . Clinical neurology case records were retrospectively collected from the university veterinary hospital for 2009 to 2014 . Lesions in all 19 dogs were localized to the cervical spinal cord, resulting in neck pain . The dogs had histories of neck stiffness, screaming, or poor cervical range of motion . However, they continued to suffer hemiparesis or tetraparesis . Dogs presented with ataxic gait affecting four limbs or non - weight bearing paresis in ipsilateral limbs or all four limbs . Additionally, four dogs underwent mri (vet - mr 0.2 tesla; esaote, italy), and one underwent mri and ct (activion 16; toshiba, japan). The dogs were referred for at least four tcvm treatments consisting of ap or ap combined with chinese herbal medicines . Distant points included li4 (he gu), si3 (hou xi), liv3 (tai chong), bl11 (da zhu), and th5 (wai guan) (table 1, fig . The local points were stimulated using stainless steel needles (0.3 mm in diameter, 25 mm in length; yu guang, taiwan) with a perpendicular insertion depth of 0.51.0 cm . Distant points were stimulated using stainless steel needles (0.27 mm in diameter, 13 mm in length; yu guang) with a perpendicular insertion depth of 0.250.50 cm . The choice of acupoints and method used depended on the grade of severity, onset period, and weakness of limbs . Briefly, grade 1 comprised neck pain / stiffness and no other deficit, grade 2 included ambulatory tetraparesis (or hemiparesis) and grade 3 was non - ambulatory tetraparesis (or hemiparesis). Treatment option 2 was used in dogs presenting with chronic, long - term signs lasting longer than 2 weeks . Treatment option 1, dry needling in local points c1-c3-c5 (jjj) and in distant points si3, liv3 and li4; treatment option 2, option 1 with eap in local points jjj; and treatment option 3, option 2 with eap in distant points bl11+th5 (bl11 to th5 connected). With the dry needle method, the procedure was identical to that of ap, except that electrical stimulation was applied to the needle while inserted . An electrostimulator (ching ming tens model-05b; ching ming, taiwan) was used to provide stimulation for 15 min at 0.2 vp - p (voltage peak to peak) with a frequency of 20 hz (interrupted wave type). The intensity of electrostimulation was adjusted according to the dog's response to avoid discomfort . Eap points included two pairs of points, a bilateral jjj and bl11 (da zhu) and th5 (wai guan). The ap treatment was performed two times per week initially, then once per week after significant improvement was achieved . Chinese herbs, which consisted of double pii (jing tang, usa; the classical antecedent was da huo luo dan) and cervical formula (jing tang; no classical antecedent) (table 2), were given to 15 of 19 dogs . The dosage was 1 g per 5 to 10 kg of body weight, which was administered orally twice daily until recovery . In four cases, specifically, one dog had a hypersensitivity to the chinese herbs (case 11) and three dog owners were reluctant to apply chinese herbal treatments (cases 3, 13 and 17). Dogs treated less than four times (at the owner's discretion) without any improvement were excluded from the analysis . The duration of signs prior to tcvm treatment (defined as the time period from disease onset tcvm treatment start) was recorded . After tcvm treatment, improvement time (defined as the time needed to walk without assistance in paretic cases or pain alleviating in neck pain cases) and recovery time (defined as the time required to return to normal daily life or absence of pain in neck pain cases) were recorded . Spss (ver . 18.0; spss, usa) was used to analyze the data . Signalment, lesion location, examination, diagnosis, severity, treatment methods, and time courses were retrieved from the medical records (table 3). The improvement in grade 1 cases (neck pain) progressed from improved neck stiffness and screaming to increased range of neck motion and increased activity, such as wagging tail freely, reduced pain medication or free from pain medication, to willingness to play (no pain). In grade 2 cases (ambulatory tetraparesis), the improve process went from gait ataxia to a well - coordinated gait . In grade 3 cases (non - ambulatory tetraparesis), the improvement proceeded from increased activity, lateral recumbence to sternal positioning, trying to stand, ataxic gait, small strides, and walking well to a little running . The mean body weight was 8.4 kg (range, 2.525.5) and the average age was 9.8 years (range, 516). The mean duration of signs before tcvm integration was 12.7 17.6 days (range, 360), the mean improvement time was 11.3 7.2 days (range, 430) and the mean recovery time was 16.9 23.0 days (range, 790). The clinical findings included neck pain / stiffness in five dogs, ambulatory tetraparesis in three dogs, non - ambulatory tetraparesis in nine dogs, and non - ambulatory hemiparesis in two dogs . In grade 1 cases (n = 5), the mean improvement time was 8 days (range, 414), while the mean recovery time was 25.6 days (range, 1175). In grade 2 cases (n = 3), the average improvement time was 7 days, and the average recovery time was 14 days (range, 714). In grade 3 (including tetraparesis and hemiparesis) cases (n = 11), the mean improvement time was 14 days (range, 430) and the mean recovery time was 35.7 days (range, 790) (table 4). Because the data were not normally distributed, they were analyzed using the kruskal - wallis test . The duration of signs to tcvm integration was significantly longer (p <0.05) in dogs weighing greater than 10 kg (n = 5) than in those weighing less than 10 kg (n = 14). N = 9) or <10 years (n = 10)] had no significant effect on the duration of signs, improvement, or recovery times . The two treatment methods, eap plus ap (n = 8) and ap only (n = 11) however, the improvement and recovery times were significantly longer in the ap+eap group (p <0.05). The effects of treatments with ap or ap+eap were compared by severity in table 5 . The three different severity grades had similar improvement times following ap treatment, while for the duration of signs, grade 1> grade 2> grade 3 . The recovery times of grade 3 dogs were longer than for grade 1 and grade 2 dogs . With ap+eap treatment, improvement time for grade 1 dogs was similar to that of grade 3, but the recovery times were far longer than for grade 3 dogs, while the duration of signs was longer than for grade 3 dogs . Dogs in group 3 receiving ap + eap had similar durations of signs and improvement times . However, the recovery times were longer in the dogs receiving option 3 treatment . Among the 19 dogs, the duration of signs, improvement time, and recovery time did not differ between groups receiving ap with chinese herbs (n = 15) and ap without chinese herbs (n = 4). Additionally, there was no significant difference between 2 groups with respect to neurological localization at c1c5 (n = 12) and c6t2 (n = 7) or for the final diagnosis ivdd (intervertebral disc disease) (n = 11) and ivdd with spondylosis deformans (n = 7). Table 6 compares different variables related to treatment progress . The duration of signs, improvement times, and recovery times in the c1c5 localization group were longer than in the c6t2 group and in the ivdd group than in the ivdd+spondylosis deformans group . There is much less literature available pertaining to tcvm treatment for cervical spinal cord diseases in dogs than there is for traditional chinese medical treatment of human cervical spinal cord disease . In humans, we found no literature on jjj points used as local acupoints for the treatment of cervical spinal cord diseases in dogs . Based on our experience, the tcvm treatment protocol and ap point selection depended on each individual case . In this study, we sought to standardize protocols as simply as possible for the cervical spinal cases we treated . In traditional chinese medicine, stimulation of jjj points harmonizes the gv (governing vessel) and bl (bladder) channels . In anatomy, stimulation of jjj points triggers a reflex arc, resulting in sympathetically induced, segmental, superficial, and visceral vasodilation . Another important effect of local point stimulation is that it activates local immune - inflammatory systems . The stimulation site also releases bradykinin, and thus, increases local vascular permeability to allow other inflammatory mediators access to the area . Because of the high concentration of nerve endings and dense microvasculature around the acupoints, these effects are greater than the effects of local stimulation on stimulation sites . In dogs, superficial needling may not attain the best point identification, and the jjj points are very near the cervical spinal cord . It is easy to palpate the lateral transverse processes and insert the needles into jjj points . Given that there is a needling sensation, changes in needle depth at the jjj points do not make cause obvious differences in the therapeutic efficacy during treatment of certain cervical spinal problems . The purpose of stimulation to si3, li4, and liv3 is to stimulate the distal extremities to arouse conscious proprioception . Stimulation through the afferent nerves enters the spinal cord and passes up to the brain, after which it travels via the efferent nerves down to the extremities to re - educate the nerves and facilitate their healing . Concurrent stimulation of bl11+th5 strengthens weak thoracic limbs . For one of the dogs with grade 1 disease, although the dog had grade 1 severity in terms of neurology, neck pain is sometimes not well tolerated by dogs over the long term . For this dog, the variance could be related to the individual conditions of the dogs, their healing abilities, and their individual responses to ap . For dogs, we found that jjj points were also beneficial for the treatment of tetraparetic dogs . From a clinical point of view, the prominent improvements were pain relief and recovery of ambulation . Two treatments were necessary for neck pain relief and four treatments (twice a week) were needed for improvement in ambulation . Among the larger, heavier dogs (n = 5), two had delays in starting tcvm (cases 12 and 13). These dogs were treated for neck pain at a local animal hospital for two months before being referred for tcvm because of their poor responses to treatment and the side effects of the analgesics . Since there were no differences in improvement and recovery times, the ap protocol had the same impact on both lighter, smaller dogs (2.5 - 9.0 kg) and heavier, larger dogs (14.0 - 25.5 kg). Because there were no differences in duration of signs, improvement times, and recovery times between the two age groups of dogs, the ap protocol had the same effects on both younger dogs (5 - 9 years) and older dogs (10 - 16 years). In addition to duration of signs, the severity of the disease was also taken into account when considering whether to add eap to the protocol . In anatomy, the purpose of eap stimulation connecting bl11 to th5 is to enforce the stimulation of ap to the thoracic limbs . In this study, 20 hz (interrupted wave) was applied for 15 min . An in vivo study in cats revealed that peripheral stimulation at 20 hz maximized the release of substance p . Substance p, which acts via neurokinin-1 receptors, promotes the proliferation of neural cells and is associated with the regulation of neurogenesis . One possible reason is that there were more dogs with grade 3 severity in the ap+eap group . In the ap group, dogs with different severity grades had similar improvement times, but the recovery times were longer in dogs with grade 3 severity than in those with lesser severity grades . Thus, with ap treatment, dogs with severe grade 3 disease needed a longer time to heal (recover) even though the duration of signs was short . In the same grade 3 group, ap treatment resulted in shorter improvement and recovery times than ap+eap treatment, probably because of the shorter duration of signs . These findings indicate that a delay in treatment at this severity grade, even when receiving ap+eap, resulted in a longer time being required to heal . Dogs in the same grade 3 group receiving ap+eap had a similar duration of signs and improvement times, but the recovery times were longer in dogs with weak thoracic limbs . Thus, dogs with grade 3 and thoracic limb weakness needed more time to heal . Only one dog with grade 1 severity received ap+eap because of the long duration of signs . Its improvement time was similar to that of dogs with grade 3 severity, but its recovery time was longer than that of dogs with grade 3 severity receiving ap+eap . These findings indicate that even though the severity grade was low, once the duration of signs was long, it affected the prognosis . Further study with more cases is necessary to verify these assumptions . In this study, no dogs with grade 2 received ap+eap because of the acceptable effects produced by ap . We anticipate that dogs with grade 2 severity (ambulatory tetraparesis), a certain duration of signs and without thoracic limb weakness will have a good prognosis upon ap+eap treatment . Further study is required to determine whether or not dogs with long - term (more than 2 weeks) or only short - term (less than 1 week) grade 2 severity should be treated with ap+eap for a better neurological response . Dogs with ivdd+spondylosis deformans had shorter improvement and recovery times than those with ivdd alone . One possible reason is a shorter duration of signs before treatment in ivdd+spondylosis deformans dogs . Therefore, a shorter onset of disease was associated with a better outcome, even when two disorders presented together . Similarly, dogs with more severe c6t2 lesions had shorter improvement and recovery times than those with c1c5 because of the shorter onset of disease before treatment . When stagnation resolves, qi flows freely; thus, pain ends and the function resumes . In this study, two chinese herb formulas were prescribed to improve the flow of qi, double pii (jing tang) and cervical formula (jing tang). The treatment principles of double pii are to break down stasis in the spine, move qi, and relieve pain . The cervical formula is a cervical transporter, blood activator, and qi mover that dissipates stagnation and relieves neck pain . Although there was no obvious statistical difference between ap treatment combined with chinese herbs or without in this study, we anticipate that improvement and recovery times would be shorter when treatment included chinese herbs (table 6); however a larger study should be conducted to confirm this . All 19 dog owners were asked to bring their dogs to the veterinary clinic for reexamination to check their conditions every few weeks or months . All of the dogs were successfully treated using this ap protocol with no relapse as of completion of the study and subsequently over a period ranging from 1.5 years (case 19) to 5 years (case 12). We do not recommend this ap protocol in cases of significant structural change, such as ruptured nerves, severe cervical vertebral dislocation, or cervical spinal cord compression due to a tumor because such cases usually have poor prognosis, even after aggressive treatment such as surgery . In the case of tetraparesis, other factors related to improvement and recovery include rehabilitation and care . In the early stages of the treatment, encouragement to stand and walk with assistance (such as walking with a sling or cart) is crucial to educate the nerves and train the muscles . When dogs exhibit marked improvement, vigorous physical rehabilitation by underwater treadmill training or sling assisted walking is highly recommended to help increase muscle strength . In this study, dogs with body weight over 10 kg received underwater treadmill rehabilitation (cases 1, 11 and 19), while those with body weight under 10 kg underwent sling aided walking (cases 2, 5, 6, 7, 9, 15, 17 and 18). There are many methods to treat cervical spinal diseases resulting in neck pain or tetraparesis in dogs, including tcvm . Among the 19 successfully treated dogs in this study, the new standardized ap protocol led to a marked improvement after only four sessions of twice weekly treatment . The dog with fibrocartilaginous embolism needed at least two sessions for improvement and six sessions to recover . Additionally, dogs with ivdd needed at least four sessions to improve and seven sessions to recover, while those with ivdd and spondylosis deformans required three sessions to improve and five sessions to recover . We objectively evaluated the effects of ap from the functional clinical perspective; however, more studies with greater numbers of subjects are needed to confirm our results and document the bio - molecular changes and mechanisms of treatment.
The importance of leukemia inhibitory factor (lif) stimulated signaling in mouse embryonic stem cell (esc) culture in vitro has long been recognized . By activating janus kinase (jak) and signal transducer and activator of transcription 3 (stat3), lif plays essential roles in the generation and maintenance of mouse pluripotent embryonic stem cells which are capable of infinite self - renewal and differentiation to any cell type of the three - germ layers of an embryo . Over the past two decades, much information has been obtained regarding the lif signaling pathway through studying mouse escs . However, the exact mechanism by which activated stat3 controls pluripotency still remains to be elucidated . The induced pluripotent stem cell (ipsc) technology provides a powerful tool to reprogram somatic cells such as skin fibroblasts to a pluripotent state, and brings us much closer to the establishment of personalized, cell - based therapy for the treatment of currently incurable diseases such as diabetes and neural degenerative diseases . In many aspects, somatic cell reprogramming represents a reversed cell differentiation process, by epigenetically resetting the cell nuclei back to a pluripotent state . A the same time reprogrammed cells turn on a cellular signal network capable of both robust cell division and fending off intra- and extra - cellular differentiation stimuli . Recently, the lif - jak - stat3 axis was demonstrated by a number of studies to be essential for the nave state pluripotency establishment during somatic cell reprogramming . In addition, these studies provided important insight for further understanding of the mechanism behind lif regulated esc pluripotency . In this review, we will summarize the current knowledge on the role of lif and especially jak - stat3 signaling pathway in esc pluripotency maintenance and in somatic cell reprogramming . Leukemia inhibitory factor (lif) is a member of the interleukin (il)-6-type cytokine family, which includes il-6, il-11, il-27, lif, ciliary neurotrophic factor (cntf), cardiotropin-1 (ct-1), oncostatin m (osm), and cardiotrophin - like cytokine-1/novel neurotrophin-1/b - cell stimulating factor-3 (clc-1/nnt-1/bsf-3). Lif was initially discovered to be pleiotropic in different mouse leukemia cell lines, by exerting either an inhibitory or promotional role on cell proliferation . The same cytokine was also isolated from culture medium conditioned with buffalo rat liver cells, which can promote the self - renewal and sustain the pluripotency of mouse escs in the absence of fibroblast feeder cells . Lif binds to the low - affinity cell surface lif receptor (lifr), which stimulates the hetero - dimerization of lifr with the signal transducer glycoprotein 130 (gp130) (fig . 1). This triggers the activation of gp130-associated jak kinases, and the subsequent phosphorylation of tyrosine residues in the gp130 cytoplasmic domain . These phosphor - tyrosines then serve as the docking sites to recruit the src - homology-2 (sh2) domain containing stat proteins (stat1 and 3), which are phosphorylated by activated jak kinase . Once phosphorylated, the stat proteins dimerize and enter the cell nucleus to regulate the expression of their target genes . Although the jak kinases including jak1, jak2, and tyk2 can all be phosphorylated following stimulation by lif as well as other il-6-type cytokines, jak1-mediated il-6/il-11 signaling cannot be substituted by jak2 and tyk2 . Additionally, while rna inhibition of jak1 induces mouse esc differentiation, jak2-deficient escs are responsive to lif stimulation . It was also found that in mouse escs, the activity of stat3, but not stat1, is responsible for pluripotency maintenance, and artificially activated stat3 can sustain esc self - renewal in the absence of lif . These lines of evidence suggest that the prevailing stemness signaling is mediated by jak1 activated stat3 dimerization in mouse escs . This is followed by the activation of jak - stat3, pi3k / akt, and erk1/2 signaling pathways . The activated stat3 leads to increased expression of socs3, which serves as a negative feedback signal to lif stimulated activation of stat3 and erk1/2 . Likewise, lifr can serve as the receptor to mediate signals of several ligands including lif, cntf, ct-1, osm, and clc-1 (table 1). Il-6-type cytokines induced gp130 homo- or heterodimerization with lifr also activates the phosphatidylinositol 3-kinase (pi3k)/protein kinase b (akt), and the sh2-domain containing tyrosine phosphatase (shp2)/extracellular - signal - regulated kinases 1/2 (erk1/2) pathways . Activated gp130 recruits shp2 through its tyrosine residue (tyr in humans, equivalent to tyr in mice), where shp2 is phosphorylated by jak kinases and interacts with the growth - factor receptor bound protein 2 (grb2) and son of sevenless (sos) complex to activate erk1/2 . The activation of stat3 also triggers the expression of the suppressors of cytokine signaling 3 (socs3), which competes with shp2 for the cytoplasmic domain of gp130 phosphorylated at tyrosine residue tyr (human) or tyr (mouse), and inhibits the jak - stat3 and erk1/2 activation (fig . 1). The negative regulation of jak kinases by socs3 involves both direct inhibition of the jak catalytic domain and the promotion of proteasomal degradation of jak . While constitutively activated akt was reported to sustain mouse esc pluripotency independent of stat3, signaling from activated erk1/2 promotes the neural commitment of escs . As the jak - stat3, pi3k / akt and erk1/2 pathways are simultaneously activated by lif, it obviously contributes to the pleiotropic roles that lif plays in different cell types, and complicates the understanding of lif signaling regulated pluripotency . It is well - known that jak - stat3 signaling is important in maintaining mouse esc pluripotency and propagation . Unfortunately, thorough elucidation has not been achieved despite the numerous attempts made to uncover the mechanism behind jak - stat3-mediated esc self - renewal . Stat3 is a transcription factor whose amino acid sequence is highly conserved across species among humans, cattle, pigs, rats, and mice . Its dna binding domain recognizes the consensus sequence of ttcc(c / g)ggaa which is present in the regulatory regions of many genes . The phosphorylation of tyr of stat3 is important for stat3 homo - dimerization and nuclear translocation following gp130 activation . By mutating the stat3 binding tyrosine residues in the cytoplasmic domain of gp130, it was shown that stat3 activity was necessary for gp130 signaling mediated mouse esc self - renewal . Expressing a mutant form of stat3 (stat3f, tyr to phenylalanine) leads to esc differentiation even in the presence of lif, while dimerization of stat3 fused with estrogen receptor (stat3er) upon 4-hydroxytamoxifen (4-ht) treatment promoted mouse esc self - renewal in the absence of lif . Thus it became clear that stat3 is the key downstream mediator of lif stimulated pluripotent signal . These embryos can form embryonic ectoderm and visceral endoderm but not the mesoderm . In culture of wild - type escs, lif prevents their differentiation into mesoderm and endoderm but needs either serum supplement or bone morphogenetic proteins (bmps) to suppress the neuronal differentiation . Bmp signaling induces the expression of inhibition of differentiation (i d) proteins, and mouse escs transfected with ids remain undifferentiated in the presence of lif without serum . Microarray analysis using stat3er transfected escs identified 58 stat3 targets, among which 22 are responsible for inhibiting the differentiation of either mesoderm (ccm4l, cyr61, dact1, etc . ), endoderm (krppel - like factor 4 [klf4], gbx2, pim1, pim3, sall4, smad7, etc . ), or both (klf5). Interestingly, 14 of these genes, including klf4, klf5, pim1, dact1, and smad7, are co - regulated by nanog, indicating a partially functional redundancy between stat3 and nanog in pluripotency maintenance . This is also in line with the finding that overexpression of either nanog or stat3 maintains esc self - renewal in the presence of reduced signaling from one another . In mouse escs, the global dna binding sites of 13 pluripotency-, cell cycle-, dna binding-, or reprogramming - related transcription factors were evaluated using chromatin immunoprecipitation coupled with high - throughput sequencing (chip - seq). Also, a total of 718 genomic loci were identified to be co - bound by stat3 and at least another 3 of the 13 factors, and stat3 clusters with nanog, oct4 (also known as pou5f1), or sex determining region y - box 2 (sox2) among 56.8% of these loci, clearly demonstrating that stat3 shares many common targets with the core pluripotent oct4-sox2-nanog circuitry . Interestingly, stat3 were found to co - bind with oct4, sox2, nanog, and smad1 to the regulatory region of key pluripotent genes which were also found to be reprogramming factors such as nanog, oct4, sox2, estrogen - related receptor (esrrb), klf4, c - myc, t - box transcription factor 3 (tbx3), sall4, etc . C - myc had been previously identified as a stat3 target and overexpression of constitutively active c - myc mutant maintains mouse esc pluripotency in the absence of lif . It was postulated that the lif / stat3 signaling promotes esc self - renewal by stimulating c - myc mrna expression, and by stabilizing c - myc protein levels through inhibiting glycogen synthase kinase 3 (gsk3) mediated threonine 58 (thr) phosphorylation . However, mouse escs with c - myc disruption were reportedly normal in self - renewal, presumably due to the redundant function from n - myc . Using chip and microarray analysis (chip - chip), 948 genes and 1459 genes were found bound by stat3 and c - myc in mouse escs, respectively, of which stat3 and c - myc co - occupy the promoters of 218 genes, including n - myc, rest, stat3, mbd3, and jmjd3 . Interestingly, it was shown that while stat3 binds to genes that are either transcriptionally activated or repressed, c - myc mainly occupies actively transcribed genes in escs . These, together with other studies described above, indicate that while stat3 functions synergistically with the oct4-sox2-nanog pluripotent circuitry and myc by co - regulating their common target gene expression, unique function by stat3 through regulating its specific targets not bound by these factors may exist for the pluripotency maintenance . Similar to nanog, overexpression of klf4 or tbx3 gene confers lif - independent mouse esc self - renewal . It was elegantly demonstrated that upon lif stimulation, klf4 expression in mouse escs is preferentially stimulated by jak - stat3 activation, whereas tbx3 expression is stimulated by pi3k / akt pathway upon the inhibition of erk activities . Based on their finding, proposed a model where lif regulates pluripotency maintenance by simultaneous stimulation of jak - stat3 and pi3k / akt pathways in escs . This leads to the activation of klf4 and tbx3 expression, and the subsequent expression of sox2 and nanog, respectively . Sox2/nanog cooperate to maintain oct4 expression, while nanog also reinforce the established oct4-sox2-nanog pluripotency network in the absence of klf4 and tbx3 (fig . 2). Schematic representation of lif regulated pluripotency circuit in escs . Upon lif activation, jak - stat3 promotes the expression of the core pluripotency circuit (green box) together with pi3k / akt for pluripotency maintenance . This model of parallel axes by lif / jak - stat3/sox2 and lif / pi3k / nanog to maintain pluripotency are supported by multiple lines of evidences . First, selective activation of klf4 by stat3 was reported to synergize with klf2, activated by oct4, to ward off the differentiation stimuli to escs . Stat3 was also reported to directly upregulate sox2 during neural progenitor cell differentiation from escs . Second, upregulation of nanog through pi3k activation or gsk3 inhibition has been reported to contribute to esc maintenance . Using pi3k inhibitor ly294002, 646 downstream targets of pi3k pathway were identified in mouse escs by microarray analysis . These include some key pluripotent genes such as nanog, esrrb, tbx3, and tcl-1, as well as zscan4c, one of the zscan4 family of zinc finger proteins . Interestingly, it was found that inhibition of zscan4c reduces the proportion of escs expressing high levels of nanog, and zscan4c was found to regulate telomerase elongation and chromosome stability in escs . In addition, although it is unclear why the constitutively activated akt confers mouse esc self - renewal, akt stabilizes myc by inhibiting gsk3-mediated phosphorylation and degradation, and akt also phosphorylates sox2, thus enhancing its stability and transcriptional activity in escs . However, in addition to the pi3k / nanog axes in escs, stat3 also binds to nanog promoter with brachyury which co - activates nanog expression in early mesoderm progenitor cells derived from escs . The activation of canonical wnt pathway leads to phosphorylation and inhibition of gsk3 and the subsequent nuclear accumulation of -catenin to regulate cell fate and many other biological events . It was reported that inhibition of gsk3 using 6-bromoindirubin-3-oxime promotes mouse esc self - renewal in the absence of lif, and that activated -catenin upregulates nanog expression by interacting with oct4 . However, it was also reported that wnt signaling alone is not sufficient for the maintenance of mouse esc self - renewal but can cooperate with lif for this action . Part of this synergistic effect of wnt could be through increasing stat3 mrna level in escs . A more recent study indicates that wnt regulated expression of orphan nuclear receptor nr5a2 (also known as lrh-1) is significant in augmenting pi3k / akt pluripotent signaling through regulating tbx3, nanog, and oct4 expression independent of jak - stat3 . However, unlike nanog and tbx3, overexpression of nr5a2 cannot sustain esc pluripotency in the absence of lif . The culture of mouse escs under the dual inhibition of erk and gsk3 (2i) ensures esc self - renewal and pluripotency maintenance without lif . Stat3 null escs can be derived under the 2i or triple inhibition of fgf receptor, erk1/2, and gsk3 culture condition . Although -catenin was found dispensable for esc self - renewal, its overexpression enhances pluripotent gene expression and delays the mouse esc differentiation . The pluripotency maintenance effect of gsk3 inhibition was recently found to be through inhibiting transcription factor 3 (tcf3) protein by activated -catenin, which relieves the suppressive effect of tcf3, leading to the expression of pluripotent gene esrrb . Smith s group therefore proposed a model of esc signal network in which pluripotency is supported by the inhibition of gsk3 and the activation of stat3 which in turn activate the expression of tcf3 and klf4, respectively, and esc is maintained by an expanded core pluripotent circuitry including oct4/sox2, nanog, klf4, tbx2, and tcf3 (fig . 2). However, esrrb is also dispensable for esc maintenance in the presence of lif, which highlights the parallel compensatory capacity by the core pluripotent circuitry for esc self - renewal . A complementary model was proposed by savatier s group which describes the synergistic effect of stat3 with nanog in preventing mesoderm and endoderm differentiation, as well as stat3 s direct effect in preventing endoderm differentiation through regulating its specific target genes in mouse escs . Together, these studies contribute a comprehensive depiction to our understanding of lif signal network (fig . 2). A few studies also investigated the stat3 regulated esc pluripotency and gene expression at the epigenetic level . One study discovered that in mouse escs, stat3, and oct4 co - bind to the promoter region of embryonic ectoderm development (eed) gene and promote its expression . As eed is a core component of polycomb repressive complex 2 (prc2), this stabilizes the histone 3 lysine 27 tri - methylation (h3k27me3) at the promoter regions of several lineage commitment genes, therefore suppresses their expression . The pluripotent cell - specific atp - dependent swi / snf chromatin remodeling helicase complex (esbaf) is essential for esc pluripotency and self - renewal, with brg1 (also known as smarca4) as a key esbaf component . In mouse escs, brg1 was shown to be required to prepare the chromatin access for stat3 to activate many of its target genes, whose promoters are otherwise occupied by prc2 complex . Other studies also demonstrated that brg1 binding to stat3 is necessary to allow stat3 to access the promoter region of inf regulatory factor 1 to control its expression, as well as the promoter of the p21waf1 gene followed by stat3-cdk9 interaction promoted transcriptional elongation . Ipscs are esc - like cells reprogrammed from somatic cells by overexpression a set of reprogramming factors including oct4, klf4, sox2, and c - myc (oksm) in the mice and humans, or oct4, sox2, nanog, and lin28 in humans . This technology represents a powerful way for regenerative medicine in terms of massively producing patient - specific pluripotent cells within a short time . However, many technical issues still remain unsolved, including the efficiency of reprogramming, the development of integration - free reprogramming method, the quality and safety of induced ipscs for clinical application, and lastly but probably most importantly, the understanding of the molecular mechanisms of reprogramming . Such information is required to ensure a proper translation of the ipsc technology to human medicine . Many major differences exist between the mouse escs / ipscs and human escs / ipscs . For example, human escs / ipscs are flat in colony morphology; depend on fgf / activin signaling for their pluripotency maintenance; and have completed x chromosome inactivation . They divide slowly (36 h doubling time), and survive poorly after single cell dissociationa property essential for gene targeting . On the contrary, mouse escs / ipscs are dome - shaped, depend on lif signaling for pluripotency, divide rapidly (16 h doubling time), and are amenable for single - cell colonization and gene targeting . The human escs / ipscs are in fact similar to mouse epiblast stem cells (mepiscs) derived from pre- or post - implantation mouse embryos which have limited in vivo differentiation capacity, and these cells are collectively referred to as being in the primed pluripotent state, while the mouse escs / ipscs from pre - implantation embryos are referred as in the nave state . So far numerous studies have focused on the role of jak - stat3 in the maintenance of the steady - state pluripotency of escs; however, until recently little had been known whether lif signaling is essential for ipsc induction, despite that lif was preferably included in the induction medium . Interestingly, withdrawing lif and supplementing the culture medium with fgf / activin a results in the transition of nave mouse escs to primed episc state . At the same time, episcs can be reprogrammed into nave mouse ipscs by overexpression of klf4, klf2, or nanog . Using this episc - esc reprogramming system, yang et al . In smith s group studied the effect of lif signaling in the conversion of primed to nave state pluripotency . They first found that lif is necessary for episc - escs transition induced by klf4 or nanog overexpression under the 2i condition . Previously a chimeric receptor was described (gy118f), in which the ligand binding domain of the granulocyte colony stimulating factor (gcsf) receptor was fused to the trans - membrane and cytoplasmic domains of gp130 modified at residue tyr (corresponding to the tyr of the wild - type mouse gp130) to phenylalanine . This ensures constitutive activation of stat3 upon gcsf stimulation . By expressing the gy118f receptor in episcs with gcsf stimulation, yang et al . Discovered that activation of stat3 can convert episcs directly to nave ipscs in 2i medium . They further demonstrated that stat3 activation in episcs does not stimulate klf4 or nanog expression . Rather, stat3 acts synergistically with either of them to dramatically improve the reprogramming efficiency . Finally, they demonstrated that activated stat3 also improves the reprogramming of mouse neural stem cells and partially reprogrammed cells (pre - ipscs) to nave state ipscs induced by oct4, klf4, c - myc (okm), or oksm, respectively . The study by smith s group for the first time demonstrated that stat3 activation is necessary for the reprogramming between mouse episcs to ipscs . A later study also demonstrated that enhanced stat3 activation can reprogram mouse episcs to nave pluripotent cells even in the presence of fgf / activin differentiation signals . Thus the stat3 activity becomes essential for converting the primed state to nave state pluripotency in the mouse . However, it remained unclear whether the lif signaling is necessary for reprogramming of terminally differentiated mouse somatic cells, which bypasses the episc stage during reprogramming with lif containing medium . Furthermore, the molecular mechanism of stat3 induced reprogramming remains elusive, albeit much information has been obtained by studying the steady - state pluripotency maintenance . We addressed these questions by studying the role of stat3 during the reprogramming of terminally differentiated mouse embryonic fibroblasts (mefs). Using stat3c, a constitutively activated stat3 mutant with two residues in its sh2 domain mutated to cysteine (a662c and n664c), we discovered that enhanced stat3 activation significantly promotes the reprogramming from mef cells to ipscs by oct4, klf4, sox2 (oks), or oksm overexpression . This result was doubly confirmed by expressing a mutant gp130 with tyr converted to phenylalanine, as well as by deprivation of lif during reprogramming . We further found that the complete mef reprogramming, as indicated by expression of gfp transgene driven by the oct4 distal enhancer, was completely blocked in the presence of jak inhibitor 1 (jaki) but not the pi3k inhibitor, ly294002 . However, the total number of induced colonies was not affected by the jaki treatment . These observations demonstrated that stat3 activation plays a vital role in the late - stage somatic cell reprogramming, i.e., the activation of the endogenous oct4 gene . We also studied the role of stat3 activation in the complete reprogramming of pre - ipscs induced by okm . These cells form colonies but do not express endogenous oct4, and can be completely reprogrammed by the expression of sox2 or the addition of repsox, an inhibitor of transforming growth factor receptor (tgfbr). Again our results show that stat3 activation is necessary for sox2 or tgf-signaling pathway inhibitor promoted reprogramming of pre - ipscs . Examining the promoter dna methylation status revealed that jak - stat3 inhibition prevents the demethylation of endogenous oct4 and nanog during reprogramming . This is associated with increased expression of dna methyltransferase 1 (dnmt1), class i histone deacetylases (hdacs), and other chromatin - repressive genes . Inhibition of dnmt1 and hdacs has been shown to significantly improve somatic cell reprogramming . In order to test whether the stat3 induced inhibition of dnmt1 and hdac expression is important for complete reprogramming, we applied inhibitors for dnmt1 and hdacs together with the inhibition of stat3 during reprogramming . Indeed we found that inhibiting either dnmt1 or hdacs but not the overexpression of nanog can overcome the halted reprogramming by stat3 inactivation . During this study, we also observed that stat3 inhibition resulted in continued expression of the retroviral transgenes which are otherwise gradually silenced at late - stage reprogramming . This lack of external gene silencing is tightly associated with the diminished expression of de novo dna methyltransferase dnmt3l . It has previously been demonstrated that expression of dnmt3l in mouse escs is crucial to the activation of de novo dna methylation which silences the viral transgenes . Our finding therefore reveals a new role of stat3 in regulating de novo dna methylation for epigenetic gene silencing during reprogramming . Taken together, our work demonstrated that (1) jak - stat3 activation is essential for the reprogramming of murine somatic cells, (2) stat3 activity is crucial for the pluripotent gene promoter demethylation, and (3) stat3 is important for retroviral transgene silencing during the reprogramming . The discovery that stat3 activity is essential for the reprogramming from mouse episcs and somatic cells to nave ipscs, as demonstrated by others and us, respectively, is significant for the understanding of reprogramming and pluripotency . The continued high - level expression of ectopic transgenes in pre - ipscs and in reprogrammed cells caused by stat3 inhibition strongly indicates the existence of a reprogramming barrier which cannot be simply overcome by a greater dosage of reprogramming factors in the absence of stat3 activity, even with the overexpression of klf4 and nanog which can sustain esc self - renewal in the absence of lif . A passive model of genomic dna demethylation as a result of inhibited methylation maintenance has been proposed to explain the somatic cell reprogramming . It was also found that transient stat3 activation poises the episcs for complete reprogramming by klf4 or nanog . These are in accordance with our finding that jak - stat3 functions epigenetically to inhibit the expression of dnmt1 and other heterochromatin - promoting genes, which in turn promotes the demethylation of pluripotent loci during reprogramming . Together, our results strongly suggest a central role of stat3 during reprogramming, by orchestrating the establishment of open - chromatin to completely activate the pluripotent genes, and by promoting the de novo dna methylation activity to silence the expression of viral transgenes and possibly the lineage commitment genes, in addition to the stat3 promoted suppression through prc2 (fig . Schematic representation of stat3 regulated somatic cell reprogramming via epigenetic mechanisms . During late - stage reprogramming, stat3 orchestrates the epigenetic changes leading to complete pluripotency, by ensuring full activation of core pluripotency genes through promoting dna demethylation and open chromatin formation, while suppressing the viral transgenes and lineage commitment genes by promoting de novo dna methylation and probably prc2 mediated histone modifications . The jak - stat3 pathway has been identified as the core signaling pathway for pluripotency maintenance, and was also demonstrated recently to be essential for the complete reprogramming of mouse somatic cells . Although a number of stat3 downstream target genes had been identified, a thorough understanding of the stat3 mediated reprogramming still remains unachieved . An emerging area of study on stat3 mechanism is to investigate the epigenetic roles of stat3 in the maintenance of steady - state pluripotency and during the dynamic changes of somatic cell reprogramming . Special emphasis may be placed on the stat3 induced formation of euchromatin for the pluripotent gene activation, and formation of heterochromatin for lineage commitment gene silencing . Interestingly, recently several groups reported the generation of nave state human ipscs, which also rely on lif signaling for their self - renewal . Together, these series of studies have brought jak - stat3 to the central stage of ipscs research.
Streptococcus pneumoniae is a leading respiratory pathogen that is responsible for infections such as pneumonia, meningitis, bacteremia and otitis media . In 2003, the world health organization (who) estimated that pneumococcal disease is responsible for 1 million deaths annually, most of which occur in children <5 years of age in the developing world . Although pneumococcal meningitis is relatively rare, it is strongly associated with mortality or subsequent neurologic damage . Pneumococcal resistance to penicillin was first described in 1967, and since the 1990s an increasing rate of resistance has been reported worldwide . This resistance makes the treatment of serious pneumococcal infections difficult, and many antibiotic treatment failures have been reported . In algeria, several reports have shown an increase in antibiotic resistance from 1996 to 2010, especially among children [69]. Although epidemiologic surveillance data for invasive pneumococcal infections are available, clinical data are lacking . Moreover, since the introduction of haemophilus influenzae type b vaccination in 2008 in algeria, s. pneumoniae has become the predominant pathogen in bacterial meningitis (unpublished data). The s. pneumoniae polysaccharide capsule is a major virulence factor; more than 90 serotypes have been identified, and their distribution differs in different regions and between developing and developed countries . The aim of the study was to investigate the evolution of antibiotic resistance and serotype distribution of s. pneumoniae in infections in children in algeria . From january 2005 to june 2012, a total of 270 unique s. pneumoniae isolates were collected from children aged 0 to 16 years with invasive and noninvasive infections; about 89% were from algiers and 11% from oran, a town located in the western part of the country . Every year, the centers isolate between 15 and 50 s. pneumoniae strains from children who are diagnosed by physicians with invasive pneumococcal disease (ipd) and non - ipd (nipd). S. pneumoniae isolates were identified by colony morphology, gram staining, catalase reaction, optochin susceptibility and bile lysis . Antibiotic susceptibilities for oxacillin, erythromycin, clindamycin, tetracyclin, chloramphenicol and cotrimoxazole were determined following the clinical and laboratory standards institute (clsi) recommendations . Minimum inhibitory concentrations (mics) for penicillin, amoxicillin and cefotaxim were determined using the e - test following the manufacturer's instructions (solna, sweden) for all strains . Serotyping was performed by latex agglutination for determining pools, and serotypes were identified using the neufeld test (pneumo test latex; statens serum institute, copenhagen, denmark). A total of 127 isolates were serotyped, 85 from invasive samples and 42 from noninvasive samples . The isolates that were serotyped were selected on the basis of the clinical data, with priority given to ipd and the number of viable isolates . From the 270 isolates collected (ipd n = 97, nipd n = 173), 197 (73.0%) were from children <5 years, of whom 151 (76.7%) were <2 years . Among the isolates from children with ipd, 78.4% were collected from children <5 years of age, of whom 76.3% were <2 years old . The ipd isolates were collected from children with meningitis (n = 53), pneumonia and pleuropneumonia (n = 25), bacteremia (n = 11), arthritis or peritonitis infections (n = 8). The non - ipd isolates were from ear, nose and throat infections (n = 91), bronchopulmonary infections (n = 77) and other suppurative infections (n = 5). Among the isolates from children with nipd, 69.9% were from children <5 years of age; 53.8% were <2 years old (table 1). Nonsusceptibility to penicillin was detected in 48% of the s. pneumoniae isolates (mics ranged from 0.016 g / ml to 4 g / ml); 2.6% of isolates had intermediate resistance to amoxicillin; 7% and 1.7% of isolates had intermediate and full resistance to cefotaxime, respectively . For the ipd isolates, the mic90s were 2 g / ml for penicillin and amoxicillin and 1.5 g / ml for cefotaxime . The highest rate of cefotaxim resistance was observed in isolates from meningitis: 20.8% intermediate and 3.8% resistant (table 2). The percentages of isolates that were resistant to non--lactam antibiotics were 53.0% for erythromycin and cotrimoxazole; 43.7% for clindamycin; 42.0% for tetracycline; and 5.3% for chloramphenicol . According to the new breakpoints suggested by clsi, whereby meningitis and nonmeningitis isolates have different breakpoints, 49.0% of the meningitis isolates were resistant to penicillin (mic 0.12 g / ml), among which 26.9% had a mic of 2 g / ml . After meningitis isolates, the next highest rate of penicillin - nonsusceptible s. pneumoniae (pnsp) was observed in the isolates from nipd . From all the invasive isolates (n = 97), 40.3% were pnsp, with 81.5% of these from children <5 years and 72.7% from children <2 years . Among the 85 ipd samples that were serotyped, meningitis was the most common diagnosis, at 50 (58.8%), followed by pneumonia and pleuropneumonia, at 21 (24.7%), and bacteremia, at 9 (10.6%) (table 3). The prevalence of ipd in children aged <5 years and <2 years was 78.3% (n = 76) and 59.8% (n = 58), respectively (table 1). The most frequent serotypes for invasive isolates were 14 (29.4%), 1 (10.6%), 19f (10.6%), 19a (7%), 6b (7%), 5 (4.7%), 3 (4.7%), 6a (3.5%) and 23f (3.5%). Serotype 14 was the most prevalent in meningitis (34%) and pleuropneumonia (28.6%), while serotypes 19f (38%) and 14 (23.8%) were the most frequent in noninvasive samples (table 3, fig . Serotypes 14, 19f, 6b, 19a, 1, 5, 23f, 6a, 3, 7f and 18c accounted for 91.0% of ipd in children <5 years old . Serotypes 5, 7f, 6b, 18c and 19a were found exclusively in children <2 years of age . The serotypes that were most often antibiotic resistant were 14, 19f, 19a and 6b; they were mainly highly resistant to penicillin, and only serotypes 14 and 19a were resistance to cefotaxime (fig . 2, the prevalence of penicillin resistance among pneumococcal disease isolates in algeria, which was measured by the oxacillin disc diffusion method, appears to have increased over the years, from 34.6% in 19952000 to 48.1% in 20052012 (current study) [69]. The percentage of pnsp among ipd isolates in children was reported to be approximately 11% in western european countries, with the highest percentage (49%) in spain . Our results are more consistent with the increasing antibiotic resistance rates reported for north african countries . For instance, in tunisia and morocco, the rates of pnsp were, respectively, 52.8% and 43.3% [69,1315]. The dramatic increase in the antibiotic resistance rate since our previous study (pnsp of 48.1% in this study compared with 34.6% in 2001) could be explained by overuse of antibiotics for acute respiratory tract infections in algeria . Although the distribution is similar to that reported for morocco and tunisia, as well as other developing countries, it differs from that reported in our previous study, where we found that serotypes / serogroups 1, 5, 14 and 6 were the most frequent . Some pneumococcal serotypes, such as serotypes 1, 5 and 7f, have more invasive potential than others; serotype 7f has been reported to be associated with a higher risk of severe and fatal outcomes . In africa, serotypes 1 and 5 are commonly associated with invasive diseases . In algeria, the frequency of serotype 1 was low during the 20022004 and 20052007 periods but increased in 20082009 (unpublished data). Similar observations of cyclical peaks in serotype 1 incidence have been reported in many countries . Although serotypes 1 and 5 are designated as developing country serotypes, they have also been reported to be frequently responsible for pediatric ipd in industrialized countries such as germany, sweden and england . Serotype 1 has remained one of the most prevalent invasive serotypes and is usually associated with meningitis outbreaks in africa and in crowded communities . It is ranked as one of the four serotypes with the highest ipd burden in africa, asia and latin american, while serotype 5 is ranked third in africa and latin america and fourth in asia . In thailand, the seven most frequent serotypes associated with ipd in patients <5 years old were 6b, 23f, 14, 19f, 19a, 6a, and 4 or 9v . Two studies in oxford and stockholm that characterized the genotypes and serotypes of nasopharyngeal and invasive pneumococcal isolates from children and adults identified serotypes 1, 4 and 7f as having a high level of invasiveness, and serotypes 3 and 7f as having a higher case fatality rate compared with other serotypes . The predominant serotypes of pnsp in our study are similar to those reported in other studies and previous studies in algeria, with the emergence of serotype 19a in the absence of routine pneumococcal vaccination in our country . The most commonly multidrug - resistant serotypes among the pnsp were 19a, 19f, 14 and 6b, which were resistant to erythromycin, cotrimoxazole, clindamycin and tetracycline . Serotype 14 is one of the most invasive serotypes that can cause life - threatening ipds . Moreover, it can harbour multiple resistance determinants, conferring resistance to penicillin, erythromycin and cefotaxime . In many countries the multidrug - resistant serotype 19a has become the most predominant nonvaccine serotype isolated after pcv7 vaccination . On the basis of the serotype distribution observed in our study, the pcv7 coverage in children <5 years of age with ipd in algeria is 55.3%, the pcv10 coverage is 71.1% and the pcv13 coverage is 86.8% . This vaccine coverage among children <2 years is 51.7% for pcv7, 69% for pcv10 and 87.9% for pcv13 . These data may not reflect the situation in all cases of ipd in the studied regions because many children with ipd are treated empirically . In addition, the limitations of existing diagnostic tests affect the ability to obtain accurate ipd burden data: only 10% of blood culture results are positive, so most patients with pneumonia are not bacteriemic . In algeria, the lack of laboratory facilities, including no facilities for storing samples frozen at 80c in different regions of the country, is another limiting factor for conducting a multicenter study in order to obtain accurate ipd burden data . Despite limited financial resources dedicated to ipd surveillance in algeria, we have conducted a nasopharyngeal carriage in healthy children and the most prevalent serogroups were 6, 14 and 19 (23rd european congress of clinical microbiology and infectious diseases, abstract r2717). The pneumococcal conjugate vaccines (pcvs) currently available have been shown to protect children . The first licensed 7-valent vaccine, which was widely used, resulted in dramatic reductions in pneumococcal disease mortality and morbidity . The emergence of the multidrug - resistant serotype 19a and the absence of the so - called developing country serotypes, 1 and 5, has led manufacturers to develop higher valency pcvs, such as pcv9, pcv10, pcv11 and pcv13 . The who recommends the inclusion of pcvs in childhood immunization programs worldwide, especially in countries with childhood mortality that exceeds 50 deaths per 1000 births . Although there are some limitations with our study, the results show that the burden of ipd is high in our country . The good vaccine serotype coverage suggests that the introduction of childhood vaccination with pcvs could be expected to have a dramatic effect on the burden of ipd in our country . Continuous national monitoring of ipd and nasopharyngeal carriage as well as judicious use of antibiotics are crucial before and after pcv implementation in order to evaluate the effect of vaccination and to prevent the selection of multidrug - resistant clones.
Tumors of the clivus are very rare; chordomas are the most common type of tumors in this region, representing only 0.1 - 0.2% of all intracranial tumors9). Common sources of bone metastases are breast, prostate, kidney, and thyroid tumors . Kistler and pribram8) reported 11 cases with metastatic disease in the sella turcica originating from prostate, breast, lung, thyroid, or lymphosarcoma malignancies . Metastasis from gastric adenocarcinoma is extremely rare and could be explained by a rapid progression of the gastric adenocarcinoma . With regard to sites of intracranial metastasis, a literature review revealed only two case reports5,6) of clival metastasis from stomach cancer . To the best of our knowledge, this is the second published english case report of skull base metastasis originating from a gastric adenocarcinoma . In this study, we report the case of a 42-year - old female patient with an adenocarcinoma of the stomach that metastasized to the clivus . A 42-year - old female patient was admitted to our hospital with 1-month history of headaches, nausea, and vomiting . In the previous month, she had lost 2 kg of weight . Laboratory examination detected abnormally elevated levels of the alpha feto - protein (1665 ng / ml), carcinoembryonic antigen (1493 ng / ml), and carbohydrate antigen 19 - 9 (695 u / ml). A computed tomography (ct) scan of the brain showed a bulging bony mass, which had destroyed the clivus and affected the sphenoid and cavernous sinuses (fig . 1). Magnetic resonance imaging (mri) scan showed an abnormal mass in the upper portion of the clivus, extending to the cavernous sinus and invasion into both carotid arteries . The mass showed cystic change and heterogeneous patterns of enhancement after intravenous injection of gadolinium (fig . A mass (approximate diameter, 2.7 1.62.0 cm) was detected in the sellar region . The mass involved the sphenoid sinus, cavernous sinus, both internal carotid arteries, and the optic chiasm, but had destroyed the clivus and sphenoid corpus . An abdominal ct scan suggested gastric cancer with liver and multiple lymph node (ln) metastases . A fiber endoscopic study of the stomach confirmed advanced cancer with poor differentiation at the cardia (fig . Lumbar puncture yielded a watery - clear fluid but the cerebrospinal pressure was not increased and subsequent cytological examination of the fluid revealed no malignant cells . A chest ct scan showed left supraclavicular lymphadenopathy, indicative of metastasis . For diagnostic purposes, histopathological findings of this biopsy were similar to those obtained from the tumor of the stomach (fig . The immunohistochemical analysis of the stomach specimen revealed negative results for mucin 5ac, mucin 6, and mucin 2 on a mucin stain and a positive result for the cd10 protein, which was similar to the results obtained for intestinal - type adenocarcinoma and for clivus metastasis . After three cycles of chemotherapy [folfox: folinic acid (leucovorin), fluorouracil (5-fu), and oxaliplatin (eloxatin)], the patient's condition deteriorated rapidly; liver and ln metastasis progressed, and she developed tumor thrombosis at the splenoportal and superior mesenteric veins and cancer peritonei . The clivus is a single midline structure of bone comprising a part of the skull base and is formed from the sphenoid rostrally and the occiput caudally . Both benign or malignant primary tumors as well as secondary metastatic tumors may occur at the clivus . Some lesions that specifically involve the clivus are chordomas, chondrosarcomas, or lymphomas3,11). A chordoma is a rare, slow - growing tumor that originates from remnants of the primitive notochord along the craniospinal axis, particularly at either end . Cranial chordomas constitute less than 1% of all intracranial neoplasms, and patients can present with headaches and diplopia11). Metastasis to the clivus is very rare, and only few cases have previously been reported4). Hematogenesis is the most common route of metastasis, and most clival metastatic lesions arise from prostate, thyroid, or breast cancers13). This is in contrast to chordomas, where surgical decompression commonly results in improvements in eye movement1). Ct evaluation is required to assess the degree of bone involvement or destruction and to detect patterns of calcifications within the lesion . Mri scans provide excellent 3-dimensional analysis of the posterior fossa, especially the brainstem, sella turcica, cavernous sinuses, and middle cranial fossa . Ct is better than mri to observe calcifications and the precise involvement of skull base osteolysis, especially those at the skull base foramina2). Three - dimensional gradient - echo t1-weighted sequences are helpful because they allow the tumor to be visible in 3 planes within a short time and allow a good signal analysis of the tumor2). Skull base chordomas are well delineated at the outset because they displace adjacent structures; however, more advanced tumors become invasive and have a pseudomalignant appearance with bone erosion and soft tissue invasion, mimicking malignant clival tumors including metastasis2). One feature that may help distinguish metastases from chordoma - like tumors is hypo - intensity on t2-weighted mri images; this would be possible because of the higher cellular density and lower cytoplasm to nuclear ratio in metastases12). Most chordomas exhibit a high - intensity signal on t2-weighted images, which is nonspecific . Fluid and gelatinous mucoid substances associated with recent and old hemorrhage and necrotic areas are found within the tumor; in some patients, calcification and sequestered bone fragments are found as well . The variety of these components may explain the signal heterogeneity observed on an mri scan . Incomplete delineation of the tumor and microscopic distal extension of tumor cells may explain the frequency of recurrences2). On imaging, other primary tumors of the clivus show findings similar to those of metastases of the skull . Lymphoma and plasmacytoma of the clivus, for example, may show a similar mri signal on t2-weighted images7). Another useful diagnostic indication on an mri scan that may help distinguish chordomas from metastases is the heterogeneity with a honeycomb appearance shown by chordomas in lobulated areas, corresponding to low - intensity t1-signal areas within the tumor after contrast infusion . The pattern of contrast enhancement can be related to the pathologic features of the chordoma, which is organized in lobules with mucinous and gelatinous contents2). In patients without a history of cancer, metastasis to the clivus occurring as the first indication of a primary neoplasm is difficult to identify . In addition, delayed clivus metastases are difficult to detect13). Pallini et al.12) reported metastasis to the clivus from a cutaneous melanoma 8 years after the primary tumor was detected, and altman et al.1) described a single metastasis to the clivus that presented 12 years after treatment of a follicular thyroid carcinoma . Our patient showed symptoms of cranial nerve palsy as the first sign of metastasis, prior to the diagnosis of the primary stomach malignancy . The overall prognosis of patients with clival metastases is very poor, with a median overall survival of about 2.5 years . Cranial nerve palsies are associated with a poorer prognosis, with an average survival of only 5 months10). Clival metastasis of gastric adenocarcinoma is extremely rare, but should be considered in the differential diagnosis of bony lesions of the clivus.
Hiv - infected patients, especially on a long duration of antiretroviral therapy (art), are now facing newer challenges in terms of developing pathological aberrations of fat metabolism and redistribution . The two terms, hiv - associated adipose redistribution syndrome (hars) and hiv - associated lipodystrophy syndrome (hals), possibly have the same connotation to describe an acquired (? Lipodystrophy (changes in fat distribution) is a clinical diagnosis and mostly subjective as standardized diagnostic criteria have not yet been defined . That is why, the exact prevalence rate of hals has not been precisely quantified since it was first reported 13 years ago . Hiv - associated lipodystrophy involves fat redistribution (lipodystrophy), fat loss from the face, buttocks, and extremities (lipoatrophy), and mixed fat disturbances (lipodystrophy and lipoatrophy). They often have insulin resistance, type 2 diabetes, and elevated plasma lipid concentrations . The combination of hyperlipidemia, insulin resistance, and visceral fat accumulation resembles the cluster of abnormalities described in the metabolic syndrome associated with increased cardiovascular risk . Skeletal muscle leptin resistance can potentially contribute to muscular fatty acid accumulation in common human obesity, simulating the muscle steatosis found in lipodystrophy patients . Anabolic steroids, growth hormone (gh), growth hormone releasing hormone (ghrh), recombinant human leptin, and adiponectin (synthetic form unavailable) are the candidates for hormone therapy . For the last 15 years, much has been known about leptin biology . However, it is only recently that the leptin hypothalamic axis has newly been explored which regulates insulin and glucose metabolism independent of its effect on adiposity . This article affords a comprehensive review of leptin therapy, a new strategy now in clinical trials, and its beneficial role in hiv patients in correction of metabolic complications related to hals . 7, originally identified in 1995 through positional cloning of ob / ob mice, a mouse model of obesity discovered serendipitously at jackson laboratories where these mice were found having complete leptin deficiency causing hyperphagia, severe obesity, diabetes, infertility, and other neuroendocrine abnormalities. [47] this discovery led to further research works that revealed important role of leptin in energy homeostasis, weight regulation, immunity, and neuroendocrine function . Leptin is secreted in a pulsatile fashion by white adipose tissue and is also found in circulation and cerebrospinal fluid . Its circulatory levels positively correlate with the amount of body fat and have significant diurnal variation, with higher levels in the evening and early morning hours . Leptin mediates its effects by binding to specific leptin receptors (obrs) expressed in brain and peripheral tissues . The obra isoform (short leptin receptor isoform) is found to have an important role in leptin transport across the blood brain barrier, while the obrb isoform (long leptin receptor isoform), also known as lepr - l or leprb, is thought to mediate signal transduction with its strong expression in hypothalamus . Leptin in brain (both in parenchyma and cerebrovascular fluid) is derived from peripheral circulation and local synthesis . Short isoform of leptin receptors on vascular endothelium and epithelium of choroid plexus transports leptin across the blood brain barrier . It has been seen that both hypo- and hyperleptinemia are associated with reduced leptin entry into the brain . The discovery of leptin has advanced our understanding of metabolic diseases . Its identification has revealed a new neuroendocrine system regulating body weight . Complete leptin deficiency from mutations in leptin gene, as found in some rare genetic conditions, presents with infantile morbid obesity and associated endocrinal dysfunction including insulin resistance and hypogonadotropic hypogonadism . Severe lipodystrophy, both genetic and acquired (as in hals), is another hypoleptinemic state characterized by adipose tissue loss, hypertriglyceridemia, severe insulin resistance, and even overt diabetes mellitus . Recombinant human leptin replacement therapy at physiologic replacement dose in both the situations described above has improved hormonal abnormalities, glycemic control, and dyslipidemia. [1214] in the management of hiv lipodystrophy and metabolic syndrome, recombinant human leptin (metreleptin) has recently been extensively studied in the context of many open - label, clinical trials . Since no approved effective treatment exists for alleviating the major health problems associated with hals, leptin therapy, in this context, stands out to be essentially promising which will be reviewed next . Though most of the therapeutic trials with leptin started focusing primarily on obesity, the majority of obese subjects were proved to be leptin resistant with high serum leptin levels, which establishes that obesity is the result of hormone resistance . Leptin treatment resulted in weight loss only in a subset of obese patients, and was therefore not found to be of much help in treating obesity in general . Again, there is substantial variability of leptin levels at a given body mass index or percent fat and approximately 10 - 15% of obese subjects have endogenous levels of leptin that are indistinguishable from lean patients . Leptin insufficiency syndrome, a concept promulgated a few years ago based mainly on strong experimental support has replaced leptin resistance as causal in the etiology of diabetes and obesity . The leptin insufficiency syndrome manifests due to hypoleptinemia and/or decreased leptin delivery to the hypothalamus by transport restrictions across blood brain interphase and increased binding of leptin to c - reactive protein (crp) in peripheral circulation are the two important endogenous defense mechanisms that operate simultaneously in hyperleptinemic state to restrict leptin supply to the hypothalamus . Hypothalamic axis has a crucial role in regulating pancreatic insulin secretion and glucose metabolism independent of its effect on adiposity . Newer experiments revealed multiple novel mechanisms whereby central leptin insufficiency and peripheral hyperleptinemia concomitantly participate in the causation of metabolic syndrome . Acute inhibition of insulin secretion by central administration of leptin has recently been reported . Enhanced leptin signaling in selected hypothalamic sites such as the medial preoptic area (mpoa), paraventriculare hypothalamus (pvn), ventromedial hypothalamus (vmh), or arcuate nucleus (arc) experimentally corrects hyperinsulinemia and averts the development of insulin resistance . Several tract tracing studies including those with microinjection of leptin transgene in hypothalamic sites imply that hypothalamus sends efferent insulin inhibiting signals to pancreas by hypothalamic neuropeptide y npy - ergic system bypassing the dorsal vagal neurons . Recent studies also detected insulin - independent role of leptin in hypothalamic glucose regulation possibly by accelerating glucose metabolism in brown adipose tissue, liver, skeletal muscles, and fat cells . Various attempts to increase leptin delivery to hypothalamus and extrahypothalamic sites with daily injection or continuous infusion, both systemically and centrally (intracerebro - ventricular or intrathecal), in pharmacological doses over short periods have been quite satisfactory in animal models . This one - time neurotherapy with its durable antidiabetic efficacy offers a potential substitution for insulin therapy in metabolic syndrome in near future . It is evident that only hypoleptinemic hiv - infected patients are the actual beneficiaries and are selected for recombinant leptin treatment trials to combat metabolic syndrome . As serum leptin level varies in general population depending on age, sex, feeding status, body habitus, and circadian cycle, hypoleptinemia is usually considered when serum leptin level is <3 ng / ml in men and <4 ng / ml in women . Fasting leptin levels have been shown to correlate with total body fat concentrations in hiv - infected patients . Nagy et al . Found that leptin levels were lowest in hiv patients exhibiting lipoatrophy, intermediate in those with mixed lipodystrophy or normal body habitus, and highest in those with lipohypertrophy . These findings suggest a reduction in leptin synthesis in those having lipoatrophy with reduced subcutaneous adipose tissue and excess circulating levels of leptin might be due to leptin resistance in those with visceral adipose tissue hypertrophy . This leptin - resistant state might also be related to metabolic syndrome and insulin resistance seen in hiv patients with lipohypertrophy . Untreated hiv infection is a progressive cellular immunodeficiency state with anorexia, weight loss, malnutrition, and opportunistic infections . Though leptin was shown to induce anorexia and augment t helper cell (th1) population, most of the patients with hiv - associated wasting were found to have decreased serum leptin levels and that low value was proportional to the degree of fat loss . Leptin levels in hiv patients have also been studied in the absence of antiretrovirals and irrespective of wasting . In symptomatic aids patients, leptin levels are shown to be depressed irrespective of wasting, possibly due to downregulation of leptin secretion by persistent inflammation, especially in the presence of secondary infections . A study on art - nave hiv - infected nigerians in 2008 has shown that serum leptin levels were significantly lower in wasted hiv - infected patients compared to normal weight hiv patients from nigeria, and leptin levels were depressed during symptomatic hiv / aids independent of the effect of body mass index (bmi). Grunfeld and coworkers also reported a similar bmi - independent suppression of serum leptin levels by secondary infection in aids patients, contrary to the known fact that circulatory leptin level increases during sepsis and inflammation in response to bacterial endotoxins and cytokines [tumor necrosis factor - alpha (tnf-)]. Exhaustion of leptin production by chronic tubercular inflammation was suggested by van crevel and colleagues as the cause of hypoleptinemia in hiv - negative tuberculosis patients irrespective of the effect of bmi . These researchers also reported insignificant difference in leptin levels between asymptomatic aids patients without wasting and normal hiv - negative individuals of similar bmi . Leptin levels have been shown to be higher in general female population than males for any given measure of adipose mass . Leptin levels also rise more rapidly in women than men with increase in proportion of body fat . In contrast, the nigerian study revealed lower level of leptin among female hiv patients as compared to male patients . Reversal of this sex difference may contribute to more wasting in female aids patients as most of the hiv wasted patients were females . Most studies in humans and animal models also found a positive correlation between the number of cd4 t cells and leptin levels in healthy controls, but this correlation was blunted in hiv patients . The morphologic and metabolic changes associated with art have led to the development of hals characterized by peripheral lipoatrophy (fat loss in face, arms, legs, buttocks), localized fat accumulation, hyperlipidemia, insulin resistance, and hyperglycemia . Hepatic steatosis may also occur, but acanthosis nigricans seems extremely rare in contrast to congenital lipodystrophy . The prevalence of hals in patients taking art has been reported to be up to 80% with increased cardiovascular risks . Hals is thought to be multifactorial with complex interactions of drugs, viral and host - related factors . Although art with protease inhibitors (pis) and nucleoside reverse transcriptase inhibitors (nrtis) are said to be the most compelling risk factors, gender, altered adipose gene expression, altered adipokines, mitochondrial toxicity, hiv- 1 associated protein, and genetic polymorphism are some of the important pathophysiologic mechanisms underlying its development. [3236] cross - sectional studies have shown low levels of leptin and adiponectin in hals, which are closely and inversely correlated with dyslipidemia and insulin resistance . Animal experiments also demonstrated that combined administration of both leptin and adiponectin fully normalized insulin sensitivity in hypoleptinemic and hypoadiponectinemic lipoatrophic mice . Walker and brinkman have shown a relation between peripheral lipoatrophy and mitochondrial toxicity in hiv patients . Mitochondrial toxicity occurs due to inhibition of mitochondrial dna polymerase- by several antiretrovirals with variable affinity for the enzyme . In vitro studies using hepg2 human hepatoma cells showed the worst effects with zalcitabine, didanosine, and stavudine in reducing order causing marked hyperlactatemia and multiorgan toxicities involving liver, pancreas, peripheral nerves, and skeletal muscles. [4143] altered levels of adipokines and proinflammatory cytokines (as demonstrated in in vitro murine and human adipocyte cell lines and in vivo studies with nrtis and pis) may be responsible for insulin resistance seen in lipodystrophy . Pis have been found to cause reduction in lipid accumulation in adipocytes, increase in adipocyte apoptosis, inhibition of insulin - stimulated glucose uptake [inhibiting glucose transporter type 4 (glut4)], induction of interleukin (il)-6, tnf-, reduction in gene expression, and secretion of adiponectin, all thereby inducing insulin resistance . Lipoatrophic fat from hals patients demonstrated reduced adipogenic transcription factors like sterol regulatory element - binding protein 1c (srebp-1c), caat enhancer binding protein- (c / ebp-), and peroxisome proliferator activated receptor- (ppar-) all involved in adipocyte differentiation along with reduced mrna expression of adiponectin and leptin . Some studies have shown similar changes in hiv patients who were not being treated with art, suggesting that hiv may have a direct role in the mechanism of lipodystrophy . Pis have also been found to inhibit proteasome chemotryptic activity, leading to endoplasmic reticulum stress response to misfolded proteins . Several small open - label clinical trials have demonstrated that patients with severe leptin deficiency from congenital and non hiv - related acquired generalized lipodystrophy could be benefited by the physiological replacement doses of leptin (0.040.08 mg / kg s.c . Daily) in terms of improvements in insulin sensitivity, glucose tolerance, levels of fasting glucose, and hba1c, hypertriglyceridemia, transaminitis, and changes in body composition (weight loss with decreased adipose tissue and lean mass), and thus the need for insulin or oral hypoglycemic agents could be lessened with the help of leptin. [5052] similarly, trial - based recombinant human leptin therapy has been tried in hypoleptinemic patients with hiv - associated lipodystrophy, and leptin was well tolerated with marked improvement in fasting insulin levels, insulin resistance, high density lipoprotein (hdl) cholesterol, and truncal obesity . Furthermore, the improvements in insulin resistance reported in patients with hals treated with metreleptin provide an advantage over gh replacement therapy as gh treatment is associated with glucose intolerance . But only those patients who have an absolute leptin deficiency (usually <3 ng / ml in men and <4 ng / ml in women) would enjoy the dramatic treatment benefit with leptin . Riddle et al . In the in vitro animal (ritonavir - treated mice) study with leptin showed reversal of raised total cholesterol, reduction in ritonavir - induced interscapular fat, and improved hepatic steatosis . Observed similar beneficial effect of recombinant human leptin therapy (0.04 mg / kg s.c . Daily for 2 months) in 7 men with hals, low leptin, and hypertriglyceridemia . Beneficial response was also reported by mulligan et al . With recombinant methionyl human leptin for 6 months (0.01 mg / kg s.c . Leptin treatment was associated with around 32% decrease in visceral fat, improvement in insulin sensitivity, fasting insulin and glucose levels, and hdl cholesterol, and 1520% decrease in low density lipoprotein (ldl) cholesterol, with considerable decrease in triglyceride, whole body lipolysis, and free fatty acid levels . It has been proposed that leptin may improve insulin resistance through several mechanisms such as: (1) activating insulin signaling pathways including skeletal muscle phosphatidylinositol 3-kinase and amp - activated protein kinase (ampk); (2) preventing lipotoxicity: decreasing intrahepatic and intramyocellular fat by activating fatty acid oxidation in skeletal muscles; (3) decreasing caloric intake; and (4) decreasing body weight and fat mass . Mulligan and khatami et al . Also suggested that leptin can improve hepatic insulin sensitivity possibly irrespective of its effect on peripheral insulin sensitivity and independent of reduction in visceral adipose tissue . In spite of the above - mentioned small observation - based hypotheses, the precise mechanisms underlying leptin's beneficial role in hals is yet to be established . Leptin as a monotherapy or an insulin - sparing agent in controlling metabolic components of hals is still a remote theoretical possibility . In spite of its successful placebo - controlled trials, leptin therapy has not yet been compared head - to - head with any of the many other available treatment modalities like metformin, thiazolidinediones (tzds) rosiglitazone, pioglitazone, gh, or synthetic ghrh (sermorelin, tesamorelin). [5658] it is also not known whether a combination of leptin with any of the above - mentioned drugs can work even better than a single agent . Just like leptin, metformin and tzds (which also increase adiponectin level) improve insulin sensitivity, but gh or synthetic ghrh is diabetogenic . As individuals with hals tend to be gh deficient, gh replacement can be a promising treatment option in this patient population . As leptin acts independent of the gh and insulin - like growth factor-1 (igf-1) system, a combination therapy with leptin and gh or ghrh analogs could potentially have additive metabolic benefits without adversely affecting glucose intolerance . Adiponectin, a 244 amino acid protein, is another endogenous insulin sensitizer that reduces gluconeogenesis primarily by stimulating adiponectin receptor 2 (adipor2) and activation of ampk phosphorylation . It also increases fatty acid oxidation in muscle via adipor1 whose stimulation in the hypothalamus might influence insulin and leptin signaling that promotes increased insulin sensitivity and reduced food intake . Adiponectin levels are also low in patients with hals, and hypoadiponectinemia is associated with insulin resistance, hypertriglyceridemia, and adipose tissue redistribution in hiv - infected patients on antiretroviral medications . Although leptin or adiponectin alone improves insulin resistance in mouse models of lipodystrophy, the combined administration of both hormones fully normalizes insulin sensitivity in animal models . Adiponectin as well as its receptors adipor1 and adipor2 are attractive future targets for drug development in hals . Recombinant human leptin, still an investigational product, is not yet available commercially in the market for the patients suffering from hiv - associated lipodystrophy and metabolic complications . The scope for its therapeutic utility is grossly suffering from lack of longer and larger well - furnished clinical trials from many countries worldwide . Leptin levels in circulation of hiv patients under various other treatments are largely unknown, which has become a major limitation of leptin therapy . Controversies and queries remain about the optimal dose, route of administration (peripheral vs. central leptin therapy), number of daily administrations, duration of therapy, need to follow - up the circulating leptin level, scope for combination therapy, possible adverse effects after long - term usage, and last but not the least, expected benefit in patients with relatively higher leptin levels . Naturally, additional information are needed further for the basic clarity of this unclear practical scenario.
Takotsubo cardiomyopathy is characterized by transient left ventricular (lv) regional wall motion abnormalities and usually involves apical segments in the absence of significant coronary artery stenosis . In the recent years, several cases on atypical forms of transient lv ballooning syndrome have been reported . The pathophysiological mechanisms remain unclear, however, the catecholamine excess and increased sympathetic activity are likely to play a pivotal role in triggering this syndrome.1 - 3) in this report, we describe an unusual case of a 38-year - old woman who had pulmonary embolism (pe) and reverse takotsubo cardiomyopathy . Pe has been listed as stressors of stress - induced cardiomyopathy,2)3) because the pain and the decreased perfusion within the lung related to pe probably cause a release of catecholamines.4)5) however, it is uncommon to present reverse types of stress - induced cardiomyopathy in the setting of pe for our patient . A 38-year - old woman with no history of cardiac diseases or cardiac risk factors was referred to our emergency department because of chest discomforts, arrhythmia and shortness of breath after the surgery . A few days before she had fallen off the ladder and underwent surgery for right lateral malleolar fracture under spinal anesthesia . Physical examination revealed vital signs as follows: blood pressure 90/60 mm hg, heart rate 75 beats / min, body temperature 36.7, respiratory rate 22/min and oxygen saturation 88% on room air . The electrocardiogram (ecg) recording showed sinus rhythm, st - segment depression in v3 through v5, and there were no typical features of ecg abnormalities associated with pe such as sinus tachycardia, s1q3t3 pattern, complete and incomplete rbbb, and t wave inversion (fig . Chest radiography showed diffuse increased bronchovascular lung markings with mild congestion and edema, d - dimer was elevated to 1572 ng / ml (normal reference range 0 - 243 ng / ml) and altered results of the arterial blood gas analysis (ph 7.42/pco2 25.8 mm hg / po2 69.7 mm hg / hco3 16.4 mmol / l) aroused suspicion of pe . It was confirmed by computed tomography and thus, therapy with heparin infusion was initiated (fig . Other laboratory findings indicated white blood cell counts of 10000/mm; hemoglobin 9.7 g / dl; platelet count 275000/mm; c - reactive protein 0.0 mg / dl; alanine aminotransferase 18 u / l; aspartate aminotransferase 39 u / l; total bilirubin 0.46 mg / dl; and serum creatinine 0.7 mg / dl . The cardiac enzyme levels were elevated with a peak level of creatine kinase - mb isoform 27 ng / ml (normal reference range 0 - 3.6 ng / ml) and troponin i 5.30 ng / ml (normal reference range 0 - 0.1 ng / ml). Transthoracic echocardiography showed hypokinesia of mid / base segments of lv with hypercontraction of apical segments and reduced ejection fractions estimated at 47% with no significant valvular dysfunctions . Right ventricular systolic dysfunction or dilated right ventricle was not found, and yet an estimated systolic pulmonary artery pressure increased mildly to 43 mm hg on the assumption of right arterial pressure of 10 mm hg (tricuspid regurgitation peak velocity: 2.87 m / s) (fig . Coronary angiography was immediately performed within an hour of admission and ruled out obstructive atherosclerotic diseases . She was managed with medical therapy using -blocker and diuretics.2)3)6)7) angiotensin converting enzyme inhibitors was not indicated because of mild hypotensions . After the medical treatment, the patient was presented free of symptoms for the following few days . Transthoracic echocardiography was undergone 1 week after her admission and showed improvements in ejection fractions of 58% with no wall motion abnormalities (fig . The patient was discharged in good clinical conditions and remained well after 3 months of follow - up . Takotsubo cardiomyopathy, also known as apical ballooning syndrome, is generally characterized as severe, reversible lv dysfunctions of apical segments . Variants, the non - apical ballooning syndrome, have been recognized as reversed, mid - ventricular, and localized type based on the involvement of the left ventricular.8) our case is consistent with the reverse type, hyperdynamic apex and akinesia of the mid / base segments of lv . Compared to typical lv ballooning syndrome, this atypical form of transient lv ballooning syndromes have different characteristics of patients.6)8) hahn et al.6) described that patients with atypical transient lv ballooning syndrome were younger with the mean age of 36 and had fewer coronary risk factors such as hypertensions, diabetes, and smoking habits . Also, t wave inversion in an ecg was found as less similar to our patient . However, according to the recent reviews and many published clinical cases, the excessive catecholamine and exaggerated sympathetic activities are greatly accountable.1 - 3)9 - 11) differences in anatomical location and density of cardiac adrenergic receptors and the degree of sympathetic activity may explain the wall motion abnormalities as seen in the typical and reverse types.8)11)12) clinical presentations and transient nature of lv wall motion abnormalities in reverse type are similar to those of classic takotsubo cardiomyopathy which could indicate a possibility of sharing pathophysiological mechanisms, and yet, none of related evidences has been revealed . Estrogens, which have a protective effect on cathecholamine - induced toxicity, appear to have influences on the preponderances of postmenopausal women toward takotsubo cardiomyopathy.1)2)13) however, further researches for the interaction of catecholamines and estrogen are necessary to clarify the underlying mechanisms of stress - induced cardiomyopathy at a younger age without estrogen deficiency, and the specific reasons for rare presentations of men with physiologically estrogen - deficient . Takotsubo cardiomyopathy has been described with a wide range of emotional or physical stressful triggers . Herein, we report a middle - aged woman with inverted takotsubo cardiomyopathy in the setting of pe, which is a rare coexistence for this association . The exact mechanisms of the relation between pe and atypical takotsubo cardiomyopathy are not clear . But increased catecholamine levels during severe pain and perfusion defect within the lung related to pe seem to result in the development of lv wall motion abnormalities.4)5) in this case, it is difficult to detect pe and reverse takotsubo cardiomyopathy independently, due to the fact that both clinical features mimic acute coronary syndromes . Despite of the poor sensitivity and specificity of ecg abnormalities to diagnose pe and inverse takotsubo cardiomyopathy, there are several frequent features including sinus tachycardia, both complete and incomplete rbbb, s1q3t3 pattern, and st - segment elevation, non specific t wave abnormalities, respectively.2)4 - 6) a transthoracic echocardiography (tte) provide the evidence of pe such as right ventricular systolic dysfunctions and pulmonary hypertensions,4)5) and stress - induced cardiomyopathy may have right ventricular involvement which is associated with more severe impairments in lv systolic functions.14) thus, it is important to carry out ecg promptly, tte and coronary angiography based on a high degree of clinical suspicions . Further research is needed to elucidate this relationship and different pathophysiological mechanisms for various ventricular morphologies of stress - induced cardiomyopathy . Diagnosing pe especially in a patient with characteristics of acute coronary syndrome such as stressinduced cardiomyopathy can be difficult . It needs to be highlighted that pe should be considered as a potential stressor once the reverse takotsubo syndrome is suspected.
Forty percent of the world's severely under - nourished under - five children live in india . Major underlying causes for this under - nutrition are inadequate access to food, insufficient health services and unhealthful environment . Integrated child development services (icds) scheme was launched in india in 1975 with a prime objective of improving the nutrition status of underprivileged children, by providing supplementary nutrition, through the network of anganwadi centers (awcs) and anganwadi workers (aww). It is the central point for the deliverance of icds services to children below 6 years of age, expecting women, lactating mothers and adolescent girls at community levels . The existing population norm for awc is: one awc per 1000 population in rural and urban project and one awc per 700 persons in the tribal project . Each awc is run by an aww supported by a helper in integrated service delivery . Together aww and awc works for better linkages of the community with the health system; as well as escalating the capability of community and women, particularly mothers for childcare, survival, and development . As per the revised guidelines of the icds, supplementary nutrition worth 500 kcal and 12 - 15 g of protein is distributed to all children of 6 - 72 months age . Severely under - nourished children aged 6 - 72 months of age are provided additional 300 kcal and 8 - 10 g of protein . Moreover, growth monitoring and nutrition surveillance of these children is also carried out with the help of growth chart . Growth chart is a vital appraisal tool for the evaluation of growth and development of child, which could be further used to detect early growth faltering and take preventive interventions accordingly . A new initiative in gujarat for under - nourished children is setting up of child development and nutrition centers (cdnc). Severely under - nourished (red category) child are referred to such centers for rehabilitation . At such centers, mother and child stays together; the child is treated for infection if any and is provided nutritious dietary supplementation with active participation of mother . Child is discharged from the center once he / she starts gaining weight . Despite being most widely studied program the present study was therefore undertaken with the objective of assessing the progress in growth of under - nourished children under icds and the factors associated with it in the tapi district of gujarat . Tribal population has higher rates of under - nutrition because of dependence on agricultural practices for food supply, discrimination in terms of socio economic status as well as neglect in the national programs . Assessment of nutritional status of children under icds is considered as a measure of effectiveness of the program and it is necessary for planners to understand the program and nutrition situation among the vulnerable tribal population of tapi region . Hence, far adequate literature is not available from the region on the subject matter . The study was conducted with priori permission from the health and family welfare department, government of gujarat . This was a retrospective cohort study where cohort of study participants was identified retrospectively from the awc data and follow - up assessment of them was carried out up to the day of the survey . Tapi is predominantly a tribal district of southern gujarat with agriculture being its principal economy . The study was conducted in 50 awc under 25 primary health centers (phc) of tapi giving equal representation to each of its five blocks . However, due to time constraint and certain national health program activities like intensive pulse polio immunization round and mass drug administration for filariasis, we were finally able to cover only 25 phcs . Equal representations was given to all the five blocks of the district, selecting five phcs from each block . In the first phase of sampling, list of awc was used as sampling frame for each phc and two awc from each phc were selected using the simple random sampling (srs), thus, total 50 awc were selected . Under the icds scheme, these growth charts are based on world health organization growth standards for weight for age for boys and girls . Three color coded categories are given in it: green for normal, yellow for under - weight (2 sd to 3 sd) and red for severely under - weight (<3 sd) child . For the second phase of sampling, list of all children aged one to five years, who were in red or yellow category of growth chart of awc before 1 year, was prepared . The month of february 2011 was considered for selecting children before 1 year . For each selected awc, on an average, ten under - nourished children of 1 to 5 years of age were selected randomly from the above list by srs . In case pretesting and piloting was carried out for checking practicability of the questionnaire and necessary corrections were made accordingly . General information like age, sex, education status of parents as well as service utilization of awc was assessed by personal interview of mothers . In case mother current growth status of child including current weight (kg) and mid upper arm circumference (muac) (cm) was measured using standard technique . From the past records of growth chart plotting, analysis was carried out to understand the advancement of growth status and factors associated with it, using independent sample t - test using epi info 2007 . The study was conducted with priori permission from the health and family welfare department, government of gujarat . This was a retrospective cohort study where cohort of study participants was identified retrospectively from the awc data and follow - up assessment of them was carried out up to the day of the survey . Tapi is predominantly a tribal district of southern gujarat with agriculture being its principal economy . The study was conducted in 50 awc under 25 primary health centers (phc) of tapi giving equal representation to each of its five blocks . Initially all the phcs were decided to be included in the study . However, due to time constraint and certain national health program activities like intensive pulse polio immunization round and mass drug administration for filariasis, we were finally able to cover only 25 phcs . Equal representations was given to all the five blocks of the district, selecting five phcs from each block . In the first phase of sampling, list of awc was used as sampling frame for each phc and two awc from each phc were selected using the simple random sampling (srs), thus, total 50 awc were selected . Under the icds scheme, these growth charts are based on world health organization growth standards for weight for age for boys and girls . Three color coded categories are given in it: green for normal, yellow for under - weight (2 sd to 3 sd) and red for severely under - weight (<3 sd) child . For the second phase of sampling, list of all children aged one to five years, who were in red or yellow category of growth chart of awc before 1 year, was prepared . For each selected awc, on an average, ten under - nourished children of 1 to 5 years of age were selected randomly from the above list by srs . In case pretesting and piloting was carried out for checking practicability of the questionnaire and necessary corrections were made accordingly . General information like age, sex, education status of parents as well as service utilization of awc was assessed by personal interview of mothers . In case mother current growth status of child including current weight (kg) and mid upper arm circumference (muac) (cm) was measured using standard technique . From the past records of growth chart plotting, analysis was carried out to understand the advancement of growth status and factors associated with it, using independent sample t - test using epi info 2007 . In current study, from the growth chart registers of awc, total of 529 under - nourished children falling into red 162 (30.6%) and yellow 367 (69.4%) category before 1 year (february 2011) were included . Follow - up weighing and categorizing of the same children after 1 year showed that 39 (7.4%) were in green category, 273 (51.6%) were in yellow category and 217 (41%) were in red category . It was observed that 89 (16.9%) of the 529 children had shown improvement in their growth in 1 year, while 334 (63.1%) and 106 (20%) of the children had shown stagnancy and faltering in their growth respectively . Number of children migrating from yellow / red category to green, yellow, and red category in 1 year was as seen in figure 1 . Mean weight gain in 1 year for all under - nourished children was 1.7 (1.4 sd) kg . There was no statistically significant difference between past and current weight in both yellow and red category children (p = 0.44) [table 1]. Categories of under nourished children: present and before one year (n = 529) association of demographic profile of under - nourished children with weight gain (n=529) moreover, looking at the growth chart it was evident that out of total 529 under - nourished children, only 114 (21.6%) children had fallen in to green category at any point of time during past 1 year . Only 19 (16.7%) out of 114 were able to maintain the green category up until the end of the year . According to the current muac, 73 (13.9%) of the children were severely under - nourished (muac <12.5 cm), 242 (45.7%) were mild and moderately under - nourished (muac = 12.5 - 13.5 cm) and 214 (40.4%) were in normal grade (muac> 13.5 cm) (kappa agreement for categorization of under - nutrition in to three categories between use of growth chart method and muac measurement was 0.029, [p = 0.20]). Out of total 529 under - nourished children, 257 (48.6%) were male and 272 (51.4%) were female . Gender - wise no difference in terms of mean weight gain in 1 year was seen between the two (p = 0.42). Furthermore, in the study, 151 (28.5%) children were in one to 3 years and 378 (71.5%) in 3 to 6 years age group with mean weight gain in younger children higher than older children [p = 0.004, table 1]. Around 140 (26.4%) fathers and 176 (33.3%) mothers of under - nourished children were illiterate with mean weight gain of children of illiterate mother being lower than literate mothers (p = 0.02), though no such difference was seen with education level of fathers (p = 0.14) [table 1]. Majority 480 (90.7%) of 529 under - nourished children had regular attendance in awc and only 49 (9.3%) children had irregular visits (absence in last 2 weeks). The major reasons for irregular visits given by mothers can be seen from figure 2 . Self - reported reasons given by mothers for irregular visit of their under nourished children to awc (n = 49) on checking for drop outs (weighing not carried out for 1 month or more in last year as seen from growth chart registers), one quarter that is 132 (25%) of children had drop - outs . Major reasons for drop - out were family being out of station as stated by 78.2% mothers, irregular running of awc as stated by 7.3% mothers, far away location of awc from home as given by 5.5% mothers, consistently ill child as given by 3.6% mothers, no one to accompany child to awc, no faith in awc services and no felt need of awc service as said by 1.8% mothers each . In 77 mothers most of the 516 (97.5%) children were eating supplementary meals given from awc . Major reasons for not eating supplementary feed in rest 13 (2.5%) children were: bad taste of food for 46.2%, not aware about the awc services for 7.7%, family being out of station for 7.7%, and child's unwillingness to attend awc for 7.7% mothers . In three children as seen from table 2, mean weight gain was not found to be associated with regularity in awc visit (p = 0.99), drop - outs (p = 0.99) or eating supplementary feeding given from awc (p = 0.61). Association of icds services utilization indicators by under - nourished children with weight gain (n=529) on observing growth chart registers at awc, 519 (98.1%) children's weight was plotted regularly, i.e., monthly . One important finding is that almost 120 (22.7%) parents were not explained about their child's under - nourished status and category by aww . Children whose parents were explained about their child's nutrition status had gained higher mean weight than their counterparts (p = 0.01). As seen from figure 3, only half of the children 285 (53.9%) were referred to higher health facility for treatment of under - nourishment by aww, from which 231 (81%) were actually taken to higher health facility by the parents . As seen from table 3 mean weight gain of children who were taken to higher centers (p = 0.03) and treated for under - nutrition (p = 0.009) was higher than others . Out of total 162 red category children before 1 year, 150 (92.6%) children were advised to visit cdnc by aww [figure 3]. Average weight gain during cdnc visit was 0.7 (sd = 0.5) kg . There was no difference in weight gain between cdnc attendees and non - attendees (p = 0.11) [table 3]. Referral, compliance and outcome of under nourished children to health facilities (n= 529) association of referral of under - nourished children with weight gain (n=529) out of all the under - nourished children, more than three - fourth of the children in yellow / red category had not come into the green category even a single time during the 1 year . Besides, in 1 year, growth faltered in one - fifth children and remained stagnant in three - fifth children despite being covered under the icds . A number of previous studies have also questioned the actual impact of icds on nutrition of children due to major implementation problems such as inadequately trained, supervised and supported aww; erratic provision of food supplies, and leakage in food procurement; poor quality bad taste food; and poorly targeted food supplementation not confined to under - nourished children . Furthermore, the highly focused approach of the program on the supplementary nutrition leads to neglection of other important interventions for reducing childhood under - nutrition like environment hygiene which directly curtails the exposure to the disease, hence breaking the vicious cycle of infection, and under - nutrition . The objectives of the icds program to enhance the capability of the mother and family to look after the health and nutrition needs of the child through community interaction as well as nutrition and health education, also remains largely unfulfilled . One more finding is that more than one fourth of the mothers of under - nourished children were illiterate with mean weight gain of these children lesser than their counterparts . Another national level survey has shown the share of under - weight boys amongst mothers with no education of 54%, compared with 32% among mothers with secondary or higher levels of education . An icds study from rohtak have also reported significant association between under - weight and maternal education of primary or less (p <0.001). In the present study, no association was found between father's education and mean weight gain . This could be explained by the fact that in typical indian family the child rearing is solely the mother's responsibility while the father remains busy in outdoor activities . Second point is that in present study almost equal representation was found of boys and girls among under - nourished children with no difference amongst them in mean weight gain in 1 year; whereas kumar et al . As well as bhalani and kotecha . Had found the condition unfavorable to girls due to societal and cultural propagated gender discrimination . Mean weight gain was also found to be higher for younger children, which could be explained by physiological slow down of growth by increasing age . In healthy children in normal circumstances weight increases by seven kg during 1 year, 2.5 kg during 2 year and 2 kg / year afterwards . Though, more than 90% surveyed children attend awc regularly which indicates a very good utilization of services, 25% of surveyed children reported to drop - out for more than 1 month during last 1 year in the study . The important reason stated for the same, was that the awc runs irregularly and they have lost the faith in awc . This indicates poor rapport of awws among the community in general and mothers in particular, which can be fatal for any program . Moreover, another major reason stated by mothers for irregular visits to awc was that child is too young . This is supported by the fact that under the icds mothers are permitted to take the supplementary food of their small children at home and so children under 3 years rarely attend the centers . This is supported by the fact that tapi is a rural district where many parents migrate in sugarcane farm seasonally for harvesting and young children of theirs usually accompany them . Another valuable reason given by some mothers was, far away location of awc from home, which should not be overlooked . Important point is that similar to present study one another study also did not found any association between nutritional status of children and duration of stay at awc (p = 0.56). The same study also showed overall percentage of deterioration (14 - 21%) in nutritional status among the children under icds twice that of improvement (5 - 12%). However, one finding of that karnataka based study of greater improvement for children with baseline higher grade of under - nutrition was in contrast to present study . In current study, around three quarter mothers were explained about the under - nutrition status of their child and hence they were aware about the same . In another study for evaluating icds, awareness about current status of child overall in the study, children whose parents were aware about their child's under - nutrition status had higher average weight gain, which is similar to abbi et al . This highlights the fact that, in addition to mere weighing of child, information of parents about their child's progress in terms of weight gain and proper counseling on how to improve and maintain their child's nutrition is more helpful in overall weight gain . In current study, more than 90% of the children referred by aww to cdnc had attended cdnc for the complete 10 days and most of these children gained weight during their cdnc stay . However, more than two - third of them lost weight again in their follow - up visits post cdnc stay . This exposed the actuality that proper attention was not given to nutrition of the child in follow - up, which reversed the benefit gained from cdnc . This is also the reason why at the end of 1 year no difference in mean weight gain was found between cdnc attendees and non attendees . The higher mean weight gain was found in children who were refereed and treated for under - nutrition in current study; which emphasis the importance of referral of all under - nourished children to community health center or other higher facilities . Follow - up on whether the child parents actually take the child to referral center is also needed to be kept by aww . Muac in place of weight for age is widely used in population surveys to check nutritional status of under - five children because of its feasibility . Attempt to check kappa agreement between muac and weight for age based classification of under - nutrition was made in current study . However, no agreement was found between two . There is also lack of clarity regarding the appropriate cut - off for muac to detect under - nutrition . One zimbabwe based study using 15.5 cm as cut - off found to perform it poorly in comparison to other standard indices for detecting under - nutrition . Further research to check for validity and reliability of muac, as well as standardizing appropriate cut off to achieve maximum sensitivity and specificity for detecting under - nutrition, needs to be carried out in large sample . Overall the current study shows important finding from the under studied tribal region in the area of under - nutrition, though it fails to take into consideration important confounders such as immunization, peri natal conditions, breast feeding, and other co - morbid conditions like diarrhea . This is the limitation of present study . In the background of knowledge gained from the current study regarding growth flattering of children despite attending awc, further operational research from the region is needed in areas of strengthening icds services; exact caloric content of food given to the children with respect to their requirement at awc; role of parental awareness; role of under - nutrition treatment; cdnc visit; and interventions to maintain the weight gained in cdnc . Overall the current study shows important finding from the under studied tribal region in the area of under - nutrition, though it fails to take into consideration important confounders such as immunization, peri natal conditions, breast feeding, and other co - morbid conditions like diarrhea . This is the limitation of present study . In the background of knowledge gained from the current study regarding growth flattering of children despite attending awc, further operational research from the region is needed in areas of strengthening icds services; exact caloric content of food given to the children with respect to their requirement at awc; role of parental awareness; role of under - nutrition treatment; cdnc visit; and interventions to maintain the weight gained in cdnc . More than three quarter under - nourished children have shown either growth stagnation or faltering at the end of 1 year despite attending awc . This indicates the need of early identification and special nutritional care of yellow / red category children as early as possible by the aww along with strengthening of icds services . Literate mothers as well as parents who were counseled about the nutritional status of their child are better off in taking appropriate care of their under - nourished child . Hence, regular weighing and plotting in growth chart for each child must be done and this information must be shared by the aww to the parents . Improvement in taste of supplementary foods may be helpful to increase its consumption by children . Referral to the higher center in case of under - nourished children must be ensured by aww . Follow - up must be taken regarding whether the child was actually taken to the referred health facility, since it was found to be an important contributing factor in improving growth status of these children . Additionally, aww should also follow - up children attending cdnc and should ensure that they avail services of awc once they return back to their home . This is an important step to prevent re - slipping of child towards red category . Supplementary feeding as a long run solution to country's under - nutrition problem and its actual benefits should be studied in detail with alternative innovative solutions.
Helicases are molecular motors that couple the energy of nucleoside triphosphate hydrolysis to the unwinding and remodeling of structured dna or rna [13]. The number of helicases expressed in higher organisms is strikingly high, with approximately 1% of the genes in many eukaryotic genomes apparently encoding rna or dna helicases . Helicases are involved in virtually all aspects of nucleic acid metabolism, including replication, repair, recombination, transcription, chromosome segregation, and telomere maintenance [47]. Based on their substrates, helicases can be classified as dna or rna helicases, although some can function on both dna and rna molecules . Dna helicases have been reported to function in a variety of dna metabolic processes, including unwinding duplex or alternative dna structures (triplex, g - quadruplex), stripping protein bound to dna, and chromatin remodeling [5, 6, 9, 10]. Traditionally, helicases are known to unwind double - stranded dna or rna in an atp - dependent manner . However, increasing evidence suggests that some helicases can rewind, or anneal, complementary strands of polynucleic acids in the presence or absence of nucleoside triphosphate (figure 1). Moreover, two so - called human helicases that were identified recently appear to only have atp - dependent rewinding activity [1115]. These discoveries not only enrich the definition of helicases but also establish the presence of a new type of protein: annealing helicase . The mechanism of this novel strand annealing activity and its biological consequences remain largely unknown . In this paper, i will provide a brief overview of strand annealing activity found in various proteins across species and then focus on annealing helicases in humans and their potential mechanisms and functions . Most knowledge regarding the strand annealing activity of proteins has come from studies of model systems, including bacteria, yeast, and xenopus laevis . The lehman lab reported the atp - dependent annealing activity of purified recombinant escherichia coli reca protein three decades ago . Although similar results were obtained by several other labs [1719], the annealing activity of reca (the human rad51 homolog) is likely due to the binding of single - stranded dna (ssdna), which forms a nucleoprotein filament . The reca (rad51) searches for homology along double - stranded dna (dsdna) and forms a stretching of dna duplex . Regulator protein stpa and recombination mediator protein reco have been reported to promote annealing of complementary single stranded rna (ssrna) and ssdna, respectively [20, 21]. The dna replication polymerase (dpo1) of sulfolobus solfataricus also possesses strand annealing activity . In yeast, the rothstein lab first found that rad52 protein binds ssdna and dsdna and promotes strand annealing . Later, the kowalczykowski lab demonstrated that rad51 and replication protein a (rpa) regulate rad52's annealing function [2426]. Another yeast protein, rad59, also stimulates complementary ssdna annealing [27, 28]. Xenopus rna - binding protein x1rbpa was reported to promote rna: rna annealing . For example, tat, one of six hiv regulatory proteins, encodes a small nuclear transcriptional activator and stimulates dna: dna annealing [30, 31]; dengue virus core protein also promotes rna: rna annealing . The wilson lab first reported that rat heterogeneous nuclear ribonucleoprotein (hnrnp) a1 has strand annealing activity on both dna and rna, and the activity is inhibited by phosphorylation of kinase pka or pkc . The annealing activity is restored by dephosphorylation of hnrnp by phosphatase 2a [34, 35]. Mouse p53 protein inhibits the unwinding activity of t antigen helicase in vitro; human p53 protein was also later found to inhibit several other helicases' unwinding activity due to its strong dna: dna and rna: rna annealing activity . The human rad51b, rad51c, rad51d, and xrcc2 protein complex catalyzes the strand - annealing reaction between a long linear ssdna (1.2 kb in length) and its complementary circular ssdna . In summary, at least a dozen proteins, particularly those involved in dna replication and repair, have been demonstrated to possess strand annealing activity . However, it is surprising to find that helicases, which unwind double stranded dna or rna, also possess strand annealing activity . The annealing activity was first reported in rna helicases (table 1). In 1997, the busch lab reported that human rh ii / gu rna helicase has rna folding activity forming an intramolecular duplex . In 2001, the stahl lab discovered that rna helicase p68 and its close relative p72 possess rna annealing activity for two complementary rna strands, and they also showed that ddx42p, another p68 homolog, has similar activity . Rna helicase a, also known as nuclear dna helicase ii or dhx9, is a superfamily 2 (sf2) helicase that unwinds dna - dna, rna - rna, and dna - rna strands with a 3-5 polarity . Recently, it was reported that rna helicase a promotes the annealing of trna3, the primer for reversing transcription, to hiv-1 rna . In addition to human rna helicases, some yeast and bacterial rna helicases also contain annealing ability . For example, the jankowsky lab demonstrated that ded1 from saccharomyces cerevisiae, in addition to its rna unwinding activity, facilitates the formation of rna duplexes . The lambowitz lab found that mss116p of s. cerevisiae promotes the annealing of the oligonucleotides in the absence of atp . Crhr, a cyanobacterial rna helicase, was also found to promote duplex formation in the presence of atp . Compared with rna helicase, more dna helicases have been found to possess annealing activity (table 1). The janscak lab is the first to report that both unwinding and annealing activity resided in a dna helicase, recq5 in 2004 . The janscak lab not only discovered the novel activity of recq5, but also mapped the unique c - terminal portion (aa 411991) that possesses the dna strand - annealing activity . This was the first demonstration of a dna helicase with an intrinsic dna annealing function residing in a separate domain of the same polypeptide (figure 2). Subsequently, many helicases, particularly recq family helicases, have been found to possess annealing activity . In humans, there are five recq homologs, and mutations in three of these genes (blm, wrn, and recq4) are associated with bloom's, werner, and rothmund - thomson syndromes, respectively . Although no disease has been linked to mutations of recq5, recq5 mice are highly cancer prone and display genomic instability [60, 61]. A single nucleotide polymorphism in recq1 correlates with decreased survival of pancreatic cancer patients [62, 63]. Annealing activity was reported for the bloom's syndrome helicase, blm, in 2005 by two independent groups [51, 53]. Recently, the brill lab further identified a subdomain of the blm / sgs1 n - terminus that contains annealing activity in vitro . Not only do human blm and yeast sgs1 display annealing activity, so does the drosophila blm homolog (mus309/dmblm) [51, 64, 65]. The wrn helicase was reported to contain strand pairing activity, and the annealing activity was mapped to the c - terminal region (aa 10721150). Later, the vindigni lab reported that recq1 efficiently promotes strand annealing as a higher order oligomer (pentamer or hexamer), while smaller oligomeric states (dimer or monomer) act to unwind duplex dna . Different quaternary states of recq1, modulated by binding of ssdna and atp, are associated with its strand annealing or unwinding activity (discussed later). Unlike other recq helicases, neither endogenous recq4 purified from hela cell extracts nor recombinant recq4 purified from e. coli originally showed unwinding activity . The unwinding activity of recq4 appears to have been masked by its strong intrinsic dna annealing activity [54, 69]. Because of its robust annealing activity, the presence of a third strand (e.g., same sequence as the labelled oligo but unlabelled) is required to demonstrate unwinding by recq4 . Furthermore, the n - terminus (aa 1492) is required for the annealing activity of recq4 . Although it was later reported that recq4 could displace short oligonucleotides (22 mer) without a third strand, the fact that longer oligonucleotides (30 mer) require a third strand [69, 70] indicates the strong annealing activity resides in the recq4 peptide . In addition to the recq helicase family, several other dna helicases possess strand annealing activity too (table 1). The pif1 helicase family is a group of 5 3 directed, atp - dependent, super - family ib helicase that is found in nearly all eukaryotes . The purified recombinant human pif1 proteins display robust annealing activity without atp, and this activity resides in the n - terminal region (aa 1180) of the protein (figure 2). Dna2 is a helicase and nuclease involved in okazaki fragment processing, double - strand break (dsb) repair, telomere regulation, and mitochondrial function . Point mutation analysis revealed that the annealing activity does not require either the nuclease or the helicase activity of dna2, indicating that the rewinding activity is uncoupled from nuclease and/or unwinding activity . Mutations in csb gene cause cockayne syndrome, a rare inherited genetic disorder characterized by uv sensitivity, severe neurological abnormalities, and progeroid symptoms . The csb protein catalyzes strand annealing of complementary ssdna, while both atp and rpa inhibit its annealing activity . Twinkle is a human mitochondrial dna helicase that is associated with heritable neuromuscular diseases, and it has ntp - independent annealing activity . The t4 phage uvsw helicase two archaea helicases (hjm / hel308a and hel112), and mycobacterium tuberculosis xpb also contain strand annealing activities . The term annealing helicase was created when two helicase domain - containing proteins were discovered to possess annealing activity and no unwinding activity . In 2008, the kadonaga lab discovered that harp is an atp - dependent annealing helicase . Harp (hepa - related protein), also known as smarcal1 (swi / snf - related, matrix - associated, actin - dependent regulator of chromatin, subfamily a - like 1), is a member of the swi / snf family protein . Mutations in harp are associated with schimke immuno - osseous dysplasia (siod), a multisystem autosomal recessive disorder characterized by short stature, kidney disease, and a weakened immune system . The majority of siod patients have t - cell deficiency and associated risk for opportunistic infection, a common cause of death . Loss of harp affects cellular proliferation and differentiation, and the response to replication stress . Following the kadonaga lab's report, three other labs found similar enzymatic activity for harp and further defined its biological functions [1113]. Harp binds directly to rpa via a conserved n - terminal motif and anneals rpa - coated complementary ssdna . It was proposed that harp might dictate its role in the s - phase - specific dna damage response to protect stalled replication forks by minimizing the accumulation of ssdna regions and facilitating the repair of collapsed replication forks [1113, 80]. The chen lab further identified that two hp domains, each has about 60 residues, dictate the annealing activity of harp . More recently, the cortez lab reported that the first hp domain is not required for annealing activity, and, intriguingly, harp is able to catalyze branch migration of holliday junctions (hjs) and regression of replication forks . After discovering the unique activity of the harp protein, the kadonaga lab identified another annealing helicase that they named annealing helicase 2 (ah2). Ah2 was previously named zranb3 (zinc - finger, ran - binding domain containing 3), a member of the snf2 family . Similar to harp, the purified recombinant ah2 protein displays dna - dependent atpase activity and atp - dependent rewinding activity . However, unlike harp, ah2 lacks a conserved rpa - binding domain and does not interact with rpa . In addition, ah2 contains an hnh motif at its extreme c - terminus (figure 2), which is common in prokaryotes and is often associated with nuclease activity . Contrary to expectations, the purified recombinant ah2 protein does not exhibit nuclease activity . With no disease linked to ah2 or genetic model generated for ah2, interestingly, the direction of both annealing helicases (harp and ah2) has not been examined in vitro . Since classic dna - dependent atpases that are bonafide helicases that have the ability to catalytically separate complementary strands behave in a directional manner with respect to the strand that the helicase protein is presumed to be bound, depend on which we define 3-5 or 5-3 helicase, therefore, it would be of interest to know whether harp or ah2 translocate in a directionally specific manner . Specific helicases need to function on the appropriate nucleic acid substrate at the appropriate time . In addition, these enzymes might be required to facilitate unwinding and/or rewinding under different circumstances . Indeed, several bloom's syndrome missense mutant proteins lack unwinding activity, but still possess strand annealing activity that is even greater than wild type blm, indicating that the misregulation of unwinding and rewinding activity may be one of the pathogenic factors . A key emerging question is how these two opposite activities of helicase are precisely regulated . The number of helicase motifs varies from seven, nine, to twelve, which are responsible for nucleic acid binding, ntp hydrolyzing, and dna or rna unwinding [2, 87]. Some helicases also contain accessory domain(s) at the n- or c - terminus, such as nuclease domain and various protein - protein interaction domains . As shown in figure 2, studies of human blm helicase and its orthologs including budding yeast sgs1 and drosophila blm revealed that its n - terminal region contains strand annealing activity . Studies of the recq5 helicase revealed that the c - terminus is responsible for its annealing activity . Furthermore, studies of recq4 protein revealed that some missense mutants lose unwinding activity but still possess strand annealing activity . These results suggest that the dna unwinding and strand annealing activities can be uncoupled, but the question remains whether there is a conserved domain that controls annealing activity . The cortez lab found that only the second hp domain is required for the annealing activity of harp (figure 2). Alignment of the hp domain with ah2 reveals a putative hp - like domain in the ah2 protein (residues 712820). Although hp domain - like amino acids are found in the ah2, it is unlikely that the hp domain is a universal element that governs annealing activity across helicases . For example, the n - terminal region (residue 156) of recq1 and the c - terminal region (aa 10721150) of the wrn helicase are required for their respective annealing activities . Alignment of the annealing domains of these two recq helicases with the hp domains present in harp and the hp - like domain in ah2 reveals no significant conserved residue . Although the n - terminal domain of recq4 and the c - terminal region of recq5 share certain identity and similarity, alignment of the n - terminus of recq4 and blm, and the c - terminus of recq5 does not result in any significant homology (data not shown). Thus, it is unlikely that a single conserved domain is responsible for the annealing activity of these helicases . Certain helicases may self - assemble to form dimers or higher order oligomers, and this can influence their catalytic activity or biological function [13]. Human recq1 helicase efficiently promotes strand annealing as a higher order oligomer (tetramer) while smaller oligomeric states (dimer or monomer) acting to separate duplex dna [50, 88]. Electron microscopy reconstructions of the higher order oligomeric form revealed that a cage - like structure forms a hollow channel, which may facilitate the annealing activity of recq1 . Both consistent and inconsistent with the findings of recq1, hel112, a homologue of human recq5 in sulfolobus solfataricus, exists as two predominant stable oligomeric states: monomer and dimer . Only the monomeric form has 3-5 dna - helicase activity, while both the monomer and the dimer possess strand - annealing activity . These findings raise the possibility that higher order oligomers promote annealing activity and smaller order oligomers promote unwinding activity . Nevertheless, additional studies are needed to address the relationship between the oligomerization and dual activities of helicases . For helicases that possess unwinding activity, it makes sense that atp fuels the unwinding activity, in turn, inhibits the annealing activity . Indeed, this has been seen in dna helicases such as blm, pif1, as well as the e. coli cas3 helicase . It was also reported that, for the rna helicase ddx42p, atp triggers rna strand separation while adp triggers annealing of complementary rna strands . However, for helicases with no detectable unwinding activity, it is largely unknown how atp regulates their annealing activity . For example, how atp inhibits csb's annealing activity, while harp and ah2 require atp [14, 15]. Rather than fueling the unwinding activity by hydrolyzing atp for example, the strand - annealing activity of recq5 is strongly inhibited by atps, a poorly hydrolyzable analog of atp . This effect is alleviated by mutations in the atp - binding motif of recq5, indicating that the atp - bound form of the protein cannot promote strand annealing . Atps also inhibits the annealing activity of blm, wrn, and crhr helicases . For recq1, atp binding induces a conformational change in the protein that serves as a molecular switch from a strand - annealing to a dna - unwinding mode . If atp indeed functions as a switch to regulate or balance the unwinding and rewinding activity of helicases, a promising avenue for future research will be to investigate the regulation mechanism, for example, structural determination of helicases with and without atp . Rpa is a fundamental protein involved in all aspects of cellular metabolism (see review [90, 91]). In dna repair processes, rpa physically coats ssdna to protect it from degradation by nucleases and also serves as a scaffold protein to recruit other repair proteins (e.g., rad51) to strand break sites . At the same time, rpa promotes checkpoint signaling after replication fork stalling through activation of atratrip and rad17 complexes . Rpa has been shown to stimulate the unwinding activity of many helicases in vitro, including wrn [92, 93], blm, recq1, and fancj . In turn, the strand annealing activity of recq1, pif1, and csb is inhibited by rpa . Rpa depletion causes a dramatic reduction in the formation of the annealing products in xenopus egg extracts, suggesting that rpa is required for single - strand annealing . The annealing helicase harp associates with rpa, but whether it is just a physical interaction or if rpa modulates harp's annealing function remains unknown . For ah2, yet to be identified proteins may regulate its nuclease and/or annealing activity . In addition to rpa, several other proteins have been shown to promote annealing activity of helicases . The 65 kda subunit of u2af is reported to mediate the annealing of complementary single - stranded rna or single - stranded dna, which reverses the action of rna helicase a . The purified human p53 protein inhibits the unwinding activity of several dna helicases, such as t antigen dna helicase, dna helicases i and ii of e. coli, and rna helicases p68, by promoting the rapid renaturation of complementary strands . The endonuclease xpg is also reported to stimulate the annealing activity of the wrn helicase . Catalytic activities of proteins can be modulated by posttranslational modifications, such as phosphorylation / dephosphorylation, acetylation, ubiquitination, and sumoylation . For example, endogenous recq1 is phosphorylated upon treatment of cells with ionizing radiation (ir), ultraviolet (uv), and hydroxyurea (hu); blm is phosphorylated by atm in response to ir [101, 102], atr in response to hu, and several other kinases ck1, cdc2, and mps1 . Wrn is phosphorylated by atm and atr in response to replication fork arrest [107, 108]. Harp is phosphorylated by atm, atr, and dna - pk in response to the dna damage checkpoint [11, 81]. Indeed, the strand annealing activity of csb is increased by dephosphorylation with phosphatase i and decreased by phosphorylation with ckii . Thus, helicase function may in specific cases be regulated by post translational modification through modulation of its strand annealing activity . Nevertheless, it remains largely unknown how annealing activity is modulated by these protein modifications . The biological function of so - called real helicases, which possess unwinding activity that includes recq family helicases [4, 6], pif1, and dna2, has been extensively reviewed . The physiological relevance of helicase annealing activity is revealed by the finding that several mutations observed in siod patients result in defective annealing activity in harp protein [14, 78, 111]. Although a limited number of annealing helicases have been identified, several biological functions have been indicated by related experimental evidence . Stalled replication forks can arise during normal chromosome replication or in the presence of dna lesions, but will collapse if being left unrepaired due to the presence of long stretches of ssdna . Annealing helicases might stabilize stalled replication forks through pairing the parental ssdna, migrating chicken foot / holliday junctions structures, and/or directly participating in repair of the lesion (figures 3(a) and 3(b)). Green fluorescent protein (gfp)-tagged harp is recruited to stalled replication forks . Compared with ssdna and dsdna, fork dna is a preferred substrate for ah2 binding and atpase activity, indicating that the forked dna is a physical substrate for ah2 . Because harp and ah2 can act as an opposing force to unwinding activities in vivo, there are obvious potential implications for the role of harp and ah2 in dna replication and dna repair activities (discussed below). Harp and ah2 might dictate their role in protecting stalled replication forks by minimizing the accumulation of ssdna regions and facilitating the repair of collapsed replication forks during dna replication . Consistent with its function on ssdna, four research groups have found that harp associates with the rpa complex [1113, 81], which possibly anchors harp to the ssdna . Cells depleted of harp accumulate ssdna and display increased sensitivity to aphidicolin and hu [12, 13]. Dna fibre analyses show that restart of replication forks after 2 hours of aphidicolin treatment is reduced in harp - depleted cells [11, 81]. These data suggest that harp promotes fork stability and restart by reannealing long stretches of ssdna generated at stalled replication forks . Indeed, very recently, the cortez lab demonstrated that in vitro harp can bind and branch - migrate three - way and four - way dna structures, and catalyze extensive fork regression of model replication forks . The recq family helicases have been well recognized to function in damaged replication forks . Wrn- deficient cells are hypersensitive to replication blocking agents, including hu [107, 114] and dna - interstrand cross - linking drugs . Blm - deficient cells are also hypersensitive to hu and mitomycin c (mmc). Although less sensitive to hu as blm - deficient and wrn- deficient cells, recq4-deficient cells are sensitive to hu . Recq1-depleted human cells are sensitive to hu and camptothecin (cpt). In addition, it has been reported that both blm and wrn are recruited to blocked replication forks in vivo and can catalyze fork regression in vitro [120, 121]. Moreover, the orren lab recently demonstrated that wrn and blm reestablish functional replication forks to overcome fork blockage . All these evidence suggest that recq helicase, particularly blm and wrn, participate in remodeling of stalled replication forks . However, it remains unknown how these helicases exert their annealing activity to contribute to replication fork restart . In addition to the recq helicases, human pif1 helicase specifically recognizes and unwinds dna structures resembling putative stalled replication forks . Using yeast ribosomal dna as a dna replication model, it has been shown that the events of replication fork block are increased in dna2 mutants . In particular, dna2 is involved in okazaki fragment processing, and it will be of interest to determine if its annealing activity stabilizes the lagging strand . Unlike harp and ah2, it would seem most likely that proteins with both unwinding and annealing activities might coordinate those activities to catalyze strand exchange and/or branch migration, such as generating and migrating a holliday junction or chicken foot structure for stalled dna replication forks (figure 3(a)). The function of the recq helicase family in dna repair processes is well recognized . The csb protein is known to function in transcription - coupled dna repair (tcr). Cells with harp depletion display a higher frequency of dsb [13, 81] and sensitivity to dna - damage (e.g., ir, mmc, and cpt). Harp is phosphorylated by atm, atr, and dna - pk in vitro, and the mobility of harp in sds gels is altered when it is isolated from cells treated with dna damage (hu, ir, and uv radiation). Taken together, evidence suggested that annealing helicases are involved in dna repair, but the question remains how the annealing activity contributes to dna repair processes . Of the various types of dna damage, dsb may be the most common and cytotoxic to cells . Dsbs are repaired by non - homologous end joining (nhej), homologous recombination (hr), and microhomology - mediated end joining (mmej). All three dna repair pathways need pairing of complementary single - stranded dna, particularly hr and mmej . There are mainly four forms of hr in higher eukaryotic cells: double holliday junctions (dhj) formed through crossover, synthesis - dependent strand annealing (sdsa) utilized by non - crossover, single - strand annealing (ssa) pathway between two repeat sequences, and break - induced replication (bir) pathway that repairs hr pathways are initiated by rad51 that searches and invades base - paired strands of homologous dna molecules, then d - loop and hjs are formed consequently (figure 3(b), left). Recq helicases have strand exchange activity [51, 126] and hjs branch migration ability [120, 121]. In the dhj pathway, it is very likely that the recq helicases, particularly wrn and blm, coordinate their unwinding and annealing activities to separate intact double - stranded dna and pair invading strand to template in the early stage, migrate hjs, and finally help to cleave hjs . Sdsa is a mechanism in which homology - mediated repair of dsbs occurs without formation and resolution of ligated hjs; it anneals the newly synthesized strand with the single strand resulting from resection of the second end (figure 3(b), left). Mmej or ssa use microhomologous sequences (525 bp) or long homologies (> 30 bp) to align broken ends before ligation (figure 3(b), right). Nevertheless, dhj, sdsa, mmej, and ssa pathways heavily rely on single - strand dna - annealing activity driven by proteins . On the other hand, dna helicases are recognized to play negative regulatory roles in recombination / repair through antirecombination, by disrupting presynaptic filaments prior to strand invasion, or by resolving d - loops before they can be extended and converted into replication forks . Although annealing helicases harp and ah2 have not been investigated in the dna repair pathways discussed above, both recq4 and blm helicases are reported to be required to promote sdsa [128, 129]. In the mmej or ssa pathways, nuclease activity is required in the flap - trimming step (figure 3(b), right). In fact, it has been reported that several helicases, including annealing activity containing helicase recq5, blm, and wrn, stimulate cleavage activity of flap endonuclease 1 (fen-1). Besides their function in dna replication and repair, another function of annealing helicases might be in dna transcription (figure 3(c)). Cas3 is a superfamily 2 helicase that possesses atpase, helicase, and nuclease activities as evident in the cas3 protein of streptococcus thermophilus . Recently, the e. coli cas3 protein was found to promote r - loop (rna: dna hybrid) formation within duplex dna in the absence of atp and to disassemble r - loops in the presence of atp, which is more relevant to structures formed in dna transcription . Given the fact that the csb protein is recruited to the site of a chromatin bound uv - stalled rna polymerase ii complex and that the recq5 helicase physically and functionally associates with rna polymerase ii [135138], it will be of interest to determine if the csb and recq5 use their annealing activity to stabilize the transcription machine as a dna damage response . A number of recq helicases are implicated in telomere metabolism, including wrn, blm, and recq4 . The purified recombinant pif1 proteins bind telomeric dna with a 100-fold higher affinity compared to random sequence, and telomere shortening was observed when pif1 was overexpressed . Telomere effects of dna2 proteins have been reported in s. cerevisiae and s. pombe [144, 145]. It will be of interest to know how these helicases exert their strand annealing activity, in particular recq4 that has robust annealing activity, to function in telomere maintenance . Annealing helicases might participate in telomere metabolism, where single strand overhang could require an annealing helicase to form a more stable structure, such as t - loop (figure 3(d)). For cells which operated by the alternative lengthening of telomere (alt) pathway, it is possible that strand annealing / strand exchange catalyzed by certain recq helicases may participate in telomere - sister chromatid exchange and hr - dependent dna replication (figure 3(d)). Coordination of strand annealing and unwinding activity at the g - rich telomeric end may influence telomere stability by affecting dna replication and repair processes, such as resolving g4 dna . The characteristic feature of this class of enzymes is that they contain a conserved atpase domain with the seven classic helicase - related motifs . The swi2/snf2 atpases are grouped within the sf2 helicase superfamily, and they have a distinct primary sequence signature defined by the spacing between helicase motifs iii and iv as well as conserved features of their sequences within the domain . Although most swi2/snf2 atpases do not have duplex dna strand separating activity, they retain other features of helicases, including directional dna translocation fueled by atp hydrolysis, participation in chromatin structure modeling, regulation transcription, and dna repair . Unlike harp and ah2, not all helicase domains containing snf2 family proteins have annealing activity, but like harp and ah2, many of them have been identified to promote branch migration of hjs in an atp hydrolysis - dependent manner . In prokaryotes, ruvab and recg have been shown to promote branch migration of hjs [147, 148]. In eukaryotes, several members of snf2 can promote fork regression and/or branch migration of hjs, including rad54, rad5 [150, 151], and hltf . Chd7, a helicase domain containing snf2 protein accounted for the majority of charge syndrome, plays a role in transcription regulation by chromatin remodeling . Although fancm is not a snf2 family member, it consists of an n - terminal sf2 helicase domain and a c - terminal inactive endonuclease domain . Fancm is able to branch migrate hjs and replication forks in vitro [154, 155]. Very recently, several helicase domain containing snf2 proteins, including smarca2 and smarca4, were identified to cause nicolaides - baraitser syndrome and coffin - siris syndrome . Interestingly, most of the patient mutations are located in the helicase domain, suggesting its importance for their function . However, it remains unknown whether they have strand annealing activity in vitro . In conclusion, it is a growing family of proteins that contain atpase / helicase domain, which use their enzymatic activity to regulate chromatin structure and gene expression . The discovery of annealing helicases establishes the presence of a class of enzymes that possess only rewinding activity and opens a new area of research . The range of proteins that function as annealing helicases remains to be determined . Researchers now hope to determine the biological function of harp and ah2 more fully, as well as to discover more of these types of enzymes . Annealing helicases could also potentially be found for rna - dna and rna - rna hybrids, expanding the research into areas such as protein synthesis, rna stability, and gene silencing . The coordinated action of unwinding and annealing may play a role in fork regression or synthesis - dependent strand annealing, in the pathway for dsb repair, as well as in transcription and telomere metabolism . The challenge will then be to understand how cells regulate helicase unwinding and rewinding activity in vivo, and determine where or when the annealing activity of helicase is needed . From an experimental standpoint, it would be great interest to identify and characterize separation of function mutants which: (1) inactivate helicase activity but retain strand annealing; (2) inactivate strand annealing but retain helicase activity . Characterization of clinically relevant or engineered helicase core domain and auxiliary domain missense mutants may be valuable to determine which biological pathways / steps require strand annealing versus unwinding activity . Finally, a better understanding of the biological function of annealing helicases is likely to provide the basis for treating a variety of human disorders, such as siod of harp, premature aging of recq helicases, and cancers.
Epigastric hernia is a type of abdominal wall hernias due to a weakness, gap or opening in the muscles or tendons of the upper abdominal wall, on the alba line between the umbilicus and the xiphoid process . The hernial sac content is usually properitoneal fat, vascular structures and, uncommonly, abdominal viscera . Epigastric hernias are usually occult in obese patients, and their symptoms may mimic peptic ulcer or gallbladder disease . There is a male predominance with a male to female ration of at least 3:1, diagnosis usually occurs in the third to fifth decade . Defects of the fascia may vary in diameter from several centimeters to only a few millimeters . The larger ones usually readily reducible, whereas the smaller often became in - carcerated . Operative management aims at reposition of the hernia sac contents and direct closure of the hernial opening with a continuous suture . Due to high recurrence rates, tension - free hernia repair with mesh is becoming more common . Even if is a common and relatively simple procedure, there is no exact protocol today on how the repair should be done . The purpose of epigastric hernia surgery is to repair the weakening area between rectus abdominis and put the hernial sac back into the abdomen . The best way to restore the anatomy of the abdominal wall in a tension free manner, the mayo technique and its alterations could not stand the test of time and it shows a recurrence rate of 20% and higher . Although there is no consensus opinion, the anatomic repair without tension and without an artificial enlargement of the defect is clearly the new trend in hernia repair techniques . In 1987 lichtenstein reported on 6321 cases of inguinal herniorraphy with a tension free repair, and in 1994 stuart reemphasized that special importance in his editorial in the lancet . A newer study from brancato and coworkers in italy also states the advantage of a tension - free prosthetic repair in 16 patients with epigastric hernia; in their work no recurrence has been recorded . They found the technique simple, safe and absolutely effective, allowing immediate rehabilitation with a low rate of complications (figs . Small epigastric hernias is usually not a medical emergency and can be healed without surgery . When the symptoms are frequent and the problem affects the quality of life of the patient, surgery is the solution . The traditional approach to incisional hernia repair usually involves a surgical approach via the vertical scar . In young woman midline vertical scar they would rather prefer not to be operated instead of having such a visible scar . Techniques developed for the surgical approach to mini - abdominoplasty include the use of the transverse lower abdominal incision and the resection of excess skin above the navel . The laparoscopic access was not the first choice because it did not allow the resection of the excess of skin . We report a case of epigastric hernia repair through a transverse lower abdominal incision with the resection of excess of skin . A 37 year - old female patient was diagnosed an epigastric hernia with a little diastasis recti . Patient's symptoms were sense of discomfort, bloat, sometimes associated with dull pain increasing with cough . She had a mild laxity of the skin in the lower part of the abdomen and the position of the navel was 16 cm from the pubic symphysis . She refused classic approach to surgical hernia repair due to the visible midline vertical scar . The general surgeon asked the cooperation of a plastic surgeon who found another technique reliable to solve the functional problem with an esthetic approach combining the hernia repair with a mini - abdominoplasty hiding the scar in the bikini zone . The miniabdominoplasty technique was chosen in accord to the abdominolipoplasty classification system proposed by mejia ja and castellanos c and categorized as a type ii . Preoperatory marking was done following the type ii abdominoplasty described by pontes r. because the patient had such criteria in fact this technique is suitable for females with high position of the navel . The patient was placed in the supine position with the break in the table at the patient's waist . The lower abdominal incision was first demarcated in the pubic area 6 cm above the anterior vulvar cleft . The incision was made, the flap was elevated, hemostasis was done to avoid any bleeding . The umbilicus was detached from its aponeurotic implantation to prepare the access to the epigastric hernia . Care was taken to elevate the skin flaps only as far as necessary to define the hernial defect and to find surrounding fascia of good quality . This area lacks important perforator vessels, and the tunnel was wide enough to expose the medial borders of the rectus muscles . The pannus was raised to the costal margins taking care to avoid undermining laterally to preserve the intercostal perforators to the flap . The navel was released from its insertion on the aponeurosis and left attached to the flap, as described by psillakis in his paper . Alba line was opened and the hernial defect was identified, isolated and was safely reduced . The edges were dissected to free the hernial sac and identify an intact facial edge . The hernia was reduced and the posterior fascia of rectus abdominis was dissected from its adjacent structures . A polypropylene mesh was placed over the posterior rectus fascia to prevent the recurrence of the hernia . The navel was reattached 2.5 cm below its original position maintaining 13.5 cm from the pubic symphysis, using a 3/0 absorbable suture . The excess of skin was sectioned after marking the cranial border of the flap with the pitanguy marker . Epigastric hernia repair through a mini - abdominoplasty incision is a reliable method to approach an abdominal wall defect with an esthetic procedure . The use of the mini - abdominoplasty approach isolates the incision from the hernial defect and repair . We found a little difficult to access to the epigastric area through the subcutaneous tunnel, but, when the defect is not too big to repair and the flaps are elevated till the xiphoid process, then it is easy to prepare the posterior fascia and to inset the polypropylene mesh . In conclusion we find this approach suitable for those people who need a surgical repair of an epigastric hernia and have such conditions:laxity of the skin in the lower part of the abdomen.high position of the navel.patients refusing midline vertical scar . Written informed consent was obtained from the patient for publication of this case report and accompanying images.
There is heterogeneity in human mrna start sites (1); 4060% of human genes are transcribed alternatively (2), and 49% of multi - exon transcripts are accompanied by alternative splicing of the initial exon (3). Transcription start sites might be altered in a variety of different cell types or affected by environmental conditions, such as methylation . Although an extensive collection of transcription start sites for a large number of human genes is available (4), the frequencies of individual start sites are unclear . There is a need for high - throughput technology to monitor the statistics of start site occurrences for a comprehensive understanding of the start site gene expression mechanism . Microarrays are unsuitable for this purpose because of their inability to detect novel start sites . The serial analysis of gene expression (sage) method (5) has demonstrated its effectiveness at cataloging large quantities of expressed genes in cells or tissues from a variety of physiological, developmental and pathological states (611). The original sage generates short (10 + 4 bp) nucleotide sequences, called tags, derived from the 3 ends of transcripts; however, typical tags are too short to be uniquely identified with their corresponding genes . This shortcoming was resolved using the longsage method (12), a high - throughput means of profiling 21 bp tags, which are sufficiently long to be unambiguously identified with genes in most cases . However, existing sage methods are designed to monitor the 3 ends of transcripts, and the challenge was to extend the sage method so that it would be capable of capturing the novel 5 ends of transcripts and efficiently quantifying individual 5 end occurrences . Recently, hashimoto et al . (13) developed such a system for human cell lines, while shiraki et al . The 5sage database stores a collection of data accumulated by using the hashimoto et al . Hashimoto et al . (13) have described the details of the method, and we present a brief summary here . The method first profiles 21 bp tags by using a novel way of combining the oligo - capping method (15), a modification of the oligo - capping method (16) and the longsage method (6). Subsequently, these 5sage tags are aligned with the human genome to locate their positions, to begin a search for neighboring mrna start sites . We found that 19 893 of 25 684 5sage tags in a human cell line, hek293, were matched to the human genome . Of the 15 448 tags that hit a locus within the human genome, 85.896.1% of the 5sage tags were assigned to within 500 to + 200 nt of the mrna start sites in the refseq, unigene (17) and dbtss (4) databases, while 1774 tags were within the introns of known genes or uncharacterized regions, indicating possible novel start sites . In the 5sage database server, users can browse transcription start sites and frequencies of individual genes by querying on the accession numbers of sequences in refseq, cluster identifiers in unigene or symbol names, such as hdac . To retrieve all the genes in the server, the word the user can impose additional conditions on the number of distinct start sites and the total frequency of 5sage tags monitored for individual genes of interest . For instance, one can look for genes by monitoring five or more distinct start sites with 10 or more 5sage tag occurrences . In response to the query clicking on each gene displays a window for browsing the transcription start sites (figure 1). The start site view initially displays the narrow, 150 bp region surrounding the transcription start site of the representation gene in refseq or unigene, while the global view presents entire structures of individual transcripts that are helpful in comprehending alternatively spliced transcripts at a glance . Users can change the zoom magnification of each view independently by setting the ruler unit to an alternative base pair length . The orange vertical lines depict transcription start points; the depth of each orange line below the axis shows the frequency of the transcription start site . The thick, green, horizontal lines are cpg islands, which are regions of 50 or more bp consisting of at least 50% g or c nucleotides . For instance, figure 1 shows the transcription start sites of neurofilament 3 (nef3). Note the large number of start points detected for nef3; most are novel, and some start at the second or third exon . Transcription start site view also lists 5sage tags, their distances from the representative start site, their frequencies and their nearest expressed sequence tags . We have performed long sage on the 3 ends of mrna in hek293 cells to validate the accuracy of our 5sage results (13). The total frequency of 3sage tags associated with the representative gene is also displayed with the 3sage tag sequences and distances from the start site . 3sage tags are sampled independently at random, the pearson correlation coefficient between the frequencies of 5sage and 3sage tags indicates moderate similarity (13). As on october 2004, the 5sage database presents transcription start sites collected from human cell lines, hek293 and ramos . Start site information in other human cell lines is being collected for the analysis of start point variation in different tissues, and will be made available at the same website . This work was supported in part by a grant - in - aid for scientific research on priority areas (c) from the ministry of education, culture, sports, science and technology of japan.
A total of 226 bengali medium students (male 99 and female 127), studying in class seven and eight, were taken from two urban and two rural schools of west bengal . Jepqr - s developed by corulla is 48 item self - reported questionnaire having four dimensions extraversion, neuroticism, psychoticism, and lie scale each of which has 12 items . The items of the questionnaire were translated into bengali by two bilingual bengali personnel . Where there were inconsistencies, both translation of the questionnaire by an expert was made and where there were any inconsistencies, the translators were consulted to get best possible solutions . Internal consistency of each items of each of the four subscales of the translated jepqr - s was completed . Inter - correlations between different subscales were also found . To find internal consistency of items under a subscale, item rest of test correlations were found . The internal consistency of the subscales of the translated questionnaire was found by calculating chronbach's alpha . The statistical analysis was made with the help of statistical package for the social science (spss) statistics 17.0 . A total of 226 bengali medium students (male 99 and female 127), studying in class seven and eight, were taken from two urban and two rural schools of west bengal . Jepqr - s developed by corulla is 48 item self - reported questionnaire having four dimensions extraversion, neuroticism, psychoticism, and lie scale each of which has 12 items . Jepqr - s developed by corulla is 48 item self - reported questionnaire having four dimensions extraversion, neuroticism, psychoticism, and lie scale each of which has 12 items . The items of the questionnaire were translated into bengali by two bilingual bengali personnel . Where there were inconsistencies, both the translators were consulted . Also back translation of the questionnaire by an expert was made and where there were any inconsistencies, the translators were consulted to get best possible solutions . Internal consistency of each items of each of the four subscales of the translated jepqr - s was completed . To find internal consistency of items under a subscale, item rest of test correlations were found . The internal consistency of the subscales of the translated questionnaire was found by calculating chronbach's alpha . The statistical analysis was made with the help of statistical package for the social science (spss) statistics 17.0 . Table 1 presents that the item rest of test correlations vary for the extraversion between 0.082 and 0.417, for neuroticism between 0.127 and 0.552, for psychoticism between 0.085 and 0.504, and for the lie scale between 0.051 and 0.363 . Item rest of test correlations alpha reliability found for the four subscales were 0.620 for extraversion, 0.663 for neuroticism, 0.604 for psychoticism, and 0.620 for lie scale . The test retest reliabilities were found 0.659 for extraversion, 0.652 for neuroticism, 0.631 for psychoticism, and 0.621 for lie scale . The present study was aimed to examine to what extent the bengali translation of the jepqr - s is functional in bengali cultured population . The results [table 1] of the first stage of data analysis indicate that most of the items within a subscale have significant correlations with rest of the items . The alpha coefficients of all the four subscales recorded in this study do not cross 0.7, the level recommended by kline, but they are very close to it and satisfactory . Alpha coefficients for extraversion, neuroticism and lie scale recorded in this study are less well relative to main stream studies, perhaps, due to cultural difference, as a measuring tool like personality test is always culturally loaded . Significant observation of this study is that the alpha coefficient of 0.604 for psychoticism is impressive against the historic difficulties encountered by the subscale . Retest reliabilities found in this study are satisfactory and the results are very similar to the findings of eysenck and eysenck which were for 13 years boys and girls with an interval of 6 months; extraversion 0.67 and 0.76, neuroticism 0.72 and 0.74, psychoticism 0.63 and 0.66, and lie scale 0.65 and 0.66 . Results relating to the main stream questionnaires provide that the dimensions of personality are not all orthogonal . The inter correlations [table 2] between the dimensions of the translated jepqr - s of the present study also show that they are not all orthogonal . Neuroticism and lie scale also showed negative correlation significant at the 0.05 level . On the other hand, extraversion and lie scale also neuroticism and psychoticism both showed positive correlations significant at the 0.05 level . However, there is a significant negative correlation at the 0.01 level between psychoticism and lie scale while extraversion is independent of neuroticism . On the basis of the present study, it may be concluded that the bengali version of the jepqr - s may be accepted as a functional tool for research work and educational purpose . It is further recommended to administer the bengali version of jepqr - s on a larger sample for determining the psychometric properties more accurately.
Bone scintigraphy is an important modality for the examination of various pathological conditions of the skeletal system . Radionuclide bone imaging is quick, relatively inexpensive, widely available, and exquisitely sensitive and is invaluable in the diagnostic evaluation of numerous pathological conditions . These compounds accumulate rapidly in bone, and by 2 - 6 h after injection, about 50% of the injected dose is in the skeletal system . Tc - methylene diphosphonate (tc - mdp) imaging, customarily directed toward identifying altered skeletal metabolism, has been used extensively to image a variety of extraosseous lesions, especially heterotopic ossification and metabolic, metastatic calcification . We report a rare case of accumulation of bone scintigraphy tracer in a phlebolith in a patient of adenocarcinoma of lung . A 43-year - old female patient, known case of adenocarcinoma of right lung was referred for a tc - mdp bone scan with complaint of persistent low backache since 3 months . The scan showed abnormal, focal increased tracer uptake in left pelvic cavity, not localizing to any bone of the skeleton [figures 1a and b, arrows]. The uptake was persistent even in post - void imaging done after adequate hydration, giving us a clue that it was not due to tracer hold up in the ureter . On single photon emission computed tomography and computed tomography (spect - ct) imaging, the focal tracer uptake localized to a small focus of calcification in the left pelvic cavity away from the ureter [figure 2, arrow]. An additional ultrasonography of the pelvis confirmed that there was no ureteric calculus [figure 3]. Review of the patient's recent contrast - enhanced computed tomography revealed a phlebolith in left iliac vein (ct hounsfield unit: 338). Thus, we concluded the extraosseous tc - mdp uptake was due to phlebolith in the left iliac vein . Planar bone scan (a and b) of a 43-year - old female patient, a known case of adenocarcinoma of right lung . Focal, intense tracer uptake seen in left pelvic cavity (arrow) correlative single photon emission computed tomography and computed tomography fusion imaging localized this uptake to a phlebolith in left iliac vein (arrow) ultrasonography of the pelvis showing ureteric jets bilaterally (arrows), ruling out obstruction (calculus) in the ureter tc - mdp, a bone scan tracer, has rapid blood clearance, excellent in vivo chemical stability, and a high bone - to - soft tissue ratio, which are ideal for bone imaging . Although tc - mdp is customarily used to evaluate skeletal pathological conditions, its excellent clearance from normal soft tissues allows the detection of abnormal extraskeletal tc - mdp accumulation . It is hypothesized that tc - mdp and its analogues bind to bone by adsorption to the surface of the hydroxyapatite crystal . While in soft tissue, these pathways result in uptake of tc - mdp through what is believed to be chemisorption of the radiopharmaceutical onto the surface of the calcium salts . Phleboliths are deposits which develop in the wall of a vein and are composed of calcium or lime . These are most commonly seen in the lower pelvis and sometime occur in large numbers . They are often confused with ureteric stones when seen around the urinary bladder in the pelvic cavity . However, on plain radiographs, these can be distinguished from a calculus due to the presence of a translucent center and circular or oval shape. [810] bone scan tracer uptake in a phlebolith has been described in past . Dystrophic calcification occurs in patients with normal ca + and po4 levels and refers to ca + deposition in tissues secondary to histological disruption caused by trauma, ischemia, or cellular necrosis or in the enzymatic necrosis of fat . It is thought that calcium ion binds to phospholipids present in membrane bound vesicles, phosphatases generate phosphate groups which in turn bind to the calcium, and the cycle is repeated until local concentrations are elevated and crystals begin to form . Hyaline collagen degeneration, a consequence of tissue damage, is particularly associated with ca + deposition . Similar mechanism operates in other known causes of extraskeletal bone scan tracer uptake in tissue infarction, deep vein thrombosis, scars, and dermatomyositis . To conclude, we report a rare case of extraosseous uptake of bone scan tracer in a phlebolith . With growing use of integration of ct with spect, nuclear medicine physicians should become aware of such anatomical changes and variants so as to avoid misinterpretation . The awareness of the underlying pathophysiological basis of these changes and uptake of mdp in extraosseous soft tissue can significantly enhance the interpretation and diagnostic value of bone scintigraphy.
Diabetes mellitus (dm) is a group of metabolic disorders, mainly characterized by impaired glucose metabolism and consequent hyperglycemia as the common feature . Whereas cardiovascular complications are well described for dm, it is a relatively new consideration that diabetic patients are highly predisposed to cancer . In spite of some ethnic-, gender-, and age - specific differences, significantly increased risk of liver, pancreas, bladder and digestive tract cancer types 1general predisposition of diabetics to single cancer types: breast, endometrial, colorectal, pancreas, and liver cancers general predisposition of diabetics to single cancer types: breast, endometrial, colorectal, pancreas, and liver cancers many population studies indicate an increased risk for almost all kinds of cancer in dm with particular ethnic- as well as gender - dependent preferences (fig . 2). 2population studies in japan as an example of cancer predisposition of diabetics in years 19902003 population studies in japan as an example of cancer predisposition of diabetics in years 19902003 with respect to single dm - types, population studies have been carried out in different countries showing geographic particularities in cancer incidence . Thus, long - term monitoring of a cancer - specific incidence in the subpopulation of type 1 diabetics was performed in sweden during 19651999 . It is noteworthy that particular risk in childhood was demonstrated for endometrial, buccal - cavity, bladder as well as cervix cancer types (fig ., the highest risk has been registered for cancer of stomach, endometrium, cervix, and bladder . 3specific cancer incidence with respect to age in swedish diabetics type 1 registered in years 19651999 specific cancer incidence with respect to age in swedish diabetics type 1 registered in years 19651999 similar studies carried out for type 2 diabetes demonstrate liver, pancreas and bladder cancer to be the leading types (fig . 4). 4cancer risk for type 2 diabetics in north italy in years 19871996 cancer risk for type 2 diabetics in north italy in years 19871996 according to the current worldwide statistics, every 10 s one patient dies due to dm - related consequences: dm is currently the fourth leading cause of death . Furthermore, accumulating data demonstrate that, once appeared, cancer outcomes have worse prognosis for diabetics compared to non - diabetic oncologic patients (fig . 5). 5mortality by cancer in diabetic versus non - diabetic patients registered in netherlands in years 19952002 mortality by cancer in diabetic versus non - diabetic patients registered in netherlands in years 19952002 this general figures are well - supported by data collected in usa to treatment of single cancer types as represented in fig . These data clearly indicate less success in treatment of cancer for dm - patients . 6increased mortality of diabetics versus non - diabetics for single cancer types as documented for patients treated in usa in years 19821998 increased mortality of diabetics versus non - diabetics for single cancer types as documented for patients treated in usa in years 19821998 the hindered treatment of oncologic diseases in diabetes care is, however, not the only reason of significantly increased cancer - related mortality of diabetics . Recent studies indicate that diabetics are generally predisposed to cancer development [29, 1122]. Here we overview subcellular and molecular mechanisms that can contribute to cancer - provocation in diabetics . Increased oxidative stress has been implicated in molecular pathomechanisms of dm and majority of chronic diseases developed secondary to diabetes [2325]. Several studies demonstrated the excessive production of ros to be the common feature of both diabetes types [10, 22, 2628]. Disturbed glucose / insulin homeostasis initiates overall cellular stress leading to ir / reversible damage to subcellular structures [28, 29]. These findings indicate an imbalance between the increased production of ros and decreased dna - repair capacity . Depending on a quality of cell - cycle controlling machinery, this imbalance can lead either to extensive apoptotic cell lost or proliferation of damaged cells . Whereas the first process causes mainly tissue - degeneration, the latter predisposes to cancer development . Both degenerative alterations in damaged organs and predisposition to cancer have been reported for dm - patients . Extensive damage to dna as well as mutations has been demonstrated also for mitochondria in dm - patients [28, 32, 33]. Mitochondrial genetic background as well as mitochondrial stress - response is considered as an important contributor in predisposition to cancer in diabetics [32, 34, 35]. Electron transfer chain (etc) is the main energy source essential for performance of all cellular functions . Particularly, dna - repair is a highly energy - consuming machinery, the efficiency of which obligatory depends on the quality of mitochondria . Mitochondrial dna variations may affect a highly sensitive balance between etc - efficiency and production of ros in favor of the latter increasing, therefore, mutagenic effects of ros and decreasing energy production . This is so called vicious circle resulting in mitochondrial dysfunction (fig . 7). As for mitochondrial protein repertoire, both quantitative and qualitative changes in nd1-nd6 (nadh - dehydrogenases of the etc - complex i) have been shown to contribute to the vicious circle resulting in premature aging and plenty of pathologies including neurodegeneration and cancer . In diabetics, the mitochondrial vicious circle has been implicated specifically in individual predisposition to breast cancer . Causes a dangerous imbalance between highly increased production of ros on one side and low energy production on the other side . Highly increased damage to chrdna and mtdna, remarkably decrease repair capacity as well as compromise cell - cycle control are direct consequences of stress - provoked mitochondrial dysfunction [22, 26, 28, 33, 36] mitochondrial vicious circle causes a dangerous imbalance between highly increased production of ros on one side and low energy production on the other side . Highly increased damage to chrdna and mtdna, remarkably decrease repair capacity as well as compromise cell - cycle control are direct consequences of stress - provoked mitochondrial dysfunction [22, 26, 28, 33, 36] patients with diabetic history are at increased risk of infection [3840]. There is a growing body of evidence for compromised immune response in this patient cohort as a consequence of metabolic syndrome [4143]. This imbalance can lead to highly increased incidence of viral infection potentiating cancer risk in diabetics [4346]. Currently it is already well - acknowledged that more than 15% of viral infections are able to cause cancer in humans . Thus, human papillomavirus (hpv) infection is attributed to 80% of all human cancers and was proposed to play a central role in molecular pathomechanisms of breast cancer [4850]. Integration of viral particles in human genome frequently results in activation of several proto - oncogenes, which in turn trigger tumorigenic mechanisms in affected cells [22, 48, 5153]. Thus, a viral activation of proto - oncogene c - myc is well described in literature . Thereby, a targeted integration of viral particles in human genome plays the crucial role for consequent cancer development [47, 48, 54]. In this context, hpv demonstrates clear preference for its integration sites, mainly in regions situated closely to c - myc coding sequences . Once activated, c - myc protein suppresses the cell - cycle controlling activity of p53, and allows, therefore, the development of new tumorigenic phenotype of transformed human cells [22, 48, 52]. In consensus, the activated synthesis of viral proteins e6, e7, e1 and e2 has been shown to be involved in cancer - related cell transformation [48, 55]. Most relevant mechanisms for viral etiology of cancer predisposition, particularly, in dm - pathology are summarized in fig . 8clue to viral etiology in dm - provoked cancer: vicious circle is the particularity of metabolic syndrome with high risk of cancer development [22, 26, 28, 33, 36, 3845, 5156] clue to viral etiology in dm - provoked cancer: vicious circle is the particularity of metabolic syndrome with high risk of cancer development [22, 26, 28, 33, 36, 3845, 5156] increased oxidative stress has been implicated in molecular pathomechanisms of dm and majority of chronic diseases developed secondary to diabetes [2325]. Several studies demonstrated the excessive production of ros to be the common feature of both diabetes types [10, 22, 2628]. Disturbed glucose / insulin homeostasis initiates overall cellular stress leading to ir / reversible damage to subcellular structures [28, 29]. These findings indicate an imbalance between the increased production of ros and decreased dna - repair capacity . Depending on a quality of cell - cycle controlling machinery, this imbalance can lead either to extensive apoptotic cell lost or proliferation of damaged cells . Whereas the first process causes mainly tissue - degeneration, the latter predisposes to cancer development . Both degenerative alterations in damaged organs and predisposition to cancer have been reported for dm - patients . Extensive damage to dna as well as mutations has been demonstrated also for mitochondria in dm - patients [28, 32, 33]. Mitochondrial genetic background as well as mitochondrial stress - response is considered as an important contributor in predisposition to cancer in diabetics [32, 34, 35]. Electron transfer chain (etc) is the main energy source essential for performance of all cellular functions . Particularly, dna - repair is a highly energy - consuming machinery, the efficiency of which obligatory depends on the quality of mitochondria . Mitochondrial dna variations may affect a highly sensitive balance between etc - efficiency and production of ros in favor of the latter increasing, therefore, mutagenic effects of ros and decreasing energy production . This is so called vicious circle resulting in mitochondrial dysfunction (fig . 7). As for mitochondrial protein repertoire, both quantitative and qualitative changes in nd1-nd6 (nadh - dehydrogenases of the etc - complex i) have been shown to contribute to the vicious circle resulting in premature aging and plenty of pathologies including neurodegeneration and cancer . In diabetics, the mitochondrial vicious circle has been implicated specifically in individual predisposition to breast cancer . Causes a dangerous imbalance between highly increased production of ros on one side and low energy production on the other side . Highly increased damage to chrdna and mtdna, remarkably decrease repair capacity as well as compromise cell - cycle control are direct consequences of stress - provoked mitochondrial dysfunction [22, 26, 28, 33, 36] mitochondrial vicious circle causes a dangerous imbalance between highly increased production of ros on one side and low energy production on the other side . Highly increased damage to chrdna and mtdna, remarkably decrease repair capacity as well as compromise cell - cycle control are direct consequences of stress - provoked mitochondrial dysfunction [22, 26, 28, 33, 36] there is a growing body of evidence for compromised immune response in this patient cohort as a consequence of metabolic syndrome [4143]. This imbalance can lead to highly increased incidence of viral infection potentiating cancer risk in diabetics [4346]. Currently it is already well - acknowledged that more than 15% of viral infections are able to cause cancer in humans . Thus, human papillomavirus (hpv) infection is attributed to 80% of all human cancers and was proposed to play a central role in molecular pathomechanisms of breast cancer [4850]. Integration of viral particles in human genome frequently results in activation of several proto - oncogenes, which in turn trigger tumorigenic mechanisms in affected cells [22, 48, 5153]. Thus, a viral activation of proto - oncogene c - myc is well described in literature . Thereby, a targeted integration of viral particles in human genome plays the crucial role for consequent cancer development [47, 48, 54]. In this context, hpv demonstrates clear preference for its integration sites, mainly in regions situated closely to c - myc coding sequences . Once activated, c - myc protein suppresses the cell - cycle controlling activity of p53, and allows, therefore, the development of new tumorigenic phenotype of transformed human cells [22, 48, 52]. In consensus, the activated synthesis of viral proteins e6, e7, e1 and e2 has been shown to be involved in cancer - related cell transformation [48, 55]. Most relevant mechanisms for viral etiology of cancer predisposition, particularly, in dm - pathology are summarized in fig . 8clue to viral etiology in dm - provoked cancer: vicious circle is the particularity of metabolic syndrome with high risk of cancer development [22, 26, 28, 33, 36, 3845, 5156] clue to viral etiology in dm - provoked cancer: vicious circle is the particularity of metabolic syndrome with high risk of cancer development [22, 26, 28, 33, 36, 3845, 5156] taking together the above given facts, we conclude that diabetics may be highly predisposed to cancer development specifically due to following contributors: strong stress factors (excessive metabolic alterations, disturbed glucose / insulin homeostasis, hormonal deregulation, insufficient detoxification) with consequently excessive production of rosmitochondrial dysfunction with consequent low energy production, insufficient repair capacity and accumulating damage to both chromosomal and mitochondrial dnahigh risk for infectious disorders with consequently induced viral proto - oncogenic activity as well as activity of particular pathogenic bacterial forms such as helicobacter pylori . Strong stress factors (excessive metabolic alterations, disturbed glucose / insulin homeostasis, hormonal deregulation, insufficient detoxification) with consequently excessive production of ros mitochondrial dysfunction with consequent low energy production, insufficient repair capacity and accumulating damage to both chromosomal and mitochondrial dna high risk for infectious disorders with consequently induced viral proto - oncogenic activity as well as activity of particular pathogenic bacterial forms such as helicobacter pylori . Adequacy of stress response, repair capacity as well as immune defence are highly individual for each patient and strongly depend on risk factors such as genetic background, age, environmental factors, nutrition, body culture, life style, etc . Thus, varying breast cancer risk in different ethnic and social groups is well documented [16, 5860]. Breast fat deposits and distribution increase risk for breast cancer in female and even in male patients [16, 6165]. In contrast, breast cancer development is significantly reduced in people with regular physical activity . Alcohol abuse and tobacco consumption are further contributors which remarkably increase risk of cancer development [17, 20, 6771]. Current biotechnology possesses sufficient power to estimate the severity of damage to subcellular structures, individual stress reactions and repair capacity . For example, by stress proteome profiling in peripheral leukocytes and blood plasma, individual stress reactions can be well estimated . Advanced predictive diagnostic approaches are currently close to clinical application and allow to select groups of risk and to estimate a predisposition to severe complications in diabetics [34, 8284]. Much attention should be focused on preventive measures in diabetic healthcare, in order to restrict or even avoid severe secondary complications, such as cancer . Nowadays, it is increasingly clear that a well - balanced individually created diet is considered as an effective preventive measure and treatment of majority of chronic complications in diabetics [8688].
In many ways, cidp resembles a chronic form of gbs.10,14 cidp differs from gbs in that few patients recall preceding infections or other triggering events . Also, unlike the putative role of antiganglioside antibodies in some gbs variants (e.g., aman), no single major target antigen(s) has been identified in cidp.14,23 nevertheless, plasma exchange (plex), which presumably removes autoantibodies, complement, and cytokines / other soluble factors, is very effective in cidp as well as in gbs, with many patients responding within a few days.10,2326 reports of clinical improvement after the use of immunoadsorbents to selectively remove immunoglobulins in small series of cidp and gbs also suggest a direct role of autoantibodies in these conditions.27,28 the importance of autoantibodies may also be supported by reports that some mmn and cidp patients improve with the anti - b cell antibody, rituximab,8,29 although this effect was not observed in all studies.30 antibodies against peripheral myelin proteins including neurofascin and contactin-1, pmp 22, and p0; nodal proteins including gliomedin; and/or gangliosides have been reported in sera of cidp patients.3141 antibodies against any individual defined antigen are relatively infrequent in any particular series, however, and in the majority of cidp patients the antigenic target is unknown.14,23 animal studies, including induction of cidp - like experimental neuritis by immunization with myelin or myelin proteins, and passive transfer studies also support a role for antibodies in the pathogenesis of cidp.13,26,33 shifts in the balance of helper, effector, and regulatory t - cell subsets in the blood of cidp patients and elevations of t - cell derived cytokines all support a role for t - cells in inducing or maintaining the autoantibody response.4149 however, the t - cells and macrophages in biopsies appear predominately in perivascular areas, rather than along the nerve fiber itself.5052 the relative paucity of t - cell infiltrates in nerve biopsies from cidp patients and the lack of cerebrospinal fluid pleocytosis51 cast doubt on the role t - cells as major effectors of nerve damage / dysfunction per se . Together with the range of recognizable clinical variants of cidp,12,53 these observations suggest heterogeneity of the autoimmune pathology and chronic neural dysfunction.12 characteristic findings on microscopic pathology of cidp include segmental demyelination/ remyelination.50,54 onion bulbs, thought to represent a response of schwann cells and macrophages to repeated cycles of injury and repair, may also be seen . The presence of segmental demyelination and onion bulbs certainly suggest that myelin disruption plays a role in cidp pathogenesis and the disability experienced by patients.51,52,5558 myelin disruption, however, may only be a partial explanation and may occur later than the initial stages of the disease . Electrophysiologic studies are beginning to highlight the importance of nodal dysfunction, and they suggest that rapid reversal of disability may be tied to improvement in nodal function.1521,55,5961 classical electrophysiologic findings considered important for the diagnosis of cidp include multifocal conduction velocity slowing, distal latency prolongation, conduction block, and temporal dispersion, which have generally been considered indicative of demyelination.14,61,62 studies of axonal excitability using the responses to multiple stimuli, strength - duration relationships, and excitability - recovery protocols offer a complementary mechanism that may be particularly relevant to the clinical experience of some cidp patients . In a study of cidp patients, measurements of axonal excitability in response to subthreshold polarizing currents (threshold electrotonus) were interpreted as showing hyperpolarizing changes.60 in another study of cidp patients, stimulus - response curves suggested increased threshold requirements.59 nerve excitability has also been studied before and after ivig administration . Duration time constant was observed shortly after ivig infusions in patients with both mmn and cidp, perhaps reflecting a reduction in the persistent na current.16 these membrane changes may be mediated by autoantibodies capable of disrupting na+ channel clusters and functions of na+/k+ atpases in nodes of ranvier, resulting in hyperpolarization and decreased excitability.1518,20,21 similar electrophysiologic changes can be replicated in laboratory animals with antiganglioside antibodies and complement63 or by immunizing animals against gliomedin.13 although focal demyelination is often considered the cause of conduction block, nodal excitability changes resulting in increased thresholds for nerve stimulation may be an alternative explanation for this classic electrophysiologic finding in cidp.59 clinical response to ivig or plex may occur rapidly, often within just a few days . Remyelination or axonal regeneration, while likely important in eventual recovery, are implausible as explanations for this rapid clinical improvement.16,55 small studies of recordings obtained just before and at various time points after individual ivig doses have been interpreted to suggest that improvements in motor performance correspond to rapid but reversible changes in nodal function.1618,20 the duration of improvements in axonal excitability and muscle strength may be limited, with a return to the preinfusion baseline before the next dose of ivig is due.15,18,21 an interesting analogy may be found in a recent report of mg patients who responded to ivig . Thirty - two of the 37 patients reported improvement within a few days after each ivig infusion but worsening of myasthenic symptoms a few days before their next scheduled ivig infusion.9 no change in achr antibody titers were observed, even with prolonged ivig therapy . Therefore, the authors concluded that the major effect of ivig was to neutralize the autoantibody, rather than to suppress its production, and that ivig was, therefore, not a disease modifying treatment in mg.9 a dramatic example of this phenomenon in cidp is shown in figure 1 . In cases in which the therapeutic effects of ivig do not persist throughout the usual 28 to 30 day dosing interval, improved management of rapidly reversible responses may offer an important opportunity for optimizing short - term treatment effects . Further studies are needed to determine if optimizing short - term responses affects the long term prognosis of cidp . Cidp: cyclic gain in strength of ankle dorsiflexion in response to monthly ivig with return to baeline before next dose is due (days 078). After the addition of prednisolone and imuran on day 79, cyclic response to monthly ivig continues, but each month, peak and nadir are higher than on ivig alone . From pollard and armati18 with permission of publisher . Mmn is distinguished by demonstrating multiple conduction blocks limited to motor nerves, with sparing of sensory nerves.6467 the electrophysiologically demonstrated conduction blocks have been considered a consequence of segmental demyelination, but recent studies suggest immunologic target(s) actually on axons rather than / or in addition to schwann cells or myelin per se.67 a major puzzle in understanding mmn is the observation that corticosteroids and plex are usually not effective,64,65,67 while ivig has become the standard of care.68 approximately half of mmn patients have igm antibodies against the ganglioside gm1, and these seropositive patients tend to have more severe weakness, disability, and eventual axon loss than seronegative patients.69 mmn patients' sera containing igm anti - gm1 have been shown to activate complement in vitro,70,71 so it is possible that ivig is acting mainly by inhibiting c3 (third component of serum complement system) activation and/or deposition on ganglioside - rich domains of axonal membranes.21,71 although the complement membrane attack complex is often considered a lytic lesion which kills cells, sublytic attack can also occur, because nucleated cells can remove membrane attack complex pores by shedding or internalizing microscopic membrane vesicles.72 when this occurs, functionally important membrane proteins can be lost . This type of membrane loss is believed to explain the simplification of postsynaptic membrane folds and loss of achr in mg22 and might be hypothesized to occur at nodes of ranvier in mmn.21 yuki et al . Have shown that in mmn, igm - induced complement - mediated injury occurs at the nodes of ranvier, which in turn leads to conduction block and muscle weakness.71 they further showed that ivig can block antiganglioside antibody binding in a dose - dependent manner.71 using stimulus strength duration measurements to assess motor axon excitability, priori et al . Showed that axonal hyperpolarization occurs in mmn, suggesting that antibody - mediated inactivation of the na+ channels at the nodal membrane contributes to the apparent conduction block.73 boerio et al . Performed nerve excitability studies before and just after ivig treatment in mmn (and cidp) patients . They reported that ivig improved axonal excitability, which they attributed to restoration of na+ channel expression and/or activity.16 these electrophysiological observations could potentially explain why effects of ivig may improve muscle strength shortly after each infusion but wane in subsequent weeks.7375 thus, taken together, the results of these recent studies of axonal excitability in cidp and mmn, the absence of clearly identifiable effector cells attacking the involved nerves, and the rapid responses to ivig reported in both disorders suggest that autoantibodies (complement) may disrupt axon function in addition to inducing structural damage . In turn, the reports of rapidity and reversibility of the responses to igg infusions in some cases may suggest competition between infused therapeutic igg and endogenous pathologic antibodies.21 a corollary of this hypothesis is that the specificities, titer, and affinities of the autoantibodies being produced by any given patient at any point in time, together with the susceptibility of the target axons, may be important determinants of the treatment regimen required to optimally manage that particular patient at that time . The initial dose of ivig used for most autoimmune / inflammatory diseases follows a regimen serendipitously found effective shortly after ivig was introduced in 1981 . Four cll patients with thrombocytopenia and concomitant immune deficiency had increased platelet counts after receiving what was then the standard monthly dose of ivig for antibody replacement, 0.4 gm / kg . Because of the rise in the platelet count, the ivig dose was repeated the next day, then also on the remaining working days (but not the weekend days) of the same week, leading to a cumulative dose of 2 gm / kg given over 45 days.76 a subsequent randomized, multicenter trial comparing the 0.4 gm / kg per day 5 regimen with a single infusion of 2 gm / kg over 10 h in children with kawasaki syndrome found that the latter was more effective in preventing aneurysms and led to faster resolution of fever and biochemical markers of inflammation.77 this suggests that the peak igg level is the most important determinant of the success of therapy in some situations . However, kawasaki syndrome, like gbs, is considered an acute monophasic disease; while cidp, mmn, and mg are chronic disorders . In current neurologic practice, a loading dose of 2 gm / kg divided over 25 days is usually followed by maintenance doses of 12 gm / kg every 36 weeks.68,78 infusion of 2 gm / kg of ivig increases the serum igg level> 4-fold, from pretreatment means of 7001,060 mg / dl to peaks well over 3,000 mg / dl.78 the levels then drop by approximately 50% over 4872 h, as igg is distributed into the total extracellular fluid volume, which is approximately double the intravascular volume.78,79 after this rapid equilibration, the igg is catabolized with first - order kinetics and a half - life of 2130 days, so infusions are usually repeated monthly.7881 the relatively slow catabolism of igg as compared to other plasma proteins is due to a saturable endothelial cell receptor which protects endocytosed igg from lysosomal degradation and returns it to the plasma.80,82 saturation of this receptor with high concentrations of normal igg from exogenous ivig keeps endogenous pathologic igg from the recycling pathway and increases its degradation.83 this is likely an important concentration - dependent mechanism by which ivig can compete with autoantibodies without affecting their production.21,83 reports of patients responsive but chronically dependent upon ivig support the notion that the effects of each dose are transient, without any cumulative effect.9,21 certainly, not all patients are chronically dependent on ivig; up to 30% might achieve long - term drug free remission . Whether these observations can be explained by spontaneous remission with neuronal integrity supported by ivig while the disease is in the active state, or if ivig fundamentally alters the immune process remains to be clarified . In either case, accumulating evidence supports the hypothesis that the infused antibodies in ivig compete with putative pathologic antibodies and/or complement, and that the effect diminishes as the relative concentrations of normal versus pathologic antibodies decrease with time after each dose.21,83 in contrast to intravenously administered igg, with subcutaneously administered igg (scig), the initial direction of the movement of igg is opposite that of ivig . Scig is first absorbed into and transported through lymphatics, then enters the bloodstream by means of the thoracic duct.84 equilibration of the igg from scig into the intravascular space requires approximately the same amount of time as equilibration of ivig out of the intravascular compartment, 3672 h.8486 the peak serum concentration achieved with scig is, on average, only 61% of the peak achieved with iv infusions of the same dose.86 the slower rate of rise toward the peak and the truncation of its height are believed to be responsible for the much lower incidence of systemic adverse effects (aes) with scig.84,85,87 this is consistent with numerous reports that many of the aes of ivig infusions are rate - related and can be obviated by giving the igg by the sc route.87,88 no differences have been reported in the half - lives (t1/2) of igg given by the sc versus iv routes, generally reported to be approximately 3035 days with currently marketed igg products.81,85,86 because of the low incidence of systemic aes and lack of a requirement for venous access, scig is commonly self - administered at home, usually weekly.89 with weekly scig, only a few days elapse between the peak serum level from 1 dose and administration of the next dose . Serum igg levels experienced 34 weeks after a large bolus of ivig.85 pooled data from 7 studies in which equivalent monthly igg doses were given as weekly scig infusions versus ivig boluses every 2128 days showed that trough serum igg levels were higher by 1020% (mean = 12.7%) with weekly scig.81,85,86 after 612 weekly infusions, scig results in near - steady - state igg levels, with peak - trough differences only approximately 5% of the overall mean.85,86 in contrast, with ivig the trough - to - peak difference is often greater than 100% of the overall mean.81,89 as with any other therapy, the shorter the interval between doses, the higher the trough level and the smaller the difference between peak and trough levels are likely to be, regardless of the route of administration.81,89,90 the overall bioavailability of scig is approximately 30% lower than that of ivig, presumably because of binding to extracellular matrix and/or degradation in the tissues.91 for this reason, to achieve the same total systemic exposure to igg, defined by the area under the curve (auc) of serum igg versus time, it is necessary to increase the monthly dose of scig by 30 to 50% compared with the monthly dose of ivig.86,91 however, there is little evidence which supports basing doses on the auc, as opposed to the trough serum igg level . Typical pk curves from ivig and scig in a patient with primary immunodeficiency (pidd) who makes only minimal endogenous igg are shown in figure 2a and b. the large differences in peak and trough on ivig versus the near steady - state serum igg levels with scig are readily apparent . If the effect of therapeutic igg is proportional to its serum concentration at any point in time (for example, in pidd, the moment when exposure to an infectious agent occurs), it is easy to see how the effect of ivig would wane as it is metabolized and its concentration decreases . Figure 2c shows a prototypic pk curve for monthly ivig superimposed on the muscle - strength curve from figure 1, while the patient was on monthly ivig but no other anti - inflammatory or immunosuppressive treatment . Seen in this way, it is quite easy to understand why there would be a rapid response to the markedly increased serum igg level in the few days just after an intravenous dose, but also why that effect begins to wear off a, b: serum igg levels in a patient with x - linked (bruton's) aggamaglobulinemia . A: ivig at 406 mg / kg (30 grams total) every 22 days . B: scig at 12 grams / week (36 grams total), a 20% increment in dose . The igg remains at a near steady state with a mean of 850 mg / dl . C: cyclic response to ivig from cidp patient in figure 1 superimposed on typical pharmacokinetic curve of ivig (on a logarithmic scale) - from bonilla81 with permission of the publisher . Note the increase in muscle strength accompanying the rapid rise in serum igg level following each monthly dose, but then the decrease in strength shortly after the igg level falls . The diagnosis of cidp requires integration of clinical, electrophysiological, and laboratory data as well as collection of appropriate exclusionary information . Often the diagnosis is not straightforward . A recent editorial by cornblath et al . Suggests that as many as one - third of cidp patients in the us have been incorrectly diagnosed and may be receiving inappropriate treatment.62 therefore, strict adherence to scientifically derived and consensus clinical diagnostic criteria is critical.62 after the cidp diagnosis is confirmed, ensuring that treatment is effective, tolerable, and minimizes the patient's disability become the major goals . Based upon results of the largest controlled trial of ivig in cidp, the study of ivig, 10% caprylate - chromatography purified for the treatment of cidp (ice trial), the food and drug administration (us) approved ivig for cidp using a loading a dose of 2 gm / kg followed by maintenance dosing of 1 gm / kg every 3 weeks.92 however, optimal ivig doses and infusion intervals across a broader range of patients have yet to be clearly established, and prescribing regimens other than those used in the ice trial are common.9395 wide inter - patient variations in the pharmacokinetics of ivig9497 further highlight the need to individualize dosing to achieve an optimal treatment response . Nonetheless, relatively little emphasis has been placed on determining how to maximize treatment efficacy . There are anecdotal reports of patients asking for booster doses of ivig before their next monthly dose is due, but few reports of objective measurements which correlate with these end of dose effects . In the absence of a validated laboratory biomarker or any other way to establish a igg level,98 frequent measurements of muscle strength and functional capabilities may provide the best basis for individualizing and optimizing therapy (see the unanswered questions/ research issues section). Studies in patients with primary antibody deficiency have demonstrated that different individuals require different serum igg levels to remain free from infection,97,99 and that there is very wide variability in igg dose and treatment interval necessary to achieve and maintain clinically determined target igg levels in different patients.86,97 gbs may have a similar dose reported that serum igg levels obtained 2 weeks after ivig 2 gm / kg showed a large degree of pharmacokinetic variation and that those patients with greater increments in their serum igg levels had better clinical outcomes at 6 months posttreatment.96 in a prospective study in cidp, the same group showed that different patients required different ivig dosing intervals and serum igg levels to achieve and maintain optimal clinical responses.90 the mean trough serum igg level (just before each dose was given) required by the subset of these patients on a single ivig product (n = 17) was 1,500 mg / dl, but the range was 1,100 to 1,900 mg / dl.90 besides the suggestion that different patients require different igg levels to achieve maximum muscle strength, the doses and treatment intervals required to achieve and maintain any given igg level are also likely to vary greatly between individuals.90,9395,98 many immunodeficient patients report feeling better and remain free from recurrent symptoms of chronic low - grade infection when their serum igg level is maintained at a steady - state with the use of weekly scig.100 a few reports suggest that maintaining high steady state levels of normal igg by the use of scig may also be beneficial in cidp and mmn (see below), but additional studies are needed . As with plex, the initial response to ivig in many patients with cidp is rapid, with symptomatic improvement beginning within days.101103 the beneficial effect generally wanes within weeks, and ivig infusions are repeated at regular intervals, often for years.104 harbo et al . Reported that 6 of 11 cidp patients on individualized ivig regimens began to lose strength within a few days when their ivig was delayed beyond the usual interval.105 conversely, they began to regain strength in 5 days after an ivig dose, although a plateau was not achieved for 15 days.106 in the ice trial, improvements in grip strength and incat score in responding subjects were seen at the first post - ivig determination 16 days after the infusion.101103 further improvement was recorded at 3 and 6 weeks, but repeated measurements were not taken before and after subsequent doses of ivig.101 wearing off of the effect of each dose of ivig may be a reason that as many as 30% of cidp patients had dosing intervals of 15 days in a us survey93 and 21 days in a uk study94 (fig . Recently reported results of a study in which they confirmed ivig dependency by determining whether reducing the dose increased the patient's disability . They then used assessments of grip strength (vigorometer), mrc sum score, incat sensory score, and disability assessments as part of a protocol for optimizing the ivig regimen in which the dose was increased until the maximal clinical response end of dose symptoms and signs.90 although the frequency of the efficacy measurements was not described, the use of this protocol resulted in 52% of the patients receiving ivig at intervals of 1014 days and an additional 8% receiving ivig at intervals <10 days90 (bottom bar, fig . The utility of hand grip strength measurements is also supported by a cross - sectional analysis of 31 cidp patients using dynamometry, electrophysiology, and conventional clinical assessments, from which rajabally and narashimhan reported highly significant correlations between jamar dynamometer measurements and results of global and upper extremity motor and sensory scores.107 ultimately, frequent measurements with hand grip dynamometers or other devices the patient can be instructed to use at home should help determine the proportion of patients who might benefit by weekly or even more frequent igg dosing, and help to identify the treatment regimens which yield the best long - term results . Larger and longer studies using tools like grip strength monitoring that specifically address the short and long term consequences of treatment - related clinical fluctuations are needed . Actual ivig dosing intervals used for cidp patients in practice: horizontal bars indicate% of cidp patients receiving ivig at intervals 14 days in each study . Rajabally in the uk and kuitwaard in holland performed prospective studies designed to optimize responses, n = 15 and 25, respectively . . Reported on a cross - sectional analysis of prescriptions for ivig therapy for 46 unique patients from a home care / specialty pharmacy by 30 different doctors in the us . If weekly or more frequent igg dosing seems desirable on clinical grounds, self - administration of scig at home offers a practical route to maintain high steady - state igg levels . The safety, efficacy and practicality of this route of therapy in cidp has been described in case reports and a small randomized, placebo controlled study,109111 and is now being evaluated in a large multicenter trial.112 some of the patients in these studies reported improved tolerability, increased independence, and stabilization of clinical status.109111 while these factors may not be applicable to all patients, the possibility of maximizing treatment by maintaining a high steady - state igg level by means of a potentially more tolerable route of igg administration (i.e., sc) is attractive . If cidp patients have a better response to higher igg levels, as reported in a recent study in gbs,96 and different patients require different igg doses and treatment intervals to achieve optimal clinical responses,90,9395,98 then frequent clinical monitoring and correlation with frequent serum igg levels may identify those patients who benefit most from frequent iv infusions or the use of scig . The possibility that minimizing treatment - related clinical fluctuations may result in better long - term outcomes remains to be determined in long - term studies . Responsiveness of the majority of mmn patients to ivig despite the lack of response to plex113 or corticosteroids114 was demonstrated in the mid-90s by multiple anecdotal and case - series reports.114116 small controlled studies soon followed,117120 and the results of a 44-subject randomized, double - blinded placebo - controlled, crossover trial were reported by hahn et al . In 2013.120 mean maximal grip strength declined 31% during placebo treatment and increased 3.75% during ivig treatment (p = 0.005),120 ivig was recommended as first - line treatment by a european federation of neurologic societies / peripheral nerve society task force in 2006121 and 2010.68 of interest, even early reports noted that improvement associated with reduction in the degree of conduction block began within a few days, but lasted only 12 months, at best.114,115 others observed that the beneficial effects of ivig generally decrease over time.74,75,122 although increasing the dose or shortening the interval generally restores short - term efficacy, gradual worsening with progressive reduction of mrc sum scores and/or distal cmap amplitudes still occurs commonly.74,75 baumann et al ., reported that the use of a protocol designed to determine the lowest effective ivig dose and longest tolerable interval resulted in slowly progressive muscle weakness over a 4-year period while the patients received a mean of 0.5 gm / kg / month of ivig given at 4- to 12-week intervals.123 the investigators subsequently performed a prospective dose escalation study and observed that 6 of 9 subjects improved when their dose was increased to 1.2 gm / kg / month . The authors concluded that their initial strategy of trying to find the lowest dose at the longest tolerated interval resulted in significant underdosing.123 others have also reported that mmn patients gradually decline despite therapy and need slowly escalating ivig doses to maintain their strength.74,75,122 notably, these reports initially used mean cumulative ivig doses equal to or less than 1.2 gr / kg / mo.74,75,122 in contrast, vucic et al . Reported the results over a 7.25 year mean follow - up period of 10 patients initially treated with 3 courses of 2 gm / kg ivig at 4 week intervals then maintained on a mean ivig dose of 1.63 gm / kg/4 weeks . Muscle strength in these patients was stable, the number of nerve segments showing conduction block decreased by 45%, and distal compound muscle action potential amplitudes were stable or improved.124 thus, we have much to learn about optimizing the use of igg in mmn . Early diagnosis and institution of therapy, followed by close monitoring and frequent adjustment of dose and interval to assure that the patients are achieving maximal short - term responses may offer the best chances for favorable long - term outcomes . Monthly ivig is now the accepted first - line treatment for mmn.68,121 even so, treatment - related fluctuations in strength and end - of - dose weakness are also reported in this condition.125 several case reports and small case series have suggested that scig may be as effective as ivig for long - term maintenance of strength in mmn,126130 but large clinical trials have not compared the efficacy of scig versus ivig . Scig may have advantages over ivig, including the ability to maintain igg levels at a higher steady - state81,85,86 and perhaps smooth out end - of - dose weakness . An mmn patient who had cyclic fluctuations in disability while receiving ivig every 34 weeks for 10 years provides a provocative example . Switching to weekly scig and increasing the total monthly dose by 25% resulted in increased strength, which was stable at the peak he had previously achieved only transiently after each ivig dose.128 this improvement was accompanied by an increase in the trough serum igg level from 1,500 mg / dl to a steady state of 2,100 mg / dl, consistent with the hypothesis that the patient's strength at any point in time is directly related to the total igg concentration of in his circulation.128 similar dose - dependency observations were reported in small prospective, open - label, noncontrolled trials in which 4 of 5 patients maintained stable mrc sum scores for at least 6 months with steady - state serum igg levels of 1,380 to 1,740 mg / dl.129,130 taken together, these results suggest that scig may be a useful alternative to ivig for some mmn patients, particularly those that experience treatment - related wear - off or there remains a controversy as to whether prolonged ivig treatment totally controls the progression of mmn, or whether axonal degeneration and long term deterioration are inevitable . Some studies suggest that careful optimization of therapy with frequent adjustments to avoid end - of - dose weakening may help promote long - term recovery and prevent axonal loss,124 although other reports suggest gradual worsening despite this approach.75 it may be that axon damage increases toward the end of each dosing interval, when the ratio of the putative autoantibodies to normal igg is relatively high and the patient is experiencing increased weakness . If that is the case, using scig to maintain higher steady - state igg levels without cyclic troughs may decrease long - term deterioration in mmn, but that hypothesis remains to be tested . In 2007, the peripheral neuropathy outcome measures standardization (perinoms) study began.131 a major aim of this international collaboration is to better define the metrics used to follow patients with inflammatory neuropathies . In 2013, the group analyzed outcome measure data collected from cross - sectional validity and reliability studies as well as longitudinal studies of responses.132 the results emphasized the importance of measuring disability (i.e., activities and participation), strength and sensory impairment, and quality of life . Disability measured by the rasch - built overall disability scale (r - ods),133 impairment measured by grip strength (martin vigorimeter),103 and quality of life measured by the short form-36 item health survey134 emerged as useful metrics by which cidp patients can be assessed and treatment responses can be better defined . Although the use of these kinds of assessments has typically been limited to clinical trials, these measures (especially r - ods and grip strength) can be performed very quickly and reliably and, if validated, may greatly facilitate routine clinical care . We propose that frequent collection of validated and reliable disease - specific measures between physician visits can be used to optimize clinical care and improve outcomes . Of course, continued assessment of symptoms and signs by interviewing and examining the patient during office visits is invaluable and irreplaceable . Defining the treatment response during relatively brief, intermittent office visits may be difficult and not representative of the patient's function in his / her home environment . What about pain, fatigue, and/or other subjective symptoms in the absence of clear indicators of disease activity? Which factors should drive the treatment plan? For the patient who demonstrates some improvement, how do we know that therapy has been maximized? These treatment challenges are further magnified by the limited frequency with which a comprehensive examination and interview can be achieved, especially with current economic pressures . One approach to treatment optimization is frequent collection of disease - specific outcome measures like grip strength and r - ods as discussed within perinoms . Ivig regimens offer a unique opportunity to perform such assessments at the time of the infusions . If a patient achieves only a partial peak response and/or reports wear - off, the ivig dose and frequency can be optimized with rapid confirmation of the desired effect . On the other hand, this type of monitoring can also be useful to identify patients who fail to respond or who no longer need ivig . The dose can then be tapered or the interval between infusions lengthened with the security of frequently obtained reliable measures in case of relapse . Use of these metrics can help establish drug efficacy in individual cases, provide a rationale for patient - specific treatment tailoring, and allow rapid detection of nonresponders . The importance of these metrics in clinical trials is obvious, but their long - term utility has yet to be studied . Extending their application to routine clinical care may offer a unique opportunity to optimize inflammatory neuropathy treatment paradigms and hopefully long term outcomes . Many investigators are actively seeking an immunologic biomarker or soluble indicator of neuronal damage which could be used to identify those patients who are most likely to respond to igg therapy and to monitor its effects in mmn, cidp and other neuropathies.33,62,64,90,95,96,122 in the absence of such biomarkers, frequent measurements of grip strength and of disability using r - ods may be used to better characterize treatment responses . Current treatment strategies rely heavily on data obtained through unstructured and often unsolicited communication from patients as well as from infrequent face - to - face office visits . Adherence to rigorous diagnostic standards3,53,62,68,122,123 and collection of focused disease - specific outcome measures at more frequent intervals may assist with development of better paradigms for optimizing treatment . Prompt recognition of those patients for whom igg or other expensive biologicals are unnecessary or ineffective is another likely benefit of frequent measurements, which may aid in the development of criteria for identifying nonresponders and selecting appropriate alternatives, . Although several recent reports suggest that dosing ivig as frequently as every 714 days, or the use of scig to maintain high steady - state igg levels may be preferable in terms of maintaining consistent function and minimizing disability, several questions remain unanswered . Importantly, analyses of larger and more diverse populations are needed to determine which patients are characterized by a predominance of functional immunologic effects that are rapidly and reversibly responsive to igg and/or other immunotherapies as opposed to those who have mainly structural and/or permanent damage . Similarly, longer term follow - up is necessary to determine whether the kinetics of responsiveness vary at different stages of disease, and whether minimizing short - term fluctuations in strength and/or disability correlates with long term outcomes . Immunologic as well as clinical studies suggest that cidp is a heterogeneous group of conditions with a multiplicity of immunologic targets and mediators . The kinetics and pattern of response to igg and other therapies may be a useful criterion according to which subsets of these diseases are classified and split - out for further studies . Because igg can act by many different mechanisms, it seems quite likely that better definition of the immunopathogenesis of particular disease subtypes might lead to preferential use of different therapies, such as steroids and anti - inflammatories, complement inhibitors, or monoclonal antibodies and other narrowly targeted biologicals . In conclusion, recent studies of the immunology and electrophysiology of cidp and mmn suggest that much of the morbidity and disability in these conditions is caused by readily reversible functional effects of autoantibodies rather than more slowly repairable structural damage.18,21 these results serve as a foundation for understanding clinical observations of rapid responses and wear - off effects with intermittent ivig bolus therapy . Together, these observations suggest the hypothesis that infused antibodies in igg actually compete with pathologic autoantibodies . Observations that dosing of ivig as often as every 710 days or the use of scig to continuously maintain high steady - state igg levels may be preferable to the periodic extremely high peaks and low troughs of ivig boluses given every 46 weeks . Giving smaller doses of ivig more frequently or routine weekly self - administration of scig in the home may be associated with fewer, less severe adverse effects and significant cost savings as compared to intermittent high dose ivig, which requires administration and monitoring by a trained nurse, even if given at home . Additional research is needed to determine how widely applicable frequent dosing of ivig or scig might be, and whether continuous maintenance of optimal strength / minimal disability is associated with better long - term outcomes . This can only be achieved with the use of frequent monitoring of patients' responses and periodic re - assessments of therapeutic efficacy . The authors thank david schaefer and tim walton of axelacare, lenexa, kansas, for helpful discussions.
It imposes a large burden on society that is growing larger in terms of mortality or morbidity, quality - of - life and costs . Resistant hypertension is defined as persistent elevation of blood pressure (bp) above the goal in spite of concurrent use of three to four antihypertensive agents of different classes at maximally tolerated doses including a diuretic . As defined, resistant hypertension may also include patients whose bp is controlled with the use of more than three medications . Patients with resistant hypertension are at increased risk of stroke, cardiovascular (cv) disease, and chronic kidney disease (ckd). The diagnosis of resistant hypertension requires optimal bp measurement techniques to confirm persistently elevated bp readings . Pseudoresistance hypertension, including patients who lack bp control secondary to inaccurate suboptimal treatment regimen, poor adherence to antihypertensive therapy, life - style and diet, use of anti - inflammatory agents or white coat hypertension, must be excluded . Ambulatory bp monitoring or home bp allows the identification of white coat effect . Among the most common secondary causes of resistant hypertension in general, plasma renin activity (pra) is very low or undetectable in patients with primary aldosteronism . Furthermore, in most patients with primary aldosteronism, the plasma aldosterone concentration is> 15 ng / dl . In general furthermore, in most patients with primary aldosteronism, the plasma aldosterone concentration is> 15 ng / dl . A plasma aldosterone level (ng / dl)/pra (ng / ml / h) ratio of greater 20 is likely suggestive of primary hyperaldosteronism but further investigation is required to confirm the diagnosis . A high suspicion for primary hyperaldosteronism should be entertained for patients with following clinical history: spontaneous or unprovoked hypokalemia with renal potassium wasting, diuretics - induced hypokalemia that does not normalize after discontinuation of diuretics for at least 4 weeks and is unresponsive to angiotensin blockers and a family history of primary hyperaldosteronis . In a study of patients with resistant hypertension versus control subjects, plasma aldosterone levels, aldosterone - to - renin ratio and 24-h urinary aldosterone levels experts recommend screening patients with resistant hypertension for plasma aldosterone and 24-h urinary aldosterone levels, as well as pra, even if the serum potassium level is normal . In addition, patients with resistant hypertension should be evaluated for pheochromocytoma if they have suggestive manifestations such as episodic hypertension, palpitations and/or diaphoresis or tremor and if all else is negative, it is reasonable to begin an evaluation for renal artery stenosis . Adrenal vein sampling (avs) is considered the gold standard for localizing aldosterone - producing adenomas in patients with primary hyperaldosteronism . Most of patients with an aldosterone producing adenoma (apa) will have cortisol - corrected aldosterone lateralization ratios greater than 4.0 . In addition, the contralateral aldosterone to cortisol ratio is less than the inferior vena cava aldosterone to cortisol ratio in 93% of patients with surgically confirmed apa . It has been shown to have an accuracy rate as high as 96.6% and also has altered the course of clinical management in about 37.5% of patients . Following the avs, an aldosterone - blocking agent can be added to test therapeutic response . Avs is recommended for patients with primary aldosteronism when the computed tomography scan is normal, shows bilateral abnormalities, or shows a unilateral abnormality who would like to pursue surgical management (unilateral adrenalectomy). Adding a mineralocorticoid receptor antagonist, such as spironolactone or epleronone, has been shown to reduce resistant hypertension in patients with primary aldosteronism especially those with bilateral adrenal hyperplasia, which has been found to be a contributing factor in about two thirds of cases of primary aldosteronism . In this study, spironolactone reduced systolic bp by as much as 25 mm hg when added to a multidrug regimen that included a diuretic and an angiotensin converting enzyme (ace) inhibitor or angiotensin - receptor blockade (arb) and the reduction was seen in patients with and without primary aldosteronism [table 1]. Similar results were seen in a smaller study of patients with hypertension that was not responding to at least a dual therapy . Antihypertensive drugs for management of resistant hypertension in children and adolescents studies combining an ace inhibitor with an arb have produced varied results, and one has stirred controversy . The cooperate trial showed the combination of an ace inhibitor and arb to be superior to ace - inhibitor monotherapy in slowing the progression of non - diabetic renal disease . Other trials also have called into question the effectiveness and/or safety of dual renin - angiotensin system (ras) blockade in the treatment of hypertension associated with heart failure or cv disease . Until studies demonstrate true benefit, experts recommend avoiding dual ras blockades . A recent systematic review suggested that treatment with beta - blockers improved all - cause mortality in patients with ckd and heart failure . Recent studies recommends treating patients with resistant hypertension who are unresponsive to aggressive antihypertensive therapy with ablation of sympathetic nerves in the renal arteries . These studies also suggest that renal sympathetic denervation provides safe and sustained bp reduction up to 1 and 2 years . Resistant htn is usually due to poor compliance, suboptimal therapy, renal vascular hypertension, or use of nsaid, oral contraceptives, steroids, and estrogen replacement therapy . Primary hyperaldosteronism, renal vascular hypertension, and ckd are the most common secondary causes of resistant hypertension . A combination of ace - inhibitor, arb, plus a beta a blocker, and/or calcium channel blocker are highly effective and have an additive effect, controlling bp in up to 85% of patients . Thiazide or loop diuretic is often indicated in edematous states including patients with heart failure or chronic kidney disease . Renal nerve ablation is preserved for patients who fail to response to aggressive antihypertensive drug therapy.
Vitamin d is a fat - soluble vitamin obtained by the human body in two possible ways . There can be a dietary intake, mainly through fatty fish, eggs and fortified food as well as endogenous production, where transformation of 7-dehydrocholesterol into vitamin d in the skin occurs after exposure to ultraviolet b radiation . In the liver, vitamin d is hydroxylated to 25-hydroxyvitamin d. subsequent hydroxylation in the kidney forms the active metabolite, 1,25-oh vitamin d. in pregnancy, there is a 2-fold higher concentration of 1,25-oh vitamin d in maternal serum due to activity of placental 1--hydroxylase (novakovic et al ., 2009). Vitamin d not only influences bone mineralisation but has implications on maternal and fetal well - being . 25-oh vitamin d deficiency is associated with an increased risk of developing preeclampsia (bodnar et al ., 2007; haugen et al ., 2009), multiple sclerosis (hayes et al ., 1997; pierrot - deseilligny, 2009) and schizophrenia (mcgrath, 1999; mcgrath et al ., there is also an association with type 1 diabetes (stene et al ., 2000) and asthma (brehm et al ., 2009; erkkola et al ., 2009; willers et al ., 2007) after deficiency in utero or in early life . Neonates from deficient mothers have lower birthweight (mannion et al ., 2006; sabour et al ., 2006; scholl and chen, 2009) and at age 9 still demonstrate a lower bone mineral content (javaid et al ., 2006). In vitro studies have suggested a protective effect of 25-oh vitamin d against malignancies such as breastcancer and cancer of the colon . Risk factors for developing deficiency have been identified; living in northern latitudes, limited sun exposure, dark skin, poor social circumstances and extensive clothing are amongst the most common ones (baile et al ., 1979;, 2009; mulligan et al ., 2009; sachan et al ., 2005;, 2009; taha et al ., 1984; waiters et al ., 1999; this makes immigrants in northern countries, especially when dark skinned and/or covered, extremely vulnerable (bowyer et al ., 2009;, 2006; wielders et al ., 2006) (clemens et al ., 1982). Results of vitamin d status in the pregnant flemish population have never been published before . This pilot study aims at determining the prevalence of vitamin d deficiency in the antwerp population . The pilot study ran from august 1, 2009 until november 30, 2009 after approval of the local ethical commitee was obtained . In each blood sample that was taken from pregnant women consulting the antenatal clinic, we determined 25-oh vitamin d. the nurse taking the blood samples put every patient in a category according to their sun exposure . There were three possible categories: not covered, covering of only the head and leaving arms exposed to sun or complete covering with no sun exposure except for the face . Because part of the period studied coincided with the month ramadan, we also asked the women whether they were fasting or not . Our laboratory uses the elecsys 25-oh d3 immunoassay (leino et al ., 2008) for determination of 25-oh vitamin d3 levels . This immunoassay is performed on a modular analytics e170 apparatus (roche diagnostics, manheimm, germany). The measuring range is 4 - 100 ng / ml (10 - 250 nmol / l), the reference range for hypovitaminosis in our laboratory is <30 ng / ml, corresponding the health based reference values . Vitamin d levels between 16 - 20 ng / ml are seen as mild deficiency, 6 - 16 ng / ml as moderate deficiency and values lower than 6 ng / ml as severe deficiency . For the statistical analysis, we used spss statistics 17.0 (spss inc ., chicago, illinois). Normality was tested with the kolmogorov - smirnov test, the means of vitamin d between all three groups were compared with anova - analysis . The means of each group according to exposure were compared with an independent samples t - test . To compare the groups of women who used a prenatal vitamin and those who did not we also used the independent samples t - test . Linear regression was used to analyse wether vitamin d level is influenced by gestational age, maternal age, parity, gravidity, sun exposure, intake of supplements and/or date of blood sample . For all tests significance was accepted at p <0.05 . The odd s ratio between covered and non - covered women with vitamin d levels lower than 30 ng / ml was calculated, and 95% confidence intercal group were also compared using the chi squared test . We determined 25-oh vitamin d3 in 171 women (n = 171). The mean age of this population was 29,1 4,6 (standard deviation or sd) years . The median gestational age was 24 weeks (range: 4 - 37), most women were primiparae (72/171, 42,1%). The number of fasting women was too small (4/171, 2,3%) to draw any conclusions . 17% (n = 29) of the women was taking a multivitamin preparation . They all used the same brand containing 10 microgram (400 iu) of vitamin d. in the entire population the mean 25-oh vitamin d value was 28 12,4 (sd) ng / ml . There was no effect of age, gravidity, parity, intake of supplements nor gestational age on the vitamin d level . There was however a statistically significant influence of date of blood sampling and sun exposure (p = 0,001). The mean vitamin d value of women taking supplements was 28,5 12,5 (sd) ng / ml, the group without supplements had a mean of 27,9 12,5 (sd) ng / ml . The difference in means between these two groups was not significantly different (p = 0,8). Of all women 86% (n = 147) was not covered, 10,5% (n = 18) wore head covers but had other body parts exposed to the sun, 3,5% (n = 6) was completely covered, leaving only the face open for sun exposure . There was a significant effect of degree of body covering on vitamin d level (linear regression, p <0,001). The mean 25-oh vitamin d value in the non - covered group was 29,5 12,2 (sd) ng / ml . There was a significant difference in vitamin d level between the three groups (anova, p = 0,001) (fig . 1). The mean of the partially veiled group, 17,2 7,2 (sd) ng / ml, was significantly lower than the mean of the non - veiled group (t - test, p = 0,001). The mean of the completely veiled group, being 22,5 12,9 (sd) ng / ml was not significantly higher than that of the partially veiled group and not significantly lower than the non - veiled group (t - test, p> 0,05). When we only compare covered versus non - covered groups, there are significantly more covered than non - covered women with a concentration of vitamin d lower than 30 ng / ml (odds ratio 6,2; 95% ci: 1,8 - 21,7; p <0,05). The mean vitamin d value of our population, 28 ng / ml, was below the reference range used in our laboratory . This suggests a widespread shortage of vitamin d in our population, 1,75% was suffering from severe deficiency, 9,9% had moderate deficiency and 18,1% had mild deficiency . The values used are based on concentrations that avoid development of rickets and osteomalacia (vieth et al ., 2007). With new date on the role of vitamin d besides bone metabolism, some authors are pleading for higher cut - off values to determine deficiency (norman et al . Heaney (2005) states that 32 ng / ml should be considered as a minimum for normal physiology, bischoff - ferrari (2008) defines values of 36 - 40 ng / ml as optimal serum concentrations . We found no effect of maternal age, gestational age, parity, gravidity and intake of supplements on the vitamin d level . No consensus exists on the recommended intake and supplementation of 25-oh vitamin d during pregnancy ., 2007; madelenat et al ., 2001; saadi et al ., 2007;, 2009; yu et al ., 2009) and several authors agree that the current recommended intake of 200 - 600 iu (or 5 - 15 g) is too low, daily requirements may be closer to 1000 iu (25 g) or higher (bisschof - ferrari et al . The most commonly prescribed multivitamin preparation in belgium, only contains 10 g (400 iu) of vitamin d, a value that will not suffice to maintain or build sufficient levels . This fact is confirmed in our pilot study: no significant difference in vitamin d levels between women taking supplements and those who did not . There clearly was an effect of sun exposure and date of sampling, probably because august has more sun hours than november . In the population studied, the non - covered women had higher mean serum concentrations of vitamin d compared to partially covered women . The higher mean values of the completely covered group were probably due to small group size and were not statistically significant compared with other groups . However, we did not classify the participants according to their nationality nor their skin tone and as most women wearing head / body cover also have a darker skin, this is a fact that we should have taken into account . Furthermore, most of the covered women are immigrants who often live in poorer social circumstances . Hence, their lower vitamin d levels might not be only attributable to wearing head / body cover but also to poor dietary intake . Although most of the vitamin d production comes from skin conversion, the dietary intake of vitamin d is something we ll have to examine in further studies, as well as darkness of skin and nationality . As this was a pilot study, we only measured 25-oh vitamin d. in the future, we will start including other relevant parameters such as medical history, serum levels of calcium and parathyroid hormone . Low vitamin d levels are frequently found in pregnancy but the optimal serum concentration remains unknown ., we found that low vitamin d levels in the antwerp population are frequent and that there is an effect of the seasonal moment of the year and degree of sun exposure . A large scale study is needed to come to clinical guidelines and recommendation for obstetricians.
Malaria ranks among the major health and developmental challenges facing some of the poorest countries in the tropical and sub - tropical region across the globe.1 an estimated 3.3 billion people were at risk of malaria in 2010, although of all geographical regions, population living in sub - saharan africa have the highest risk of acquiring malaria; in 2010, 81% of the cases and 91% of the deaths are estimated to have occurred in the world health organization (who) african region with children under 5 years of age and pregnant women being most severely affected.2 in ghana, malaria is one of the leading causes of mortality in children under 5 years.3 similarly, studies have indicated that about 3.5 million people suffer from malaria every year, and approximately 20,000 children die from malaria annually with 25% of the deaths occurring in children under the age of 5 years.4 urine analysis remains the most valuable and highly important means of diagnosis in clinical medicine, as it helps to detect many diseases even before symptoms appear.1 liver dysfunction and renal impairment have been reported in severe malaria infections,56 and these observations led to the suggestion that malaria infection may have a significant effect on urine composition.1 studies conducted in nigeria and sudan examined urinary abnormalities among the general population with malaria infection and reported parasite density using the semi - quantitative (plus) system instead of the standard quantitative system.17 however, studies on urinary abnormalities in plasmodium falciparum infection, and the extent to which the degree of malaria parasitemia affects urinary composition in ghanaian children remains scarce . Considering the endemicity of malaria in ghana, and the associated mortality and morbidity, particularly in children and pregnant women, accurate diagnosis and proper management are very necessary . It is imperative, therefore, to determine urine abnormalities and its relationship with parasite density in children with p. falciparum infection in a resource - limited malaria - endemic setting . This randomized study was conducted at comboni mission and sogakope district hospitals, in the south tongu district of the volta region from december 2013 to march 2014 . A total of 116 participants (age- and sex - matched) comprising 58 children aged 12 years with confirmed falciparum malaria (cases) and 58 healthy children (controls) were recruited . Children with other variants of malaria and those with ailments such as renal disease, liver disease, or urinary tract infection were excluded . The institutional review board of university of cape coast and the ethical committee of the hospitals concerned approved the study . Written informed consent venous blood (3 ml) was obtained for the determination of hemoglobin (hgb), white blood cell count (wbc), and malaria parasite density . Smears for malaria parasite were stained with giemsa and examined using standard protocols.12 hgb concentration and total wbc count were estimated using the mindray auto - hematology analyzer bc-3000 plus (shenzhen, china). Malaria infection was grouped into mild / moderate (parasite density <7000/l) and severe (parasite density> 7000/l).5 dipstick urinalysis strips (accu - tell ref abt - um - a33) was used to detect the following parameters in urine provided by the participants; protein, glucose, bilirubin, urobilinogen, ketones, blood, and leukocytes . The outcomes were measured with the mindray urine analyzer ua-66 (shenzhen, china). Ibm spss statistics for windows, version 21.0 (ibm corporation, armonk, ny, usa) was used for statistical analysis . Continuous variable estimates were expressed as mean standard error mean (sem), and student's t - test used to determine the variation amongst healthy individuals and malaria patients while mann - whitney u - test was used for the analysis of categorical variables . Spearman's rho correlation coefficient was used to show correlation of the parameters measured . Statistical significance level was set at p <0.05 . Table 1 summarizes the mean age, hgb concentration, and parasite density of the study participants . The participants included 58 malarial patients (29 males and 29 females) and 58 controls (29 males and 29 females), indicating that comparable numbers of malaria cases and controls were selected for this study . The independent sample t - test showed no significant difference between mean ages of cases and controls . Although the malaria cases and controls were of comparable age, the former had significantly (p <0.001) lower hgb concentration than the latter . There was a high mean parasite density in the cases, signifying severe infection of the participants with malaria . Demographic, hemoglobin concentration, and parasite density study participants table 2 categorizes malaria infection among the cases into two, those with mild infection and those with severe infection . Parasite density of participants with malaria table 3 shows the percentage distribution of the urinary parameters of the study participants . Although the concentration of all the urine parameters were elevated in the cases in comparison to the controls, only protein, blood, bilirubin, urobilinogen, and ketones were statistically significant . Percentage distribution of dipstick urinary findings among study participants figure 1 is a graphical (visual) presentation of the comparison of the significant dipstick urinalysis findings between cases and controls . Differences between the significant urinary abnormalities of the cases and controls the dipstick urinalysis findings in relation to parasite density of the participants is summarized in table 4 . The spearman's rho correlation test showed positive correlation between proteinuria, hematuria, bilirubinuria, urobilinogenuria, and ketonuria with malaria parasite density . However, only bilirubinuria was significantly (p = 0.001) higher at higher parasite density . Accurate diagnosis of malaria is integral to the appropriate and effective treatment of affected individuals and in the reduction of malaria - related morbidity and mortality.131415 this study related dipstick urinalysis findings to malaria parasite density, with the aim of using dipstick urinalysis in conjunction with other diagnostic tests to accurately diagnose malaria in resource - limited malaria - endemic settings . Our findings indicated a significantly higher urine protein, blood, bilirubin, urobilinogen, and ketones in individuals with p. falciparum infection in comparison to healthy controls . Although proteinuria, hematuria, bilirubinuria, urobilinogenuria, and ketonuria were positively correlated with malaria parasitemia, only bilirubinuria was significantly (p = 0.001) higher at higher parasitemia . The presence of significant bilirubinuria and urobilinogenuria in malaria patients is similar to observations made in other west african countries1 and is suggestive of either hepatic involvement or hemolysis . However, this is attributable to malaria since bilirubinuria and urobilinogenuria were positively correlated with malaria parasite density, with bilirubinuria increasing with increasing parasite density . Consequently, a study has shown that in patients presenting with fever and mainly conjugated hyperbilirubinemia, there should be a high index of suspicion for falciparum malaria even in the face of negative blood films.16 malaria is known to have an effect on the liver with cases of altered liver function tests being reported.17 although the determination of plasma bilirubin was not part of this study, the appearance of significantly higher bilirubinuria in the cases in comparison to the controls suggests the presence of conjugated bilirubin and by extrapolation, there was conjugated hyperbilirubinemia . Jaundice is one of the common manifestation of severe falciparum malaria that may be caused by many factors including intravascular hemolysis of parasitized and nonparasitized red blood cells and hepatic dysfunction.181920 the co - existence of malaria with viral hepatitis could be another cause of jaundice.1921 however, the selection procedure excluded people with viral hepatitis and thus the increased bilirubinuria and urobilinogenuria observed in the present study cannot be attributed to co - infection with viral hepatitis . The significantly lower hgb concentration observed in cases in comparison to the controls reaffirms anemia as a complication of severe malaria infection.22 similar results was obtained from a study conducted in nigeria.1 the anemia may partly be attributed to increased destruction of red blood cells in high parasitemia hence reducing hgb levels leading to anemia . This buttresses the fact that the observed urobilinogenuria may be a consequence of intravascular hemolysis . As indicated in this study, there was significant proteinuria and hematuria in cases compared to controls . These findings are in agreement with earlier studies.72324 proteinuria is an early manifestation of renal disease.525 in healthy kidneys, proteins are completely filtered from the bloodstream and subsequently reabsorbed, allowing no protein or only untraceable amounts of protein into the urine . Persistent presence of considerable amounts of protein in the urine is a useful indicator of a form of kidney disease.5 studies have shown that positive urine tests for hematuria and/or proteinuria in mass screening settings were significant predictors of end - stage renal disease.26 therefore, the presence of significant levels of proteinuria and hematuria in cases in comparison to controls is suggestive of renal impairment . However, these findings are not conclusive of renal impairment due to the lack of data on renal function tests in this study . Nevertheless, renal impairments such as glomerulonephritis and nephrotic syndrome have been reported in malaria patients.17 this study also observed significant ketonuria in the cases which cases might have resulted from some form of caloric deprivation (starvation) or an overnight fast due to loss of appetite.25 in contrast to the findings of this study, research conducted in nigeria observed significantly higher urobilinogenuria at higher parasitemia in p. falciparum infection.1 the difference between these studies might be as a result of the methods used in conducting the urinalysis . This study assessed the dipstick urinalysis using the automated urine analyzer as compared to the previous study where dipstick color changes were assessed visually . The small sample size used and the short duration of the study, however, remain the limitations of this study . In view of these, it is recommended that further studies should be conducted using a large sample size with enough time duration where dipstick urinalysis findings could be correlated with renal function and liver function markers in children with falciparum malaria infection . This would help in knowing the diagnostic value of dipstick urinalysis in detecting renal impairment and liver dysfunction in falciparum malaria in resource - limited malaria - endemic areas . It is evident that severe malaria infection has significant effects on urine, which may lead to urine abnormalities, such as proteinuria, hematuria, bilirubinuria, and urobilinogenuria . Urinalysis could be used in conjunction with microscopy in health facilities, especially in resource - limited malaria - endemic settings for accurate diagnosis and prognosis of severe malaria infection, particularly falciparum malaria.
The majority of the protein structures deposited in the protein data bank are determined either by x - ray crystallography or solution - state nuclear magnetic resonance spectroscopy (nmr). While x - ray crystal structures are derived from electron density data and are often of higher accuracy, protein nmr structure determination in solution may more accurately reflect molecular dynamics and has the advantage of not requiring crystallization . Solution nmr structure determination is generally based on three classes of experimental restraints: distance restraints, dihedral angle restraints, and orientation restraints . In combination with these restraints, different algorithms and force fields have been implemented to determine nmr structure using a variety of programs . Two groups of simulated annealing based programs are most commonly used by the nmr community: xplor / cns and dyana / cyana . Aside from the accuracy and completeness of experimental data, the quality of nmr structures also depends on the programs utilized in structure calculation and structure refinement . In particular, as demonstrated by many studies, the quality of nmr structures can be improved by structure refinement in state - of - the - art force field with explicit or implicit solvent . Using such advanced refinement protocols, a few large - scale rerefinement studies have been done to improve the quality of nmr structures, especially for nmr structures determined prior to 2000 . One is the assessment of how well the structures fit with the experimental nmr data, including noe - based distance restraint violations, dihedral angle restraint violations, noe completeness, and goodness - of - fit with nmr noesy peak list and rdc data . The second class includes knowledge - based normality scores relative to high - resolution x - ray crystal structures, such as bond length, bond angle, backbone or side chain dihedral angle, and packing statistics . Recent studies comparing various methods for automated analysis of nmr data and structure generation, such as the critical assessment of structure determination by nmr (casd - nmr) study, demonstrate that the algorithms and force fields utilized in nmr structure refinement can significantly improve these normality scores . For example, protein nmr structures refined by rosetta without restraints generally have excellent knowledge - based stereochemical and geometric quality scores, but sometimes have poorer fit to the original experimental data . The rosetta molecular modeling program was first developed for de novo protein structure prediction, homology modeling, and protein design . However, it has also been used in protein crystallography as part of improved protocols for determining crystallographic phases by molecular replacement and for nmr structure determination and unrestrained nmr structure refinement . Have shown that unrestrained rosetta refinement can improve the phasing power of an nmr structure by moving it closer to its x - ray crystal structure counterpart . This observation has been corroborated for two additional nmr structures as part of a systematic investigation of using nmr structures in molecular replacement . These results are intriguing, as they suggest that the force field of rosetta may be even more accurate than the nmr data themselves in defining the protein structure . However, only one or two examples are reported in these two papers . In order to assess the generality of unrestrained rosetta refinement, it is necessary to perform a systematic study using a much larger data set . Another intriguing observation is that the number of restraint violations significantly increases after unrestrained rosetta refinement, which begs the question: do those violated restraints reflect true structural differences between nmr structures and x - ray crystal structures? If that is the case, then would incorporating those nmr experimental restraints into rosetta refinement drive the nmr structure away from its x - ray counterpart? More generally, what is the most efficient protocol for using rosetta to improve the accuracy of protein nmr structures? The northeast structural genomics consortium (nesg; http://www.nesg.org) is one of several large - scale structure production centers of the protein structure initiative (psi). The nesg has contributed more than 500 nmr structures to the pdb over the past 12 years (summarized at http://www.nesg.org/statistics.html), representing some 5% of the 10 000 nmr structures available in the pdb . Although most nesg structures have been solved by either nmr or x - ray crystallography, as of december, 2011 the nesg consortium had solved 41 pairs of protein structures for identical construct sequences using both x - ray crystallography and nmr methods . These 3d structures of proteins with identical sequences, together with the raw nmr and crystallography data available in the biomagresbank (bmrb) and protein data bank (pdb), are an extremely valuable composite data set available for studies directed at understanding structural variations between solution and crystal states and for new methods development . In this study, we carried out a comprehensive and systematic study of both unrestrained and restrained rosetta refinement for the nmr structures of 40 nesg nmr / x - ray structure pairs . Nesg target gr4 was excluded from this study, since it s deposited nmr structure is a single model and our protocol requires the input nmr structure as an ensemble of multiple models . For a subset of these pairs, we also assessed the value of the restrained cs - rosetta method carried out starting from extended conformations . The accuracy of (i) previously deposited pdb nmr structures, which were mostly refined using cns with explicit solvent, (ii) unrestrained rosetta refined structures, (iii) restrained rosetta refined structures, and (iv) restrained cs - rosetta structures generated with nmr restraints starting from extended conformations, were assessed by various structural validation metrics, including restraint violation analysis, comparison against unassigned noesy peak list data, convergence based on ensemble rmsd calculation, and various knowledge - based stereochemical and packing statistics . The rosetta refined structures were further assessed based on their structural similarity with corresponding x - ray crystal structures and by analysis of how useful they are as molecular replacement (mr) templates for solving the corresponding x - ray crystal structure . This comprehensive study demonstrates the significant value of restrained rosetta refinement of protein nmr structures, and provides efficient standard protocols for restrained rosetta refinement that will be broadly useful to the protein nmr community . Experimental data for this study were obtained by the nesg consortium for 40 proteins or protein domains solved by both solution nmr and x - ray crystallography and deposited in the pdb as of december 31, 2011 . The structures range in size from 5 to 22 kda and include 7 homodimers . Most of these nmr structures were refined using a standard nesg refinement protocol involving initial structure generation with cyana followed by structure refinement with cns in explicit water solvent, as described in detail at http://www.nmr2.buffalo.edu / nesg.wiki/. The coordinate files of both nmr structures and x - ray crystal structures were downloaded from the pdb database, along with the nmr restraint and x - ray structure factor files . Structure factor files, downloaded in mmcif format, were converted to mtz format using the ccp4 program cif2mtz (collaborative computational project, number 4, 1994). These protein data sets, together with citations to the corresponding pdb files, are summarized in supplementary table s1 . Another ccp4 program uniquefy was used to standardize the mtz files and select reflections for free r calculation . The nmr restraints files are either in cyana format or in xplor / cns format . The extensive experimental data for the 40 nmr and x - ray structures have been organized in a single publicly available database (http://psvs-1_4-dev.nesg.org / results / rosetta_mr / dataset.html). This compilation of nmr and crystallographic data, which was done as part of this study, will be valuable for future methods development projects . The robetta fragment server was used to generate a fragment library, based on the target protein sequence (excluding chemical shift data). Although this process could be done using chemical shift data in the fragment selection, for the refinement protocols developed in this work, chemical shift data were not used in the fragment generation for the rosetta refinement calculations . Tests using chemical - shift - based fragment selection demonstrated no significant improvement in the refinement protocol, although there is no a priori reason not to use chemical shift data in the fragment selection for restrained rosetta refinement . For each target protein, fragments from the target protein itself were eliminated from the fragment library . Loop regions were then defined by the consensus of (i) secondary structure, (ii) not - well - defined residues identified by the psvs server based on dihedral angle order parameter values, and (iii) noncore residues determined by findcore . For these regions, loop rebuilding was done together with all - atom refinement of the entire structure using the loopmodeling application of rosetta version 3.3, based on cyclic coordinate descent (ccd) and kinematic closure (kic). Fastrelax mode was used to allow the whole structure to relax in rosetta all - atom force field . The process was used to sample side chain conformations of the well - defined regions and both backbone and side chain conformations of the loop and not - well - defined regions . The fast relax modes work by running many side chain repack and minimization cycles to locate a low - energy state for the input model . The structural divergence of the starting model to the relaxed model is determined by the resulting energy gap . The structure can change up to 23 from the starting conformation during the minimization cycles . For restrained rosetta refinement, rosetta formatted distance restraints and dihedral angle restraints were generated using the pdbstat restraint converter software and were merged into a single restraint file . Although dihedrals are restrained by rosetta s energy terms, where chemical shift data provide reliable dihedral restraint data using talos+, these dihedral restraints were retained in the refinement process . These distance restraints were used in restrained rosetta refinement with an upper - bound tolerance of 0.3, to allow the structure to better relax energetically in the rosetta force field . Details of the restraint violation penalty functions are provided in the supporting information . For each individual conformer of the nmr structure ensemble, the restrained rosetta refinement was used to generate 10 decoys, and the one with lowest rosetta energy was selected as the final rosetta refined model for this specific conformer . For homodimeric nmr structures, a symmetry definition file, restraining the structures of protomers to be identical, is generated by rosetta and used to guide rosetta refinement, as outlined in supporting information . The other steps in the restrained rosetta refinement were exactly the same as those outlined above for unrestrained rosetta refinement . Sophisticated methods could be used to define the relative weight, w, between knowledge - based rosetta energy terms and experimental restraint terms . In this study, the rational was that at this value of w, plots of total energy (rosetta energy + restraint energy) vs w exhibit a minimum (as shown in supplementary table s3 and figure s5). A detailed protocol for restrained cs - rosetta (rcs - rosetta) calculations, starting from extended conformations, is also included as supporting information . Chemical shift information is used in rosetta fragment picking by mfr method using the updated fragment library . Then, a total of 10 000 decoys were generated using the abinitiorelax application of rosetta 3.3 with the nmr restraints . For 9 targets in 1022 kda range, 20 000 decoys were generated for each target instead of 10 000 decoys . Chemical shift rescores were then calculated for the 1000 lowest rosetta energy decoys, and the 20 lowest rescore decoys are selected as the final rcs - rosetta model . Gdt.ts stands for global distance test total score, which measures the 3d similarity of two structures with identical amino acid sequences . The global distance test performs many different sequence - independent superpositions of the model and the gold standard structure and calculates the percentage of structurally equivalent pairs of c atoms that are within specified distance cutoffs d. the gdt.ts score is the arithmetic mean of four scores obtained with distance cutoffs of d = 1, 2, 4, and 8 . The protein structure validation software suite (psvs) (http://psvs.nesg.org/) was used for structure quality assessment analysis . Psvs provides z scores for a variety of widely adopted structural quality measures, such as procheck g factor, molprobity clash score and other structure quality assessment metrics . The procheck all dihedral angle g factor is determined by the stereochemical quality of both backbone and side - chain dihedral angles of proteins, and the molprobity clash score is calculated by the program probe is a measure to reflect the number of high - energy contacts in a structure . Structure quality assessments also include ensemble rmsd analysis, restraint violations, (46) and rpf - dp statistics . Z scores are computed relative to a set of 252 high - resolution x - ray structures and normalized so that more positive z scores corresponding to better structure quality scores . (21) to evaluate structural similarity between nmr structure models and their x - ray counterparts, we utilized the programs findcore and pdbstat v5.9 to calculate the rmsd of backbone atom and/or all heavy atom positions, for both well - defined residues and for all residues (including those that are ill - defined in the pdb nmr structures). We also used the tm - score program to calculate the gdt.ts global superimposition scores . To further determine rmsd for specific subset of atoms, such as side chain atoms of -helix residues, we used pymol to superimpose nmr structures with reference x - ray crystal structures, then calculated average rmsd based on the structural superimposition . The same procedures were performed to evaluate structural similarity between rosetta refined structures and the corresponding x - ray crystal structures . Well - ordered residues are defined by dihedral angle order parameters with s() + s() 1.8 units, and core atoms were calculated using the findcore program based on interatomic distance variance matrices . The dssp program was utilized for annotating secondary structure elements, and solvent accessible areas of atoms were calculated by areaimol program in ccp4 package . The program phaser (version 2.1) was used for estimating diffraction phases by molecular replacement . The programs arp / warp version 7.0 and/or phenix.autobuild were used for automatic model building, based on the phaser mr solution . The arp / warp expert system mode was employed for automatic model building, and refmac5 was used in refinement, staring from the positioned search model, and a maximum of 10 building cycles were allowed . Forty nesg nmr structures which have corresponding x - ray crystal structures were downloaded from the pdb and refined using unrestrained and restrained rosetta protocols, as outlined in supporting information . More comprehensive structure quality statistics for these structures are available on line at http://psvs-1_4-dev.nesg.org / results / rosetta_mr / rosettamr_psvs_summary.html . We assessed distance restraint and dihedral angle restraint violations for the 40 protein nmr structures downloaded from the pdb and for the corresponding unrestrained and restrained rosetta refined structures . Restraint violations were assessed using the standardized methods of the pdbstat program, against the original distance and dihedral restraint lists (i.e., not accounting for the 0.3 upper - bound tolerance used in the restrained rosetta calculations). Distance restraint violations were divided into three categories based on the level of severity; i.e., distance restraint violations between 0.1 and 0.2, between 0.2 and 0.5, and higher than 0.5 . Dihedral angle restraint violations were divided into two categories: between 1 and 10 and higher than 10. the mean and standard deviations of the number of restraint violations in each category were calculated . These restraint violation statistics for each nmr structure ensemble are summarized in table s2, and the average violations per conformer of the 40 nmr structures assessed for each of the restraint violation categories and for each of three methods are presented in table 1 . These distributions of restraint violations obtained for these three data sets are also illustrated graphically in figure 1 . The number of restraint violations is significantly reduced by incorporating nmr restraints into rosetta refinement . Restraint violations were assessed using pdbstat, across the complete set of 40 nesg nmr structures used in this study . (a) boxplot of the number of distance restraint violations between 0.1 and 0.2 . (b) boxplot of the number of distance restraint violations between 0.2 and 0.5 . (c) boxplot of the number of distance restraint violations larger than 0.5 . (d) boxplot of the number of dihedral angle restraint violations between 1 deg and 10 deg . (e) boxplot of the number of dihedral angle restraint violations larger than 10 deg . Knowledge - based statistics were calculated using the programs verify3d, prosaii, procheck, and molprobity, normalized to z = 0 for a set of 252 high - resolution x - ray crystal structures . Structure quality scores were calculated for the nmr structures available from the pdb (pdb) and for the unrestrained rosetta (r3) and restrained rosetta (r3rst) structures . For each statistic, the mean and standard deviation were computed across the 40 nmr structures and are formatted as mean sd . Computed following superimposition of atoms with well - defined atomic positions, as determined by the dihedral angle order parameter method as implemented in psvs . Bb_ord, backbone atoms (n, c, c) in well - ordered residues; hvy_ord, all heavy (n, c, o, s) atoms in well - ordered residues; bb_all, backbone atoms of all residues; hvy_all, all heavy atoms in all residues . Rpf - dp scores were computed for 35 nmr structures for which noesy peak list data is available, and provide a statistical assessment of the consistency of the 3d nmr structure ensemble with the noesy peak list as provided by the rpf software . As expected, unrestrained rosetta refinement results in a significant number of restraint violations, especially for the most severe violation categories . However, in restrained rosetta refined structures the number and distribution of restraint violations per conformer is similar to, though slightly higher than, those assessed for the nmr structure ensembles deposited in the pdb (table 1 and figure 1). From this analysis we conclude that protocols for incorporating nmr restraints into rosetta refinement are effective in generating rosetta refined nmr structures that satisfy the experimental distance and dihedral angle restraint data as well as the structures deposited in the pdb that have been refined by conventional methods . The resolution of electron density maps and atomic b - factors reflect the precision of x - ray crystal structures . However, there are no such experimental observables to define the precision of solution nmr structures . Usually, the rmsd of the ensemble of superimposed nmr conformers is considered to be a useful measure of its overall precision, although as discussed elsewhere this measure can be problematic if there are extensive intramolecular dynamics . We calculated the ensemble rmsd of pdb nmr structures (pdb), unrestrained rosetta refined structures (r3), and restrained rosetta refined structures (r3rst) for each of the 40 protein nmr structure ensembles in our data set . Four categories of rmsd were calculated: (i) backbone rmsd of well - defined residues, defined by dihedral angle order parameters, (ii) backbone rmsd of all residues, (iii) heavy atom rmsd of well - defined residues, defined by dihedral angle order parameters, and (iv) heavy atom rmsd of all residues . The mean and standard deviations of rmsds for backbone and for all heavy atoms in these well - defined residues are listed in table 1, and the values for each of the 40 ensembles generated by each of the three protocols are plotted in supplementary figure s1 . The rmsd s of unrestrained rosetta - refined structures are higher than pdb nmr structures in all four categories, for both backbone atom and all - heavy atom classes (figure s1a d). Ignoring experimental restraints in rosetta refinement (r3) generally increases structural uncertainty for all the backbone and side chain atoms of all residues . For restrained rosetta refined structures (r3rst), in well - defined regions the average rmsd of backbone atoms is comparable with pdb nmr structures (figure s1a), and the average rmsd of all heavy atoms is about 10% lower than pdb nmr structures (supplementary figure s1c). For most targets restrained rosetta refined structures have lower ensemble rmsds in well - defined regions for all heavy atoms (including both backbone and side chain atoms) than pdb nmr structures . These results demonstrate that restrained rosetta refinement has the potential to improve the precision of side - chain atoms . On the other hand, the average ensemble rmsd statistics for all residues (including atoms that are not well - defined in the original pdb nmr ensembles), for both unrestrained and restrained rosetta refined structures, are higher than for the corresponding pdb nmr structures (supplementary figure s1b, d). This demonstrates that when restraints are included, the loop rebuilding process implemented in our rosetta refinement protocol does a better job of sampling the wide range of conformations which are consistent with the experimental data . Rpf - dp is a metric used to evaluate how well a protein nmr model fits the experimental unassigned noesy peak list and resonance assignment data . The program calculates recall, precision, and dp scores of the match between short distances in the model and all possible noesy crosspeak assignments . Recall is defined as the percentage of peaks in the noesy peak list that are consistent with the interproton distances of the 3d structures . Precision is defined as the percentage of close distances (general set at <5) between proton pairs in the query structures whose back calculated noe cross peaks are also actually detected in nmr experiments . The dp score is a normalized f - score calculated from the recall and precision to measure the overall fit between the query structure and the experimental data, with a freely rotating chain model and the quality of the noesy data set defining the lower and upper bounds, respectively, of the f - measure . Noesy peak list data are available for 35 of the 40 protein nmr / x - ray structure pairs used in this study . The mean and standard deviations of recall, precision, and dp score are listed table 1, and boxplots of recall, precision, and dp score are shown in figure 2 . Unrestrained rosetta refined structures generally have precision similar to pdb nmr structures but lower recall and dp scores, i.e., in general, the unrestrained rosetta refined structure does not fit the noesy peak list data as well at the pdb nmr structures . On the other hand, restrained rosetta refined structures have recall, precision, and dp scores that are essential identical to those of the pdb nmr structures (table 1 and figure 2a c). While the majority of the nmr structures generated by unrestrained rosetta refinement (r3) have dp scores lower than the pdb nmr structures, most structures refined by the restrained rosetta protocol (r3rst) have dp scores similar to pdb nmr structures (figure 2c, d). In a few cases, the restrained rosetta refined nmr structures have significantly better dp scores compared with the corresponding pdb nmr structure (figure 2d). Rosetta - refined structures have rpf - dp scores, comparing the structure against the unassigned noesy peak list, similar to those of structures deposited in the pdb . (a) boxplots of recall scores for structures deposited in the pdb or refined with rosetta protocols . (b) boxplots of precision scores for structures deposited in the pdb or refined with rosetta protocols . (c) boxplots of dp- scores for structures deposited in the pdb or refined with rosetta protocols . Dp - scores of the pdb nmr structures are plotted on the x - axis, while the dp - scores of both the unrestrained rosetta refined structures represented by red solid triangle symbols (r3) and restrained rosetta refined structures represented by blue solid rectangle symbols (r3rst) are plotted on the y - axis . The black dashed line indicates y = x. data are presented for 35 nmr structures for which noesy peak list data are available . As no distance restraints are enforced during the unrestrained rosetta refinement process, the refined structures do not satisfy distance restraints as well as the pdb nmr structures . They also do not fit as well to the unassigned noesy peak lists data because the distance restraints are directly derived from noesy peak lists . On the other hand, when distance restraints are incorporated into rosetta refinement, the refined structures generally fit the noesy peak list data as well or better than the pdb nmr structures that have been refined by conventional methods . We used psvs to calculate a variety of knowledge - based structural quality z scores, including verify3d, prosa, procheck backbone g factor (procheck_bb), procheck all dihedral angle g factor (procheck_all), and molprobity clash scores . These scores are normalized so that more positive z scores correspond to better values of these knowledge - based metrics . The mean and standard deviation of those z scores for the 40 nmr structures generated by the three methods (nmr pdb, unrestrained rosetta, and restrained rosetta) are summarized in table 1 . Both unrestrained and restrained rosetta refined structures have better (i.e., more positive) z scores for all the five measures, especially for procheck all dihedral angle g factor and molprobity clash score z scores . Boxplots of procheck_bb, procheck_all, molprobity clash score z scores for these nmr pdb and unrestrained and restrained rosetta refined structures are shown in figure 3a, c, e . Rosetta refined structures consistently have improved procheck_bb, procheck_all, and molprobity clash score z scores . (a) boxplot of procheck backbone dihedral angle g - factor z - scores for structures refined with different protocols . (b) scatterplot of procheck backbone dihedral angle g - factor z - scores . (c) boxplot of procheck all dihedral angle g - factor z - scores for structures refined with different protocols . (d) scatterplot of procheck all dihedral angle g - factor z - scores . (e) boxplot of molprobity clashscore z - scores for structures refined with different protocols . (f) scatterplot of molprobity clashscore z - scores . In the scatter plots (b), (d) and (f), the z - scores of unrestrained rosetta refined structures (r3) are plotted on the x - axis, while the z - scores of restrained rosetta refined structures (r3rst) are plotted on the y - axis . In order to further investigate the effect of incorporating experimental restraints into rosetta refinement on these knowledge - based z scores, we also made 2d scatter plots of procheck_bb, procheck_all, and molprobity clash score z scores comparing unrestrained and restrained rosetta refined structures . In figure 3b, d, f the z scores of unrestrained (r3) and restrained rosetta refined structures (r3rst) are plotted on x- and y - axes respectively . The procheck_bb z scores of restrained rosetta refined structures are consistently better than unrestrained rosetta refined structures (figure 3a, b). This is attributable to the fact that the experimental dihedral angle restraints and local noe data are very helpful in guiding rosetta to generate decoys with more accurate backbone stereochemical quality . Procheck_all z scores, which include side chain dihedrals, are also marginally improved for the restrained rosetta refined structures (figure 3c, d). On the contrary, the molprobity clash score z scores of unrestrained rosetta refined structures are generally better than restrained rosetta refined structures (figure 3f). However, while the unrestrained rosetta refined structures have fewer molprobity clashes, they are less converged and sometimes underpacked relative to restrained rosetta refined structures . Overall, these data demonstrate that stereochemical quality and geometry of pdb nmr structures can be significantly improved by rosetta refinement carried out with or without restraints . However, the restrained rosetta refinement protocol provides structures that have both improved z scores (figure 3) and simultaneously fit well to both the experimental distance restraints (figure 1) and the unassigned noesy peak list data (figure 2). Theoretically, solution nmr structures need not necessarily be identical to x - ray crystal structures, which are determined in a crystalline environment . In addition, these crystal structures were determined with cryoprotection at 77 k, while the nmr structures were determined in solution at 300 k. in particular, crystal packing effects may stabilize conformers that do not predominate in solution . However, since x - ray structures are highly hydrated, with relatively few intermolecular contacts, one might expect that such effects are the exception rather than the rule and that the dominant structure in solution characterized by nmr should generally be very similar to the x - ray crystal structure that is obtained for the same protein construct . This conclusion is supported by comparisons of protein structures in different crystal forms, which generally agree within an rmsd of <0.5 . Based on these considerations, and assuming the x - ray structure to be a accurate representation of the predominant solution structure, we also assessed whether or not rosetta refinement, with or without experimental restraints, moves the pdb nmr structures closer to their x - ray counterparts . For this assessment, we calculated the gdt.ts between (i) pdb nmr structures, (ii) unrestrained rosetta refined structures, and (iii) restrained rosetta refined structures, with their corresponding x - ray structures . Nesg target drr147d was left out of this analysis because its solution nmr structure is a monomer solved at ph 4.5, while its x - ray structure is a dimer solved at ph 6.0, and nmr studies demonstrate a significant structural change over this ph range (data not shown). These results for the remaining 39 nesg nmr / x - ray pairs are summarized in a gdt.ts scatterplot (figure 4), with the gdt.ts of pdb nmr structures relative to the corresponding x - ray crystal structure on the x - axis and gdt.ts of the unrestrained or restrained rosetta refined structures on the y - axis . Based on observations of previous studies done with a much small number (i.e., 1 or 2) of protein targets, we expected unrestrained rosetta refinement would generally move nmr structures closer to their x - ray counterparts . However, as illustrated in figure 4, using this larger data set of 39 nmr / x - ray pairs after unrestrained rosetta refinement (r3), only 17 of 39 targets exhibit higher gdt.ts values, 6 targets remain about the same, and 16 of the protein ensembles have lower gdt.ts values than the nmr structures refined by conventional methods and deposited in the pdb . On average, unrestrained rosetta refinement improved the gdt.ts by only 0.4% . On the other hand, as illustrated in figure 4, restrained rosetta refinement (r3rst) generally improved the gdt.ts score to the x - ray crystal structure, compared with the nmr structure deposited in the pdb; 32 of 39 targets have better gdt.ts values, 4 targets remain about the same, and only 3 targets have slightly lower gdt.ts values . On average, restrained rosetta refinement improved the gdt.ts scores of the pdb nmr structures by 2.5%, with some increasing by as much as 10% . Restrained rosetta refined structures are more similar to their corresponding x - ray crystal structures than pdb nmr structures . Gdt.ts values of pdb nmr structures to corresponding x - ray structures are plotted on the x - axis, and gdt.ts values of both unrestrained rosetta refined structures (r3, represented by red solid triangle) and restrained rosetta refined structures (r3rst, represented by blue solid rectangles) to their corresponding x - ray structures are plotted on the y - axis . The two green dash lines indicate gdt.ts of pdb nmr structures equal to 0.7 and 0.85 respectively . The black dash line indicates y = x, and the two gray dash lines indicate y = x + 0.05 and y = x 0.05 respectively . Further analysis of the data of figure 4 indicates that when the similarity between the conventionally - refined nmr structure and the corresponding x - ray crystal structure is moderate (0.7 gdt.ts 0.85), more often than not, rosetta refinement can move nmr structures closer to their x - ray counterparts when the experimental restraints are incorporated . However, in cases where the similarity between nmr and x - ray structures is initially high (gdt.ts> 0.85), more often than not, unrestrained rosetta refinement moves nmr structures further from their x - ray counterparts, while the improvement provided by restrained rosetta refinement is less dramatic (figure 4). We further investigated in these data how restrained rosetta refinement improves the similarity between nmr and x - ray structures by rmsd calculations . As illustrated in figure 5 (top panel), restrained rosetta refinement consistently improved the agreement between nmr and x - ray structures for both backbone and side chain atoms . The lower panel provides some comparisons between the mediod nmr conformer (i.e., the single conformer in the nmr ensemble most like all the other members of the ensemble) before and after restrained rosetta refinement, and the corresponding x - ray crystal structure coordinates . Typically, improvements in accuracy are the result of better packing between secondary structure elements . Often, this improves the accuracy of interhelical orientations, as shown for example in figure 5 for nesg targets hr3646e and hr4435b . For dhr29b, in order to emphasize the structural changes, only the last two c - terminal strands are plotted . In this case, the two - residue strand (7677) of the nmr structure deposited in the pdb is extended to six residues long (7681) after restrained rosetta, which is more consistent with corresponding x - ray crystal structure . The agreement between nmr structures and their x - ray counterparts are generally improved following restrained rosetta refinement . Top: plot of differences of rmsd to x - ray crystal structures before and after restrained rosetta refinement . The nesg nmr / x - ray pair target index is plotted on the x - axis, and the differences between the rmsd of pdb nmr structures to their corresponding x - ray structures and the rmsd of restrained rosetta refined structures to their corresponding x - ray structures are plotted on the y - axis in units of ngstroms . The four subpanels summarize data for well - defined (lower half) and not - well defined (upper half) residues, and for backbone (left) and sidechain (right) atoms . Well - defined vs not well - defined residues are defined by s(phi)+s(psi) 1.8 . Bottom: superimposition of x - ray, nmr and restrained rosetta refined structures . Left hr3646e; middle hr4435b; right dhr29b . The structures are color coded as: magenta- x - ray crystal structure; cyan nmr structure deposited in pdb; blue restrained rosetta refined structure . For dhr29b, only the last two c - terminal beta strands are plotted . On average, the improvement of structural similarity to corresponding x - ray structure resulting from restrained rosetta refinement is modest . However, restrained rosetta refinement drives some nmr structures significantly closer to their x - ray counterparts, as much as 0.45 and 0.55 rmsd, respectively, for backbone and side chain atoms in well - defined regions (figure 5 top). Specific atom positions change by as much as 13 (as illustrated in some of the examples of superimposed structures shown in figure 5 bottom). These changes may be biologically significant and can have significant effects on the phasing power of the structure, as illustrated below . The fact that restrained rosetta refinement consistently improves the accuracy of nmr structures relative to the corresponding x - ray crystal structure is a significant observation . In order to explore this in more detail, we compared the rmsd between either refined nmr or deposited nmr structures relative to x - ray crystal structures for several different classes of atoms . These included (i) atoms in well - defined residues (defined by dihedral angle order parameters), (ii) well - defined core atom sets calculated by findcore program, (iii) atoms in buried residues, and (iv) atoms in regular secondary structure elements . Comparisons were made for both unrestrained rosetta refinements (summarized in supplementary figure s2) and for restrained rosetta refinements (summarized in supplementary figure s3). More often than not, restrained rosetta refinement also improved the agreement between nmr structures and x - ray structures for (i) not - well - defined regions, (ii) noncore residues, (iii) surface residues, and (iv) loop regions as well as for well - defined backbone and side - chain atoms . For classes of atoms in regions of the structure that are not - well - defined (i.e., less well converged) in the nmr ensemble, the improvement is often quite substantial, as illustrated in the top half of figure 5 for some structures the accuracy relative to the corresponding crystal structure improves by 1.02.5 rmsd in loop regions . This reflects the ability of rosetta to accurately model regions of the protein structure, such as surface loops, that are under - restrained by the experimental nmr data . Molecular replacement (mr) is widely used for addressing the phase problem in x - ray crystallography . Historically, the common notion in the structural biology community is that the quality of nmr structure is often not good enough for mr, even when the sequence of the search model is identical to the target x - ray structure . However, as demonstrated by a recent study with 25 nesg nmr / x - ray pairs, protein nmr structures prepared by excluding not - well - defined atom positions using an interatomic variance matrix - based protocol can generally be used successfully as mr templates . Additionally, the phasing power of nmr structures that failed to provide good mr solutions was observed to be improved by unrestrained rosetta refinement in two cases . Using the extensive set of nmr / x - ray pairs, we critically assessed this hypothesis by comparing the phasing powers of the conventionally - refined pdb nmr structures with those of unrestrained and restrained rosetta refined structures . We prepared the mr starting models for pdb nmr structures, unrestrained rosetta refined structures, and restrained rosetta refined structures by first eliminating not - well - defined atoms using the findcore protocol . Two targets (drr147d, er382a) were excluded in this study due to the following facts: the nmr structure of target er382a (pdb i d: 2jn0) was solved as a monomer without a ligand, whereas its crystal structure counterpart (pdb i d: 3fif) has eight subunits in the asymmetric unit and was solved in complex with a heptapeptide ligand and appears to have a distinct structure, i.e., the c rmsd between the nmr structure and chain a of the crystal structure is 2.44 . As mentioned above, the nmr structure of target drr147d (pdb i d: 2kcz) is a monomer solved at ph 4.5, while its crystal structure counterpart (pdb i d: 3ggn) is a dimer solved at ph 6.0, with significant structural changes in backbone structure due to ph - induced dissociation of the dimer . The remaining 38 nmr / x - ray pairs were used to assess the impact of restrained rosetta refinement on the mr phasing power of the nmr ensemble . For the initial rosetta refinement protocol, the decoys are picked solely based on rosetta energy, that is, we picked the top 20 decoys with the lowest rosetta energy from the entire pool of decoys generated from all the conformers in nmr structure ensemble . It was observed, however, that frequently those 20 decoys originated from the same one or two similar conformers in the unrefined nmr ensemble; thus the structural variance information within the nmr ensemble is lost using this simple decoy picking process . In order to preserve the conformational variability information within the nmr ensemble, we adopted a protocol in which the one lowest - energy rosetta decoy was selected from the ensemble of decoys generated from each nmr conformer . As shown in figure 6a, b, the resulting rosetta ensembles are much better mr templates and also fit the noesy peak list data better than the rosetta ensembles generated by our initial protocol, as manifested by the significantly improved tfz and dp scores for the majority of the targets . These ensembles of rosetta refined (with or without restraints) conformers were then trimmed to exclude not - well - defined atoms using findcore and used as templates for phaser as described previously . For rosetta refinement of nmr structure, preserving ensemble information is beneficial for mr success . Scatterplot of phaser tfz scores (a) and dp - scores (b) for two different protocols for selecting models for mr . Decoy(energy) rosetta - refined structure ensembles are composed of the 20 lowest rosetta energy decoys from the entire pool of decoys generated from all the nmr conformers . Decoy(conformer+energy) rosetta - refined structure ensembles are composed of each lowest rosetta energy decoy generated from each nmr conformer . The scores of structures picked by decoy(energy) protocol are plotted on the x - axis, and the scores of structures picked by decoy(conformer+energy) protocol are plotted on the y - axis . Unrestrained rosetta refined structures are represented by red solid triangles and restrained rosetta refined structures are represented by blue solid rectangles . Data are summarized for 38 nesg nmr / xray pairs used in the crystallographic mr study . Starting from phaser mr solutions obtained by three methods [nmr pdb, unrestrained rosetta refinement (r3), and restrained rosetta refinement (r3rst)] for 38 nmr structures, we utilized phenix and arp / warp for automatic model rebuilding and refinement . Models generated by either software with the lowest rfree values were chosen as the final structures solved by mr . Hence 114 crystal structures were determined from the nmr structures and compared with the corresponding x - ray crystal structure available in the pdb . For each target, the rfree values of the final mr structures are plotted against the sources of their templates in figure 7 . Structures generated using the ensembles of pdb nmr structures, unrestrained rosetta refined structures, and restrained rosetta refined structures are represented by black, red, and green dots, respectively . The green dashed line indicates rfree = 0.3, and the red dashed line indicates rfree = 0.45 . Data points above the red dashed line (rfree> 0.45) are considered as failed mr solutions . Starting from nmr structures deposited in the pdb as mr templates, seven targets (zr18, sgr145, rpr324, str65, spr104, sr478, hr4435b) failed to provide valid mr solutions . Four of these (rpr324, str65, sr478, hr4435b) provided good mr solutions after rosetta refinement with or without experimental restraints . One target (zr18) provided a good mr solution and another target (spr104) a borderline acceptable mr solution (gdt.ts between mr structure and x - ray structure is 0.875) only after restrained rosetta refinement . Two targets (hr41, srr115c), which originally provided valid mr solutions when using their pdb nmr structures as mr templates, failed to provide valid mr solutions after unrestrained rosetta refinement but could be solved after restrained rosetta refinement . Only one target (sgr145) failed to provide good mr solutions with any of the protocols, even after restrained rosetta refinement . Sgr145 is a sparse - restraint nmr structure, and its c rmsd to the corresponding x - ray structure is relatively large (3.1). Restrained rosetta refined nmr structures provide better templates for mr, and generally yield crystal structures with better rfree scores . Dotplot of rfree values of mr structures using mr templates for 38 nesg nmr / x - ray pairs deposited in the pdb or refined by rosetta . Pdb nmr structures (pdb), unrestrained rosetta refined structures (r3) and restrained rosetta refined structures (r3rst) are colored black, red and green respectively . Each subpanel represents one nesg target, and the subpanels are organized in ascending order of the resolution of its x - ray crystal structure from bottom left corner to top right corner . The same conclusion can be drawn from figure s4, comparing the gdt.ts of the x - ray crystal structure models phased using the pdb nmr structures or rosetta refined structures as mr templates, and autotraced, compared to the corresponding x - ray crystal structures deposited in the pdb . Most of these crystal structures deposited in the pdb were solved by anomalous dispersion (sad or mad) methods . These data further demonstrate that when the nmr structures available from the pdb are poor mr templates to start with, with gdt.ts <0.8, their phasing power and the quality of the resulting crystal structure solution were generally significantly improved by restrained rosetta refinement . As is also illustrated in figure 7 for targets srr115c, psr293, and hr41, if the initial nmr structures are good mr templates, their phasing power can potentially deteriorate by unrestrained rosetta refinement . Therefore, despite the fact that unrestrained rosetta refinement has been reported to sometimes improve the phasing power of nmr structures, ignoring the experimental restraints is not recommended when preparing nmr structures for use in phasing crystallographic data by molecular replacement . For thirteen nmr structures with gdt.ts <0.85 relative to their x - ray counterparts, we also carried out restrained cs - rosetta (rcs - rosetta) calculations, starting from extended conformations, using the same restraints used in the corresponding restrained rosetta refinement calculations . Rcs - rosetta calculations are much more cpu intensive than the restrained rosetta refinement protocol outlined above, requiring 45 times more cpu time for proteins in the size range of 510 kda and exponentially longer times for larger proteins . These results are summarized in table 2 . For proteins <10 kda, the restrained cs - rosetta structures (cs - rrst) were slightly closer to the x - ray structure than the corresponding restrained rosetta refined structures (r3rst), especially for targets er382a and zr18 . On the other hand, for proteins in the 10 22 kda range, the faster r3rst restrained rosetta refinement protocol provides structures with accuracy, relative to their x - ray counterparts, similar to the computationally - intensive cs - rrst protocol . Indeed, for the 19 kda target hr41, the faster r3rst protocol provided a more accurate structure than the restrained cs - rosetta protocol . These results demonstrate that the two restrained rosetta protocols described in this work, r3rst which refines a structure initially modeled with other methods and cs - rst which generates a structure starting from an extended conformation, are well suited for small to medium sized proteins, of up to about 25 kda . While restrained cs - rosetta (cs - rst) can provide slightly more accurate structures, the improvements relative to the restrained cs - rosetta (r3rst) results are often marginal relative to the much longer cpu times required . Number of residues, excluding short disordered purification tags . Molecular weight (kda). The quality of solution nmr structures is mainly determined by two factors: the accuracy and completeness of experimental data and the algorithm and energy force field used in structure calculation and refinement . In the past few years, several papers have demonstrated that unrestrained rosetta refinement can improve the stereochemical quality of nmr structures and move nmr structures closer to x - ray crystal structures . These observations may be explained by an interesting hypothesis: once the protein conformation has been placed in a near - native structure using experimental restraints, energy minimization by all - atom relaxation in the rosetta energy field without restraints can produce a more accurate structure than is obtained using the restraints . In this interpretation, the small errors in the nmr experimental restraints, which are in conflict with the x - ray structure, can be circumvented or corrected using the unrestrained energy force field . In this study, we tested this hypothesis in a large - scale investigation of the impact of rosetta refinement on nmr structure accuracy, and the significance of experimental restraints in rosetta refinement . This analysis has allowed us to design a protocol for using rosetta to improve the quality of protein nmr structures with tractable computational cpu requirements . As would be expected, restrained rosetta refinement of nmr structures produces models with much fewer restraint violations than models generated by unrestrained rosetta refinement . This result is significant in that it demonstrates that our restrained rosetta refinement protocol is self - consistent with respect to a large number of experimental restraints, validating the accurate implementation of restraint conversions by pdbstat software and interpretations of these restraints by the rosetta program . We observed that if the relative weights on restraints are too high, the final rosetta refined models are over restrained and often end up with poor rosetta energies . On the other hand, if the weights of restraints are too low, the final rosetta refined models exhibit a large number of restraint violations, and the restraint information is not fully utilized . An important concern in assessing nmr method development regards which structure to used as the gold standard of accuracy . Although the natural choice is the corresponding x - ray crystal structure, this issue has been controversial insofar as the crystal structure may be influenced by the structural and energetic requirements of intermolecular packing . For example, the crystal lattice may select for one of multiple conformational states of the protein structure . Moreover, protein x - ray crystal structures are often determined using cryoprotected crystals at 77 k, while nmr structures are generally determined at 2040 c . None the less, as we have demonstrated elsewhere, except under special circumstances, the solution nmr structure is generally quite similar to the crystal structure and can be used for phasing by molecular replacement methods . Hence, we contend that the crystal structure is an excellent proxy for nmr structure accuracy . The availability of these 40 nmr / x - ray pairs together with extensive raw experimental nmr and diffraction data (summarized in supplemental tables s1 and s2) will greatly facilitate the testing and development of new methods for protein nmr structure refinement and analyses of subtle structural differences between crystal and solution nmr structures . Judged by ensemble rmsd analysis, unrestrained rosetta refinement generally decreases the precision of nmr structures, while restrained rosetta refinement can increase the precision of the side chain heavy atoms of otherwise well - defined residues . Additionally, restrained rosetta refined structures fit the unassigned noesy peak list data significantly better than unrestrained rosetta refined structures . Rosetta refinement can generally improve the stereochemical quality and geometry of nmr structures . More specifically, the experimental backbone dihedral angle restraints can guide rosetta to generate models with even better backbone structures than is achieved without restraints . In most cases, restrained rosetta refinement will move protein nmr structures closer to their x - ray counterparts, while unrestrained rosetta refinement often fails to do so, especially when the structural similarity between the nmr and x - ray structures is high (gdt.ts> 0.85). For nmr structures with poor phasing power, rosetta refinement can often be used to generate mr templates which are better able to guide phasing software, such as phaser, to identify correct mr solutions . The phasing power of the template and the accuracy of the resulting crystal structures are better when experimental restraints are utilized in rosetta refinement . Indeed, unrestrained rosetta refinement can sometimes make nmr structures less useful mr templates, even when they are good mr templates to start with . With respect to our hypothesis regarding final - stage unrestrained rosetta refinement providing more accurate structures than can be achieved using all of the experimental restraints, this comprehensive study with 40 nmr / x - ray pairs demonstrates that the majority of nmr experimental restraints are completely consistent with the corresponding x - ray structures . While in some cases, a few inaccurate restraints may be identified using an unrestrained rosetta refinement protocol as proposed by ramelot et al ., the most accurate structures, with the highest phasing power, were obtained by combining the experimental restraints with the sophisticated algorithms and the more advanced force field of rosetta . We also computed rosetta energies of relaxed x - ray and relaxed nmr structures . The structures are first idealized using rosetta idealization application and then are relaxed in rosetta all - atom energy field . The relaxed x - ray structures generally have lower rosetta energy per residue, while the relaxed nmr structures, the r3-refined nmr structures, and the r3rst - refined nmr structures generally have slightly higher, similar rosetta energies . This suggests that even our r3rst - refined nmr structures have some room for improvement in terms of their energies . While they are more accurate relative to the corresponding x - ray crystal structure and generally satisfy the experimental restraint data, restrained rosetta refined structures have modestly more small distance restraint violations than the nmr structures from which they are derived . As discussed in detail elsewhere, these small restraint violations associated with rosetta refined nmr structures may reflect inaccuracies in the interpretation of upper - bound distance restraints from noesy data due various effects, including relaxation - modulation of noe intensities in heteronuclear filtered noesy data and the effects of dynamic averaging . It is generally not possible to satisfy all of the experimental restraints in a r3rst refinement . This is evidenced first from the fact that the lowest - energy rosetta structures generated in this study [i.e., the unrestrained rosetta refined (r3) structures] have poorer agreement with the noesy peak list data (i.e., lower dp scores summarized in figure 2) than restrained rosetta refined (r3rst) structures . The r3 structures also often diverge from the x - ray structures (figure 4), our best proxy for a gold standard. The inconsistency between the noe - derived distance restraints and rosetta energy terms is also illustrated in analyses presented in supplementary figure s5 and table s3; increasing the relative weight on restraint terms allows excellent satisfaction of restraints but results in structures with higher rosetta conformational energies . Accordingly, there is some fundamental inconsistency between our minimum rosetta energy structures, the noesy peak list data, the nmr restraints, and the gold standard x - ray crystal structures . In order to further investigate potential inaccuracies on the noe - derived restraints themselves, we also assessed how well the corresponding x - ray crystal structures fit these nmr restraint data . Hydrogen atoms were added to the x - ray structure coordinates using rosetta idealization application, which rebuilds molecules using ideal bond lengths, bond angles, and torsion angles . All those resulting idealized x - ray structures have quite a few restraint violations, and the number of restraint violations varies from target to target . No attempt was made to further adjust the x - ray crystal structures to better match the nmr restraint data . Inconsistencies between the nmr restraints, the x - ray crystal structures, and the rosetta energy function arise from several sources, including (i) the crystal lattice, which may stabilize a subset of the conformations that are present in the solution nmr experiments and that contribute to the noesy data, (ii) the noesy data arise from ensemble averages of dynamic distributions which are not captured by the methods used in these studies to model restraints and nmr structures, and (iii) there may be inaccuracies in the rosetta potential energy function . However, aside from these fundamental challenges in modeling protein structures from nmr data, it is not surprising that the lowest - energy models do not perfectly satisfy the noe - derived distance restraints . These distance restraints are interpreted from noesy spectra assuming a simple two - spin approximation, single isotropic rotational correlation time, uniform linewidths, identical relaxation in filtering through bound c and n atoms, and many other assumptions that are simply not correct . The details of how upper bound distance restraint violations were defined are different as various laboratories across the nesg use somewhat different methods for calibrating these distances . Although noesy peak lists (usually providing resonance intensities) are available for many of the data sets, the issues of linewidths and differential relaxation in different x - filtered noesy spectra cannot be addressed with the available data . It could be interesting to compare simulated spectra generated for r3 and r3rst models using full - relaxation matrix analysis with relaxation - corrected, integrated, noesy spectra data, but such an analysis is beyond the scope of the current work . An alternative method for incorporating the rosetta force field into the nmr structure determination process is restrained cs - rosetta (rcs - rosetta) in which structures are generated starting from extended conformations with nmr restraints and the cs - rosetta protocol . Generally, for a 100-residue protein rcs - rosetta calculations require about 510 times more cpu time to generate each decoy than restrained rosetta refinement . The difference in cpu time becomes even larger as the size of protein increases . Rcs - rosetta calculations generally require tens of thousands decoys in order to ensure convergence, compared to only hundreds of decoys required for restrained rosetta refinements which begin with native - like conformations as the starting point . Hence, the restrained rosetta refinement protocols used here are some 200500 (or more) times faster than restrained cs - rosetta methods . For example, for a 100 residue protein, rcs - rosetta calculations required about 4000 min to generate 10 000 decoys using 20 2.5 ghz processors (0.4 min per decoy). For the same size protein, cyana structure generation followed by restrained rosetta refinement requires about 1020 min per for an ensemble of 20 conformers . The rasac iterative cs - rosetta protocol may sometimes provide more accurate structures using restrained cs - rosetta, but it is even more cpu intensive . Therefore, for proteins of more than 10 kda, a good practice is to use traditional methods for nmr structure generation, followed by restrained rosetta refinement . Although rosetta refinement can modify the input conformation to some extent, rosetta refined structures will not deviate significantly from the input structure because the rosetta refinement protocol samples only conformations that are close to the initial nmr structure . If the nmr structures are highly inaccurate to begin with, these severe structural differences cannot be corrected by the restrained rosetta refinement protocol alone . Moreover, for sparse - restraint nmr structures, such as the sgr145 target, additional information, such as evolutionary restraints, or more advanced sampling techniques, such as rasrec rosetta, may also be required to obtain the most accurate nmr structures . In comparison with nmr structures refined by traditional methods, restrained rosetta refined structures fit the experimental nmr data equally well and are of significantly better stereochemical and geometric quality . Rosetta refinement drives nmr structures to be more similar to their x - ray counterparts, thus increasing their phasing power . Despite the fact that they are more accurate relative to the corresponding x - ray crystal structure, restrained rosetta refined structures tend to have slightly higher distance restraint violations . This may reflect inaccuracies in the interpretation of nmr data in terms of upper bound restraints, providing guidance to the experimentalist to confirm and possibly refine these interpretations of the raw experimental data . The restrained rosetta refinement protocols described here utilize nmr structures initially determined by more conventional methods as input . They are much less cpu intensive than restrained cs - rosetta methods, which generate nmr structures from extended starting structures, and provide comparable or better results . All of the nmr and crystallographic experimental data used in this project are available on line at: http://psvs-1_4-dev.nesg.org / results / rosetta_mr / data set.html . Coordinates of the unrestrained and restrained rosetta refined structures, together with structure quality assessment reports, are available on line at: http://psvs-1_4-dev.nesg.org / results / rosetta_mr / rosettamr_psvs_summary.html
A variety of non - prescription slimming products are now readily available on the market, which are often advertised to contain purely natural ingredients, hence assumed to be harmless . However, these products may contain prescription weight - loss agents or banned pharmaceutical analogues that are not mentioned on the pack or in the patient information leaflet, and therefore may result in significant toxicities and even mortality.1)2) sibutramine, which has now been banned due to cardiovascular adverse effects, is one of the most commonly encountered illicit adulterants in non - prescription slimming pills.2) we describe a rare case of dilated cardiomyopathy with massive left ventricular (lv) thrombus in an otherwise healthy 32-year - old man who was taking sibutramine - containing slimming products . A 32-year - old man was admitted with progressively worsening dyspnea on exertion of 1 month duration . The patient was not known to have hypertension, diabetes or any other medical illness . He reported having taken the unauthorized health product, " slim-30 ", for the last 7 months and had stopped taking it 2 weeks ago . Several medicines regulatory authorities are warning that this product contains an undeclared pharmaceutical ingredient, n - desmethyl sibutramine, an analogue of sibutramine, which has now been banned because of cardiovascular adverse effects . When the drug was first started, his body mass index was 26.3 . From the outset the patient presented higher blood pressure and palpitation, on admission, initial vital signs were as follows: blood pressure of 110/80 mm hg, pulse rate of 130 beats / min, respiration rate of 20 breaths / min, and body temperature of 36.5. upon physical examination, pitting edema in both lower extremities was noted and a s3 gallop sound was audible . Chest x - ray showed cardiomegaly (cardiothoracic ratio was 0.60) and no pulmonary edema (fig . The cardiac enzymes were within the normal range with a troponin - t level of 0.023 ng / ml (normal 0.100) and creatine kinase - mb level of 1.86 ng / ml (normal 4.94). However, pro - b - type natriuretic peptide level was elevated to 5404 pg / ml (normal 88). A complete blood cell count, coagulation profile, and thyroid function test were within normal limits . Liver enzymes were elevated with an aspartate aminotransferase level of 80 iu / l and alanine transaminase level of 120 iu / l . The transthoracic and transesophageal echocardiogram revealed dilated lv (end - diastolic diameter of 6.5 cm) with severely impaired systolic function {ejection fraction (ef) of 23%} and multiple hyperechoic, pedunculated masses attached to the lv apical wall, of which the largest measured 4.61.5 cm in size (fig . Severe lv systolic dysfunction, the mass - like lesions were suspected of thrombi . The patient was started on diuretics, angiotensin - converting - enzyme inhibitor (acei) and parenteral unfractionated heparin . He had a good clinical response to treatment and subsequent echocardiogram performed 10 days later showed that lv thrombi had nearly dissolved, although there was only a slight improvement in lv dilatation and contractility . Multi - detector computed tomographic coronary angiography, which was performed before discharge, showed normal a coronary artery (fig . He was discharged in a stable condition and prescribed a beta blocker, acei, and oral warfarin . At 1 month follow - up, echocardiogram demonstrated complete resolution of lv thrombi and markedly improved lv systolic function (ef of 45%) and dilatation (end - diastolic diameter of 5.6 cm) (fig . The patient is currently doing well and is being followed up via the outpatient department . Sibutramine (meridia, reductil, ectiva, abbott laboratories, abbott park, il, usa) was approved by the u.s . Food and drug administration in 1997 and was approved for use in the european union (eu) in 1999 for the long - term (12 months) management of obesity . Sibutramine and its two active metabolites, n - desmethyl and n - bisdesmethyl sibutramine, act centrally to inhibit serotonin and noradrenaline (norepinephrine) reuptake leading to satiety and act peripherally to increase metabolic rate, thermogenesis, and energy expenditure by stimulating 3-adrenergic receptors.3) such sympathomimetic activity of sibutramine causes a modest increase in heart rate and blood pressure,4)5) which can potentially increase the risk of adverse cardiovascular outcome in susceptible patients . Since 2002, serious adverse events including cardiac arrhythmia (qt interval prolongation), myocardial infarction (mi), and death had been reported in sibutramine - treated patients.6 - 12) this led to a contraindication of the use of this drug in patients with established coronary heart disease, previous stroke, heart failure, or cardiac arrhythmias . In the sibutramine cardiovascular outcomes trial, subjects with pre - existing cardiovascular disease who were receiving long - term sibutramine treatment (5 years) had an increased risk of nonfatal mi and nonfatal stroke but not of cardiovascular death or death from any cause.5)13) on the basis of this trial, sibutramine was withdrawn from the eu in january 2010 and subsequently withdrawn from parts of asia and the u.s . Market in october 2010.14 - 16) however, sibutramine has still been found in adulterated non - prescription slimming products or natural herbal products.1)17) these products, of which ingredients are not declared, are usually found to contain n - desmethyl sibutramine in concentrations far above the maximum daily dose (5 to 15 mg).1)17) the unperceived use of this substance may be even more hazardous and lead to unpredictable complications and even mortality for individuals without any cardiovascular risk factor . Therefore, more effective and proactive measures are required to guard against illicit use of slimming products containing n - desmethyl sibutramine or other banned pharmaceutical analogues such as n - nitrosofenfluramine . One case has been reported of reversible cardiomyopathy possibly associated with sibutramine.18) however, cases of patients who presented with dilated cardiomyopathy with massive intracardiac thrombus secondary to sibutramine use have not been reported . In our case, the patient did not have any attendant cardiovascular risk factors and another culpable agent was not identified . We excluded other etiologic causes of reversible cardiomyopathy such as alcohol abuse, abnormal thyroid function, and coronary heart disease . The chance of myocarditis seemed to be very low due to cardiac enzymes within the normal range and no history of viral infection . This strongly suggested that sibutramine use was responsible for his dilated lv with severely impaired contractility, thereby causing intracardiac thrombus formation . We report a rare case of an otherwise healthy man who presented with dilated cardiomyopathy with massive lv thrombus secondary to the use of sibutramine - containing slimming pills . This case highlights the emerging threat posed by adulteration of non - prescription slimming products with undeclared, banned pharmaceutical analogues . When investigating the secondary cause of dilated cardiomyopathy with unknown etiology, physicians should be vigilant to the possibility of over - the - counter weight - loss agents or dietary supplements with undeclared ingredients.
Maintenance of a normal serum sodium concentration is dependent on both an intact thirst sensation and the action of arginine vasopressin (avp), also known as antidiuretic hormone . Thirst osmoreceptors and cell bodies containing avp overlap in location in the hypothalamus and share a common blood supply through branches of the anterior communicating artery 1 . Thus, disruption of this blood supply can result in both lack of thirst and avp synthesis, in response to appropriate stimuli of hypernatremia and hyperosmolality . Herein, we report the case of adipsic diabetes insipidus following anterior communicating artery clipping . At presentation, the patient had no perception of thirst despite the presence of significant hypernatremia . The fluid management in this case is rendered more complex due to the patient having poor shortterm memory and the subtropical climate in queensland, australia . A 36yearold woman was transferred to our hospital for further investigation and management of a subarachnoid hemorrhage (sah). She had initially presented to the emergency department following a syncopal episode on a background of a 2day history of a severe frontal headache associated with nausea and vomiting . Physical examination at the time of admission revealed weight of 85 kg, heart rate 84/min, blood pressure 140/85, respiratory rate 16 breaths / min, and oxygen saturation 99% on room air . Computerized tomographic angiography (cta) revealed a ruptured 5 mm anterior communicating artery aneurysm (fig . Endocrinology was notified for review after her urine output was recorded at 7.5 l on the day of the procedure . Aneurysm arising from the anterior communicating artery and proximal a2 segment of the right anterior cerebral artery (a) preoperative serum sodium concentration on the morning of surgery was normal at 136 mmol / l (reference range: 135145). The following morning, the serum sodium level was 153 mmol / l and serum osmolality was 318 mosmol / kg (reference range: 280295). Serum sodium concentration had further increased to 156 mmol / l 2 h later . The urine was dilute, with hourly urine output elevated at 300400 ml / h . A clinical diagnosis of central diabetes insipidus was made . Despite the clinical presence of volume depletion and significant hypernatremia, the patient had no perception of thirst . Given the anatomy and location of the aneurysm, the most likely diagnosis was adipsic diabetes insipidus secondary to clipping of the anterior communicating artery aneurysm . Values varied from 159 to 823 mosmol / kg, depending on the temporal relationship with the administered desmopressin . There was no evidence of major temperature dysregulation in the immediate postoperative period, temperature varied between 36.5 and 38.1c, and by the second postoperative week was consistently between 36 and 37c . Nmol / l at 08:10 h, free thyroxine concentration 7.2 pmol / l (reference range: 717), thyroidstimulating hormone (tsh) concentration 0.9 mu / l (reference range: 0.34.5), prolactin 374 mu / l (reference range: 71566), estradiol 141 pmol / l, folliclestimulating hormone (fsh) 1.8 u / l (reference range: 18), and luteinizing hormone (lh) 0.6 u / l (reference range: 112). During the acute period, the patient was initially monitored with hourly urine output, twice daily electrolytes, and daily weighs . Initial parameters for repeat desmopressin administration were the presence of breakthrough polyuria, defined as a urine output of> 350 ml / h for two consecutive hours, or> 300 ml / h for three consecutive hours . Several doses of parenteral desmopressin were required over the following 72 h. treatment was then commenced with regular oral desmopressin 100 g in the morning and 200 g in the evening . The patient continued to have no perception of thirst . Based on her fluid balance chart after commencing oral desmopressin, therefore, she was placed on a regular water prescription of 250 ml eight times a day . It was not deemed necessary to perform a formal water deprivation test or infusion of hypertonic saline to confirm the diagnosis in this clinical setting . She was then transferred to the brain injuries unit for rehabilitation of shortterm memory impairment . After initiation of regular oral desmopressin and a fixed dose water prescription, the patient was able to maintain a normal serum sodium concentration in hospital . Serum sodium concentration was initially monitored on a daily basis, with the interval being extended to twice weekly prior to discharge . Discharge planning involved ongoing followup with weekly bloods for serum sodium concentration with her general practitioner . The desmopressin was increased to 200 g twice daily and the water prescription also modified, aiming for approximately 1 l above urine output . It was thought that insensible losses in the queensland late spring / summer accounted for the increased fluid requirements, as 24h urine volumes were not excessive and there was no nocturia . Further review 2 months later revealed some improvement in cognitive function and stable normal electrolytes (serum na 139142 mmol / l) on the above regimen . Longitudinal followup out to 15 months post sah has been undertaken . While improved, significant shortterm memory impairment persists . Repeat assessment at 1 year indicates that her anterior pituitary function remains intact and she has regular menses . Mmol / l since she has been living with family support in her own home . The most commonly reported causes include congenital lesions such as septooptic dysplasia, germinoma, anterior communicating artery rupture or clipping, and craniopharyngioma 2 . Crowley et al . 3 have reported a series of 13 patients, of whom four were the result of anterior communicating artery aneurysm surgery . A case report and review of the literature published in 2008 revealed 10 cases of adipsic diabetes insipidus following clipping of an anterior communicating artery aneurysm 2 . Two subsequent case reports have since been identified 4, 5 . Even in the presence of hypernatremia published cases have continued management in the community by using a combination of regular desmopressin and a fixed dose water prescription 6, 7 . Calculating an ideal body weight when the patient is euvolemic provides a set point from which water intake can be adjusted . A behavioral modification technique for the patient with shortterm memory impairment has also been described with the use of a wristwatch alarm 8 . This report demonstrated the success of a staged technique, first by regular prompting by staff and initiation of a reward system when all water was consumed in a day . The rewards were gradually withdrawn and the patient maintained a stable serum osmolality by the use of a wristwatch alarm as the prompt to drink . The present case had isolated diabetes insipidus in the presence of normal anterior pituitary function . Once the immediate postoperative period had passed, a regular twice daily dose of oral desmopressin coupled with a prescribed fluid intake resulted in stable serum sodium concentrations while in the rehabilitation ward . The challenge was to maintain this level of stability when she is living in the community . This is particularly important given the patient's subtropical geographical location of southeast queensland, australia where there are high ambient temperatures and humidity during the summer months (latitude 27 south, mean maximum ambient temperature 2829c, humidity 6570%), which will increase insensible fluid losses . This required adjustment in her water prescription, over and above what would generally be required in a temperate climate . This is in part related to associated conditions of nonendocrine hypothalamic dysfunction, such as obesity, temperature dysregulation, and sleep disorders, but also an apparent increased rate of venous thromboembolism 3 and serious infections 9 . When compared to patients with diabetes insipidus and normal thirst perception, patients with adipsic diabetes insipidus are more than 10 times more likely to develop significant outpatient hypernatremia (> 150 mmol / l) 10 . Close monitoring in conjunction with the patient's general practitioner is an essential component of the longterm management . This has resulted in acceptable stability in the patient's serum sodium despite the triple challenge of adipsia, poor shortterm memory and humid subtropical climate.
In a recent issue of critical care, morgan and colleagues present the results of a well - conducted systematic review and meta - analysis of the effect of statin therapy on inflammatory markers after cardiac surgery . Observational evidence suggests that statin therapy may dampen the inflammatory response following exposure to a significant trigger and there is currently much interest in using statins to treat sepsis . In this context cardiopulmonary bypass (cpb) is appealing methodologically because it allows the study of preventive interventions [4 - 6]. Fortunately for patients, mortality following cpb is low, but the methodological downside of this success is that very large trials of low risk patients (or somewhat smaller trials of higher risk patients) are needed to show a mortality effect . The randomised controlled trials included by morgan and colleagues measured post - operative inflammatory markers in adults receiving a statin or placebo prior to cpb . They found that statin therapy may reduce post - cpb inflammation as measured by il-6, il-8, c - reactive protein and tumour necrosis factor - alpha . For example, six of the eight apparently randomised studies provide no information on sequence generation and allocation concealment . Three were unblinded and only two had a low risk of bias (defined by applying the cochrane risk of bias tool). The median sample size was 43.5 (range 20 to 200) and the confidence intervals around the mean differences in inflammatory markers for individual studies and for the summary estimates were fairly wide . Other studies of inflammatory biomarkers are likely to vary widely between patients and within patients over time, suggesting that analysis of within - patient changes over time may detect differences between treatment groups with more statistical power . While the meta - analysis does not provide a definitive answer, it raises key methodological issues relevant to sepsis research in general, and to statin research in critical illness in particular . The methodological quality of many of these studies is variable and frequently the mechanisms (at both biological and functional levels) through which benefit are supposed to accrue were not robustly described . We agree with other authors that the logical sequence of questions to answer before performing pragmatic mortality trials should be: first, can statins theoretically beneficially modulate the immune response in these patient populations? Second, do statins beneficially (and safely) modulate the immune response and associated physiology? Third, does the modulated immune response translate into benefit at the level of organ function? In this regard the critical care research community can learn much from colleagues in rheumatology, cardiology and oncology, who have explored and described mechanistic pathways - paths reliably connecting biological plausibility and effect with organ performance and then outcomes important to patients (for example, mortality); and developed reliable and validated surrogate endpoints . Morgan and colleagues want to establish whether potential surrogate endpoints (inflammatory markers) are modulated, but herein lay the problems . Second, while data from successful' mortality' randomised controlled trials may improve our understanding of surrogate outcomes, interventions that improve surrogate markers do not necessarily translate into improved mortality [12 - 14]. Third, what is the minimum clinically important difference for a biomarker or combination of biomarkers? How much should individual (and aggregate) marker levels differ between groups to translate into clinical benefit? Lastly, what if' good' markers are also suppressed and, indeed, how much inflammation is good for you? It is clear that in this relatively new study area the knowledge space is already occupied by poor studies and potentially unreliable data . We would like to encourage investigators to design studies that are methodologically robust and provide reliable mechanistic data . Icu researchers should work towards developing valid surrogate endpoints to allow robust and reliable translational research, although we acknowledge that previous success at improving organ performance has not always improved outcomes [12 - 14]. Once validated, these surrogate endpoints should be used to establish the biological effectiveness of new treatments (and probably some existing ones) before moving on to pragmatic studies using mortality as outcome measure . Without demonstrating first biological and then functional (for example, organ performance) effectiveness, we run the risk of wrongly adding statins to the wasteland of icu pharmacotherapy . On the positive side, the pleiotropic effects of statins and extensive experience with these agents in cardiology mean that we may be less likely to fall into a trap constructed of an insufficient understating of mechanisms combined with a single - target therapy.
Biochemical markers play an important role in accurate diagnosis and also for assessing risk and adopting therapy that improves clinical outcome . Over decades research and utilization of biomarkers has evolved substantially . National institute of health (nih) 2001 defined a biomarker as " a characteristic that is objectively measured and evaluated as an indicator of normal biological, pathologic processes, or pharmacologic responses to a therapeutic intervention . As markers of renal function creatinine, urea, uric acid and electrolytes are for routine analysis whereas several studies have confirmed and consolidated the usefulness of markers such as cystatin c, -trace protein . Creatinine is a breakdown product of creatine phosphate in muscle, and is usually produced at a fairly constant rate by the body depending on muscle mass . Creatinine is a commonly used as measure of kidney function.the normal creatinine clearence test valve is 110 - 150ml / min in male and in female it is 100 - 130ml / min.the national kidney disease education program recommends calculating glomerular filtration rate from serum creatinine concentration . The diagnosis of renal failure is usually suspected when serum creatinine is greater than the upper limit of the normal interval . In chronic renal failure and uremia, an eventual reduction occurs in the excretion of creatinine by both the glomeruli and the tubules . Creatinine values may alter as its generation may not be simply a product of muscle mass but influenced by muscle function, muscle composition, activity, diet and health status . The increased tubular secretion of creatinine in some patients with kidney dysfunction could give false negative value . The elevated values are also seen in muscular dystrophy paralysis, anemia, leukemia and hyperthyroidism . The decreased values are noticed with glomerulonephritis, congestive heart failure, acute tubular necrosis, shock, polycystic kidney disease, and dehydration . Urea is major nitrogenous end product of protein and amino acid catabolism, produced by liver and distributed throughout intracellular and extracellular fluid . In kidneys urea is filtered out of blood by glomerulli and is partially being reabsorbed with water . The most frequently determined clinical indices for estimating renal function depends upon concentration of urea in the serum . It is useful in differential diagnosis of acute renal failure and pre renal condition where blood urea nitrogen urea clearance is a poor indicator of glomerular filtration rate as its overproduction rate depends on several non renal factors, including diet and urea cycle enzymes . Increased blood urea nitrogen (bun) is seen associated with kidney disease or failure, blockage of the urinary tract by a kidney stone, congestive heart failure, dehydration, fever, shock and bleeding in the digestive tract . The high bun levels can sometimes occur during late pregnancy or result from eating large amounts of protein - rich foods . If the bun level is higher than 100 mg / dl it points to severe kidney damage whereas decreased bun is observed in fluid excess . Low levels are also seen in trauma, surgery, opioids, malnutrition, and anabolic steroid use . Cystatin c has been proposed to be a marker as it is produced by all nucleated cells at a constant rate and is freely filtrated by the glomeruli and completely catabolized in the proximal tubules . The concentration of serum cystatin c is mainly determined by glomerular filtration, which makes cystatin c an endogenous marker of glomerular filtration rate . In a meta analysis study by dharnidharka et al found cystatin c was superior to serum creatinine as a marker of glomerular filtration rate . Other studies have shown similar results when compared with other markers such as a 1-microglobulin and 2-microglobulin . Cystatin c was found to be an effective marker for glomerular filtration rate in patients with cirrhosis following liver transplantation . Cystatin c has been found more useful for detecting early renal impairment in both type 1 and type 2 diabetic patients . Moreover cystatin c was also found to be associated with mild kidney dysfunction with increased risk for cardiovascular events, peripheral arterial disease and heart failure . This protein is filtered at glomerulus and then reabsorbed in proximal tubule or excreted in urine and hence have potential to meet the criteria for use as a marker of glomerular filtration rate . -trace protein is a low - molecular weight glycoprotein belonging to the lipocalin protein family with 168 amino acids and a molecular weight of 2300029000, depending on the degree of glycosylation . It has been reported to be a better indicator of reduced glomerular filtration rate than serum creatinine . Serum -trace protein has been found to be elevated in patients with renal diseases . However, when compared, cystatin c is still a better indicator than serum -trace protein . Fructose polymer inulin (mw 5kda) satisfies the criteria as an ideal marker of glomerular filtration rate . Rapid measurement of glomerular filtration rate by an inulin single - bolus technique would be practically useful . A new technique of measuring iohexol clearance using timed dried capillary blood spots was shown by mafham m et al . Blood spot iohexol clearance showed potential in estimating glomerular filtration rate accurately in large - scale epidemiological studies especially among individuals without established chronic kidney disease . Plasma clearance after single injection of iohexol gives a good estimate of glomerular filtration rate and is advantageous for the patients and clinicians . Some of them to mention are 125iodine (i)-iothalamate, 51credta ethylenediamine tetra acetic acid, 99mtc - dtpa (diethylene triamine penta acetic acid) and 99mtc mercapto acetyl triglycine . Renal 125iodine (i)-iothalamate clearance, is a simple and accurate test after a single subcutaneous injection, to measure glomerular filtration rate in adults . Efficiency of 125 iodine (i)-iothalamate was shown by geeta bajaj et al . The same author found renal clearance of 125 iodine (i)-iothalamate was reproducible, simple, and practical in healthy children and those with mild and advanced renal disease . In one of the study the mean renal extraction of cystatin c was equal to the mean renal extraction of 125 iodine (i)-iothalamate in hypertensive patients, suggesting tubular secretion of cystatin c. it was possible to get an accurate determination of 5lcr - edta clearance from a single - plasma sample in adults by applying the mean sojourn time - based approach previously shown to be very precise for determination of 99mtc - dtpa single - sample clearance . 5lcr edta- glomerular filtration rate is suggested for systemic lupus erythematosus patient with suspected renal involvement even when the serum creatinine concentration and creatinine clearance are normal . The limitation of this marker is that glomerular filtration rate measured by 5lcr edta can be overestimated in patients with severe oedema . Clinically the appearance of significant amount of protein in urine is one of the earliest sign of almost all renal diseases . Estimation of proteinuria helps in differentiating between tubulointerstitial and glomerular diseases and also to follow the progress of renal disease and to assess the response to therapy . Normally excretion in most healthy adults is between 20 - 150 mg of protein in urine over 24 hrs . Proteinuria more than 3.5 gm / day is taken to be diagnostic of nephrotic syndrome . Panels of protein measurement including albumin, 2-macroglobulin, igg and 2- microglobulin have been employed in differential diagnosis of prerenal and postrenal disease . It has been recommended the use of the protein / creatinine ratio as an index of quantitative proteinuria in 24 hour urine collection . The use of the clearance of haptoglobin, in particular provided valuable diagnostic information in cases in which the routine methods gave borderline values for the index of proteinuria . During pregnancy proteinuria assay in 24 hour urine sample one of the investigations for proteinuria is semi - quantitative dipstick urinalysis as this method is relatively low cost and easily performed.in pregnancy automated dipstick urinalysis is a more accurate screening test for the detection of proteinuria than visual testing . The finding of dipstick proteinuria should be confirmed by either a 24 hour urine collection or a protein - creatinine ratio . Tubular function tests involve evaluation of functions of the proximal tubule (i.e. Tubular handling of sodium, glucose, phosphate, calcium, bicarbonate and amino acids) and distal tubule (urinary acidification and concentration). Tsukahara h et al assessed the renal proximal tubular function in neonates by measuring urinary 2-microglobulin concentrations . Chen jy et al showed that in sick neonates the urinary 2-microglobulin and n - acetyl--d - glucosaminidase were the early markers of renal tubular dysfunction . They concluded that the elevated levels of urinary 2-microglobulin and n - acetyl--d - glucosaminidase in neonates born with meconium - stained amniotic fluid indicated the existence of tubular dysfunction, probably due to prenatal distress . Serum osmolality was measured directly using osmometry, or estimated based on the direct measurement of the concentrations of the osmotically active substances (i.e. Sodium, glucose, blood urea nitrogen, and ethanol). The difference between the measured osmolality and the calculated molarity is referred to as the osmole gap . Pa et al observed severe hyponatraemia in some of the patients by measuring urine osmolality and urine sodium . According to jeff ms there are some genes which are involved in urine concentration which may encode solute - transport proteins and the vasopressin receptors . These molecular mechanisms show the reduction in urine - concentrating ability with aging that predicts various changes in kidney function . While landon s et al showed that aquaporin-1 has a physiologic role in renal function and is also essential for maximal urinary concentrating ability . In a complete deficiency of aquaporin-1 electrolyte panel is frequently used to screen for an electrolyte or acid - base imbalance and to monitor the effect of treatment on a known imbalance that is affecting bodily organ function . The test for electrolytes includes the measurement of sodium, potassium, chloride, and bicarbonate for both diagnosis and management of renal, endocrine, acid - base, water balance, and many other conditions . The combination of decreased filtration and decreased secretion of potassium in distal tubule during renal failure cause increased plasma potassium . Creatinine is a breakdown product of creatine phosphate in muscle, and is usually produced at a fairly constant rate by the body depending on muscle mass . Creatinine is a commonly used as measure of kidney function.the normal creatinine clearence test valve is 110 - 150ml / min in male and in female it is 100 - 130ml / min.the national kidney disease education program recommends calculating glomerular filtration rate from serum creatinine concentration . The diagnosis of renal failure is usually suspected when serum creatinine is greater than the upper limit of the normal interval . In chronic renal failure and uremia, an eventual reduction occurs in the excretion of creatinine by both the glomeruli and the tubules . Creatinine values may alter as its generation may not be simply a product of muscle mass but influenced by muscle function, muscle composition, activity, diet and health status . The increased tubular secretion of creatinine in some patients with kidney dysfunction could give false negative value . The elevated values are also seen in muscular dystrophy paralysis, anemia, leukemia and hyperthyroidism . The decreased values are noticed with glomerulonephritis, congestive heart failure, acute tubular necrosis, shock, polycystic kidney disease, and dehydration . Urea is major nitrogenous end product of protein and amino acid catabolism, produced by liver and distributed throughout intracellular and extracellular fluid . In kidneys urea the most frequently determined clinical indices for estimating renal function depends upon concentration of urea in the serum . It is useful in differential diagnosis of acute renal failure and pre renal condition where blood urea nitrogen urea clearance is a poor indicator of glomerular filtration rate as its overproduction rate depends on several non renal factors, including diet and urea cycle enzymes . Increased blood urea nitrogen (bun) is seen associated with kidney disease or failure, blockage of the urinary tract by a kidney stone, congestive heart failure, dehydration, fever, shock and bleeding in the digestive tract . The high bun levels can sometimes occur during late pregnancy or result from eating large amounts of protein - rich foods . If the bun level is higher than 100 mg / dl it points to severe kidney damage whereas decreased bun is observed in fluid excess . Low levels are also seen in trauma, surgery, opioids, malnutrition, and anabolic steroid use . Cystatin c has been proposed to be a marker as it is produced by all nucleated cells at a constant rate and is freely filtrated by the glomeruli and completely catabolized in the proximal tubules . The concentration of serum cystatin c is mainly determined by glomerular filtration, which makes cystatin c an endogenous marker of glomerular filtration rate . In a meta analysis study by dharnidharka et al found cystatin c was superior to serum creatinine as a marker of glomerular filtration rate . Other studies have shown similar results when compared with other markers such as a 1-microglobulin and 2-microglobulin . Cystatin c was found to be an effective marker for glomerular filtration rate in patients with cirrhosis following liver transplantation . Cystatin c has been found more useful for detecting early renal impairment in both type 1 and type 2 diabetic patients . Moreover cystatin c was also found to be associated with mild kidney dysfunction with increased risk for cardiovascular events, peripheral arterial disease and heart failure . This protein is filtered at glomerulus and then reabsorbed in proximal tubule or excreted in urine and hence have potential to meet the criteria for use as a marker of glomerular filtration rate . -trace protein is a low - molecular weight glycoprotein belonging to the lipocalin protein family with 168 amino acids and a molecular weight of 2300029000, depending on the degree of glycosylation . It has been reported to be a better indicator of reduced glomerular filtration rate than serum creatinine . Serum -trace protein has been found to be elevated in patients with renal diseases . However, when compared, cystatin c is still a better indicator than serum -trace protein . Creatinine is a breakdown product of creatine phosphate in muscle, and is usually produced at a fairly constant rate by the body depending on muscle mass . Creatinine is a commonly used as measure of kidney function.the normal creatinine clearence test valve is 110 - 150ml / min in male and in female it is 100 - 130ml / min.the national kidney disease education program recommends calculating glomerular filtration rate from serum creatinine concentration . The diagnosis of renal failure is usually suspected when serum creatinine is greater than the upper limit of the normal interval . In chronic renal failure and uremia, an eventual reduction occurs in the excretion of creatinine by both the glomeruli and the tubules . Creatinine values may alter as its generation may not be simply a product of muscle mass but influenced by muscle function, muscle composition, activity, diet and health status . The increased tubular secretion of creatinine in some patients with kidney dysfunction could give false negative value . The elevated values are also seen in muscular dystrophy paralysis, anemia, leukemia and hyperthyroidism . The decreased values are noticed with glomerulonephritis, congestive heart failure, acute tubular necrosis, shock, polycystic kidney disease, and dehydration . Urea is major nitrogenous end product of protein and amino acid catabolism, produced by liver and distributed throughout intracellular and extracellular fluid . In kidneys urea is filtered out of blood by glomerulli and is partially being reabsorbed with water . The most frequently determined clinical indices for estimating renal function depends upon concentration of urea in the serum . It is useful in differential diagnosis of acute renal failure and pre renal condition where blood urea nitrogen urea clearance is a poor indicator of glomerular filtration rate as its overproduction rate depends on several non renal factors, including diet and urea cycle enzymes . Increased blood urea nitrogen (bun) is seen associated with kidney disease or failure, blockage of the urinary tract by a kidney stone, congestive heart failure, dehydration, fever, shock and bleeding in the digestive tract . The high bun levels can sometimes occur during late pregnancy or result from eating large amounts of protein - rich foods . If the bun level is higher than 100 mg / dl it points to severe kidney damage whereas decreased bun is observed in fluid excess . Low levels are also seen in trauma, surgery, opioids, malnutrition, and anabolic steroid use . Cystatin c has been proposed to be a marker as it is produced by all nucleated cells at a constant rate and is freely filtrated by the glomeruli and completely catabolized in the proximal tubules . The concentration of serum cystatin c is mainly determined by glomerular filtration, which makes cystatin c an endogenous marker of glomerular filtration rate . In a meta analysis study by dharnidharka et al found cystatin c was superior to serum creatinine as a marker of glomerular filtration rate . Other studies have shown similar results when compared with other markers such as a 1-microglobulin and 2-microglobulin . Cystatin c was found to be an effective marker for glomerular filtration rate in patients with cirrhosis following liver transplantation . Cystatin c has been found more useful for detecting early renal impairment in both type 1 and type 2 diabetic patients . Moreover cystatin c was also found to be associated with mild kidney dysfunction with increased risk for cardiovascular events, peripheral arterial disease and heart failure . This protein is filtered at glomerulus and then reabsorbed in proximal tubule or excreted in urine and hence have potential to meet the criteria for use as a marker of glomerular filtration rate . -trace protein is a low - molecular weight glycoprotein belonging to the lipocalin protein family with 168 amino acids and a molecular weight of 2300029000, depending on the degree of glycosylation . It has been reported to be a better indicator of reduced glomerular filtration rate than serum creatinine . Serum -trace protein has been found to be elevated in patients with renal diseases . However, when compared, cystatin c is still a better indicator than serum -trace protein . Fructose polymer inulin (mw 5kda) satisfies the criteria as an ideal marker of glomerular filtration rate . Rapid measurement of glomerular filtration rate by an inulin single - bolus technique would be practically useful . A new technique of measuring iohexol clearance using timed dried capillary blood spots was shown by mafham m et al . Blood spot iohexol clearance showed potential in estimating glomerular filtration rate accurately in large - scale epidemiological studies especially among individuals without established chronic kidney disease . Plasma clearance after single injection of iohexol gives a good estimate of glomerular filtration rate and is advantageous for the patients and clinicians . A new technique of measuring iohexol clearance using timed dried capillary blood spots was shown by mafham m et al . Blood spot iohexol clearance showed potential in estimating glomerular filtration rate accurately in large - scale epidemiological studies especially among individuals without established chronic kidney disease . Plasma clearance after single injection of iohexol gives a good estimate of glomerular filtration rate and is advantageous for the patients and clinicians . Some of them to mention are 125iodine (i)-iothalamate, 51credta ethylenediamine tetra acetic acid, 99mtc - dtpa (diethylene triamine penta acetic acid) and 99mtc mercapto acetyl triglycine . Renal 125iodine (i)-iothalamate clearance, is a simple and accurate test after a single subcutaneous injection, to measure glomerular filtration rate in adults . Efficiency of 125 iodine (i)-iothalamate was shown by geeta bajaj et al . The same author found renal clearance of 125 iodine (i)-iothalamate was reproducible, simple, and practical in healthy children and those with mild and advanced renal disease . In one of the study the mean renal extraction of cystatin c was equal to the mean renal extraction of 125 iodine (i)-iothalamate in hypertensive patients, suggesting tubular secretion of cystatin c. it was possible to get an accurate determination of 5lcr - edta clearance from a single - plasma sample in adults by applying the mean sojourn time - based approach previously shown to be very precise for determination of 99mtc - dtpa single - sample clearance . 5lcr edta- glomerular filtration rate is suggested for systemic lupus erythematosus patient with suspected renal involvement even when the serum creatinine concentration and creatinine clearance are normal . The limitation of this marker is that glomerular filtration rate measured by 5lcr edta can be overestimated in patients with severe oedema . Clinically the appearance of significant amount of protein in urine is one of the earliest sign of almost all renal diseases . Estimation of proteinuria helps in differentiating between tubulointerstitial and glomerular diseases and also to follow the progress of renal disease and to assess the response to therapy . Normally excretion in most healthy adults is between 20 - 150 mg of protein in urine over 24 hrs . Proteinuria more than 3.5 gm / day is taken to be diagnostic of nephrotic syndrome . Panels of protein measurement including albumin, 2-macroglobulin, igg and 2- microglobulin have been employed in differential diagnosis of prerenal and postrenal disease . It has been recommended the use of the protein / creatinine ratio as an index of quantitative proteinuria in 24 hour urine collection . The use of the clearance of haptoglobin, in particular provided valuable diagnostic information in cases in which the routine methods gave borderline values for the index of proteinuria . During pregnancy proteinuria assay in 24 hour urine sample one of the investigations for proteinuria is semi - quantitative dipstick urinalysis as this method is relatively low cost and easily performed.in pregnancy automated dipstick urinalysis is a more accurate screening test for the detection of proteinuria than visual testing . The finding of dipstick proteinuria should be confirmed by either a 24 hour urine collection or a protein - creatinine ratio . Tubular function tests involve evaluation of functions of the proximal tubule (i.e. Tubular handling of sodium, glucose, phosphate, calcium, bicarbonate and amino acids) and distal tubule (urinary acidification and concentration). Tsukahara h et al assessed the renal proximal tubular function in neonates by measuring urinary 2-microglobulin concentrations . Chen jy et al showed that in sick neonates the urinary 2-microglobulin and n - acetyl--d - glucosaminidase were the early markers of renal tubular dysfunction . They concluded that the elevated levels of urinary 2-microglobulin and n - acetyl--d - glucosaminidase in neonates born with meconium - stained amniotic fluid indicated the existence of tubular dysfunction, probably due to prenatal distress . Serum osmolality was measured directly using osmometry, or estimated based on the direct measurement of the concentrations of the osmotically active substances (i.e. Sodium, glucose, blood urea nitrogen, and ethanol). The difference between the measured osmolality and the calculated molarity is referred to as the osmole gap . Lalo pa et al observed severe hyponatraemia in some of the patients by measuring urine osmolality and urine sodium . According to jeff ms there are some genes which are involved in urine concentration which may encode solute - transport proteins and the vasopressin receptors . These molecular mechanisms show the reduction in urine - concentrating ability with aging that predicts various changes in kidney function . While landon s et al showed that aquaporin-1 has a physiologic role in renal function and is also essential for maximal urinary concentrating ability . In a complete deficiency of aquaporin-1 electrolyte panel is frequently used to screen for an electrolyte or acid - base imbalance and to monitor the effect of treatment on a known imbalance that is affecting bodily organ function . The test for electrolytes includes the measurement of sodium, potassium, chloride, and bicarbonate for both diagnosis and management of renal, endocrine, acid - base, water balance, and many other conditions . The combination of decreased filtration and decreased secretion of potassium in distal tubule during renal failure cause increased plasma potassium . Clinically the appearance of significant amount of protein in urine is one of the earliest sign of almost all renal diseases . Estimation of proteinuria helps in differentiating between tubulointerstitial and glomerular diseases and also to follow the progress of renal disease and to assess the response to therapy . Normally excretion in most healthy adults is between 20 - 150 mg of protein in urine over 24 hrs . Proteinuria more than 3.5 gm / day is taken to be diagnostic of nephrotic syndrome . Panels of protein measurement including albumin, 2-macroglobulin, igg and 2- microglobulin have been employed in differential diagnosis of prerenal and postrenal disease . It has been recommended the use of the protein / creatinine ratio as an index of quantitative proteinuria in 24 hour urine collection . The use of the clearance of haptoglobin, in particular provided valuable diagnostic information in cases in which the routine methods gave borderline values for the index of proteinuria . During pregnancy proteinuria assay in 24 hour urine sample one of the investigations for proteinuria is semi - quantitative dipstick urinalysis as this method is relatively low cost and easily performed.in pregnancy automated dipstick urinalysis is a more accurate screening test for the detection of proteinuria than visual testing . The finding of dipstick proteinuria should be confirmed by either a 24 hour urine collection or a protein - creatinine ratio . Tubular function tests involve evaluation of functions of the proximal tubule (i.e. Tubular handling of sodium, glucose, phosphate, calcium, bicarbonate and amino acids) and distal tubule (urinary acidification and concentration). Tsukahara h et al assessed the renal proximal tubular function in neonates by measuring urinary 2-microglobulin concentrations . Chen jy et al showed that in sick neonates the urinary 2-microglobulin and n - acetyl--d - glucosaminidase were the early markers of renal tubular dysfunction . They concluded that the elevated levels of urinary 2-microglobulin and n - acetyl--d - glucosaminidase in neonates born with meconium - stained amniotic fluid indicated the existence of tubular dysfunction, probably due to prenatal distress . Serum osmolality was measured directly using osmometry, or estimated based on the direct measurement of the concentrations of the osmotically active substances (i.e. Sodium, glucose, blood urea nitrogen, and ethanol). The difference between the measured osmolality and the calculated molarity is referred to as the osmole gap . Lalo pa et al observed severe hyponatraemia in some of the patients by measuring urine osmolality and urine sodium . According to jeff ms there are some genes which are involved in urine concentration which may encode solute - transport proteins and the vasopressin receptors . These molecular mechanisms show the reduction in urine - concentrating ability with aging that predicts various changes in kidney function . While landon s et al showed that aquaporin-1 has a physiologic role in renal function and is also essential for maximal urinary concentrating ability . In a complete deficiency of aquaporin-1 electrolyte panel is frequently used to screen for an electrolyte or acid - base imbalance and to monitor the effect of treatment on a known imbalance that is affecting bodily organ function . The test for electrolytes includes the measurement of sodium, potassium, chloride, and bicarbonate for both diagnosis and management of renal, endocrine, acid - base, water balance, and many other conditions . The combination of decreased filtration and decreased secretion of potassium in distal tubule during renal failure cause increased plasma potassium . The above discussed glomerular and tubular function markers are effective in proper assessment of renal function tests . These markers act as an indicator of biological, pathologic processes, or pharmacologic responses to a therapeutic intervention.
Since its introduction by clayman et al, laparoscopic surgery has enabled great progress in the area of urology, and less invasive techniques such as laparoendoscopic single - site surgery (less) and natural orifice transluminal endoscopic surgery (notes) have recently been introduced to clinical practice . Minimally invasive procedures such as less and notes have an aesthetic advantage over conventional laparoscopic surgeries because they require fewer portals of entry, which leaves minimal to almost no evident surgical scars . Laparoscopic partial nephrectomy is performed as the surgery of choice for small renal tumors with established evidence, and the surgical effectiveness and overall oncological outcomes of this procedure have been proved to be equal to those of conventional open surgeries for selected patients, even in the case of locally advanced renal tumors . For radical nephrectomy, the less technique is currently being practiced in many institutions, and its effectiveness has already been established . However, in the case of partial nephrectomy, the less technique is not yet actively practiced in clinical fields owing to its technical difficulties . We performed less partial nephrectomy in a porcine model with the objectives of overcoming the technical challenges of less and exploring the feasibility of the procedure from a technical viewpoint . Under the approval of the seoul national university institutional animal care and use committee (snuiacuc), six partial nephrectomies were performed on bilateral kidneys of a 5-month - old swine that weighed 30 kg . Three operations were done on each kidney by a surgical staff consisting of two urologists with much experience in laparoscopic surgery (e1, e2) and two less - experienced urologists (b1, b2). A 5 mm flexible laparoscope was used for vision, and the choice of articulating needle driver, rigid needle driver, grasper, and dissectors was made according to the preference of each surgeon . After a 2.5 cm skin incision was made at the umbilicus, the subcutaneous fat tissues were dissected and the peritoneum was opened . The octoport wound retractor (type b, designed for a small wound) was put into the peritoneal cavity covering from the skin to the peritoneum . The octoport wound retractor has 3 access ports, one 12 mm port and two 5 mm ports, and also has an additional gas inlet and gas outlet (fig . The renal hilum and gerota's fascia were dissected to expose the renal capsule . After scoring around the imaginary tumor by use of monopolar electrocautery, a bulldog clamp was applied on the renal artery and parenchymal resection was done . E1 performed a partial nephrectomy on the anterior side of the right kidney upper pole, e2 on the anterior side of the right kidney lower pole, and finally b1 on the posterior side of the right kidney lower pole, followed by b1's right nephrectomy . E1 performed a partial nephrectomy on the anterior side of the left kidney upper pole, e2 on the anterior side of the left kidney lower pole hilar area, and last, b2 resected the left kidney after performing partial nephrectomy on the posterior side of the left kidney lower pole . All operators used 3 - 0 vicryl running sutures to repair the open calyx and for hemostasis of the resection bed and 1 - 0 vicryl interrupted sutures for renorrhaphy, which was done with sliding knots only, without the use of any suture slip equipment such as hem - o - lok (teleflex medical, research triangle park, nc, usa) or lapra - ty (ethicon, somerville, nj, usa). During the calyx and parenchyma suture, articulating needle drivers were used alone for the repair of the resection margin of e1's first procedure and b2's procedure, and an articulating needle driver and rigid needle driver were used concurrently in all other cases . The resected parenchymal tissues and each kidney were extracted through a 4 cm extended umbilical incision (fig . 2, 3). After all procedures were performed, the pig was euthanized by use of an extra dose of kcl intravenously . All six partial nephrectomies were successfully performed without the need to introduce any additional ports, and all hemostatic procedures were successful in the repair of the vascular and collecting systems on the resection bed and renorrhaphy . Stable vital signs were maintained throughout the procedures, and there were no noticeable complications . During the partial resection of the renal parenchyme, an articulating grasper and articulating cold scissors were used in all cases . The mean time for partial resection was 3.1 minutes (range, 2.5 - 3.3 minutes), and the mean resection times for the upper and lower pole areas were 3.4 (range, 3 - 4) and 2.8 (range, 2.5 - 3.3) minutes, respectively . The experienced (e1, e2) and less - experienced (b1, b2) surgeons' mean times for partial parenchymal resection were 2.9 minutes (range, 2.5 - 3.3 minutes) and 3.25 minutes (range, 2.5 - 4 minutes), respectively . The mean sizes of the resected parenchyma were 2.1 cm (range, 1.9 - 2.4 cm) and 1.5 cm (range, 1.4 - 1.6 cm) for the long diameter and depth, respectively . Regarding warm ischemic time, e1 recorded 60 minutes on the anterior side of the right kidney upper pole and 35 minutes on the anterior side of the left kidney upper pole . E2 scored 30 minutes on the anterior side of the right kidney lower pole and 35 minutes on the anterior side of the left kidney lower pole around the hilar area . For b1 and b2, the warm ischemic times were 47 and 50 minutes for the posterior side of the right kidney lower pole and the posterior side of the left kidney lower pole, respectively . The shortest ischemic time, 30 minutes, was achieved by e2 by use of the early unclamping technique during renorrhaphy . The mean warm ischemic time was 42 minutes (range, 30 - 60 minutes); according to imaginary tumor location, it was 47.3 minutes (range, 35 - 60 minutes) for upper pole tumors and 36.7 minutes (range, 30 - 50 minutes) for lower pole tumors, respectively . The experienced (e1, e2) and less - experienced (b1, b2) surgeons' mean ischemic times were 38.8 minutes (range, 30 - 60 minutes) and 48.5 minutes (range, 47 - 50 minutes), respectively . The average number of sutures for renorrhaphy was 3.2 (range, 2 - 5). The rising demand for minimally invasive surgical procedures and the development of surgical techniques to meet such a need has enabled urologists to apply the single - port surgery techniques to most laparoscopic surgeries in urology . The cleveland clinic has reported 100 surgical cases of less ranging from nephrectomy to even radical cystectomy . However, there are relatively fewer successful reports on less in partial nephrectomy . Boylu et al reported 10 cases of partial nephrectomies using a porcine model . At this point in clinical practice, there are only initial case reports of less in highly selected cases . Aron et al reported 4 human cases in highly selected patients, but they used an additional 2 mm grasper via a 2 mm veres needle for the purpose of tissue traction . Our study focused on evaluating in a porcine model the technical feasibility of using a pure less technique for performing partial nephrectomy . In this study, all six partial nephrectomies were successfully done without any significant complications . One obvious difference between the less surgical technique and pure laparoscopy is the limitation in the movement of the instruments . That limitation makes the less surgery difficult and the learning curve for less surgery steep . Three major procedures make it difficult to manipulate the surgical instruments properly in less partial nephrectomy ., it took only 2.9 minutes for the experienced laparoscopic surgeons, and even for the inexperienced surgeons, it took only 3.3 minutes with the use of the flexible instruments . However, sewing the open calyx and resected renal parenchyma was the most difficult procedure during less partial nephrectomy . To identify whether the suture technique used in pure laparoscopic surgery could also be adapted for less partial nephrectomy, the surgeons in this study did not use any laparoscopic clips, which can make suturing easier and faster . We tried only interrupted parenchymal sutures with the sliding knot technique, which is simple and accurate but the most difficult and time - consuming technique, with the object of identifying the feasibility of this suturing technique for less partial nephrectomy . Therefore, it took from 27 minutes to 57 minutes for the calyceal and parenchymal sutures . The articulating instrument is very useful during all of the procedures in less surgery, especially for triangulation and procuring enough space for the instruments to move freely in the restricted space . In our experience, it was convenient for the right - handers to use the articulating instrument for the right - side instrument, because the right - hand instrument usually performs the counter - traction to make the dissection easier in contrast with pure laparoscopic surgery . However, which hand should use the articulating instrument depends on the situation . Regarding the needle drivers, the articulating needle drivers with their flexible characteristics did not provide sufficient strength during sutures, which made the sewing procedures more difficult . Therefore, replacing the flexible needle drivers with rigid, conventional needle drivers became more convenient . When replacing the articulating needle driver with a rigid needle driver, the surgeons changed the right - hand instrument to the rigid needle driver, because all the surgeons in this study were right - handed . Also, we used right - angled forceps for the left - hand instrument and instead of using triangulation of the instruments we coordinated both instruments in a parallel position . During knot - tying, however, the instruments should be coordinated in a forward and backward direction, because there is no space for the instruments to move in a lateral direction as in pure laparoscopic surgery . During the renal parenchymal suturing, we used early unclamping and the sliding knot technique to shorten the ischemic time . Describing our early unclamping technique in detail, first, an interrupted renal parenchymal stitch was made . After making a loose square knot, we converted the square knot to a sliding knot . Then two or three more stitches were made according to the size of the parenchymal resection . We made just one stitch fasten, unclamped the bulldog clamp, and finally fastened the other stitches . Shikanov et al reported in a multicenter study that ischemic time (mean ischemic time was 29 minutes) does not affect global renal function in the case of two normal functioning kidneys . However, becker et al reported in a mass analysis that in order to minimize parenchymal ischemic injury, the tumor should be removed within 20 minutes of warm ischemia, regardless of the surgical approach . Large - scale institutions today score mean ischemic time around 30 minutes in the case of laparoscopic partial nephrectomy and it is assumed that warm ischemic time under 30 minutes is required in order to successfully apply less to partial nephrectomy in clinical practice [9 - 11]. In our study, the mean warm ischemic time was 42 minutes . The experienced urologists group scored an average of 38.8 minutes, and e2 achieved 30 minutes by using the early unclamping technique . However, considering that this study was performed with a porcine model, a longer warm ischemic time can be assumed in the case of a human kidney . Compared with the human body, the porcine model we used was smaller and had a smaller resected volume, which results in a shorter distance and smaller defect to repair . Furthermore, it is believed that it is easier to obtain hemostasis in a porcine model than in a human kidney because of the different cell biology, blood supply, and tissue textures . All the above factors will make the procedure of less partial nephrectomy more difficult in humans than in the porcine model . Nguyen and gill reported halving the ischemic time from 31.1 to 13.9 minutes by using the early unclamping technique, although the technique was associated with a risk of bleeding and reclamping . However, we can also infer that the early unclamping technique and dry and wet laboratory disciplinary efforts to handle the instruments more freely can reduce the warm ischemic time . Although hem - o - lok (teleflex medical, research triangle park, nc, usa) or surgical clips such as lapra - ty (ethicon, cincinnati, oh, usa) are generally used in laparoscopic partial nephrectomy, our study used only sliding knots for suturing . Another important fact that we found in this study was that there was no need for an additional trocar for less partial nephrectomy . All four surgeons could finish the less partial nephrectomy without any added trocars, even for right partial nephrectomies . Boylu et al reported 10 consecutive less partial nephrectomies in porcine models performed by a single surgeon . That study showed an overcoming of the learning curve with decreasing warm ischemic time . In our study, because of the limited number of cases and the many surgeons, the learning curve could not be assessed . But we can postulate that consecutive dry and wet laboratory discipline and experience would improve surgical technique, shorten the warm ischemic time, and result in the surgeon overcoming the learning curve . However, our study suggests that less for partial nephrectomy results in longer ischemic times than for conventional laparoscopic surgeries . Therefore, many dry and wet laboratory disciplinary efforts are needed to decrease the warm ischemic time and improve this surgical technique.
Pleomorphic carcinoma (pc) is a rare malignant lung tumor characterized by dual - cell components including spindle or giant cells as well as epithelial cells . Pc has been reported to have a more aggressive clinical course and a poorer survival compared to other histological types of non - small cell lung cancer (nsclc) [1, 2]. We report the case of a patient with pc and a single brain metastasis that achieved long - term recurrence - free survival following treatment with combined modality therapy . A 71-year - old male presented with aphasia and muscle weakness of the left side of his body . He was suspected of having a central nervous system disorder and underwent head brain ct that showed a 50 50 mm mass lesion in the right frontal lobe (fig . His chest x - ray showed a mass shadow with a cavity in the right - middle lung field (fig . The chest ct also showed a 70 68 mm mass with a cavity in the right lower lobe (fig . The level of tumor markers like carcinoembryonic antigen, cytokeratin 19 fragments and pro - gastrin - releasing peptide were not elevated . Based on these clinical findings, the patient was diagnosed with lung cancer with a single brain metastasis . Craniotomy was performed because the patient's central nervous system's symptoms were severe and his eastern cooperative oncology group performance status was zero . The brain tumor in the right frontal lobe was completely removed, and the pathological diagnosis was confirmed as sarcomatoid pattern carcinoma . A ct - guided percutaneous lung biopsy proved that the pathological diagnosis of the right lung mass was spindle cell carcinoma . The patient was therefore diagnosed as having pleomorphic carcinoma of the lung with a single brain metastasis (clinical t3n0m1b stage iv). After craniotomy, the patient underwent 6 courses of chemotherapy (carboplatin auc 4 on day 1 and gemcitabine 800 mg / m on days 1 and 8, repeated every 3 weeks). After chemotherapy, the chest ct showed a reduced nodular shadow (62 50 mm) (fig . 1d), while f - fluorodeoxyglucose positron emission tomography showed no uptake in the lymph nodes (data not shown). The patient achieved a partial response by preoperative chemotherapy and underwent a right - lower lobectomy, partial resection of a right s2 segment, parietal pleurectomy, and mediastinal lymph node dissection through a posterolateral thoracotomy . This surgery was required because of the possibility of invasion into the right upper lobe and the parietal pleura . Microscopically large, spindle - shaped atypical cells had sarcomatously proliferated into most of the tumor portions (fig . Immunohistochemically, the mib-1 index of the specimen obtained by ct - guided percutaneous lung biopsy before preoperative chemotherapy was high at 60% (fig . 2c), whereas that of the resected tumor was low at 10% (fig . Pc is rare, accounting for 0.31.0% of all lung cancers; it is defined as a poorly differentiated nsclc . In a recent large study on patients with stage i iii lung cancer, the overall 5-year survival rate and mean survival time of these patients were reported to be significantly lower and shorter than that of patients with other types of nsclc (36.7 vs. 59.4%, and 22.8 vs. 96 months, respectively). Therefore, patients with pc have a significantly poorer outcome than patients with other types of nsclc . In the present case, the patient underwent preoperative chemotherapy after craniotomy . The national comprehensive cancer network recommends neoadjuvant chemotherapy combined with surgical treatment or surgical treatment combined with adjuvant chemotherapy in nsclc cases with brain metastasis (tnm category t12, n01, t3n0 if the metastasis can be controlled). Although previous papers showed that pc had a poor response to chemotherapy regimens, there is a report indicating the efficacy of chemotherapy for pc . In our case, gemcitabine - based chemotherapy was effective and suggested that this treatment was potentially useful for pc . The following discussion includes the possible reasons why the present case achieved long - term survival . . Showed the following 4 factors that contributed to the poor prognosis for a pc survival: (1) tumor size> 5 cm, (2) stage greater than i at presentation, (3) presence of distant metastases, and (4) lymph node metastases . In this case, the absence of lymph node metastasis was a good prognostic factor . These 4 factors only include the tnm classifications and are common prognostic factors for pc and other nsclcs . However, patients with pc have poorer outcomes than those with other nsclcs, and it is therefore necessary to investigate specific prognostic factors for pc . In the present case, the mib-1 index of the immunohistochemical specimen obtained by ct - guided percutaneous lung biopsy before preoperative chemotherapy was high at 60% (fig . 2c), although it was reduced to 10% in the resected tumor (fig . Mib-1 is present during all active phases of the cell cycle (g1, s, g2, and mitosis), but absent in resting cells (g0). This property makes it an excellent marker for determining the so - called growth fraction of a given cell population . In patients with pc, a low mib-1 index (<35%) moreover, there is a report in which the mib-1 index was significantly lower after gemcitabine - based chemotherapy and exerted a true antiproliferative effect on tumors in vivo . Reduced proliferation with gemcitabine - based chemotherapy may partly be because of increased apoptosis in actively proliferating cells so that the residual population would be enriched by mib-1-negative cells . In our case, the mib-1 index was reduced by gemcitabine - based chemotherapy, which may have led to long - term disease - free survival . The mib-1 index may therefore be a useful biomarker of the response to chemotherapy, with the reduction in the index following preoperative chemotherapy representing a response marker that reflects the proliferation of tumor cells . The changes in the mib-1 index caused by preoperative chemotherapy may therefore provide useful information for deciding the regimen for adjuvant chemotherapy.
The stainless steel crowns (sscs) are often the first choice for the repair of defects in primary dentition caused by caries, and have been one of the most effective and efficient methods of tooth restoration in pediatric dentistry since humphrey first used them in pediatric patients in 1950.1 ssc placement is simple and economical with a high success rate for protecting remaining teeth weakened by excessive preparation.23 however, sscs are disadvantaged by a non - aesthetic appearance,4 and this esthetic issue has become more and more important in patients with primary tooth problems . In a survey, esthetic concerns were confirmed to be the most critical issue for dental restoration in pediatric patients.5 accordingly, new materials, such as, open - faced crowns, bonded strip crowns, and pre - veneered sscs were developed to replace sscs.67 these new materials improve esthetics, but have side effects that include poor gingival health, hemorrhage of gingival tissues, and exposure of dental margins, which are associated with the presence of metals.3 in particular, the veneer resin of preveneered sscs frequently chips occurs and results in additional treatment and cost.78 the recently developed all - ceramic crown is now used as an esthetic restorative material for permanent teeth, and ready - made primary zirconia crowns are now being used for primary teeth . Zirconia, also known as " ceramic steel ", has reasonable aesthetics and has excellent mechanical properties for the restoration of permanent teeth, and has been used for crowns, fixed partial dentures, implant abutments, fixtures, inlays, and onlays.9 however, zirconia crowns are thicker than sscs and cannot be corrected, and thus, manufacturers recommend passive seating . Furthermore, due to their thicknesses, aggressive tooth preparation is required and pulp exposure is increased . Preveneered sscs can still provide full coverage despite esthetic veneer chipping or fracture, but zirconia crowns must be replaced when fractured.10 this limitation can be overcome by lithium disilicate or leucite crown restoration for permanent teeth, but no study has been conducted as yet on the use of different ceramics for the repair primary teeth . Furthermore, no study has evaluated the wear resistance of primary teeth restored using different ceramic materials based on considerations of occlusal force in pediatric patients . Primary tooth wear is common, and occurs due to the loss of enamel and dentin on the occlusal surface.1112 the abrasivities of primary and permanent teeth differ due to their different enamel strengths,13 morphological factors, such as, enamel and dentin thickness,14 and the different biting forces of adults and infants.15 in a comparative study conducted by nose16 on molar enamels of primary and permanent teeth, the vickers hardness number (hv) of primary teeth was 106 (hv) and that of permanent teeth was 126 (hv), which suggests poorer wear resistance of primary teeth . In a study by mortimer,17 primary teeth were found to be less mineralized than permanent teeth, and nelson et al.18 reported primary tooth enamel was thinner than permanent tooth enamel, and thus, more prone to wear . Proffit and fields15 studied the bite forces of children and adults and found mean bite forces of 17.4 kg (mean age: 9.3) and 31.0 kg (mean age: 26.9) at a 2.5 mm opening; and 15.5 kg and 35.6 kg at a 6.0 mm opening, respectively, which confirmed that in children low bite forces reduced wear on the occlusal surfaces of posterior composite restorations . Restoration materials affect enamel wear.19 seghi et al.20 stated that the wear rates of dental restoration materials should be similar to that of the enamel . Previous studies on primary tooth abrasivity against restoration materials have focused on composite or glass ionomer restorative materials.212223 due to growing interest in esthetics and the development of zirconia crowns, various studies have been conducted utilizing different restorative materials . In an evaluative study by jung et al.24 on the abrasivity of natural teeth as compared with those of restoration materials, the natural tooth wear caused by zirconia was found to be much less than that caused by feldspathic dental porcelain . Sripetchdanond and leevailoj25 confirmed that zirconia and composite resins wear enamel significantly less than glass ceramics and enamel . In pediatric dentistry, various cases of anterior tooth restoration using ready - made primary zirconia crowns have been reported.2627 however, few studies have conducted on primary tooth wear by ceramic restoration materials.212223 in this study, the associations between restoration materials, namely, zirconia crowns, lithium disilicate, and leucite and primary tooth wear were compared and evaluated to investigate the possibility of using ceramic restoration materials for primary tooth restoration . Primary canine teeth with no cusp wear, which were lost naturally during transition to permanent teeth, were used in this study . Teeth were washed in an ultrasonic cleaner and then placed in deionized water at 37 for 24 hours . The primary canine teeth were fixed in an acrylic resin (orthodontic resin, dentsply, philadelphia, pa, usa) and approximately 5 mm of the cusps of the primary canine teeth was exposed (20 mm wide and deep and 10 mm high). Severely worn or fractured teeth and teeth with caries were excluded (fig . The 40 antagonistic specimens were assigned equally to a stainless steel (the steel group; the control group), a leucite glass - ceramic (the leucite group), a lithium disilicate glass - ceramic (the lithium group), or a monolithic zirconia (the zirconia group) group (table 1). For the steel control group, 11 mm - wide and -deep, and 13 mm - high, cubic specimens were prepared by crimping stainless steel (sts 304l) of sscs (kids crown, shinhung, seoul, korea). For the leucite, lithium, and zirconia experimental groups,, charlotte, nc, usa), and converted to stl files using design software (ceramill mind, amanngirrbach corp ., the materials used were; a monolithic zirconia block (zirtooth fulluster, hass, kangneng, korea), a lithium disilicate block (rosetta sm, hass, kangneng, korea), and a leucite block (rosetta bm, hass, kangneng, korea). Using a milling machine (ceramill motion2, amanngirrbach corp ., charlotte, nc, usa), 11 mm - diameter and 13 mm - high specimens were prepared . Heat treatments were conducted in ceramics except leucite group according to manufacturers' instructions, and specimens were subsequently washed using an ultrasonic cleaner (table 2). Prepared specimens were fixed with an acrylic resin (orthodontic resin, dentsply, philadelphia, pa, usa) using uniform molds by the same method used to prepare tooth specimens (fig . Wear tests were conducted using a cs-4.8 masticator (sd mechatronik, feldkirchen - westerham, germany). In each chamber, restorative materials were placed on top and antagonistic teeth at the bottom using specimen holders (fig . A 3 mm vertical movement and a 2 mm horizontal movement were reproduced using two computer - controlled servomotors . Masticatory force was established using the results of previous studies that compared the abrasivities of dental materials and primary teeth.2223 in the present study, 50 n was used as the masticatory force, which was the middle value of the lowest and the greatest masticatory forces used in previous studies . To meet the 50 n condition, in addition to the weight, a thermodynamic condition similar to the real oral environment was reproduced using a computer - controlled hot / cold water circulation system . Testing was conducted over 100,000 loading cycles (table 3).23 to measure the amount of the volume of tooth loss, teeth were scanned using a 3d scanner before and after testing.2829 the 3d data obtained before and after testing were overlapped using 3d software (dentacian software, ezplant, seoul, korea). Worn areas were then separated using boolean operations and wear volumes were measured using 3d software (dentacian software, ezplant, seoul, korea) (fig . 4). Wear losses of restoration materials after testing were determined using an electronic scale (pag213, ohaus, seoul, korea) accurate to 10 gram . To qualitatively characterize wear patterns, antagonistic teeth and restorative materials tokyo, japan) operated at 15 kev at magnifications of 40, 100, and 1000. the statistical significances of changes in tooth volumes and weights of restoration materials in each group were evaluated . Distribution normality and variance homogeneities were determined using the shapiro - wilk's test and levene's test . The analysis was conducted by one - way anova (= .05) with tukey's post - hoc test (= .05). Chicago, il, usa) was used throughout, and significance level was set at 5% . The means and standard deviations of the volume losses of antagonistic teeth (vt) and the weight losses of restorative materials (vm) in each group after wear testing are shown in table 4 and fig . The leucite group showed the greatest tooth volume loss at 2.670 1.471 mm, followed by the lithium group with 2.042 0.696 mm, the zirconia group with 1.426 0.477 mm, and the steel group with 0.397 0.192 mm . Tooth volume losses in the leucite and lithium groups were significantly greater than that in the steel group (p <.05), but no significant difference was observed between the steel group and the zirconia group (p>.05). In terms of weight losses of restorative materials after testing, the lithium group showed most at 0.006 0.002 g, followed by the leucite group (0.003 0.002 g) and the steel and zirconia groups (0.002 0.001 g). Weight loss in the lithium group was significantly greater than in the steel and zirconia groups (p <.05), but no significant difference was observed between the steel, leucite, and zirconia groups (p>.05). The sem images of wear surface areas in enamel and tested materials are shown in fig . 6 and fig . 7 . In enamel sem images of the steel group, smooth surfaces, fragmentation or particle chipping, and striated plow marks were observed . In tested material images, no notable surface changes or wear were observed other than slight stress marks and scratches in the sliding direction . Even after wear testing, dense and homogeneous surfaces were observed . In sem images of the leucite group, notable surface changes and wear were observed on the rough surfaces of tooth enamel with ploughing in the sliding direction . In particular, the presence of fragments chipped from enamel surfaces was confirmed by irregular concavities and gaps on worn surfaces . Striated wear grooves and rough surfaces, caused by lateral movements of the test instrument, were clearly observed on tested materials and on enamel surfaces . In enamel sem images of the zirconia group, surfaces were mostly smooth, and no chips or fractures were observed . Comparative studies have been conducted on the abrasivities of different dental restorative materials and teeth . Due to growing interest in esthetics, the abrasivities of teeth and of ceramic materials, such as, leucite, lithium disilicate, and zirconia, which have excellent mechanical properties and esthetics, have been evaluated . However, these attempts have been limited to permanent teeth.3031 more recently, in pediatric dentistry, several manufacturers have started to produce ready - made primary zirconia crowns, and clinical applications of these products have already been reported . 2627 however, no comparative study has yet addressed the abrasivities of these ceramic materials when worn against primary teeth . Moreover, accurate measurements are challenging because variables such as chewing forces and environmental factors cannot be completely controlled.32 although in vitro studies are limited in terms of accurately reproducing mastication in the oral cavity, simple movements, such as, tooth grinding and clenching, can be reproduced, and the anti - wear mechanisms of various restoration materials can be evaluated at the pre - clinical stage.33 because of the advantages of in vitro studies, various mastication simulators that reproduce wear process in the oral environment have been developed.3435 various tests (e.g., pin - on - block, pin - on - disk, three - body wear, and toothbrush simulation) can be used to investigate the wear performance of dental materials, and antagonist wear has been confirmed to be closely associated with ceramic material types and testing conditions.36 since the two - axe wear test device used in this study is practical, durable, and cost - effective, it has been widely used . The device has eight interior chambers and reproduces the mandibular closure of mastication through sliding movements after occlusal contact.30 in this study, a two - body wear test was conducted . This method is widely used to measure wear resistance, and reproduces the attrition caused by occlusal contact between restoration materials and teeth.34 this method can also reproduce the friction and fatigue wear caused by the direct contact between the maxillary and mandibular teeth during swallowing or non - functional dynamic occlusal movements.37 the 50 n force and 100,000 cycles used for the wear test in this study were determined based on the suggestions of previous studies that compared the abrasivities of various restoration materials and primary teeth.2223 simultaneous thermal cycling with water to reproduce temperature changes in the oral cavity also removes wear particles generated during the wear test, and thus simulates aging.38 suggestions made regarding the standardization of the enamel surface of natural teeth in the wear test are controversial.36 krejci et al.39 suggested a non - standardized enamel cusp of natural teeth is the most appropriate antagonist . Kunzelmann et al.40 reported that unlike untreated enamel, polished enamel could show changes in the wear properties of enamel . Accordingly, in this study, the enamel surfaces of primary canine teeth that were naturally lost during the transition to permanent dentition were used as antagonist teeth . Magne et al.41 suggested height loss measurements provided a convenient method of measuring wear because they can be easily determined and are associated with clinical vertical measurements of occlusion . However, volumetric loss provides a more sensitive means than weight loss because measurements change linearly with time.42 in the present study, three - dimensional wear measurements with a laser scanner were used to measure the tooth wear . Using this method 2829 on the other hand, in two - dimensional studies, it is difficult to overlap restoration material profiles before and after wear . Weight measurement has also been used to measure and quantify the amounts of wear in restoration material . 43 but it is difficult to remove moisture from the teeth after wear due to the presence of dentinal tubules . Despite drying, water can remain in teeth, and thus, moisture levels cannot be determined before testing . However, after testing restoration materials were completely dried, and thus, precise measurements of weight losses were obtained . In this study, the abrasivity of primary teeth was compared with that of the four types of crown restoration materials: sscs (kids crown), which has been widely used for the crown restoration of primary teeth; zirconia as represented by the recently developed ready - made primary zirconia crowns (zirtooth fulluster); lithium - disilicate (rosetta sm), a particle - filled glass ceramic; and leucite (rosetta bm). The amount of wear of primary teeth was greatest in the leucite group, followed in order by, the lithium group, the zirconia group, and the steel group . In particular, amounts of wear in the leucite and lithium groups were significantly greater than that in the steel group . Surface hardness and friction factor are used to estimate the wear levels of dental restoration materials . Greater hardness is known to typically result in more enamel wear,24 and metal hardness has been shown to be associated with enamel wear.30 however, according to oh et al.,44 enamel wear by ceramic is associated more with surface roughness, microstructure, fracture toughness, and environmental factors than with hardness per se . In the present study, enamel wear was greatest in the leucite group because leucite has comparatively low flexural strength (120 mpa) and fracture toughness (1.42 mpam). In contrast, zirconia has high flexural strength (1,200 mpa) and fracture toughness (5.5 mpam), and showed less enamel wear than the leucite group . This result agrees with that of a previous study that demonstrated an association between a low wear rate and high flexural strength and fracture toughness.29 if a restorative ceramic material does not have enough ductility fracture and/or chipping may occur . Furthermore, chips function as abrasives on ceramic surface and increase wear rates.45 the high enamel wears caused by glass particles in the leucite and lithium groups could be partly explained by the formation of wear debris . Glass particles freed by wear function as abrasives, a phenomenon referred to as the " three - body wear mechanism".46 the steel group showed the lowest enamel wear rate because occlusal forces were absorbed by the ductility of the steel . In addition, as shown in the sem images, smooth surfaces might reduce the wear rates of antagonist teeth . In the present study, enamel wear in the zirconia group was comparatively small, as has been previously reported.24253031 this outcome is attributed to its excellent physical properties, such as, its hardness, flexural strength, density, and fracture toughness, which inhibit the formation of surface microfractures, and to the addition of yttria, which reinforces the crystal structure and prevents crack propagation.47 as a result, the smooth surface of zirconia was maintained during the wear test and only a small amount of enamel wear was observed after testing.37 the lithium group showed the largest amount of restoration material wear, followed by the leucite, zirconia, and steel groups . Wear in the lithium group was significantly greater than that in the steel and zirconia groups, but no significantly difference was observed between the leucite and lithium groups . These outcomes concur with those of previous studies.34 the leucite and lithium group showed high amounts of wear because glass ceramics like leucite and lithium disilicate are sensitive to fatigue, which causes material defects.48 actually, wear starts with crack formation on the ceramic surface, is propagated by repetitive loading, and eventually results in material loss.49 according to our findings, the amounts of wear of restoration materials and of antagonistic primary teeth tended to be positively related . Moreover, the flexural strength and fracture toughness of the ceramic materials (leucite, lithium disilicate, and zirconia) also seemed to be correlated with amounts of primary tooth wear . The occlusal force, masticatory movement, and conditions used in this study differ from those in the oral environment . In addition, two - body wears were evaluated in this study, and three - body wear tests could result in different outcomes . Therefore, we suggest further long - term studies that simulate the oral environment be conducted to investigate the clinical implications of various ceramic material in primary teeth in vitro measured volumetric losses in the leucite and lithium groups were significantly greater than in the steel group, but no significant difference was found between the steel and zirconia groups . In this study, zirconia was the only material found to have an abrasivity that did not differ significantly from that of the steel used in conventional steel crowns . On the other hand, the leucite and lithium groups showed comparatively high primary - tooth abrasivity levels, which if confirmed in vivo may suggest that they should be used with caution in pediatric dentistry.
Meiosis - specific genes have been identified in several eukaryote pathogen genomes by phylogenomic analysis [5, 6], with demonstrated functionality in giardia intestinalis and trypanosoma brucei . Three functionally distinct, meiosis - specific proteins (mnd1, dmc1, and hop1) were expressed in t. b. brucei strain j10, implying that meiosis might be an integral part of the trypanosome s developmental cycle in the tsetse fly vector . To test this hypothesis and to obtain further information on the timing of meiosis the endogenous loci of three genes expressed solely during the prophase of meiosis i were modified so that each contained an n - terminal yfp tag (yfp::mnd1, yfp::dmc1, yfp::hop1). We used the following trypanosomes: t. b. brucei (lister 427), t. b. rhodesiense (058), t. b. gambiense group 1 (dal972), and t. b. gambiense group 2 (th2), the last three being human pathogens . Each strain expressed the meiosis - specific genes exactly as previously observed for t. b. brucei j10, confirming that the meiotic program takes place in the salivary glands (sg) during transmission of a clonal trypanosome strain (figure 1). Although successful crosses of t. b. brucei, t. b. rhodesiense, and t. b. gambiense group 2 have been reported previously, this is the first indication that t. b. gambiense group 1 is capable of meiosis and, potentially, genetic exchange, despite lack of evidence of recombination in population genetics analyses [9, 10]. Sex provides the opportunity for new pathogen strains to arise by recombination, a phenomenon already suspected in t. b. rhodesiense, which has the capacity to become human infective by transfer of a single gene for human serum resistance (sra). Trypanosomes expressing meiosis - specific genes were present in fly sg dissected between 14 and 38 days after infection (figure 1c), with the highest frequency of expression around day 20 . It follows that postmeiotic cells, including haploid gametes, should occur at the highest frequency at this time point . From measurements of nuclear dna contents of different life - cycle stages, it has been assumed that t. brucei is diploid throughout its developmental cycle [1315]. But mating in trypanosomes is believed to involve haploid nuclei or cells because the pattern of inheritance in experimental crosses is largely mendelian; moreover, triploid laboratory hybrids are often found, implying that fusion of haploid and diploid nuclei has taken place [3, 17, 18]. The expression of meiosis - specific genes preceded cell fusion, and hence meiosis generates the cells that subsequently undergo fusion . Our initial search for haploid trypanosomes by flow cytometry of sg - derived trypanosomes was unsuccessful because cell numbers were too low and amounts of fly tissue and debris too great to distinguish signal from noise; movie s1 (available online) illustrates the suboptimal nature of the material under analysis . We therefore developed an alternative search strategy to find cells with gamete - like behavior in mixtures of sg - derived trypanosomes . Analysis of trypanosome crosses is facilitated by the incorporation of red fluorescent protein (rfp) or green fluorescent protein (gfp) into the parental clones, enabling hybrids to be identified by yellow fluorescence . This system established that hybrid trypanosomes occur in the sg, not the midgut (mg), of infected flies and are found as early as 13 days after flies are coinfected with the parental clones . Here, rather than carrying out the cross in vivo, we mixed the parental clones in vitro using trypanosomes derived from the sg of flies separately infected with either red or green fluorescent cell lines . Trypanosomes were harvested from fly sg during the window of peak expression of meiosis - specific genes, and the ex vivo mixtures were observed as living cells in microslides over the course of about an hour, and also after fixation on microscope slides . Twenty replicate experiments were carried out using mating - compatible pairs j10 rfp/1738 gfp or f1g2/f1r1 (table s1a). Small clusters of two or more red and green fluorescent trypanosomes, as well as clusters of single color trypanosomes, were observed within 10 min of mixing the red and green fluorescent sg - derived parental cells (figure 2; movies s2 and s3). We focused the search for gamete interactions on the red - green clusters because single - color clusters might also arise from cell division . All red - green clusters contained at least one trypanosome with a short, wide body and long anterior flagellum . These trypanosomes were observed to interact by intertwining their long flagella, often drawing the cell bodies into close proximity (figure 2a). These interactions are reminiscent of the recognition and attachment of gametes of the unicellular plant chlamydomonas reinhardtii via their paired flagella . In the clusters, the trypanosomes were highly active, frequently changing position (movies s2 and s3). These distinctive cell interactions had not been observed previously in our analysis of experimental crosses [3, 18, 20]. To rule out the possibility that the sg cells were sticky, we set up mixtures of mg- and sg - derived trypanosomes in all possible combinations (table s1b). The distinctive flagellar interactions were observed only among sg - derived trypanosomes and did not occur in mixtures of sg- and mg - derived trypanosomes or between mg - derived trypanosomes; when red and green trypanosomes were found together in these mixtures, they were associated with debris or dead trypanosomes . Yellow fluorescent trypanosomes started to appear within 30 min of mixing the sg - derived parental lines (figure 2b) and were observed in 11 of 20 experiments (table s1a). The rapid appearance of yellow fluorescent trypanosomes signifies fusion of cell membranes and exchange of cytoplasm between red and green fluorescent cells rather than de novo synthesis of fluorescent proteins, which would take several hours . These results demonstrate that clonal trypanosome populations derived from the sg already contain fusion - competent cells, ruling out the hypothesis that these cells are generated after recognition of nonself among trypanosomes of different genotypes . The trypanosomes implicated as trypanosome gametes had a distinctive morphology, and dapi staining revealed either one kinetoplast and one nucleus (1k1n) or two kinetoplasts and one nucleus (2k1n) (figure 2; movies s3 and s4). In trypanosome biology the closest is promastigote, which refers to a cell with an antenuclear kinetoplast and a flagellum that emerges anteriorly without connection to the cell body via an undulating membrane . In the following, we refer to these 1k1n and 2k1n cells collectively as promastigote - like (pl) cells . Both 1k1n and 2k1n pl cells displayed gamete - like cell - cell interactions, but we were unable to distinguish different behavior during mating . The presence of two kinetoplasts in the 2k1n pl cells was confirmed by differential staining with dapi and propidium iodide (pi) (figures 3a and 3b) and also by visualization of the subcellular location of a yfp::p166 fusion construct (figures 3c and s1a). P166 is an intrinsic component of the tripartite attachment complex (tac), the filamentous structure that physically attaches the kinetoplast to the basal body of the flagellum . The intensity of fluorescence of p166 in the anterior tac was usually greater than that in the posterior tac (figure s1a), perhaps associated with the presence of a flagellum attached to the anterior kinetoplast . The 2k1n pl cells had only one flagellum, although the two kinetoplasts were widely separated at the two poles of the cell on either side of the nucleus, and a new flagellum would normally be evident at this stage of cell division . To detect whether a second flagellum was present but not discernible by light microscopy, we visualized the subcellular localization of pfr1, a major structural protein of the paraflagellar rod (pfr), using cells expressing the fusion yfp::pfr1 (figures 3d and s1b). Of 26 2k1n pl cells examined, 23 (88%) had only a single fluorescent flagellum, arising near the anterior kinetoplast . The remaining three cells had two flagella, the posterior flagellum appearing as a tiny dot of fluorescence near the posterior kinetoplast (figure s1b). The pfr extends from the point at which the flagellum emerges from the flagellar pocket to its distal tip, and thus pfr1 is absent from a transitional zone of the flagellum adjacent to the basal body . We therefore cannot rule out the presence in all 2k1n cells of a very short flagellum that does not extend beyond the flagellar pocket, as seen in leishmania amastigotes . The above evidence on interactions and cytoplasmic fusion implicates pl cells as trypanosome gametes; the crucial question is whether they are haploid, a defining feature of eukaryote gametes . Pl cells were present in small numbers in live preparations of sg spillout (movies s1 and s5), together with metacyclics and other unattached trypanosomes . Fixed cells were stained with both dapi and propidium iodide (pi) before measurement of total fluorescence intensity of the nucleus . This provided two independent measures of nuclear dna content, because dapi and pi have different dna binding characteristics (although dna binding could in principle be affected by chromatin packing). Both 2k1n and 1k1n pl cells were haploid relative to metacyclics, the diploid, g1-arrested, mammal - infective stage also present in the sg (figure 4a). The combined dapi and pi pixel intensities of pl cells peaked at 0.5, compared to metacyclics at 1.0 (2c dna content) (figure 4a). Procyclics from the fly midgut had a major peak at 1.0 and a smaller peak at around 2.0, consistent with the 2c and 4c peaks expected for this proliferating cell population (figure 4a). Epimastigotes are also a proliferative insect stage, which are characteristically found attached to the sg epithelium via the flagellum, but here we examined free epimastigotes in the sg spillout; these cells did not have the elongated posterior nozzle typical of attached epimastigotes . The population shows nuclear dna content peaks at 1.0 (2c) and 2.0 (4c) like procyclics, but there is a noticeable shoulder of nuclei with dna content <1.0 (figure 4a). Reexamination of this population revealed ten cells apparently in division, as each had two nuclei (either 3k2n or 2k2n), with nuclear dna contents in the haploid range . We speculate that some of these are cells in reduction division (meiosis ii), but they were difficult to distinguish from dividing pl cells, except by the extreme length of the flagellum (figure s2). A total of 12 dividing pl cells was recorded among 600 cells examined; because this was a clonal trypanosome population, this cell morphology is unlikely to arise by fusion of pl cells . A small number of epimastigotes in meiosis i was identified by morphology (2k epimastigote with posterior nucleus and two short flagella; figure s1b); these had nuclear dna contents consistent with 4c or greater (mei, figure 4). Meiotic cells are often found attached inside the sg (figure 1b), explaining the small number of free meiotic cells observed . Pl cells frequently had a large, elongated anterior kinetoplast, which was highly conspicuous in dapi staining (figure 2), confirmed by measurement of kinetoplast dna (kdna) contents relative to the unit kinetoplast of metacyclics (figure 4b). Twice the unit amount of kdna usually indicates a kinetoplast about to divide, suggesting a simple hypothesis for the generation of 2k1n pl cells by kinetoplast division in 1k1n pl cells . However, this is contradicted by the fact that both 1k1n and 2k1n pl cells had enlarged kinetoplasts . Alternatively, 1k1n and 2k1n pl cells might arise by unequal division of a 3k1n cell, because both pl cell types were found in approximately equal numbers . Both 3k1n and 3k2n cells were observed (e.g., figure s2e). In summary, we have shown that meiosis is a normal part of the developmental cycle of t. brucei in the tsetse fly and have identified a novel haploid pl cell that displays the behavior expected of a gamete . When pl cells of different strains are mixed, they readily form pairs or clusters and undergo cytoplasmic fusion . We conclude that the haploid pl cells are trypanosome gametes, although formal proof will require the demonstration of exchange of nuclear and kinetoplast dna . Until now, the extent and significance of sex in kinetoplastid parasites have been controversial, but this study reveals that t. brucei is essentially a sexual organism . Hence, these results support the hypothesis that meiosis and sexual reproduction are ancestral and ubiquitous features of eukaryotes . The following tsetse - transmissible strains of trypanosoma brucei subspecies were used: t. b. brucei j10 (mcro / zm/73/j10 clone 1), 1738 (movs / ke/70/eatro 1738), lister 427 (movs / ug/60/427 variant 3); t. b. rhodesiense 058 (mhom / zm/74/058 clone b); t. b. gambiense group 1 dal972 (mhom / ci/86/dal972 clone 1); t. b. gambiense group 2 (mhom / ci/78/th2). The experimental cross of j10 and 1738 carrying cytoplasmically expressed genes for fluorescent proteins is described in and produced hybrid progeny f1g2 and f1r1 . Procyclic form (pf) trypanosomes were grown in cunningham s medium (cm) supplemented with 10% v / v heat - inactivated fetal calf serum, 5 g / ml hemin, and 10 g / ml gentamycin at 27c . Fusion constructs of the yfp gene with the homologs of meiosis - specific genes (dmc1, tb09.211.1210; hop1, tb10.70.1530; mnd1, tb11.02.3380) and pfr1 (tb927.3.4290) were described in . P166, a component of the tripartite attachment complex connecting the kinetoplast and basal body of the flagellum, was also tagged with yfp (accession number fj407182). Pfs were transfected by electroporation, antibiotic selected, and cloned as previously described . For analysis of expression of fusion proteins associated with meiosis, fly organs (sg and alimentary tract from the proventriculus to the hindgut) were dissected in a drop of pbs and examined for the presence of fluorescent trypanosomes using a dmrb microscope (leica) equipped with a retiga exi camera (qimaging) and volocity software (perkinelmer). Cells were fixed in 2% w / v paraformaldehyde (pfa) at room temperature for 20 min and stained with dapi in vectashield mounting medium (vector laboratories) to visualize the nucleus and kinetoplast . For analysis of mating between red and green fluorescent trypanosomes, medium containing spilled - out trypanosomes was introduced into a microslide capillary for live imaging as above, together with hoechst live stain if required . Alternatively, preparations were spread on microscope slides using a cytospin after fixation in 2% w / v pfa and were dapi stained and mounted as above.
There is increasing evidence that higher levels of high sensitivity c - reactive protein (hs - crp) is a marker of inflammation and a potential independent predictor of cardiovascular disease, as it may play a role in the development of atherosclerosis, adversely affecting mortality.1)2) rate of obesity is increasing globally where studies have shown association of body weight as assessed by body mass index (bmi) with clinical outcomes after percutaneous coronary intervention (pci) in acute myocardial infarction (ami) patients.3) previous reports have also indicated that hs - crp level is correlated with bmi and fat distribution.4)5) the mechanism for elevation of plasma hs - crp in obese subjects could be through a high production of cytokines, e.g., interleukin-1 (il-1), interleukin-6 (il-6) and tumor necrosis factor- (tnf-), by excess adipose tissue which could induce high hs - crp production in liver.4) curently there is no data available evaluating the relationship between higher baseline hs - crp levels, body mass index (bmi) status, and adverse outcomes in patients with ami undergoing pci . Therefore, in the present study we attempted to assess the association between baseline hs - crp level and 12-month clinical outcomes in patients with ami . This retrospective study was carried out at the heart center of chonnam national university hospital, korea . The permission to carry out the study had been sought from the hospital authorities (irb no.05 - 49) and informed consent obtained from the patients . Patient medical documents were used to obtain the demographic data, clinical characteristics and relevant laboratory results . Patients were enrolled in the registry after admission to participating hospitals with a suspected diagnosis of ami . The korea acute myocardial infarction registry (kamir) is a prospective, multicenter, observational registry designed to examine current epidemiology in hospital management and outcome of patients with ami in korea . The registry included 52 community and university hospitals capable of primary pci with one - year clinical follow up . Data was collected at each site by a well - trained study coordinator based on a standardized protocol.6 - 8) a total of 10974 consecutive patients with ami (both st - segment elevation mi and non - st - segment elevation mi) undergoing pci from november 2005 to september 2008 were assessed in this study . Patients with unknown bmi (n=395) and missing hs - crp (n=2405) data were excluded from this study; hence the total study population was 8174 patients . The aim was to evaluate the impact of baseline hs - crp on 12-month clinical outcomes according to bmi status . Then, according to bmi categories suggested by the world health organization for asian population, the total study population was divided into three groups that included 1) overweight / obese (bmi 23 kg / m, n=5647), 2) normal - weight (bmi 18.5 to 22.9 kg / m, n=2246) and 3) underweight (bmi <18.5 kg / m, n=281).9) each group was then stratified into quartiles based on their hs - crp levels . A final diagnosis of ami was made by the european society of cardiology / american college of cardiology (esc / acc) diagnostic criteria for ami.10) bmi was calculated as weight (kg) divided by height squared (m). Diabetes mellitus (dm) was defined as requiring the use of oral hypoglycaemic agent or insulin to lower blood glucose levels . Hypertension was defined as patient systolic blood pressure> 140 mm hg and/or diastolic blood pressure> 90 mm hg at rest, over a series of repeated measurements, or after treatment with anti - hypertensive medications . For diabetics and patients with chronic renal disease, hypertension was defined as systolic blood pressure 130 mm hg and/or diastolic blood pressure 80 mm hg . Hyperlipidemia was defined as patient total cholesterol level> 200 mg / dl or treatment with a lipid - lowering agent . Coronary artery disease (cad) was defined as patient having a history of myocardial infarction (mi) revascularization procedure, or obstructive cad . Blood samples were centrifuged and serum was removed and stored at a temperature of -700 until the assay for sugar and proteins was performed . Absolute creatine kinase - mb levels were determined by radioimmunoassay (dade behring, inc ., cardiac specific troponin i levels were measured using a paramagnetic particle, chemiluminescent immunoenzymatic assay (beckham, coulter, inc ., twelve - hour fasting serum levels of total cholesterol, triglyceride, and low and high density lipoprotein - cholesterol were measured by standard enzymatic methods . Blood sample for hs - crp was obtained on admission and was analyzed turbidimetrically with sheep antibodies against human crp; this has been validated against the dade behring method . Overweight / obese quartiles were: first quartile <0.2 mg / dl, n=1370, second quartile 0.2 to <0.82 mg / dl, n=1451, third quartile 0.82 to <4.08 mg / dl, n=1413 and fourth quartile 4.08 mg / dl, n=1413 . Normal - weight quartiles were: first quartile <0.2 mg / dl, n=548, second quartile 0.2 to <0.92 mg / dl, n=575, third quartile 0.92 to <5.23, n=563 mg / dl and fourth quartile 5.23 mg / dl, n=563 . Underweight quartiles were: first quartile <0.31 mg / dl, n=70, second quartile 0.31 to <1.54 mg / dl, n=70, third quartile 1.54 to <8.76 mg / dl, n=71 and fourth quartile 8.76 mg / dl, n=70 . Two - dimensional echocardiography was performed in all patients and left ventricular ejection fraction (lvef) was assessed using a modified simpson's biplane method . The morphology in coronary angiography was classified by criteria from the american college of cardiology / american heart association (acc / aha).11) the degree of coronary flow was classified by thrombolysis in myocardial infarction (timi) score . The presence of left main coronary artery stenosis was defined as a luminal stenosis 50% . Multivessel disease was defined as the presence of a lesion with> 50% diameter stenosis in a non - infarct related coronary artery . Successful pci was defined as timi flow 3 with residual stenosis 50% in the infarct related artery . In - hospital complications included atrio - ventricular block, bradycardia, ventricular tachycardia / ventricular fibrillation, atrial fibrillation, no reflow, dissection, cardiogenic shock, acute renal failure, metabolic acidosis / lactic acidosis . Major advense cardiac event (mace) were defined as all - cause death, recurrent mi, or repeat revascularization . The primary endpoint of this study was all - cause mortality at 12-month clinical follow up . All data were recorded on a standardized, electronic, web based registry at http://www.kamir.or.kr . Continuous variables were presented as the meansd; comparisons were conducted by one - way anova test . Discrete variables were presented as percentages and frequencies; comparisons were conducted by chi - square statistics . Cox regression analysis was performed to identify a model with independent predictive factors including determination of a hazard ratio and its 95% confidence interval (ci) for each variable in the model . Cox analysis was performed to identify variables that most affected the hazard ratio of hs - crp, with a cut off at p<0.20 for entry into the model . The korea acute myocardial infarction registry (kamir) is a prospective, multicenter, observational registry designed to examine current epidemiology in hospital management and outcome of patients with ami in korea . The registry included 52 community and university hospitals capable of primary pci with one - year clinical follow up . Data was collected at each site by a well - trained study coordinator based on a standardized protocol.6 - 8) a total of 10974 consecutive patients with ami (both st - segment elevation mi and non - st - segment elevation mi) undergoing pci from november 2005 to september 2008 were assessed in this study . Patients with unknown bmi (n=395) and missing hs - crp (n=2405) data were excluded from this study; hence the total study population was 8174 patients . The aim was to evaluate the impact of baseline hs - crp on 12-month clinical outcomes according to bmi status . Then, according to bmi categories suggested by the world health organization for asian population, the total study population was divided into three groups that included 1) overweight / obese (bmi 23 kg / m, n=5647), 2) normal - weight (bmi 18.5 to 22.9 kg / m, n=2246) and 3) underweight (bmi <18.5 kg / m, n=281).9) each group was then stratified into quartiles based on their hs - crp levels . A final diagnosis of ami was made by the european society of cardiology / american college of cardiology (esc / acc) diagnostic criteria for ami.10) bmi was calculated as weight (kg) divided by height squared (m). Diabetes mellitus (dm) was defined as requiring the use of oral hypoglycaemic agent or insulin to lower blood glucose levels . Hypertension was defined as patient systolic blood pressure> 140 mm hg and/or diastolic blood pressure> 90 mm hg at rest, over a series of repeated measurements, or after treatment with anti - hypertensive medications . For diabetics and patients with chronic renal disease, hypertension was defined as systolic blood pressure 130 mm hg and/or diastolic blood pressure 80 mm hg . Hyperlipidemia was defined as patient total cholesterol level> 200 mg / dl or treatment with a lipid - lowering agent . Coronary artery disease (cad) was defined as patient having a history of myocardial infarction (mi) revascularization procedure, or obstructive cad . Blood samples were centrifuged and serum was removed and stored at a temperature of -700 until the assay for sugar and proteins was performed . Absolute creatine kinase - mb levels were determined by radioimmunoassay (dade behring, inc ., cardiac specific troponin i levels were measured using a paramagnetic particle, chemiluminescent immunoenzymatic assay (beckham, coulter, inc ., twelve - hour fasting serum levels of total cholesterol, triglyceride, and low and high density lipoprotein - cholesterol were measured by standard enzymatic methods . Blood sample for hs - crp was obtained on admission and was analyzed turbidimetrically with sheep antibodies against human crp; this has been validated against the dade behring method . Overweight / obese quartiles were: first quartile <0.2 mg / dl, n=1370, second quartile 0.2 to <0.82 mg / dl, n=1451, third quartile 0.82 to <4.08 mg / dl, n=1413 and fourth quartile 4.08 mg / dl, n=1413 . Normal - weight quartiles were: first quartile <0.2 mg / dl, n=548, second quartile 0.2 to <0.92 mg / dl, n=575, third quartile 0.92 to <5.23, n=563 mg / dl and fourth quartile 5.23 mg / dl, n=563 . Underweight quartiles were: first quartile <0.31 mg / dl, n=70, second quartile 0.31 to <1.54 mg / dl, n=70, third quartile 1.54 to <8.76 mg / dl, n=71 and fourth quartile 8.76 mg / dl, n=70 . Two - dimensional echocardiography was performed in all patients and left ventricular ejection fraction (lvef) was assessed using a modified simpson's biplane method . The morphology in coronary angiography was classified by criteria from the american college of cardiology / american heart association (acc / aha).11) the degree of coronary flow was classified by thrombolysis in myocardial infarction (timi) score . The presence of left main coronary artery stenosis was defined as a luminal stenosis 50% . Multivessel disease was defined as the presence of a lesion with> 50% diameter stenosis in a non - infarct related coronary artery . Successful pci was defined as timi flow 3 with residual stenosis 50% in the infarct related artery . In - hospital complications included atrio - ventricular block, bradycardia, ventricular tachycardia / ventricular fibrillation, atrial fibrillation, no reflow, dissection, cardiogenic shock, acute renal failure, metabolic acidosis / lactic acidosis . Major advense cardiac event (mace) were defined as all - cause death, recurrent mi, or repeat revascularization . The primary endpoint of this study was all - cause mortality at 12-month clinical follow up . All data were recorded on a standardized, electronic, web based registry at http://www.kamir.or.kr . Spss 17.0 for windows (spss, inc ., chicago, il, usa) was used for all analyses . Continuous variables were presented as the meansd; comparisons were conducted by one - way anova test . Discrete variables were presented as percentages and frequencies; comparisons were conducted by chi - square statistics . Cox regression analysis was performed to identify a model with independent predictive factors including determination of a hazard ratio and its 95% confidence interval (ci) for each variable in the model . Cox analysis was performed to identify variables that most affected the hazard ratio of hs - crp, with a cut off at p<0.20 for entry into the model . A total of 8,174 ami patients, mean age=62.712.4 years and 76% male gender (n=6217), were stratified into quartiles based on their hs - crp level to study their 12-month clinical outcomes . Twelve - month all - cause death and 12-month composite of mace increased as the value of hs - crp increased from 1st to 4th quartile . Cox proportional hazard analysis showed 12-month mortality to be highest in patients of 4th quartile {hr=2.80 (1.335 - 5.873), p=0.006} followed by 3rd quartile {hr=2.495 (1.186 - 5.248), p=0.016}. It was statistically significant among hs - crp quartiles (p=0.045). Independent factors for 12-month mortality were age greater than 60 years, in - hospital complications, killip class> 1, use of statin, heart rate> 100 beats / min, n - terminal pro - b - type natriuretic peptide (nt - probnp)> 3000 pg / ml, left ventricular ejection fraction (lvef) <55% and creatinine clearance <60 min / ml (data not provided). As the 12-month mortality was statistically borderline significant among hs - crp quartiles in the total study population, we sought to further evaluate this finding by dividing the total study population into three groups based on their bmi . Overweight and obese patients were grouped together as there was no baseline significant difference in their 12-month all - cause mortality (p=0.076, data not provided). Baseline clinical characteristics and laboratory findings of this group are presented in table 1 and 2 respectively . Overweight / obese patients with higher hs - crp (i.e., 2nd, 3rd and 4th quartiles) were older, more often female, had higher killip classes, heart rate and nt - probnp; and had lower blood pressure, lvef and creatinine clearance . They were associated with higher incidence of dm, hypertension, cad, heart failure and cerebrovascular disease . As per past regular medication history, 7.15% of the patients at the time of admission were on statin (n=404). Multivessel involvement, acc / aha lesion type c, and pre - pci timi flow grade 0 were observed to increase with an increase in hs - crp . Pci success rate decreased and in - hospital complication rate increased with increasing hs - crp . Table 4 shows the clinical outcomes during the 12-month follow - up . In - hospital death, composite mace at 1 month and 12 months, and mortality at 1 month and 12 months were more frequent with increasing hs - crp levels . Twelve - month mortality increased as the value of hs - crp increased; 2.0% (n=27) in 1st, 2.5% (n=37) in 2nd, 4.4% (n=62) in 3rd and highest 6.6% (n=94) in the 4th quartile . Cox proportional hazard model was implemented to identify the independent predictors of mortality at the 12-month clinical follow - up . Serum hs - crp quartiles showed significant association with 12-month mortality when adjusted for age and gender (p<0.001). With quartile 1 as a reference, the risk of 12-month mortality was higher in the 3rd quartile {2.153 (1.369 - 3.384), p=0.001} and 4th quartile {3.268 (2.129 - 5.016), p<0.001}. After adjustment with multiple covariates, 12-month mortality was highest in patients within the 4th quartile compared to other patients {hazard ratio (hr) 2.382 (1.079 - 5.259), p=0.032} though statistical significance was not achieved (p=0.172). Independent factors for 12-month mortality were old age (> 60 years), heart rate> 100 beats / min, lvef <55%, creatinine clearance <60 min / ml and in - hospital complications . The variables included in cox model were age, male gender, heart rate, systolic blood pressure, smoking history, history of hypertension, diabetes mellitus, coronary artery disease, cerebrovascular disease and heart failure, lvef, killip classes> 1, glucose, total cholesterol, triglyceride, creatinine clearance, nt - probnp, left main and multivessel involvement, pre - timi flow grade 0, post - timi flow grade 3, acc / aha lesion type c, pci success rate, in - hospital complications and use of statin . Patients were also stratified into quartiles based on hs - crp level to evaluate their 12-month clinical outcomes . Patients with higher hs - crp were found to be older (p<0.001), with increased heart rate (p=0.015) and higher killip classes (p=0.002). They had more association with diabetes mellitus (p=0.019), hypertension (p=0.049), heart failure (p=0.001) and peripheral vascular disease (p=0.001). Creatinine clearance, lvef and high - density lipoprotein cholesterol decreased with higher hs - crp (p<0.001, p<0.001 and p=0.001 respectively). Total cholesterol, triglyceride and low density lipoproteincholesterol (ldl - c) were also significant among quartiles (p<0.001, p=0.001 and p=0.001 respectively). They were more associated with acc / aha lesion type c, multivessel involvement, pre - timi flow grade 0 and in - hospital complications . Twelve - month composite of mace (p=0.009) and all - cause death (p<0.001) increased as the value of hs - crp increased from 1st to 4th quartile . Cox proportional hazard model showed 12-month mortality to be statistically insignificant among hs - crp quartiles in this group (p=0.681). The variables included in the model were age, dm, hypertension, hyperlipidemia, heart failure, peripheral vascular disease, smoking history, clinical presentation st - elevation mi, total cholesterol, triglyceride, creatinine clearance, nt - probnp, systolic blood pressure, heart rate, in - hospital complications, killip class> 1, lvef <55%, pre - procedure timi grade 0 flow, acc / aha lesion type c, multivessel involvement, and use of statin . Patients from this study were additionally divided into quartiles based on hs - crp level to study their 12-month clinical outcomes . The variables included in the model were age, systolic blood pressure, lvef <55%, glucose, total cholesterol, ldl - c, creatinine clearance, nt - probnp, smoking history, heart failure, post - procedure timi grade 3, pci success rate, and in - hospital complications . Age, nt - probnp, killip class> 1 and in - hospital complications increased with increasing levels of hs - crp (p=0.006, p<0.001, p=0.009 and p=0.032 respectively), while creatinine clearance decreased with rising level of hs - crp (p=0.001). Systolic blood pressure, lvef, total cholesterol and post - timi flow grade iii were statistically significant among the quartiles (p=0.043, p=0.023, p=0.038 and p=0.002 respectively). Twelve - month composite of mace increased as the value of hs - crp increased from 1st to 4th quartile, but it was statistically insignificant (p=0.382), and twelve - month all - cause death showed no association among quartiles (p=0.079). Cox proportional hazard model showed 12-month mortality to be statistically insignificant among hs - crp quartiles in this group as well (p=0.760). 1 shows adjusted survival curves of 12-month mortality in hs - crp quartiles in (a) total study population, (b) overweight / obese group, (c) normal - weight group and (d) underweight group . Baseline clinical characteristics and laboratory findings of this group are presented in table 1 and 2 respectively . Overweight / obese patients with higher hs - crp (i.e., 2nd, 3rd and 4th quartiles) were older, more often female, had higher killip classes, heart rate and nt - probnp; and had lower blood pressure, lvef and creatinine clearance . They were associated with higher incidence of dm, hypertension, cad, heart failure and cerebrovascular disease . As per past regular medication history, 7.15% of the patients at the time of admission were on statin (n=404). Multivessel involvement, acc / aha lesion type c, and pre - pci timi flow grade 0 were observed to increase with an increase in hs - crp . Pci success rate decreased and in - hospital complication rate increased with increasing hs - crp . Table 4 shows the clinical outcomes during the 12-month follow - up . In - hospital death, composite mace at 1 month and 12 months, and mortality at 1 month and 12 months were more frequent with increasing hs - crp levels . Twelve - month mortality increased as the value of hs - crp increased; 2.0% (n=27) in 1st, 2.5% (n=37) in 2nd, 4.4% (n=62) in 3rd and highest 6.6% (n=94) in the 4th quartile . Cox proportional hazard model was implemented to identify the independent predictors of mortality at the 12-month clinical follow - up . Serum hs - crp quartiles showed significant association with 12-month mortality when adjusted for age and gender (p<0.001). With quartile 1 as a reference, the risk of 12-month mortality was higher in the 3rd quartile {2.153 (1.369 - 3.384), p=0.001} and 4th quartile {3.268 (2.129 - 5.016), p<0.001}. After adjustment with multiple covariates, 12-month mortality was highest in patients within the 4th quartile compared to other patients {hazard ratio (hr) 2.382 (1.079 - 5.259), p=0.032} though statistical significance was not achieved (p=0.172). Independent factors for 12-month mortality were old age (> 60 years), heart rate> 100 beats / min, lvef <55%, creatinine clearance <60 min / ml and in - hospital complications . The variables included in cox model were age, male gender, heart rate, systolic blood pressure, smoking history, history of hypertension, diabetes mellitus, coronary artery disease, cerebrovascular disease and heart failure, lvef, killip classes> 1, glucose, total cholesterol, triglyceride, creatinine clearance, nt - probnp, left main and multivessel involvement, pre - timi flow grade 0, post - timi flow grade 3, acc / aha lesion type c, pci success rate, in - hospital complications and use of statin . Patients were also stratified into quartiles based on hs - crp level to evaluate their 12-month clinical outcomes . Patients with higher hs - crp were found to be older (p<0.001), with increased heart rate (p=0.015) and higher killip classes (p=0.002). They had more association with diabetes mellitus (p=0.019), hypertension (p=0.049), heart failure (p=0.001) and peripheral vascular disease (p=0.001). Creatinine clearance, lvef and high - density lipoprotein cholesterol decreased with higher hs - crp (p<0.001, p<0.001 and p=0.001 respectively). Total cholesterol, triglyceride and low density lipoproteincholesterol (ldl - c) were also significant among quartiles (p<0.001, p=0.001 and p=0.001 respectively). They were more associated with acc / aha lesion type c, multivessel involvement, pre - timi flow grade 0 and in - hospital complications . Twelve - month composite of mace (p=0.009) and all - cause death (p<0.001) increased as the value of hs - crp increased from 1st to 4th quartile . Cox proportional hazard model showed 12-month mortality to be statistically insignificant among hs - crp quartiles in this group (p=0.681). The variables included in the model were age, dm, hypertension, hyperlipidemia, heart failure, peripheral vascular disease, smoking history, clinical presentation st - elevation mi, total cholesterol, triglyceride, creatinine clearance, nt - probnp, systolic blood pressure, heart rate, in - hospital complications, killip class> 1, lvef <55%, pre - procedure timi grade 0 flow, acc / aha lesion type c, multivessel involvement, and use of statin . Patients from this study were additionally divided into quartiles based on hs - crp level to study their 12-month clinical outcomes . The variables included in the model were age, systolic blood pressure, lvef <55%, glucose, total cholesterol, ldl - c, creatinine clearance, nt - probnp, smoking history, heart failure, post - procedure timi grade 3, pci success rate, and in - hospital complications . Age, nt - probnp, killip class> 1 and in - hospital complications increased with increasing levels of hs - crp (p=0.006, p<0.001, p=0.009 and p=0.032 respectively), while creatinine clearance decreased with rising level of hs - crp (p=0.001). Systolic blood pressure, lvef, total cholesterol and post - timi flow grade iii were statistically significant among the quartiles (p=0.043, p=0.023, p=0.038 and p=0.002 respectively). Twelve - month composite of mace increased as the value of hs - crp increased from 1st to 4th quartile, but it was statistically insignificant (p=0.382), and twelve - month all - cause death showed no association among quartiles (p=0.079). Cox proportional hazard model showed 12-month mortality to be statistically insignificant among hs - crp quartiles in this group as well (p=0.760). 1 shows adjusted survival curves of 12-month mortality in hs - crp quartiles in (a) total study population, (b) overweight / obese group, (c) normal - weight group and (d) underweight group . This study demonstrated that higher baseline hs - crp level (4.08 mg / dl) in overweight / obese ami patients showed significant association with 12-month all - cause mortality independent of other prognostic markers . Over the past few years, it has become increasingly clear that inflammation plays a pivotal role in cardiovascular disease, and increased circulating inflammation markers may be predictive of cardiovascular events.12)13) among the inflammation markers available, hs - crp is one of the independent predictors of cardiovascular events.14)15) adiposity is an inflammatory condition and il-6, tnf- and hs - crp levels are positively correlated with adipocyte size.4)15)16) these cytokines induce insulin resistance in adipose cells by inhibiting insulin signaling.17)18) crp along with il-6 and other cytokines / adipokines could be deleterious on the arterial wall since it has been found to directly promote endothelial cell inflammation and atherosclerotic processes.19)20) thus, the link between adiposity, plaque accumulation / progression / rupture and atherothrombotic events, especially ami, might be explained by higher levels of systemic inflammation and their chronic effect on coronary atherosclerosis over time . Marsik et al.2) report that patients with crp concentrations> 5 mg / l at the time of hospital admission had a 50% to 330% increase in risk of death from any cause . This increase in risk was present in both short - term and long - term follow - ups, and rose in magnitude as concentrations of crp increased to> another study by koenig et al.1) deals with the issue of hs - crp as a predictor of death in the monitoring of trends and determinants in cardiovascular disease . After adjustment for age, smoking, hypertension, hyperlipidemia, diabetes, obesity and socioeconomic markers, those with baseline hs - crp concentrations> 3 mg / l had a 2-fold increase in risk of total mortality . Some studies have shown that higher bmi is associated with higher crp concentrations even among young adults 17 to 39 years of age . These findings suggest a state of low - grade systemic inflammation in obese patients.21) as previously reported by sutter et al.22) it is known that increased levels of hs - crp are greatly associated with extensive tissue destruction or infarct size . In such situations with more severe inflammation and extensive tissue damage, the relationship between adverse outcomes and crp level might be considered independent from bmi status . The present study shows that hs - crp concentrations in the obese rise with increasing age, diabetes mellitus, hypertension, coronary artery disease, heart failure and cerebrovascular disease reaffirming data from earlier studies.23 - 25) a prospective study by bruci et al.26) on 329 patients with myocardial infarction at the time of admission showed crp to be associated with a strong, positive graded increase in the risk of heart failure and death independently of known risk indicators . Ninety - four patients (29%) were in killip class greater than 1 at presentation, and greater killip class was associated with increased crp . Interestingly, a study in cairo by fareed et al . Noted that patients with hs - crp -17 mg / l were prone to heart failure (at this value sensitivity=88%, specificity=51.2%). Our findings are in agreement with a recently published report that showed a trend to decreasing values of lvef in relation to higher crp levels.27) the significant relationship between crp and lvef suggests the implication of inflammatory mechanisms in left ventricular dysfunction and in the pathogenesis of congestive heart failure, independently of the underlying atherosclerotic burden . Angiographic findings of multivessel involvement, frequency of acc / aha lesion type c and subsequently higher pre - timi grade 0 flow, lower procedure success rate and higher complications support the previous study findings on acute coronary syndrome that demonstrated multiple complex stenoses with high plaque burden suggesting a pan - coronary involvement.28) this study showed a negative relation of smoking with hs - crp in the overweight / obese subset . The mechanism whereby smoking is related to crp concentration is unclear, but it may be multi - factorial, involving bronchial injury, endothelial activation and systemic inflammation.29) use of a statin is a negative predictor of 12-month mortality in total study population . However, there was no significant association of statin use and hs - crp levels in higher bmi patients though earlier studies have shown that statin reduces hs - crp levels.30)31) this could be due to relatively small number of patients on a statin at the time of admission (7.15%) or unavailability of follow - up hs - crp data in our registry . Moreover, in anglo - scandinavian cardiac outcomes trial: lipid lowering arm trial neither baseline nor on - treatment crp provided useful information about the efficacy of statin treatment to reduce cardiovascular events beyond ldl - c reduction.32) this study should be interpreted in the light of the following limitations . This is not a randomized trial, but a retrospective evaluation on a large - scale multi - center registry . Blood samples for hs - crp were obtained at the time of admission, hence higher levels of hs - crp in our study may not be associated with myocardial necrosis.33) the time of onset and size of the myocardial infarction may also increase the hs - crp levels . However, we did not determine the serial changes in hs - crp concentration after ami . Other inflammatory markers, such as il-6, tnf- or lipoprotein - associated phospholipase a2 (lp - pla2) that could have added more robust evidence of other inflammatory pathways associated with poor outcome were not a part of this study . Extreme variations in hs - crp levels that could have made a difference in standard deviation in each group have not been excluded from this study . Higher baseline hs - crp level (4.08 mg / dl) in overweight / obese ami patients showed significant association with 12-month all - cause mortality independent of other prognostic markers . We suggest further long term evaluation with serial changes in hs - crp concentration after ami and other inflammation markers to clearly elucidate its role in more diverse population . This is not a randomized trial, but a retrospective evaluation on a large - scale multi - center registry . Blood samples for hs - crp were obtained at the time of admission, hence higher levels of hs - crp in our study may not be associated with myocardial necrosis.33) the time of onset and size of the myocardial infarction may also increase the hs - crp levels . However, we did not determine the serial changes in hs - crp concentration after ami . Other inflammatory markers, such as il-6, tnf- or lipoprotein - associated phospholipase a2 (lp - pla2) that could have added more robust evidence of other inflammatory pathways associated with poor outcome were not a part of this study . Extreme variations in hs - crp levels that could have made a difference in standard deviation in each group have not been excluded from this study . Higher baseline hs - crp level (4.08 mg / dl) in overweight / obese ami patients showed significant association with 12-month all - cause mortality independent of other prognostic markers . We suggest further long term evaluation with serial changes in hs - crp concentration after ami and other inflammation markers to clearly elucidate its role in more diverse population.
Recurrence has been attributed to neovascularization in the granulation tissue around stump of great or short saphenous veins or to the development of incompetence in pre - existing collateral, which had not been adequately ligated by the previous surgeon . Attention to technical details will decrease the regrettably high rate of recurrence after sapheno - femoral disconnection and render safer exploration . Early postsurgical recurrence results from an incomplete operation, late recurrence after correct surgery is due to deterioration of the remaining superficial venous system or in case of inappropriate surgery . The ultrasonic marker of recurrent lower limb varicose veins was the re - emergence of dilated saphenous and perforating veins, as well as valve apparatus failure in the operated leg . Ultrasound study is the most rational method for screening diagnosis in case of abnormal veins of the lower extremities in the postoperative period . The aim of this study was to identify the possible causes and patterns of recurrent varicose veins lower limbs in patients with history of varicose veins surgery . Written consents were obtained from all patients before the study . The steps of the study; the aims and the potential benefits were discussed with each individual patient . The patient had the right for withdrawal from the study at any time with neither jeopardizing his right to be treated nor affecting the relationship between the patient and the care provider . Our descriptive prospective study was carried out on ninety two patients over 36 months from december 2006 to november 2009 with history of previous varicose veins surgery at the outpatient clinic to assess the possible causes of recurrent varicose veins after surgery and different patterns of recurrence . All patients of both sexes regardless to age with recurrent varicose veins with history of previous varicose veins surgery at the same limb were included . Full detailed history, examination and duplex ultra sound was made over the superficial and deep venous system of patients of this study . Sample was taken as all patients with recurrent varicose veins after previous varicose veins surgery in outpatient clinic . Data entry and analysis were accomplished using windows operating system and the based statistics program (spss 10.0) adopting in the outcome the following statistical tests: continuous variables are expressed as means.discrete variables are expressed as frequencies and percentagesdifferences were considered statistically significant if probability (p value 0.05), it was calculated using epi - info statistical package 11.0 programs . Discrete variables are expressed as frequencies and percentages differences were considered statistically significant if probability (p value 0.05), it was calculated using epi - info statistical package 11.0 programs . Presentation of the statistical outcome in form of tabulation and graphs were accomplished by windows - based microsoft excel . Data entry and analysis were accomplished using windows operating system and the based statistics program (spss 10.0) adopting in the outcome the following statistical tests: continuous variables are expressed as means.discrete variables are expressed as frequencies and percentagesdifferences were considered statistically significant if probability (p value 0.05), it was calculated using epi - info statistical package 11.0 programs . Discrete variables are expressed as frequencies and percentages differences were considered statistically significant if probability (p value 0.05), it was calculated using epi - info statistical package 11.0 programs . Presentation of the statistical outcome in form of tabulation and graphs were accomplished by windows - based microsoft excel . Sixty patients out of 92 patients were females (65.2%) and 32 patients were males (34.8%) and their age distribution was shown in [table 1]. Thirty patients (32.6%) had recurrence after saphenofemoral disconnection (trendelnberg operation), 22 patients (23.9%) had recurrence after saphenofemoral disconnection, with stripping below knee (truly below knee), 28 patients (30.4%) had recurrence after saphenofemoral disconnection with stripping above knee and 12 patients (13.1%) had recurrence after sapheno - popliteal disconnection with stripping . Age distribution in the study group regarding the pattern of recurrence, 14 patients (15.2%) had double long saphenous, 2 patients (2.1%) had double short saphenous, 24 patients (26%) had recurrence due to neovascularization, 34 patients (36.9%) had deep venous thrombosis before and after surgery and 18 patients (19.8%) have incompetent surgery through the wrong site of incision or the performance of non specialized surgeon in the field [table 2]. Recurrence was classified regarding the patients jobs as 28 patients (30.4%) housewives, 32 patients (34.8%) teachers, 20 patients (9.3%) workers, 4 patients (4.3%) officers and 8 patients (8.7%) employees . The authors studied the relationship between the operations performed and the post - operative recurrence for 2 years, 2 - 5 years, 6 - 10 years and more 10 years and the detailed description was noted in [table 4]. The distribution of the patients of the study group regarding the possible causes of recurrence the different patterns of recurrence the relationship between the operations performed for the patients of the study before recurrence and the postoperative recurrence duration regarding the duplex findings in our study, there are 24 patients (26.1%) with incompetent perforators in the thighs, 14 patients (15.2%) with incompetent perforators in the legs, 30 patients (32.6%) with incompetent perforators in both thigh and leg, and 24 patients (26.1%) without incompetent perforators . Nonspecialized surgeons operations came with 58 patients (63.5%) recurred whereas those of specialized ones brought about a recurrence of 34 patients (36.5%). There are few epidemiological data specifically relating to recurrent varicose veins and the published retrospective studies are not easy to compare because of differences in the definition of recurrence, differences in the initial treatment, the classification of recurrences and the method and duration of follow - up . Previous studies reported the highest frequency of recurrence was in the age between 40 and 49 and the least age of recurrence was 20 - 29 years . Our data came in agreement with these studies but with slight increase of age (50 - 56 years) in the highest frequency of recurrence . This slight increase may be due to the fact that more than 34% of our patients were above 50 years old . Causes of recurrence are multiple, as there are many anatomical variations as double short saphenous, double long saphenous, neovascularization or deep venous thrombosis preoperative . Many investigators published their studies about the cause of recurrence with nearly comparable incidence, but incomplete surgery still an important cause in all studies. [911] the recurrence is an avoidable complication of a imperfect primary surgery . Our data came in agreement with these studies[911] regarding neovascularization and incomplete surgery as both showed the highest points of recurrence in our series . An important recent study reported that recurrence after primary varicose vein surgery is associated with inadequate primary surgery or progression of disease, and neovascularization alone is not a cause of recurrent varicose veins . The associations between occupational characteristics, gender differences and symptoms of varicose veins contribute to knowledge of gender - specific occupational risk factors in such patients . Prolonged standing is one of the main factors which can precipitate varicose veins and it is also one of the main factors of recurrence due to increase venous pressure especially in diseased venous valves . More than 65% of our patients were house wives and teachers that came in concordance with other studies . Regarding the anatomical site our study, like others showed the least recurrence was inguinal pattern (4.3%), and the highest was in the legs and 22 patients (42.3%). The relation between the type of operation and the duration between the surgery and recurrence is very important by which we can reach to the method which can avoid or decrease the higher incidence of recurrence . The saphenofemoral disconnection without stripping showed a higher recurrence rate up to 20% with short (within 2 years) or 66.6% with long (from 6 - 10 years) follow up period when compared with saphenofemoral disconnection and below knee stripping whose recurrence rate was 0% and 9.1% respectively . The presence of incompetent perforators is also one of the risk factors of recurrence especially if not ligated during the 1 surgery as it may be responsible for dilatation and incompetence of the superficial venous system . In our study, only 26.1% of patients had nt incompetent perforators while other studies showed only 18.3% and 21% had not incompetent perforators . It was stated that varicose veins recurred despite technically correct surgery confirmed on post - operative duplex ultrasonography . The likelihood of recurrence increased in the presence of ssv reflux, perforating vein incompetence and post - thrombotic deep vein incompetence . The specialty of the surgeon is may play a role in recurrence as there are many errors occurred during the surgical procedure as the site of incision must be at the crease to avoid excess fat, which can lead to miss branches of the saphenofemoral or saphenopopliteal junction and lead to incompetent surgery . In literatures, nearly, all of these studies reported the same incidence of recurrence in case of non - specialized surgeons 59.2% to 70% . In our study 58 patients (63.5%) were operated by general surgeons, while 34 patients (36.5%) were operated with vascular surgeons . Duplex scanning can provide the necessary anatomical and functional information about the nature of recurrence and has become the investigation of choice in patients with recurrent varicose veins, also inadequate preoperative assessment in presence of deep venous thrombosis is one of the most common cause of recurrence, in addition to this, incompetent surgery of the wrong site of incision containing excess fat lead to incomplete ligation of all tributaries of the superficial system . Also the preoperative duplex ultrasound assessment is important which may lead to true diagnosis or false one as assessment of incompetent valves at the saphenofemoral and saphenopopliteal junctions and the perforators and also the patency of the deep venous system and absence of thrombosis . It was concluded that recurrent varicose veins after surgery is a common problem which has different causes as anatomical variation between person and other which is need good assessment by clinical and radiological procedure as duplex ultrasound, and also there is another cause of recurrence as neovasculerization also inadequate assessment preoperative as presence of deep venous thrombosis is one of the most common cause of recurrence and also incompetent surgery as wrong site of incision which may be away from the inguinal crease which contain excess fat lead to incomplete ligation of all branches of the superficial system.
On the somewhat nominal date of 31 october 2011, the world human population was deemed to have reached 7 billion (7 10), prompting speculation as to whether everyone on the planet can be adequately fed . That currently a poor job of it is being made is not in dispute: the number of people estimated to be undernourished in 2010 was close to 1 billion (fao, 2011a). The most obvious signs of undernutrition are mortality, morbidity, stunting, underweight and wasting . Less immediately apparent are the effects on immune function, cognitive ability and work productivity, with profound effects at individual, family and societal levels (underwood, 2000; caulfield et al ., 2006; it is estimated that maternal and child undernutrition accounts for 11% of total global disability - adjusted life years (daly; a measure of overall disease burden, expressed as the numbers of years lost due to ill - health, disability or early death), with dire consequences for development (black et al ., 2008)., it is anticipated that the global population will rise to 9 billion (un department of economic and social affairs, population division, 2011). Satisfying the food and nutrition needs of the growing population, let alone its demands, is likely to require a profound change in what and how much is eaten, and where and how food is produced . Failure to do so could profoundly affect the biosphere in ways that further erode the life - support system through biodiversity loss, changes in ecosystem services supply and exacerbated global warming (battisti & naylor, 2009; foley et al ., 2011; phalan et al ., 2011; royal society, 2012). In 2009, c. 95 10 t of fishes were consumed by humans (fao, 2012b; fao fishstat, 2012). More than 1 billion poor people obtain most of their average per capita intake of animal protein from fish (tacon & metian, 2009). Fao data for 2009 (updated with data from tacon & metian, 2009) show that africa has the lowest average per capita supply of total energy (10 711 kj day), protein (666 g day), non - fish animal protein (151 g day) and fish protein (92 kg year) of any region (fao faostat, 2013). Nevertheless, fish contributed 9% of total animal energy intake here, the highest of any region, and 18% of total animal protein consumption (second only to asia at 19%). Global wild fish catches have for some time been at or near the limits of what aquatic ecosystems can be expected to naturally provide (fao, 2012a; unhrc, 2012). Meeting the world's demand for fish has thus depended on the spectacular growth of aquaculture . In 2011, c. 41% of fish consumed came from farming (fao, 2012b; fao fishstat, 2012). A growing body of research studies shows the importance of fish in the supply of not only protein but also more importantly of essential fatty acids and micronutrients (kawarazuka & bn, 2011). The importance of fish as a rich source of essential fats, crucial for brain development and cognition, is highlighted in the implementation of the scaling up nutrition framework and roadmap [a private and public sector and civil society partnership that seeks to better understand the crisis of undernutrition in early life (first 1000 days) and elevate nutrition on the global agenda; http://www.scalingupnutrition.org]. Discussion of the rise of aquaculture has largely focused on its contribution to global aquatic animal food supplies, largely ignoring the resultant changes in species composition of the fishes consumed or how it is farmed and the consequences for food and nutrition security (kawarazuka & bn, 2010; unhrc, 2012). This paper sets out to redress the situation and considers the technological and policy innovations needed to ensure that fish cultivation fulfils its potential to meet the global population's food and nutrition needs . This paper focuses on fishes that account for two - thirds of gross global aquatic animal source food supplies, and make particular reference to africa and asia . Fish is an excellent source of high quality animal protein and essential fatty acids, especially long - chain polyunsaturated fatty acids (lcpufa) and micronutrients, which are much greater in fishes than in terrestrial animal - source foods (table 1). Drawing on such evidence, a recent fao who expert consultation group concluded that among the general population, fish consumption is beneficial for individual growth and development, while consumption of certain amount of fish (fatty fishes in particular) is associated with reduced risk of coronary heart disease and stroke (fao who, 2011). People are generally encouraged to increase consumption of fatty fishes two to three - fold in order to obtain sufficient quantities of lcpufas (surette, 2008; jenkins et al . There is no convincing evidence, however, for increased risk of heart disease linked with methylmercury while the potential cancer risks from dioxins are concluded to be well below coronary heart disease benefits associated with fish consumption (fao who, 2011). Nutrient content of selected fishes and other foods (modified from kawarazuka & bn, 2011). Where no figure is given, no analysis was carried out pufa, polyunsaturated fatty acid; epa, eicosapentaenoic acid; dha, docosahexaenoic acid . The benefits of fish consumption for vulnerable groups are also increasingly recognized and there is a growing interest in its potential to better contribute to food and nutrition security objectives through supplemental feeding and other food - based strategies (roos et al ., 2002, 2007c; gibson et al ., 2003). A controlled study in malawi, for example, showed that individuals fed intervention diets containing significantly more soft - boned fishes had lower incidences of anaemia and common infections than those in the control group (gibson et al ., 2003). Recognizing that eating fish is beneficial and encouraging people to do so are clearly insufficient to overcome undernutrition; issues of food availability, food access and food utilization these imperatives are codified in the definition of food security adopted by the world food summit in 1996, which states that food security exists when all people, at all times, have physical and economic access to sufficient, safe and nutritious food to meet their dietary needs and food preferences for an active and healthy life. The term food and nutrition security incorporates the other pillars of good nutrition: care, health, hygiene water and sanitation (klennert, 2009). A conceptual model showing how nutritional status is determined by these various causal factors is presented in fig . Individual nutritional status can be seen as an immediate outcome of nutrient intake, care and health . Nutrient intake is, in turn, governed by use and utilization, the former being dependent upon the food that is purchased by and shared within households, while the latter refers to the body's ability to utilize the nutrients consumed . The underlying causes of health status are in part not only environmental, determined by factors such as air quality, but also related to health care, housing, sanitation and access to clean water, sometimes worsened by inadequate nutrition, which predisposes individuals to disease . Availability and access to food and nutrients, however, change over time and adequacy of dietary intake is affected by critical life stages such as pregnancy, lactation and early childhood . Determinants of nutritional status (modified from unicef, 1991; kawarazuka & bn, 2010). For a comprehensive analysis of food and nutrition security, all of the contributory factors shown in fig ., however, it is its potential as a driver of change in availability (abundance), access and the nutritional quality of fish being produced that warrants particular attention . The availability of food - fish is a function of production and trade, less that used for non - food purposes . The term food - fish is applied here exclusively to fish and does not include shellfish, as is usually the case, used directly for human consumption . Unless otherwise stated, fao data for 2009 (fao faostat, 2013) is used as the most recent set of figures that allows calculation of regional per capita food - fish supplies (excluding molluscs and crustaceans) in which fish imports and exports can also be taken into account . Global fish supplies continue to expand, primarily as a result of the sustained, rapid growth in aquaculture production . Supplies of food - fish from capture and farming increased by c. 62%, from 86 to 139 kg year, between 1961 and 2009 (fig . Increases during the 1960s1980s were largely due to increased capture fisheries landings while those since are largely attributable to aquaculture . Per capita aquatic food (, total fish and aquatic resources;, total fish) and fishes by species group (, freshwater and diadromous fishes;, demersal fishes;, pelagic fishes;, marine fishes) by decade (19612001) and by year (20022009). The statistics, however, mask enormous inter - regional differences in production and trade (table 2). Asia, including china, accounts for c. 90% of global aquaculture production while production in least developed countries is <1% (fao, 2012a). Seafood is the most highly traded food commodity internationally and exports of seafood from developing countries exceed the total value of coffee, cocoa, tea, tobacco, meat and rice combined (smith et al ., 2010; trade increased in value by an average of nearly 11% per annum between 1976 and 2009 (fao, 2012b). The effect of trade on food - fish availability at regional level can be assessed from the fao food - fish balance statistics that account for production plus imports, minus fish used for non - food uses (e.g. Fishmeal) and exports (fao fishstat, 2012). The data for 2009 show that regional per capita food - fish supplies are greatest in oceania (189 kg year), followed by europe (174 kg year) and asia (150 kg year), with africa (92 kg year) trailing last (table 2). High food - fish availability in north america and europe is in part sustained by net imports from asian countries such as china and vietnam, accounting for> 20 and 26% of supplies in north america and europe, respectively (fao fishstat, 2012). Low production costs and relatively high international prices, combined with liberal trade policies, have increased exports of farmed white - fleshed fishes such as tilapia oreochromis spp . And catfishes pangasius spp ., substituting for dwindling supplies from domestic white - fish fisheries (norman - lpez & bjorndal, 2009; beveridge et al ., 2010; little et al . Even africa is a net food - fish importer, imports of mainly cheap, oily pelagic fishes increasing net food - fish availability by 14% . Total and per capita food - fish supplies by region and economic grouping, 2009 (from fao, 2011b; fao fishstat, 2012) data for central and south america and caribbean combined . While trade data do not indicate whether the fish is of farmed origin, with key commodities such as oreochromis spp . And pangasius spp . Allison (2011) found that effects of fish trade on poverty and food and nutrition security ranged from large and positive to negative and small . With the exception of tuna (thunnini), increases in both per capita food - fish supplies and the value of trade only occurred when there was strong growth in aquaculture (e.g. In bangladesh, indonesia and vietnam). Increases in aquaculture enhance food - fish availability in countries where sector growth is strong . Although annual per capita food - fish availability in low - income food - deficit countries (lifdcs) grew from 45 kg in 1961 to 105 kg in 2009, it remains comparatively low (fao, 2011b; fao fishstat 2012) (table 2). Moreover, in africa, where fish constitutes a particularly large proportion of animal - source foods, per capita food availability of fish has increased little over the past 20 years, in large measure due to the limited growth of aquaculture . It is not just the availability of food - fish per se that is of concern, however, rather the nutrients that fish provide . Qualitatively, fish supplies have changed markedly over the past 50 years . In 1961, 32% of food fishes were of demersal origin, 26% were pelagic, 16% were fresh water and diadromous and 12% comprised other (i.e. Non - demersal and pelagic) marine fishes (fig . The availability of demersal and other marine fishes had fallen in both absolute and relative terms, that of pelagic fishes had increased in terms of biomass but had fallen as a proportion of total food - fish supplies, while that of freshwater and diadromous fishes had increased by c. 250% . Annual per capita freshwater and diadromous food - fish supplies in 2009 were 61 kg, equivalent to one - third of supplies (fig . The changes largely result from stagnation in capture fisheries production and the large rise in carps (cypriniformes), oreochromis spp . And salmonid aquaculture . The species being farmed while changes in the fishes eaten are likely to have some effect on protein and energy supplies, they may have an even greater effect on the availability of dietary lipids (see table 1). Demersal white fishes (gadoids) typically have low levels (<2%) of fat . Pelagic herring, anchovies and sardines (clupeids), as well as salmonids, mackerels (scombrids) and eel (anguilla spp . ), are oily fishes (> 2% oil content), with levels in mackerel scomber scombrus l. 1758 seasonally exceeding 20% (wallace, 1991). While species is a major determinant of farmed fish nutrient content, nutrient composition is also influenced by how the animal is farmed . Farm environmental conditions, especially water temperature, quantitatively and qualitatively influence lipid deposition (haard, 1992). While the majority of farmed fishes are freshwater omnivores and herbivores, there has nonetheless been a trend towards intensification of production methods, involving increasing reliance on nutritionally complete feeds (tacon & metian, 2008). Traditional pond - based fish farming methods use inorganic and organic fertilizers to stimulate autotrophic and heterotrophic production (hepher, 1988). Production is further enhanced by the administration of small quantities of supplemental feeds, generally derived from long - chain carbohydrate - based agricultural by - products (e.g. Rice and wheat bran) (hepher, 1988; avinmelech, 1999). The intensification of rearing methods responsible for increasing production per unit land and water is primarily driven by economics: the growing scarcity and thus value of land and fresh water, together with the price of feed and the strong market for fish (van der zijpp et al ., 2007). Total lipid content of farmed fishes is typically higher due to differences between wild and farmed environments in terms of feed availability and composition and animal activity (vliet & katan, 1990; haard, 1992; grigorakis et al ., 2002; palstra & planas, 2011). Also have lower -3:-6 fatty acids, the intensity of production methods (i.e. The amount and composition of external feed used) having a particularly important influence on fish lipid levels and composition (grigorakis et al ., 2002; karapanagiotidis et al ., 2006; weaver et al ., 2008) in short, while aquaculture has increased global food - fish supplies, it has also radically changed the availability of certain food - fish types, species and nutrients consumed via fishes . Freshwater species, in particular cyprinids and tilapines, increasingly dominate food - fish supplies . While this may have marginal effects on protein supplies per unit food - fish, it changes the quantities and types of lipid . Farming methods have a further effect on fish lipid content and composition: intensification of production methods tends to increase fat levels and, where plant - based diets in particular are used, alter fat composition . The significance of these changes for food and nutrition security can only be determined in the context of individual food consumption and health . Availability alone is insufficient to ensure household food security: access to food, determined by power relations, poverty, lack of assets and prices that are increasingly governed by globalized markets, is also critical (fig . Although global food supplies undoubtedly have been improving, growing competition for use of farm land for biofuels, lack of key inputs in some places, natural disasters and increasing dependence of food production systems on energy have, since 2006, resulted in high and volatile food prices, a situation that is likely to continue for some time (fao, 2011a). Poor, food import - dependent countries, with inadequate resources and capacity to put into practice policies targeted at incomes and expenditure, markets and prices or implement food safety nets, will continue to be disproportionally affected (fao, 2011a). Fisheries and aquaculture can improve household food security (prein & ahmed, 2000; dey et al ., 2006; thilsted, 2012). The pathways by which this occurs have been elaborated by kawarazuka & bn (2010): directly through consumption of fish and indirectly through increased purchasing power from the sale of fish (i.e. Increased access) (fig . The latter was found to be especially true when women engage in aquaculture and fisheries - related activities such as processing and trading, which results in a greater proportion of income being spent on food (i.e. Improved use) (kawarazuka & bn, 2010). Worldwide, an estimated 120 10 people are engaged in fishing (world bank, 2010) and 23 10 in aquaculture (valderrama et al ., 2010), increasing their physical access to and, it is hypothesized, consumption of fish . The great majority of people in developing countries do not of course produce their own fish and physical access is largely determined by distance from source . Drying, salting and smoking extend the life of this highly perishable commodity, enabling distribution over far greater areas, albeit at some deterioration in nutritional quality (roos et al ., 2002). There have been few specific studies and no comprehensive review of how increases in farmed - fish availability affect access and use by poor consumers (kawarazuka & bn, 2010; allison, 2011). The growth of aquaculture has undoubtedly increased access in production hotspots such as the nile delta, egypt, but despite the volumes produced, physical access in distant upper egypt remains poor (macfadyen et al . Moreover, in subsaharan africa, the fish aquaculture sector remains dominated by smallholder, subsistence - type operations and physical access to the relatively small amounts of fish produced is largely limited to producer households and neighbours (dey et al ., 2006; brummett et al . The greatest influence on access to food is prices, which are largely determined by markets and incomes (fig . The consumption of meat and fish, which are expensive compared to starchy staples such as rice or maize, is highly linked to wealth (speedy, 2003). Low - income consumers therefore preferentially purchase less expensive fishes, such as small pelagic species, high in lcpufas (tacon & metian, 2009; kabahenda et al ., 2012). In southern africa, for example, the cheapest fishes are the universally available small, dried kapenta limnothrissa spp . Quantities as little as a few tens of grams are purchased and used with vegetables to prepare relishes that accompany the staple maize porridge . A review of studies of fish price elasticities of demand in western markets concluded that demand responds closely to price (gallet, 2009). In developing countries, price is likely to be an even greater determinant of whether poor consumers buy fish or not . Where aquaculture production dominates the market, farmed fish tends to be cheaper, increasing economic access . In egypt, for example, farmed fish now account for two - thirds of all fish consumed and is considerably less expensive than most wild - caught fish (gafrd, 2010). In bangladesh, a decade ago, farmed fish was more expensive than wild - caught fish (thompson et al ., 2002). Today, due to a doubling of farmed - fish production, however, farmed fish is generally less expensive than wild - caught fish (b. belton, pers . Although unsupported by rigorous study, it is hypothesized that aquaculture producers in developing countries tend to target the production of larger - sized fish, aimed at middle - class urban regional and international markets (unhrc, 2012), presumably in the expectation that the higher absolute and relative prices such fish command increase profits . It is proposed here that there is a largely unarticulated and increasingly unmet demand for economically accessible fish by poor consumers, who are in the majority in developing countries . Given any particular species, and irrespective of whether fresh or frozen, smaller fish are generally less expensive . In a study conducted in bangladesh throughout 2011, for example, market prices of farmed 250 g oreochromis spp . Were 2030% less per kg than that of 500 g fish (b. belton, unpubl . While production of smaller, less expensive fish undoubtedly increases access of poor consumers, from a food and nutrition security perspective the point is not how much fish is eaten but that fish consumption fulfils its potential to help meet nutritional needs, especially of poor and vulnerable consumers . The most important role that fish plays in diets dominated by starchy staples is the provision of essential fatty acids and highly bioavailable micronutrients (gibson et al ., 2003; roos et al ., 2003, 2007a, b, c, d; hambraeus, 2009; kawarazuka & bn, 2010, 2011) from this perspective, oily fishes and small fishes that are eaten whole are superior . Small fish species, however, are generally not farmed, an exception being in bangladesh, where small species, e.g. Mola amblypharyngodon mola (hamilton 1822) and chanda parambassis baculis (hamilton 1822), are allowed to enter freshwater fish ponds from adjacent water bodies (roos et al ., 2002). While incorporation of small fish species into cyprinid - based pond polycultures increases overall production and revenues, seed remains unavailable from commercial hatcheries (alim et al ., 2004; kadir et al ., the absence of obvious candidate small fish species for aquaculture and the likely high associated seed costs may make their culture unprofitable, except where self - recruitment occurs . There also seems to be little market for very small - sized (i.e. That can be eaten whole) commonly farmed fishes, such as oreochromis spp . Or cyprinids . A healthy diet depends on the consumption and absorption of the appropriate amounts of energy in the form of carbohydrate, fats and protein, as well as essential fatty acids, amino acids, minerals and vitamins (fig . Inadequate food intake, compounded by the body's inability to utilize needed nutrients, results in undernutrition . Nutritional requirements are determined by genetic makeup, sex, age and health status, as well as physiological demands associated with factors such as pregnancy and physical labour . What individuals choose to eat has always been determined not only by availability and access but also by taste, nutritional value, culture and religion . Personal perspectives and social contexts (life experiences, reliance on foods away from home, food advertising, marketing and promotion) are increasingly influential . The result is that a complex mix of product attributes such as convenience, quality, freshness, health and nutrition beliefs, environmental and animal welfare concerns and social relationships now determines western consumer food choices (furst et al ., 1996; lennerns et al ., 1997). It is no surprise then that the importance of fish in household food baskets varies enormously geographically and temporally . Demographic characteristics, education, place of purchase and generic advertising have been found to determine beliefs and attitudes about aquaculture production (fernndez - polanco & lunes, 2012). A survey of women consumers in belgium, for example, found that consumption of wild - caught fish was influenced by sustainability and ethical considerations whilst that of farmed fish by perceptions of quality (verbeke et al ., 2007). In bangladesh, much of the increase in aquaculture production has been of exotic species, such as oreochromis spp ., which are less preferred than the increasingly scarce indigenous wild fishes (b. belton, pers . Comm . ). It seems, therefore, that there can be consumer resistance to farmed fish, especially unfamiliar exotic species . Use may change over time, especially where availability and economic access increase . At the household level, how food is handled, prepared and cooked influences the nutritional value of what is consumed (kabahenda et al ., 2012). The quantities of food distributed among family members depend on cultural and power determined norms with respect to sex and age in particular (wheeler, 1991). Traditional products such as dried, smoked, salted and fermented small fishes are usually cooked as a mixed curry or stew dish, with a little oil, vegetables and spices . Such dishes, as well as fish paste and fish sauces, are more readily shared among family members than larger farmed fishes . Individual health status determines how effectively the body utilizes what is consumed (caulfield et al ., 2006). The institutions and policies that regulate air quality, adequacy of housing (especially in relation to provision of clean water and sanitation) and access to health care influence the prevalence of infectious, diarrhoeal and acute respiratory diseases among the poor in developing countries (cairncross & valdmanis, 2006). While only the flesh and sometimes the skin or heads of larger fishes tend to be consumed, small fishes are often eaten whole . The micronutrient content of small fishes is often high (see table 1) but the micronutrients are concentrated in the bones, heads and gut, and these fishes must be eaten whole to derive full nutritional benefit (steiner - asiedu et al ., 1993; the contribution of fish as rich sources of vitamins and minerals is poorly documented and often overlooked . Studies from rural bangladesh have shown that a number of widely occurring small tropical freshwater fish species, such as a. mola, p. baculis, dhela osteobrama cotio cotio (hamilton 1822) and darkina esomus danricus (hamilton 1822), have high contents of pre - formed vitamin a (thilsted et al ., 1997; roos et al ., 2007a). Because most of the small fish species are eaten whole, they are also a very rich source of highly bioavailable calcium (hansen et al ., 1998; esomus danricus and trey changwa plieng esomus longimanus (lunel 1882) from cambodia have a high iron and zinc content (roos et al ., 2007c). A traditional daily meal of rice and sour soup made with e. longimanus can meet 45% of the daily iron requirement of a cambodian woman (roos et al . Table 1 shows the vitamin a, calcium, iron and zinc content of some selected common small fishes, as well as two commonly farmed large freshwater fishes . Cooking affects the macro and micronutrient content of fish (kabahenda et al ., 2012). Minerals are generally conserved during cooking but vitamins such as thiamine, cobalamine and niacin are often lost or denatured (holland et al ., 1991). Consuming fish as part of a meal also confers additional benefits in terms of increasing the bioavailability of iron and zinc from other foods in a meal (aung - than - batu et al ., 1976). Vulnerability, a product of exposure to risk factors such as seasonality in supply, conflict, rising prices and disease, and the ability to cope with such shocks, as established by assets (physical and educational) and degree of social marginalization, determines the stability of food and nutrition security (fig . Inadequate food access and utilization on a periodic basis, especially during key life stages such as the first 1000 days of life, can have long - term consequences for an active and healthy life (caulfield et al ., 2006; ruel et al ., 2008) farming improves the continuity of global fish supplies, but locally, export - oriented aquaculture increasingly falls into a gilded trap in focusing on economic rather than socio - ecological aspects (steneck et al ., 2011), which can undermine rather than improve local access to fish food . The availability of food - fish is a function of production and trade, less that used for non - food purposes . The term food - fish is applied here exclusively to fish and does not include shellfish, as is usually the case, used directly for human consumption . Unless otherwise stated, fao data for 2009 (fao faostat, 2013) is used as the most recent set of figures that allows calculation of regional per capita food - fish supplies (excluding molluscs and crustaceans) in which fish imports and exports can also be taken into account . Global fish supplies continue to expand, primarily as a result of the sustained, rapid growth in aquaculture production . Supplies of food - fish from capture and farming increased by c. 62%, from 86 to 139 kg year, between 1961 and 2009 (fig . Increases during the 1960s1980s were largely due to increased capture fisheries landings while those since are largely attributable to aquaculture . Per capita aquatic food (, total fish and aquatic resources;, total fish) and fishes by species group (, freshwater and diadromous fishes;, demersal fishes;, pelagic fishes;, marine fishes) by decade (19612001) and by year (20022009). The statistics, however, mask enormous inter - regional differences in production and trade (table 2). Asia, including china, accounts for c. 90% of global aquaculture production while production in least developed countries is <1% (fao, 2012a). Seafood is the most highly traded food commodity internationally and exports of seafood from developing countries exceed the total value of coffee, cocoa, tea, tobacco, meat and rice combined (smith et al ., 2010; deutsch et al ., 2011). Trade increased in value by an average of nearly 11% per annum between 1976 and 2009 (fao, 2012b). The effect of trade on food - fish availability at regional level can be assessed from the fao food - fish balance statistics that account for production plus imports, minus fish used for non - food uses (e.g. Fishmeal) and exports (fao fishstat, 2012). The data for 2009 show that regional per capita food - fish supplies are greatest in oceania (189 kg year), followed by europe (174 kg year) and asia (150 kg year), with africa (92 kg year) trailing last (table 2). High food - fish availability in north america and europe is in part sustained by net imports from asian countries such as china and vietnam, accounting for> 20 and 26% of supplies in north america and europe, respectively (fao fishstat, 2012). Low production costs and relatively high international prices, combined with liberal trade policies, have increased exports of farmed white - fleshed fishes such as tilapia oreochromis spp . And catfishes pangasius spp ., substituting for dwindling supplies from domestic white - fish fisheries (norman - lpez & bjorndal, 2009; beveridge et al . Even africa is a net food - fish importer, imports of mainly cheap, oily pelagic fishes increasing net food - fish availability by 14% . Total and per capita food - fish supplies by region and economic grouping, 2009 (from fao, 2011b; fao fishstat, 2012) data for central and south america and caribbean combined . While trade data do not indicate whether the fish is of farmed origin, with key commodities such as oreochromis spp . And pangasius spp . Allison (2011) found that effects of fish trade on poverty and food and nutrition security ranged from large and positive to negative and small . With the exception of tuna (thunnini), increases in both per capita food - fish supplies and the value of trade only occurred when there was strong growth in aquaculture (e.g. In bangladesh, indonesia and vietnam). Increases in aquaculture enhance food - fish availability in countries where sector growth is strong . Although annual per capita food - fish availability in low - income food - deficit countries (lifdcs) grew from 45 kg in 1961 to 105 kg in 2009, it remains comparatively low (fao, 2011b; fao moreover, in africa, where fish constitutes a particularly large proportion of animal - source foods, per capita food availability of fish has increased little over the past 20 years, in large measure due to the limited growth of aquaculture . It is not just the availability of food - fish per se that is of concern, however, rather the nutrients that fish provide . Qualitatively, fish supplies have changed markedly over the past 50 years . In 1961, 32% of food fishes were of demersal origin, 26% were pelagic, 16% were fresh water and diadromous and 12% comprised other (i.e. Non - demersal and pelagic) marine fishes (fig . The availability of demersal and other marine fishes had fallen in both absolute and relative terms, that of pelagic fishes had increased in terms of biomass but had fallen as a proportion of total food - fish supplies, while that of freshwater and diadromous fishes had increased by c. 250% . Annual per capita freshwater and diadromous food - fish supplies in 2009 were 61 kg, equivalent to one - third of supplies (fig . The changes largely result from stagnation in capture fisheries production and the large rise in carps (cypriniformes), oreochromis spp . And salmonid aquaculture . The species being farmed are largely determined by ease of culture and profitability . While changes in the fishes eaten are likely to have some effect on protein and energy supplies, they may have an even greater effect on the availability of dietary lipids (see table 1). Demersal white fishes (gadoids) typically have low levels (<2%) of fat . Pelagic herring, anchovies and sardines (clupeids), as well as salmonids, mackerels (scombrids) and eel (anguilla spp . ), are oily fishes (> 2% oil content), with levels in mackerel scomber scombrus l. 1758 seasonally exceeding 20% (wallace, 1991). While species is a major determinant of farmed fish nutrient content, nutrient composition is also influenced by how the animal is farmed . Farm environmental conditions, especially water temperature, quantitatively and qualitatively influence lipid deposition (haard, 1992). More important, however, is the role of food . While the majority of farmed fishes are freshwater omnivores and herbivores, there has nonetheless been a trend towards intensification of production methods, involving increasing reliance on nutritionally complete feeds (tacon & metian, 2008). Traditional pond - based fish farming methods use inorganic and organic fertilizers to stimulate autotrophic and heterotrophic production (hepher, 1988). Production is further enhanced by the administration of small quantities of supplemental feeds, generally derived from long - chain carbohydrate - based agricultural by - products (e.g. Rice and wheat bran) (hepher, 1988; avinmelech, 1999). The intensification of rearing methods responsible for increasing production per unit land and water is primarily driven by economics: the growing scarcity and thus value of land and fresh water, together with the price of feed and the strong market for fish (van der zijpp et al ., 2007). Total lipid content of farmed fishes is typically higher due to differences between wild and farmed environments in terms of feed availability and composition and animal activity (vliet & katan, 1990; haard, 1992; grigorakis et al . Also have lower -3:-6 fatty acids, the intensity of production methods (i.e. The amount and composition of external feed used) having a particularly important influence on fish lipid levels and composition (grigorakis et al ., 2002; karapanagiotidis et al . While aquaculture has increased global food - fish supplies, it has also radically changed the availability of certain food - fish types, species and nutrients consumed via fishes . Freshwater species, in particular cyprinids and tilapines, increasingly dominate food - fish supplies . While this may have marginal effects on protein supplies per unit food - fish, it changes the quantities and types of lipid . Farming methods have a further effect on fish lipid content and composition: intensification of production methods tends to increase fat levels and, where plant - based diets in particular are used, alter fat composition . The significance of these changes for food and nutrition security can only be determined in the context of individual food consumption and health . Availability alone is insufficient to ensure household food security: access to food, determined by power relations, poverty, lack of assets and prices that are increasingly governed by globalized markets, is also critical (fig . Although global food supplies undoubtedly have been improving, growing competition for use of farm land for biofuels, lack of key inputs in some places, natural disasters and increasing dependence of food production systems on energy have, since 2006, resulted in high and volatile food prices, a situation that is likely to continue for some time (fao, 2011a). Poor, food import - dependent countries, with inadequate resources and capacity to put into practice policies targeted at incomes and expenditure, markets and prices or implement food safety nets, will continue to be disproportionally affected (fao, 2011a). Fisheries and aquaculture can improve household food security (prein & ahmed, 2000; dey et al ., 2006; thilsted, 2012). The pathways by which this occurs have been elaborated by kawarazuka & bn (2010): directly through consumption of fish and indirectly through increased purchasing power from the sale of fish (i.e. Increased access) (fig . The latter was found to be especially true when women engage in aquaculture and fisheries - related activities such as processing and trading, which results in a greater proportion of income being spent on food (i.e. Improved use) (kawarazuka & bn, 2010). Worldwide, an estimated 120 10 people are engaged in fishing (world bank, 2010) and 23 10 in aquaculture (valderrama et al ., 2010), increasing their physical access to and, it is hypothesized, consumption of fish . The great majority of people in developing countries do not of course produce their own fish and physical access is largely determined by distance from source . Drying, salting and smoking extend the life of this highly perishable commodity, enabling distribution over far greater areas, albeit at some deterioration in nutritional quality (roos et al ., 2002). There have been few specific studies and no comprehensive review of how increases in farmed - fish availability affect access and use by poor consumers (kawarazuka & bn, 2010; allison, 2011). The growth of aquaculture has undoubtedly increased access in production hotspots such as the nile delta, egypt, but despite the volumes produced, physical access in distant upper egypt remains poor (macfadyen et al ., 2012). Moreover, in subsaharan africa, the fish aquaculture sector remains dominated by smallholder, subsistence - type operations and physical access to the relatively small amounts of fish produced is largely limited to producer households and neighbours (dey et al . The greatest influence on access to food is prices, which are largely determined by markets and incomes (fig . The consumption of meat and fish, which are expensive compared to starchy staples such as rice or maize, is highly linked to wealth (speedy, 2003). Low - income consumers therefore preferentially purchase less expensive fishes, such as small pelagic species, high in lcpufas (tacon & metian, 2009; kabahenda et al ., 2012). In southern africa, for example, the cheapest fishes are the universally available small, dried kapenta limnothrissa spp . Quantities as little as a few tens of grams are purchased and used with vegetables to prepare relishes that accompany the staple maize porridge . A review of studies of fish price elasticities of demand in western markets concluded that demand responds closely to price (gallet, 2009). In developing countries, price is likely to be an even greater determinant of whether poor consumers buy fish or not . Where aquaculture production dominates the market, farmed fish tends to be cheaper, increasing economic access . In egypt, for example, farmed fish now account for two - thirds of all fish consumed and is considerably less expensive than most wild - caught fish (gafrd, 2010). In bangladesh, a decade ago, farmed fish was more expensive than wild - caught fish (thompson et al ., 2002). Today, due to a doubling of farmed - fish production, however, farmed fish is generally less expensive than wild - caught fish (b. belton, pers . Although unsupported by rigorous study, it is hypothesized that aquaculture producers in developing countries tend to target the production of larger - sized fish, aimed at middle - class urban regional and international markets (unhrc, 2012), presumably in the expectation that the higher absolute and relative prices such fish command increase profits . It is proposed here that there is a largely unarticulated and increasingly unmet demand for economically accessible fish by poor consumers, who are in the majority in developing countries . Given any particular species, and irrespective of whether fresh or frozen, smaller fish are generally less expensive . In a study conducted in bangladesh throughout 2011, for example, market prices of farmed 250 g oreochromis spp . Were 2030% less per kg than that of 500 g fish (b. belton, unpubl . While production of smaller, less expensive fish undoubtedly increases access of poor consumers, from a food and nutrition security perspective the point is not how much fish is eaten but that fish consumption fulfils its potential to help meet nutritional needs, especially of poor and vulnerable consumers . The most important role that fish plays in diets dominated by starchy staples is the provision of essential fatty acids and highly bioavailable micronutrients (gibson et al ., 2003; roos et al ., 2003, 2007a, b, c, d; hambraeus, 2009; kawarazuka & bn, 2010, 2011) from this perspective, oily fishes and small fishes that are eaten whole are superior . Small fish species, however, are generally not farmed, an exception being in bangladesh, where small species, e.g. Mola amblypharyngodon mola (hamilton 1822) and chanda parambassis baculis (hamilton 1822), are allowed to enter freshwater fish ponds from adjacent water bodies (roos et al ., 2002). While incorporation of small fish species into cyprinid - based pond polycultures increases overall production and revenues, seed remains unavailable from commercial hatcheries (alim et al . The absence of obvious candidate small fish species for aquaculture and the likely high associated seed costs may make their culture unprofitable, except where self - recruitment occurs . There also seems to be little market for very small - sized (i.e. That can be eaten whole) commonly farmed fishes, such as oreochromis spp . Or cyprinids . A healthy diet depends on the consumption and absorption of the appropriate amounts of energy in the form of carbohydrate, fats and protein, as well as essential fatty acids, amino acids, minerals and vitamins (fig . Inadequate food intake, compounded by the body's inability to utilize needed nutrients, results in undernutrition . Nutritional requirements are determined by genetic makeup, sex, age and health status, as well as physiological demands associated with factors such as pregnancy and physical labour . What individuals choose to eat has always been determined not only by availability and access but also by taste, nutritional value, culture and religion . Personal perspectives and social contexts (life experiences, reliance on foods away from home, food advertising, marketing and promotion) are increasingly influential . The result is that a complex mix of product attributes such as convenience, quality, freshness, health and nutrition beliefs, environmental and animal welfare concerns and social relationships now determines western consumer food choices (furst et al ., 1996; lennerns et al ., 1997 it is no surprise then that the importance of fish in household food baskets varies enormously geographically and temporally . Demographic characteristics, education, place of purchase and generic advertising have been found to determine beliefs and attitudes about aquaculture production (fernndez - polanco & lunes, 2012). A survey of women consumers in belgium, for example, found that consumption of wild - caught fish was influenced by sustainability and ethical considerations whilst that of farmed fish by perceptions of quality (verbeke et al ., 2007). In bangladesh, much of the increase in aquaculture production has been of exotic species, such as oreochromis spp ., which are less preferred than the increasingly scarce indigenous wild fishes (b. belton, pers . Comm . ). It seems, therefore, that there can be consumer resistance to farmed fish, especially unfamiliar exotic species . Use may change over time, especially where availability and economic access increase . At the household level, how food is handled, prepared and cooked influences the nutritional value of what is consumed (kabahenda et al ., 2012). The quantities of food distributed among family members depend on cultural and power determined norms with respect to sex and age in particular (wheeler, 1991). Traditional products such as dried, smoked, salted and fermented small fishes are usually cooked as a mixed curry or stew dish, with a little oil, vegetables and spices . Such dishes, as well as fish paste and fish sauces, are more readily shared among family members than larger farmed fishes . Individual health status determines how effectively the body utilizes what is consumed (caulfield et al ., 2006). The institutions and policies that regulate air quality, adequacy of housing (especially in relation to provision of clean water and sanitation) and access to health care influence the prevalence of infectious, diarrhoeal and acute respiratory diseases among the poor in developing countries (cairncross & valdmanis, 2006). While only the flesh and sometimes the skin or heads of larger fishes tend to be consumed, small fishes are often eaten whole . The micronutrient content of small fishes is often high (see table 1) but the micronutrients are concentrated in the bones, heads and gut, and these fishes must be eaten whole to derive full nutritional benefit (steiner - asiedu et al ., 1993; larsen et al ., 2000; roos et al ., 2002, 2003, 2007d,) the contribution of fish as rich sources of vitamins and minerals is poorly documented and often overlooked . Studies from rural bangladesh have shown that a number of widely occurring small tropical freshwater fish species, such as a. mola, p. baculis, dhela osteobrama cotio cotio (hamilton 1822) and darkina esomus danricus (hamilton 1822), have high contents of pre - formed vitamin a (thilsted et al ., 1997; roos et al ., 2007a). Because most of the small fish species are eaten whole, they are also a very rich source of highly bioavailable calcium (hansen et al ., 1998; esomus danricus and trey changwa plieng esomus longimanus (lunel 1882) from cambodia have a high iron and zinc content (roos et al ., 2007c). A traditional daily meal of rice and sour soup made with e. longimanus can meet 45% of the daily iron requirement of a cambodian woman (roos et al . Table 1 shows the vitamin a, calcium, iron and zinc content of some selected common small fishes, as well as two commonly farmed large freshwater fishes . Cooking affects the macro and micronutrient content of fish (kabahenda et al ., 2012). Minerals are generally conserved during cooking but vitamins such as thiamine, cobalamine and niacin are often lost or denatured (holland et al ., 1991). Consuming fish as part of a meal also confers additional benefits in terms of increasing the bioavailability of iron and zinc from other foods in a meal (aung - than - batu et al ., 1976). Vulnerability, a product of exposure to risk factors such as seasonality in supply, conflict, rising prices and disease, and the ability to cope with such shocks, as established by assets (physical and educational) and degree of social marginalization, determines the stability of food and nutrition security (fig . Inadequate food access and utilization on a periodic basis, especially during key life stages such as the first 1000 days of life, can have long - term consequences for an active and healthy life (caulfield et al ., 2006; ruel et al ., 2008 farming improves the continuity of global fish supplies, but locally, export - oriented aquaculture increasingly falls into a gilded trap in focusing on economic rather than socio - ecological aspects (steneck et al ., 2011), which can undermine rather than improve local access to fish food . The availability of food - fish is a function of production and trade, less that used for non - food purposes . The term food - fish is applied here exclusively to fish and does not include shellfish, as is usually the case, used directly for human consumption . Unless otherwise stated, fao data for 2009 (fao faostat, 2013) is used as the most recent set of figures that allows calculation of regional per capita food - fish supplies (excluding molluscs and crustaceans) in which fish imports and exports can also be taken into account . Global fish supplies continue to expand, primarily as a result of the sustained, rapid growth in aquaculture production . Supplies of food - fish from capture and farming increased by c. 62%, from 86 to 139 kg year, between 1961 and 2009 (fig . Increases during the 1960s1980s were largely due to increased capture fisheries landings while those since are largely attributable to aquaculture . Per capita aquatic food (, total fish and aquatic resources;, total fish) and fishes by species group (, freshwater and diadromous fishes;, demersal fishes;, pelagic fishes;, marine fishes) by decade (19612001) and by year (20022009). The statistics, however, mask enormous inter - regional differences in production and trade (table 2). Asia, including china, accounts for c. 90% of global aquaculture production while production in least developed countries is <1% (fao, 2012a). Seafood is the most highly traded food commodity internationally and exports of seafood from developing countries exceed the total value of coffee, cocoa, tea, tobacco, meat and rice combined (smith et al ., 2010; deutsch et al ., 2011). Trade increased in value by an average of nearly 11% per annum between 1976 and 2009 (fao, 2012b). The effect of trade on food - fish availability at regional level can be assessed from the fao food - fish balance statistics that account for production plus imports, minus fish used for non - food uses (e.g. Fishmeal) and exports (fao fishstat, 2012). The data for 2009 show that regional per capita food - fish supplies are greatest in oceania (189 kg year), followed by europe (174 kg year) and asia (150 kg year), with africa (92 kg year) trailing last (table 2). High food - fish availability in north america and europe is in part sustained by net imports from asian countries such as china and vietnam, accounting for> 20 and 26% of supplies in north america and europe, respectively (fao fishstat, 2012). Low production costs and relatively high international prices, combined with liberal trade policies, have increased exports of farmed white - fleshed fishes such as tilapia oreochromis spp . And catfishes pangasius spp ., substituting for dwindling supplies from domestic white - fish fisheries (norman - lpez & bjorndal, 2009; beveridge et al . Even africa is a net food - fish importer, imports of mainly cheap, oily pelagic fishes increasing net food - fish availability by 14% . Total and per capita food - fish supplies by region and economic grouping, 2009 (from fao, 2011b; fao fishstat, 2012) data for central and south america and caribbean combined . While trade data do not indicate whether the fish is of farmed origin, with key commodities such as oreochromis spp . And pangasius spp . Allison (2011) found that effects of fish trade on poverty and food and nutrition security ranged from large and positive to negative and small . With the exception of tuna (thunnini), increases in both per capita food - fish supplies and the value of trade only occurred when there was strong growth in aquaculture (e.g. In bangladesh, indonesia and vietnam). Increases in aquaculture enhance food - fish availability in countries where sector growth is strong . Although annual per capita food - fish availability in low - income food - deficit countries (lifdcs) grew from 45 kg in 1961 to 105 kg in 2009, it remains comparatively low (fao, 2011b; fao moreover, in africa, where fish constitutes a particularly large proportion of animal - source foods, per capita food availability of fish has increased little over the past 20 years, in large measure due to the limited growth of aquaculture . It is not just the availability of food - fish per se that is of concern, however, rather the nutrients that fish provide . Qualitatively, fish supplies have changed markedly over the past 50 years . In 1961, 32% of food fishes were of demersal origin, 26% were pelagic, 16% were fresh water and diadromous and 12% comprised other (i.e. Non - demersal and pelagic) marine fishes (fig . The availability of demersal and other marine fishes had fallen in both absolute and relative terms, that of pelagic fishes had increased in terms of biomass but had fallen as a proportion of total food - fish supplies, while that of freshwater and diadromous fishes had increased by c. 250% . Annual per capita freshwater and diadromous food - fish supplies in 2009 were 61 kg, equivalent to one - third of supplies (fig . The changes largely result from stagnation in capture fisheries production and the large rise in carps (cypriniformes), oreochromis spp . And salmonid aquaculture . The species being farmed are largely determined by ease of culture and profitability . While changes in the fishes eaten are likely to have some effect on protein and energy supplies, they may have an even greater effect on the availability of dietary lipids (see table 1). Demersal white fishes (gadoids) typically have low levels (<2%) of fat . Pelagic herring, anchovies and sardines (clupeids), as well as salmonids, mackerels (scombrids) and eel (anguilla spp . ), are oily fishes (> 2% oil content), with levels in mackerel scomber scombrus l. 1758 seasonally exceeding 20% (wallace, 1991). While species is a major determinant of farmed fish nutrient content, nutrient composition is also influenced by how the animal is farmed . Farm environmental conditions, especially water temperature, quantitatively and qualitatively influence lipid deposition (haard, 1992). More important, however, is the role of food . While the majority of farmed fishes are freshwater omnivores and herbivores, there has nonetheless been a trend towards intensification of production methods, involving increasing reliance on nutritionally complete feeds (tacon & metian, 2008). Traditional pond - based fish farming methods use inorganic and organic fertilizers to stimulate autotrophic and heterotrophic production (hepher, 1988). Production is further enhanced by the administration of small quantities of supplemental feeds, generally derived from long - chain carbohydrate - based agricultural by - products (e.g. Rice and wheat bran) (hepher, 1988; avinmelech, 1999). The intensification of rearing methods responsible for increasing production per unit land and water is primarily driven by economics: the growing scarcity and thus value of land and fresh water, together with the price of feed and the strong market for fish (van der zijpp et al ., 2007). Total lipid content of farmed fishes is typically higher due to differences between wild and farmed environments in terms of feed availability and composition and animal activity (vliet & katan, 1990; haard, 1992; grigorakis et al . Also have lower -3:-6 fatty acids, the intensity of production methods (i.e. The amount and composition of external feed used) having a particularly important influence on fish lipid levels and composition (grigorakis et al ., 2002; karapanagiotidis et al . While aquaculture has increased global food - fish supplies, it has also radically changed the availability of certain food - fish types, species and nutrients consumed via fishes . Freshwater species, in particular cyprinids and tilapines, increasingly dominate food - fish supplies . While this may have marginal effects on protein supplies per unit food - fish, it changes the quantities and types of lipid . Farming methods have a further effect on fish lipid content and composition: intensification of production methods tends to increase fat levels and, where plant - based diets in particular are used, alter fat composition . The significance of these changes for food and nutrition security can only be determined in the context of individual food consumption and health . Availability alone is insufficient to ensure household food security: access to food, determined by power relations, poverty, lack of assets and prices that are increasingly governed by globalized markets, is also critical (fig . 1). Although global food supplies undoubtedly have been improving, growing competition for use of farm land for biofuels, lack of key inputs in some places, natural disasters and increasing dependence of food production systems on energy have, since 2006, resulted in high and volatile food prices, a situation that is likely to continue for some time (fao, 2011a). Poor, food import - dependent countries, with inadequate resources and capacity to put into practice policies targeted at incomes and expenditure, markets and prices or implement food safety nets, will continue to be disproportionally affected (fao, 2011a). Fisheries and aquaculture can improve household food security (prein & ahmed, 2000; dey et al ., 2006; thilsted, 2012). The pathways by which this occurs have been elaborated by kawarazuka & bn (2010): directly through consumption of fish and indirectly through increased purchasing power from the sale of fish (i.e. Increased access) (fig . 1). The latter was found to be especially true when women engage in aquaculture and fisheries - related activities such as processing and trading, which results in a greater proportion of income being spent on food (i.e. Improved use) (kawarazuka & bn, 2010). Worldwide, an estimated 120 10 people are engaged in fishing (world bank, 2010) and 23 10 in aquaculture (valderrama et al ., 2010), increasing their physical access to and, it is hypothesized, consumption of fish . The great majority of people in developing countries do not of course produce their own fish and physical access is largely determined by distance from source . Drying, salting and smoking extend the life of this highly perishable commodity, enabling distribution over far greater areas, albeit at some deterioration in nutritional quality (roos et al . There have been few specific studies and no comprehensive review of how increases in farmed - fish availability affect access and use by poor consumers (kawarazuka & bn, 2010; allison, 2011). The growth of aquaculture has undoubtedly increased access in production hotspots such as the nile delta, egypt, but despite the volumes produced, physical access in distant upper egypt remains poor (macfadyen et al ., 2012). Moreover, in subsaharan africa, the fish aquaculture sector remains dominated by smallholder, subsistence - type operations and physical access to the relatively small amounts of fish produced is largely limited to producer households and neighbours (dey et al ., 2006; brummett et al ., 2008; kawarazuka & bn, 2010). The greatest influence on access to food is prices, which are largely determined by markets and incomes (fig . The consumption of meat and fish, which are expensive compared to starchy staples such as rice or maize, is highly linked to wealth (speedy, 2003). Low - income consumers therefore preferentially purchase less expensive fishes, such as small pelagic species, high in lcpufas (tacon & metian, 2009; kabahenda et al ., 2012). In southern africa, for example, the cheapest fishes are the universally available small, dried kapenta limnothrissa spp . And other associated freshwater pelagic species . Quantities as little as a few tens of grams are purchased and used with vegetables to prepare relishes that accompany the staple maize porridge . A review of studies of fish price elasticities of demand in western markets concluded that demand responds closely to price (gallet, 2009). In developing countries, price is likely to be an even greater determinant of whether poor consumers buy fish or not . Where aquaculture production dominates the market, farmed fish tends to be cheaper, increasing economic access . In egypt, for example, farmed fish now account for two - thirds of all fish consumed and is considerably less expensive than most wild - caught fish (gafrd, 2010). In bangladesh, a decade ago, farmed fish was more expensive than wild - caught fish (thompson et al ., 2002). Today, due to a doubling of farmed - fish production, however, farmed fish is generally less expensive than wild - caught fish (b. belton, pers . Although unsupported by rigorous study, it is hypothesized that aquaculture producers in developing countries tend to target the production of larger - sized fish, aimed at middle - class urban regional and international markets (unhrc, 2012), presumably in the expectation that the higher absolute and relative prices such fish command increase profits . It is proposed here that there is a largely unarticulated and increasingly unmet demand for economically accessible fish by poor consumers, who are in the majority in developing countries . Given any particular species, and irrespective of whether fresh or frozen, smaller fish are generally less expensive . In a study conducted in bangladesh throughout 2011, for example, market prices of farmed 250 g oreochromis spp . Were 2030% less per kg than that of 500 g fish (b. belton, unpubl . While production of smaller, less expensive fish undoubtedly increases access of poor consumers, from a food and nutrition security perspective the point is not how much fish is eaten but that fish consumption fulfils its potential to help meet nutritional needs, especially of poor and vulnerable consumers . The most important role that fish plays in diets dominated by starchy staples is the provision of essential fatty acids and highly bioavailable micronutrients (gibson et al ., 2003; roos et al ., 2003, 2007a, b, c, d; hambraeus, 2009; kawarazuka & bn, 2010, 2011). From this perspective, oily fishes and small fishes that are eaten whole are superior . Small fish species, however, are generally not farmed, an exception being in bangladesh, where small species, e.g. Mola amblypharyngodon mola (hamilton 1822) and chanda parambassis baculis (hamilton 1822), are allowed to enter freshwater fish ponds from adjacent water bodies (roos et al ., 2002). While incorporation of small fish species into cyprinid - based pond polycultures increases overall production and revenues, seed remains unavailable from commercial hatcheries (alim et al ., 2004; kadir et al ., the absence of obvious candidate small fish species for aquaculture and the likely high associated seed costs may make their culture unprofitable, except where self - recruitment occurs . There also seems to be little market for very small - sized (i.e. That can be eaten whole) commonly farmed fishes, such as oreochromis spp . Or cyprinids . A healthy diet depends on the consumption and absorption of the appropriate amounts of energy in the form of carbohydrate, fats and protein, as well as essential fatty acids, amino acids, minerals and vitamins (fig . Inadequate food intake, compounded by the body's inability to utilize needed nutrients, results in undernutrition . Nutritional requirements are determined by genetic makeup, sex, age and health status, as well as physiological demands associated with factors such as pregnancy and physical labour . What individuals choose to eat has always been determined not only by availability and access but also by taste, nutritional value, culture and religion . Personal perspectives and social contexts (life experiences, reliance on foods away from home, food advertising, marketing and promotion) are increasingly influential . The result is that a complex mix of product attributes such as convenience, quality, freshness, health and nutrition beliefs, environmental and animal welfare concerns and social relationships now determines western consumer food choices (furst et al ., 1996; it is no surprise then that the importance of fish in household food baskets varies enormously geographically and temporally . Demographic characteristics, education, place of purchase and generic advertising have been found to determine beliefs and attitudes about aquaculture production (fernndez - polanco & lunes, 2012). A survey of women consumers in belgium, for example, found that consumption of wild - caught fish was influenced by sustainability and ethical considerations whilst that of farmed fish by perceptions of quality (verbeke et al ., 2007). In bangladesh, much of the increase in aquaculture production has been of exotic species, such as oreochromis spp ., which are less preferred than the increasingly scarce indigenous wild fishes (b. belton, pers . Comm . ). It seems, therefore, that there can be consumer resistance to farmed fish, especially unfamiliar exotic species . Use may change over time, especially where availability and economic access increase . At the household level, how food is handled, prepared and cooked influences the nutritional value of what is consumed (kabahenda et al ., 2012). The quantities of food distributed among family members depend on cultural and power determined norms with respect to sex and age in particular (wheeler, 1991). Traditional products such as dried, smoked, salted and fermented small fishes are usually cooked as a mixed curry or stew dish, with a little oil, vegetables and spices . Such dishes, as well as fish paste and fish sauces, are more readily shared among family members than larger farmed fishes . Individual health status determines how effectively the body utilizes what is consumed (caulfield et al ., 2006). The institutions and policies that regulate air quality, adequacy of housing (especially in relation to provision of clean water and sanitation) and access to health care influence the prevalence of infectious, diarrhoeal and acute respiratory diseases among the poor in developing countries (cairncross & valdmanis, 2006). While only the flesh and sometimes the skin or heads of larger fishes tend to be consumed, small fishes are often eaten whole . The micronutrient content of small fishes is often high (see table 1) but the micronutrients are concentrated in the bones, heads and gut, and these fishes must be eaten whole to derive full nutritional benefit (steiner - asiedu et al ., 1993;, 2000; roos et al ., 2002, 2003, 2007d,). The contribution of fish as rich sources of vitamins and minerals is poorly documented and often overlooked . Studies from rural bangladesh have shown that a number of widely occurring small tropical freshwater fish species, such as a. mola, p. baculis, dhela osteobrama cotio cotio (hamilton 1822) and darkina esomus danricus (hamilton 1822), have high contents of pre - formed vitamin a (thilsted et al . Because most of the small fish species are eaten whole, they are also a very rich source of highly bioavailable calcium (hansen et al ., 1998; larsen et al ., 2000). Esomus danricus and trey changwa plieng esomus longimanus (lunel 1882) from cambodia have a high iron and zinc content (roos et al ., 2007c). A traditional daily meal of rice and sour soup made with e. longimanus can meet 45% of the daily iron requirement of a cambodian woman (roos et al ., 2007b table 1 shows the vitamin a, calcium, iron and zinc content of some selected common small fishes, as well as two commonly farmed large freshwater fishes . Cooking affects the macro and micronutrient content of fish (kabahenda et al ., 2012). Minerals are generally conserved during cooking but vitamins such as thiamine, cobalamine and niacin are often lost or denatured (holland et al ., 1991). Consuming fish as part of a meal also confers additional benefits in terms of increasing the bioavailability of iron and zinc from other foods in a meal (aung - than - batu et al ., 1976). Vulnerability, a product of exposure to risk factors such as seasonality in supply, conflict, rising prices and disease, and the ability to cope with such shocks, as established by assets (physical and educational) and degree of social marginalization, determines the stability of food and nutrition security (fig . Inadequate food access and utilization on a periodic basis, especially during key life stages such as the first 1000 days of life, can have long - term consequences for an active and healthy life (caulfield et al . Farming improves the continuity of global fish supplies, but locally, export - oriented aquaculture increasingly falls into a gilded trap in focusing on economic rather than socio - ecological aspects (steneck et al ., 2011), which can undermine rather than improve local access to fish food . Fish is a preferred food item in the diets of many, especially poor, consumers . Fish provides energy and is a superior source of protein to other animal source foods in terms of total protein and essential amino acid content and digestibility (kawarazuka & bn, 2011). It is as a source of essential fatty acids and micronutrients, superior in both qualitative and quantitative terms to other animal - source foods (table 1), that may be of greatest importance in food and nutrition security terms . Aquaculture accounts for an increasing proportion of global food - fish supplies and, indeed, has increased global per capita food - fish supplies . Market demand, resulting more from urbanization and increasing wealth than from population growth, is likely to continue to drive expansion of global aquaculture production, albeit that the rate of increase is reducing as constraints on and costs of resources and essential ecosystem services (feedstuffs, space and capacity to disseminate and assimilate wastes) increasingly affect the sector (hall et al ., 2011; merino et al ., fish farming is largely absent from those parts of the world where it is most needed, especially sub - saharan africa, however, despite favourable soils and climate . Here, arguably, there has been an over - emphasis on promotion of subsistence aquaculture, which, while improving resilience of poor smallholders to external shocks (dey et al ., 2006), has proved costly to implement and has had limited effect on incomes or food and nutrition security (brummett et al ., 2008). There is, however, an increasing focus on market - based aquaculture that is resulting in marked increases in aquaculture production (beveridge et al ., 2010), although whether this will suffice to meet growing demand is a moot point . In much of sub - saharan africa, growth in demand between 2007 and 2015 is expected to be 2550% (cai, 2011). Assuming little change in capture fisheries or import supplies, demand must be met by aquaculture, but the required rates of sector growth, in the order of 40140% (cai, 2011), are much higher than are taking place . In addition to increasing availability, especially in those parts of the world where fish is most needed, aquaculture must also increase access . A number of economists have identified low - income markets as potential growth areas (prahalad, 2004; diamandis & kotler, 2012). There are many good economic and environmental reasons to produce smaller - sized herbivorous and omnivorous fishes or fish products for poorer consumers . In addition to increased economic access, production per unit land use (productivity) is higher and it is more energy efficient and cheaper per unit biomass to produce smaller - sized fishes, a result of better food conversion ratios (fcr) and lower production costs (robinson & li, 2010; tlusty et al ., 2011). Because it takes less time to produce smaller fishes, farmers may be able to produce several harvests per season . Moreover, risks (mortality, price changes and natural disasters) are lower (pascoe et al ., 2002; bauer & schlott, 2009) and the cost of any borrowing is also reduced . Surprisingly, little research has been done on production economics and on these so - called bottom - of - the - pyramid markets . Access to food can also be increased by greater policy focus on incomes and expenditure, markets and prices (fao, 2011a). While such instruments are often used to increase access to starchy staples, more evidence is needed to show why increasing access to fish is an effective and cost - efficient way to improve food and nutrition security (allison, 2011; kawarazuka & bn, 2011). While production of smaller, less expensive fishes may increase access by poor consumers, from a food and nutrition security perspective (unhrc, 2012) the point is not how much fish is eaten but that the farmed fish meets the nutrition needs of poor and vulnerable consumers . Farmed fish is an excellent source of animal protein but because of species, size and method of rearing it is often inferior to small wild fish species as a source of essential fatty acids and micronutrients . Inclusion of fish - derived products, especially fish oil, in aquaculture diets can help improve the nutritional value of the finished product . Given the importance of wild pelagic fishes in the diets of poor consumers, however, it is important that the growth of aquaculture does not increase the amount of fish of low economic value converted into fish meal and fish oil . There are strong economic drivers to reduce dietary fish oil content and over the past decade, much has been replaced by plant (soy, flax and corn) oils (olsen, 2011). Judicious use of diets with higher fish oil inclusion rates in the weeks prior to harvesting can change fish fat content and fatty acid profile (young, 2009). The feed sector must continue to seek alternative feedstuffs that do not compromise the nutritional quality of farmed fishes . Recent studies have also increased the understanding of fish lipid metabolism, indicating the possibility of selecting for strains of some species of farmed fishes with improved lcpufa biosynthesis capabilities (leaver et al ., 2008).
In order to maintain cellular homeostasis, the amount of proteins in cells is selectively controlled not only in protein synthesis but also in protein degradation . The ubiquitin proteasome pathway is essential for multiple physiological systems via selective degradation of target proteins (hershko and ciechanover, 1998). The proteins designated for proteasome - mediated degradation are conjugated with polypeptide of ubiquitin, which are then targeted to 26s proteasome complex (hochstrasser, 1995). Ubiquitination of target protein is regulated through multi - enzyme processes in an atp - dependent manner . First, the e1 protein, ubiquitin - activating enzyme, activates ubiquitin, which is then transferred to the e2 protein . The ring finger - containing e3 ligase binds to its substrate and the ubiquitinated e2 protein and then directly transfers the ubiquitin from the e2 protein to the substrate (lipkowitz and weissman, 2011). On the other hand, the hect domain - containing e3 ligase can also receive ubiquitin from the e2 protein first through an active - site cysteine of its hect domain then interacts with its substrate to catalyze the conjugation of the activated ubiquitin to the substrate (kee and huibregtse, 2007). Since the specificity of the target proteins for proteasome - mediated degradation is dependent on the interaction between the e3 ligases and their targets, the e3 ubiquitin ligases are critical for regulating the expression levels of key short - lived proteins . Cancer is a genetic disease that is caused by multiple genetic mutations . In cancer cells, oncogenic drivers that are frequently mutated or overexpressed activate the signaling pathways to promote cell proliferation, growth, and survival while tumor suppressors that are commonly inactivated by mutation or deletion inhibit these pathways . It has been demonstrated that the expression levels of some key oncoproteins and tumor suppressors are under the control of ubiquitin proteasome system with some e3 ligases that function as oncogenic factors or tumor suppressors . For example, mdm2 and skp2 ubiquitinate and inhibit tumor suppressors via proteasomal degradation, and thereby function as oncogenic factors (marine and lozano, 2010; wang et al ., 2011). In contrast, other e3 ligases such as the anaphase promoting complex / cyclosome (apc / c) and f - box and wd repeat domain - containing 7 (fbw7) serve as tumor suppressors by downregulating oncogenic factors (crusio et al ., 2010; wasch et al ., 2010)., bortezomib is a specific proteasome inhibitor that is currently used for the treatment of multiple myeloma . Moreover, the inhibitors for specific e3 ligases have been also considered as potential anti - cancer drugs . Mdm2 is the primary ubiquitin ligase for tumor suppressor protein, p53, which induces apoptosis or senescence in response to oncogenic stress or dna damage . The p53 pathway is frequently inactivated in human cancer cells, and the small molecules that block the interaction between p53 and mdm2 to inhibit p53 degradation have been tested in clinical trials (brown et al ., 2009). Protein kinases and phosphatases catalyze the protein phosphorylation and dephosphorylation, respectively, which are essential for maintaining signal transduction . When cells receive extracellular signaling and stress, the signals are primarily transduced to the nucleus via protein phosphorylation, resulting in the alteration of gene expression . For example, epidermal growth factor (egf) stimulates cell proliferation by binding to its receptor, egf receptor (egfr), and activating it . Egfr is a receptor tyrosine kinase that phosphorylates and activates multiple downstream targets and promotes cell growth and survival . Egfr, considered as an oncogene, is frequently overexpressed or mutated in multiple human cancers and promotes tumor progression, metastasis, and drug resistance (nicholson et al ., 2001; hynes and lane, 2005; quatrale et al ., indeed, many oncoproteins include protein kinases, and these oncogenic kinases phosphorylate downstream targets to promote tumor growth, metastasis, and/or angiogenesis . The serine / threonine kinase akt is one of the major downstream kinases activated by growth factor signaling such as egfr, platelet - derived growth factor receptor (pdgfr), and insulin - like growth factor receptor (igfr). Akt has three isoforms, akt1, akt2, and akt3, and their activities are frequently elevated in multiple human cancers, which contribute to cancer cell survival and growth (altomare and testa, 2005). Akt is activated by phosphatidylinositol-3 kinase (pi3k) that converts phosphatidylinositol (3,4)-bisphosphate (pip2) to phosphatidylinositol (3,4,5)-trisphosphate (pip3) in plasma membrane through lipid phosphorylation (altomare and testa, 2005; yuan and cantley, 2008). Akt and phosphoinositide dependent kinase 1 (pdk1) are then recruited to the plasma membrane where akt is directly phosphorylated and activated by pdk1 (chan et al ., 1999). Activated akt phosphorylates various substrates involved in cell metabolism (gsk3, tsc2), survival (bad, foxo), and cell cycles (p21, p27, mdm2; cross et al ., 1995; datta et al ., 1997; 2001a, b; liang et al ., 2002; manning et al ., 2002), and then inhibits apoptosis and promotes cell growth . Therefore, the pi3k akt pathway is a potential drug target, and several pi3k or akt inhibitors have been actively tested in numerous clinical trials (garcia - echeverria and sellers, 2008; wong et al ., 2010; chappell et al ., extracellular signal - regulated kinase (erk) is another critical downstream kinase in growth factor signaling and plays an essential role in cancer cell proliferation (robinson and cobb, 1997; sebolt - leopold, 2000). Erk pathway is a well - characterized signaling pathway and is commonly activated in multiple human cancers . Studies have shown that ras and raf are frequently mutated in various human cancer types and responsible for cancer progression (adjei, 2001; davies et al ., 2002). Therefore, this signaling pathway has been considered a drug target for cancer therapy, and a variety of inhibitors have been developed, including mek or raf inhibitors (davies et al ., 2007; bollag et al ., 2010; hatzivassiliou et al ., 2010; maurer et al ., ib kinases (ikks) are the primary regulator of nf-b, which plays a key role in immune response, cell proliferation, and survival (baldwin, 2001; luo et al ., 2005). Ikks are activated in response to various cytokines and inflammatory stimuli such as tumor necrosis factor (tnf)-, interleukin-1, and lipopolysaccharide . The ikk family includes ikk, ikk, ikk, ikk, and tank - binding kinase 1 (tbk1). Interestingly, ikk has no kinase activity and functions as an adaptor protein for the canonical ikk complex (hacker and karin, 2006). Ikks are involved in two distinct pathways for nf-b activation: the canonical and non - canonical pathways . Ikk plays a dominant role in the canonical pathway and ikk in the non - canonical pathway (perkins, 2007; israel, 2010). In the canonical pathway, ikk, ikk, and ikk form a kinase complex that phosphorylates ib, an inhibitor protein of nf-b, and induces the ubiquitination and subsequent proteasome - dependent degradation of ib. In the non - canonical pathway, ikk forms a homodimer and phosphorylates p100, and generates p52 by partial processing of p100, resulting in the activation of p52/relb . In contrast to ikk and ikk, ikk and tbk1 play a role in the induction of interferon signaling in response to viral infection (shen and hahn, 2011). Although nf-b has been known to be involved in the progression of various cancers, increasing evidence suggests that ikks also play vital roles in cancer independently of nf-b (lee and hung, 2008; baud and karin, 2009; shen and hahn, 2011). For example, ikk phosphorylates both estrogen receptor (er) and co - activator src3 and enhances er transcriptional activity while ikk phosphorylates a tumor suppressor, tuberous sclerosis 1 (tsc1), and inhibits its function (park et al ., 2005; ikk also phosphorylates cbp and the phosphorylated cbp preferentially interacts with nf-b rather than p53, resulting in nf-b activation as well as p53 inactivation (huang et al ., 2007). Inactivation of foxa2 results in the decrease of numb expression, and subsequent notch activation (liu et al ., 2012). Considering that inhibition of nf-b may affect inflammatory responses, ikks may be the potential alternative drug targets for cancer . The above - mentioned three survival kinases play critical roles in cancer cell survival, metabolism, proliferation, and growth . Interestingly, these kinases have many common targets that they directly or indirectly regulate . Moreover, we and others have identified several common targets of these three kinases that are regulated by the ubiquitin we will discuss these proteins one by one in the later next section of the review . The forkhead box o (foxo) family proteins are critical transcription factors that are involved in the regulation of cell proliferation, cell death, cell metabolism, and dna repair (tran et al ., 2003; arden, 2008). Foxo family includes foxo1, foxo3, foxo4, and foxo6, and is conserved from c. elegans to mammals (burgering, 2008; calnan and brunet, 2008). Foxo family proteins directly activate multiple gene expression involved in cell cycles, apoptosis, metabolism, and dna damage repair, such as p27kip, bim, fasl, mnsod, gadd45 (dijkers et al ., 2000; kops et al ., 2002; tran et al ., 2002; ciechomska et al ., 2003; sunters et al moreover, it has been shown that foxo proteins are dysregulated in multiple human cancers such as breast, prostate, leukemia, and glioblastoma (hu et al ., 2004; seoane et al ., 2004; conditional knockout mice of foxo1, 3, and 4 develop thymic lymphomas and hemangiomas (paik et al . It has been shown that ikk, akt, and erk directly phosphorylate foxo and induce foxo ubiquitination and degradation . Among the three kinases, akt was first identified as a foxo kinase that phosphorylates foxo3 at t32, s253, and s315 . Phosphorylated foxo3 protein is excluded from entering the nucleus and binds to 14 - 3 - 3 in the cytoplasm (brunet et al ., 1999) in addition to foxo3, foxo1, and foxo4 are also phoshorylated by akt (tzivion et al ., 2011). Akt - phosphorylated foxo1 and foxo3 then undergo degradation in a proteasome - dependent manner (plas and thompson, 2003). Specifically, foxo1 phosphorylated by akt translocates to the cytosol where it is ubiquitinated by skp2 and subjected to proteasome - dependent degradation (huang et al ., 2005). We found that ikk directly phosphorylates foxo3 at s644 and induces its ubiquitination and degradation (hu et al ., 2004). Recently, e3 ligase -transducing repeat - containing protein (-trcp) is reported to interact with foxo3 and induces ubiquitination and degradation in an ikk-mediated - phosphorylation - dependent manner (tsai et al ., 2010; su et al ., 2011). Furthermore, we and others demonstrated that erk phosphorylates foxo3 and foxo1, respectively (asada et al ., 2007; yang et al ., 2008). We also showed that foxo3 is phosphorylated by erk at s294, s344, and s425, which then undergoes mdm2-mediated ubiquitination, followed by proteasome - dependent degradation (yang et al ., 2008). Mdm2-mediated ubiquitination and degradation is also observed with foxo1, which is dependent on the akt - mediated phosphorylation (fu et al ., 2009). Interestingly, mdm2 induces mono - ubiquitination of foxo4, which promotes nuclear localization of foxo4, and subsequent polyubiquitination by skp2 and degradation (brenkman et al ., 2008). Taken together, the ubiquitin proteasome system plays an essential role in regulating foxo transcription factors by akt, erk, and ikk, and mdm2, skp2, and trcp are e3 ligases for foxo ubiquitination (figure 1a). (a) akt, erk, and ikk phosphorylates foxo3 at different sites and induces its ubiquitination and subsequent degradation via skp2, mdm2, and -trcp, respectively . Gsk3 phosphorylates catenin and induces its ubiquitination and subsequent degradation via -trcp . Both akt and ikk phosphorylate -catenin and stabilize it . -catenin is the key protein in both cadherin junction and wnt pathway and plays an important role in development and adult homeostasis as well as tumorigenesis (cadigan, 2008; stepniak et al ., 2009). In the wnt signaling pathway, -catenin functions as a transcription co - factor and is involved in the transactivation of several oncogenic proteins such as c - myc, cyclind1, and matrix metalloproteases (he et al ., 1998; lin et al ., 2000 glycogen synthase kinase-3 (gsk3) and casein kinase 1 (ck1) are the major protein kinases regulating the -catenin stability . In the absence of wnt ligand, -catenin forms a complex with axin, apc, gsk3, and ck1 and is phosphorylated by these kinases . Once phosphorylated, -catenin undergoes -trcp - mediated ubiquitination and subsequent degradation . When wnt binds to its receptor, frizzles, and co - receptor, lrp5/6, the receptor complex recruits axin gsk3 complex to cell membrane, releasing -catenin from the complex for its translocation to the nucleus where it activates gene transcription with t - cell factor (tcf) and lymphocyte enhancer factor (lef). Akt has been shown to directly phosphorylate gsk3 and inhibits it (cross et al ., 1995), and therefore, akt seems to indirectly inhibit -catenin degradation and inactivation through inhibition of gsk3 (monick et al ., 2001). In addition to the indirect mechanism, akt directly mediates the -catenin stability by phosphorylating -catenin at s552 . Once phosphorylated by akt, -catenin binds to 14 - 3 - 3 and is stabilized (tian et al . In addition to akt, we also demonstrated that erk upregulates -catenin via inhibition of gsk3 (ding et al ., activated erk directly interacts with gsk3 and phosphorylates it at t43 . After the phosphorylation by erk, gsk3 is primed for subsequent phosphorylation by p90rsk at s9, which inactivates it . Furthermore, ikk has been shown to be directly involved in the -catenin regulation, and ikk but not ikk phosphorylates -catenin and prevent its ubiquitination and degradation (lamberti et al ., 2001; albanese et al ., 2003; carayol and wang, 2006). Collectively, -catenin is another common target of akt, erk, and ikk, demonstrating that the ubiquitin myeloid cell leukemia-1 (mcl-1) is a member of anti - apoptotic bcl-2 family proteins which are the central regulators of apoptosis signaling pathway (inuzuka et al ., 2011a). The bcl-2 family consist of pro - apoptotic and anti - apoptotic proteins that regulate the release of apoptogenic proteins such as cytochrome c and smac from mitochondria (youle and strasser, 2008). Pro - apoptotic bcl-2 family proteins include the bh3-only proteins such as bim, bid, bik, and bad and multi - bh domain like bax and bak . Bax and bak are able to form channels on the surface of mitochondria from which cytochrome c and smac are released . Anti - apoptotic bcl-2 family proteins, which include bcl-2, bcl - xl, and mcl-1, prevent apoptotic cell death by inhibiting the activation and channel formation of bax and bak . In contrast, the bh3-only proteins directly bind to anti - apoptotic bcl-2 family proteins and inhibit their functions . Thus, the balance of anti - apoptotic and pro - apoptotic proteins determines cell survival and death, and the expression of anti - apoptotic bcl-2 family protein is the critical for cell survival . Among the anti - apoptotic bcl-2 family proteins, 2003; adams and cooper, 2007) but its expression is enhanced in various cancer types (placzek et al ., 2010). The primary kinase that regulates mcl-1 stability is gsk3. We and another group reported that gsk3 interacts with and phosphorylates mcl-1 at s155, s159, and t163 (maurer et al . Mule is the bh3 domain - containing e3 ligase that was the first identified as the mcl-1 ubiquitin ligase by biochemical purification (zhong et al ., 2005). Later, we found that -trcp can ubiquitinate and induce mcl-1 degradation in gsk3-mediated - phosphorylation - dependent manner (ding et al ., 2007). Recently, a tumor suppressor protein, fbw7, is shown to function as a mcl-1 ubiquitin ligase (inuzuka et al . Fbw7-induced ubiquitination of mcl-1 is also dependent the phosphorylation induced by gsk3. Although both -trcp and fbw7 recognize the same gsk3-mediated phosphorylation sites in mcl-1, the exact roles of these two ubiquitin ligases under various apoptotic stresses are unknown . Akt and erk have been shown to upregulate mcl-1 transcription (wang et al ., 1999; in addition, both pi3k / akt and mek / erk pathways have also been shown to enhance mcl-1 protein stability (derouet et al ., 2004). Because akt inhibits gsk3 as described above, akt increases mcl-1 stability, at least in part, by inhibiting gsk3. Indeed, the inhibition of pi3k induces s159 phosphorylation of mcl-1 and subsequent ubiquitination and degradation of mcl-1, which are blocked by gsk3 inhibition (maurer et al ., 2006). In addition to gsk3, it has been show that erk phosphorylates mcl-1 at t92 and t163 (domina et al . In particular, we showed that erk - phoshorylated mcl-1 can interact with pin1 (ding et al ., 2008). Prolyl cis / trans isomerase that binds to specific ps / t - p motifs and then isomerizes its substrates, resulting in their conformational changes . Interestingly, pin1 stabilizes mcl-1 protein after the phosphorylation by erk, and the expression of mcl-1 correlates with pin1 in multiple human cancer cell lines (ding et al ., 2008). Regarding ikk, there is no evidence that ikk is directly involved in mcl-1 or gsk3 phosphorylation and/or ubiquitination . However, it has been shown that nf-b is required for egf - induced mcl-1 induction, suggesting that the ikk nf-b pathway plays a role in mcl-1 expression or stability (henson et al ., 2003). Thus, mcl-1 is a critical apoptosis regulator that is controlled by the three kinases at the post - translational as well as transcriptional level (figure 2a). Gsk3 phosphorylates mcl-1 and induces its ubiquitination and subsequent degradation via -trcp, mule, and/or fbw7 . Erk also directly phosphorylates mcl-1, and phosphorylated mcl-1 interacts with pin1, resulting in its stabilization . Gsk3 phosphorylates snail and induces its nuclear exclusion, ubiquitination and subsequent degradation via -trcp . Nf-b pathway inhibits snail via upregulation of csn2, which interferes with the gsk3snail interaction and ubiquitination of snail . Epithelial mesenchymal transition (emt) is an important physiological process that converts epithelial cells to mesenchymal cells which plays an essential role in embryonic development and tissue repair (nieto, 2009). Epithelial cells lose cell cell contacts and gain migratory properties during emt . During cancer progression, cancer cells undergo emt, resulting in increased motility, invasiveness, and aggressive behavior (kalluri and weinberg, 2009). Snail is a zinc - finger transcription repressor that is one of the emt regulators . Snail family contains snail1 (snail), snail2 (slug), and snail3 (smuc; de herreros et al ., 2010). Like other emt regulators in addition to emt, snail is also involved in cell death, survival, stem cell, and immune regulation by controlling multiple target genes (wu and zhou, 2010). Downregulation of snail reduces tumor growth and invasiveness in xenograft animal model (olmeda et al ., 2007). Moreover, snail is overexpressed in multiple human cancers, and expression of snail is associated with poor cancer prognosis (peinado et al ., 2007). Snail stability is primarily regulated by gsk3 through the pi3k akt pathway (song et al ., 2009). We have shown that gsk3 can phosphorylate snail at six serine residues in which two of them are responsible for snail stability while the other four are involved in its nuclear localization (zhou et al ., 2004). First, gsk3 phosphorylates snail at four serine residues to allow its export from the nucleus . Then, gsk3 phosphorylates the other two sites, resulting in -trcp - mediated ubiquitination and degradation of snail . Specifically, nf-b induces cop9 signalosome 2 (csn2), which disrupts the interaction between gsk3 and snail, resulting in the inhibition of snail ubiquitination and subsequent degradation (wu et al ., 2009). However, erk does play a role in c - myc - induced emt via the inhibition of gsk3, and there by stabilizing snail (cho et al ., 2010). Furthermore, erk upregulates snail gene transcription though activation of ap-1 transcription factor (hudson et al . Independently of kinases, wild type p53 but not mutant p53 has been shown to interact with and induce snail and slug ubiquitination and degradation (wang et al ., 2009; lim et al ., moreover, f - box and leucine - rich repeat protein 14 (fbxl14) has been shown to interact with and induce snail ubiquitination and degradation (vinas - castells et al ., 2010). So far, no other kinases have been reported to be involved in mdm2- or fbxl - mediated snail ubiquitination . Thus, the three kinases (akt, erk, and ikk) seem to be involved in emt, at least in part, by regulating snail expression through ubiquitination (figure 2b). Recent advances in signal transduction studies have identified many key oncogenic kinases and their substrates in cancer progression, and the signaling pathways associated with these kinases have been recognized as promising drug targets . Indeed, several kinase inhibitors have been developed and used in clinic that show high efficacy and low toxicity (sharma and settleman, 2010). However, several clinical studies have emerged showing that some patients exhibit little or no response to these targeted drugs, and those who originally responded the drugs eventually developed resistance . Although the detailed mechanisms underlying drug resistance are not fully understood, there is evidence to support that alternative pathways are being activated in resistant cells to compensate for the survival signal blocked by targeting agents . For example, egfr tyrosine kinase inhibitors (tkis) are effective drugs for egfr mutant lung cancer, but c - met amplification or k - ras mutation causes the resistance to tkis by bypassing the inhibition of survival signaling (bean et al ., 2007; linardou et al ., we also showed that cancer cells with high akt signaling pathway exhibit resistance to erk inhibitors by inhibiting foxo3 (yang et al ., 2010). Therefore, in order to develop effective personalized cancer therapy, it would be essential that we understand the cross - talk among the multiple oncogenic signaling pathways . In this review, we introduced akt, erk, and ikk as the key survival kinases for cancer progression and survival . We also mentioned that these three pathways have several common targets that are critical for cancer cell proliferation, survival, and emt . Because there are many other pathways that are activated in human cancers, we believe that they likely also contribute to the same targets we described here . These three kinase - signaling pathways may have other common targets that are critical for cancer progression . We also introduce some examples of the signaling pathways that are controlled via the ubiquitin proteasome system, which seems to play an essential role in signaling pathway like phosphorylation . As we described above, inhibition of protein ubiquitination moreover, blockade of specific ubiquitination may exhibit less toxicity because inhibition of upstream molecules in key oncogenic signaling pathways may affect numerous signaling pathways and induce unfavorable side effects . Clearly, further studies for signaling pathways in cancer including post - translational modifications are required for the development of effective personalized cancer therapies . The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
First recognized in humans by van leeuvenhoek in his own diarrheal stool in the 17 century (named as animalcules), intestinal spirochetes in humans are still poorly understood in their biology, origin, and state as commensals or pathogens in the human large intestine . Originally found as a disease of economic devastation in veterinary medicine (e.g. In swine), intestinal spirochetes in humans and its clinical significance have been debated for years,,,,,,,,,,, . In 1967, harland and lee coined the term intestinal spirochetosis (is), recognizing the adherence of spirochetes to colorectal epithelium in histology and electron microscopy, the characteristic appearance that is still considered pathognomonic for a possible capacity to cause human disease (figure 1 (fig . Is, it is still unclear whether this condition represents an actual disease process, or rather, the organisms represent interesting intestinal colonizers in men that does exclusively manifest in the large bowel . In the veterinary world, is has been linked to diarrheal illness in swine, poultry, dogs, cats, opossum, non - human primates, and guinea pigs . The disease causes significant economic losses when it affects large numbers of swine, leading to porridge - like diarrhea, human disease is less well understood, though the presence of intestinal spirochetes in stool has been documented microbiologically throughout africa, australia, india, indonesia, and much of the western world for decades (review:). The prevalence data strongly depend on the material and the detection methods used (direct histology or polymerase chain reaction (pcr) of fecal samples or of colorectal biopsies). A large study in chicago in the early 1900s revealed a 28% prevalence of intestinal spirochetes in the stools of healthy persons . Prevalence rates in soldiers of western command during the early 1900s reached 3.3% in their stools for those with previous bouts of dysentery . It is noteworthy that the presence of spirochetes in the stool might not be associated with is and with clinical symptoms . In more recent times, the prevalence of intestinal spirochetes in stools appears to correspond with habitation in a developing region . In contrast, spirochaetes were only recovered from 8 of 695 (1.2%) fecal samples that were obtained from other mainly non - aboriginal children and adults in western australia or the northern territory of australia, even though most of these individuals were suffering from gastrointestinal disturbances . A study looking at hospitalized and healthy persons in oman found prevalence rates of 11.4 and 26.7%, respectively . A study in bali in 2002 examined 992 fecal samples from people living in rural, urban, and suburban areas . In contrast to the rural predominance seen in earlier studies, prevalence in bali varied from 3.3 to 23.4%, with the highest percentages in the suburban areas . Other studies reported rates from 1.1 to 5% in most developed countries,,, . The highest rates of colonization of stools with intestinal spirochetes in developed countries are found in homosexual males and in human immunodeficiency virus (hiv)-infected individuals . In the united states, homosexual males have shown rates of colonization as high as 20.6 to 62.5%,,,,, . The reason for this increased colonization in homosexual men is speculative at best but has caused proponents to ponder whether is is sexually transmitted,, . For those with is and hiv, there appears to be no correlation with degree of immunodeficiency and extent of disease . Colonization of the colonic mucosa with intestinal spirochetes (is) is not limited to the homosexual population in developed countries, as cases in heterosexual adults have been reported in the u.s ., japan, australia, denmark, sweden, switzerland, norway, england, france, italy, spain and brasil (review:). Particularly in children, is may be associated with severe clinical symptoms,,,, . Intestinal spirochetes have been documented in second trimester fetuses while infections by treponema pallidum, lyme and relapsing fever borrelia and leptospira were ruled out . Fetal tissues showed a brisk lymphocytic - plasmacytic response in the intestinal mucosa . In all instances the placenta had chorioamnionitis and severe chronic villitis . As the modern classification of bacteria came to rely on morphologic differences at the level of dna and rna, the spirochetes were divided into three phylogenetic groups . The family spirochaetaceae includes borrelia, spirochaeta, spironema, and treponema; leptospiraceae contains leptonema and leptospira; and the intestinal spirochetes of brachyspira (serpulina) are in the brachyspiraceae family (table 1 (tab . Traditionally, brachyspira and serpulina were referred to as separate genera; however, a lack of significant phylogenetic differences has led to the unifying classification under brachyspira, with the two genus names considered interchangeable . The two members of the brachyspiraceae family most commonly associated with human is are brachyspira aalborgi and brachyspira pilosicoli . B. aalborgi was first identified in the stool of a patient from aalborg, denmark in 1982 . In the years that followed, subsequent cases of is were assumed to be caused by b. aalborgi on the basis of similar histologic appearance . However, studies published in 1994 and 1996 reexamined the stools using multilocus enzyme electrophoresis and yielded a predominance of b. pilosicoli, . Additionally, a study by trivett - moore et al ., published in 1998, looked at rectal biopsy specimens in homosexual men and found only b. pilosicoli . More recently, pcr - based assays have been used to identify these fastidious organisms (see below). The characteristic of all spirochetes, movement through fluid environments, is performed by rotation of flagellae . The periplasmic space contains the axial fibrils, the number of which varies for individual species . Characteristics of b. aalborgi are the length: 26 m; diameter: 0.2 m; slender, tapered point (causative agent of diarrhea in humans),, . Characteristics of the weakly beta hemolytic b. pilosicoli are length: 420 m; diameter: 0.20.5 m; slender, tapered point (causative agent of diarrhea in humans, pigs, dogs, poultry). Both b. aalborgi and b. pilosicoli are slowly growing fastidious anaerobes, with estimated growth times of 6 days for b. pilosicoli and up to 2 weeks for b. aalborgi,,, . The first reported isolation of the organism from human feces was on brain heart infusion agar with 10% bovine blood and spectinomycin plus polymyxin b. incubation in an anaerobic jar allowed growth of larger colonies, and growth was slightly improved at 38.5c than at 37c, . Antimicrobial susceptibility was determined using clinical and laboratory standards institute (formerly national committee for clinical laboratory standards, or nccls) breakpoints for anaerobes, with isolates determined to be susceptible to ceftriaxone, chloramphenicol, meropenem, metronidazole, and tetracycline . Erythromycin was not active against b. pilosicoli, but approximately 30% of erythromycin - resistant isolates were susceptible to clindamycin . In many cases, the histological findings of is are simply an incidental discovery during a screening colonoscopy . Symptomatic is is most commonly accompanied by complaints of chronic (watery) diarrhea and vague abdominal pain without other apparent cause . Though mild to moderate disease symptoms predominate, disease severity can range from asymptomatic to invasive and rapidly fatal . Several cases of invasive disease have been reported,,,,,,,,,,,,,,,,,,,, . Infected children usually complain of diarrhea and may also present with nausea, weight loss, and failure to thrive,,,, . Co - infection with other enteric pathogens, including enterobius vermicularis, helicobacter pylori, shigella flexneri, and neisseria gonorrhoeae, is common, making the question of clinical significance of is a difficult one to answer,, . The endoscopic appearance of the colon lends very little to the diagnosis . A literature review by alsaigh and fogt examined the documented endoscopic appearance of 15 biopsy specimens that were histologically consistent with is . Area was seen in one patient, a lesion was documented in another patient; and normal - appearing mucosa was noted in six patients . But probably the spirochetes were found coincidentally in biopsies taken from mucosal areas with irregular appearance, while in most cases the mucosa colonized with spirochetes does not reveal any gross irregularities . Colonic involvement has been documented from the proximal to the distal colon, including the rectum . Involvement of the vermiform appendix has also been reported,, . The diagnosis of is is traditionally based on the histological appearance of a diffuse blue fringe (seen in hematoxylin - eosin stain), which is approximately 3 to 6 m thick, along the border of the intercryptal epithelial layer . 2)). When is is suspected on the basis of finding a blue fringe, warthin - starry or dieterle silver impregnation stains can be used to highlight the spirochetes in fixed tissue samples (figure 3 (fig . 3)),,,,,,,,,,, . Recently, an antibody against borrelia burgdorferi has been applied in the immunohistochemical detection of is (figure 4 (fig . The spirochetes are seen to dock perpendicularly to the intestinal epithelium,,,,,,, (figure 5 (fig . 5)). Even with significant diarrhea, the organisms have been described for a long time to be typically non - invasive mainly seen docking onto the cell surface mostly without actually penetrating the membrane,,,,,, . This view has been challenged for the first time in electron microscopic studies; additionally, a particular intraepithelial mast cell and ige plasma cell reaction has been found, . The epithelium undergoes changes, such as blunting and loss of the microvilli, defects of the glycocalyx, and swelling of the mitochondria,, . Cell - membrane destruction can occur with the spirochetes found in the intercellular spaces, within the surface epithelial cytoplasm as intact organisms, or in phagolysosomes of macrophages as morphological altered spirochetes, . The amount of cell destruction usually parallels the degree of invasion microscopically and clinically, with more diarrhea typically seen in those with a greater degree of microvillus destruction and a heavier burden of spirochete attachment . The diarrhea is hypothesized to be a result of decreased resorptive areas of the damaged brush border, . Two reports that reviewed histological changes in symptomatic hiv - infected patients with is noted a higher degree of epithelial invasion, as well as more pronounced loss of microvilli, in this population compared with non - hiv - infected patients, . Because diarrhea is common in the hiv - infected population, subtle histologic changes can be easily overlooked, with diarrhea attributed to a cause other than is . Diagnosis of is in the hiv - infected population requires pathologists to have a high level of expertise in evaluating biopsy material from hiv - infected individuals . Although the diagnosis of is is usually made from histological examination of colorectal biopsy material, newer methods for identifying the etiologic organism are being explored but are not yet available commercially . Pcr has become one of the more reliable methods, targeting the 16s rrna, nadh - oxidase, and the 23rdna gene specific for b. pilosicoli, b. hyodysenteriae, and s. intermedia, . Additionally, fluorescent in situ hybridization with oligonucleotide probes targeting 16s or 23s rrna of b. aalborgi and b. pilosicoli has been reported to be applicable in formalin - fixed, paraffin - embedded intestinal biopsy specimens, . Nevertheless, although molecular genetic techniques separate the different spirochetal species specifically, the diagnosis of is has still to be ascertained morphologically in the biopsy material . Nine cases of bacteremia caused by b. pilosicoli, mostly in immunocompromised or critically ill patients have been reported in the english literature,, and a specific antibody to b. aalborgi could be obtained from the serum of a patient with is . While some patients may have complete remission of diarrhea and normalization of the colorectal mucosa, others continue to have diarrhea with or without persistence of the false brush border . We suggest that the amount of invasiveness could correlate to the clinical signs and symptoms and that patients with invasion of spirochetes beyond the surface epithelium may be more apt to respond to antibiotic therapy . Eradication of symptoms has been reported with metronidazole administered at 500 mg q.i.d . For 10 days . However, there are relatively little data published on recommended treatments other than successful case reports,,,,, . Symptomatic improvement with the use of other antibiotics, including clindamycin and macrolides, has been reported as well . As the genome sequence of the major swine brachyspira hyodysenteriae was recently deciphered the genome sequences of other pathogenic and non - pathogenic brachyspira species are becoming available . This data will facilitate to reveal how these species have evolved and adapted to the varied lifestyles in the complex and changing nutritional and polymicrobial environment of large bowels of different species, and why some but not others can induce colitis and diarrhea . Also, it will be possible to know what survival advantages are gained by brachyspira species through lateral gene transfer events that seemed to be a dominant evolutionary force in several pathogens . Particularly detailed functional genomic analysis of brachyspira species may reveal the association with chemotaxis, motility, invasiveness, proteases, hemolysins and other potential virulence factors and allow a differentiation between pathogenic and non - pathogenic strains . As advances in techniques for the detection of intestinal spirochetes emerge, experts continue to argue about the significance of this condition . Although treatment with effective antibiotic does lead to symptomatic remission and histological clearance in some patients, it is still uncertain whether it was the elimination of the spirochetes that led to the symptomatic improvement . Yet, other patients have no symptomatic relief with treatment despite clearance of spirochetes . Diagnosis of apparent is made on the basis of histologic examination of biopsy specimens from asymptomatic patients add further to the confusion . On the other hand, the reported cases of is with septicemia and dissemination provide some validity to the possible consequences of the condition . As is is more consistently recognized with better identification techniques, it is hoped that the clinical significance of this condition, particularly that of different strains and their potential of invasiveness, will soon become evident.
Next generation genomic profiling technologies are generating deep and detailed characterizations of patients and disease states . This data - intensive approach is providing unprecedented insights that can be used to resolve mechanistic complexity and clinical heterogeneity, thereby revolutionizing how we study, manage, and treat complex diseases . To support this revolution, bioinformatics tools are rapidly emerging to process and analyze large - scale complex molecular data sets for discovery research applications . Unfortunately, when it comes to clinical (n=1) applications of genomics, the data deluge is rapidly outpacing our capacity to interpret rich data sets to extract medically useful and meaningful knowledge . The next great challenge will be to address the manual interpretation bottleneck through the development of computational solutions for intelligently linking complex patient data to actionable biomedical knowledge . This illuminates a need to represent and query large - scale complex relationships distributed across disparate types of biomedical knowledge . A recent report states a goal for the community is to transition from traditional database management to managing potentially unstructured data across many repositories.1 we propose the key challenges for intelligently linking prior knowledge to partially automate genomic interpretation require: (a) a fundamentally different computational framework for storing and representing disparate data types with complex relationships, and (b) advanced software applications that leverage this framework to structure the representation of prior knowledge so that it can be intelligently linked to patient data . We propose a framework conceptually based on requirements and cognitive strategies for knowledge computing, previously introduced as the biointelligence framework.2 our framework is compatible with future directions toward computational intelligence . Since it can support the capturing and querying of multilateral and multi - scalar relations among genomes, phenotype, environment, lifestyle, medical history, and clinical outcome data, our platform can support systems with higher order functions such as inference and learning . This will ultimately allow genomic data to be intelligently repurposed beyond personalized medicine to support more sophisticated translational research and highly iterative knowledge discovery . Systems biology is concerned with emergent properties in complex interactions of systems of systems involving disparate data elements . Extracting useful information requires syntactic and semantic linking of data within and across large data sets . Systems modeled as networks based on binary graphs (where edges connect node pairs) are suited to capturing bilateral relationships and interactions . To represent multilateral relationships we generalize the binary graph model to a hypergraph model, an approach which has been previously suggested,3 and introduce a hypergraph - based solution for representing multilateral relations and multi - scalar networks . Biological systems may benefit from a flexible data model that supports nesting of data elements and concept abstraction in a more natural manner than functionally equivalent relational counterparts, and the ability to readily query across multiple systems and abstraction layers representing complex relationships, leading to systems compatible with learning, reasoning, and inferencing . Following a model for human intelligence, information lives in different levels of the neocortex: from highly variable data inputs, to patterns, to patterns of patterns, to invariant concepts.4 inspired by this model of intelligence, we extend the notion of a hypergraph to allow links among edges to capture relationships that cross bounds of scale and dimension, and develop a novel generic framework for capturing information that can benefit systems biology and other areas . We desire a solution that is flexible to include various types of data from disparate sources, extensible to scale to massive stores of information, and accessible to permit the efficient extraction of patient - centric knowledge . Figure 1 outlines the architecture of our biointelligence framework, the components of which are: a biointelligence framework for creating a hypergraph - like store of public knowledge and using this, along with an individual's genomic and other patient information, to derive a personalized genome - based knowledge store for clinical translation and discovery research . A public hypergraph - based network for representing knowledge, including a. a scalable hypergraph - like model for representing a knowledge network b. processes to automate populating and updating the network with public domain knowledge from multiple sources c. an efficient database solution for storing the network platform a patient data locker application built on top of the knowledge network, including: d. an accessible web - based solution for storing patient - centric knowledge e. processes for structuring and formatting patient genomic and health data, inducing patient - centric subgraphs on the public hypergraph, and stratifying patients based on information in their lockers a process for structuring and formatting analyst interpretation to facilitate feedback and rapid automated learning in the system . A graph is defined g(v, e) where v is a set of vertices (nodes) and e is a set of edges (links) between two vertices . A hypergraph is a generalization of a graph in which an edge can connect any number of vertices . As a modeling paradigm supports the characterization of multilateral relationships and processes.3 for example, in a general graph, an edge might represent a relationship between a gene and disease state . That relationship may change in the context of a drug, and a hypergraph can represent this contextual knowledge with an edge containing all three elements . Hypergraphs are proving useful for capturing semantic and biomedical information in semantic web technologies for biological knowledge management and semantic knowledge networks.5 6 approaches to extracting knowledge from biological research literature to store in a hypergraph have been proposed,7 8 with similar techniques used for population stratification.9 to support a data intelligent system, we wish for information to be stored not only explicitly in the data itself, but implicitly in how the data are linked, and capture this in our model . Abstraction is permitted by allowing hyperedges to contain other edges, forming a nested graph structure . A machine learning model called hierarchical temporal memory (htm) mimics the human neocortex.4 10 inspired by this design, we store knowledge at different levels of granularity, from single points of data, to collections of points, abstracting out to collections of collections . Thus, we perceive edges in lower levels of abstraction as nodes in higher levels, thereby permitting the network to be viewed and operated on within and across different scales of abstraction . Information is stored on the nodes and edges of the network and accessed via processes . Populating the network platform requires processes to pull different types of information from multiple sources, such as the cancer biomedical informatics grid (cabig) and biowarehouse,11 12 and other tools and techniques.1315 the processes are represented as s0 sm in figure 1, and take unstructured, public domain knowledge as input and structures it as input to the public network . The most common database management system (dbms) is based on the relational data model, which is best suited to capturing data structured in a predefined schema, and presents limitations in handling complexity and scalability.16 our solution handles unstructured and semi - structured data, and is in the scope of non - relational (nosql) databases, which do not require pre - defined schemas.16 17 such databases include those based on graph models and triplestores (eg, rdf), and are best suited to capturing binary relationships between two elements (a triplestore is even more restrictive as it is essentially a directed binary graph). To effectively represent multilateral relationships and interactions present in biomedical data, hypergraph - based approaches have been suggested.3 1821 the flexibility granted by allowing elements to contain elements allows processing knowledge at different levels of abstraction, in a less restrictive way than hierarchical models that restrict the network's topology . Hypergraphdb resembles our model, but uses a directed hypergraph and is built on a traditional database.22 our model is more general, based on less restrictive undirected edges, and intended to be implemented natively, although a dbms using our model may use other db solutions as a persistent data store . In fact, other solutions can be built on our model as it is a generalization of other models . This example captures multilateral, multiscalar, and multidimensional relationships using a general model (a), and viewing the network at different levels of abstraction (b and c). The elements shown in this solution are described in the legend of the image, and based on a real - world problem we are exploring . A possible schema model for a relational database capturing these same data can be found in the online supplementary material, and demonstrates the added effort involved in capturing these complex relationships in a sql database . An illustrative example of storing biomedical information in our proposed knowledge base: a component of the biointelligence framework . B and c show the elements described in the legend (at the bottom of the figure) at two different levels of abstraction . An attribute is a key / value pair, and a list of attributes (attribute set) is stored with each element . In this way, we can arbitrarily add any type of attribute to an element without changing the database structure . In the relational model, each entity type requires its own table, with pre - defined fields for attributes, and adding an attribute requires adding a field to the table, and migrating the database . A characteristic of the relational model is that all entities of the same type are stored in the same table . Our model is flexible in that it does not require pre - structuring data, but we can certainly mimic this behavior if desired by enforcing a rule that requires all elements to have an attribute with key=type. Using our model, this decision is left to the database designer, and not enforced by the model itself . An element in our model can contain an arbitrary number of other elements (allowing has - a and has - many relationships). For example, in figure 2, element g is a gene and contains three gene variant elements (v1, v2, v3) in its internal element set . This is an example of a multi - lateral relationship as g can be viewed as a nodes. While this behavior is easy to model in a relational database, using a one - to - many relation, it becomes more complex when an element contains an arbitrary number of arbitrary types of elements . For example, the element r2 represents a molecular state, which in this case is a protein p associated with a protein state ps1 . In a relational database, we can capture these relationships in a molecular state table with foreign key fields pointing to a now consider a molecular state that exists in the context of a modifier drug (ie, the state of the protein is perturbed by a modifier drug in a laboratory experiment). To capture this in our model, we can simply create a new element with three internal elements: p, ps1 and the element representing the modifier drug . To capture this in the relational database, we would need to either add a field to the molecular state table, which may be blank for many records, or create a new table with the three related fields . Both of the later options require a change to the underlying data structure, and migrating the database . The elements shown in figure 2c represent higher - level concepts and recursive nesting of elements at different levels, illustrating the ability to flexibly and efficiently capture multi - scalar relationships among elements, the motivation behind our data model . For example, note that r1 captures the relationship that gene g codes for protein p. c1 captures the genetic event concept, where gene variant v2 changes the state of the protein (the molecular state represented by r3). C2 is a drug response concept representing the higher - level concept that c1, in the context of the pharmaceutical ph, leads to a changed molecular state, r2 . These combined biological and pharmacologic effects lead to a change in disease state to ds2, captured by the clinical response concept c3 . The internal (nested) element sets contain the topology of the network, that is, they define how entities are related, and capture meaning in those relationships . Further details to describe the nature of the relationships can always be stored in attributes of the elements . The external element set of an element is the inverse of internal element relations . For example, v1, v2, and v3 all have g in their external element set . While it is not necessary to store this information (the network of relationships among elements can be constructed via the internal element sets alone), it does aid in querying the database . We have defined three new types of queries associated with our model: recover, context, and expand . The expand and context queries retrieve all internal and external elements of an element, respectively, optionally limited by modifiers presented with the query . All three query actions have an optional level constraint, defining how deep to traverse the graph when retrieving related elements . For instance, expand n will retrieve all internal elements, and their internal elements, recursively up to n times . For instance, we can view c3 as an abstraction; a clinical effect that we can relate to patients and other concepts . Expanding c3 by one level shows us that it represents a disease state ds2, triggered by a pharmacologic effect c2 . Expanding c3 by two levels shows us the details of the pharmacologic effect, and so on . In this way, we can choose which level of abstraction we wish to view and compute over, and we can create new concepts that cross these layers of abstraction (multi - scalar relationships). By the definition of the internal and external element sets, it follows that our model naturally handles many - to - many relationships as well . In summary, we do not argue that a relational database is incapable of capturing the types of relationships we discuss here, rather that it requires more work, and added layers of complexity to the underlying structure of the database, which makes capturing and querying complex biomedical relationships more difficult . Our model is an abstraction of other models, including relational, graph, hierarchical, and object - oriented, and can therefore be used to model data represented using any and all of these models at once . The potential benefit of our model is that it provides levels of scalability and flexibility that are difficult to achieve with existing models . We are currently developing a solution based on this model and will present additional details of the model and related query language in future publications . Given a patient's data (genomic, health, etc), we wish to recover related knowledge from our network using biointelligence tools (bit). The first step (bit1 in figure 1) is a process to structure data as input to a process for inducing patient - relevant subgraphs of the knowledge network (bit2 in figure 1). Bit1 integrates many types of data sets across multiple databases to support electronic medical and health records (emr / ehrs), and is designed as a modular based system to provide metadata and indexing for queries . The next step (bit2 in figure 1) is a process to extract relevant knowledge from the network based on individual patient information . An induced subgraph h(s, t) of network g(v, e) has the properties sv, and for every vertex set si of h, the set si is an edge of h if and only if it is an edge in g. that is, h has the same edges that appear in g over the same set of nodes . We say that h is an induced subgraph of g, and h is induced by s. in our system, v is the set of nodes in the platform network g, and s is the set of nodes that map to an individual's genomic and health information . The architecture in figure 1 shows an example public hypergraph, and private subgraphs stored in a data locker . These networks are detailed in figure 3, where the network on the left is a public knowledge network, and the darkened nodes are elements relevant to an individual's information (based on input patient data). The network on the top right is induced by this information, and contains all of the darkened nodes, and edges incident to them . Alternately, we can expand the information retrieved to include all connected components of the induced subgraph . An example of a connected - component induced subgraph is shown on the bottom right of figure 3 . The network on the top right is a genome - induced subgraph of the network . The network on the bottom right is a genome - induced subgraph, expanded out to include additional knowledge stored on edges in the connected - component each data element is contained in . The most important characteristic of the data locker is that it contains all relevant knowledge to facilitate clinical translation . Induced subgraphs can be used to transform a large set of patient - relevant data to smaller, task - tailored formats void of extraneous detail . The patient data locker is linked to the public knowledge store, and automatically updated to contain only a subset of information related to the patient . Thus, an expert need not develop their own intricate search queries and perform the tedious task of progressively reducing the amount of irrelevant data returned by the query . Any query that can be run on the entire knowledge network, can be run on the subgraph in a patient's locker, leading to a more precise subset of knowledge returned, and potentially faster querying speeds as the search space is reduced . The expert analyst is provided with knowledge tailored to a particular patient, partially automating the interpretation process, and a process (bit3 in figure 1) allows the analyst to input new interpretation knowledge into the public network . We envision this type of feedback mechanism will support the inclusion of a learning model for our system, and allow the community to contribute to its growth . The system is diverse, providing framework and template libraries, allowing users to integrate their own tools for analysis, data collection, and beyond . A graph is defined g(v, e) where v is a set of vertices (nodes) and e is a set of edges (links) between two vertices . A hypergraph is a generalization of a graph in which an edge can connect any number of vertices . As a modeling paradigm supports the characterization of multilateral relationships and processes.3 for example, in a general graph, an edge might represent a relationship between a gene and disease state . That relationship may change in the context of a drug, and a hypergraph can represent this contextual knowledge with an edge containing all three elements . Hypergraphs are proving useful for capturing semantic and biomedical information in semantic web technologies for biological knowledge management and semantic knowledge networks.5 6 approaches to extracting knowledge from biological research literature to store in a hypergraph have been proposed,7 8 with similar techniques used for population stratification.9 to support a data intelligent system, we wish for information to be stored not only explicitly in the data itself, but implicitly in how the data are linked, and capture this in our model . Abstraction is permitted by allowing hyperedges to contain other edges, forming a nested graph structure . A machine learning model called hierarchical temporal memory (htm) mimics the human neocortex.4 10 inspired by this design, we store knowledge at different levels of granularity, from single points of data, to collections of points, abstracting out to collections of collections . Thus, we perceive edges in lower levels of abstraction as nodes in higher levels, thereby permitting the network to be viewed and operated on within and across different scales of abstraction . Information is stored on the nodes and edges of the network and accessed via processes . Populating the network platform requires processes to pull different types of information from multiple sources, such as the cancer biomedical informatics grid (cabig) and biowarehouse,11 12 and other tools and techniques.1315 the processes are represented as s0 sm in figure 1, and take unstructured, public domain knowledge as input and structures it as input to the public network . The most common database management system (dbms) is based on the relational data model, which is best suited to capturing data structured in a predefined schema, and presents limitations in handling complexity and scalability.16 our solution handles unstructured and semi - structured data, and is in the scope of non - relational (nosql) databases, which do not require pre - defined schemas.16 17 such databases include those based on graph models and triplestores (eg, rdf), and are best suited to capturing binary relationships between two elements (a triplestore is even more restrictive as it is essentially a directed binary graph). To effectively represent multilateral relationships and interactions present in biomedical data, hypergraph - based approaches have been suggested.3 1821 the flexibility granted by allowing elements to contain elements allows processing knowledge at different levels of abstraction, in a less restrictive way than hierarchical models that restrict the network's topology . Hypergraphdb resembles our model, but uses a directed hypergraph and is built on a traditional database.22 our model is more general, based on less restrictive undirected edges, and intended to be implemented natively, although a dbms using our model may use other db solutions as a persistent data store . In fact, other solutions can be built on our model as it is a generalization of other models . This example captures multilateral, multiscalar, and multidimensional relationships using a general model (a), and viewing the network at different levels of abstraction (b and c). The elements shown in this solution are described in the legend of the image, and based on a real - world problem we are exploring . A possible schema model for a relational database capturing these same data can be found in the online supplementary material, and demonstrates the added effort involved in capturing these complex relationships in a sql database . An illustrative example of storing biomedical information in our proposed knowledge base: a component of the biointelligence framework . B and c show the elements described in the legend (at the bottom of the figure) at two different levels of abstraction . An attribute is a key / value pair, and a list of attributes (attribute set) is stored with each element . In this way, we can arbitrarily add any type of attribute to an element without changing the database structure . In the relational model, each entity type requires its own table, with pre - defined fields for attributes, and adding an attribute requires adding a field to the table, and migrating the database . A characteristic of the relational model is that all entities of the same type are stored in the same table . Our model is flexible in that it does not require pre - structuring data, but we can certainly mimic this behavior if desired by enforcing a rule that requires all elements to have an attribute with key=type. Using our model, this decision is left to the database designer, and not enforced by the model itself . An element in our model can contain an arbitrary number of other elements (allowing has - a and has - many relationships). For example, in figure 2, element g is a gene and contains three gene variant elements (v1, v2, v3) in its internal element set . This is an example of a multi - lateral relationship as g can be viewed as a nodes. While this behavior is easy to model in a relational database, using a one - to - many relation, it becomes more complex when an element contains an arbitrary number of arbitrary types of elements . For example, the element r2 represents a molecular state, which in this case is a protein p associated with a protein state ps1 . In a relational database, we can capture these relationships in a molecular state table with foreign key fields pointing to a protein table and a protein state table . Now consider a molecular state that exists in the context of a modifier drug (ie, the state of the protein is perturbed by a modifier drug in a laboratory experiment). To capture this in our model, we can simply create a new element with three internal elements: p, ps1 and the element representing the modifier drug . To capture this in the relational database, we would need to either add a field to the molecular state table, which may be blank for many records, or create a new table with the three related fields . Both of the later options require a change to the underlying data structure, and migrating the database . The elements shown in figure 2c represent higher - level concepts and recursive nesting of elements at different levels, illustrating the ability to flexibly and efficiently capture multi - scalar relationships among elements, the motivation behind our data model . For example, note that r1 captures the relationship that gene g codes for protein p. c1 captures the genetic event concept, where gene variant v2 changes the state of the protein (the molecular state represented by r3). C2 is a drug response concept representing the higher - level concept that c1, in the context of the pharmaceutical ph, leads to a changed molecular state, r2 . These combined biological and pharmacologic effects lead to a change in disease state to ds2, captured by the clinical response concept c3 . The internal (nested) element sets contain the topology of the network, that is, they define how entities are related, and capture meaning in those relationships . Further details to describe the nature of the relationships can always be stored in attributes of the elements . The external element set of an element is the inverse of internal element relations . For example, v1, v2, and v3 all have g in their external element set . While it is not necessary to store this information (the network of relationships among elements can be constructed via the internal element sets alone), it does aid in querying the database . We have defined three new types of queries associated with our model: recover, context, and expand . The expand and context queries retrieve all internal and external elements of an element, respectively, optionally limited by modifiers presented with the query . All three query actions have an optional level constraint, defining how deep to traverse the graph when retrieving related elements . For instance, expand n will retrieve all internal elements, and their internal elements, recursively up to n times . For instance, we can view c3 as an abstraction; a clinical effect that we can relate to patients and other concepts . Expanding c3 by one level shows us that it represents a disease state ds2, triggered by a pharmacologic effect c2 . Expanding c3 by two levels shows us the details of the pharmacologic effect, and so on . In this way, we can choose which level of abstraction we wish to view and compute over, and we can create new concepts that cross these layers of abstraction (multi - scalar relationships). By the definition of the internal and external element sets, it follows that our model naturally handles many - to - many relationships as well . In summary, we do not argue that a relational database is incapable of capturing the types of relationships we discuss here, rather that it requires more work, and added layers of complexity to the underlying structure of the database, which makes capturing and querying complex biomedical relationships more difficult . Our model is an abstraction of other models, including relational, graph, hierarchical, and object - oriented, and can therefore be used to model data represented using any and all of these models at once . The potential benefit of our model is that it provides levels of scalability and flexibility that are difficult to achieve with existing models . We are currently developing a solution based on this model and will present additional details of the model and related query language in future publications . Given a patient's data (genomic, health, etc), we wish to recover related knowledge from our network using biointelligence tools (bit). The first step (bit1 in figure 1) is a process to structure data as input to a process for inducing patient - relevant subgraphs of the knowledge network (bit2 in figure 1). Bit1 integrates many types of data sets across multiple databases to support electronic medical and health records (emr / ehrs), and is designed as a modular based system to provide metadata and indexing for queries . The next step (bit2 in figure 1) is a process to extract relevant knowledge from the network based on individual patient information . An induced subgraph h(s, t) of network g(v, e) has the properties sv, and for every vertex set si of h, the set si is an edge of h if and only if it is an edge in g. that is, h has the same edges that appear in g over the same set of nodes . We say that h is an induced subgraph of g, and h is induced by s. in our system, v is the set of nodes in the platform network g, and s is the set of nodes that map to an individual's genomic and health information . The architecture in figure 1 shows an example public hypergraph, and private subgraphs stored in a data locker . These networks are detailed in figure 3, where the network on the left is a public knowledge network, and the darkened nodes are elements relevant to an individual's information (based on input patient data). The network on the top right is induced by this information, and contains all of the darkened nodes, and edges incident to them . Alternately, we can expand the information retrieved to include all connected components of the induced subgraph . An example of a connected - component induced subgraph is shown on the bottom right of figure 3 . The network on the top right is a genome - induced subgraph of the network . The network on the bottom right is a genome - induced subgraph, expanded out to include additional knowledge stored on edges in the connected - component each data element is contained in . The most important characteristic of the data locker is that it contains all relevant knowledge to facilitate clinical translation . Induced subgraphs can be used to transform a large set of patient - relevant data to smaller, task - tailored formats void of extraneous detail . The patient data locker is linked to the public knowledge store, and automatically updated to contain only a subset of information related to the patient . Thus, an expert need not develop their own intricate search queries and perform the tedious task of progressively reducing the amount of irrelevant data returned by the query . Any query that can be run on the entire knowledge network, can be run on the subgraph in a patient's locker, leading to a more precise subset of knowledge returned, and potentially faster querying speeds as the search space is reduced . The expert analyst is provided with knowledge tailored to a particular patient, partially automating the interpretation process, and a process (bit3 in figure 1) allows the analyst to input new interpretation knowledge into the public network . We envision this type of feedback mechanism will support the inclusion of a learning model for our system, and allow the community to contribute to its growth . The system is diverse, providing framework and template libraries, allowing users to integrate their own tools for analysis, data collection, and beyond . A deluge of biomedical data generated from next - generation sequencing (ngs) and clinical applications is overwhelming our ability to efficiently extract value from it . Existing bioinformatics tools were not developed to support clinical translation for an individual patient, causing an n=1 translation bottleneck . A new architecture for managing biomedical data is desired, and we present the biointelligence framework as a genome - compatible biomedical knowledge representation platform . Our future efforts to achieve the goals outlined in this paper include ensuring that we develop algorithms on this framework that minimally meet the performance expectations of existing solutions in practice.
Congenital adrenal hyperplasia (cah) is caused by deficiency of 21-hydroxylase in the adrenal glands . Cortisone acetate (ca) is used worldwide as an equivalent to hydrocortisone (hc), as the glucocorticoid component of substitution therapy for cah . Hc is identical to cortisol, while ca is nearly equivalent to cortisone apart from the presence of an acetate group at the c21 position . Cortisol represents active glucocorticoid, while cortisone is an inactive form . The hepatic enzyme 11-hydroxysteroid dehydrogenase (11-hsd) type 1 catalyzes the conversion of cortisone to cortisol by reducing the keto group at the c11 position to a hydroxyl group accordingly, orally administered ca must be converted to cortisol by 11-hsd in order to be bioactive . The overall bioactivity of ca given orally has been reported to be 80% of that of hc (1). Furthermore, a patient with 21-hydroxylase deficiency has been reported as a poor responder to ca treatment (2). We converted 10 of our cah patients from ca to hc substitution therapy, compared clinical and laboratory findings before and after the change . Ten patients with cah caused by 21-hydroxylase deficiency were studied (6 male, 4 female; ages, 4 to 35 yr). Of the 10 patients, 8 were salt losers, who required fludrocortisone in addition to glucocorticoids . For all subjects, hc was administered instead of ca, initially at 80% of the previous ca dose . The dose of hc then was increased or decreased according to circulating concentrations of 17-hydroxyprogesterone (ohp) and/or adrenocorticotropin (acth). Target concentrations were below 10 ng / ml for 17-ohp and below 50 pg / ml for acth . Doses of fludrocortisone were not changed . To compare required doses of ca and hc, the ca requirement was calculated as the average of the several months preceding the change of drug, while the hc requirement was the dose found to provide stable control of cah after several months . These doses were calculated as milligrams per square meter of body - surface area . Before and after the drug change, we measured concentrations of 17-ohp and acth, as well as patients height and weight . The mean observation period after the drug change was 10 mo (6 to 14 mo). A radioimmunoassay was used to measure 17-ohp, while acth was measured by immunoradiometric assay . Genomic dna of a patient who responded poorly to treatment with ca was obtained from peripheral leukocytes . All exons, exon - intron boundary regions and 2.4 kb of the promoter region of 11-hsd were amplified by pcr . Then the dna sequence was determined using an abi prism 310 genetic analyzer . For bone age determination, the tanner - whitehouse 2 rus method according to the japanese standard was used . The mean 17-ohp concentration during treatment of our patients with ca was 48.6 ng / ml . This decreased to 10.1 ng / ml when the treatment was changed to hc (table 1table 1 demographic, pharmacologic, and endocrinologic data for individual subjects, fig . 1 serum concentrations of 17-hydroxyprogesterone (ohp) during treatment were significantly lowered by changing from cortisone acetate (ca) to hydrocortisone (hc). Each data point represents the mean concentration of 17-ohp of an individual during treatment with ca or hc . ). The mean concentration of acth was 198.0 pg / ml during treatment with ca, decreasing to 35.1 pg / ml during treatment with hc . We compared the dose of ca preceding the change of drug with that of hc after dose adjustment, when disease control was stable . The average drug requirement for ca was 33.9 mg / m, while it was 20.3 mg / m for hc . The relationship can be expressed as an equation, hc = 0.58 ca, and the coefficient is substantially lower than the conventionally reported dose ratio of 0.8 (1). In addition, older patients required more ca per square meter of body - surface than younger patients . The relationship between the ca dose shortly before the change of drug and the final hc dose is shown in fig . . 2 relationship between the dose requirements of cortisone acetate (ca) and hydrocortisone (hc). The solid regression line can be expressed as: hc = 0.58 ca .. no significant change in the obesity index occurred in any subject in association with the change of drug . Among subjects who already had attained their adult height, all male patients (cases 5, 8, and 9) showed short stature attributable to precocious puberty . In case 5, four patients (cases 1 to 4) who had been diagnosed by neonatal screening were at a prepubertal age . In cases 1 to 3, no change of height sd score was recognized before or after the drug change . Case 4 showed some auxological change related to medication, described below . Serum concentrations of 17-hydroxyprogesterone (ohp) during treatment were significantly lowered by changing from cortisone acetate (ca) to hydrocortisone (hc). Each data point represents the mean concentration of 17-ohp of an individual during treatment with ca or hc . Relationship between the dose requirements of cortisone acetate (ca) and hydrocortisone (hc). The solid regression line can be expressed as: hc = 0.58 ca . Case 4: a 10-yr - old boy was found to have an increased concentration of 17-ohp at 6 yr of age, and was treated with ca . The ca dose was increased from 20 mg / m at 6 yr to 35 mg / m at 8.2 yr . During this period, height velocity increased, as did height sd score (0.1 to 0.8). The bone age (ba) / chronological age (ca) ratio also increased (0.9 to 1.2). After conversion to hc at 9.4 yr of age, control of disease improved as evidenced by a decrease in 17-ohp . At 10.1 yr of age, the height sd score had decreased to 0.6, and the ba / ca ratio had decreased to 1.1 . The hc requirement was 20.9 mg / m . In case 5, we performed dna sequence analysis for 11-hsd type 1 because treatment with ca had no effect at all . Case 5: a 13 -yr - old boy was referred from another hospital where he had been treated with 28 mg / m of hc . In our outpatient clinic, treatment was changed to 36 mg / m of ca . Soon afterwards 17-ohp increased abruptly to 260 ng / ml from 5.3 ng / ml . The plasma level of acth increased to 1038 pg / ml from 8.3 pg / ml . Since this patient appeared to be a poor responder to ca, 28 mg / m of hc inability to respond to ca initially was thought to result from impaired low conversion of cortisone to cortisol, because of low activity of 11-hsd type 1 . However, dna sequence determination in the gene encoding this enzyme detected no changes from the reported normal sequence in any of the six exons, exon - intron boundary regions, or the promoter region (2.4 kb) (3). In 10 patients with 21-hydroxylase deficiency, we changed the glucocorticoid for the substitution therapy from ca to hc . Indices of control of cah such as 17-ohp, and acth decreased, indicating improvement . On average, the final requirement for hc based on these indicators, was only 0.58 times the previous dose of ca, which was smaller than previously reported (1). Whorwood and warne (4) determined urinary tetrahydrocortisone (the) / tetrahydrocortisol (thf) ratios for 14 cah patients treated with ca, and found that better control of the disease was associated with lower the / thf ratios . The pharmacologic effect of ca depends on conversion of cortisone to cortisol by 11-hsd . However, when we performed gene sequencing in one of our poor ca responders, we found no mutation in the 11-hsd gene including the promoter region . (2) similarly reported failure to detect a mutation in the 11-hsd gene . Up to the present, no 11-hsd gene mutation has been detected in poor responders . Even single - nucleotide polymorphism has not been common, apart from the recently reported intronic gene polymorphism (5). As described for case 4, an individual patient s response to ca can vary with age or other factors . In addition, blood concentrations of cortisone have been reported to be higher than those of cortisol in the neonatal period and early infancy (6). Accordingly steroid metabolism in young children may differ from that in school - age or older children . In our study, a poor response to ca, therefore, may involve variability of 11-hsd activity rather than genetic changes . Jamieson et al . (7) reported a 36-yr - old woman who had clinical features of hypercortisolemia associated with a normal plasma cortisol concentration and an elevated urinary the / thf ratio, possibly caused by a defect in hepatic 11-hsd . In another case of 6 yr old boy with precocious pubarche had an elevated urinary the / thf ratio (decreased thf / the ratio) attributed to low activity of 11-hsd (8). This enzyme has attracted considerable attention in studies concerning obesity and other endocrinological disorders . An agonist at the peroxisome proliferator - activated receptor is suspected to regulate 11-hsd, decreasing its activity (9). Among patients with cah, good responders however, we found no relationship between response to ca and obesity . Among our subjects who attained adult height, male patients were shorter than previously reported adult patients with cah (10). Our findings provided no definitive indication of whether or not hc is superior to ca in achieving a desirable height . However, in one growing child (case 4), changing the drug from ca to hc decreased the ba / ca ratio . Final height in patients treated with hc might prove to be greater than that in patients treated with ca . As a therapeutic agent, ca shows considerably greater inter- and intra - individual variations in efficacy than hc . In addition, we found greater difference in pharmacological activity between ca and hc than has been previously reported . Ca would seem inadequate for substitution therapy not only in patients with cah, but also those with other forms of adrenal insufficiency such as adrenal hypoplasia or hypofunction caused by pituitary disorders . Treatment with hc is recommended for these patients as well . However, since hc has been reported to be too bioavailable to maintain cortisol concentrations within physiologic limits (11), careful evaluation of physiologic aspects of hc - based substitution regimens may be needed.
Melanocyte - stimulating hormone release inhibiting factor-1 (mif-1), also known as plg based on its amino acid structure (pro - leu - gly - nh2), is an endogenous brain peptide that exerts a variety of pharmacological effects on the central nervous system . Clinical studies have shown that mif-1 can alleviate symptoms in parkinson's disease (pd) and mental depression . These have been summarized elsewhere, although the review overlooked a report in the chinese literature of favorable results of mif-1 in pd . Mif-1 was the first hypothalamic peptide shown to act up on the brain, not just down on the pituitary . In human plasma, a duration of 5 days is required for 50% degradation of mif-1 at 37c . This remarkable stability of mif-1 in human blood, coupled with its persisting biological activity, makes mif-1 a worthwhile candidate as a human therapeutic agent . The therapeutic potential of mif-1 indicates the importance of further determining how it acts on the brain . There already is evidence that mif-1 activates cns pathways related to opiate and dopaminergic systems based on the following evidence: (1) mif-1 antagonizes opiate actions, and the first report of such activity correctly predicted the discovery of other endogenous antiopiate peptides blocking the analgesic effect of morphine and enkephalin in a radiant heat tail - flick assay . Mif-1 also significantly antagonized the effects of morphine in a double - blind study in humans . (2) mif-1 is effective in the dopa - potentiation, oxotremorine antagonism, and deserpidine antagonism tests . In a small number of patients with pd, barbeau found its potentiation of the effects of levodopa to be remarkable; (3) mif-1 can modulate dopaminergic transmission in - vitro as well as in - vivo, increasing the binding affinity of agonists to the high - affinity state of the dopamine receptor and shifting the ratio of high- and low - affinity states of the dopamine receptor in favor of the g - protein - coupled high - affinity state . (4) the actions of mif-1 appear rather selective toward dopamine receptors since it does not interact with other aminergic receptors such as adrenergic, gabaergic, or serotonergic receptors . (5) mif-1 also facilitates passive acquisition of brightness discrimination, passive avoidance retention, appetitive maze performance, and inhibits shock - suppressed water intake, findings interpreted as contributing to the processes of memory consolidation [1, 12]. However, mif-1 does not change camp in the brain in contrast to the increase induced by -msh, and its induction of cgmp is not robust in rat brain . This led us to study alternative cellular signaling pathways . A number of exogenous stimuli, including an increase in neuronal activity, trigger the transcription of c - fos, which is an immediate early gene that in combination with the specific jun proteins forms the heterodimeric transcription regulator, ap-1 . The extracellular signal - regulated kinase (erk)-1/2 pathways are involved in the induction and regulation of c - fos . In this study, we performed a brain mapping of the neuronal expression of c - fos after intravenous (iv) or intracerebroventricular (icv) injection of mif-1 . All studies were conducted following a protocol approved by the institutional animal care and use committee . Adult male c57bl/6j mice were purchased from jackson laboratories (bar harbor, me) and housed in the animal care facility for at least 2 weeks before study . The mice were housed 4/cage and provided with regular rodent chow and water ad libitum . The light span was 07:0019:00 hours in a light - dark (ld) 12:12 lighting regimen . Mif-1 was purchased from phoenix pharmaceuticals (burlingame, ca) and reconstituted in phosphate - buffered saline (pbs) before use . Rabbit polyclonal anti - c - fos antibody, goat anti - pstat3-tyr antibody, and mouse anti - perk e-4 monoclonal antibody were purchased from santa cruz biotechnology (santa cruz, ca). Louis, mo). In accordance with a protocol approved by the institutional animal care and use committee, c57bl/6j male mice (57 weeks old) mif-1 was delivered either into the isolated left jugular vein (iv) at 10 g / mouse in a volume of 50 l (n = 3), or into the right lateral cerebral ventricle (icv) at 1 g / mouse in a volume of 1 l (n = 3). The icv coordinates were 2 mm lateral and 0.2 mm posterior to the bregma, and 2.5 mm below the skull . The mice were perfused intracardially with 30 ml of normal saline (ns) followed by 60 ml of 4% paraformaldehyde . The brain was postfixed overnight in 4% paraformaldehyde and cryoprotected in 15% and then 30% sucrose . Coronal sections of 20 m thickness were obtained by the use of a cryostat . The tissue sections were permeabilized with 0.3% triton x-100 and blocked with 10% normal donkey serum, and incubated with a primary antibody overnight at 4c . The antibodies include rabbit polyclonal anti - c - fos antibody (1: 200, santa cruz biotechnology sc-52) and anti - rat neun antibody (1: 100, chemicon). After thorough washing, they were incubated with respective alexa488-conjugated secondary antibodies at room temperature for 1 hour, washed, and mounted . Sh - sy5y human neuroblastoma cells (american type culture collection, atcc, manassas, va) were grown in dulbecco's modified eagle's medium (dmem) with 10% fetal bovine serum (fbs). The cells were differentiated by treatment with 10 m of all - trans retinoic acid (sigma, st . Sixteen hours after serum starvation, the cells were treated with mif-1 (110 ng / ml for different time intervals (03 hours). All cells were plated at the same time and treated according to the time intervals designed for individual experiments . The cells were lysed in ice - cold ripa buffer (100 mm nacl, 10 mm tris, ph 7.2, 0.1% sds, 1% triton x-100, 1% deoxycholate, 5 mm edta) in the presence of protease inhibitor cocktail (pierce, rockford, il). Thirty to 50 g of protein was electrophoresed on 12% sds - polyacrylamide gel and transferred to a nitrocellulose membrane (bio - rad, hercules, ca). The membrane was blocked with 5% non - fat dry milk in tris - buffered saline (ph 7.6) containing 0.1% tween-20, and probed with rabbit anti - c - fos (polyclonal, 1: 200, santa cruz biotechnology, sc-52), goat anti - pstat3 tyr 705 (polyclonal, 1: 1,000 sc-7993), mouse anti - perk e-4 (monoclonal, 1: 500, sc-7383 and mouse anti--actin (monoclonal, 1: 10,000, sigma, a2228) overnight at 4c . After thorough washing, the membranes were incubated with horseradish peroxidase - conjugated secondary antibody for 1 hour at room temperature . The signals were developed with enhanced chemiluminescence - plus western blotting detection reagents (amersham biosciences, piscataway, nj). We previously observed that mif-1 is saturably transported from blood to brain . In this study, we demonstrate that iv injection of mif-1 increased c - fos immunoreactivity in different brain regions . The regions that showed the highest c - fos activation include cingulate cortex (figures 1(c3) and 2(a)), infralimbic cortex (figures 1(c1) and 2(e)), nucleus accumbens (figures 1(c1) and 2(i)), paraventricular nucleus (pvn) in the hypothalamus (figures 1(c5) and 2(f)), medial basal amygdaloid nucleus (figures 1(c6) and 2(h)), fiber tract in piriform cortex (figures 1(c6) and 2(g)), paraventricular thalamic nucleus (figures 1(c6), 2(c), and 2(d)), and other thalamic nuclei (figures 1(c7) and 2(b)). Double labeling with neun showed that many of the cells expressing c - fos were neurons . The increase in c - fos expression was greater after iv injection than after icv injection in many brain regions . This is consistent with the ability of stable substances in the cerebral circulation to reach all parts of the brain rapidly . After icv, the increase of c - fos was mainly seen in the paraventricular nucleus of the hypothalamus (figures 1(b5) and 2(f)). Table 1 summarizes the number of c - fos immunopositive cells in different brain regions . Western blotting showed that the c - fos signal was increased 60 minutes after mif-1 treatment (10 ng / ml). There was also a dose - dependent increase, highest at the maximal dose of 10 g / ml, but even the lowest concentration of mif-1 tested (6.25 ng / ml) showed a robust induction of c - fos 1 hour later (figure 3(b)). Western blotting analysis showed that perk expression was increased in sh - sy5y cells 10 minutes after mif-1 treatment (10 ng / ml) (figure 4). By contrast, the cells responded to mif-1 with an initial reduction of pstat3 at 10 and 60 minutes, followed by increased pstat3 expression at 2 and 3 hours (figure 5). In this study, we showed that mif-1 induces c - fos activation in different regions of the brain and in cultured neurons . This is the first report stating that mif-1 increases the phosphorylation of erk, indicative of activation of a mitogen - activated protein kinase (mapk) pathway . Our results show that mif-1 decreased pstat3 initially (10 and 60 minutes), but then increased pstat3 at later times (2 and 3 hours) in neuronal culture, probably reflecting a secondary mechanism . This also is the first report showing that mif-1 modulates pstat3 activation, although the functional consequences are not clear . These are not classical elements of the gpcr signaling pathway, and suggest a broader action of this orphan ligand . While a peptide like mif-1 may either show direct cns effects or activate secondary mediators, c - fos immunoreactivity reflects a final common pathway of brain activation as a result of mif-1 application . The immediate early gene product c - fos is an easily identifiable and rather sensitive marker for cns activation . The increase of c - fos has been demonstrated after various stimuli, including growth factors, ion channel activation, neurotransmitter release, and behavioral modifications . The increase of its expression can be mediated by many intracellular signaling pathways, such as increases in camp, calcium influx, and activation of mapk . Our results show that the increase in c - fos expression is greater after iv injection than after icv injection in many brain regions . After icv administration, the increase of c - fos immunoreactivity was mainly seen in the pvn of the hypothalamus . Considering that less than 1% of mif-1 from blood permeates the blood - brain barrier to reach the brain, like most centrally active peptides and even l - dopa and morphine, this indicates that blood - borne mif-1 is more effective than when administered into the slower moving ventricular system of the brain . This is not surprising considering that no neuron is more than about 8 m from a capillary . It is also possible that peripherally injected mif-1 activates additional mediators, thus triggering a cascade of signalling events . The implications of mif-1-induced c - fos activation in different brain regions are discussed below . (1) cingulate cortex: the cingulate cortex is an anatomically and functionally heterogeneous region and it modulates emotion and mood . Attention deficit in pd has been explained by dopamine depletion of the cingulate cortex . Fornix - induced lesions can reduce c - fos immunoreactivity in the cingulate cortex of rats . Earlier studies showed that lesions of the cingulate cortex affect behavior in the open - field and interspecies aggression behavior in rats . Melatonin (5-methoxy - n - acetyltryptamine) was reported to be critically involved in the regulation of both mood and pain . Melatonin receptor type 1 (mt1)-knockout mice display depression - like behavior with altered sensory responses and attention deficits . These previous studies show that the central melatoninergic system might play an important role in the mechanism of interactions between pain and depression, and the anterior cingulate cortex could be a forebrain region of interest in this process . Mif-1 can potentiate the melanocyte - lightening effect of melatonin in rats, and its effects in patients with pd are associated with marked mood elevation . Therefore, the mif-1-induced c - fos activation in the cingulate cortex supports the speculation that the effectiveness of mif-1 in treating movement disorders may be associated with increased melatonin secretion . (2) thalamus: the lateral geniculate nucleus of the thalamus is involved in fluctuations in both visual attention and visual awareness . Mif-1 can facilitate acquisition of brightness discrimination, probably by affecting processes of attention when rats are tested with a spatial extradimensional shift problem after acquisition of a visual task . C - fos expression has been found in the medial geniculate body (mgb) of the thalamus after mice acquired a visually cued conditioned fear . The activation of c - fos by mif-1 in the thalamus supports the direct effects of mif-1 there . (3) infralimbic cortex: the infralimbic cortex (il) is a cortical region in the medial prefrontal cortex that is important in tonic inhibition of subcortical structures and emotional responses such as fear this illustrates cortical control over extinction processes, which is one of the simplest forms of emotional regulation . Less c - fos immunoreactivity is present in the il of the extinction - resistant mouse compared with the control . In a 12-choice warden maze for a palatable food reward, rats receiving mif-1 have shorter latencies and make fewer errors than controls during learning, but not extinction, of the task . (4) nucleus accumbens: both typical and atypical antipsychotic drugs increase c - fos protein expression in the nucleus accumbens shell . The ability of mif-1 to increase c - fos in the forebrain may have considerable predictive validity for antipsychotic drug actions . Administration of mif-1 to patients with depression showed substantial improvement within a few days after initiation of treatment [3335]. Previous studies showed that antipsychotic drugs like clozapine and amperozide preferentially increase dopamine release in the rat nucleus accumbens and prefrontal cortex . Hippocampal dopamine receptors modulate c - fos expression in the rat nucleus accumbens that is evoked by chemical stimulation of the ventral hippocampus . Thus, mif-1 may activate cells in the nucleus accumbens and modulate dopaminergic activity there to alleviate mood and schizoaffective disorder . (5) pvn: the pvn plays important roles in neuroendocrine and autonomic nervous system controls . For example, many experimental challenges (such as restraint stress, dehydration, and immune challenge) induce c - fos expression in the pvn [38, 39]. Although mif-1 has no effects on a naloxone - sensitive peptide yy (pyy) model of hyperphagia after pyy injection into the pvn, the induction of c - fos by mif-1 through both iv and icv injection indicates that pvn is a major site of action for mif-1 . (6) medial amygdaloid nucleus: an avoidance task in the elevated t maze can increase fos protein expression in the medial amygdaloid nucleus . The amygdala is a point of convergence for conditioned and unconditioned stimuli and seems to impart emotional value to sensory stimulation . Increased expression of immediate early genes in the amygdala has been reported in several paradigms of aversive conditioning . These findings may provide a physiological basis for mif-1 induced c - fos activation in the amygdala . (7) piriform cortex: the presence of the c - fos protein has been shown in the piriform cortex at different stages during the acquisition of trace conditioning in rabbits . Mif-1 also facilitates passive avoidance retention and inhibits shock - suppressed water intake, findings interpreted as contributing to the processes of memory consolidation . In elevated - plus - maze tests, mice treated with tyr - mif-1 tend to spend more time in the open arms compared with the control group, suggesting the anxiolytic properties of this peptide that shows structural homology with mif-1 . Training induces c - fos mrna expression in the piriform cortex and the neocortex of n-3-fatty acid depleted rats, who showed learning improvement in an olfactory discrimination task . Mif-1 also improves the capacity of rats to store information received through olfactory cues in social investigatory behavior . In summary, the results show that mif-1 increased c - fos expression in brain regions involved in the regulation of mood, anxiety, depression, and memory . Blood - borne mif-1 induced a greater extent of activation than that after icv, suggesting a prominent role of blood - brain barrier permeation . The activation status of perk and pstat3 may contribute to the overall expression level of c - fos . Thus, the results indicate the cellular mechanisms of actions of mif-1 that may underlie the therapeutic effects of mif-1 in the treatment of parkinson's disease and depression.
The fda - approved da vinci surgical system is a novel approach to perform minimally invasive surgery and is considered a second revolution in surgery after the introduction of laparoscopic surgery . This system was introduced in april 2003 at our institution, with 90 pediatric patients undergoing a variety of procedures performed by our surgical group . Among these procedures, several reports have been published on this subject, concluding that it is a feasible, safe alternative . Despite some of its potential benefits, there has yet to be any improvement shown by using the robot over the standard laparoscopic or open technique . Our objective in this study was to compare results using the robot system with that of laparoscopic and open techniques in our pediatric patients to determine the potential for acceptance as a standard approach in this population . Following irb approval, 150 charts of patients who underwent nissen procedures from 1994 to 2005 were divided into 3 treatment groups defined by technical approach, either robotic (r) (n=50), laparoscopic (l) (n=50), or open (o) (n=50). Groups were case - matched and performed by several surgeons and residents, under the care of one of the 3 staff surgeons at our facility . The robot system used was the da vinci (intuitive surgical, mountain view, ca, usa). The fourth arm was used in a minority of pediatric patients due to the short distance between ports leading to the restricted movement of the working arms outside the patient . We now use a 5-mm scope in addition to the 11-mm stereoscopic scope more typically used . All cases were performed with the patient in a reverse trendelenburg position under general anesthesia and complete paralysis with an age - appropriate esophageal dilator in place . Port placement with the robot followed laparoscopic standards with the exception of ports being placed more distant to one another to allow broader external movements . In open cases, unless the patient had a previous midline scar, a left subcostal incision was performed . Regardless of the surgical approach, once the equipment was inside the abdominal cavity, identical steps were taken to dissect the gastroesophageal junction and wrap the gastric fundus around the esophagus . Descriptive and analytical statistics were applied to compare surgical times, length of hospitalization, and outcomes using kruskal - wallis and tukey tests for continuous data and the chi - square text for nominal data . In the 150 nissen cases included in this study, patients were younger and smaller in the open group (8555 months, 2417 kg, p<0.05) compared with those in the robotic (11764 months, 3723 kg) and laparoscopic groups (10771 months, 3324 kg) (table 1). The most common indication for the procedure was reflux refractory to medical management either as the sole reason or associated with failure to thrive or neurological impairment, or both of these [r = 39(78%), l = 50(100%), o = 34(68%)]. Other indications include a failed previous antireflux procedure, reflux associated with oromotor dysfunction, hiatal hernias, aspiration with an acute life - threatening event, and esophageal stricture . Robot operative times proved significantly longer compared with times for laparoscopic and open procedures (r 16061 min, l = 107 + 31 min, o = 7327 min, p<0.05). The number of gastrostomy tubes done in addition to the nissen fundoplication in the robot group were similar to that of the other groups [r = 17/50 (34%), l = 24/50 (48%), o = 11/50 (22%), p>0.05]. The robot group experienced 2 conversions to the open approach (2/50 4%), comparable to the laparoscopic conversion rate (1/50 2%). Open cases resulted in longer hospitalization compared with the robot - assisted cases [r = 2.944.5 d, o = 3.52.8, p<0.05]. Complication rates were equivalent between groups, including hiatal hernia, tight wrap requiring dilatation, and wound infection [r = 7(14%), l = 8(16%), o = 5(10%), p=0.387]. The most common complication with the da vinci and laparoscopic approaches was a tight wrap, requiring dilatation [r = 4/50, 8% and l = 3/50, 6%], whereas in the open series, wound infections were more common (2/50, 4%). On 30-day follow - up, the presence of transient symptoms including dysphagia, abdominal pain, feeding aversion, and gas bloating were equivalent [r = 15 (30%), l = 14(28%), o = 6(12%), p=0.06]. In our experience, the robot proved to be an acceptable approach for laparoscopic nissen fundoplication . This parallels the findings reported on early experiences from other centers . As in previous randomized trials, our experience with nissen fundoplication shows comparable efficacy of the robotic and laparoscopic approaches, with similar morbidity . The laparoscopic procedure, whether da vinci assisted or not, demonstrated a slight reduction in hospital stay compared with the open technique . Patient demographics, surgical times, and complication rates according to surgical approach denotes significant difference between the robot vs. open group . Of the 2 robot cases that were converted to open, one was due to intraoperative hypotension and arrhythmia and the other due to difficult dissection following failed prior repair . Postoperatively, the presence of transient symptoms was similar between groups, reaching up to 30% . There was a trend towards fewer symptoms in the open group that may be due to achieving a tighter wrap in the robot and laparoscopic groups leading to more gas bloating and abdominal complaints . However, in long - term follow - up, all patients achieved symptomatic relief . The learning curve for the da vinci system played a key role in our surgical times despite previous reports . The 50 robotic cases in our study were distributed among the 3 surgical faculty and 4 pediatric surgery residents during this time . In addition to this, the robot requires several extra steps to achieve assembly in a sterile fashion and to change the instruments . We believe these factors combined would explain why the robot - assisted procedures resulted in both longer operative and total room times compared with the open series . We expect reduced surgical times once the operating surgeons overcome this 10-case learning curve and reduced setup time as well with more practice and repetition of use . Therefore, like others, we have found no proven outcome benefits of using the robot in low- or medium - difficulty cases compared with the laparoscopic approach . Potential benefits over standard laparoscopy include 3-dimensional image quality, camera steadiness, and the dexterity of the instrumentation for dissection and suturing . To better delineate cases that benefit most from each one of the 3 techniques, randomized prospective trials utilizing surgeons past the learning curve is required . Robot - assisted surgery is equivalent to standard laparoscopic surgery in terms of complications and length of stay, with both having significantly increased operation times but reduced length of stay compared with open surgery . Improved results are expected once the learning curve is overcome . However, potential outcome benefits have yet to be proven.
Twenty - eight male new zealand white rabbits weighing 2.5 - 3 kg were anesthetized by intramuscular injection of 50 mg / kg ketamine hydrochloride (ketamine; yuhan, seoul, korea) and 5 mg / kg xylazine (rumpun; bayer korea, ansan, korea) prior to rfa and other procedures . Booster injections of up to one - half of the initial dose were administered as needed . The upper back and lower abdominal areas were shaved and sterilized, and each animal was placed in the prone position on the ct table . To assess the feasibility and safety of saline - enhanced rfa of normal lung parenchyma compared to conventional rfa, rabbits were allocated to either the rfa group (n=10) or the saline - enhanced rfa (srfa) group (n=18). In addition, to compare the histopathologic change in lung parenchyma following srfa and the occurrence of delayed complications, the rabbits in the srfa group were allocated to either an acute (n=10) or subacute subgroup (n=8), and sacrificed at different time intervals after the procedure . In the rfa group (n=10) and the acute subgroup of the srfa group (n=10), unilateral lung rfa was performed in 20 rabbits and all were sacrificed on the day of the procedure . During the subacute phase, eight rabbits were sacrificed on day 7 (n=2), or day 10 (n=2), and at two (n=2) or three weeks (n=2) after rfa . A somatom plus-4 ct scanner (siemens, erlangen, germany) was used to obtain axial scans (2-mm slice thickness and 1.0 - 1.5 pitch) of the entire lung field, and the target portion and appropriate approach route for saline infusion and rfa were thus determined . In the saline infusion group, a polyteflon - coated 21-gauge chiba needle (m.i.tech, seoul, korea) was used for 0.9% saline infusion before and during the application of rf energy . An internally cooled, 17-gauge electrode (radionics; burlington, mass ., u.s.a .) With a 1- or 2-cm active tip was placed in the target area of the lung under ct guidance, and the chiba needle was inserted using the tandem technique (20). To maximize the effects of saline instillation, the tip of the needle was placed 3 mm posterior to the tip of the rf electrode . To confirm the position of the needle and the electrode in the target area, ct scanning was performed . Saline (0.5 ml) was then infused at a rate of 0.1 ml / sec prior to the application of rf energy, and to avoid bronchial aspiration, 1 ml saline at a rate of 0.05 ml / sec was also infused during rfa after frequent pulsing began . An electrode with a 1-cm active tip was used in rabbits in the rfa and srfa groups to evaluate the immediate effects of rfa, while the electrode used in the subacute subgroup to evaluate histopathologic change and delayed complications had a 2-cm active tip . Lesions were created using a 500-khz rf generator (cc-3; radionics) capable of producing 200 w of power . For analyzing the adverse effects of rf energy on lung parenchyma, ablated lesions were induced in the central portion of the lung in 14 rabbits and in its peripheral portion in the other 14 . During the procedure, a thermocouple embedded within the electrode tip continuously measured the local tissue temperature, and tissue impedance was monitored by circuitry incorporated within the generator . A peristaltic pump (watson - marlow; medford, mass ., u.s.a .) Was used to infuse normal saline solution at 0 into the lumen of the electrode at a rate of 10 - 25 ml / min, and this was sufficient to maintain a tip temperature of 20 - 25. when the desired current could not be applied due to a rapid elevation of impedance suggestive of tissue boiling, the generator automatically switched to the pulsed - rf technique (21). Power output was set at 30 w, and rf energy was applied for approximately five minutes on the basis of our earlier study findings (22). Using the same scanner and starting two hours after rfa (day 0), spiral ct scans were obtained to monitor the effects of ablation and to observe morphological change in the lesions at weeks 1, 2, and 3 after rfa . Axial scans (2-mm slice thickness and 1.0 - 1.5 pitch) of both the lung and upper abdomen, including the kidneys, were obtained before and after the injection of contrast medium (6 - 9 ml, ultravist 370; schering, berlin, germany) at a rate of 1 ml / sec through the ear vein . The diameters of the ablated lesions were measured on pacs images by one radiologist using an electric caliper . Imaging analysis: two radiologists experienced in body imaging reviewed pre- and post - ablation ct images of all animals . Each rfa lesion was evaluated in terms of its location, size and shape, attenuation change, and the presence of hemorrhage or air in the pleural cavity, and then classified as either central (inner 2/3) or peripheral (outer 1/3), depending on its location . To ensure that the changes noted were not present before rfa histopathologic examination: after spiral ct examination, rabbits were sacrificed at various points in time by injection of an overdose of ketamine and xylazine, and their lungs were harvested . The gross specimens obtained were dissected in planes similar to those of the spiral ct scans, and were examined . For macroscopic examination, two observers, who reached a consensus, used calipers to measure the central discolored region of coagulation necrosis in each pathologic specimen . Tissues were then fixed in 10% formalin for routine histologic examination, and final processing for light microscopic study involved paraffin sectioning and hematoxylin - eosin (he) staining . Tissues obtained from all treatment areas were analyzed for nonviability, their histologic appearance, and demarcation from surrounding viable tissue . A surgical pathologist and a radiologist evaluated the gross and microscopic findings at each rfa site, and reached a consensus . The technical aspects of rfa (namely, total time needed for the procedure and current or impedance changes occurring) and complications arising were compared for both techniques . For all statistical analysis, spss 9.0 computer software (spss inc ., the size of the acute rf lesions in the two groups was compared using an unpaired student's t test . All contingency data were analyzed using the chi - square test, or fisher's exact test for fewer than five observed events . For all statistical analysis, a p value of less than 0.05 was considered statistically significant . Twenty - eight male new zealand white rabbits weighing 2.5 - 3 kg were anesthetized by intramuscular injection of 50 mg / kg ketamine hydrochloride (ketamine; yuhan, seoul, korea) and 5 mg / kg xylazine (rumpun; bayer korea, ansan, korea) prior to rfa and other procedures . Booster injections of up to one - half of the initial dose were administered as needed . The upper back and lower abdominal areas were shaved and sterilized, and each animal was placed in the prone position on the ct table . To assess the feasibility and safety of saline - enhanced rfa of normal lung parenchyma compared to conventional rfa, rabbits were allocated to either the rfa group (n=10) or the saline - enhanced rfa (srfa) group (n=18). In addition, to compare the histopathologic change in lung parenchyma following srfa and the occurrence of delayed complications, the rabbits in the srfa group were allocated to either an acute (n=10) or subacute subgroup (n=8), and sacrificed at different time intervals after the procedure . In the rfa group (n=10) and the acute subgroup of the srfa group (n=10), unilateral lung rfa was performed in 20 rabbits and all were sacrificed on the day of the procedure . During the subacute phase, eight rabbits were sacrificed on day 7 (n=2), or day 10 (n=2), and at two (n=2) or three weeks (n=2) after rfa . A somatom plus-4 ct scanner (siemens, erlangen, germany) was used to obtain axial scans (2-mm slice thickness and 1.0 - 1.5 pitch) of the entire lung field, and the target portion and appropriate approach route for saline infusion and rfa were thus determined . In the saline infusion group, a polyteflon - coated 21-gauge chiba needle (m.i.tech, seoul, korea) was used for 0.9% saline infusion before and during the application of rf energy . An internally cooled, 17-gauge electrode (radionics; burlington, mass ., u.s.a .) With a 1- or 2-cm active tip was placed in the target area of the lung under ct guidance, and the chiba needle was inserted using the tandem technique (20). To maximize the effects of saline instillation, the tip of the needle was placed 3 mm posterior to the tip of the rf electrode . To confirm the position of the needle and the electrode in the target area, ct scanning was performed . Saline (0.5 ml) was then infused at a rate of 0.1 ml / sec prior to the application of rf energy, and to avoid bronchial aspiration, 1 ml saline at a rate of 0.05 ml / sec was also infused during rfa after frequent pulsing began . An electrode with a 1-cm active tip was used in rabbits in the rfa and srfa groups to evaluate the immediate effects of rfa, while the electrode used in the subacute subgroup to evaluate histopathologic change and delayed complications had a 2-cm active tip . Lesions were created using a 500-khz rf generator (cc-3; radionics) capable of producing 200 w of power . For analyzing the adverse effects of rf energy on lung parenchyma, ablated lesions were induced in the central portion of the lung in 14 rabbits and in its peripheral portion in the other 14 . During the procedure, a thermocouple embedded within the electrode tip continuously measured the local tissue temperature, and tissue impedance was monitored by circuitry incorporated within the generator . A peristaltic pump (watson - marlow; medford, mass ., u.s.a .) Was used to infuse normal saline solution at 0 into the lumen of the electrode at a rate of 10 - 25 ml / min, and this was sufficient to maintain a tip temperature of 20 - 25. when the desired current could not be applied due to a rapid elevation of impedance suggestive of tissue boiling, the generator automatically switched to the pulsed - rf technique (21). Power output was set at 30 w, and rf energy was applied for approximately five minutes on the basis of our earlier study findings (22). Using the same scanner and starting two hours after rfa (day 0), spiral ct scans were obtained to monitor the effects of ablation and to observe morphological change in the lesions at weeks 1, 2, and 3 after rfa . Axial scans (2-mm slice thickness and 1.0 - 1.5 pitch) of both the lung and upper abdomen, including the kidneys, were obtained before and after the injection of contrast medium (6 - 9 ml, ultravist 370; schering, berlin, germany) at a rate of 1 ml / sec through the ear vein . The diameters of the ablated lesions were measured on pacs images by one radiologist using an electric caliper . Imaging analysis: two radiologists experienced in body imaging reviewed pre- and post - ablation ct images of all animals . Each rfa lesion was evaluated in terms of its location, size and shape, attenuation change, and the presence of hemorrhage or air in the pleural cavity, and then classified as either central (inner 2/3) or peripheral (outer 1/3), depending on its location . To ensure that the changes noted were not present before rfa, the post- and preprocedural ct findings were compared . Histopathologic examination: after spiral ct examination, rabbits were sacrificed at various points in time by injection of an overdose of ketamine and xylazine, and their lungs were harvested . The gross specimens obtained were dissected in planes similar to those of the spiral ct scans, and were examined . For macroscopic examination, two observers, who reached a consensus, used calipers to measure the central discolored region of coagulation necrosis in each pathologic specimen . Tissues were then fixed in 10% formalin for routine histologic examination, and final processing for light microscopic study involved paraffin sectioning and hematoxylin - eosin (he) staining . Tissues obtained from all treatment areas were analyzed for nonviability, their histologic appearance, and demarcation from surrounding viable tissue . A surgical pathologist and a radiologist evaluated the gross and microscopic findings at each rfa site, and reached a consensus . The technical aspects of rfa (namely, total time needed for the procedure and current or impedance changes occurring) and complications arising were compared for both techniques . For all statistical analysis, the size of the acute rf lesions in the two groups was compared using an unpaired student's t test . All contingency data were analyzed using the chi - square test, or fisher's exact test for fewer than five observed events . For all statistical analysis, a p value of less than 0.05 was considered statistically significant . Rfa was technically successful in all instances, and 28 lesions were created with or without saline infusion . Since the tip of the rf electrode or chiba needle was easily localized at ct, its positioning was not difficult . The time required for correct needle placement ranged from 1.5 to 3.5 (mean, 2.3 0.6) minutes for rfa and from 2.7 to 4.5 (mean, 3.4 1.5) minutes for srfa (p = .04). In the rfa group, mean initial tissue impedance was 187 24,and in the srfa group, after instillation of 0.5 ml of normal saline, the reading decreased to 134 24 (p <.05). In the rfa group, tissue impedance changed markedly (from 200 to 1000) during the procedure and frequently induced activation of the pulsing technique, whereas in the srfa group, impedance showed no notable change (range, 100 - 500). Without saline infusion, as in the rfa group, impedance rose abruptly within a mean period of 20 4.5 seconds . This automatically initiated rf pulsing, which was followed by alternating 5 - 10-second periods of high - energy deposition and approximately 15-second periods of low energy deposition . With saline infusion prior to and during rfa (srfa group), impedance remained constantly low (at approximately 100) during the first 1 - 2 minutes of rf energy instillation, but an abrupt rise which induced rf pulsing occurred during the second half of the procedure (at mean 107 54 seconds). Additional infusion of saline after the initiation of rf pulsing led to a lower rise in impedance and extended the time of continuous rf energy application . Differences between the two groups in the duration of rf energy instillation before pulsing were statistically significant: 20 4.5 vs. 107 54 seconds (p <.05). In the srfa and rfa groups, the mean maximum diameters of acute lesions induced by a 1-cm active tip, as measured in gross specimens, were 12.5 1.6 and 8.5 1.4 mm, respectively; this difference between the two groups was statistically significant (p <.05) (table 1). In the srfa group, the mean maximum diameter of subacute lesions induced by a 2-cm active tip was 21.3 5.8 cm (p <.05). The complications occurring after rfa are summarized in table 2, and were as follows: pneumothorax (n=8); thermal injury to the chest wall (n=2); hemothorax (n=1); and lung abscess (n=1). Three pneumothoraces were large (with lung volume decrease due to pleural air collection and clinically visible respiratory distress) and five were small (perilesional small air collection, with no evidence of respiratory distress). Complications tended to occur more frequently in the srfa group (55.6%, 10/18) than in the rfa group (20%, 2/10), though the difference was not statistically significant (p = .11). However, complication rates varied between the two groups, depending on the location of the lesions . Among central lesions, large pneumothorax occurred in two rabbits in the rfa group (20%, 2/10) and in one in the srfa group (5.6%, 1/18) (p = .28). Among peripheral lesions, on the other hand, the complication rate was much higher in the srfa group (77.8%) than in the rfa group (p = .02). The complications involved included thermal injury to the chest wall, and one lung abscess . The incidence rates of complications, namely 35.7% (5/14) for centrally located lesions and 50% (7/14) for peripherally located lesions, did not differ significantly (p = .72), though the type of complication involved depended on the location of the ablated lesion . Although the incidence rate of pneumothorax (28.6%, 4/14) was not different between centrally and peripherally located lesions, large pneumothoraces (n=3) or hemothorax (n=1) occurred only in four central lesions (28.6%) adjacent to hilar vessels or bronchi . Major hemorrhage due to electrode penetration of vessels did not occur even where the lesion was located directly on a vessel . After rfa, unenhanced ct scanning revealed circumscribed hyperattenuated regions extending 5 - 8 mm from the portion of the inserted electrode (fig . 1), while contrast - enhanced ct showed no enhancement in the region of altered pulmonary attenuation . Greater conspicuity of coagulated tissues was observed at wide window settings (level=500 hu, width = 2000 hu). At ct imaging, thermal lesions appeared as hazy opacity in the soft tissue window (level=50 hu, width=350 hu) and ranged in diameter from 8 to 19 (mean, 12.6 4.3) mm (figs . 1, 2). At ct imaging at a soft - tissue window setting, acute lesions were round or oval - shaped except in regions abutting pulmonary vessels, and there was no significant difference in the shape of acute lesions between the rfa and the srfa group . However, because of the opacity related to saline infusion in rabbits in the srfa group, the appearance of lesions in the lung window was not well matched with that of gross specimens . Gross examination showed that the diameter of an acute lesion, measured as a central discolored region, was 7 - 14 (mean, 10.9 1.8)mm, and the thickness of the peripheral rim was 1 - 2 mm . The mean difference in lesion size, as determined by ct scanning and pathologic examination, was 3 mm, which was not statistically significant (p>.05). Histological examination of an acute lesion revealed a central charred zone with complete destruction of the parenchyma, including a small central cavity where tissue had been lost . Surrounding this were two zones of eosinophilic coagulative necrosis and a peripheral hemorrhagic rim (figs . 1, 2) one to two weeks following rfa, surrounding tissue was becoming organized into granulation tissue, with an increase of fibroblasts and macrophages and dilatation of blood vessels at the perimeter of the lesion (fig . 3). In a lesion's central zone, typical findings of coagulation necrosis were observed . In centrally located lesions,, granulation tissue had achieved progressive ingrowth into the original area of necrosis, and was replacing it, and there was sharp cut - off between the lesion and normal tissue . The final appearance was of a nodule comprised of central coagulation necrosis surrounded by a fibrous capsule . Since the tip of the rf electrode or chiba needle was easily localized at ct, its positioning was not difficult . The time required for correct needle placement ranged from 1.5 to 3.5 (mean, 2.3 0.6) minutes for rfa and from 2.7 to 4.5 (mean, 3.4 1.5) minutes for srfa (p = .04). In the rfa group, mean initial tissue impedance was 187 24,and in the srfa group, after instillation of 0.5 ml of normal saline, the reading decreased to 134 24 (p <.05). In the rfa group, tissue impedance changed markedly (from 200 to 1000) during the procedure and frequently induced activation of the pulsing technique, whereas in the srfa group, impedance showed no notable change (range, 100 - 500). Without saline infusion, as in the rfa group, impedance rose abruptly within a mean period of 20 4.5 seconds . This automatically initiated rf pulsing, which was followed by alternating 5 - 10-second periods of high - energy deposition and approximately 15-second periods of low energy deposition . With saline infusion prior to and during rfa (srfa group), impedance remained constantly low (at approximately 100) during the first 1 - 2 minutes of rf energy instillation, but an abrupt rise which induced rf pulsing occurred during the second half of the procedure (at mean 107 54 seconds). Additional infusion of saline after the initiation of rf pulsing led to a lower rise in impedance and extended the time of continuous rf energy application . Differences between the two groups in the duration of rf energy instillation before pulsing were statistically significant: 20 4.5 vs. 107 54 seconds (p <.05). In the srfa and rfa groups, the mean maximum diameters of acute lesions induced by a 1-cm active tip, as measured in gross specimens, were 12.5 1.6 and 8.5 1.4 mm, respectively; this difference between the two groups was statistically significant (p <.05) (table 1). In the srfa group, the mean maximum diameter of subacute lesions induced by a 2-cm active tip was 21.3 5.8 cm (p <.05). The complications occurring after rfa are summarized in table 2, and were as follows: pneumothorax (n=8); thermal injury to the chest wall (n=2); hemothorax (n=1); and lung abscess (n=1). Three pneumothoraces were large (with lung volume decrease due to pleural air collection and clinically visible respiratory distress) and five were small (perilesional small air collection, with no evidence of respiratory distress). Complications tended to occur more frequently in the srfa group (55.6%, 10/18) than in the rfa group (20%, 2/10), though the difference was not statistically significant (p = .11). However, complication rates varied between the two groups, depending on the location of the lesions . Among central lesions, large pneumothorax occurred in two rabbits in the rfa group (20%, 2/10) and in one in the srfa group (5.6%, 1/18) (p = .28). Among peripheral lesions, on the other hand, the complication rate was much higher in the srfa group (77.8%) than in the rfa group (p = .02). The complications involved included thermal injury to the chest wall, and one lung abscess . The incidence rates of complications, namely 35.7% (5/14) for centrally located lesions and 50% (7/14) for peripherally located lesions, did not differ significantly (p = .72), though the type of complication involved depended on the location of the ablated lesion . Although the incidence rate of pneumothorax (28.6%, 4/14) was not different between centrally and peripherally located lesions, large pneumothoraces (n=3) or hemothorax (n=1) occurred only in four central lesions (28.6%) adjacent to hilar vessels or bronchi . Major hemorrhage due to electrode penetration of vessels did not occur even where the lesion was located directly on a vessel . After rfa, unenhanced ct scanning revealed circumscribed hyperattenuated regions extending 5 - 8 mm from the portion of the inserted electrode (fig . 1), while contrast - enhanced ct showed no enhancement in the region of altered pulmonary attenuation . Greater conspicuity of coagulated tissues was observed at wide window settings (level=500 hu, width = 2000 hu). At ct imaging, thermal lesions appeared as hazy opacity in the soft tissue window (level=50 hu, width=350 hu) and ranged in diameter from 8 to 19 (mean, 12.6 4.3) mm (figs . 1, 2). At ct imaging at a soft - tissue window setting, acute lesions were round or oval - shaped except in regions abutting pulmonary vessels, and there was no significant difference in the shape of acute lesions between the rfa and the srfa group . However, because of the opacity related to saline infusion in rabbits in the srfa group, the appearance of lesions in the lung window was not well matched with that of gross specimens . Gross examination showed that the diameter of an acute lesion, measured as a central discolored region, was 7 - 14 (mean, 10.9 1.8)mm, and the thickness of the peripheral rim was 1 - 2 mm . The mean difference in lesion size, as determined by ct scanning and pathologic examination, was 3 mm, which was not statistically significant (p>.05). Histological examination of an acute lesion revealed a central charred zone with complete destruction of the parenchyma, including a small central cavity where tissue had been lost . Surrounding this were two zones of eosinophilic coagulative necrosis and a peripheral hemorrhagic rim (figs . 1, 2). There was sharp cut - off between ablated lesions and normal lung . Outside this area, one to two weeks following rfa, surrounding tissue was becoming organized into granulation tissue, with an increase of fibroblasts and macrophages and dilatation of blood vessels at the perimeter of the lesion (fig . 3). In a lesion's central zone, typical findings of coagulation necrosis were observed . In centrally located lesions,, granulation tissue had achieved progressive ingrowth into the original area of necrosis, and was replacing it, and there was sharp cut - off between the lesion and normal tissue . The final appearance was of a nodule comprised of central coagulation necrosis surrounded by a fibrous capsule . Lung cancer is among the most commonly occurring malignancies in the world and is one of the few that continues to show an increasing incidence (23, 24). Although surgical resection is acknowledged to be the treatment of choice and the only therapy with any prospect of cure or long - term survival, in practice a considerable percentage of patients with lung cancer are not eligible for surgical intervention due to the advanced stage of the disease, their limited pulmonary functional reserve, co - morbidities or advanced age (25). Those who are not candidates for surgery can undergo radiation treatment and/or chemotherapy, but survival prospects increase only modestly and gains are often accompanied by substantial toxicity, especially in patients suffering from other co - morbidities (26). Nevertheless, the development of nonsurgical and minimally invasive percutaneous techniques for the treatment of lung cancer would be advantageous . Effective options might prove useful for patients with multiple medical problems, co - morbid disease, or concomitant tumor, or for whom surgery carries high risks . After encouraging results of rfa in the liver, some researchers have suggested that the procedure could be used for the treatment of lung malignancies (13 - 17). The main advantage of rfa is that it is simple, easy to perform and offers the option of an indefinite number of repeated applications . A drawback, however, is that it is often necessary to overlap ablations by multiple repositioning of the electrode in order to decrease marginal recurrence after rfa (6). Furthermore, if lung tumors are to be treated by rfa, the naturally high impedance of air - containing lung tissue and the risk of pneumothorax related to multiple passes through the pleura during rfa might be an obstacle to induction of complete tumor necrosis . If these inherent problems of rfa of lung tumors are to be solved, ablation must produce a larger coagulation area that could include focal lung malignancies and some safety margin . Several investigators have demonstrated the possibility of increasing rf tissue heating and coagulation during rf ablation by altering electrical and/or thermal conduction through the injection of saline into the tissues during rf application (18, 19). The present study was conducted to assess the actual effect of simultaneous infusion of saline during rfa, and possible resultant complications . In our study, the mean diameter of rfa lesions in the saline infusion group was significantly greater than in the control group: 12.5 mm vs. 8.5 mm (p <.05). In addition, initial impedance in the srfa group was significantly lower than in the rfa group (p <.05), and tissue impedance did not change markedly . Thus, in the srfa group, high - rf energy instillation over a long period was possible, but in the rfa group, impedance changed rapidly during the procedure, frequently inducing activation of the pulsing technique . Furthermore, impedance was decreased by additional infusion of saline during the application of rf energy . This increases tissue ionicity and decreases tissue impedance, thereby permitting greater current flow, and the heated liquid spreads thermal energy further and faster through the tissue than does heat conduction (28, 29). In this study, an internally cooled electrode was used for rfa, together with the pulsing technique, and the resultant lesion was larges than that made by the conventional electrode used in previous studies (21, 27, 30). Nonetheless, even with an internal cooling mechanism and pulsing technique, impedance rose rapidly and uncontrollably during rf energy instillation, inducing frequent pulsing and leading to restrictions in the size of lesions . After saline infusion, however, the period of rf energy instillation increased, and with it, lesion size . Our results agreed with those of previous studies of saline - enhanced rfa of the liver and retroperitoneum (31 - 33). As demonstrated in this investigation, an extended volume of coagulation necrosis due to saline infusion may increase the clinical utility of rfa therapy by permitting successful treatment of larger lung tumors or reducing the number of sessions needed for the treatment of a given tumor . This finding is of particular importance in the application of rfa to the treatment of lung cancer, since in order to decrease the occurrence of pneumothoraces, electrodes should pass through the pleura as infrequently as possible . If the incidence of pneumothorax can be reduced, more patients may benefit from this potentially curative therapy, with its reduced medical and social costs . Procedure - related complications arose in 12 cases, comprising eight pneumothoraces, two thermal injuries to the chest wall, one hemothorax, and one lung abscess (table 2). Their incidence tended to be higher in the srfa group (55.6%) than the rfa group (20%), though the difference was not statistically significant (p = .11). For the peripheral lesions, however, the complication rates among rabbits in the srfa group (77.8%, 7/9) was higher than among those in the rfa group (0%) (p <.05). The relatively high incidence rates (28.6%, 8/28) of pneumothorax in this study were related to the small size of rabbit lung, the relatively large size of the electrodes, and the additional use of a chiba needle with an electrode in the srfa group . We believe that if the electrode used during rfa is adequate, permitting simultaneous instillation of saline during rfa in large animals or in clinical trials, the incidence rates of pneumothorax could decrease markedly . According to earlier reports of saline - enhanced rfa (18, 19, 31, 32), direct and uncontrollable thermal damage to both adjacent and remote structures was observed more frequently in the saline infusion group than in the conventional rfa group . To decrease this damage, we used a very small amount of saline (1.5 ml) at a slow infusion rate (approximately 0.05 ml / sec), and it is possible that the two cases of unexpected thermal injury to the chest wall and diaphragm resulted from drainage of steam or saline through low - resistance tissue . A further possible drawback of saline - enhanced rfa, also involving this steam or saline drainage, is that the lesions produced may be somewhat irregular in shape, rather than spherical . However, most ablated lesions in the present study were spherical, and we believe that instillation of a larger amount of saline than we used could be related to the formation of irregularly shaped lesions . The clinical role of rfa in the treatment of lung tumors is still not clear but will undoubtedly evolve . For example, in patients with hemoptysis or cough in whom radiotherapy has not controlled the symptoms or cannot be undertaken due to poor lung function or co - morbidity, this technique might play a primarily palliative role . We believe that in lung cancer patients, rf ablation possesses several potential benefits compared with systemic chemotherapy or radiotherapy . First, because the therapy is local in nature, it is likely to minimize damage to lung parenchyma and reduce adverse systemic affects on a patient's general health, and for this same reason, rf ablation therapy can be utilized in patients with limited pulmonary reserve . It is less likely to have a curative role for stage - i tumors because many patients with peripheral tumors who have poor lung function can be offered limited resection, such as wedge resection or segmentectomy by video - assisted thoracoscopic surgery (34 - 36). However, a randomized trial of lobectomy versus limited resection for stage - i lung cancer showed that the latter did not confer improved perioperative morbidity or mortality . Furthermore, even if less invasive than open surgery, limited resection also requires general anesthesia (35). There could, therefore, be a role for rfa as a less invasive alternative to metastasectomy, but for the present, the greatest clinical utility of rfa may be in patients with small peripheral lung cancers who are poor candidates for surgery . First, the results obtained in healthy rabbit lung may differ from those obtained with non - small - cell human lung carcinoma . However, aspects of the process of cell degeneration caused by the effect of heat on tissue lead us to believe that the results might well be the same with either normal lung tissue in rabbits or human lung cancer cells . Second, rabbit lungs are smaller than the size of the rf ablation zone that can be produced with the currently available rf electrode system, and the effectiveness of saline infusion during rfa may thus not be entirely comparable between the two groups . In addition, since the 17-gauge electrode used in this study is too large for rabbits, with their relatively smaller lungs, the complication rates of rfa might be overestimated . In conclusion, ct - guided percutaneous transthoracic rfa with simultaneous hypertonic saline infusion is feasible, and more effectively produces coagulation necrosis than rfa without saline infusion . Saline - enhanced rfa might be a promising technique for the management of inoperable lung malignancies and has the potential for use as a minimally invasive approach . To determine whether the technique can be feasibly and safely used to produce a sufficiently large volume of necrosis to be of value in the treatment of small peripheral lung tumors in patients for whom surgery or palliative radiotherapy is unsuitable, further study using a larger animal model is warranted
Genome - wide association (gwa) studies are now well established for discovering hypothesis - free genetic loci whose variations are associated with a phenotype [1 - 4]. Downstream analysis of the study result in terms of gene sets is gaining popularity these days, as it facilitates biological interpretation of a gwa result . The korea association resource (kare) project has collected epidemiological and genotype data from the regional cohorts in ansung and ansan, korea . A number of gwa studies based on this kare data have been published so far [6 - 8]. We pursued re - analyses of these studies in terms of gene sets in a systematic way to warrant cross - comparisons of the traits . We mimicked the analysis conditions of the original published gwa works as much as possible, based on the de facto standard program plink . For the gene set analysis, we used gsa - snp software, an efficient java - based application that accepts a list of single nucleotide polymorphisms (snps) and their association p - values and outputs the gene set p - values after multiple testing correction . We applied this procedure to 49 baseline quantitative traits that were of epidemiological, anthropometric, or blood chemistry parameters . As expected, those traits that are known to share common biological mechanisms and to overlap in their population incidences indeed showed similar profiles of the significantly associated gene sets . To our surprise, some of the traits that were phenotypically uncorrelated in our study population and were seemingly unrelated to each other showed similar profiles of the significantly associated gene sets . Our results may demonstrate a useful strategy of discovering pleiotropy, which refers to a phenomenon of common pathways involved in distinct phenotypes . Briefly, the genotype data were measured for a total of 10,038 residents in both ansung and ansan provinces, korea, using affymetrix genome - wide human snp array 5.0 chips (affymetrix inc ., after quality control, 352k snp genotypes for 8,842 samples were used in the subsequent gwa analyses . The epidemiological trait data for these individuals were also received from the kare project . Among a total of 49 quantitative traits gwa analyses of these 49 quantitative traits were performed by linear regression under the additive genetic model, as implemented in plink . We performed gsa using the gene ontology (go) databases, where only gene sets having 10 - 200 members (2,476 biological process go terms) were used . We applied the z - statistic method, as implemented in gsa - snp, with the default options . Briefly, those snps residing inside or within 20 kb of the boundary of each gene were compiled, and the second best p - value was assigned to the gene . See kwon et al . For the rationale of using the second best p - value instead of the best p - value . The gene score was defined as the -log of the p - value assigned to the gene . The p - values for each gene set were computed under the assumption of a normal distribution of the z - statistic, followed by multiple testing correction using the false discovery rate method . When the member genes of a gene set overlapped in their genomic loci or were located in tandem within a short block of strong linkage disequilibrium, the p - values assigned to them might have been highly correlated . In such cases, the r package gosemsim was developed to compute semantic similarity among go terms, sets of go terms, gene products, and gene clusters . This package contains functions to estimate the semantic similarity of go terms based on resnik's, lin's, jiang and conrath's, rel's, and wang's methods . Here this method determines the semantic similarity of two go terms based on both the locations of these terms in the go graph and their relationships with their ancestor terms . The similarity index between the two go terms was between 0 (the least similar) and 1 (identical). First, the highest value against all members of the other set was calculated for a given go term in one of the sets . Then, all of these values were collected and averaged to provide the similarity between the two sets . The significance of the similarity index was inferred, based on the distribution of the indices from 10 random samplings . Briefly, the genotype data were measured for a total of 10,038 residents in both ansung and ansan provinces, korea, using affymetrix genome - wide human snp array 5.0 chips (affymetrix inc ., after quality control, 352k snp genotypes for 8,842 samples were used in the subsequent gwa analyses . The epidemiological trait data for these individuals were also received from the kare project . Among a total of 49 quantitative traits gwa analyses of these 49 quantitative traits were performed by linear regression under the additive genetic model, as implemented in plink . We performed gsa using the gene ontology (go) databases, where only gene sets having 10 - 200 members (2,476 biological process go terms) were used . We applied the z - statistic method, as implemented in gsa - snp, with the default options . Briefly, those snps residing inside or within 20 kb of the boundary of each gene were compiled, and the second best p - value was assigned to the gene . See kwon et al . For the rationale of using the second best p - value instead of the best p - value . The gene score was defined as the -log of the p - value assigned to the gene . The p - values for each gene set were computed under the assumption of a normal distribution of the z - statistic, followed by multiple testing correction using the false discovery rate method . When the member genes of a gene set overlapped in their genomic loci or were located in tandem within a short block of strong linkage disequilibrium, the p - values assigned to them might have been highly correlated . In such cases, the r package gosemsim was developed to compute semantic similarity among go terms, sets of go terms, gene products, and gene clusters . This package contains functions to estimate the semantic similarity of go terms based on resnik's, lin's, jiang and conrath's, rel's, and wang's methods . Here, we used wang's method for our analysis . This method determines the semantic similarity of two go terms based on both the locations of these terms in the go graph and their relationships with their ancestor terms . The similarity index between the two go terms was between 0 (the least similar) and 1 (identical). First, the highest value against all members of the other set was calculated for a given go term in one of the sets . Then, all of these values were collected and averaged to provide the similarity between the two sets . The significance of the similarity index was inferred, based on the distribution of the indices from 10 random samplings . Parallel and systematic gwa studies of a number of traits using a single genetic epidemiology dataset give a unique opportunity to explore common biological pathways regulating multiple traits that do not display phenotypic correlations . In this report, we focused on the 49 baseline quantitative trait data that were demographic, anthropometric, or blood chemistry parameters . We surveyed the literature for the published gwa studies, based on the kare data, and extracted the information on the analysis conditions, such as exclusion of samples and covariates of association regression . For the gwa analyses of all 49 traits, we included area, age, and sex as covariates, and for some of the traits, additional covariates were added, based on the literature information (table 1). For example, the directions pointed by waist and body mass index (bmi) were similar in the pca plot (fig . 1); using bmi as one of the covariates for the analysis of waist . On the contrary gwa analyses for all 49 traits were performed using linear regression, as implemented in plink, and the resulting snp p - values were fed into gsa - snp for gene set analysis . For each of the 49 traits, we identified biological process go terms that showed p <0.05 after multiple testing correction (the lists are available upon request). As go terms are hierarchically arranged, verbatim matches are not desirable for the comparison of a pair of gene sets . Instead, one should take into consideration the number of nodes in the go tree that separate a pair of terms . For this, we used so - called semantic similarity, as implemented in the r package gosemsim . For each pair of traits, we calculated the semantic similarity of the gene sets and plotted it against the correlation coefficient between the trait values (fig . The pairs showing semantic similarity greater than 0.8 corresponded to traits that had high correlations in the trait values . We selected 46 trait pairs that showed a semantic similarity in gene sets greater than an arbitrary cutoff of 0.75 and depicted the interaction network using cytoscape (fig . 3). The traits related to blood lipid levels, such as total cholesterol, high density lipoprotein cholesterol, low density lipoprotein cholesterol, and triglycerides (tgs), formed a small network by themselves . As cholesterol and tgs are components of lipoproteins, it is not surprising to observe such a network . Both hip and waist - hip ratio are connected to suprailiac skinfold; they are all related to body fat . The most striking feature is a large network involving 20 traits . In this network, the traits related to blood glucose levels, such as glu0, glu60, glu120, hba1c, and homa, form a subnetwork . In addition, the traits related to either blood pressure or liver damage also formed respective subnetworks, as expected from their high phenotypic correlations . Interestingly, the ph level was connected to 7 other traits, none of which showed high phenotypic correlations with it . We examined the gene sets that were commonly shared between these traits (table 2). Among them, 11 were related to neuron development and function . We surveyed the literature for putative involvement of neuronal or nerve systems in the regulation of those 8 traits (table 3). Although it is presumptive, this may imply that these traits are regulated partly by common pathways that involve the neuronal system . In conclusion
Oculo - orbital malformations are developmental anomalies of the eye and/or ocular adnexa . In europe, its prevalence in the general population varies between 2.2 and 14 per 10,000 births.1 african studies have mainly reported cataract and congenital glaucoma as the most frequent types of eye malformations.24 malformations of the eye and orbit can be isolated or associated with other systemic malformations . To the best of our knowledge, the aim of this study was to describe the clinical aspects of a series of oculo - orbital malformations among children seen at the ophthalmology unit of the yaound gynaecology, obstetrics and pediatrics hospital . We carried out a retrospective study in which all children aged 05 years who were seen at the ophthalmology unit of the yaound gynaecology, obstetrics and pediatrics hospital from january 2003 to december 2009 were included . The medical records of all children diagnosed with a malformation of the eye and/or ocular adnexae were retained . In children with multiple malformations, the following variables were analyzed: age at first consultation (diagnosis), sex, and the various malformations observed . A total of 2254 children aged 05 years were examined in the ophthalmology unit during this period, and 150 of them were diagnosed with eye malformations, representing 6.65% of our consultations . There were 78 boys (52%) and 72 girls (48%), corresponding to a male - to - female ratio of 1.08 . Eye malformations were diagnosed in 71.66% (n = 107) of cases during the first year of life . Table 1 presents the distribution of children according to the age at which their malformation was diagnosed . Diagnosis was made in 72.66% of cases (n = 109) during the first year of life, with 11.33% of cases (n = 12) diagnosed during the first month . A total of 159 malformations were identified from the 150 files selected, considering that a child could present with one or several malformations . Congenital lacrimal duct obstruction (cldo) was the most frequent malformation, with a total of 106 cases out of 159 (66.66%). It was unilateral in 90 patients (84%) and bilateral in 16 patients (15.10%). Congenital cataract was second, with 17 cases (10.69%), unilateral in 41.18% of cases (n = 7) and bilateral in 58.82% of cases eight cases of congenital glaucoma were diagnosed (5.03%); it was more frequent among boys (five boys against three girls). Congenital glaucoma was diagnosed in 62.5% (n = 5) of cases before the age of 1 year and in 37.5% of cases (n = 3) between 1 and 3 years . With regards to microphthalmos, eight cases (5.03%) six cases of ptosis (3.77%) were recorded and one bilateral aniridia associated with a case of congenital glaucoma without an associated systemic anomaly . The relevance of this study lies in the fact that it is a pioneer study in this domain in cameroon . It is intended to provide the basis for prospective studies that will specifically target each of the anomalies identified, especially the most frequent ones . A prevalence of 1.7% was reported in nigeria by lawan2 and 2.2% in the democratic republic of the congo by kaimbo wa kaimbo et al.5 the difference between these results may be explained by the heterogeneous nature of the study population in each study . The age group was 010 years in the study carried out by lawan; and 025 years in that by kaimbo wa kaimbo et al . The true prevalence of eye malformations could not be determined in this study because the total population served by this unit could not be easily assessed . The yaound gynaecology, obstetrics and pediatrics hospital is a referral center for the management of mother - and - child diseases, and therefore the majority of children seen are referred cases . Several authors have reported that males are more affected.27 late diagnosis, which was observed in this study, might be due to the lack of attention given to suspicion of eye malformations in infants by mothers and medical practitioners . On the contrary, studies carried out in europe report a diagnosis rate of 80% during the first week of life.8,9 in this study, congenital cldo was the most frequent malformation . This is contrary to the studies conducted by lawan2 and bodunde and ajibode,3 both in nigeria, where cldo was the third - commonest eye malformation after congenital cataract and congenital glaucoma . Cldo among children is most often caused by failure of hasner s valve to open spontaneously.10 the majority of cases resolve spontaneously during the first year of life with massage and local antibiotic therapy.11,12 congenital cataract, which was the second most frequent malformation in this study, is the main cause of blindness and low vision among children.13 mature forms require early surgery as well as long - term and rigorous management of amblyopia, which requires the participation of the child and his / her family.14 in immature forms allowing for visual development, surgery may be delayed until the child starts learning to read or even until it becomes impossible for normal schooling.14 intrauterine infections by toxoplasmosis, rubella, cytomegalovirus, and herpes (torch) microorganisms, especially congenital rubella, are known for being responsible for congenital cataract.4,15 torch infection screening, although recommended during pregnancy, is not always done for several reasons: firstly, practitioners do not frequently request the tests, and secondly, even when requested, they are not done due to lack of means to pay . Cameroon is a developing country without a social security policy allowing for low - cost medical coverage . Congenital glaucoma (figure 1) was diagnosed in 62.5% of cases during the first year of life . This is less than those reported by several african studies,6,7,16 in which the diagnosis was made in 73%82% of cases during the first year of life . It is also lower than the result obtained by zech and ravault in lyon, who reported 80% of cases before the age of 1 month.8 congenital glaucoma presents a surgical emergency, but the delay in diagnosis and hence late management in the african context might be explained by the fact that parents are ignorant about the signs . The equal distribution between bilateral and unilateral forms is contrary to data published in the literature, where bilateral cases are more predominant . This predominance is explained by the hereditary nature of the illness.79 microphthalmos was eight times more frequent than clinical anophthalmos (figure 2), both of which are incompatible with normal visual development resulting from an arrest in the development of the primary optic vesicles at the embryonic stage.17 with regards to ptosis, its prevalence worldwide is unknown, and it is unilateral in most cases.18 in severe cases of ptosis, the drooping eyelid can cover part of or the entire pupil and interfere with vision, resulting in amblyopia.19 bilateral aniridia is rare, with prevalence varing between 1/64,000 and 1/100,000.20,21 it is caused by a mutation in the pax6 gene, located on human chromosome 11, and is usually associated with other eye and systemic anomalies . Cataract is found in 50%85% of patients suffering from bilateral aniridia.20 ectopia lentis, which is considered a major diagnostic criterion for marfan s syndrome,22 was found in one patient . It is caused by a deficient development of the zonule, which like elastic tissue is of mesodermic origin.23 goldenhar syndrome (figure 3) also known as oculoauriculovertebral dysplasia, is a rare congenital anomaly involving derivatives of the first and second branchial arches.24 its main ocular manifestation is limbal dermoid, which is found in 30%60% of cases and is a cause of astigmatism, amblyopia, and strabismus.25 persistent hyperplastic primary vitreous results from failure of the primary vitreous and hyaloid vasculature to regress . Its unilateral localization, which was found in this study, exists equally in literature, where it represents 90% of cases.26 other malformations, such as cryptophthalmos, iris coloboma, and the usher syndrome, described in the literature4,15 were not identified in this study . Eye malformations in children may lead to visual impairment . Consequently, systematic postnatal screening for early detection and management are recommended . Close collaboration among pediatricians, general practitioners, and ophthalmologists for a multidisciplinary care approach is necessary.
Demand for improvement of quality of therapists has increased with the recent advancement in medical technologies and the growing understanding of society toward rehabilitation medicine1 . However, the basic scholastic ability of students enrolled in training schools is not increasing . The minimum attainment level for pre - graduation education was changed from becoming able to perform basic physical therapy to becoming able to perform basic physical therapy with some advice and supervision by the physical therapy education guidelines3 . A previous study4 reported that most novice physical therapists (pts) need supervisors advice and cannot accomplish their duties independently . Other previous studies5,6,7,8,9 suggest that novice pts do not have sufficient clinical skill and thus require postgraduate education . In the current japanese situation first, postgraduate education is performed in individual facilities, which have their own characteristics and are thus not homogenized10 . In other facilities, novice pts rotate among different departments based on the type or stage of disease12 . Regarding the relation between the number of therapists and the education system, postgraduate education systems are better established in a facility with a large number of therapists13 . Second, many members of the japanese physical therapy association are young, with ages ranging from 2030 years3, 4.thus, lack of supervising therapists is also a crucial problem . Under these circumstances, the postgraduate education systems are not likely to ensure a certain level of quality . To maintain a level of educational quality, setting an explicit goal, goal setting has a second - order effect that promotes self - directed learning based on adult learning theories14 . In line with these perspectives, the medical education system has compulsory post graduation clinical training for 2 years that has an explicit goal15 . In the nursing education system, postgraduate training goals and guidelines on supervision have been established as well16 . However, in the therapist education system, goals for post graduation therapists have not been determined yet . To achieve a certain level of quality in novice pts, the first goal is for them to be able to implement their duties independently . The aim of this study was to clarify the essential abilities of novice physical and occupational therapists for independent execution of their duties and to develop an assessment tool . First, semi structured interviews were conducted on 15 experienced therapists to create a comprehensive list of essential abilities that novice therapists need17 . Second, 30 experienced therapists participated in a two - round delphi study to select items for the assessment tool being developed for novice therapists . Therapists working in hospitals, training schools, or geriatric health services facilities; those with experience in supervising other therapists; and those with management experience were included in the study . All experienced therapists were provided with oral explanations regarding the details of this study as ethical considerations . The study was conducted with the approval of the ethics committee of fujita health university (13 - 254). Before the interview, the definition of therapist who is able to implement their duties independently (table 1table 1.definition of terms and the interview guidedefinition of terms: therapists who are able to independently implement their duties1) having basic clinical skills that all therapists should develop regardless of individual domain expertise 2) not requiring supervisors active guide3) being able to behave appropriately in workplaces (as members of society)the details of an interviews guide used in this study:please answer the following questions, envisioning what you supervise novice therapists:1) when do you feel that therapists under your supervision reach the level enough to routine clinical practice independently?2) what actions do you expect such novice therapists to achieve under your supervision?3) when you have been brought up as a therapist, what type of experience did you need to become able to independently implement your duties? ), which was defined based on the definition of doctors basic clinical ability18, was presented to participants to ensure that the term has the same meaning to the subjects . All participants were simultaneously interviewed using with focus group semi structured interview methods19 based on an interview guide (table 1). The participants were asked to imagine supervising other therapists and answer questions such as, what novice pt behaviors affect your appreciation that therapists under your supervision have the ability to fulfill their professional duties independently? The researchers encouraged the participants to verbalize their thought and listened with close attention . All interview contents were recorded using an ic recorder and were converted into character data to create narrative records . Therapists who are able to fulfill their professional duties independently and classified the contents into categories based on similarity of content . We used 5-point rating method (1=unnecessary; 2=relatively necessary; 3=necessary; 4=absolutely necessary but may not be achieved within 6 months; 5=absolutely necessary and should be achieved within 6 months) focusing on therapists who are able to fulfill their professional duties independently . In the second round, the ratings of each rater and the frequency distribution, median, and interquartile range of all participants ratings were presented . Subsequently, all raters were again asked to rate the items extracted from the first round . Using the results of the second round, the items where more than 80% of the total number of experienced therapists scored a rating of 4 or 5 were adopted as evaluation items . Then, these items were classified based on semantic similarity, and each category was named by the abstraction of their semantic contents . To confirm the reliability of the results, the items must also be classified into such categories by other experienced therapists serving as third party . Based on the classifications set by the researchers and third - party therapists, one hundred fifty - six items were extracted from data obtained through interview with 15 experienced participants in relation to abilities necessary for therapists to fulfill their professional duties independently . By unifying similar or overlapping items, these items were aggregated to 86 items . After a considerable discussion using two - round delphi technique, these items were classified into three categories: basic attitudes, 19 items; therapeutic skills, 20 items; clinical practice - related thoughts, 16 items (table 2table 2.outcomes of the development of a clinical ability evaluation table for therapistsevaluation items: basic attitudeusing appropriate language as a member of societyadhering to appointed times and deadlinescomplying with rules in the workplaceunderstanding the role and duties of the therapist as a team memberadopting appropriate actions in consideration of the role of the therapist as a team membercontributing to the improvement of coordination as a team memberefficiently implementing duties so as to be completed within working hoursappropriately understanding and considering confidentiality and personal information managementperforming appropriate infection control measures (including hand wash)performing appropriate equipment management (before and after use)performing treatment, with a sense of responsibilityappropriately managing the therapist s own physical condition and schedule and avoiding interfering with his / her dutiesappropriately implementing reporting, communication, and consultation procedures (developing and expressing the therapist s own thoughts) in all timesidentifying problems which are difficult to independently addressconsulting problems which are difficult to independently address with appropriate persons in appropriate situationsseriously accepting and addressing issues noted by the supervisor or the therapist s own failuresdeveloping positive attitudes and making efforts to achieve knowledge and skillsperforming treatment and implement duties based on learning outcomes and experiencetherapeutic skillsadopting appropriate measures, such as life - saving techniques, to manage sudden changes in patients conditionsappropriately dealing with individual patients in consideration of their symptomsusing appropriate verbal or non - verbal communication methods for individual patientsshowing empathy when communicating with patients in consideration of their psychological conditionsappropriately listening to patients and their families to clarify their needshaving medical knowledge necessary for a therapistselecting appropriate evaluation items for individual patientsperforming vital (blood pressure and heart rate) measurement, according to each situationappropriately (and also accurately, efficiently) conducting medical interviews with patientsappropriately (and also accurately, efficiently) examining reflexesappropriately (and also accurately, efficiently) conducting orthopedic examinationappropriately (and also accurately, efficiently) evaluating painappropriately (and also accurately, efficiently) evaluating coordinationappropriately (and also accurately, efficiently) evaluating muscle toneappropriately (and also accurately, efficiently) measuring the range of motionappropriately (and also accurately, efficiently) evaluating the muscle strengthappropriately (and also accurately, efficiently) conducting sensory examinationappropriately (and also accurately, efficiently) performing morphometryappropriately (and also accurately, efficiently) evaluating the motor function of patients with paralysis (using the sias and brunnstrom stage test)appropriately (and also accurately, efficiently) evaluating adl (using instruments, such as the fim and barthel index)clinical practice - related thoughtsclarifying individual patients general characteristicsidentifying individual patients possible risks based on the results of examinationlogically examining the causes of problems in movements or activities of daily livingdeveloping treatment programs to achieve goals (also referring to literature)safely implementing treatment programssafely handling treatment devicesappropriately managing risks related to medical accidents, such as tube removal and bleedingappropriately managing risks related to fallsproviding appropriate range - of - motion trainingproviding appropriate muscle - strengthening trainingproviding appropriate assistance and guidance for the maintenance of sitting positionsproviding appropriate assistance and guidance for the maintenance of standing positionsproviding appropriate assistance and guidance for standing from a seatproviding appropriate assistance and guidance for transferproviding appropriate assistance and guidance for gait trainingcontinuously evaluating (and observing) patients in the progress of treatmentcriteria: ratings . 4=being able to accurately understand and adopt appropriate actions without supervision . 3=being able to accurately understand and adopt appropriate actions under monitoring and supervision . 2=being able to understand and adopt appropriate actions to a certain extent under monitoring and supervision . 1=being unable to understand or adopt appropriate actions even under monitoring or supervision . 0=being inappropriate for implementation . ). The coefficient, representing the agreement rate between the researcher and third - party experienced therapist, was 0.86 . Criteria: ratings . 4=being able to accurately understand and adopt appropriate actions without supervision . 3=being able to accurately understand and adopt appropriate actions under monitoring and supervision . 2=being able to understand and adopt appropriate actions to a certain extent under monitoring and supervision . 1=being unable to understand or adopt appropriate actions even under monitoring or supervision . 0=being inappropriate for implementation this study adopted the sequential exploratory strategy performed from a qualitative approach to a quantitative approach in a phased manner21, 22 . In other words, the data were collected qualitatively and examined quantitatively using the delphi technique, which is a questionnaire method with repetitive feedback23,24,25 . As a result, the focus group interview used in the present study might be effective in facilitating the collection of a broad range of opinions from experienced therapists because similar experiences about supervision assists in causing a sense of empathy and stimulates the discussion . The items were classified into three categories: basic attitudes, therapeutic skills, and clinical practice - related thoughts . The high coefficient between classifications by the researcher and a third - party therapist suggest high reliability of the classification . The basic attitudes category consisted of items associated with the ability for continuing self - education, as mentioned in the japanese physical therapy association s code of ethics26 . In addition, an attitude of humility toward each patient and a cooperative attitude toward other professionals were included in this category . Thus, the results suggest that knowledge of these social skills is also important in the postgraduate education of novice therapists . The therapeutic skills category consisted of abilities associated with collection of medical information such as communication with patients and assessment technique . These items suggest that novice therapists should have a certain amount of communication skill in addition to medical knowledge . Thus, optimal communicational education methods have to be developed for the postgraduate education of novice therapists . The clinical practice - related thoughts category included items associated with integration of patient information obtained from medical assessment, determination of disabilities (impairment, activity limitation, participation restriction), planning of therapeutic program, re - evaluation, and corresponding plan revision . These items are substantially coincident with the clinical reasoning model proposed by edwards, which includes a set of processes such as the recognition and interpretation of medical information, development and revision of hypothesis, determination of intent, and re - evaluation after intervention27 . In the present study, experienced therapists were encouraged to consider not only knowledge of implementing therapy - related duties, clinical practice - related thoughts, or therapeutic skills, but also appropriate social skills and attitudes, self - management, and self - education, for continuous self - improvement . The 55 evaluation items may cover all domains defined in the taxonomy (cognitive, emotional, and psychomotor), which is a concept often used in medical education and services28 . Therefore, the preset items might accurately represent the abilities needed by therapists to implement their duties independently and should be the appropriate goals of novice therapists.
Video laryngoscopes (vl) which work on the principles of indirect laryngoscopy have become popular in clinical practice . They provide a significantly better view of the larynx, which may be useful in difficult tracheal intubation scenarios . The key novel feature of these indirect laryngoscopes is that they facilitate visualisation of the vocal cords without the need to align the oropharyngeal and tracheal axes . Kaplan and berci introduced c - mac vl (karl storz, tuttligen, germany) in 2003 . It has been found to improve cormack - lehane (c - l) grading by 2 to 1 grade and possibly aid easier intubation . It provides both a direct laryngoscopic view and a small digital camera view that is displayed on the video screen, in contrast to many previous vls . Recognition of the anatomical structures and anomalies is easier, and manipulation of airway devices is facilitated . Nasotracheal intubation (nti) is often required for head and neck surgeries like tonsillectomies . Direct laryngoscopy with the macintosh blade, with the use of magill's forceps to direct endotracheal tube (ett) into glottic opening, is time - consuming and may lead to trauma to surrounding structures and damage ett cuff . Hence, this study was conducted to assess the intubating conditions, using the conventional macintosh laryngoscope and the storz c - mac vl during nti in paediatric patients posted for tonsillectomy surgeries . This prospective randomised study was conducted after obtaining approval from the institutional review board (iec no . Patients of either sex, aged between 8 and 18 years, belonging to american society of anesthesiologists physical status i, ii and mallampati grade i, ii were included and study was conducted between january 2013 and june 2014 . Parents who refused to give consent, patients with significant systemic disease and patients having contraindications for nti were excluded from the study . The procedure was explained to the patients and written informed consent from parent / guardian was obtained . Patients in group 1 underwent conventional laryngoscopy using macintosh direct laryngoscope and group 2 underwent videolaryngoscopy using c - mac vl for nasal intubation . The sample size was estimated based on a pilot study carried out in 10 patients where it was found that mean intubation times for the macintosh group, and the c - mac group were 55 s and 45 s respectively with standard deviation (sd) of 5 s. based on these figures and using alpha error = 0.05 and 0.85 power of the study, we got the required sample size of 25 each . Hence, we recruited 30 into each group by increasing the sample size by 5 . The investigator who performed the intubation in this study had previously performed about 100 nti using c - mac vl . After connecting the routine pre - induction monitors, baseline values of systolic blood pressure (sbp), diastolic blood pressure (dbp), mean blood pressure (mbp), heart rate (hr) and oxygen saturation (spo2) were recorded . All patients were pre - medicated with injection glycopyrrolate 10 g / kg, injection fentanyl 2 g / kg and injection midazolam 10 g / kg intravenous (iv). Anaesthesia was induced with injection propofol 2 mg / kg iv and neuromuscular blockade achieved with injection vecuronium 0.1 mg / kg . Patients were ventilated with oxygen, nitrous oxide (33:67 ratio) and end - tidal concentration of isoflurane 0.81.2 as observed on the gas monitor for initial 4 min, followed by ventilation with 100% oxygen for 1 min before intubation . Preservative free injection lignocaine 1.5 mg / kg iv was administered 90 s before intubation . Five minutes after giving injection vecuronium, ensuring adequate muscle relaxation, lubricated appropriate sized nasotracheal ett was inserted through the most patent nostril until its tip lay in the oropharynx . Laryngoscopy was then performed using either macintosh laryngoscope (blade size 2 or 3) or storz c - mac vl (macintosh blade size 2 or 3) as per the group and a view of laryngeal opening was obtained . Initially, attempt was made to pass the ett through the vocal cords without the aid of manoeuvres (m0). If difficulty was encountered, additional external manipulations (m1) such as head flexion, rotation of tube and backwards, upwards, rightwards pressure (burp) were used . In case of failure to intubate using above manoeuvres, cuff of the ett was inflated with approximately 10 ml of air and the ett brought into view (m2) (as per study done by baddoo hk et al . ). Once the tip of ett was in the glottic opening, cuff was deflated; the ett was then advanced into the trachea and then cuff was reinflated . If this technique failed then, cuff was deflated, and magill's forceps alone (m4) or in combination with burp (m5) was used to position and guide the tube . The manuoevres were followed in the sequence described in table 1 . If there was failure to intubate with all the above - said manoeuvres, oral intubation was performed . Correct placement of ett was confirmed by auscultation over the chest for bilateral equal air entry and using capnograph . Sequence of additional manoeuvres used in the study during this procedure, hr, sbp, dbp, mbp and spo2 were recorded every minute for the initial 5 min after induction of anaesthesia, and thereafter at 5 min intervals for next 15 min . If a decrease in saturation to 90% or lower was observed during nasal intubation then oral intubation was performed . Parameters noted during the study were: c - l grading, time required for intubation, intubation without any manoeuvre (m0), need for the manoeuvres, type of manoeuvre (m1m5) used, haemodynamic changes, lowest recorded spo2 during or immediately after intubation attempt and occurrence of any other complications . Duration of nti was defined as the time taken from the insertion of the ett through the nostril, till passage of tube through vocal cords by visual confirmation by the intubating anaesthesiologist . Duration of nti more than 120 s, fall in spo2 below 90% during the procedure were considered as failed nti . Data collected were coded, tabulated, and then analysed using statistical package for the social sciences (spss 20, ibm, armonk, ny, united states of america) computer package . Mann - whitney u - test was used for analysing age, sex, c - l grading and for comparing the duration of intubation between both groups . Independent - t - test was used to compare haemodynamics with respect to hr, sbp, dbp, mbp in both groups . A difference with the adjusted p demographic profiles were evenly distributed between both groups . In group 1, 86.7% of patients and in group 2, 96.6% had c - l grading of 1 and remaining patients had c - l grading of 2, which was not statistically significant (p = 0.35). Duration of intubation was significantly shorter in group 2 compared to group 1 patients . In group 1, 36.6% of patients and in group 2, 93.3% of patients were intubated within 2 min which was statistically significant p = 0.001 [figure 1]. Comparison of intubation time between the groups in group 1, 3.3% of patients and in group 2, 23.3% of patients were intubated successfully without the application of manoeuvres (m0). Application of optimisation manoeuvres (m1m5) was needed more in group 1 compared to group 2 (c - mac) (97% vs. 77%) and was statistically significant p = 0.001 [figure 2]. In group 1, 30% of patients and in group 2, 53.3% patients needed additional external manipulation (m1). Only 6.7% patients of either the groups were intubated using cuff inflation technique alone (m2). Combined use of cuff inflation with external laryngeal manipulation (m3) was not useful in both groups . Use of magill's forceps alone (m4) and m4 with external manipulation (m5) were required more in group 1 compared to group 2 (m4 - 37% vs. 13%) (m5 - 23% vs. 3%). (m3 = combined use of cuff inflation with external laryngeal manipulation was not useful in both the groups) after induction, haemodynamic parameters (hr, sbp, dbp and mbp) decreased in both groups when compared to pre - induction values . At the 1 min after intubation, the values increased in both groups, but there were no intergroup differences and both the parameters returned to baseline after 5 min after nti [table 2]. No complications (drop in spo2, dental trauma, etc) were observed during the procedure in both groups . C - mac vl allows adequate glottic view, without the need for aligning oropharyngeal and laryngeal axes . We found no significant difference in airway assessment using c - l grading in both groups . This can be explained by the fact that both groups of patients were of similar demography and patients with airway difficulties were excluded from the study . Duration of nti was significantly decreased in group 2 in comparison with group 1 patients . C - mac vl has slim blade profile and edges are inclined, thus reducing the potential contact area of the blade with the upper incisors . It magnifies airway view and allows supporting staff to optimise their assistance such as applying adequate external manipulation as necessary . The anterior angulation of the blade and placement of the video camera allow the operator to see structures that would be difficult or even impossible to see under direct vision . The majority of patients in group 1 required different manoeuvres as per study protocol . External laryngeal manipulation (m1) this can be explained by the fact that there was requirement of more hand - eye coordination while viewing the glottis on vl monitor and intubating the patient even with experienced anaesthesiologists . A previous study showed that cuff inflation technique (m2) helps to lift ett from the posterior pharyngeal wall, thus helping to bring it into view and also directs it towards the glottis . This technique of cuff inflation has been described for blind nasal intubation in spontaneously breathing patients . However, the technique was found to be less useful for successful intubation in this study . Combined use of cuff inflation with external laryngeal manipulation (m3) was not useful in this study . Direct laryngoscopy requires elevation of the laryngoscope blade, moves the larynx upwards and elevates the glottis . Thus, lengthens the distance between the glottic orifice and the posterior pharyngeal wall and also makes the nasally introduced tube slide upwards and then downwards in sequence . Thus, it often requires the use of magill's forceps to align this ett tip with the glottic inlet and its use may sometimes lead to trauma to surrounding structures, damage to ett cuff . Magill's forceps alone (m4) and m4 with additional external manipulation (m5) were needed more in group 1 as compared to group 2 . Similar studies conducted by kaki et al . And hirabayashi and seo concluded that vls needed lesser use of magill's forceps for nti . C - mac vl helped the supporting staff to assist intubation, using less invasive manoeuvres and thus may prevent trauma to oral cavity, damage to ett cuff . It was also observed that there was a positive correlation between the number of manoeuvres used and the intubation time required in both groups . Patients in group 1 required longer time (2 min) to intubate than group 2 (1.5 min) when the use of additional manoeuvres of the highest level (m5) was required . For good glottic view, videolaryngoscopy requires the application of lesser force as compared to direct laryngoscopy to the base of the tongue . Therefore, videolaryngoscopy is less likely to stimulate pressor - response and induce local tissue injury . In contrast, both groups in our study had similar intubation responses which returned to baseline after 5 min . The difference between both groups preoperatively, before induction and after intubation was statistically insignificant . Further studies are required to know its utility in paediatric patients with difficult airways as well as in adult patients posted for nasal tracheal intubation . Limitation of this study was that anaesthesiologist could not be blinded to the type of device being used for nti . The study was limited to only sixty patients considering intubation time as the primary outcome parameter . Larger number of enrolled cases are required to assess other parameters of the nasotracheal intubating conditions . Storz c - mac vl provided better glottis visualisation as compared to conventional macintosh direct laryngoscope . Lesser time was required for intubation and there was lesser need for magill's forceps during nti . However, requirement of additional external manipulations (m1) was more with the c - mac vl group . Thus, c - mac vl improves the nasotracheal intubating conditions and can be superior alternative to macintosh laryngoscope in clinical practice in paediatric patients.
The advent of titanium implants resulted in a treatment modality with a high level of applicability in several clinical situations . Although the original protocol was initially designed for the treatment of completely edentulous patients, the need arose to extrapolate treatment alternatives with osseointegrated implants to partially dentate patients . Implant dentistry added a new alternative in oral rehabilitation, but at no time, have osseointegrated implants been capable of resembling natural teeth with regard to their characteristics . This combination was applied to partially edentulous patients, contradicting branemark's protocol, which was based on isolating implants from natural teeth . However, the distribution of the teeth in the arch may induce the adoption of combined prostheses . For decades, tooth - implant - supported dentures have been questioned because of the differences of mobility between the abutments, the risk of intrusion of the natural abutment, as well as the atrophy of the periodontal ligament, and the high general risk of technical complications . The great difference between an osseointegrated implant and a natural tooth is the form of the structural union with the bone and the different mechanism of absorption and dissipation of force, which makes the tooth - implant bond a biomechanical dilemma . The possibility of connecting implants to teeth in fixed denture, with a favorable prognosis has been studied by several authors who concluded that the tooth - implant bond does not have a negative influence on the marginal bone and soft tissues . Therefore, it was not possible to show any greater risk of deficiency for fixed tooth - implant - supported dentures (ftisd) when compared with implant - supported dentures, which were well accepted, particularly by patients in unfavorable financial situations, who were unable to have the ideal number of implants placed . Nevertheless, the connection of natural teeth and osseointegrated implants in a rigid denture caused concern and publications, with studies and guidelines for both extremes . There is a significant difference in the absorption and distribution of force between natural teeth and implants . This occurs because in tooth - supported dentures there is a system of cushioning causing a micro - movement of 100 to 300 m due to the presence of the periodontal ligament, as load will be transmitted to the bone with beneficial stimulation by transforming the stresses of pressure into uniform traction on the alveolar cortical . In implants, the resultant stress is concentrated on the bone crest, and this different dissipation of force may cause a lever arm, which depends on the length of the pontic producing torque on the implant, causing loosening or fracture of the retention screw . In view of such a situation, the use of semi - rigid connections has been recommended, taking into consideration that this type of connection could be more efficient in terms of compensating for the difference in mobility between the abutments . Nevertheless, other authors have reported that the semi - rigid connections are rarely indicated in unilateral fixed dentures . This type of connection does not improve the stress distribution between the abutments, and are the cause of migration of the natural teeth . Ideal tooth - implant supported fixed dentures (tisfds) are those in which the space is small, including one tooth and one implant with the possibility of a maximum of two pontics . Nevertheless, other authors have reported that the ideal tisfds are those with a larger number of natural abutments to promote greater rigidity of this denture . The aim of this study was to use finite element method (fem) to evaluate the generation of stresses in a fixed tooth - implant - supported denture with a rigid connection, when varying the number of teeth used as abutments . Over the last few years, fem applied to biomechanics has become an extremely useful tool for numerically assessing stresses and deformations associated with the mechanical behavior of biomaterials and human tissues . In this study, the 3-d model of the fem is an approximate representation of an in vivo geometry, with the physical characteristics of a real model . In this study, the ansys revision 5.7 program was used to develop a model of a partially edentulous maxilla, conceived by means of 3-d fem, in which an implant - tooth supported fixed denture was constructed . Representative volumes of the implants, abutments, prosthetic crowns and cortical and spongy bone were created . Connection of this denture was simulated by means of a metal surface of a non - noble nicr alloy, varying the number of teeth connected to an osseointegrated iti strauman implant, 10.00 mm long, 4.1 mm in diameter, with a 4.8 mm platform . To compose this denture, metal - ceramic crowns were constructed in the shape of premolars, which were connected by means of a pontic, using rigid connection, in order to be analyzed in two configurations: the first configuration contemplated one tooth and one implant (model 1), and the second configuration contemplated two teeth and one implant (model 2). From the basic geometry created, the elastic properties of the various materials were attributed, using approximate values found in the literature (table 1). The elastic properties of the materials were adopted in a linear system, whose hypothesis is that the deformation of elastic bodies is proportional to the force applied . Furthermore, these properties were considered constant and isotropic (equal in all directions). Elastic properties of several materials that compose the model from the creation of the basic geometry, the finite element mesh composed of 297.096 knots and 213.129 elements for the model with one tooth and one implant (model 1) and 529.930 knots and 383.670 elements for the model with two teeth and one implant (model 2) were generated, according to figures 1 and 2 . Finite element mesh model 1 finite element mesh model 2 the study of biomechanics is, however, an analysis of the distribution of forces to the bone when teeth are occluding . It has been observed in tests that the intensity of the bilateral and unilateral physiological force is 569 n and 430 n respectively and clinical observations have shown that lateral forces are not well tolerated by the dental and bone structures, as occurs with axial forces . In this model, a vertical load of 100 n was applied on the occlusal face of the entire prosthetic set, distributed uniformly according to the number of elements of the respective surfaces (figures 3 and 4). Nodal load of 100 n on the denture containing 3 elements nodal load of 100 n on the denture containing 4 elements this model was designed and submitted to a vertical load, in which its effect was assessed quantitatively in n / mm (mpa) and qualitatively . The images generated by the program used in the present study made it possible to gain a broad and significant understanding of the distribution of these stresses in the bone tissue, as well as in the prosthetic components and associated structures . The quantitative results are summarized in table 2 with plotting of the von mises stress (seqv) for the tooth - implant - supported dentures with one and two teeth . The table also shows the results of maximum displacement (dmx) of the set . Quantitative analysis seqv = von mises stress; dmx = maximum displacement in a qualitative analysis, it may be observed that the vertical displacement of tooth - implant - supported dentures with one tooth and one implant, the tooth showed greater movement in the apical direction (figure 5). However, when a tooth was added in the mesial region of this denture, a reduction in its vertical movement was observed (figure 6). Movement of the set in the occlusal - gingival direction (model 1) movement of the set in the occlusal - gingival direction (model 2) in the analysis of the seqv stresses, it was observed that the maximum stress in the tisfds containing one tooth (model 1) was 47.84 mpa, whereas for the denture containing two teeth (model 2) the maximum stress was 35.82 mpa, both located in the region between the tooth and the pontic, as shown in figures 7 and 8 . In selecting the images, when the structures that compose the prosthetic crowns are removed, we can verify that the maximum seqv stress occurred on the mesial side of the implant neck region, at the junction with the cortical bone, with values of 12.15 and 8.85 mpa for models 1 and 2 respectively, as illustrated in figures 9 and 10 . It can be verified that in the denture containing two teeth, the load is practically absorbed by the implant with a slight increase in tension on the tooth closest to the pontic, however, these loads can be considered insignificant . Von mises stress (seqv) in model 1 von mises stress (seqv) in model 2 von mises stress (seqv) in the implant region in model 1 von mises stress (seqv) in the implant and teeth in model 2 in the analysis of equivalent stresses of von mises (seqv) generated in metal, we note that the maximum stress is found in the same region between the natural abutment and pontic for both the models, with values of 50.0 mpa for model 1 and 34.14 mpa for model 2 (figures 11 and 12). This location of the maximum value in metal indicates that there is greater flexion of the metal bar in the region between the tooth and pontic . Von mises stress (seqv) in the metallic infrastructure (model 1) von mises stress (seqv) in the metallic infrastructure (model 1) in the electromyography study to assess the intensity of the bilateral and unilateral physiological force, the result found for bilateral force was 569 n and 430 n when measured unilaterally . Thus, according to table 3, one may make a comparison for functional loads from the flow limit of the materials . This table allows one to observe that the porcelain with specific properties used in this study, when submitted to load in model 1, showed admissible values for occlusal loads (kx100n) lower than the one found for maximum physiological load . Maximum von mises stress (seqv) values compared with the se flow stresses and admissible occlusal loads for the materials starting from a real principle proposed in the literature, the connection between teeth and implants must not be considered as the first alternative for rehabilitation and it is preferable to adopt planning of isolated implant - supported dentures . Nevertheless, in case of anatomic limitations that may require advanced surgical techniques at high costs or if teeth already require restorative interventions and are favorably distributed in the arch, a combination between teeth and implants may be adopted with success rates similar to those of fixed implant - supported dentures . There is a vast amount of literature with regard to the biomechanical challenge of the connection between teeth and implants . Authors have reported that this complication is due to the difference in mobility between them, different mechanisms of absorption and dissipation of forces and mechanical - receptor properties . However, biomechanical responses in the face of a force are completely different, and in tooth - implant - supported dentures, special care must be taken in planning to compensate this difference . Nevertheless, according to the literature it is conclusive that in fixed tooth - implant - supported dentures, connections of the semi - rigid type generate more stress in the denture components so that the rigid connection has been preferred instead of the semi - rigid type . From analysis of the results, the present study allows one to observe that there was a reduction in the displacement of the prosthetic set, as well as a lower stress, when a natural abutment was added, confirming previous findings that if the placement of only one implant were possible, then two natural abutments must be used as retainers to support a pontic thereby improving the rigidity of the set . This difference in stresses can also be explained by the fact that although the loading value had been equal, the loads were better distributed in model 2 . According to the literature, the resulting stress in implants is concentrated on the bone crest, which is in agreement with the results obtained in this study, in which the maximum seqv stresses occurred on the mesial side in the neck region of the implant, as reported elsewhere . It has been stated that the ideal tooth - implant supported fixed dentures are those in which the space between the abutments is small, including only one tooth and one implant, with the possibility of a maximum of two pontics . This configuration is necessary because the flexion of the bar is proportional to the cube of the length of the edentulous space, in agreement with the findings of this study, in which it was observed a greater displacement in the pontic region, and higher tension located between the pontic and the abutments . According to the quantitative and qualitative analysis of the present study, it may be concluded that: tooth - implant - supported prostheses must be limited with regard to the edentulous space and it is a feasible and biomechanically predictable treatment option; the placement of additional teeth decrease the resultant stress values; the type of alloy used in the metallic infrastructure plays a key role in denture displacement, and preference should be given to those with the highest modulus of elasticity . The internal connection type of implant provides greater rigidity to the set (abutment / implant) mechanically presenting lower stress levels.
Cervical infection by one of approximately 15 high - risk hpv types is generally accepted as the necessary causative agent of cervical cancer [1, 2]. The upper aerodigestive tract, including the oral cavity, the pharynx, and the larynx, is also lined by a squamous mucous membrane and because of the morphological similarities and epitheliotropic nature of hpv, a link between head and neck squamous cell carcinoma (hnscc) and hpv seems logical . Hnscc is usually etiologically linked to tobacco and/or alcohol or other lifestyle habits, but a minority of patients develop hnscc in the absence of exposure to these factors or any other obvious predisposing genetic defect . Several investigators have reported detection of hpv infection in healthy oral mucosa as well as in squamous cell carcinoma of the oral cavity (oscc) and oropharynx (opscc) [4, 5], which are related to sexual behaviour and younger age . Hpv has shown to have a predilection for certain, especially nonkeratinized, anatomical sites of the oropharynx . High - risk hpv types, such as hpv 16, have been detected even in clinically normal oropharyngeal mucosa . In the cervix, the persistence of hpv infection may increase the likelihood of viral integration and concomitant deregulation of viral protein expression, leading to overexpression of e6/e7 oncoproteins [7, 8]. In oral cancers the integration of hpv dna into the host's cell genome is probably a less common event . Various hpv types have been identified in patients with oral cancer, but clinical and case control studies have not proved a causal relationship between the virus and oral carcinomas beyond any reasonable doubt [8, 9, 11]. Hpv dna detection alone is regarded as insufficient evidence for a causal role in oral cells transformation and is more like a secondary invader [7, 10]. Hpv integration into the host cell genome however, is a causal factor in head and neck carcinogenesis [1113]. In many reports, in which the hpv - positivity varies from 40 to 57%, there is no reference to the viral integration of the hpv positive samples [5, 8, 10]. The purpose of our study is to define hpv detection in patients with osccs and to evaluate the detection of e6/e7 high - risk hpv mrna as a possible biomarker for posttreatment surveillance . Sixty - four (64) cytological samples were obtained from patients with hnscc of the oral cavity, (35 oral tongue, 8 maxilla, 4 mandible, 8 floor of mouth, 6 retromolar trigone, and 3 buccal mucosa) who visited the outpatient clinic of the radiotherapy department of the regional anticancer oncology hospital saint savvas, athens, greece, between november 2008 and november 2011 . Ethical approval was granted by the ethics committee of regional anticancer oncology hospital of athens st . The samples were collected using a brush and swabbing the mouth, maxilla and mandible, oral tongue, and buccal mucosa and were preserved in thin prep (preservcyt solution, hologic uk). Cytological samples were transferred in lysis buffer (nuclisens lysis buffer, biomrieux hellas s.a, cat no . 200292) for 30 minutes, then total nucleic acid was extracted by the offboard protocol with the nuclisens easymag platform (biomrieux hellas s.a), according to the manufacturer's instructions . Dna quality test was carried out using human globin, beta, primer set kit (maxim biotech, inc ., south san francisco, ca, usa) according to manufacturer's instructions . To assess rna integrity, 5 g of rna per sample then, the papillocheck hpv - screening (greiner, germany) was used for the type - specific identification of 24 types of hpv (15 high - risk types: 16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, 68, 73, and 82, probable high - risk types: 53, 66 and 7 low - risk types: 6, 11, 40, 42, 43, 44/55, and 70). This technology is based on a dna chip for the type - specific identification of 24 types of hpv . E1-based pcr was performed according to the manufacturer's guidelines . For each sample, we mixed 19.8 l papillocheck mastermix, 0.2 l hotstartaq plus dna polymerase (5u/l, qiagen, cat no . Hybridization is followed by mixing 30 l of the papillocheck hybridization buffer in a new reaction tube with 5 l of the pcr product at room temperature and transferring 25 l of the hybridization mix into each compartment of the chip . The chip was washed in 3 washing solutions, centrifuged for 3 minutes at 5000 rpm, and scanned on the checkscannertm . A commercial real - time nuclisens easyq assay (nuclisens easyq hpv 1.1, biomrieux hellas s.a, cat no . 290003) was performed for the qualitative detection of hpv e6/e7 mrna of five high - risk hpv types (16, 18, 31, 33, and 45) according to the manufacturer's instructions . Firstly, three premixes were made by adding reagent sphere diluent (tris - hcl, 45% dmso) into reagent spheres (nucleotides, dithiotreitol, and mgcl2). In each premix, we added u1a / hpv 16, hpv 33/45, or hpv 18/31 primer and molecular beacon mixes, kcl stock solution, and nasba water . Secondly, 10 l of this premix was distributed to each well in a reaction plate, and the addition of 5 l rna followed . The plates were incubated for 4 minutes at 65c to destabilize secondary structures of rna, followed by cooling down to 41c . The reaction was started by addition of enzymes (amv - rt, rnase h, t7 rna polymerase, and bovine serum albumin) and measured in real time using the lambda fl 600 fluorescence reader (bio - tek, winooski, vt) at 41c for 2 hours and 30 minutes . Following diagnosis and molecular analysis, patients with positive histology of hnscc of the oral cavity, with a karnofsky index (ki) 70%, and with normal renal, hepatic and bone marrow function were included . Baseline laboratories studies requirements included neutrophils greater than 1.5 10/l and platelets> 100 10/l . Exclusion criteria were distant metastatic disease, a life expectancy of <3 months, pregnancy, previous cancer disease within 5 years of study entry, existence of second primary tumor, and karnofsky index (ki) of <70% . Furthermore, patients with severe renal, liver, cardiovascular, or pulmonary diseases and patients with hematological malignancies were excluded . All participants underwent an extensive presurgical evaluation that included clinical examination, panendoscopy, complete blood count and biochemical profile, clearance creatinine, cardiovascular examination, chest x - ray or ct, and ct and/or mri of head and neck . Patients with early stage resectable disease (stage i - ii) and selected patients of stage iii (t2n1m0) were treated surgically . Patients with locally advanced disease (unresectable or marginally resectable), stage iii - iva, were treated either with induction chemotherapy or radical chemoradiation . Depending on response after induction chemotherapy, patients underwent either surgery followed by postoperative chemoradiation or radical combined radiation therapy with chemotherapy . Before induction chemotherapy the palpable edges of the primary lesion (both the longest and the shortest axes) were marked by at least four points, which were 0.5 cm away . Tumor response was evaluated after the end of induction chemotherapy using a clinical examination and ct or mri of the head and neck with tumor volumetry . Complete response (cr) was defined as a reduction of the tumor volume 70% up to the complete disappearance . Partial response (pr) was defined as at least a 30% decrease in the sum of diameters of tumor, taking as reference the baseline sum diameters . Progressive disease (pd) was defined as enlargement of tumor volume 20% or new tumor manifestations . Stable disease (sd) was defined as insufficient shrinkage to qualify for pr and insufficient increase to qualify for pd . The median follow - up interval was 18 months (range 4 to 36 months). Patients are monitored every two months in the first two years, every three to four months in the next 3 to 5 years, and once a year thereafter until death . Disease - free survival was estimated from the end of treatment to tumor recurrence, distant metastasis, or death from any cause . Chi - squared tests were performed to assess statistical significance of any differences in prevalence . 2 2 contingency tables fisher's exact test was performed along with odds ratio and 95% confidence intervals calculation . We collected 64 samples from the oral cavity, 19 of which were unsatisfactory for molecular analysis due to insufficient quantity of dna, thus 45 samples were finally analysed (table 1). The patients' ages ranged from 19 to 82 years (mean age: 51.9 years). Clinical, pathological, and treatment characteristics of the patients are described in table 1 . Papillocheck assay detected high risk hpv dna in 3/45 of the osccs (2 sccs of the oral tongue and 1 of the floor of the mouth). The different hpv types revealed by the dna and rna test are shown in table 2 . In the 3 high - risk hpv dna positive oral cavity cancers, hpv 16 was detected in 2 samples (1 case of scc of the oral tongue and 1 of the floor of the mouth) and hpv 18 in 1 sample (1 case of oral tongue scc). In addition, the low - risk hpv 6 was found in 2 oral tongue samples . Further analysis using the nuclisens easyq assay detected e6/e7 mrna expression from the five high - risk hpv types (16, 18, 31, 33, and 45) in 4/45 of the total samples (8.9%) (3 cases of oral tongue scc and 1 of the floor of the mouth). Hpv 16 was the commonest type revealed by the rna test as shown in table 2 . As far as the site - specific oscc is concerned, hpv 16 was detected in 3 out of 5 hpv dna positive oral cavity sccs (2 cases of oral tongue scc and 1 of floor of the mouth), while hpv 18 was found in 1 out of 5 hpv - infected oral cavity sccs (1 case of oral tongue scc), by the rna detection method . 8 of 45 patients (1 stage i (t1n0m0), 5 stage ii (t2n0m0), 2 stage iii (t2n1m0)) underwent surgical excision (7 oral tongue, 1 maxilla). 4 of them had no adverse features, and they did not undergo any further treatment . The rest of the 4 patients with adverse features (> 2 positive ln, resection margins <5 mm, perineural tumor invasion, and vascular space invasion) received external beam radiation therapy (ebrt) 5460 gy . All patients who were treated surgically are so far disease - free (7 hpv dna negative and 1 hpv dna positive (defined as absence of recurrence at the primary site, assessed by physical examination at every clinic visit and imaging studies at specified intervals). However, one of them developed a second primary tumor of the lung and so far is disease - free from both primaries (table 2). From the 37 patients with locally advanced (unresectable or marginally resectable) disease (stage iii - iva), 28 patients underwent induction chemotherapy with 2 cycles of tpf (docetaxel 75 mg / m, (d1) cisplatin 75 mg / m (d1), and 5-fu 500 mg / m (d1-d5) (referred as treatment protocol a) and 9 patients underwent radical external beam radiation therapy (ebrt: 6872 gy) with concurrent chemotherapy (cisplatin) (d1d22) and weekly cetuximab due to medical contraindications for induction chemotherapy with tpf (referred as treatment protocol b). From 28 patients treated with protocol a, 18 had complete response . 10 of them underwent radical surgery and 8 of them underwent radical radiotherapy with concurrent chemotherapy . Depending on histological findings, patients underwent ebrt 5460 gy with or without concurrent chemotherapy (cisplatin 75 mg / m d1, d22) and weekly cetuximab . For the patients with high - risk features, such as r1 resection, extra capsular nodal spread, and vascular space invasion, perineural invasion total dose of 66 gy was granted . From 18 patients with complete response, 14 patients are today free of disease (3 hpv dna positive (hpv 18, 16, 6), 11 hpv dna negative), 2 died from lung metastasis (1 hpv dna positive (hpv 16), 1 hpv dna negative), and 2 are still alive with local recurrence (2 hpv dna negative) (table 2). The rest of the 10 patients who were treated with protocol a had partial response (table 1). All of them underwent radical ebrt (6872 gy) with concurrent chemotherapy (cisplatin) (d1d22) and weekly cetuximab . 1 of them is free of disease, 6 died from metastatic disease, 1 died from other causes, and 2 of them are still alive with local recurrence . From 9 patients with stage iii - iva who were treated with protocol b, 5 of them are free of disease, 1 died from metastatic disease, and 3 are still alive with local recurrence . Of the approximately 120 hpv types so far known to infect the mucosal surfaces of the genital tract, 14 are considered to be high risk or oncogenic [1, 2]. Some of these high - risk types have been found in the oral cavity and oropharynx of both cancer - free adult individuals and in patients suffering from hnscc [4, 7, 8, 12]. Hpv 16, the hpv type most prevalent in cervical sccs, is also the most common type present in hpv - positive hnsccs [10, 1315]. The great variation in hpv prevalence found in osccs in different studies may be due to differences among the analyzed population, but also due to differences in the samples tested (i.e., formalin - fixed or fresh biopsies, exfoliated fresh cells), the methods of dna extraction, and, most importantly, the hpv detection methods used [8, 16]. Several studies using a variety of techniques, including immunohistochemistry, in situ hybridization, dot blot and southern blot hybridization, and polymerase chain reaction (pcr), have been used to demonstrate the presence of hpv genome in hnscc [4, 5, 7, 15]. Our study shows that the use of dna and rna detection methods confirms the prevalence of hpv infection among patients with osccs . Hpv 16 infection has been found in 2 cases . In both cases infected by hpv 16, what is interesting is that the rna test revealed hpv 16 e6/e7 mrna . This may be explained by the fact that total viral dna of hpv 16 has been integrated into the host genome, and, therefore, it cannot be detected by the dna test . In 75% of the hpv - positive sccs of the oral tongue, hpv implication in oral tongue cancer has already been stated by many authors [5, 17]. On the other hand, clinical results indicated that the association between patient mortality and hpv detection was not statistically significant (p = 0.4215). The prevalence of hpv among currently disease - free patients was also not statically significant (p = 1.000). As already stated, e6/e7 mrna expression from high - risk hpv types is probably a less common event in hnscc patients [13, 14]. Nevertheless different investigators' results suggest that hpv - positive carcinomas represent a different tumor entity [14, 18]. High - risk hpv types demonstrate an integration tendency, as can be assumed in our study by the mrna oncoproteins' expression . We should also mention, as many investigators indicate, that low - risk hpv types (hpv 6 in our case) have been found in some head and neck carcinomas and might be implicated in the carcinogenesis process [14, 18, 19]. Although authors support better prognosis for hpv - positive oral cancer cases [3, 14, 16, 18], hpv - positive tumors are usually diagnosed in higher stage than hpv - negative tumors . Therefore there is a small subgroup of hpv oral cancers that demonstrate a worse response to treatment and have a lower rate of survival . Sexual transmission of oncogenic hpv genotypes is universally accepted for the anogenital region, whereas the route of infection for the oropharyngeal region is unclear [2, 18]. Although several studies have recently identified hpv, particularly type 16, in a subset of squamous cell carcinoma of the tonsils and base of the tongue [9, 14, 16, 21], the possibility of sexual or other transmission of hpv in oral cancer patients also needs to be explored [5, 6, 18]. The immune response might also affect the survival, but it seems to depend on whether hpv is present in the tumor cells in an episomal form or as an integrated virus [14, 18]. Although our data showed a relatively low hpv and oral cancer association, people from different geographical regions often demonstrate higher or lower hpv prevalence in oscc, which could also be the reason for our results . Despite the heterogeneity between different studies, hpv appears to play an important role in some types of oropharyngeal carcinomas and possibly a small subgroup of cancers in the oral cavity and may represent an alternative pathway in carcinogenesis to the known and established factors of tobacco and alcohol [9, 18] the ability to control head and neck cancer will therefore depend on three basic cornerstones: prevention, detection, and early diagnosis . The recent development of an hpv vaccine might offer hope for the prevention of cervical and anogenital carcinomas and possibly also represent an additional prevention option for a substantial number of patients with hnscc . This study described the detection rates and attribution of hpv genotypes as well as the e6/e7 mrna expression of site - specific osccs in 45 greek patients . Dna and rna assays detected the same genotypes in all high - risk hpv infected samples . This study confirms the prevalence of hpv infection among patients with osccs . Future analysis and followup of more osccs
This variation can be quantified by determining the gene frequencies of alleles at segregating loci which characterize one population and distinguish with another . Tasting ability to phenylthiocarbamide (ptc) by an individual is considered as a useful and important tool to study the genetic diversity in human populations . Taste and smell affects food preferences and dietary habits, thereby directly influencing the eating behavior of an individual . As taste threshold increases with age, abnormality in taste function may contribute to poor dietary intake in the elderly (1). Bitter taste perception is a conserved chemical sense against the ingestion of naturally toxic substances in mammals (2). The experience of bitterness occurs after certain chemicals contact taste receptors located in cells on the surface of the tongue . Some investigators hypothesize that this sense provides information so that people do not ingest bitter - tasting toxic chemicals (3). Studies of sensitivity to the bitter tasting anti thyroid compound, ptc have shown this to be an inherited trait and non - taster status has been linked to a variety of medical and health disorders (4). A high incidence of non - tasters has been reported among patients with nodular goiter (56), congenital athyreotic cretinism (7, 8), and dental caries (9). Bitter perception generally occurs through bitter taste receptors located on the surface of taste cells of the tongue (10). These receptors are encoded by t2r genes that show 2589% amino acid sequence identity between the 25 different members of this gene family . These differences presumably allow a wide variety of different chemical shapes, sizes, and functionalities to be bound by these receptors and perceived as bitter . In humans, responses to some bitter compounds the best - studied example of these is the ability to taste ptc and other structurally related compounds (11). The importance of the ability to taste bitter chemical compound ptc was realized by fox (12). Thereafter, synder (13) showed that the inheritance of the ability to taste ptc was dependent on a single autosomal dominant gene . Ptc is a bitter tasting, harmless chemical compound (14), which is a member of a class of compounds known as these compounds are having the chemical group n - c = s, which is responsible for their characteristic bitter taste (15, 16). 17) have identified a small region on chromosome 7q, and harbours a gene that encodes a member of the tas2r bitter taste receptor family . A major locus on chromosome 7q35-q36 and a secondary locus on chromosome 16p tasters are those who taste the substance (ptc) while non - tasters cannot taste at all . The ability to taste ptc is a dominant genetic trait, and the test to determine ptc sensitivity is one of the most commonly used genetic tests on humans . The strong genetic basis for sensitivity to ptc has been used as a tool to trace family lineages and population migration patterns (11, 19). It was previously used in paternity testing before the advent of dna markers (20). A review of the literature reveals that human populations show a tremendous variation in the frequency of tasters which ranges from 10% to 98% (2123). Among population groups of india, the frequency of taster allele (t) is higher among population groups of islands, followed by people in north and south india and is low in the people of west and central india, as well as among scheduled tribes (24). The aim of the present study was to analyze the gene frequency, relative fitness value and threshold distribution for phenylthiocarbamide among some muslim populations of uttar pradesh, india to show their genetic heterogeneity . Males and females of different populations have also been compared for the taste sensitivity of this trait . We also tried to find out the status of ptc tasters and non - tasters in different muslim populations of north india . Muslims of india comprise more than 12% of the population, yet their genetic structure has not been well investigated . Muslims belong to two major sects: sunnis and shias, while each sect has different biradaries, which are grouped under ashraf and ajlaf (25). The former comprise higher rank muslims like syeds, sheikhs, pathans and mughuls while the latter comprise qureshis, ansaris, and saifis . A large number of the ajlaf may also be converted from local indigenous population of other faiths (26). The aligarh city in uttar pradesh is situated between latitude 27.28 to 28.10 north, and 77.29 to 78.36 east longitude and its total area is 34.05 km . The annual average rainfall in the district is 594.1mms and maximum temperature recorded is 44c . Hindus comprise brahmins, jats, banias, thakurs and balmikis while muslims comprise syed, sheikh, pathan, shia, sherwani, ansari, saifi and qureshi populations . A cross - sectional, analytical and randomized study was done to find out phenylthiocarbamide taste sensitivity and threshold distribution among different muslim populations of aligarh district, from march 2011 to october 2011 . Out of a total number of about 1124 individuals, a survey was conducted among healthy, normal and unrelated individuals with the age range of 16 - 45 years which were randomly selected from six populations viz . ; syed, sheikh, pa - than, shia, sherwani and ansari . His or her general particulars (address, age, sex, ethnic group) were recorded . The prior informed written consent was taken from the individuals and their parents before their inclusion in the study . The questionnaire was designed to collect information about food preferences, socio economic factors, health status and medical history of family . The samples were collected from the upper court, civil lines, hamdard nagar, friends colony, amu campus, sir syed nagar and jamalpur areas of aligarh . The method to distinguish tasters from non - tasters was adopted as per the sorting technique with serial dilutions of harris and kalmus (27), because of its superiority in discerning the threshold of the individual with near perfection . A solution of 0.13% of ptc was prepared by dissolving 130 mg of the ptc in 100ml of water (solution 14). The serial dilution from 1 through 14 was prepared taking 50ml of solution and adding 50ml of distilled water to it to make solution 13 which is diluted as half 14 . If an individual did not taste even the solution 14 (strongest), then he was designated as non - taster . Taster and non taster status was also entered into the proforma and presented in the form of tables . After the test, the participant was asked to spit out the chemical and to rinse the mouth with water . The distribution of the frequency of tasters and non - tasters is usually bi - modal with antimode recording the lowest frequency separates the two distributions . The anit - modal point was taken to classify the subjects as tasters or non - tasters . The phenotypes were recorded for ptc taste sensitivity for each individual, and the allele frequencies were calculated according to hardy - weinberg law (28) using a gene counting method . The level of heterozygosity was calculated using the formula, hetrozygosity= 1 - ho where ho is the homozygosity of the allele, ho=pi chi - square test: it is used for the measurement of the size of the discrepancy between the observed and expected values at particular degrees of freedom . Muslims of india comprise more than 12% of the population, yet their genetic structure has not been well investigated . Muslims belong to two major sects: sunnis and shias, while each sect has different biradaries, which are grouped under ashraf and ajlaf (25). The former comprise higher rank muslims like syeds, sheikhs, pathans and mughuls while the latter comprise qureshis, ansaris, and saifis . A large number of the ajlaf may also be converted from local indigenous population of other faiths (26). The aligarh city in uttar pradesh is situated between latitude 27.28 to 28.10 north, and 77.29 to 78.36 east longitude and its total area is 34.05 km . The annual average rainfall in the district is 594.1mms and maximum temperature recorded is 44c . Hindus comprise brahmins, jats, banias, thakurs and balmikis while muslims comprise syed, sheikh, pathan, shia, sherwani, ansari, saifi and qureshi populations . A cross - sectional, analytical and randomized study was done to find out phenylthiocarbamide taste sensitivity and threshold distribution among different muslim populations of aligarh district, from march 2011 to october 2011 . Out of a total number of about 1124 individuals, only 821 individuals consented to participate in this study . A survey was conducted among healthy, normal and unrelated individuals with the age range of 16 - 45 years which were randomly selected from six populations viz . ; syed, sheikh, pa - than, shia, sherwani and ansari . His or her general particulars (address, age, sex, ethnic group) were recorded . The prior informed written consent was taken from the individuals and their parents before their inclusion in the study . The questionnaire was designed to collect information about food preferences, socio economic factors, health status and medical history of family . The samples were collected from the upper court, civil lines, hamdard nagar, friends colony, amu campus, sir syed nagar and jamalpur areas of aligarh . The method to distinguish tasters from non - tasters was adopted as per the sorting technique with serial dilutions of harris and kalmus (27), because of its superiority in discerning the threshold of the individual with near perfection . A solution of 0.13% of ptc was prepared by dissolving 130 mg of the ptc in 100ml of water (solution 14). The serial dilution from 1 through 14 was prepared taking 50ml of solution and adding 50ml of distilled water to it to make solution 13 which is diluted as half 14 . If an individual did not taste even the solution 14 (strongest), then he was designated as non - taster . Taster and non taster status was also entered into the proforma and presented in the form of tables . After the test, the participant was asked to spit out the chemical and to rinse the mouth with water . The distribution of the frequency of tasters and non - tasters is usually bi - modal with antimode recording the lowest frequency separates the two distributions . The anit - modal point was taken to classify the subjects as tasters or non - tasters . The phenotypes were recorded for ptc taste sensitivity for each individual, and the allele frequencies were calculated according to hardy - weinberg law (28) using a gene counting method . The level of heterozygosity was calculated using the formula, hetrozygosity= 1 - ho where ho is the homozygosity of the allele, ho=pi chi - square test: it is used for the measurement of the size of the discrepancy between the observed and expected values at particular degrees of freedom . A well - defined bimodal distribution of the taste sensitivity was observed in all the communities investigated as shown in (fig . 1). Fig . 2 presents the threshold values among six populations which ranged from 8.29 to 9.59 in males, 7.76 to 9.03 in females and 8.09 to 8.95 as combined . The means and standard deviations of the thresholds for males, females and combined population groups were calculated as 9.08 0.195, 7.99 0.163, 8.51 0.13 respectively . Graph showing threshold distribution of ptc trait among combined population groups of north india graph showing of mean threshold values of males, females and combined populations for ptc trait of north india the pathan shows the highest threshold value (9.59 in males and 8.35 in females) while the syed the lowest (8.47 in males and 7.76 in females) and the sheikh, sherwani, shia and ansari showed the intermediate threshold values . In overall population, it is interesting to note that the males show a higher mean threshold value than females . Out of 821 subjects studied 545 (66.38%) were tasters and 276 (33.62%) were non - tasters to ptc . Among 400 males, 140 (35.00%) were non - tasters and among 421 females, 136 (32.30%) were non - tasters, and this shows more males were observed to be non - tasters of ptc as compared to females . Again females were having more tasters (285, 67.70%) than males (260, 65.00%). 3 presents the phenotypic frequencies of tasters and non - tasters for the male, female and total combined populations . The phenotype frequency of taster showed that the percentage of taster was higher as compared to non- tasters, and is statistically significant (= = 5, p = 0.036). It is observed that the highest phenotypic frequencies for ptc tasters were found among syed (73.75% in males and 72.83% in females) while least among ansari (52.33% in males and 61.04% in females). The highest non - tasters frequencies were found among syed (26.25% in males and 27.17% in females) while least among ansari (47.67% in males and 38.96% in females). We also observed that more females were ptc tasters than males which is statistically significant (= 31.20, df= 5, p <0.00001). Phenotype frequency for ptc tasting ability in north indian muslim populations the values for ptc tasting ability in north indian muslim populations table 3 shows the allelic frequencies for ptc tasters and non - tasters among male, female and combined populations . Allele frequency for the non - taster (t) varies in different populations . The allelic frequency for the non - taster (t) for males and females the highest allelic frequency for, non - taster (t) was found among ansaris for being males and females 0.6904 and 0.6242 respectively . In the syed population the t - allele frequencies for males and females were found to be least i.e. 0.5123 and 0.5212 respectively . The difference in allelic frequencies for different population was non - significant because there is no rigid caste system in muslims, only biradaries are there . Allele frequency for ptc tasting ability in north indian muslim populations table 4 and fig . 4 present the homozygosity and heterozygosity among male, female and combined population groups . The pooled heterozygosity for males and females is found to be 0.4832 and 0.4907 respectively . The highest heterozygosity was found among syed i.e. 0.4994 and the least among ansari i.e. 0.4489 . Heterozygosity and homozygosity for ptc tasting ability in north indian muslim populations fitness values of different traits from the total population are presented in (table 5). The highest fit genotype is taken as having fitness value of one, and the fraction of fitness of each genotype with fitness of highest trait is taken as relative fitness of the other genotypes ayala (29). The highest fitness value of t trait was found among syed (1.0) followed by sherwani (0.96), shia (0.93), sheikh (0.92), pathan (0.88) and ansari (0.77). Graph showing phenotype frequencies for ptc tasting ability among different muslim populations of north india graph showing heterozygosity and homozygosity for ptc tasting ability among different muslim populations of north india relative fitness value (w) for ptc tasting ability in north indian muslim populations a well - defined bimodal distribution of the taste sensitivity was observed in all the communities investigated as shown in (fig . 1). Fig . 2 presents the threshold values among six populations which ranged from 8.29 to 9.59 in males, 7.76 to 9.03 in females and 8.09 to 8.95 as combined . The means and standard deviations of the thresholds for males, females and combined population groups were calculated as 9.08 0.195, 7.99 0.163, 8.51 0.13 respectively . Graph showing threshold distribution of ptc trait among combined population groups of north india graph showing of mean threshold values of males, females and combined populations for ptc trait of north india the pathan shows the highest threshold value (9.59 in males and 8.35 in females) while the syed the lowest (8.47 in males and 7.76 in females) and the sheikh, sherwani, shia and ansari showed the intermediate threshold values . In overall population, it is interesting to note that the males show a higher mean threshold value than females . Out of 821 subjects studied 545 (66.38%) were tasters and 276 (33.62%) were non - tasters to ptc . Among 400 males, 140 (35.00%) were non - tasters and among 421 females, 136 (32.30%) were non - tasters, and this shows more males were observed to be non - tasters of ptc as compared to females . Again females were having more tasters (285, 67.70%) than males (260, 65.00%). 3 presents the phenotypic frequencies of tasters and non - tasters for the male, female and total combined populations . The phenotype frequency of taster showed that the percentage of taster was higher as compared to non- tasters, and is statistically significant (= = 5, p = 0.036). It is observed that the highest phenotypic frequencies for ptc tasters were found among syed (73.75% in males and 72.83% in females) while least among ansari (52.33% in males and 61.04% in females). The highest non - tasters frequencies were found among syed (26.25% in males and 27.17% in females) while least among ansari (47.67% in males and 38.96% in females). We also observed that more females were ptc tasters than males which is statistically significant (= 31.20, df= 5, p <0.00001). Phenotype frequency for ptc tasting ability in north indian muslim populations the values for ptc tasting ability in north indian muslim populations table 3 shows the allelic frequencies for ptc tasters and non - tasters among male, female and combined populations . Allele frequency for the non - taster (t) varies in different populations . The allelic frequency for the non - taster (t) for males and females the highest allelic frequency for, non - taster (t) was found among ansaris for being males and females 0.6904 and 0.6242 respectively . In the syed population the t - allele frequencies for males and females were found to be least i.e. 0.5123 and 0.5212 respectively . The difference in allelic frequencies for different population was non - significant because there is no rigid caste system in muslims, only biradaries are there . Table 4 and fig . 4 present the homozygosity and heterozygosity among male, female and combined population groups . The pooled heterozygosity for males and females is found to be 0.4832 and 0.4907 respectively . The highest heterozygosity was found among syed i.e. 0.4994 and the least among ansari i.e. 0.4489 . Fitness values of different traits from the total population are presented in (table 5). The highest fit genotype is taken as having fitness value of one, and the fraction of fitness of each genotype with fitness of highest trait is taken as relative fitness of the other genotypes ayala (29). The highest fitness value of t trait was found among syed (1.0) followed by sherwani (0.96), shia (0.93), sheikh (0.92), pathan (0.88) and ansari (0.77). Graph showing phenotype frequencies for ptc tasting ability among different muslim populations of north india graph showing heterozygosity and homozygosity for ptc tasting ability among different muslim populations of north india relative fitness value (w) for ptc tasting ability in north indian muslim populations human infants show an innate pleasure response to sweet taste, but dislike bitterness and reject bitter - tasting foods (30). Whereas sweetness serves as a sensory cue for energy rich foods, bitterness often predicts toxicity (30). The human sense of taste can be categorized into five basic tastes sweet, bitter, sour, salty and umami, that are critical for nutrition and survival . Bitter perception has a particularly significant role, as it protects us from ingesting naturally toxic substances which are typically bitter in taste (3). The best known example of variation in sensitivity to a bitter compound is that of phenylthiocar - bamide (ptc). In 1931 fox (12) observed that to some individuals the simple chemical compound phenylthiocarbamide (ptc), has an intensely bitter taste, while to others it is tasteless . Harris and kalmus (27) found that the distribution of ptc tasting thresholds was bimodally distributed, but there were some intermediate individuals . The major gene tas2r38 on chromosome 7 responsible for this trait was identified as a member of the tas2r bitter taste receptor gene family consisting of a single coding exon 1002 bp long, encoding a 333 amino acid, 7-transmembrane domain g protein- coupled receptor (17), that responds to bitter stimuli (3135) and the milestones of this discovery have been summarized (36). Bufe et al . (31) demonstrated that alleles of htas2r38 codes for functionally different receptor types that directly affect perception of bitterness containing compounds . Two major forms of this bitter receptor gene were identified in most of the world s populations, designated as the these two forms differ in 3 amino acid positions, numbers 49, 262, and 296 (37). The ability or inability to taste the ptc is a classic inherited mendelian trait that has long been known to vary in human population . This trait is of genetic, epidemiologic and evolutionary interest and has been shown to correlate with a number of dietary preferences and thus have important implications for human health (31, 38, 39). The main objective of this study was to investigate the threshold distribution and determine the gene frequencies of dominant and recessive alleles for ptc taste sensitivity among different muslim populations of uttar pradesh, north india . The present study provides brief information on the distribution of ptc tasters and non - tasters in different populations of north indian muslims . Some studies on muslim populations have been attempted earlier in uttar pradesh (40). The present work shows some differences from earlier studies on ptc taste blindness among muslim populations of north india . Data on ptc taste ability is vast and a great deal of work has been done over the world . Many studies have reported that in world population, approximately 30% of them are ptc non tasters and 70% are tasters (11, 41). The prevalence of taste blindness or an inability to taste bitter chemicals ranges from 3% in west africa, to 6 - 23% in china, 40% in india and 30% in us population (11, 42). The average frequency of t allele among indian populations is 53.4 percent (varies from 8.8% among scheduled caste of andhra pradesh to 89.2% in munda of ranchi, bihar) while in european populations it varies from 25 to 57% which is little higher but similar to that of south west asian (43). For ptc taste ability the overall frequency of allele t for muslims is 51.3% (44), which is 57.98% in our case . For the ansari from bihar, the frequency of the t allele is 71% (26), which is 65.99% in the present study . Aarzoo and afzal (45), reported that the overall frequency of allele t is 58% for muslims which is similar to the present data . In our study we found the percentage frequency of 33.62% for non - tasters and the allele frequency t, as 0.5798 . Singh and singh (46), observed percentage frequency of 31.3% and allele frequency t as 0.56 among the muslims of ambedkar nagar district of eastern uttar pradesh, north india . The value of non - taster allele t varies from 0.44 - 0.56 among muslims of eastern uttar pradesh (46). In india the frequency of t - allele shows variation in different ethnic groups and castes (45, 24). In the present study the overall frequency of tasters was 66.38% and it varies in different populations of india (47). The frequency of allele t among indian population is 45.7% (48). In general frequency of allele t is higher among population groups with mongoloid affinities from the himalayan region but lower from the mongoloid populations from the east and southeast asia and lowest among scheduled tribes (24). In the present study the frequency of taster (t) is about 0.50 among european populations (5). In the present investigation the frequency of t allele ranged from 0.34 - 0.48 and the non - taster allele t ranged from 0.52 - 0.65 among muslims of uttar pradesh, north india . Our observations on ptc taste perception revealed that there is significant higher percentage frequency of tasters as compared to non - tasters among different populations in the present study which supports other studies (11, 41, 34). In the present study, we found the ratio of non - tasters among males was more than females as reported by others (24, 49). Previous studies suggest that the frequency values for non - taster of ptc may be unique to the specific populations studied (50). We found that females are more ptc tasters as compared to males which is in total conformity with other studies (50, 51). Ptc taste thresholds vary in different populations and females are found to taste ptc at lower concentrations of thresholds than males, a small number of specific differences in taste ability have long been known and well - studied (11). It also provides a clear cut distribution of ptc taster and non - taster phenotypes among different muslim populations of north india . Acceptance and rejection of bitter fruits and vegetables, as well as sweet foods, added fats, spicy foods and alcoholic beverages had an association with ptc / prop taste sensitivity (5254). People who can taste ptc (taster) are more sensitive to salt, sweet foods, sharp tasting foods and spicy foods (55). Anatomical studies reported that tasters actually have more taste buds than non - tasters (56). Keller et al . (57) suggested that non tasters prefer high fat diet more, than low fat diet, while tasters show this lack of preference for food . The prop / ptc tasters also have other oral sensations for example, the prop tasters perceive more fattiness in foods whereas non - tasters cannot discriminate, between high and low fat containing foods and consequently be more obese (more weight gain / higher body mass). Hence, the variation in genetic taste sensitivity may also play important role in dietary patterns and food habits . Aside its importance in genetic and anthropological studies, ptc taste sensitivity has been shown to be important in food selection, which may affect individual metabolism and physiology (58). The effect of genetic factors on food selection has acquired a new importance in cancer research . If ptc and prop taster status helps to identify food preferences and food consumption, it might turn out to be a genetic marker for some of the major diet related chronic diseases (16). On a larger scale, the ptc gene may be illustrative of ancient genetic variation that has been proposed to underlie common disease in modern populations (59). In addition, the mapping of the ptc genes will provide a powerful tool to examine the genetic basis for food preferences and the relationship between taste status and health outcomes (11). Finally, ptc presents a unique opportunity in the field of bitter taste transduction . Having a known gene with a strong effect on pheno - type in vivo provides many opportunities for studies of taste physiology, biochemical function, and the molecular structure elucidation in the human sense of taste . The present paper reports the threshold distribution and gene frequencies of ptc taste sensitivity among different muslim populations of north india . We also tried to find out the status of ptc tasters and non - tasters among these populations . Our observations reveal that the percentage of ptc tasters is greater than that of non - tasters and the, females have lower non - taster phenotypes than males . Although ptc itself has not been found in nature, the ability to taste ptc is strongly correlated with the ability to taste other naturally occurring bitter substances, many of which are toxic (60, 55). Such studies have a great significance in understanding the adaptability of the populations to the same region which results in their varying response to threshold of sensitivity of the same genetic trait (6163). Further, the adaptive fitness of tasters is higher than that of non - tasters for all phenotypes, which speaks of adaptive value of taster pheno - type . Therefore, understanding the nature of the variation in bitter taste perception and its relationship to diet and other behavior aspects may have important implications for human health . Ethical issues (including plagiarism, informed consent, misconduct, data fabrication and/or falsification, double publication and/or submission, redundancy, etc .) Have been completely observed by the authors.
Craniovertebral junction (cvj) abnormalities constitute an important group of treatable neurological disorders, especially in certain ethnic groups like indian subcontinent . These are one of the major causes of spinal cord, vascular and nerve compression, and hydrocephalus . Hence, in every patient presenting with these features, cvj abnormalities should be excluded . Cvj is a complex region that incorporates the occiput as well as the c1 and c2 vertebrae, while the stability and flexibility to cvj is provided by the bony as well as ligamentous nature of atlantooccipital and atlantoaxial joints . Variety of abnormalities can affect the cvj with their diagnostic dilemmas and few studies have been conducted in this regard . This study is an effort to systematically classify various cvj abnormalities according to their etiological group and to define the importance of precise diagnosis for pretreatment evaluation with multidetector computed tomography (mdct) and/or magnetic resonance imaging (mri). This study presents the data of 62 patients referred to our department between october 2012 and september 2014 . Written informed consent for the study all patients clinically suspected to have a cvj disorder were included in the study, from all age groups and both genders . The abnormalities involving cvj had been grouped as developmental or congenital, traumatic, degenerative, infective, inflammatory, neoplastic, and unknown . All patients were subjected to mdct and/or mri and contrast was given if required in patients with normal serum creatinine (normal up to 1.3 mg%). Ct was performed in neutral, flexion, and extension positions; except in situations where patient was not in a condition to perform flexion and extension and in cases of trauma . After thin axial images were obtained, these were isotropically reconstructed into coronal and sagittal planes . Mri was done on 3 t philips machine and the following sequences were obtained: t1-weighted spin echo (t1w se) and t2-weighted turbo spin echo (t2w tse) in the sagittal and axial planes.t1w se and short tau inversion recovery (stir) in coronal plane.t2w tse in flexion and extension whenever required.post gadolinium administrationt1w fat saturated (fs) images were obtained in all three planes . T1-weighted spin echo (t1w se) and t2-weighted turbo spin echo (t2w tse) in the sagittal and axial planes . Post gadolinium administrationt1w fat saturated (fs) images were obtained in all three planes . Typical parameters used for t1w se sequence were a repetition time (tr) of 598 ms and an echo time (te) of 27 ms; for t2w tse sequence were tr of 4,100 ms and te of 100 ms; for stir sequence were tr of 2,300 ms, te of 60 ms, and inversion time (ti) of 150 ms . These sequences were done with slice thickness of 3 mm with an inter - slice gap of 0.3 mm . Subsequently, in cases where contrast was required, gadolinium enhanced (administered in a dose of 0.1 mmol / kg) t1w fs sequences were obtained in all three planes . Craniometric measurements used in radiologic assessment of cvj abnormalities include chamberlain's line, mcgregor line, mcrae line, wackenheim clivus line, fishgold digastric line, fishgold bimastoid line, welcher basal angle, and atlantooccipital joint axis angle . Statistical analysis was done using ratio and percentages for gender distribution and percentage distribution of each disease affecting the cvj . Statistical analysis was done using ratio and percentages for gender distribution and percentage distribution of each disease affecting the cvj . In our study of 62 patients, 39 were males and 23 were females with male to female ratio of 1.6:1 . Most common age group was 2140 years (19 patients, 30.64%) followed by older age of more than 60 years (17 patients, 27.41%). The most common presenting complaint in these group of patients was neck pain (26 patients, 41.93%) followed by limb weakness (17 patients, 27.41%); with others being headache, tingling numbness, restriction of neck movements, ataxia, giddiness, and scoliosis . Developmental anomalies were the most common etiology group followed by traumatic, degenerative, infective, inflammatory, and neoplastic, and no cause found in one patient in our study [table 1]. Distribution of patients according to etiological group among the developmental anomalies, congenital atlantoaxial dislocation (aad; 56.45%) [figure 1a and b], basilar invagination (37.10%) [figure 2], and occipitalization of atlas (20%) were the common radiological features and often exist with each other in varying combinations . Other developmental anomalies were os odontoideum (nine patients, 14.51%), chiari malformation (eight patients, 12.90%) [figure 3], platybasia (five patients, 8.06%), klippel - feil syndrome, and unassimilated rudimentary atlas (one patient each, 1.61%). 1 = flexion, 2 = neutral, 3 = extension of neck ct cvj region bone window image sagittal reconstruction showing tip of the odontoid process invaginated into the foramen magnum and was above the chamberlain line (longer line) and mcrae's line (shorter line) in basilar invagination . Ct = computed tomography, cvj = craniovertebral junction mri cvj region stir midsagittal image showing syringomyelia and peg - like tonsils 8.2 mm below the foramen magnum . Mri = magnetic resonance imaging, stir = short tau inversion recovery out of the 10 patients in traumatic group, five patients had type 2 fracture of the dens [figure 4], two had type 3 fracture of the dens, one patient had tear drop fracture of anterioinferior aspect of the axis body, and one each had bilateral atlantooccipital dislocation and type 3 atlantoaxial rotatory dislocation . Ct cvj region bone window coronal reconstruction showing type ii dens fracture degenerative changes affecting the cvj commonly mimic cvj anomalies . Amongst the infective etiologies, tuberculosis (tb) [figure 5a and b] was seen in four patients . Inflammatory pathology like rheumatoid arthritis (ra) [figure 6a and b] was seen in three patients . The neoplasms detected were, one meningioma [figure 7], another was chordoma of axis which was also involving c3 vertebra, and a nerve sheath tumor was found at c2 vertebral level . Only two patients had a syndromic association, one was klippel - feil syndrome and other was down's syndrome . Mri cvj region; (a) midsagittal t1w and (b) axial t2w images . Hyperintense soft tissue in the predental and left paravertebral space extending through c1 c2 foramen with erosions of dens and left lateral anterior arch of c2, which was to be of tuberculous origin . (a) postcontrast soft tissue window midsagittal reconstruction showing enhancing soft tissue pannus surrounding the dens . (b) precontrast bone window coronal reconstruction showing erosion and thinning of the dens suggestive of ra . Ra = rheumatoid arthritis mri cvj region postcontrast t1w midsagittal image showing strongly enhancing anterior dural - based cvj mass lesion with dural tail sign suggestive of meningioma the craniovertebral junction is a complex region formed by the occipital condyles, atlas (c1), axis (c2) vertebrae, and their articulations . Cvj has intricate relationship with the major neurovascular structures which can lead to medullary - cervical cord compression, cranial or spinal nerve compressions, vertebral artery compression, and obstructive hydrocephalus . Therefore, treatment of various types of cvj abnormalities poses many challenges which are critically affected by the precise diagnosis of the abnormality as shown in our series by classifying the abnormalities into etiological group with their precise diagnosis . The clinical manifestations are often delayed into the 2 and 3 decade because they are usually subtle and easily missed in children unless looked for specifically . In our study of 62 patients, male to female ratio was 1.6:1 (39 males and 23 females) and the most common age group was 2140 years (19 patients, 30.64%), which correlated well with the study by jawalkar et al ., and sankhe and kumar . In our study, most common presenting symptom was neck pain, followed by limb weakness, which correlated well with most other studies . Moreover, the radiological picture is confusing as the ossification of the bones is completed only by 9 years of age . The incidence of different types of abnormalities varies with the demographic environment and has ill - defined genetic factors . The indian subcontinent with very high population density of varying socioeconomic strata, high incidence of infectious diseases, and lack of healthcare awareness among the population shows wide spectrum of cvj abnormalities and in its late stages . These different types of abnormalities with a complex pathological bony anatomy need precise diagnosis by experienced radiologists for individual management decision tailored for that particular case, which is why this study was conducted for categorizing the abnormalities etiologically, making precise diagnosis for pretreatment evaluation, and ruling out mimickers . Plain radiographs of cvj show overlap of many soft tissue structures . Due to anatomic complexities of the cvj and high frequency of craniocervical trauma with muscle spasm,, the cross - sectional imaging used was mdct and mri, as mdct is ideal modality for evaluation of complex osseous anatomy associated with cvj abnormalities while mri, with its multi - planar capabilities and high soft tissue contrast resolution, has become the mainstay in radiological evaluation of the cvj . The craniometry of the cvj uses a series of lines, planes, and angles to define the normal anatomic relationships of the cvj namely chamberlain's line, mcgregor line, mcrae line, wackenheim clivus line, height index of klaus, welcher basal angle, clivus canal angle, atlantooccipital joint axis angle (schmidt angle), fishgold digastric line, and fishgold bimastoid line . Also ct with its sagittal and coronal reconstruction confirms the diagnosis and helps precisely to know the occipitalization of atlas, hypoplastic posterior arch of atlas, and c1-c2 instability . Enhancing soft tissue pannus at cvj in cases of ra, retropharyngeal abscess, and lytic lesions in the vertebrae in cases of tuberculosis were precisely diagnosed with ct . Hence, knowing the underlying cause of the abnormality helps in better prognostication and treatment of the patient's condition . In our study, developmental anomalies were the most common etiology group, followed by traumatic, degenerative, infective, inflammatory, and neoplastic, and no cause found in one patient [table 1]. Study out of 159 cases of cvj anomaly, developmental anomalies were the most common affecting 147 patients, neoplasm was found in 10 patients . Another study of 189 cases by kale and colleagues showed developmental cause as the most common followed by traumatic and tuberculosis in decreasing order . In clinicoradiological practice, congenital aad accounted for 51.568% of all cvj anomalies, which correlated with our study . In our study, os odontoideum was found in nine patients with male to female ratio of 2:1 (6 males:3 females) which correlated with study done by dai et al ., and spiering and braakman; one patient presented with bilateral atlantooccipital dislocation and left lateral atlantoaxial subluxation after road traffic accident . One patient had traumatic type iii atlantoaxial rotatory dislocation, which is very uncommon in adult patient . Till date, a total of 16 patients have been reported in the literature . In our four patients of cvj tb, osteolytic destruction of the anterior arch of atlas was seen in three patients and in another three; erosions were noted in the dens . Basilar invagination was seen in one case and atlantoaxial dislocation was seen in two patients . In one patient, active pulmonary tuberculosis was present, while in other three patients there was past history of tuberculosis for which they had completed treatment . Chest radiograph in two of three patients showed sequelae of old tuberculosis . In our three patients of ra, the history of ra was long standing, more than 5 years in all patients . All the three patients had erosion of the odontoid process and enhancing soft tissue pannus along the dens . Syringomyelia was found in five patients, scoliosis in two, and platybasia in two . Peg - like tonsillar herniation of more than 8 mm was seen in all eight patients . One patient of chiari i had multiple osseous abnormalities such as aad, platybasia, fusion of c2 and c3 vertebrae, and hemivertebra at c4 . These results were comparable in order of frequency with the study carried out in ayub teaching hospital, abbottabad between july 2008 and july 2010 with a prospective cohort of 60 symptomatic patients . These were meningioma which was anterior dural based, another was chordoma of the c2 body and spinous process and also involving the c3 vertebral body, and one c2 nerve sheath tumor causing aad . In three patients in the age group of 7581 years, who presented with complains of neck pain, walking difficulty, and imbalance; we found aad and basilar invagination . Age - related degeneration of ligaments and bones caused the patients to present with above symptoms . Cvj abnormalities constitute an important group of treatable neurological disorders, especially in certain ethnic groups, and are approached with much caution by clinicians . Thus, it is essential that radiologists should be able to make a precise diagnosis of cvj abnormalities, classify them into the appropriate etiological group, and rule out important mimickers on mdct and/or mri; as this information ultimately helps determine the management of such abnormalities, prognosis, and quality of life of patients.
Accumulating evidence suggests that apolipoprotein b (apob) has additional benefits over conventional lipid measurements, such as serum low - density lipoprotein (ldl) cholesterol, for the assessment of future development of cardiovascular disease (cvd). Despite this evidence, recently, we developed a new equation to estimate serum apob (apobe) using the same serum total cholesterol, triglyceride, and high - density lipoprotein (hdl) cholesterol level used in friedewald's equation to estimate ldl cholesterol . In this study, apobe was accurate not only for the entire study population, but also for several subgroups, including patients with diabetes, those with atherogenic dyslipidemia, and those taking lipid - lowering agents . In addition, contrary to friedewald's equation, our apobe can be applied regardless of serum triglyceride range . Despite the strong approximation with directly measured apob, it is still uncertain whether apobe has clinical relevance in the prediction of the development of cvd . Therefore, the aim of this study was to validate the clinical relevance of apobe in predicting future cvd and to compare the performance of the equation with ldl cholesterol level from friedewald's equation using data from a large - scale, prospective, community - based cohort . Study subjects were individuals who participated in the ansung ansan cohort study from 20012002 (baseline year) to 20112012 (fifth follow - up visit). Ansan cohort study is an ongoing study that began in 2001 to 2002 and involves biennial follow - up examinations . The design and baseline characteristics of the ansung ansan cohort study have been published in previous studies . In brief, residents of 2 south korean communities (ansung and ansan) were recruited for this study . Eligibility criteria included an age of 40 to 69 years and residence within the borders of the survey area for at least 6 months before testing . In 2001 to 2002 (baseline year), 5018 of the 7192 eligible individuals in ansung were surveyed using a cluster sampling method . A total of 15,580 individuals in ansan were eligible, and 5020 were recruited using a random sampling method of the local telephone directory . In this study, 9001 subjects were analyzed after excluding 1037 subjects who did not visit their follow - up examinations . In addition, we further excluded subjects as follows: (1) those with history of cvd (n = 228); (2) those taking lipid - lowering medications (n = 51); and (3) those whose outcome data were not available (n = 33). Finally, a total of 8713 subjects without cvd history (4126 men and 4587 women; mean age, 52.2 years) were enrolled in the study . The study protocol was approved by the ethics committee of the korean center for disease control and the ajou university school of medicine institutional review board . Collected blood samples were delivered and analyzed at a central laboratory (seoul clinical laboratories, seoul, korea). Plasma glucose, total cholesterol, triglyceride, and hdl cholesterol levels were determined using a hitachi 747 chemistry analyzer (hitachi, tokyo, japan). All subjects underwent a 75-g oral glucose tolerance test (ogtt) after a 8- to 14-hour overnight fast at study inclusion and biennially thereafter . The hba1c level was measured using high - performance liquid chromatography (variant ii; biorad laboratories, hercules, ca). Fasting plasma insulin concentration was determined using radioimmunoassay (linco kit; st charles, mo). Insulin resistance was calculated using the homeostasis model assessment (homa - ir) as the product of fasting serum insulin (mu / l) and fasting plasma glucose (mg / dl) concentrations divided by 405 . In the present study, diabetes mellitus was defined as one of the following: (1) fasting plasma glucose level 7.0 mmol / l (126 mg / dl); (2) 2-hour plasma glucose 11.1 mmol / l (200 mg / dl) after 75-g ogtt; (3) hba1c level 6.5%; (4) use of oral antidiabetic agent or insulin; or (5) a self - reported history of diabetes . Hypertension was defined as systolic blood pressure 140 mm hg, diastolic blood pressure 90 mm hg, use of antihypertensive drugs, or self - reported history of hypertension . In this study, cvd was divided into ischemic heart disease (ihd) and stroke, and ihd included myocardial infarction and coronary heart disease . Estimated apob was calculated using an equation introduced in our previous study: apob = 0.65 total cholesterol 0.59 hdl cholesterol + 0.01 triglyceride (if triglyceride 270 mg / dl)/apob = 25.6 + 0.58 total cholesterol 0.38 hdl cholesterol 0.06 triglyceride (if triglyceride> 270 mg / dl). Our apob equation has a coefficient of determination (r) of 0.994 for directly measured apob, and the residuals in the development, internal validation, and external validation datasets were randomly distributed around 0 with no clear trends . All data are expressed as the mean sd or as proportion . The kaplan meier survival curve was used to compare the development of cvd according to the median value of ldl cholesterol or estimated apob . Survival analyses were used to determine the associations between clinical measurements including lipid parameters and incidence of cvd . To compare these measurements, we calculated hazard ratios (hr) per 1-sd increment using a cox proportional hazards model . Multivariate cox proportional hazard regression analyses were performed to determine whether various lipid parameters were associated with incident cvd independent of age, sex, waist circumference, current smoking, diabetes, and hypertension . Harrel's c statistic was used to compare the performance of the models in predicting future outcomes . Study subjects were individuals who participated in the ansung ansan cohort study from 20012002 (baseline year) to 20112012 (fifth follow - up visit). Ansan cohort study is an ongoing study that began in 2001 to 2002 and involves biennial follow - up examinations . The design and baseline characteristics of the ansung ansan cohort study have been published in previous studies . In brief, residents of 2 south korean communities (ansung and ansan) were recruited for this study . Eligibility criteria included an age of 40 to 69 years and residence within the borders of the survey area for at least 6 months before testing . In 2001 to 2002 (baseline year), 5018 of the 7192 eligible individuals in ansung were surveyed using a cluster sampling method . A total of 15,580 individuals in ansan were eligible, and 5020 were recruited using a random sampling method of the local telephone directory . In this study, 9001 subjects were analyzed after excluding 1037 subjects who did not visit their follow - up examinations . In addition, we further excluded subjects as follows: (1) those with history of cvd (n = 228); (2) those taking lipid - lowering medications (n = 51); and (3) those whose outcome data were not available (n = 33). Finally, a total of 8713 subjects without cvd history (4126 men and 4587 women; mean age, 52.2 years) were enrolled in the study . The study protocol was approved by the ethics committee of the korean center for disease control and the ajou university school of medicine institutional review board . Collected blood samples were delivered and analyzed at a central laboratory (seoul clinical laboratories, seoul, korea). Plasma glucose, total cholesterol, triglyceride, and hdl cholesterol levels were determined using a hitachi 747 chemistry analyzer (hitachi, tokyo, japan). All subjects underwent a 75-g oral glucose tolerance test (ogtt) after a 8- to 14-hour overnight fast at study inclusion and biennially thereafter . The hba1c level was measured using high - performance liquid chromatography (variant ii; biorad laboratories, hercules, ca). Fasting plasma insulin concentration was determined using radioimmunoassay (linco kit; st charles, mo). Insulin resistance was calculated using the homeostasis model assessment (homa - ir) as the product of fasting serum insulin (mu / l) and fasting plasma glucose (mg / dl) concentrations divided by 405 . In the present study, diabetes mellitus was defined as one of the following: (1) fasting plasma glucose level 7.0 mmol / l (126 mg / dl); (2) 2-hour plasma glucose 11.1 mmol / l (200 mg / dl) after 75-g ogtt; (3) hba1c level 6.5%; (4) use of oral antidiabetic agent or insulin; or (5) a self - reported history of diabetes . Hypertension was defined as systolic blood pressure 140 mm hg, diastolic blood pressure 90 mm hg, use of antihypertensive drugs, or self - reported history of hypertension . In this study, cvd was divided into ischemic heart disease (ihd) and stroke, and ihd included myocardial infarction and coronary heart disease . Estimated apob was calculated using an equation introduced in our previous study: apob = 0.65 total cholesterol 0.59 hdl cholesterol + 0.01 triglyceride (if triglyceride 270 mg / dl)/apob = 25.6 + 0.58 total cholesterol 0.38 hdl cholesterol 0.06 triglyceride (if triglyceride> 270 mg / dl). Our apob equation has a coefficient of determination (r) of 0.994 for directly measured apob, and the residuals in the development, internal validation, and external validation datasets were randomly distributed around 0 with no clear trends . All data are expressed as the mean sd or as proportion . The kaplan meier survival curve was used to compare the development of cvd according to the median value of ldl cholesterol or estimated apob . Survival analyses were used to determine the associations between clinical measurements including lipid parameters and incidence of cvd . To compare these measurements, we calculated hazard ratios (hr) per 1-sd increment using a cox proportional hazards model . Multivariate cox proportional hazard regression analyses were performed to determine whether various lipid parameters were associated with incident cvd independent of age, sex, waist circumference, current smoking, diabetes, and hypertension . Harrel's c statistic was used to compare the performance of the models in predicting future outcomes . The mean body mass index (bmi) was 24.6 kg / m and fell into the category of overweight . At baseline, 24.9% of subjects were current smokers, 12.5% had diabetes, and 22.2% had hypertension . Incident cvd occurred in 600 of the study subjects (493 ihd and 424 stroke) during the mean 8.1-year follow - up, leading to a cumulative incidence of 6.9% . In univariate cox proportional hazard regression analysis, a variety of conventional risk factors, including age, bmi, waist circumference, blood pressures, homa - ir, and presence of diabetes and hypertension, were associated with the development of cvd . Among all lipid measurements, non - hdl cholesterol (hr per 1-sd increment [95% ci]; 1.24 [1.151.34], p <0.001) and estimated apob (hr per 1-sd increment [95% ci]; 1.24 [1.151.34], p <0.001) levels showed the strongest associations with the development of cvd, and their hrs were identical . However, the ldl cholesterol level showed a somewhat weaker association with the development of cvd compared with non - hdl cholesterol or estimated apob level (hr per 1-sd increment [95% ci]; 1.11 [1.031.12], p = 0.008) (table 2). In addition, when the subjects were divided into 2 groups according to median levels, estimated apob was discriminative earlier than ldl cholesterol for the development of incident cvd (fig . 1). Similarly, in a separate analysis, non - hdl cholesterol and estimated apob levels were more powerful predictors of future ihd and stroke than was the ldl cholesterol level . Kaplan meier survival curve for development of cardiovascular disease according to median estimated apob (a, p <0.001) and ldl cholesterol (b, p = 0.017) levels . Black and gray lines represent the upper and lower median for corresponding variables, respectively . Independent variables included in the models were age, sex, waist circumference, current smoking, and presence of diabetes and hypertension . Both non - hdl cholesterol (hr per 1-sd increment [95% ci]; 1.13 [1.051.23], p = 0.002) and estimated apob (hr per 1-sd increment [95% ci]; 1.14 [1.051.24], p = 0.001) were associated with the development of cvd independent of the aforementioned risk factors . In addition, both non - hdl cholesterol and estimated apob showed significant independent associations with future ihd and stroke, and the hazard ratios were comparable . However, the ldl cholesterol level was not predictive of any cardiovascular outcome in this analysis (table 3). In addition, no difference in performance between the non - hdl cholesterol model and the estimated apob model in predicting future outcomes (table 4). In the current prospective, community - based, cohort study performed in 8713 subjects from a general korean population, our newly developed equation to estimate apob, which was calculated from total cholesterol, triglyceride, and hdl cholesterol levels, was predictive of future cvd independent of other well - established risk factors including age, sex, waist circumference, current smoking, and presence of diabetes and hypertension during 8.1 years of follow - up . In addition to the association with cvd, estimated apob was predictive of both incident ihd and stroke when the outcomes were analyzed separately . Several, but not all, epidemiologic studies and clinical trials have demonstrated that both non - hdl cholesterol and apob are superior to ldl cholesterol in predicting future development of cvd; however, there is much debate over whether apob has additional clinical benefit in predicting future cvd over non - hdl cholesterol . In a meta - analysis of 12 reports including 233,455 subjects and 22,950 events, apob was the most potent marker of cardiovascular risk (relative risk ratio, 1.43; 95% ci, 1.351.51), ldl cholesterol was the least potent (relative risk ratio, 1.25; 95% ci, 1.181.33), and non - hdl cholesterol was intermediate (relative risk ratio, 1.34; 95% ci, 1.241.44). However, another meta - analysis based on 91,307 participants (including 4499 cases) from 22 studies found that hrs for coronary heart disease were similar between apob (hr, 1.58; 95% ci, 1.391.79) and non - hdl cholesterol (hr, 1.59; 95% ci, 1.361.85). In the present study, estimated apob (hr per 1-sd [95% ci]; 1.14 [1.051.24], p = 0.001) and non - hdl cholesterol (hr per 1-sd [95% ci]; 1.13 [1.051.23], p = 0.002) showed almost identical association with incident cvd and had similar risk for both incident ihd and stoke . In addition, there was no difference in performance between the non - hdl cholesterol model and the estimated apob model in predicting future cvd, ischemic heart disease, or stroke . Therefore, it appears that our equation to estimate apob has comparable predictive ability for future cvd . Collectively, estimated apob can be used to predict a diverse spectrum of vascular events, and its performance was grossly similar to that of non - hdl cholesterol . It has also been suggested that there is no difference between apob and non - hdl cholesterol in predicting cvd risk in a healthy, low - risk group in which a relatively small number of subjects would have increased numbers of small dense ldl particles, the group in which apob has a greater predictive value . Based on our observations, it is possible that lipid parameters are not powerful predictors for incident cvd in the korean population compared with other ethnic groups . In our study, adjusted hr of non - hdl cholesterol and estimated apob for cardiovascular outcomes ranged from 1.12 to 1.14, somewhat lower than those noted in the 2 aforementioned meta - analyses . In addition, most of the conventional lipid parameters were not associated with future cardiovascular outcome in this analysis . In particular, rather, total cholesterol was associated mainly with ihd, and hdl cholesterol showed an inverse association with future development of stroke . Although we cannot explain clearly the reason for the null association between ldl cholesterol and incident cvd, we offer the following as plausible explanations . First, it has been suggested that the association between the ldl cholesterol level and the development of cvd is not strong in asians as it is in caucasians . In a community - based, prospective cohort study of cvd performed in 4696 japanese men and women, the ldl cholesterol level was not associated with future myocardial infarction or cerebral infarction in either men or women during an 11.9-year follow - up . Ldl cholesterol was associated with incident myocardial infarction only when data from men and women were combined and ldl cholesterol level was in the highest quintile (3.91 in addition, among 8131 residents from 4 japanese communities who had no history of cvd, the ldl cholesterol level could not predict future myocardial infarction or total coronary heart disease in either men or women after adjustment for potential confounding factors within low - to - moderate mean ldl cholesterol level (<3.08 the mean ldl cholesterol level of our study subjects falls into this category (mean ldl cholesterol of 3.07 furthermore, a meta - analysis of 32 cohort studies performed in the asia - pacific region showed that calculated ldl cholesterol was a relatively poor predictor of future cvd and coronary heart disease compared with lipid parameters including triglycerides, hdl cholesterol, and non - hdl cholesterol . Second, robust adjustment for other risk factors of future cvd including current smoking, hypertension, and diabetes might dilute the association between ldl cholesterol and the development of cardiovascular outcomes . Eight years of follow - up might not be long enough to reveal the association between ldl cholesterol and incident cvd in such a healthy population . Thus, it was not possible to compare the performance of estimated apob from our equation and directly measured apob in the prediction of cvd . However, we demonstrated the accuracy of our equation not only with internal validation, but also with external validation . Moreover, the equation can be used in diverse subgroups of patients including those with diabetes, atherogenic dyslipidemia, and those taking lipid - lowering agents . Therefore, we expect that apob estimated with our equation approximates direct apob in our study population . Second, our study subjects were generally healthy, as they were selected from a community - based general population . A negligible proportion of the subjects had history of cvd (2.5%) or took lipid - lowering medications (0.6%), and we could not validate the performance of our equation in these critical subgroups . Therefore, our results cannot be generalized to subjects with diverse cardiovascular risk and clinical conditions . Third, in this study, cardiovascular outcomes were assessed by questionnaire, which can result in bias . Thus, it is uncertain whether this measure is also valid in other ethnic groups . However, in our previous study, we validated the accuracy of our apobe using data from nhanes 2007 to 2008 for other ethnicities . As a result, this indicates that estimated apob from apobe predicts directly measured apob without bias in other ethnic groups . Despite the limitations, we conducted this study with a large community - based population and showed that it is reasonable to calculate apob with our equation without additional cost to measure direct apob level in order to predict incident cvd for relatively healthy subjects without previous cvd . In conclusion, the estimated apob level from our equation was independently associated with future development of cardiovascular outcomes, and the predictive power for incident cvd was comparable to that of non - hdl cholesterol . In addition, although our equation used the same lipid measures with friedewald's equation, it showed a stronger association with future cvd than did any other lipid measures including ldl cholesterol and can be applied regardless of triglyceride range . Based on our observations,
Physical fitness directly affects one s health state and becomes the basis of healthy adulthood1 . Therefore, suitable physical activity in children and adolescents contributes to the development of their physique, strength, and balance . Many developed countries have national projects designed to encourage students to enhance their physical fitness, e.g., fitnessgram in the united states, trimming 130 in germany, participaction in canada, eurofit in europe . Health - related physical fitness measures were first developed in 2009 in korea to evaluate students physical strengths (cardiorespiratory endurance, muscular strength, muscular endurance, flexibility, and body fat). The physical activity promotion system (paps) is used for continuous management of the degrees of improvement in physical fitness and activities among elementary, middle, and high school students through systematic evaluation of their physical fitness as well as the recommendation of desirable physical activities to the students via their parents and teachers . A cardiorespiratory endurance test includes stepping, running, and walking, and its evaluation results are classified into five grades using the heart rate to evaluate heart function2 . The current study focuses only on the measured physical fitness levels and lacks follow - up management . Efficient management by exercise programs that provide various benefits should be offered to elementary school children . In the recent years, studies have been conducted on exercise machines, such as the simulator, that are used to enhance the muscle strength and cardiorespiratory endurance, improve flexibility, and reduce body fat3, 4 . The ski simulator exercises in particular are designed to mimic snow surface repulsion; hence, they have the advantage of providing resistance . Such resistance exercises enhance the muscle mass and stimulate muscle strengthening, thus efficiently aligning the body parts and maintaining good posture . They also improve one s ability to perform various exercises requiring muscle strength, endurance, and energy; thus, they can positively influence basic health functions such as metabolism and cardiovascular functioning6, 7 . In a study on the effects of simulator - based exercises on injury prevention, lee et al.8 reported that training with a ski simulator contributes to increased range of motion and improved hamstring strength, which help to prevent sports - related injuries . However most previous studies analyzed the skier s posture9, 10, and some differences were noted between individuals depending on the exercise intensity and the simulator type . Due to continuous demand for research in this area, in this study, the heart rate was measured and analyzed after a ski simulator exercise and the harvard step test . These exercises have various effects that can be used to evaluate the cardiopulmonary endurance by calculating the post - exercise recovery rate . The body mass index (bmi) analysis can provide useful information . Because simulator exercises improve the muscle strength and endurance, this study aimed to assess the exercise performance capacity improvements of elementary school students . Participants included 77 elementary school students (normal weight, 40 students; overweight and obesity, 37, based on the asia oceania association for the study of obesity standards) with no previous or current foot injury . This study was approved by the ethics committee of the institutional review board of pukyong national university . The cohort size was calculated using the gpower 3.1 version program by faul et al11 . The specifications of the sample calculated by this analysis was 70 participants with a 0.05 significance level, 0.95 power, and 0.8 effect size being the largest size; therefore, this cohort (77 participants) satisfied the required sample size criteria (table 1table 1.participants characteristicsnormal (40)over weight / obesity (37)height (cm)149.28.1151.97.2weight (kg)45.16.455.86.3bmi (kg / m)20.21.624.11.0normal group (18.5 bmi <23.0 kg / m), overweight, obesity (bmi 23.0 kg / m) aoaso (asia oceania association for the study of obesity) s standards). This study was conducted after obtaining written informed consent of the participants and their parents and teachers . The ski simulators (pro ski simulator; slovenia) were fixed onto a flat surface consisting of a platform on wheels that moved left and right on two bowed parallel metal rails . Rubber belts fastened the platform to the rails and ensured that it regained its resting position in the middle of the apparatus . The ski simulator s band elasticity had a rotation radius of 16 levels; larger the rotation radius, weaker was the band elasticity . This study conducted the experiment with two elasticity strength levels . To ensure accuracy, sufficient time was given to each subject for practice, and then the actual skiing was performed for 3 minutes . Each subject held a strap in each hand to maintain balance, and a low intensity ski simulator setting was used for the study . Each participant performed the harvard step movements for 3 minutes and then rested in a chair for 3 minutes . The height of the step box for harvard step test was 20.3 cm, and the steps were performed at a rate of 24 steps per minute . To ensure postural accuracy, each subject a heart rate monitor and a stopwatch were used in this study, and cardiorespiratory endurance was calculated by the physical efficiency index (pei) formula described below.pei = d/(2 p) 100d: duration of the exercise (s)p: first phase (6090 s) + second phase (120150 s) + third phase (180210 s) heart rates normal group (18.5 bmi <23.0 kg / m), overweight, obesity (bmi 23.0 kg / m) aoaso (asia oceania association for the study of obesity) s standards using these methods, the heart rate in each phase as well as the differences in the 2 groups and the 2 exercises were computed through analysis of the biomechanical factors . Each subject rested for 10 minutes between the conditions, which were performed in a random order to avoid compromising the results . The data were statistically processed using the statistical package for the social sciences, version 23.0 . The independent t - test and paired t - test were used to examine the differences, which were considered statistically significant at p values <0.05 . Using the aforementioned methods, the movement - dependent cardiorespiratory endurance factors of heart rate and pei were calculated . There was a significant difference among the bmi based groups at 2 and 3 minutes when participants were exercising and at 6 minutes when they had cooled down . Furthermore, the normal weight group had higher pei levels (table 2table 2.heart rate and physical efficiency index (pei)ski simulatornormaloverweight / obesity1 minute84.321.481.813.72 minute122.110.1139.612.73 minute130.17.4150.010.54 minute84.711.787.411.55 minute81.111.184.411.16 minute80.611.887.513.0pei61.45.656.33.5*harvard stepnormaloverweight / obesity1 minute92.819.793.615.52 minute129.612.6140.414.83 minute137.89.3147.914.9*4 minute87.116.685.818.65 minute83.819.083.517.46 minute85.112.486.514.2pei57.55.555.24.2normalski simulatorharvard step1 minute84.321.492.819.7 * 2 minute122.110.1129.612.63 minute130.17.4137.89.34 minute84.711.787.116.65 minute81.111.183.819.06 minute80.612.485.112.4pei 61.45.657.55.5overweight / obesityski simulatorharvard step1 minute81.813.793.615.52 minute139.612.7140.414.83 minute150.010.5147.914.94 minute87.411.585.818.65 minute84.411.183.517.46 minute87.513.086.514.2pei56.33.555.24.2<0.05, * * <0.01, * * * <0.001 . Pei = d/(2 p) 100; d: duration of the exercise (s); p: first phase (6090 s) + second phase (120150 s) + third phase (180210 s) heart rates). The t - test results regarding the participants heart rate before and after the exercises showed that the average heart rate of the normal weight group was higher during step - boxing; however, the overall pei was higher during skiing . The obesity group revealed significant differences in the initial stages of the exercise, and the overall pei of the obese group was higher during skiing . * <0.05, * * <0.01, * * * <0.001 . Pei = d/(2 p) 100; d: duration of the exercise (s); p: first phase (6090 s) + second phase (120150 s) + third phase (180210 s) heart rates the american college of sports medicine has underscored the importance of physical strength with regard to health over physical strength in terms of motor skills based on the fact that a decline in the capacities of body composition, cardiorespiratory endurance, muscular strength, and muscular endurance and flexibility significantly increases the probability of lifestyle diseases and health impairments . Relying on the kinetic functions of the heart and lungs, cardiorespiratory endurance refers to the body s ability to continue supplying energy to the human circulatory system and muscles over extended periods . There have been positive reports12,13,14 about how advanced cardiorespiratory endurance not only enables one to engage in aerobic exercises, such as walking and jogging for a longer time, but also enhances one s academic accomplishments by improving concentration levels . There are many methods to evaluate cardiorespiratory endurance considering various aspects such as assessment purpose, targets, and social influences . A certain method may or may not be superior to another; however, the paps evaluation method is currently considered an optimal standard method . Continued research15 showed that a solution is required to reduce the gaps among the different methods evaluating cardiorespiratory endurance . In this regard, skiing has developed as a popular health - improving sport that can facilitate students physical fitness development and provide great exercising benefits . The ski simulator exercise is a training machine that uses a band to simulate an environment of reduced resistance force between the snow surface and ski plates . Due to these mechanical features, the ski simulator exercise is considered to have an effect similar to that of the elastic resistance exercises . Anderson et al.16 reported that elastic resistance exercises are more effective for training small muscle groups, such as the muscles of the neck, shoulders, and arms, as compared to the strength training exercises using free weights . Elastic bands undergo a linear increase in tension from the beginning of the contraction to the full range of motion17 . The tension generated may make it difficult to maintain a balanced posture, thus facilitating the transition to the next movement with a different heart rate as evident from the pei data difference between two groups and exercises . Oloughlin et al.18 emphasized on the absolute lack of physical activities due to increased time spent on video games and computers . On the other hand, kim et al.19 claimed that the interest in sports can promote the development of physical fitness by increasing the level of participation in exercises . The importance of adequate exercising applies to both obese and normal weight children; therefore, as mentioned in this study, skiing as an ideal sport can be practically utilized in real - life settings . Taking bmi, physical fitness level, and sport durability into consideration, this study showed that the ski simulator exercise could produce a cumulative load even when performed at low intensity . Furthermore, the ski simulator exercise can be effectively utilized as exercise equipment since it resulted in higher pei levels than the harvard step test . If the schools can increase sport durability by stimulating students interests, the ski simulator exercise can be practically used in programs designed to improve and strengthen students physical fitness.
Screening for gestational diabetes mellitus is routinely programmed to prevent complications caused by elevated blood glucose levels in pregnancy, including macrosomia, cesarean delivery, shoulder dystocia, neonatal metabolic problems, perinatal mortality, and pre - eclampsia.1 diabetes mellitus during pregnancy also appears to be associated with an increased risk of cardiovascular diseases even in later life.2 moreover, this underlying co - morbidity is an independent risk factor for subsequent coronary artery disease . In this context, diabetes mellitus during pregnancy has been identified as a major etiology for atherosclerosis in large elastic arteries.3 one of the main indicators for assessing atherosclerotic lesions during this period is the increased intima - media thickness (imt) of carotid arteries.4 it has been well known that, as opposed to the blood flow through the other arteries of the maternal organs, the blood flow through the carotid artery is decreased during pregnancy, which has been attributed to pregnancy - mediated increased responsiveness of the carotid artery to vasoconstrictors and decreased responsiveness to vasodilators.5 also, the endothelial hypertrophy of the carotid artery can be a common finding, leading to changes in the carotid blood flow and its complications.6, 7 thus, increased carotid imt can be deemed a validated endothelial dysfunction surrogate endpoint during pregnancy . Some studies have recently shown that pregnant women with previous gestational diabetes mellitus are at increased risk of carotid artery disorders.8, 9 be that as it may, the scarcity of research into this hypothesis means that it is still unknown whether or not gestational diabetes mellitus causes increased imt . The current study was performed to evaluate carotid imt in diabetic pregnant women with gestational diabetes and to ascertain if an impaired oral glucose challenge test (ogct) correlates with the development of increased imt . This cohort study included 50 women ranging from 18 to 35 years of age at high risk of diabetes during pregnancy . Gestational diabetes mellitus was screened with a one - hour 50 g oral glucose challenge test (ogct). Abnormal results were, thereafter, confirmed with a three - hour 100 g oral glucose tolerance test (ogtt). Eligible women were nulliparous with a singleton pregnancy, had a normal blood pressure at the time of recruitment, and gave informed consent . Women with any of the following were excluded: family history of cardiovascular disorders; history of hypertension; anti - hypertensive and cholesterol medication use; hyperlipidemia; overt diabetes or fasting plasma glucose (fpg)> 125 mg / dl according to the american diabetes association (ada) definition;10 chronic renal or hepatic diseases; malignancies; recent hormonal medications; cigarette smoking; severe obesity (body mass index [bmi]> 35 kg / m); and history of infertility or polycystic ovarian disease . Those with the status of plaques / shadowing (> 1.0 mm) at any carotid site were also excluded . The study protocol was approved by the research and ethics committees at kerman university of medical sciences . Baseline demographic variables were collected either from the women s medical records or self - completed questionnaires at trial entry and comprised maternal age, height, weight, bmi, smoking status, and blood pressure at trial entry . Total cholesterol was measured enzymatically with standard methods and total triglyceride was measured via standard spectrophotometric techniques . After the precipitation of low - density lipoprotein (ldl) particle with phosphotungstic acid, high - density lipoprotein (hdl) cholesterol was measured enzymatically in the supernatant by a modification of the method for total cholesterol . B - mode ultrasound scans were performed at baseline and at two time points of mid - term pregnancy (20 to 24 weeks) and full - term pregnancy (36 to 38 weeks) on all the participants . Carotid ultrasound scans were carried out by a single trained sonographer unaware of the study protocols and methodology . B - mode ultrasound images were equipped with a 7.5-mhz linear array transducer and captured with a ge log 200 ultrasound machine . The ultrasonic variable used in the statistical analysis was the mean of the imt of common carotids and internal carotid arteries from two walls (near and far walls) at four different angles . The mean of carotid imt was compared between the women with impaired ogct and those who screened normal on ogct at the two study time points . For the statistical analyses, the statistical software spss version 19.0 for windows (spss inc . The continuous variables, if normally distributed, were analyzed using the student - test and presented as mean differences, while the mann - whitney test was employed for skewed data . The baseline characteristics of the pregnant women with impaired and normal ogct tests are presented in table 1 . The two groups were similar in terms of pregnancy age, height, weight, bmi, and baseline laboratory parameters . There were no significant associations between carotid imt and maternal indices, including the demographic variables and laboratory parameters . An overall comparison between the impaired ogct test group and the control group via the mann - whitney u test revealed significant differences in carotid imt in the midterm and full - term pregnancy (table 2). The trend of the changes in carotid imt during the mid - term to full - term pregnancy was, however, insignificant in each group . An increased carotid imt can be observed not only in long - standing type ii diabetic but also in newly detected type ii diabetic patients . Especially in pregnant women, carotid imt gradually increases from the first to the third trimester of normal pregnancy and regresses in the postpartum period . Nevertheless, the trend of the increase in pregnant women with gestational diabetes is still unclear . In our study, with the aid of carotid ultrasound, arterial examination was performed at mid - term and full - term pregnancy and both controls and the women with an impaired ogct test were assessed and compared with regard to the changes in carotid imt . We showed that although carotid imt was more increased in those with impaired ogct, the trend of this change was similar between the impaired and normal ogct groups . Furthermore, we observed that carotid imt was significantly higher in the diabetic group than in the normoglycemic group in different trimesters, but the trend of these gradual changes from the first to the third trimester was similar in both groups . Totally, effective glycemic control seems to be helpful for the prevention of increased carotid imt . During the pregnancy period, peripheral vascular resistance is physiologically paralleled by improved macrovascular compliance.11, 12 some researchers have shown that 2 - 4 years after previous gestational diabetes mellitus, a significantly higher arterial stiffness can be found compared with reference women without a history of diabetes.13 pregnancies complicated by diabetes not only are associated with increased carotid imt but also can lead to increased maternal arterial stiffness.9 this study demonstrates increased imt of the carotid artery in a group of women who had a pregnancy complicated by impaired ogct . This finding is in line with the literature confirming that women with a history of gestational diabetes have a higher risk of developing increased carotid imt . One of the first steps in the development of atherosclerosis is endothelial activation, followed by endothelial dysfunction . Thus, in diabetes mellitus, vascular endothelial activation or dysfunction is considered to play a key role in the development of many of the clinical manifestations related to carotid artery disease, several years after delivery . Some epidemiological studies have found positive associations between parity and risk of carotid artery plaques in elderly women and, therefore, age of pregnancy can be a trigger for this phenomenon.14 also, multi - gravidity and previous history of coronary diseases have been also identified to be related to the appearance of carotid artery plaques.15 folate deficiency during pregnancy is another probable triggering factor for progressing carotid imt . Folate deficiency is linked with hyperhomocystinemia,16 which is associated with accelerated progression of atherosclerosis17 and, thereby, carotid artery imt . Pregnancy is potentially a cause of folate deficiency.18 consequently, it is possible that multiparous women are at risk of prolonged folate deficiency; this may explain their susceptibility to the development of carotid artery imt . In the present study, the main limitation was blood glucose controlled by insulin; we could not hold treatment because of ethical issues . Also, we did not assess the confounding effects of the triggering variables such as age of pregnancy, multi - parity, or medication during this period on increasing carotid imt; that should be considered in further studies . Prospective follow - up studies will also be needed and have meanwhile been started to determine whether diabetes during pregnancy itself is responsible for the increase in imt . In conclusion, an impaired ogct test is proven to be an independent risk factor for increased carotid imt and subsequent coronary artery disease . Even with this small study, we were able to find an increased imt after diabetes appearance, which might be used as an indicator of a potential increased vascular risk . Furthermore, imt measurements in diabetic pregnant women could offer an opportunity to identify a high - risk group of women who might benefit from early screening and preventive measures . These measures could include lifestyle interventions such as improving diet and physical activity as well as increased surveillance of blood pressure, serum lipids, and particularly blood glucose.
Since dental ceramic restorations have been introduced in 20 century,1 reproduction of natural appearance of teeth has been a major concern in dentistry . For metal - ceramic restorations, light reflection from an opaque porcelain layer to mask the metal substrate resulted in opaque appearance and therefore, their use in high esthetic area was limited.2 glass ceramic restorations without metal substrate induced more light transmission and accordingly, they improved the ability to reproduce the appearance of tooth structure.3 despite the esthetic advantage of glass ceramics, the demands for stronger ceramic restorations have increased . As a result, high strength zirconia - based ceramics combined with cad / cam technology have broadened the range of their applications in dentistry.4 however, cohesive failure of the veneering porcelain has been reported as a major drawback56 and thereby, fabricating monolithic zirconia restoration which consists of a single zirconia material without any veneering could be an alternative approach to obviate the veneering failure.7 the esthetic value of dental ceramic restorations is influenced by several factors, such as color, translucency, fluorescence, surface texture and shape.8 furthermore, the overall color of ceramic restorations can be influenced by the thickness of the ceramic, the thickness and the color of luting agent, and the color of the underlying tooth structure . 9 several studies investigated the effect of the thickness on overall color and translucency of ceramic restorations.291011121314 changes of color and translucency may be expected when the thickness of porcelain layer changes, although the direction of color change may depend on the specific components of the ceramic systems.15 due to its inherent white and opaque appearance, monolithic zirconia can be colored in a pre - sintered state to match adjacent teeth . In a clinical situation, there could be a thickness reduction during the process of occlusal adjustment by dentists . However, there have been no reported studies regarding the changes of color and translucency as a function of changes in thickness using monolithic zirconia . The purpose of this study was to evaluate the effect of the amount of thickness reduction on color and translucency of dental monolithic zirconia ceramics . The null hypothesis to be tested was that there was no significant difference in color and translucency between monolithic zirconia ceramics with different amount of thickness reduction . One - hundred sixty - five square - shaped specimens from presintered yttria - stabilized tetragonal zirconia blocks (lot no . : b 105566, b 105583, b 105565, b 88712; bruxzir, glidewell laboratories, newport beach, ca, usa) were colored with coloring liquid (lot no . : 40127, 40129; tanaka zircolor, a2, tanaka dental, skokie, il, usa) and assigned to 5 groups according to the number of coloring liquid application (group i (one time) to v (five times), n = 33 per each group) following the same protocol used in our previous study.7 the specimens were heated in a furnace (austromat basic, dekema dental - keramikfen gmbh, freilassing, germany) with a step sintering procedure; sintering at 950 for 10 minutes and at 1,500 for 2 hours . After sintering, the thickness adjustment was performed in the same manner as was used in our previous studies.716 accordingly, the final dimensions of the specimens were 16.3 mm 16.3 mm 2.0 mm . Each group was then divided into eleven subgroups (n = 3 per each subgroup) by reducing the thickness of 0.1 to 1.0 mm in increments of 0.1-mm on the colored surface using a horizontal grinding machine (hrg-150, am technology, asan, korea); subgroup 0 (no reduction), subgroup 1 (0.1 mm reduction) to subgroup 10 (1.0 mm reduction). Color parameters were obtained from cie - lab (commission internationale de l'eclairage l, a, b) color space relative to d65 on a reflection spectrophotometer (cm-3500d, konica minolta, tokyo, japan). For the instrument, diffuse illumination was used and the reflected light was measured (cie diffuse/8-degree) at the center and each quarter of the specimen . A 3-mm diameter aperture for diffuse illumination and 3-mm measurement area each of l, a and b values was measured against a black background (cm - a 101b, konica minolta, tokyo, japan, l = 0.1099, a = 0.2107, and b = -0.4292) and a white background (cm - a120, konica minolta, tokyo, japan, l = 96.6880, a = -0.1755, and b = -0.1236) in the reflectance mode with specular component excluded (sce) at 10 nm intervals in the wavelength range of visible light, 400 - 700 nm . Optical contact was obtained by placing a drop of distilled water (refractive index: 1.33, approximately) between each specimen and a background.11 spectral reflectance against a white background was recorded at 10 nm intervals in the range of 400 to 700 nm . Color difference between each subgroup was calculated using cie lab color - difference formula17 denoted by eab = [(l) + (a) + (b)]. L, a, and b refer to the difference on lightness, red / green axis, and yellow / blue axis, respectively . To determine the color difference, the average cie values against a black background were used . For translucency measurements, translucency parameter tp value was calculated by the color difference between values against a black and a white background18 which is denoted by tp = [(lb - lw) + (ab - aw) + (bb - bw)]. Diffuse transmittance measurement was performed using an integrating sphere with the aperture size of 9.5 mm in diameter . All measurements, therefore, were made at the center and each quarter of the specimen and values were averaged ., chicago, il, usa) and the level was set at 0.05 . Normal distribution of each color value and tp value was verified with shapiro - wilk test . To identify if there is any significant difference in color and tp values among subgroups, one - way anova was carried out followed by multiple comparison scheff test . Pearson correlation and linear regression was fitted to test for a relationship between the amount of thickness reduction and color and tp values . 3 showed means of cie l, a and b values of each group against a black background in the reflectance mode as a function of the amount of thickness reduction, respectively . Cie a value generally increased, while cie b value decreased with the increase of thickness reduction in all groups . Correlation analyses between l, a or b values against a black background in the reflectance mode and the amount of thickness reduction were conducted . There were negative, but weak correlations between l value and the amount of thickness reduction in most groups (-0.58 <r <0.34, 0.09 <r <0.34). There were positive correlations between a value and the amount of thickness reduction in all groups (0.72 <r <0.85, 0.52 <r <0.73). There were negative correlations between b value and the amount of thickness reduction in all groups (-0.86 <r <-0.07, 0.00 <r <0.74). Average spectral reflectance curves against a white background of each subgroup within groups were obtained (fig . 4). There was a significant difference between subgroup 0 and other subgroups through the entire spectrum and the values of spectral reflectance in other subgroups were lower than subgroup 0 . The interpretation of the color difference for this study is based on the visual matching study of johnston and kao19 who found that color difference of 3.7 eab unit was acceptable for resin composites . Color differences between subgroup 0 and other subgroups were clinically perceptible (eab> 3.7) (fig . 5) color differences between subgroup 1 and 2 were within the range of perceptibility threshold (eab <3.7) except group ii . Color differences between subgroup 2 and 3 were within the range of perceptibility threshold except group v. color differences between subgroup 3 and 4, 4 and 5, 5 and 6, 6 and 7, 7 and 8, 8 and 9, 9 and 10 were within the range of perceptibility threshold in all groups . Means of tp for each subgroup within groups are calculated and ranged from 2.27 to 5.34 (table 1). Highly significant correlations were found out between tp values and the amount of thickness reduction in all groups (r> 0.94, r> 0.89, p <.001). Spectral transmittance of each subgroup exhibited similar spectral behavior through the entire spectrum and transmittance generally increased with increasing the amount of thickness reduction in all groups (fig . According to the results of this in vitro study, the null hypothesis could be rejected because there were significant differences in l, a or b values and tp values between monolithic zirconia specimens with different amount of thickness reduction . The effect of various changes in thickness of each layer on the final appearance of layered metal - ceramic structures has been studied.212152021 l value substantially increased with the decrease of porcelain thickness212 and the direction of color changes were dependent on porcelain shade and the type of metal - ceramic alloy . Increasing the thickness of dentin porcelain produced more scattering and absorption of the incident light and less light reflected back from the opaque layer . With regard to all - ceramic systems, l value generally decreased due to increased absorption of incident light with thicker specimens, while a and b values increased as the ceramic thickness increased.101113 there might be a difference in the amount of light reflection at the opaque core between all - ceramic systems with different core translucency . Douglas and przybylska2 demonstrated that the semi - translucent all - ceramic systems were less affected by reduced porcelain thicknesses compared to metal - ceramics . In this study, the changes in l value showed a different feature compared to metal - ceramic or all - ceramic systems . There was a significant decrease in l value at initial reduction, but there were no further significant changes on l value in most groups (fig . 1). The different aspect of change might come from different optical and structural properties since monolithic zirconia ceramic is polycrystalline monolayer without any veneering . It can be inferred that there might be reduced scattering due to the reduced thickness which induces lower l value at first 0.1 mm reduction . However, as the thickness reduction proceeds, monolithic zirconia itself could act as an opaque core and induce internal reflection.22 thus, reduced reflection might compensate increased internal reflection and l value could be relatively stable . Chromatically, a value increased, while b value generally decreased with increasing thickness reduction . Regarding the shift in chroma, b value was more sensitive to the change of thickness than a value showing minimal shifts in a value . 21113 according to the study of douglas and brewer,23 dental observers were more sensitive and critical to the color difference in redness than yellowness for metal - ceramic crowns . However, their study was conducted with metalceramic crowns and therefore, further study should be performed to determine whether there is any difference in subjective color assessment between a and b value for monolithic zirconia restorations . 3), group ii exhibited noticeable changes in a and b values down to 0.2 mm reduction and group iii; to 0.3 mm reduction, group iv; to 0.6 mm reduction, and group v; to 0.5 mm reduction . There was no distinct difference in a and b values between groups after around 0.6 mm reduction . It can be inferred that the more coloring liquid is applied, the deeper the coloring liquid infiltrates . In addition, one time of coloring liquid application might infiltrate 0.1 mm deep through monolithic zirconia specimen, two times of application; 0.2 mm deep, three times of application; 0.3 mm deep, and four or five times of application; around 0.6 mm deep through monolithic zirconia specimen . This study exhibited a perceptible color difference from no reduction (eab> 3.7) even after first 0.1 mm reduction regardless of the number of coloring liquid applications . Antonson and anusavice14 investigated the translucency of dental core and veneering ceramics as a function of ceramic thickness . There was a positive linear correlation between contrast ratio and thickness (r> 0.81). Hefffernan et al . Investigated the effect of the thickness of core materials,24 and the thickness of veneered core materials25 on the translucency of the specimens . O'keefe et al.26 suggested that the thickness of the porcelain veneer was the primary factor affecting light transmission and not the opacity . Tp values generally increased as the amount of thickness reduction increased in all groups (r> 0.89, p <.001). Based on lambert's law,27 decreasing the thickness of material the fraction of incident light that is reflected, absorbed, and transmitted depends upon the thickness of the specimen as well as the scattering and absorption characteristics.28 this in vitro study has several potential limitations . The first limitation is that even application of coloring liquid on the specimens and exact amount of the increase of coloring liquid were difficult to control . Secondly, possible pressure fluctuation inside the furnace during the sintering process might have induced uneven color of the specimens . Thirdly, the aperture diameter of spectrophotometer for reflectance measurement was 3 mm and possible edge loss would have affected the color measurement . Finally, this study was conducted with limited color of shade a2 and with a specific kind of monolithic zirconia system and coloring liquid . Therefore, the influence of varied color combinations with different monolithic zirconia systems should be further studied . Increasing thickness reduction reduces lightness and increases a reddish, bluish appearance, and translucency of monolithic zirconia ceramics.
Rituximab is a relatively novel medication for immunomodulation in current clinical practice . With its use becoming fairly widespread and newer indications being approved at a fast rate it is also imperative to watch for any adverse reactions, which may need monitoring parameters during therapy a 54-year - old man was diagnosed with limited form of wegener's granulomatosis 1 year before the current hospitalization . He had failed therapy with corticosteroids and was recommended rituximab for resistant disease state . Besides lung and upper airway involvement, he had no other organ involvement from wegener's disease . Five days after receiving the infusion he developed postural dizziness and had near syncopal episodes, which led to hospital admission . He denied chest pain, shortness of breath, fever, palpitations, and any rash . Vital signs on admission revealed hypotension with a blood pressure of 80/40 mmhg, pulse 75 beats / min, respiratory rate 20/min, and temperature 98f . Electrocardiogram (ecg) showed a new onset left bundle branch block (lbbb) [figure 1c] as compared to his prior ecg performed a month back before the current admission [figure 1a]. In view of new lbbb, an urgent transthoracic echocardiogram was performed revealing normal left ventricular systolic function and absence of wall motion abnormalities . Patient was admitted to intensive care unit and was treated with intravenous fluids and inotropic agents for hypotension . Contrast - enhanced cardiac magnetic resonance imaging was conducted to rule out focal myocarditis as a cause of the new onset lbbb; and failed to show any abnormality . On day 2 of admission, telemetry showed intermittent lbbb [figure 1b] and eventually the lbbb was replaced by a narrow qrs complex [figure 1d] with only supportive treatment . Patient remained hemodynamically stable off inotropic agents and was discharged home and is doing well on follow up . Telemetric strip new onset left bundle branch block (lbbb) intermittent sinus beats with lbbb and finally resolution of lbbb rituximab, the first monoclonal antibody approved by the united states food and drug administration (fda) for the treatment of malignant disease, is being used to treat a wide variety of conditions in modern practice, including non - hodgkin's lymphoma, wegener's granulomatosis, rheumatoid arthritis, thrombotic thrombocytopenic purpura, among many others . Currently, four adverse effects that warrant a " black box " warning in the package insert are known: infusion reactions, tumor lysis syndrome, mucocutaneous reactions, and progressive multifocal leukoencephalopathy . It is also known to promote severe orthostatic hypotension often associated with allergic symptoms, urticaria, bronchospasm, and angioedema . Most adverse events occur during or after the first infusion of rituximab, and the number and severity of adverse events decreases with subsequent infusions . As with any novel therapy, new adverse reactions are being noted with increasing time and usage . In a multicenter phase ii study conducted to assess the toxicity and response rates to rituximab in b - cell malignancies that express cd20, 10 out of 131 patients developed an arrhythmia with treatment . These included bradycardia (n = 3), atrial fibrillation (n = 2), and nonspecified arrhythmia or tachyarrhythmia (n = 5). One other patient had palpitations, and another was noted to have premature ventricular complexes . In most cases, ventricular tachycardia during the infusion of rituximab and prompt disappearance after discontinuation of infusion was first reported in 2005 . Complete atrioventricular block induced by rituximab monotherapy in an 83-year - old has also been described in literature . Another recent report of polymorphic ventricular tachycardia causing syncope during initial infusion of rituximab raises concerns of arrhythmogenic side effects of this medication . Despite these reports a study to determine the maximum tolerated infusion rate of rituximab with special emphasis on monitoring the effect of rituximab on cardiac function concluded with confirmation of lack of cardiotoxic effect of a fast infusion rate . However, we could not come across any reported case of lbbb associated with rituximab infusion . Increased ventricular dysfunction after rituximab infusion has been seen which is attributed to growth of reticulin fiber in cardiac myocytes . Reticulin deposition may have an effect on conduction system causing rhythm abnormalities and interventricular conduction delays as seen in our patient . It is also hypothesized that the drug affects conduction by inhibiting the calcium - ion channel properties of the cd20 antigen, which could lead to formation of early after depolarizations . Still the mechanism by which rituximab may cause arrhythmias is presently unclear and needs more research . Also, it would be prudent to keep patients on electrocardiac monitoring during drug infusions to monitor for possible conduction abnormalities, especially the initial infusions.
Gallstone ileus causing small bowel obstruction is a well - document phenomenon; however, gallstones causing large bowel obstruction are much rarer and almost always secondary to existing bowel pathology . We report what we believe to be the first case of large bowel obstruction caused by an impacted gallstone without primary pathology distal to the stone and discuss potential management options from the literature to rationalize our choice of a defunctioning loop colostomy with the stone left in situ . A 92-year male, with no significant co - morbidities apart from peptic ulcers, was admitted with 6 days of obstination . On examination blood showed features of dehydration and plain abdominal x - ray demonstrated both small and large bowel dilatation, but no obvious causal pathology . A contrast - enhanced computed tomography scan revealed a 2.5-cm partially calcified gallstone impacted at the descending colon - sigmoid junction (fig . 1). 2), with a further smaller gallstone in the caecum (fig . 3). The offending gallstone could be seen incidentally in the gallbladder on imaging 3 years previously (fig . Figure 1:large gallstone impacted in the descending colon - sigmoid junction, causing large bowel obstruction proximally . Figure 2:cholecysto - colic fistula, with a thick - walled, dilated, gallbladder . Figure 3:ct reconstruction showing the impacted gallstone and a smaller incidental gallstone in the caecum . Large gallstone impacted in the descending colon - sigmoid junction, causing large bowel obstruction proximally . The patient was initially resuscitated, although he could not tolerate an naso - gastric tube . This failed due to a large amount of faecal matter distal to the stone, despite several phosphate enemas . In light of worsening abdominal distension and pain, the patient underwent a lower midline laparotomy where the hugely dilated small bowel was decompressed via the stomach, the descending colon mobilized and the diagnosis confirmed . There was indeed no primary pathology distal to stone; however, the stone could not be disimpacted, and the overlying colonic wall was viable with no evidence of ischaemia . Considering the patient's age and physiological reserve, the duration of large bowel obstruction, high morbidity and mortality associated with emergency surgery, and the fear of leak following a colotomy, an on - table decision was made to perform a proximal defunctioning loop transverse colostomy to relieve the obstruction . The cholecysto - colic fistula was left untouched, and the impacted stone left in situ . He will be brought back to the clinic to discuss the options with regard to removal of stone and reversal of his colostomy . Gallstone ileus is not an uncommon phenomenon; however, large bowel obstruction due to stone impaction is rarely seen due to the large calibre of the colon, with few case reports in the literature [2, 3]. The site of impaction is usually the sigmoid [3, 4], with retention of the stone as a result of a stricture from diverticular disease or previous radiotherapy . The stone is thought to enter the colon via a cholecysto - colic fistula, developing during a bout of acute cholecystitis affecting the hepatic flexure . Cases usually present with features of large bowel obstruction; however, colonic gallstones may also present atypically with non - specific symptoms such as diarrhoea, cholangitis or bleeding from the fistula tract . The diagnosis is best made on computed tomography (ct). A trial of conservative treatment may be attempted, and colonoscopy with and without lithotripsy has been successful in relieving obstruction; however, surgery may be needed if the stone cannot be retrieved and will not pass spontaneously . There is no definite consensus as to how a gallstone impacted in the colon should be treated . The options are a combination procedure of enterolithotomy, cholecystectomy and fistulectomy, or enterolithotomy alone with or without a covering loop colostomy to resolve the immediate obstruction [2, 3]. The former leads to relief of the obstruction as well as preventing further stone formation and episodes of cholangitis; however, as these patients are invariably elderly and bearing significant co - morbidities, a minimalistic approach is often preferable . In our case a laparotomy was undertaken as endoscopy failed and the patient's pain and distension continued to worsen . At laparotomy the small bowel was decompressed to view the colon and to rule out further contributing pathology . A defunctioning transverse loop colostomy was performed without removing the stone to avert the immediate crisis, while minimizing morbidity and mortality . This would have hastened patients post - operative recovery, while resulting in a similar functional outcome . We believe this to be the first instance that an impacted gallstone has been left in situ post - operatively with a proximal loop colostomy used for symptomatic relief . There are various options now for retrieval of the stone, should this be necessary . The gallstone could be accessed directly via the colostomy or anus, and it may be possible to use lithotripsy to shatter and remove the stone without resorting to surgery . On the other hand, it could be left alone, as although fears remain that such a stone might erode through the wall or cause a localized abscess, decompression of the bowel has significantly reduced the chance of pressure necrosis and related complications.
Diabetes mellitus is a common endocrine disease that is characterized by chronic hyperglycemia and insulin deficiency or resistance which are associated with other complications such as macroangiopathy and microangiopathy . Moreover, studies have also recorded that hyperglycemia can eventually induce the production of reactive oxygen species (ros) and nitric oxide (no) in the long run, increase cell apoptosis, decrease cell mass, and cause insulin deficiency and resistance . To date, the treatment for diabetes including insulin, metformin, and sulfonylureas was found to cause various side effects especially the development of resistance after a certain period of time . Thus, efforts to search for alternative and novel therapies to manage diabetes are still receiving great attention . Personalized nutritional management and physical activity have been recommended to replace the american diabetes association diet to achieve better glycemic control in diabetic patients . Besides, complementary and alternative medicine in the form of plant - based food and spices that are commonly used in traditional medicine to treat diabetes have also been recommend as better oral agents . For example, momordica charantia (bitter melon) is a traditional antidiabetic remedy that has been identified as a potential hypoglycemic agent in streptozocin / alloxan - induced diabetic and type ii diabetic subjects . Other than herbs, whole grains and cereals that serve as the source of energy in asian food have also been suggested as potential antidiabetic food due to their low - glycemic indices [6, 7]. The glycemic index of a food is defined as an effect on postprandial glucose in comparison to the reference food . Low - glycemic index foods have been proven to improve glycemic control of insulin and noninsulin - dependent diabetes mellitus . Mung bean (vigna radiata l.) is a food that is traditionally used to reduce fever and used for detoxification . Among all types of seeds, mung bean has been recommended as an alternative food for diabetic patients due to its high - fiber content and low - glycemic index . Yao et al . Had reported that ethanolic extract of mung bean was able to reduce blood glucose, total cholesterol, and tg levels while enhancing the glucose tolerance and insulin sensitivity in type ii diabetic mice . Fermentation is a common food processing method traditionally practiced in the east and southeast asian regions to improve the food colour quality, flavour, or even the nutrient content . Alterations made by microflora during the fermentation process may help to release the active ingredients that are beneficial to human health . Fermented soybean, for example, was found to have better antidiabetic effect due to attenuation of the structures and contents of isoflavonoids and smaller bioactive peptides . Although the antihyperglycemic effect of mung bean has been reported, the potential of fermentation in improving the antihyperglycemic and the antioxidant effect of mung bean is still unknown . Thus, this study compared the effects of fermented and nonfermented mung bean extracts on normoglycemic, glucose - induced hyperglycemic and alloxan - induced hyperglycemic mice . The serum antioxidant levels of extracts treated alloxan - induced hyperglycemic mice were also evaluated in this study . Alloxan, glucose, folin - ciocalteu reagent, ascorbic acid, gallic acid, and gsh assay kit were purchased from sigma - aldrich (usa). Momordica charantia was purchased from ccm pharmaceutical (malaysia) as positive control in this study . Strain 5351 inoculums were obtained from the culture collection center of the malaysian agricultural research and development institute (mardi). Seeds of mung bean (vigna radiate) were subjected to solid - state fermentation before extraction . Then, the fermented bean was dried and ground into powder followed by water extraction in the ratio of 1 g of fermented seeds in 20 ml of deionised water (25c) for 30 minutes . The mixture was then centrifuged and the supernantant was freeze - dried at an operating temperature of 50c to obtain a final yield of 25% (w / w). Uplc analysis was performed on a acquity uplc system (waters corp, usa) coupled with acquity uplc accq tag ultra column (2.1 100 mm, 1.7 m) and pda detector at 55c to analyse gaba and amino acid concentrations . Gaba and amino acids were separated using a gradient mobile phase consisting of a: accq tag ultra eluent a and b: accq tag ultra eluent b with the following gradient conditions: 00.54 min, 0.19.1% b; 5.747.74 min, 9.1%21.2% b; and finally, reconditioning the column with 0.1% b with isocratic flow for 2.1 min after washing column with 59.6% b for 0.30 min . One l of all samples and standards were injected at a flow rate of 0.7 ml / min . The data were then analyzed using the waters empower 2 software . From the analysis, every 100 g of the nonfermented mung bean extract contained 0.016 0.001 g of gaba and 0.256 g of total amino acids . In contrast, the concentration of gaba in the fermented mung bean extract increased by 7.6-fold to 0.122 0.009 g/100 g of dried powder while the amount of amino acids increased by 13 fold to 3.326 g/100 g dried powder . The experiments were evaluated on normoglycemic, glucose - induced hyperglycemic, and alloxan - induced diabetic mice . The mice were subjected to 18 h of fasting before each test was carried out . Balb / c mice (8 weeks old, 1822 g) were purchased from the animal house in the institute of bioscience, university putra malaysia . Standard laboratory pellet diet and water were made available ad libitum throughout the experimental period at 22c of dark - light cycle . This study was approved by the animal care and use committee of university putra malaysia . Mice were randomly assigned into their respective groups for normoglycemic, glucose - induced hyperglycemic, and alloxan - induced hyperglycemic studies as listed below . Blood glucose was collected from all experimental mice for analysis after 18 h of fasting . Group i: normal control mice without any treatment; group ii: m. charantia extract (200 mg / kg); group iii: nonfermented mung bean extract (1000 mg / kg); group iv and v: fermented mung bean extract (200 mg / kg and 1000 mg / kg, resp . ). After 18 hours of fasting, blood glucose was determined (0 min) before oral administration of distilled water or the respective extracts (0.3 ml / mice) was given to each mouse . Monitoring of blood glucose level was continued at 30, 60, 120, and 240 min after the administration of treatment or distilled water . Mice were randomly assigned into five different groups (n = 8) as listed above . After 18 h of fasting, blood glucose level was determined at 0 min . Then, oral feeding of distilled water or the respective extract was given simultaneously with 1 g / kg (0.3 ml) of glucose solution to each group . Monitoring of blood glucose level was continued at 30, 60, 120, and 240 min after the oral administration . Group 1 was the normal control mice that received distilled water as placebo while groups 26 were diabetic mice . Diabetes was induced using intraperitoneal injection of alloxan (100 mg / kg, 0.1 ml). The hyperglycemic mice were maintained on 5% glucose solution for the next 24 h to prevent hypoglycemia and monitored for 3 days to ensure constant blood glucose levels before they were subjected to 18 hours of fasting . After the fasting period, blood glucose was determined at 0 min, followed by oral feeding with distilled water (group 1 and 2) or the respective treatment . Group 3 received m. charantia extract (200 mg / kg); group 4 received nonfermented mung bean extract (1000 mg / kg); group 5 and 6 received fermented mung bean extract (200 mg / kg and 1000 mg / kg, resp . ). In addition, all the mice were also fed with glucose solution once (1 g / kg, 0.3 ml, p.o . ). Monitoring of blood glucose level was continued at 30, 60, 120, and 240 min after administration . Treatments with distilled water and the extracts were continued for a total of 10 days . On the last day of treatment, all mice were fasted for 18 h before being anesthetized with ether and sacrificed by cervical dislocation . Blood was collected to obtain serum for determination of glucose, total cholesterol (biovision, usa), triglyceride (tg) (biovision, usa), low - density lipoprotein (ldl) (biovision, usa), high - density lipoprotein (hdl) (biovision, usa), and insulin (mercodia, sweden) levels . The antioxidant level of serum was evaluated by detecting the level of malondiadehyde (mda) as described previously while serum nitric oxide level was determined using the griess method (invitrogen, usa). The results for blood glucose level, serum biochemical profiles, and antioxidant level were presented as mean s.d . One way analysis of variance (anova) followed by duncan test was used in this study with p values <0.05 being considered as significant . Overall, fermented mung bean, nonfermented mung bean, and m. charantia extracts did not produce any hypoglycemic effect but caused slight hyperglycemic effect within 2 hours of oral feeding in normal mice (figure 1(a)). However, for the glucose - induced hyperglycemic mice, the animals from all groups were found to develop high blood glucose levels at the first 30 minutes after oral administration (figure 1(b)). However, treatment with 1000 mg / kg body weight of fermented and nonfermented mung bean extracts could significantly reduce the elevated blood glucose level in comparison to the normal control group . Although significant effect was also shown by the m. charantia extract treatment but the effect was comparatively weaker than in the previous groups . On the other hand, low concentrations of the fermented mung bean extract did not show any significant difference in antihyperglycemic effect when compared to the normal control . Significant changes of body weights were observed in the untreated normal mice . For all the diabetic mice, changes of body weights were not significant (figure 2). Treatments on day 15 were based on 22 g / mice while from day 6 to10 were based on 24 g / mice . Generally, diabetic mice (groups 2 to 6) gained less weight than normal mice (group 1) during the treatment period (figure 2). Nonfermented mung bean showed a hyperglycemic effect similar to the untreated diabetic mice in group 2 . M. charantia and fermented mung bean extracts (200 mg / kg body weight) on the other hand were able to prevent drastic increases in blood sugar when compared to the untreated diabetic mice . Among all treatment groups, high concentration of fermented mung bean extract (1000 mg / kg body weight) was able to reduce blood sugar level most significantly throughout the period of monitoring (30 min to 2 hours after feeding) (figure 1(c)). The alloxan - induced diabetic mice were monitored continuously in the following 10 days with continued treatment for groups 3 to 6 . Untreated mice in group 2 maintained a high blood glucose level in comparison to mice in the other groups . The blood sugar levels of m. charantia, nonfermented mung bean, and low concentration of fermented mung bean (200 mg / kg body weight) extracts treatment groups were found to be reduced slightly at day 10 while a high concentration of fermented mung bean extract at 1000 mg / kg body weight was able to reduce blood sugar levels even at day 5 after administration (figure 1(d)). The serum lipid profile and the insulin level of the alloxan - induced hyperglycemic mice after 10 days of treatment were assessed . Untreated diabetic mice in group 2 showed significantly higher levels of total cholesterol and tg but lower levels of hdl and insulin . In contrast, a high concentration of fermented mung bean extract (1000 mg / kg body weight) showed lower levels of total cholesterol and tg but higher levels of insulin and hdl in comparison to the nonfermented mung bean extract (table 1). Similar to the effects on serum lipid profile and insulin levels, untreated diabetic mice in group 2 exhibited significantly higher mda and no levels . Both m. charantia and fermented mung bean extracts were able to restore the antioxidant level more effectively than the nonfermented mung bean extract . Besides, we also observed that the antihyperglycemic effect of the fermented mung bean extract was dosage dependent whereby a higher concentration of fermented mung bean (comparing between group 5 and group 6) exhibited better antioxidant activity with lower no level (table 1). Previously, m. charantia and mung bean have been reported as potential antidiabetic agents . Low - glycemic - index mung bean was able to reduce plasma lipid level, epidilymal adipocyte volume and plasma insulin [68]. Thus, mung bean has been recommended as a food of choice for diabetic patients . However, it is still uncertain whether fermentation could enhance the antidiabetic effect of mung bean . In this study, we have compared the antihyperglycemic effects of fermented and nonfermented mung bean extracts in normoglycemic, glucose - induced hyperglycemic, and alloxan - induced hyperglycemic mice . Normal fasting blood glucose for mice is around 90 mg / dl (~5 mmol / l). Animals having fasting blood glucose levels more than 200 mg / dl (~11 changes of fasting blood glucose of normaglycaemic and glucose - induced hyperglycaemic mice which were 20% lower than those of the untreated normal control were considered as hypoglycaemia . All the extract - treated mice in the normoglycemic study showed slight increases in blood sugar without indication of hypoglycemic effect . This outcome may be contributed by the primary metabolites that are present in the water extract, or more specifically by the carbohydrates in this context . However, in both glucose- and alloxan - induced hyperglycemic mice, m. charantia, fermented and non - fermented mung bean extracts were able to reduce oral glucose tolerance to prevent drastic glucose increase in the blood . These results suggested the possibility of using fermented and nonfermented mung bean extracts for regulating blood sugar via their antihyperglycemic effects, which could enhance glucose adsorption in the gut . Continued administration of the extracts for 10 days had also been associated with blood sugar reduction (figure 1(d)). Fermented mung bean extract at 1000 mg / kg body weight showed the best reductions of blood sugar levels of diabetic mice at day 5 . M. charantia, nonfermented mung bean, and low concentration of fermented mung bean extracts showed similar trends of reduction at day 10 . The findings from this study were in good agreement with a previous report on the assistance of m. charantia in the regulation of blood sugar via improved insulin sensitivity and recovery of -cells in the pancreas after 12 days of treatment . In this study, fermented mung bean (200 mg / kg body weight) and non - fermented mung bean exhibited a trend of blood sugar regulation similar to that of m. charantia extract . Therefore, fermented and nonfermented mung bean extracts could also possibly regulate blood sugar level by enhancing the sensitivity of insulin and by the regeneration of -cells in the pancreas . Clinical studies had reported that low - glycemic - index diet contributed small effects on the control of postprandial hyperglycemia in diabetic patients . Thus, the improved antidiabetic effect due to fermented mung bean may be contributed by the enhancement of phytochemicals during the fermentation process . Advances in the effectiveness for controlling glucose metabolism through fermentation were also reported for soy bean [2, 16]. Solid state fermentation was predicted to improve the antidiabetic effect of mung bean via enrichment of antioxidants and phytochemicals . In this study, we have found that enhanced blood sugar regulation by a high concentration of fermented mung bean may be contributed by the enriched gaba content (7.6 fold) in the extract as compared to the nonfermented mung bean . The regenerative effect of gaba on islet -cell via activation of pi3-k / akt - dependent growth and survival pathways had been reported by soltani et al . And tian et al . Free amino acids (13 fold increase in fermented mung bean) had also been reported as an effective oral supplement for diabetic patients . Among the tested free amino acids, lysine which recorded a marked increase in the fermented mung bean (0.001 g/100 g dry weight of nonfermented mung bean and 0.134 g/100 g dry weight of fermented mung bean) (result not shown) had also been reported as being an enhancer to the insulin - receptor tyrosine kinase activity in type ii diabetic patients . These free amino acids or more specifically lysine may contribute synergistically with gaba to regulate the blood glucose of the fermented mung bean - extract treated diabetic mice . Elevated serum lipid profile including cholesterol, tg, ldl with low hdl level is one of the pathogenesis of diabetes that also representing the risk factor for coronary heart disease . In this study, alloxan - treated diabetic mice was observed with high serum cholesterol, tg, and ldl when compared with normal mice . Treatment with m. charantia, fermented and nonfermented mung bean extracts were able to reduce the risk factors for coronary heart disease by restoring the healthy lipid profile in the alloxan - induced diabetic mice . Other than a higher lipid profile, the serum of diabetic patient was also indicated with higher level of mda and oxidative stress [22, 23]. Fermentation was able to improve the in vitro antioxidant and phenolic contents of mung bean . This effect may contributed greatly to the reduction of the mda level of the fermented mung bean extract (1000 mg / kg body weight) treated diabetic mice . Besides, our results also showed that fermented mung bean extract was able to reduce the nitric oxide (no) level in the serum of the alloxan - induced diabetic mice in a dosage dependent manner . Where ethanolic extract of mung bean showed anti - inflammatory effect and reduced no synthesis in a macrophage cell line . Thus, the significant reduction of no by a high concentration of fermented mung bean extract may indirectly help to reduce the damage of -cell . In this study, fermented mung bean extract further improved the antihyperglycemic effect of nonfermented mung bean extract in both glucose and alloxan - induced hyperglycemic mice . This effect may be due to the improvement of the gaba and free amino acid contents through the fermentation process . Investigating on the details mechanism of fermented mung bean's antihyperglycemic effect are still on - going.
Hailey - hailey disease (hhd) or familial benign chronic pemphigus first described in 1939, is a rare autosomal dominant genodermatosis, which presents with recurrent vesicles, erythematous crusts and erosions in the areas subjected to friction, including, the neck and intertriginous areas . Abnormalities in the tonofilament desmosome keratin complex results in marked acantholysis, giving the histological appearance of a dilapidated brick wall, which is pathognomonic of the disease . Ultra violet b rays the treatment is often not satisfactory and hence, various modalities of treatment have been tried . We describe a case of hhd with a positive family history, in which various treatment modalities were tried without any benefit but responded well to thalidomide . A 30-year - old unmarried male presented with a history of recurrent painful fluid and pus filled lesions followed by painful erosions over the neck, axillae, trunk and groins of 15 years duration exacerbated over the past 10 - 15 days . He gave family history of similar disease in his father, paternal grandmother and paternal uncles . Before coming to us, he had been treated with dapsone following which he developed agranulocytosis and dapsone was discontinued . Several other treatment modalities including oral and topical antibiotics, corticosteroids were tried but resulted in only partial or temporary improvement . Large macerated plaques studded with foul - smelling pus along with erosions, fissures, and crusts were present on the anterior and the lateral aspect of the neck, axillae, back, lower abdomen, pubic area, gluteal cleft, groins, upper medial thighs and scrotum [figure 1]. Erosions and crusts were seen on the glans with purulent foul smelling discharge in the prepucial sac, sparing rest of the penis . The skin biopsy specimen for histopathological reconfirmation of the diagnosis revealed focal suprabasilar clefting, few acantholytic cells, intercellular edema with dilapidated brick wall appearance which confirmed our diagnosis [figures 2 and 3]. Macerated plaques with erosions and crusts over the scrotum, glans penis and upper medial thighs focal suprabasal clefting and lacunae (h and e, 10) suprabasalar clefting with few acantholytic cells, intercellular edema and dilapidated brick wall appearance (h and e, 40) patient was started on intravenous (iv) betamethasone 4 mg, 8 h which was tapered off with the introduction of 40 mg of oral prednisolone, iv ceftriaxone 1 mg twice daily and later iv piperacillin - tazobactam based on pus culture and sensitivity reports along with a combination of fusidic acid and betamethasone for topical application . He continued to develop new lesions with the deterioration of his general condition and was febrile throughout . In spite of controlling the secondary infection, the vesicular eruptions persisted . Therefore, he was started on oral thalidomide 100 mg three times a day and a combination of betamethasone and gentamycin for topical application . Marked improvement was seen within a week of starting thalidomide [figure 4] and hence we discontinued corticosteroid after rapid tapering of its dose and continued treating him with oral thalidomide 100 mg three times a day for one more week, which was then tapered off in 3 - 4 weeks and maintained on 50 mg daily . After 6 months of receiving 50 mg thalidomide, the drug was stopped in view of no recurrence of the lesions . He has improved well and comes to us for regular follow - up . Mucosal involvement is unusual in hhd and has been very rarely reported and can involve oral, conjunctival, vaginal, or in very rare instances esophageal mucosa . Our patient had oral, pharyngeal, and genital mucosal involvement, which were resistant to the symptomatic treatment . Apart from the symptomatic therapy, drugs such as corticosteroids, dapsone, etretinate, methotrexate, cyclosporine, topical 5-fluorouracil, topical vitamin d analogs, topical zinc oxide, alefacept, psoralen plus ultraviolet a therapy and photodynamic therapy have been tried with varying results . As hhd is often recalcitrant to treatment, further options including invasive methods such as grenz ray therapy, carbon dioxide laser abrasion, erbium: yag laser ablation, dermabrasion, electron beam therapy, botulinum toxin and full - thickness excision of affected skin with repair by split - thickness grafting have been reported as useful in treatment of hhd . In the study conducted by galimberti et al . Hhd is linked to mutations in the calcium - transporting atpase type 2c member 1 gene encoding the human secretory pathway ca / mn atpase . Topical gentamicin was found to be very effective in inducing remission in a hhd patient carrying a premature stop mutation . It may be an important alternative in the treatment of hhd in patients not responding to the other modalities of treatment or when the conventional drugs are contraindicated . Mucosal involvement is unusual in hailey - hailey disease (hhd) and has been very rarely reported . Our patient had oral, pharyngeal, and genital mucosal involvement.thalidomide may be an important alternative in the treatment of hhd in patients not responding to the other modalities of treatment or when the conventional drugs are contraindicated . Mucosal involvement is unusual in hailey - hailey disease (hhd) and has been very rarely reported . Thalidomide may be an important alternative in the treatment of hhd in patients not responding to the other modalities of treatment or when the conventional drugs are contraindicated.
In numerous industrial countries, cerebro - vascular accident (cva) has been the third common cause of death after coronary arteries diseases (cad) and cancers . Several studies have indicated that higher levels of inflammatory biomarkers such as c - reactive protein (crp) and interlukin-6 (il-6) have been associated with worsening ischemic events . Crp is a systemic inflammatory marker that is produced in a large amounts by hepatocytes in response to il-1, il-6 and tnf factor . Rapid induction of crp, its long half - life (19 hours) and lack of alteration during day and night in comparison with other acute phase reactants has introduced crp as an important factor for evaluation in inflammatory and infectious diseases . Nowadays, crp is a confirmed diagnostic marker for the patients with cva and recent prospective investigations showed that crp is clinically helpful for predicting the risk of the next cardiovascular diseases . Although many studies have been conducted on association of crp and cardiac diseases; only few studies have evaluated its role in predicting mortality in stroke patients . In addition, it can be used as biomarker at early phases in diagnosis of stroke, determining prognostic value of therapeutic programs and secondary prevention strategies . In this study, we intended to evaluate association of crp as an inflammatory marker with acute cerebral ischemic attack characteristics, risk factors and to determine a cutoff point of hs - crp in predicting early mortality . This study was conducted on 200 patients with impression of stroke who had been referred to emergency ward of university hospital, imam khomeini hospital, tehran, iran, within may 2009 march 2011 . Patients who had referred earlier than 24 hours after ischemic stroke were enrolled in the study . 38 patients with body temperature higher than 37.8 c, hemorrhagic stroke and those with previous inflammatory or malignant diseases were excluded . Medical history was taken from the patient or his / her relatives if the patient was unconscious or not able to speak . Patients were evaluated for age, sex, diabetes, hyperlipidemia, ischemic heart diseases, smoking and past history of stroke or hypertension . Routine laboratory tests, brain magnetic resonance imaging (mri), transthoracic echocardiography (tte) and carotid doppler ultrasonography were done in all of the patients . National institutes of health stroke scale (nihss) was used for assessing stroke severity . Type of stroke was determined based on toast (trial of org 10172 in acute stroke treatment) classification . It is able to demonstrate various types of acute ischemic stroke with different etiology and is consisted of 5 sub - groups: large - vessel atherosclerosis, cardioembolic, small - vessel occlusion or lacunar, undetermined etiology, and non - atherosclerotic determined etiologies . Another sample for specific tests was stored in room temperature for 20 minutes until clotting . Serum was stored in -70 c and sent to heart center hospital of tehran university of medical sciences and hs - crp concentration was determined by turbidimetry method and roche kit (manufactured in swiss) with using cobaf apparatus (model integra400 +). Usa) using chi - square test and student's t - test for univariate analysis and mantel hansel analysis for multivariate analysis . Receiver operating characteristic (roc) curve was drawn for demonstrating cut off point of crp for predicting patients mortality within the first week of admission . They had been referred to emergency ward of imam khomeini hospital within may 2009march 2011 . Mean age of the patients was 67 12 years with a range of 33 - 95 years . Patients were classified into 3 age groups: 11 patients were younger than 50 years (6.8%), 81 cases were 50 - 70 years (50%) and 70 patients were older than 70 years (43.2%). Clinical demographic evaluation showed hypertension in 77 (47.5%) patients, diabetes in 50 (30.9%), hyperlipidemia in 56(35%), history of cardiovascular diseases in 46(24.8%), history of previous cva in 33(20.4%) and cigarette smoking in 67(41.4%) patients . Mean of nihss score was 9.5 8 (min 1 and max 30). According to nihss score, our patients were classified to 3 sub - groups: nihss score <7 (mild neurologic disorders), nihss score 7 - 13 (moderate neurological disorders) and nihss score> 13 (severe neurological disorders). According to toast classification criteria, large vessel atherosclerosis was seen in 95 subjects (58.6%), cardioembolic in 11 (6.8%) and small vessel occlusion in 56 patients (35%). Regarding roc curve analysis, appropriate cut - off point for predicting patients short time mortality was determined as 2.15 in this study . In addition, nihss> 10 was considered as appropriate score for predicting patients short - term mortality (fig . Roc curve of variables for predicting mortality in the patients with stroke association between hs - crp and early mortality in the patients with acute cva was significant . Mean of crp in died patients was 8.9 7 mg / dl and in survived patients was 2.2 5 mg / dl (p = 0.0001). The hs - crp amounts showed a significant association with early mortality, diabetes, ihd (ischemic heart diseases), smoking and nihss . Incidence of early onset mortality based on sub - groups of evaluated demographic variables in the investigated patients with acute ischemic stroke nihss: national institutes of health stroke scale; rr: relative risk; crp: c - reactive protein after multivariate analysis and adjusting for sex, age, history of heart disease, nihss score and toast, we found hs - crp as an independent factor in predicting early onset mortality . Significantly increased rate of mortality by 13.3 times was seen in patients by simultaneous crp> 2.15 and nihss> 10 as cut - off points for predicting mortality, so that out of 23 patients possessing these conditions 11(47.8%) died . In the patients who had simultaneously crp> 2.15, neurological defect severity was more than 10 and diabetes and mortality rate increased about 19 times; so that out of 13 patients possessing these conditions, 10(76.90%) died . Therefore, co - existence of these three factors in a patient may strongly increase the risk of mortality . Determinant criteria for mortality risk in the patients with cva and comparing them with each other are summarized in table 2 . Comparing of multivariate factors with early death in the patients with stroke nihss: national institutes of health stroke scale; rr: relative risk; crp: c - reactive protein the results of present study showed that hs - crp in the patients with acute ischemic cva who had died within the first week after manifesting symptoms was significantly higher than survived patients . In addition, hs - crp levels more than 2.15 mg / dl were considered as cut - off point for predicting mortality in this study . In addition, a large number of previous studies have reported that increasing crp at the first hours after stroke was associated with risk of mortality . Montaner et al . Introduced crp as a powerful factor for predicting mortality after cva . Ischemic damage to brain resulted in disturbance in neuroglia activity especially astrocytes adhered to endothelial . Therefore, these cells release cytokines and inflammatory factors that resulted in neuron necrosis and vessels endothelial permeability . At the same time by impaired blood brain barrier (bbb) permeability, neutrophils by exiting through endothelial cells, enters into tissues and increase inflammatory markers concentration . As a consequence, it is considerable that numerous articles recommend application of nihss system for more accuracy in stroke severity . Cut - off point of> 10 for nihss was shown in present study that in combination with an elevated crp> 2.15 was associated with 13 times increase in mortality . Similarly, studies performed by basic et al . And shenhar et al . Showed association of nihss and increase in inflammatory factors . Neurological defect severity and its association with elevated crp were shown in ischemic cycles so that more ischemia resulted in more neurological defect severity . Among 16 dead cases, 14 (30.4%) patients had history of heart diseases and significant association was seen between hs - crp and mortality in relation to ischemic heart disease . In addition, a meta - analysis study indicated that crp is directly associated with ischemic heart diseases, stroke and mortality risk . Time of hs - crp evaluation was a determining factor in early predicting mortality in this study . Maximum of plasma crp concentration has been usually reported within 36 to 48 hours after initiating signs of stroke . A study by winbeck et al . Showed that the most appropriate time for obtaining blood samples was 12 - 24 hours after initiating signs and can predict the risk of cardiac and cerebral vascular events . In the present study, this study showed that there was a direct association between hs - crp and mortality within the first week after stroke . Cut - off point of crp was 2.15 mg / dl and measuring hs - crp within the first hours after stroke increase the predicting rate of early mortality risk . As up to now, a blood biomarker that can introduce accurate information about cause and outcome after stroke has not been known yet, cut - off point of hs - crp can be used for therapeutic decision making.
Mushrooms have been used as food, medicine, poison, and in spiritual mushroom practices in religious rituals across the world since at least 5000 bc . Gordon wasson (father of modern ethno mycology) believed that the soma plant used in religious ceremonies, over 4000 years ago, before the beginning of the christian era, by the people who called themselves the vedic juice called soma rasa is said to bestow divine qualities on the soul of the consumer, even immortality . Ayurveda classifies mushrooms under tamasika ahara, and as a medicine for enhancing vigor and vitality . The fungus cordyceps sinensis has been described in old chinese medical books from ancient times, and is also found in tibetan medicine . The fungus penicillium from which the antibiotic penicillin is derived is the most famous medicine of the age, and the most potent hallucinogen agent lysergic acid diethylamide (lcd), has also been derived from the plant traditional healers in sikkim recommend the fungus / mushroom cordyceps sinensis for all illnesses as a tonic, because they claim that it improves energy, appetite, stamina, libido, endurance, and sleeping patterns . It is a rare combination of a caterpillar and fungus found in sikkim at altitudes above 3,800 m. the mushroom is most popular in the lachung and lachen area of north sikkim and has the reputation of being a precious longevity - promoting herb . The present study was undertaken to collect as much information as possible regarding traditional claims for its uses in different diseases . There are a number of reputed classes of practitioner like the amchi (tibetan folk practitioner) and vaidyas (herbalist / folk healers). Relevant information was gathered from local people, local practitioners, folk healers, and by direct contact with herb collectors of lachung and lachen, during repeated field visits between june 2008 and september 2009 . Information was collected through an open - ended questionnaire from a large number of individual respondents, as well as through semi - structured interviews . They were asked for herbs local names, traditional and commercial uses, parts used, and mode of administration . Information obtained in each locality was cross - checked at different places with other respondents . To substantiate the usefulness of cs, scientific information for the chemical constituents, curative effect, biological studies, and pharmacological studies although not actually a mushroom taxonomically, it has been described as an exotic medicinal mushroom in traditional chinese and tibetan medicine . It grows only in high - altitude regions of about 3800 m above sea level, in cold, grassy, alpine meadows of the himalayan mountains . The base of the mushroom first originates from an insect larval host (hepialis armoricanus family hepialidac) and ends at the club - like cap, including the stipe and stroma . The fruit body is dark brown to black, and the root of organism, the larval body pervaded by the mycelium, is yellowish to brown color . The immature larvae (host) on which cordyceps grows usually lies about 6 inches below the surface of the ground . As the fungus approaches maturity, it consumes more than 90% of the infected insect effectively mummifying its host . The people of north sikkim call the fungus / mushroom / herb yarsa gumba; its tibetan name [winter (yarsa) and summer (gumba)]. In the literature, gunba or gonba have also been used instead of gumba . Dollar per piece in the international market and is locally available at rs.100/- per piece . Thereafter, local people and herders used the fungus powder with jaggery to increase milk production, and improve reproductive capacity and vitality of their cattle . Then its relevant medicinal properties were explored, collecting only the aerial part (fruiting body / stroma), which they dried in sunlight as primary processing . Then they themselves consumed it and became convinced of its medicinal effects in enhancing vigor and vitality . They further claimed that it has aphrodisiac effects, and hence they used to give it as a gift to relatives and friends from gangtok and adjoining areas . At present, local folk practitioners use the product alone or in combination with other medicinal herbs to treat various diseases, administering different doses for different ailments according to their experience, based on an empirical trial - and - error method . People of both sexes usually take one piece of c. sinensis with a cup of milk to enhance their sexual potency and desire . The bhutia community put one piece of c. sinensis in a cup of local - made alcohol (chang), leave it for 1 hour, and drink it morning and evening as a tonic . Similar reports are also available from nepal. [911] an attempt was made to evaluate the strength of the folk claims by counting the number of users for particular illnesses . Prolonged, continuous use by local folk healers / traditional healers for the treatment of 21 ailments, including cancer, bronchial asthma, bronchitis, tb, diabetes, cough and cold, erectile dysfunction, bhp, jaundice, alcoholic hepatitis, etc ., were noted [table 2]. Most traditional healers and elderly people use it to increase longevity and cure erectile dysfunction . Traditional uses of cordyceps sinensis (yercha gumpa) in north sikkim various pharmacological and biological studies establishing the curative effect of corydeps involving various experimental models (in vitro and in vivo) and some clinical trials in volunteer athletes . C. sinensis exhibits very broad biological and pharmacological actions in hepatic, renal, and cardiovascular diseases . Pharmacological actions of cordyceps are primarily due to bioactive polysaccharides, modified nucleosides, and cyclosporine like metabolites . Also, the fermentable strain of the mycelia causes normal fat mobilization and beta - oxidation, thereby maintaining blood glucose level during prolonged exercise in athletes . A chinese study conducted on mice, a double - blind, placebo - controlled trial, investigated whether oral administration of cordyceps results in enhanced endurance and resistance to fatigue . After 3 weeks of administration, the groups given cs-4 were able to swim significantly longer than the control groups . The results of the study were dose - dependent with results of one group on a higher dose showing a 30% increase in endurance and the second group showing a 73% increase in endurance . The study concluded that the cardiotonic action, inhibition of tracheal constrictions, and relaxation of contracted vascular smooth muscle (which cs-4 evokes) increase the ability and endurance of exercise . Another double - blind, placebo - controlled study was conducted to test the effects on physical performance in 1998 led by s. morrissey of beijing medical university sports research institute . They found that the group given the most of the product containing cordyceps experienced improved lactate clearance . Researchers concluded that lactate clearance improved due to improved lactate energy metabolism within the cell . Hence the authors concluded that using this cs formulation would enhance lactate clearance and allow athletes greater anaerobic physical performance [table 3]. Major pharmacological functions of cordyceps sinensis scientific proof of the effects of the cordyceps mushroom seem to be quite promising and coincide with folk practices of sikkim and other parts of india, china, nepal and bhutan . Many natural products have been identified from the fruiting bodies and cultured mycelium of cordyceps and related species . The major chemical constituent is cordycepic acid with other amino acids, vitamins and minerals [table 4]. Various pharmacological and biological studies establishing the curative effect of corydeps involving various experimental models (in vitro and in vivo) and some clinical trials in volunteer athletes . C. sinensis exhibits very broad biological and pharmacological actions in hepatic, renal, and cardiovascular diseases . Pharmacological actions of cordyceps are primarily due to bioactive polysaccharides, modified nucleosides, and cyclosporine like metabolites . Also, the fermentable strain of the mycelia causes normal fat mobilization and beta - oxidation, thereby maintaining blood glucose level during prolonged exercise in athletes . A chinese study conducted on mice, a double - blind, placebo - controlled trial, investigated whether oral administration of cordyceps results in enhanced endurance and resistance to fatigue . After 3 weeks of administration, the groups given cs-4 were able to swim significantly longer than the control groups . The results of the study were dose - dependent with results of one group on a higher dose showing a 30% increase in endurance and the second group showing a 73% increase in endurance . The study concluded that the cardiotonic action, inhibition of tracheal constrictions, and relaxation of contracted vascular smooth muscle (which cs-4 evokes) increase the ability and endurance of exercise . Another double - blind, placebo - controlled study was conducted to test the effects on physical performance in 1998 led by s. morrissey of beijing medical university sports research institute . They found that the group given the most of the product containing cordyceps experienced improved lactate clearance . Researchers concluded that lactate clearance improved due to improved lactate energy metabolism within the cell . Hence the authors concluded that using this cs formulation would enhance lactate clearance and allow athletes greater anaerobic physical performance [table 3]. Major pharmacological functions of cordyceps sinensis scientific proof of the effects of the cordyceps mushroom seem to be quite promising and coincide with folk practices of sikkim and other parts of india, china, nepal and bhutan . Many natural products have been identified from the fruiting bodies and cultured mycelium of cordyceps and related species . The major chemical constituent is cordycepic acid with other amino acids, vitamins and minerals [table 4]. The folk healers of sikkim use c. sinensis to cure 21 ailments including cancer, asthma, tb, diabetics, cough and cold, erectile dysfunction in males and female bhp, hepatitis, etc . Many studies in vitro and in vivo support c. sinensis having diverse biological activities and pharmacological potential [table 3]. Its effects on renal and hepatic function and immunomodulatory - related antitumor activities are most promising and deserve further attention . Although the origin and preparation of cordyceps have not always been clearly addressed, most studies use water - soluble, polysaccharide - rich fractions or alcohol extracts . Now all possible measures have to be undertaken to ensure that a healthy environment is sustained so that substantial harvesting can be carried out for the medicinal fungi and plants, which will be able to provide the basic income for folk healers and other rural people . Fermented mycelia can be constantly produced on a large scale, and are a better source of the medicine . Available evidence regarding c. sinensis's medicinal value look very promising, but there is a lack of study performed specifically on humans . More mechanism - based and disease - oriented pharmacological studies are required . The need of the hour is now to undertake detailed pharmacological studies of c. sinensis for its pharmacokinetics, pharmacodynamics, and toxicities in humans . In the ayurvedic pharmacopoeia, the mushroom / fungus, c. sinensis
The replacement of missing anterior teeth presents challenges to the prosthodontist regarding esthetics and function . Implant supported prosthesis for missing anterior teeth are increasingly finding acceptance in the present day treatment options . The morphology of existing bone in the premaxilla often dictates that implants be placed at angles that are difficult to restore with conventional (0) abutments . Angled implants are often used in single tooth replacements in the anterior region of the maxilla, distal extension cases in the maxillary and/or mandibular arch, overdentures in the edentulous maxilla and occasional anatomic problems for placement of straight implants . However, the angulated abutments might transfer unfavourable forces to the implant or bone, thereby compromising the prognosis of the treatment . The angulation of the implant abutments is one of the many biomechanical variables involved in implant dentistry . During the prosthetic phase, in order to have a well - designed, functioning and esthetic supra - structure, angulated abutments are used . However, due to a change between the long axis of the supra - structure, and the implant, the stresses generated in response to the masticatory or vertical load may be different in type, magnitude and direction . This may result in resorption of the bone at the cervical cortical region or loss of osseointegration . There is surprisingly little information in the available literature regarding the clinical success of angled abutments . Hence, it was considered appropriate to undertake the study of stresses generated having different angulations to the long axis of the implant, under axial and oblique loading, by finite element modelling and analysis . Because, it is difficult to assess the generated forces clinically, a finite element analysis was chosen for the present study as it is a useful tool in estimating stress distribution in the contact area of the implant with the bone . The three dimensional (3d) finite element analysis study was conducted in the post graduate department of prosthodontics, sardar patel post graduate institute of dental and medical sciences, lucknow - in collaboration with - lelogix design solutions private limited, greater noida, uttar pradesh using the software package solid works 2009 [figure 1a and 1b]. Maxillary bone was modelled representing the frontal region of the maxilla with a cortical bone of 1.5 mm thickness enclosing cancellous core . Implant was modelled as a cylindrical, round ended, 13 mm long with 4.1 mm diameter . Abutment was modelled as 7 mm in height with a five degree occlusal taper [table 1]. Finite element mesh was generated by a network of fine elements or nodes [table 2], [figures 2a - c] and then the mechanical properties of the material were assigned [table 3]. Four different abutment angulations, respectively 0, 10, 15 and 20 were used . The magnitude of force in the axial loading was 100 n, 125 n, 150 n, 175 n, and 200 n. the oblique loading was kept constant at 50 n [figure 3]. The loading was based on the average axial / oblique loading observed in the natural dentition by different researchers . To prevent the movement of the model during loading, model of straight abutment (solid works 2009 software) model of angulated abutment (solid works 2009 software) list of parameters used in fea study number of elements and nodes modelled for the bone mesh of cortical bone mesh of cancellous bone material properties used in finite element analysis directions of load application (axial and oblique) the implant was placed in the section of the bone and the 0 abutment was placed onto it, and the von misses, compressive and tensile stresses were calculated . Similarly, in the second and third and fourth groups, 10, 15 and 20 abutments were used on the same implant configuration and the same load was applied to the implant [tables 4 and 5], [figure 5a and b]. Compressive stress and tensile stress under axial loading compressive stress and tensile stress for 50 n force under oblique loading compressive stress and tensile stress for 200 n force at 0 degree axial loading compressive stress and tensile stress for 50 n force at 45 degree oblique loading the most common complications in implant dentistry once the prosthesis is placed are bone loss, fracture of the occlusal materials or implant components . An implant, placed in improper position, can compromise the final result in esthetics, biomechanics and hygiene maintenance . The most compromising position for an implant is, when placed too far facially: phonetics, lip position and function are compromised . Changing its angulation may have a bearing on the kind of loads transferred to the bone . This study was conducted to gain more insight into the influence of different angulated implant abutments on the stress distribution in the alveolar bone surrounding the implant both, under axial and oblique loading . The stresses can be evaluated by using one of the following methodologies: photoelastic methodstrain gauge analysisfinite element method / analysis . The finite element analysis is capable of providing detailed quantitative and qualitative data at any location within the mathematical model . The finite element analysis was chosen for the present study as it has proved to be a useful tool in estimating stress distribution in the contact area of the implant with cortical bone and around the apex of the implant in trabecular bone . The finite element analysis (fea) has been established as a standardized procedure for qualitative as well as quantitative assessment of the stress distribution in various structures . With the fea, the validity of the fea results depends on the precision, whether the geometry, the material proportion, the interface condition, support and loading are in accordance with the biomechanical reality and the mathematical modelling should be verified by actual experiment in order to verify the findings of the result . In the results the negative values assigned were that of the compressive stresses and positive for tensile stresses . A similar study was done by celland et al . In which axial loading of 178 n only was used . Their results could be compared with the findings of the current study for 200 n axial loading since; it is nearest to the loading conditions used in the current study [figure 6a and b]. It was observed that the maximum compressive stresses for 20 abutment were about 3.271 mpa in the present study whereas their value was about 5.0 mpa . For tensile stresses their observed value was about 2 mpa as compared to the value of approximate 6.833 mpa in the current study . The slight variation could be attributed to the change in geometry, amount of loads applied and difference in the bone density . On comparing the location of stresses it was seen that as the abutment angulation increased from 0 to 20, the concentration of stresses shifted to the cortical bone which was a consistent finding in both the studies . It was seen that there was an increment in compressive stress in proportion to the force being used and the changes were statistically significant whereas in case of tensile stress, though an increment was observed on increasing the force, this was not a proportional or significant change . On analysis of the results it was seen that as the abutment angulation is increased there is an increase in stresses, both tensile and compressive . However the magnitude of tensile stresses under oblique loading was found to be the greatest of all . On assessing the location of these peak stresses as the angulation changes it was observed that the peaks were located in the region of cortical bone . On taking the physiological limit of bone to be 170 mpa for compressive stress and 100 n for tensile stress for compact bone and 2 to 5 mpa for both compressive and tensile stresses in trabecular bone . . Only high levels of oblique loading for abutment angulations 20 were seen to be exceeding these limits . In general however, the component of oblique load should be kept to a minimum while designing restorations, as these forces were seen to be the ones which could be detrimental to the maintenance of bone around implants . 200 n force under axial loading 20 abutments (front view) 200 n force under axial loading 20 abutments (top view) though the location and magnitude of stresses generated in response to the load applied in the study are pertaining to the finite element model design of the study, yet limitations of modelling assumptions should also be considered as the nature of the material used for the study model as well as the static loads applied in the current study may vary from the heterogenous nature of the bone and dynamic chewing forces generated clinically . Hence, further research using 3d fea combined with long term clinical evaluation is encouraged . On the basis of the observations, of a three dimensional finite element analysis to access stress pattern in different abutment angulations, it can be concluded that though the compressive and tensile stresses generated through axial and oblique loading increase as the abutment angulation increases yet they are within the tolerance limits of the bone . However, care should be taken while planning a restoration so as to minimize the oblique component of force.
Ankylosing spondylitis (as) is a chronic, progressive disease, manifesting with inflammation of the sacroiliac joints and entheses . This disease may lead to structural and functional disorders1 and may be a significant cause of sleep disorders and reduced quality of life and ability to work2, 3, with consequent negative effects on family and social relationships4, 5 . The prevalence of psychiatric symptoms has been found to be higher in as patients than in the general population; the most common psychological symptoms are depression and anxiety6 . The concept of temperament is related throughout the lifetime of a relatively stable individual to the emotions, cognitive functions, and behaviors experienced in the home at a young age7 . Akiskal, who developed the modern concept of affective temperament, suggested that affective temperament had the potential risk of behavioral disorder8 . Five dominant affective temperaments have been defined: depressive, hyperthymic, cyclothymic, irritable, and anxious . Depression and anxiety may be subtypes of temperament or may develop as comorbidities of as disease . In recent years, the relationship between chronic auto - inflammatory and auto - immune diseases and the temperament of patients has attracted the attention of researchers9,10,11,12 . The psychiatric status of the patient can affect the disease process, prognosis and even treatment results13 . Therefore, the investigation and treatment of affective temperament in as patients may not only reduce patient concerns and problems, but may also provide alternative approaches to treatment and should be taken into consideration when planning treatment for these patients14 . To date, there has been no controlled study evaluating affective temperament in as patients and examining the relationship between existing depression and/or anxiety and dominant affective temperament . In this study, we aimed to determine and compare the most common dominant affective temperaments in as patients and in a healthy control group using the temperament evaluation of memphis, pisa, paris and san diego auto questionnaire (temps - a) and to examine the relationship in as patients between existing depression and anxiety levels and levels of pain, disease activity, and quality of life and the dominant affective temperament . Fifty - one patients diagnosed with axial spondiloartropathy (spa) and forty - two age- and gender - matched control subjects were included in this study . The radiographic arm of the assessment of spondyloarthritis international society (asas) identification was used for identification of axial spa . Baseline assessments were completed by trained investigators using identical questionnaires that included demographic information (age, gender, and education), disease duration, medications (non - steroidal anti - inflammatory drugs (nsaids), anti - tumor necrosis factor (tnf)), serum c - reactive protein level (crp), erythrocyte sedimentation rate (esr), pain by visual analog scale (vas), and measurements for disease activity, functional status, psychological status, health assessment, and affective temperament . Patients with any kind of collagen tissue disorders or any other inflammatory diseases, malignancies, diseases of the central nervous system, chronic kidney disease, chronic liver disease and thyroid diseases besides the as were excluded . Patients who were being treated for a psychiatric disorder or who had a lifetime history of psychiatric disorder, patients with mental retardation, and patients who had diseases of the brain or central nervous system, fibromyalgia, diabetes mellitus, hypertension, or were pregnant were also excluded . All assessments were made by the same physician and standardized case report forms were filled out . For all patients, written informed consent was obtained, and the protocol of the study was approved by the local ethics committee of namk kemal university (no: 2014/116). Disease activity and functional status; the bath ankylosing spondylitis disease activity index (basdai) is an index used to determine the activity of as . The index includes six questions about the levels of neck, back, lower back, and hip pain, fatigue, pain and swelling at peripheral joints, tenderness with palpation at several areas of the body, and morning stiffness, including its duration . The mean value of the last two questions is calculated together and the mean value of the resulting five items is then obtained . The bath ankylosing spondylitis functional index (basfi) was used to assess patient function . This scale is based on 10 questions about daily functioning, each scored on a 10-cm visual analogue scale (vas), reflecting status over the past month . The reliability and validity of the turkish version of basdai and basfi have already been demonstrated17, 18 . Pain; in the vas, the two extremes of the parameter being assessed are written at the edges of a 100-mm line, and the patient is asked to draw a line to or put a mark at the place that would indicate his or her status . For pain, no pain is written at one edge and very severe pain at the other edge . The distance from the point of no pain to the patient s mark defines his or her pain level . This test has proven itself over a long period of time and is widely accepted in the literature . Psychological status; affective temperament, the turkish version of the temps - a scale was used to determine the dominant affective temperament of the subjects . Volunteers were asked to complete the temps - a . The validity and reliability of temps - a has been proven in many languages, including in turkish by vahip et al20 . The turkish version of the scale consists of 99 items . Its 99 constituent items inquire about the subject s life - long traits along depressive, cyclothymic, hyperthymic, irritable, and anxious lines . No when considering their life experience . Cutoff scores to determine the dominant temperament are 13 for depressive mood (18 items), 18 for cyclothymic (19 items), 20 for hyperthymic (20 items), 13 for irritable (18 items), and 18 for anxious (24 items). It is possible to have more than one dominant affective temperament8, 20, 21 . The beck depression inventory (bdi) is a self - report inventory that measures the severity of depression22 . The bdi includes 21 items scored between 0 and 3.the turkish version was validated by hisli23 . The beck anxiety inventory (bai) is a self - report inventory consisting of 21 items scored between 0 and 3 that measures the frequency of physiological and other symptoms of anxiety experienced during the previous week24 . Measure of the quality of life; disease - related quality of life was measured using the ankylosing spondylitis quality of life (asqol) scale26 . The reliability and validity of the turkish version of this questionnaire was determined by duruz et al27 . This questionnaire consists of 18 items with dichotomous responses (yes / no) and is reliable and valid for measuring the health - related quality of life in patients with as . Asqol has a total score ranging from 0 to 18, with lower scores representing better as - specific quality of life measures of laboratory variables; the erythrocyte sedimentation rate (esr) was measured using the wintergreen method (mm / h), and serum c - reactive protein (crp) level was measured by nephelometry (mg / dl). Statistical analyses; spss for windows version 17.0 software was used for the statistical analyses of our study data . Mean standard deviation (sd) was used to identify the data related to the continuous variables, and number was used to identify the data related to the categorical variables . The kolmogorov - smirnov normalizing test was used to determine whether the continuous variable data fit a normal distribution . The comparison of the variables with normal distribution was carried using an unpaired t - test, and the comparison of the variables without normal distribution was carried out using the mann - whitney u - test . The comparison of categorical variables was done using pearson s test, and the relation among continuous variables was studied using spearman rank correlation analysis . Multiple linear regression analysis was used to explain the relationship between one continuous dependent variable from two or more independent variables . The data from 51 patients with as (32 female) and 42 healthy controls (32 female) were analyzed . Demographic characteristics and clinical and laboratory features of the patients are summarized in table 1table 1.demographic, clinical and laboratory variablesvariablesas (n=51)mean sdcontrol (n=42)mean sdage (years)38.7 10.437.8 4.6gender f / m32/1932/10crp7.3 8.9esr25 20.8hla - b27 seropositivity n;% 27/3; 81.8vas (0100 mm)47 26.4basfi3.1 2.5basdai4.0 1.8asqol7.0 4.4bdi10.2 9.77.5 5.9bai12.3 12.2 * 5.3 3.2duration of symptoms (years)12.2 7.7duration of education (years)9.5 3.3nsaid use n;% 41, 81.4anti - tnf use n;% 36, 70.6esr: erythrocyte sedimentation rate; crp: c - reactive protein; vas: visual analog scale; basdai: bath ankylosing spondylitis disease activity index; basfi: bath ankylosing spondylitis functional index; bdi: beck depression inventory; bai: beck anxiety inventory; asqol: ankylosing spondylitis quality of life; nsaid: non - steroid anti - inflammatory drugs . Esr: erythrocyte sedimentation rate; crp: c - reactive protein; vas: visual analog scale; basdai: bath ankylosing spondylitis disease activity index; basfi: bath ankylosing spondylitis functional index; bdi: beck depression inventory; bai: beck anxiety inventory; asqol: ankylosing spondylitis quality of life; nsaid: non - steroid anti - inflammatory drugs . * significant difference from the baseline value (p<0.05) temps - a scores of the patients and controls are shown in table 2table 2.distribution of temperament scores in the as and control groupsvariablesas (n=51)mean sdcontrol (n=42)mean sddepressive 6.2 3.96.9 3.3cyclothymic 7.8 5.06.9 4.3hyperthymic 9.6 4.39.2 4.4irritable 3.9 4.14.0 4.1anxious 7.4 6.76.0 4.9significant difference from the baseline value (p<0.05). There was no significant difference in the distribution of temperament scores between the as and control groups (table 2). significant difference from the baseline value (p<0.05) no difference was observed in patients between temperament, bdi, and bai levels according to the use of anti - tnf therapy (table 3table 3.temperament scores of patients according to the use of anti - tnf therapy and comparison of the bdi and bai scoresvariablesanti - tnftreatment (n=36)mean sdanti - tnfnon - treatment (n=15)mean sddepressive6.1 4.46.6 2.6cyclothymic 7.7 5.38.0 4.3hyperthymic9.5 4.89.8 3.2irritable3.8 4.44.0 3.4anxious7.6 6.87.0 6.9bdi9.9 9.811.1 9.8bai12.7 13.411.4 8.2bdi: beck depression inventory; bai: beck anxiety inventory * significant difference from the baseline value (p<0.05)). Bdi: beck depression inventory; bai: beck anxiety inventory * significant difference from the baseline value (p<0.05) temperament scores and bdi, bai values were compared with gender, duration of symptoms, education, and disease activity . Depressive, cyclothymic and anxious temperament scores along with the values of bdi and bai were higher in females . The increase in anxious temperament scores and bai values was statistically significant (table 4table 4.comparison of temperament, bdi, and bai scores according to gender, duration of symptoms, education, and disease activityvariablesdepressivecyclothymic hyperthymicirritableanxiousbdibaigenderf5.3 3.8 * 6.3 5.0 * 9.9 4.73.4 4.14.9 5.9 * 6.8 7.9 * 6.7 7.0m7.8 3.710.4 3.89.1 3.84.7 4.011.7 5.915.2 10.220.6 10.2duration of educaton 8 years7.3 3.8 * 8.6 5.710.2 4.24.4 5.09.7 7.4 * 13.5 8.8 * 17.8 13.6 > 8 years4.2 3.76.5 4.79.3 4.63.3 3.65.0 6.18.7 9.47.5 8.1duraton of symptoms <10 years6.0 3.58.6 4.410.4 4.24.5 3.48.1 6.512.1 11.114.7 14.8> 10 years6.3 4.37.2 5.48.8 4.43.4 4.66.8 7.08.9 8.610.4 9.1basdai<4.05.4 3.66.7 5.09.9 4.83.4 3.66.0 5.98.6 8.911.1 11.54.07.0 4.29.0 4.89.2 3.94.4 4.59.0 7.312.0 10.513.6 12.60.1890.0850.6300.3470.1330.3800.216basdai: bath ankylosing spondylitis disease activity index; bdi: beck depression inventory; bai: beck anxiety inventory . basdai: bath ankylosing spondylitis disease activity index; bdi: beck depression inventory; bai: beck anxiety inventory . * significant difference from the baseline value (p<0.05) temperament, bdi, and bai scores, age, duration of symptoms, duration of education, basdai, asqol, and correlations with vas are summarized in table 5table 5.correlation of temperament scores with the duration of symptoms, duration of education, and basdaivariablesageduration of symptomsduration of educatonbasdaiasqolvasdepressiver0.1520.0260.470 * 0.296 * 0.2500.280cyclothymic r0.1320.2590.2700.278 * 0.1150.408hyperthymicr0.2240.1370.0210.1290.1140.266irritabler0.1110.2950.2260.1780.0210.239anxiousr0.0580.1650.433 0.330 * 0.294 * 0.373bair0.1870.1020.522 0.2590.343 * 0.42bdir0.1510.1860.367 * 0.2620.3240.020basdai: bath ankylosing spondylitis disease activity index; bdi: beck depression inventory; bai: beck anxiety inventory . Basdai: bath ankylosing spondylitis disease activity index; bdi: beck depression inventory; bai: beck anxiety inventory . * significant difference from the baseline value (p<0.05) there was a negative correlation between depressive and anxious temperament, bdi and bai scores, and the duration of education . Positive correlation was only found between irritable temperament scores and duration of symptoms . There was a positive correlation between the basdai and the depressive and cyclothymic scores . There was a positive correlation between asqol and the anxious temperament, bdi, and bai scores . Depressive, cyclothymic, and anxious temperaments and bai and bdi scores were positively correlated with vas . Temperament, basfi, bdi, and bai scores have been found to have no correlation between hla b27 seropositivity, sedimentation, and crp values . Depressive, cyclothymic, irritable, and anxious temperament scores were positively correlated with bai and bdi (table 6table 6.association of temperament scores with bai and bdibaibdidepressiver0.579 * 0.454cyclothymic r0.582 0.506hyperthymicr0.1560.106irritabler0.4500.449anxiousr0.6910.576bdi: beck depression inventory; bai: beck anxiety inventory; vas: visual analog scale . Bdi: beck depression inventory; bai: beck anxiety inventory; vas: visual analog scale . this study, in which the turkish version of temps - a was used, is the first study to evaluate affective temperament in turkish as patients . No statistically significant difference was determined between the as patients and the control group with respect to the distribution of temperament subtypes . Various previous studies have shown similar results in the gender distribution of the five dominant affective temperaments, with females found to be more depressive, anxious, and cyclothymic26, 28 . Individuals with a depressive temperament display low energy and emotional state and negative cognition . Those with an anxious temperament have a tendency to be overly concerned about the welfare of themselves and those close to them . A cyclothymic temperament shows rapid and unexpected swings between the polar opposite emotional states of depressive and hyperthymic30 . In the current study, the anxious and depressive temperament scores were higher in those with low levels of education and there was a significant positive correlation between the duration of symptoms and irritable temperament . In a study by litaem, it was reported that as the duration of the disease increased, the irritable and hyperthymic temperament scores were found to be significantly higher10 . Irritable temperament forms with a highly variable mixture of dysthymic and hyperthymic features and manifests with habitual complaining, excessively critical attitudes, and outbursts of anger30 . There may be a relationship between high irritable temperament scores and longer duration of symptoms . The biological and psychological results of a chronic disease such as as may predispose an individual to the development of an irritable temperament . Studies have shown that depressive and anxiety symptoms were found at high levels in as31, 32 . In the current study, only the rates of anxiety were determined to be statistically significantly high compared to the control group . The bdi and bai values were high in females and those with less than 8 years of education . There is known to be a relationship between disease activity in as and a patient s psychological status and quality of life34 . Several studies have found a positive correlation between an increase in disease activity and depression and anxiety symptoms and a reduction in quality of life35 . In those with high basdai and vas values in the current study, the depressive, cyclothymic, and anxious temperament scores were higher . This shows that the affective temperament in as patients was affected by disease activity and pain . The correlation between the asqol values and the anxious temperament subtype scores demonstrates that anxious affective temperament affected quality of life . In a study by janowski, a relationship the role of stress in the etiology of as has not yet been fully understood, but the temperament characteristics of the patient may affect the success of the struggle against stress10 . Affective temperament can be included in the factors creating a predisposition to the development of affective disorders such as depression37 . Therefore, just as depression and anxiety symptoms could be a significant comorbidity in as patients, it could also be form of the infrastructure of temperament . The results of this study have shown a significant relationship between bai and bdi scores and depressive, cyclothymic, irritable, and anxious temperaments . This result suggests that affective temperament could be a risk factor for depression and anxiety in as patients (table 7table 7.multiple linear regression analysis of temperament scores with bai and bdibaibdiconstant4.4264.555depressive0.4420.299cyclothymic0.0950.122hyperthymic0.2090.312irritable0.9590.321anxious1.628 * 0.687bai: beck anxiety inventory; bdi: beck depression inventory . significant difference from the baseline value (p<0.05) this comparative study is the first to evaluate affective temperament in as patients by evaluating the relationship between the dominant affective temperament and existing depression and/or anxiety . Patients with additional diseases such as diabetes mellitus, hypertension, or fibromyalgia were not included in the study . Therefore, it was possible to evaluate the relationship between pain, disease activity, disability, and temperament . It was determined that as the depressive and anxiety symptoms of affective temperament increased in patients with as, so disease activity increased and quality of life deteriorated . Therefore, the importance of psychosocial support for as patients must be considered in the prognosis, and it can be suggested that the determination of the affective temperament of as patients would be helpful for clinicians in the treatment and motivation of patients . The factors explaining physical activity are unclear for axspa patients: is physical activity related to disease characteristics, e.g. Disease activity, severity, or treatment, or to patient - related characteristics? Whether the level of physical activity is related to disease activity is uncertain, some studies finding no correlation38, others reporting that patients with high disease activity exercised less39, 40 or reversely, more41 . Furthermore, other factors such as patients willingness and motivations to exercise may be more important to explain physical activity . A better knowledge of physical activity levels and their causes or related factors in axspa would allow physicians to target this aspect of disease management . The number of cases included in this study was relatively low and it was a cross - sectional study . There is a need for further prospective studies to evaluate the effects of temperament on as patients.
Udp - glcua (ammonium salt;> 98% purity), and nad (sodium salt; 98% purity) were obtained from sigma aldrich . Purified preparations of wild - type hugdh and e161q mutant were obtained using reported procedures . Both enzymes were produced as fusion proteins containing an n - terminal extension, which comprised a solubility enhancement tag, a streptavidin tag, and a tobacco etch virus protease cleavage site . The n - terminal extension was then removed, and the enzymes were further purified by gel filtration and anion - exchange chromatography . A 50 mm potassium phosphate buffer at pd 5.9, 7.0, 7.9 or 8.8 was used . Starting concentrations were 15 mm nad, 2 mm udp - glc and 0.38 m wild - type hugdh or 15 m e161q . After addition of all components, the reactions were incubated at 25 c for 16 h. for determination of the solvent isotope effect, enzymatic conversions in h2o or d2o were performed in a beckman coulter du800 spectrophotometer using a 50 mm potassium phosphate buffer with ph / pd 7.5 . Reaction velocity was measured by nadh absorption (= 340 nm). All spectra were recorded on a bruker drx-600 avance spectrometer (bruker, rheinstetten, germany) at 600.13 mhz (h). The h nmr spectra were measured at 298.2 k with presaturation (1.0 s) and acquisition of 32k data points . After zero filling to 64k data points, spectra were performed with a range of 7200 hz . Chemical shifts were referenced to external acetone (h = 2.225 ppm). The reactions were directly made in a 5 mm high precision nmr sample tube (promochem, wesel, germany) to measure in situ h nmr spectra . Samples contained 2 mm udp - glc, 15 mm nad, and 0.084 m wild - type hugdh or 33 m e161q, as well as 50 mm potassium phosphate buffer in d2o (0.70 ml, 99.9% d, pd 7.5 or 8.3). 12 h in the magnet by recording up to 64 h nmr spectra in regular intervals . The topspin 3.0 software from bruker was used for processing the nmr spectra after data acquisition . For quantitative analysis of the nmr data, a correction value was subtracted from the integral values of each proton to account for background noise . Udp - glcua (ammonium salt;> 98% purity), and nad (sodium salt; 98% purity) were obtained from sigma aldrich . Purified preparations of wild - type hugdh and e161q mutant were obtained using reported procedures . Both enzymes were produced as fusion proteins containing an n - terminal extension, which comprised a solubility enhancement tag, a streptavidin tag, and a tobacco etch virus protease cleavage site . The n - terminal extension was then removed, and the enzymes were further purified by gel filtration and anion - exchange chromatography . Full details of the purification protocol are given elsewhere . Enzymatic assays were performed in 1 ml of d2o . A 50 mm potassium phosphate buffer at pd 5.9, 7.0, 7.9 or 8.8 was used . Starting concentrations were 15 mm nad, 2 mm udp - glc and 0.38 m wild - type hugdh or 15 m e161q . After addition of all components, the reactions were incubated at 25 c for 16 h. for determination of the solvent isotope effect, enzymatic conversions in h2o or d2o were performed in a beckman coulter du800 spectrophotometer using a 50 mm potassium phosphate buffer with ph / pd 7.5 . Reaction velocity was measured by nadh absorption (= 340 nm). All spectra were recorded on a bruker drx-600 avance spectrometer (bruker, rheinstetten, germany) at 600.13 mhz (h). The h nmr spectra were measured at 298.2 k with presaturation (1.0 s) and acquisition of 32k data points . After zero filling to 64k data points, chemical shifts were referenced to external acetone (h = 2.225 ppm). The reactions were directly made in a 5 mm high precision nmr sample tube (promochem, wesel, germany) to measure in situ h nmr spectra . Samples contained 2 mm udp - glc, 15 mm nad, and 0.084 m wild - type hugdh or 33 m e161q, as well as 50 mm potassium phosphate buffer in d2o (0.70 ml, 99.9% d, pd 7.5 or 8.3). 12 h in the magnet by recording up to 64 h nmr spectra in regular intervals . The topspin 3.0 software from bruker was used for processing the nmr spectra after data acquisition . For quantitative analysis of the nmr data, a correction value was subtracted from the integral values of each proton to account for background noise.
Bone marrow cells from all 13 mice transplanted with single cd150 hscs gave rise to hematopoiesis after secondary transplantation (morita et al ., 2010). In contrast, only a minority of single cd150 or cd150 hscs gave rise to significant hematopoiesis in secondary recipients (morita et al . These findings dovetail with data demonstrating (with an entirely different hsc enrichment strategy) that cd150 expression predicts successful repopulation of secondary recipients (kent et al ., 2009). 2008) about whether cd150 hscs exist into perspective and suggest that the answer is to some degree arbitrary . A proportion of hscs lacking cd150 meet the conventional criteria for hsc activity in primary recipients, but these cells largely lack durable self - renewal in secondary transplant assays . Morita et al . (2010) further demonstrate that single cd150 hscs display robust myeloid reconstitution potential upon transplantation, whereas cd150 hscs mediate only faint myeloid, but superior lymphoid, reconstitution; these patterns appeared stable in secondary transplantations . Recently, three other groups independently reported similar findings, even though the enrichment strategies for hscs were quite dissimilar except for the use of cd150 (kent et al ., 2009; 2009) examined lymphoid versus myeloid reconstitution patterns associated with the absence or presence of cd150 on hscs (defined as cd45epcrcd48; kiel et al . 2006) and report a strong predominance of myeloid or lymphoid reconstitution after transplantation of cd150 or cd150 cells, respectively . Challen et al . (2010) demonstrated that myeloid and lymphoid - biased hscs can be purified based on hoechst dye efflux in combination with the absence of lineage markers and the presence of sca-1 and c - kit; further separation of these hscs based on cd150 expression enhanced discrimination of the lineage bias . (2010) used an hsc isolation strategy similar to that used by nakauchi s group and detected the same lineage bias associated with cd150 expression . Interestingly, this study revealed that the proportion of cd150 hscs strikingly increases with aging, whereas the proportion of cd150 or cd150 hscs strikingly diminishes with aging, suggesting that the well documented aging - related compromise of lymphopoiesis (sudo et al ., 2000; rossi et al ., 2005) is not caused by loss of lymphoid potential by a homogeneous population of stem cells, but rather by expansion of hsc populations with predominantly myeloid potential (beerman et al ., 2010). This model is also supported by recent experiments using limiting dilution transplantation of total bone marrow (cho et al ., 2008). Collectively, these data suggest that the output of different blood cell types by the hematopoietic system may be influenced by a balance of coexisting stem cell populations with different lineage propensities . The proportions of different stem cells appear to impact the final composition of differentiated blood cell populations even before the separation of distinct lineages occurs (fig . If different hsc populations coexist, an important question is whether they exist in a hierarchy . In principle, the different populations might be able to convert into each other, or they may derive from a parental stem cell that may or may not persist into adulthood (challen et al ., 2010). (2010) demonstrate that cd150 hscs can give rise to cd150 hscs (themselves), as well as to cd150 and cd150 hscs after transplantation, but that cd150 and cd150 hscs fail to give rise to cd150 hscs . Thus, cd150 hscs represent the top of the hierarchy . Yet, it is unclear at this point whether cd150 hscs continuously replenish cd150 and cd150 hscs during the steady state in adult bone marrow . (2009) demonstrated that cd150 hscs (lineage markerc - kitsca-1cd48) turn over almost as slowly as cd150 hscs . Hence, it is possible that this population can be maintained for long periods of time, even with limited self - renewal capacity . During normal aging, cd150 hsc populations expand while cd150 hsc populations diminish, suggesting that they are differentially regulated (beerman et al ., 2010). More directly, this notion is supported by the demonstration that lineage - biased hsc subtypes respond differently to transforming growth factor-1 (challen et al ., 2010). Deciphering the regulation of different hsc populations and investigating their potential cross talk is an important task for the future . Cd150 hscs harbor an impressive capacity to reconstitute the lymphoid system (kent et al ., 2009; however, their partially preserved self - renewal and the absence of expression of flt-3 clearly distinguish cd150 hscs from the first known major stage of lymphoid differentiation, the lymphoid - primed multipotent progenitor (lmpp; adolfsson et al ., 2005). Supporting a close developmental relationship between cd150 hscs and lmpps, cd150 hscs give rise to lmpps after transplantation much more efficiently than cd150 hscs (beerman et al . In addition, cd150 hscs harbor diminished erythroid - megakaryocytic potential in vitro (morita et al ., 2010). This is intriguing because loss of erythroid - megakaryocytic potential, even if controversial (forsberg et al ., 2006), was described as a hallmark trait of lmpps (adolfsson et al . Thus, it appears that self - renewal is not always entirely extinguished during the initial steps toward lineage differentiation . (2010) suggests that the cd150 hsc population is still heterogeneous . In the future, first, some stem cells appear to exclusively give rise to myeloid cells and, nevertheless, are capable of repopulating secondary hosts . Second, up to 10% of cd150 hscs represent latent stem cells, which did not give rise to detectable progeny for at least 3 mo after transplantation, and then produced only low levels of myeloid reconstitution in the primary host . The authors speculate that latent hscs may overlap with recently described highly quiescent label - retaining hscs (wilson et al . Such label - retaining hscs, like latent hscs, exhibited much stronger reconstitution activity after secondary transplantation (wilson et al . Single - cell transplantation of label - retaining hscs will be necessary to definitively clarify their overlap with latent hscs . Whether or not they are quiescent, the existence of the latent reconstitution patterns demonstrates that not all hscs contribute to blood formation at all times . This observation is reminiscent of retroviral marking experiments, which suggested that hematopoiesis at any given time is sustained by only very few clones (lemischka et al ., 1986 these experiments support a clonal succession model, in which most of the cells within the hsc pool remain quiescent, periodically releasing active clones to sustain blood production, as previously active clones exhaust their proliferative capacity . However, a clonal succession model was difficult to reconcile with data from chimeric mice made with different embryonic stem cell founders (harrison et al ., 1987) that showed that hematopoiesis was sustained simultaneously by large numbers of hscs derived from different founder cells . Nevertheless, the latter observations do not prove that all or even the majority of hscs produce blood at all times . It is tempting to speculate that latent stem cell behavior may be even more common in the nontransplanted host in the absence of stimulation from cytopenias resulting from myeloablative irradiation . It will likely be possible in the future to directly investigate such issues using conditional clonal genetic marking strategies that do not involve transplantation . At least in primary transplant recipients, latent hscs do not meet widely accepted operational criteria for hsc activity, which set the bar at a> 1% contribution to myeloid and lymphoid progeny in the peripheral blood for 16 wk (morrison and weissman, 1994; miller and eaves, 1997; ema et al ., 2005). As (2010) reasonably emphasize that current criteria for defining hscs may need to be reexamined . In fact, defining hsc activity based on peripheral blood analysis alone is also problematic for biological reasons . Although granulocytes are short - lived so that their presence in the blood, indeed, indicates ongoing active cell production, the situation is much more complicated with blood b and t lymphocytes . Conditional ablation of b and t cell production by time - controlled disruption of the recombination - activating gene-2 gene has shown that peripheral b and t lymphocytes are maintained for very long time periods, even in the absence of any new production (hao and rajewsky, 2001; bourgeois et al ., 2008). For example, naive follicular b cells are only gradually lost, with a half - life of 4.5 mo, and some smaller b cell subsets remain stable indefinitely (hao and rajewsky, 2001). As a result, using 1% lymphoid reconstitution as a criterion may lead to considerable overestimates of hsc properties, particularly for hsc populations with predominantly lymphoid output . It is emerging that heterogeneous hsc populations in the bone marrow coexist and coordinately give rise to hematopoiesis . In combination with other markers, the slam family member cd150 allows for the prospective enrichment of hsc populations with distinct characteristics . High expression of cd150 appears to identify cells at the very top of the hematopoietic hierarchy, as it is correlated with high self - renewal and marks the only cells with the potential to give rise to themselves, as well as to all other stem cell populations after transplantation . Absence or low expression of cd150 on hscs is associated with the acquisition of powerful lymphoid reconstitution potential . In the future, it will be important to further define the precise regulation, developmental relationships, and cross talk between different hsc populations, as well as to explore their role in disease.
The surgical indication is difficult to establish in some cases (more than 40%). Acute abdominal pain in women may be a manifestation of a disorder of various organs . In addition to surgical, urological, orthopedic, neurological, and psychogenic problems, gynecological causes play a major role . Incarcerated herniation of the bowel, occurring through a defect in the broad ligament, is extremely rare . We herein report the 2 cases of women with intestinal obstruction, neither of whom had a previous history of any surgical pelvic treatment . The laparoscopic approach revealed in both cases an incarceration of the small bowel herniated through a defect in the broad ligament . Without the antecedent of uterine surgery, delivery trauma, and pelvic diseases, congenital abnormalities are considered the causes of these defects although the real mechanism is unknown . This cause should therefore be considered in the differential diagnosis of female patients presenting with an intestinal obstruction who have not had a prior laparotomy . A 38-year - old gravida 1, para 1, woman was admitted to our hospital with a chief complaint of lower abdominal colicky pain and vomiting of 1 day's duration . Her relevant past medical history included a laparoscopic appendectomy performed 7 years previously and a diagnosis, in the same setting, of endometriosis, since then successfully treated with medical therapy . Laboratory findings showed slight leucocytosis, and a plain abdominal radiograph showed some loops of dilated small bowel with air fluid levels . Ultrasonography confirmed the small bowel obstruction and disclosed the presence of fluid in the pelvis . With the diagnosis of intestinal obstruction of unknown origin because abdominal distension was moderate, a laparoscopic approach was performed with 3 trocars, instruments, and optics 5-mm in diameter . A 30-cm long ileal loop was found to have herniated through a defect in the right broad ligament . A 23-cm defect was noted, and it was closed by using a purse - string 2/0 monofilament absorbable suture . The postoperative course was uneventful, with bowel movement and hospital discharge on the first and fourth postoperative days, respectively . A 55-year - old gravida 2, para 2 woman was admitted to our department with symptoms of colicky pain and nausea but no vomiting for the previous 2 days . Most notable, she had no history of prior abdominal or pelvic surgery or pelvic inflammatory disease . On examination, as with the previous case, a plain abdominal radiograph showed some loops of dilated small bowel with no air fluid levels . Ultrasonography confirmed the small bowel obstruction and disclosed the presence of fluid in the pelvis . Due to a diagnosis of intestinal obstruction of unknown origin, the patient was taken into the operating room and a laparoscopic approach was used in the same manner as the case described above . A 20-cm long ileal loop was found to have herniated through a fenestration of the left broad ligament . As above, the small bowel, once reduced, appeared vital, and a defect of 13 cm was seen and closed by using a purse - string monofilament absorbable 2/0 suture . The postoperative course was uneventful, with bowel movement and hospital discharge on the first and third postoperative days, respectively . Surgeons treating a patient with lower abdominal pain of uncertain origin are caught between the extremes of conservative and operative treatment . After clinical examination and ultrasonography, exploratory laparoscopy has been shown by several studies to solve this therapeutic dilemma . A corollary to the application of diagnostic laparoscopy is the potential for therapeutic manipulation during the same setting . Internal hernias represent only 0.4% to 4.1% of all small bowel incarcerations, and of these, the hernias through a defect of the broad ligament represent only 4% to 7% . Regarding their cause, they are thought to be either congenital or acquired . The congenital ones are a consequence of a spontaneous rupture of congenital cystic structures within the broad ligament reminiscent of the mesonephric or mllerian ducts . This hypothesis could account for those patients who are nulliparous or have never undergone pelvic surgery . An acquired defect may result from either operative trauma, pregnancy and birth trauma, or prior pelvic inflammatory disease . They have therefore been frequently reported in multiparous patients, patients who have undergone a surgical pelvic procedure, and patients with a history of salpingitis or endometriosis . One of our patients had only a history of multiple pregnancies and deliveries, and the other patient with endometriosis had an appendectomy . A classification of broad ligament defects has been proposed based on their anatomical position: type 1 defect, which occurs throughout the entire broad ligament; type 2, which occurs throughout the mesosalpinx and the mesovarium; and type 3, which occurs throughout the meso - ligamentum teres . Plain film radiography because of its low sensitivity and specificity helps little in the diagnosis of most causes of abdominal pain due to gynecological disorders . Other radiological investigations, such as either ultrasonography or ct scan, or both used together, are expensive and not possible to perform in all hospital situations, 24 hours a day . Diagnostic laparoscopy, with an accuracy of more than 90% has been demonstrated to be superior to other diagnostic tools and may lead to the correction of an erroneous preoperative diagnosis in up to 40% of patients, or it may be used to exclude other pathologies . A corollary to the application of diagnostic laparoscopy is the potential for therapeutic manipulation during the same setting, which has been reported in the literature to be more than 80% . The goal of surgical treatment includes reduction of the intestinal loop (its resection, if needed), and direct closure of the opening to avoid any recurrence . Only one report exists in literature, to the best of our knowledge, of a pathology totally diagnosed and treated by using laparos - copy . For more than 10 years, we have been using laparoscopy routinely in both scheduled and emergency situations, if no absolute contraindication to the technique is present . In both cases reported herein, the laparoscopic approach was possible to perform due to the mild intestinal gas distension . Intestinal resection was not necessary, and we closed the opening of the broad ligament with a purse - string absorbable suture . Early diagnosis and, if possible, therapeutic laparoscopy is cost - effective in many scenarios dealing with managing nonspecific acute (low) abdominal pain, especially in women of reproductive age . Thus, the following is perfectly applicable to the 2 cases we have report herein: both were rare gynecological pathologies causing small bowel obstruction that were diagnosed and treated in the same setting with good results and perceptions of the patients . We do think that laparoscopy is not an alternative to physical examination and conventional noninvasive diagnostic methods in any acute abdominal situation . However, it must be considered an effective option in patients in whom these methods fail, especially as surgeons become more experienced and skilled.
An age - group stratified (1824, 2534, 3544, 4554, 5564, 6574, and 7584 y) geographically representative random sample of 2,604 swedish inhabitants with an equal number of women and men was selected by swedish national tax agency in 2007 . The respondents were divided into equally large summer and autumn groups to cover the possible seasonal variation in f&v consumption . A questionnaire enclosed with an invitation letter the respondents were also given a web - based questionnaire as an alternative measure; this was done to encourage respondents who find a traditional pen - and - paper questionnaire too time - consuming to complete the survey . As compensation, the respondents could receive a short report of the main results of the study, if they wished . A few weeks after the first circular, a reminder letter was sent to the non - responders . To increase the response rate, a second reminder was sent to all non - respondents in january 2008 . For a detailed picture of the study design, the returned questionnaires were treated confidentially, the respondents gave their informed consents, and the swedish research council's guidelines for good research practice (30) were followed in conducting the present study . Detailed information regarding consumption of different kinds of f&v was collected using a 13-item self - administered 24-h recall and a 12-item food frequency questionnaire (ffq). Respondents were asked to report consumed amounts either in deciliters or number of portions in the self - administered 24-h recall (e.g. Did you eat apples yesterday and, if yes, how many?). The ffq included eight response categories for each item (never, less than once / week, once / week, 24 times / week, 56 times / week, once / day, two times / day, and more than twice a day), indicating the average consumption frequencies for salad / raw and cooked vegetables as well as for fresh fruit and fruit juice (e.g. How often do you usually eat fresh fruit?). Both the ffq and the self - administered 24-h recall were based on a validated questionnaire where no differences were observed between the 24-h recall and one - day weighed food record of f&v (31). In addition, the ffq showed a correlation coefficient of 0.73 for total f&v with a seven - day food record (31). The present questionnaire was also pre - tested on 20 swedish adults, and one focus group interview (n=5) was held in which respondents discussed f&v . Mean daily consumption of different types of fruits, vegetables, as well as total consumption (including berries and juice, excluding potatoes) on a population - level was calculated from the self - administered 24-h recall . Data on different sociodemographic variables (gender, age, household size, country of birth, and level of education) are presented in table 1 . Level of pa was measured by asking how many hours per week the respondents engage in exercise that causes them to perspire or become breathless . Respondent characteristics and fruit and vegetable consumption (portions / day) according to the self - administered 24-h recall note: groups with significantly (p0.01) higher consumption with bolded figures . Tukey hsd post test: 0.5 h vs. 1.12.5 h, p<0.001; 0.5 h vs.> 2.5 h, p<0.001 . The analyses were undertaken separately for women and men as well as for different demographic groups . Means and 99% confidence intervals [99% cis] were calculated for daily f&v consumption (portions / day). Respondents reporting unusually high consumption of> 15 f&v portions / day were excluded from the analyses (five men and five women). Two - sample t - tests and one - way anova were used to determine whether mean f&v consumption from the self - administered 24-h recall differed between subgroups . Where needed based on normality tests and regarding the large sample size, the variable was used in its original form . Mann whitney test was used to analyze consumption data from the ffq . Due to the large number of significance tests conducted, a p - value <0.01 (two - sided) was considered statistically significant throughout the study . Detailed information regarding consumption of different kinds of f&v was collected using a 13-item self - administered 24-h recall and a 12-item food frequency questionnaire (ffq). Respondents were asked to report consumed amounts either in deciliters or number of portions in the self - administered 24-h recall (e.g. Did you eat apples yesterday and, if yes, how many?). The ffq included eight response categories for each item (never, less than once / week, once / week, 24 times / week, 56 times / week, once / day, two times / day, and more than twice a day), indicating the average consumption frequencies for salad / raw and cooked vegetables as well as for fresh fruit and fruit juice (e.g. How often do you usually eat fresh fruit?). Both the ffq and the self - administered 24-h recall were based on a validated questionnaire where no differences were observed between the 24-h recall and one - day weighed food record of f&v (31). In addition, the ffq showed a correlation coefficient of 0.73 for total f&v with a seven - day food record (31). The present questionnaire was also pre - tested on 20 swedish adults, and one focus group interview (n=5) was held in which respondents discussed f&v . Mean daily consumption of different types of fruits, vegetables, as well as total consumption (including berries and juice, excluding potatoes) on a population - level was calculated from the self - administered 24-h recall . Data on different sociodemographic variables (gender, age, household size, country of birth, and level of education) are presented in table 1 . Level of pa was measured by asking how many hours per week the respondents engage in exercise that causes them to perspire or become breathless . Respondent characteristics and fruit and vegetable consumption (portions / day) according to the self - administered 24-h recall note: groups with significantly (p0.01) higher consumption with bolded figures . Tukey hsd post test: 0.5 h vs. 1.12.5 h, p<0.001; 0.5 h vs.> 2.5 h, p<0.001 . The analyses were undertaken separately for women and men as well as for different demographic groups . Means and 99% confidence intervals [99% cis] were calculated for daily f&v consumption (portions / day). Respondents reporting unusually high consumption of> 15 f&v portions / day were excluded from the analyses (five men and five women). Two - sample t - tests and one - way anova were used to determine whether mean f&v consumption from the self - administered 24-h recall differed between subgroups . Where needed based on normality tests and regarding the large sample size, the variable was used in its original form . Whitney test was used to analyze consumption data from the ffq . Due to the large number of significance tests conducted, a p - value <0.01 (two - sided) was considered statistically significant throughout the study . A total of 1,304 questionnaires were returned and properly filled out, giving a response rate of 51% . Approximately one - third of the respondents chose the web - based questionnaire . Roughly one - third (37%) had a university - level education, and 49% had been employed during the past six months . About 12% of the respondents were born outside sweden, compared to roughly 17% in the total swedish population (33). Sociodemographic characteristics of the respondents and total f&v consumption in each subgroup are presented in table 1 . According to the self - administered 24-h recall, total f&v consumption was 2.2 (99% ci 2.02.4) portions per day in the lowest quartile among women (n=187) and 1.9 (1.72.1) daily portions among men (n=201). The highest quartile of women (n=159) consumed 9.9 (9.310.4) portions on the examined day compared to 9.4 (8.410.5) portions among men (n=143). Mean number of total f&v portions varied from 4.9 to 5.8 among women and 4.2 to 5.0 among men in different age groups, but consumption did not differ statistically across age groups . Men born in sweden had lower total f&v consumption than did men born in another country (p=0.006). Women with 0.5 h self - reported pa / week had lower f&v consumption than those reporting 1 h pa / week (p<0.001). Also among men, those reporting 0.5 h pa / week had lower f&v consumption than those reporting 2.5 h pa / week . Consumption of different types of f&v, based on the self - administered 24-h recall, by gender and age group is presented in table 2 . Fresh fruits, as well as raw vegetables and salad, were consumed in the greatest amounts, and more by women than by men (p<0.001). Comparisons between women and men within each age group showed that 55- to 74-year - old women consumed more fruits in total (p0.001), and more fresh fruits (p0.002), than men . Women between 55 and 64 years also had higher total vegetable consumption than men in the same age group (p=0.002). Overall consumption of berries and cooked vegetables was relatively low, and no gender differences were shown . Mean consumption of different fruit and vegetable types (n of self - reported portions / day, [99% confidence interval]) by gender and age group (24-h recall) note: p - values for gender differences within age group . The ffq also showed that fresh f&v were consumed most often (table 3). More women than men in all age groups consumed fresh fruit every day (63.5% vs. 38.9% for all age groups combined, respectively; p<0.001)). Almost one half of women (48.3%) consumed salad or raw vegetables every day compared to 28.8% among men (p<0.001). Men reported a higher consumption frequency only for canned fruit (p=0.002), although the overall consumption frequency was very low . Percentages of daily users of different fruit and vegetable types and gender differences in f&v consumption frequencies within age groups (food frequency questionnaire) note: bolded figures are statistically significant differences . Once / day + two times / day + more than twice a day . Mann whitney test for gender differences in consumption frequencies (eight categories as presented in methods). Comparisons between women and men using the web - based or pen - and - paper questionnaire showed no differences in total f&v consumption . Age differences between these two groups could not be seen, whereas women choosing the web - based questionnaire had higher level of education . According to the self - administered 24-h recall, total f&v consumption was 2.2 (99% ci 2.02.4) portions per day in the lowest quartile among women (n=187) and 1.9 (1.72.1) daily portions among men (n=201). The highest quartile of women (n=159) consumed 9.9 (9.310.4) portions on the examined day compared to 9.4 (8.410.5) portions among men (n=143). Mean number of total f&v portions varied from 4.9 to 5.8 among women and 4.2 to 5.0 among men in different age groups, but consumption did not differ statistically across age groups . Men born in sweden had lower total f&v consumption than did men born in another country (p=0.006). Women with 0.5 h self - reported pa / week had lower f&v consumption than those reporting 1 h pa / week (p<0.001). Also among men, those reporting 0.5 h pa / week had lower f&v consumption than those reporting 2.5 h pa / week . Consumption of different types of f&v, based on the self - administered 24-h recall, by gender and age group is presented in table 2 . Fresh fruits, as well as raw vegetables and salad, were consumed in the greatest amounts, and more by women than by men (p<0.001). Comparisons between women and men within each age group showed that 55- to 74-year - old women consumed more fruits in total (p0.001), and more fresh fruits (p0.002), than men . Women between 55 and 64 years also had higher total vegetable consumption than men in the same age group (p=0.002). Overall consumption of berries and cooked vegetables was relatively low, and no gender differences were shown . Mean consumption of different fruit and vegetable types (n of self - reported portions / day, [99% confidence interval]) by gender and age group (24-h recall) note: p - values for gender differences within age group . The ffq also showed that fresh f&v were consumed most often (table 3). More women than men in all age groups consumed fresh fruit every day (63.5% vs. 38.9% for all age groups combined, respectively; p<0.001)). Almost one half of women (48.3%) consumed salad or raw vegetables every day compared to 28.8% among men (p<0.001). Men reported a higher consumption frequency only for canned fruit (p=0.002), although the overall consumption frequency was very low . Percentages of daily users of different fruit and vegetable types and gender differences in f&v consumption frequencies within age groups (food frequency questionnaire) note: bolded figures are statistically significant differences . Once / day + two times / day + more than twice a day . Mann whitney test for gender differences in consumption frequencies (eight categories as presented in methods). Comparisons between women and men using the web - based or pen - and - paper questionnaire showed no differences in total f&v consumption . Age differences between these two groups could not be seen, whereas women choosing the web - based questionnaire had higher level of education . On average, respondents in the present study reported slightly higher f&v consumption than expected based on earlier findings in sweden (13, 14). Some other recent studies (25) have also reported changes in dietary habits during the past decade . However, the methodology used in the present study differed from the latest national food intake survey (13), and the results are not directly comparable with each others . In line with our findings, previous studies have also shown that men tend to have lower f&v consumption than women (1518). A study from finland showed that gender differences in vegetable consumption have actually increased (34). Both the self - administered 24-h recall and ffq showed higher f&v consumption in women when all age groups were combined, while the data from the ffq showed larger differences between women and men within different age groups . Earlier studies have shown that men slightly underestimate their f&v consumption, whereas the opposite applies to women (33). Thus, the gender differences revealed here may turn out to be slightly less significant, but the similar findings from two measures indicate that these differences actually exist . The self - administered 24-h recall showed higher consumption of fresh fruit particularly for middle - aged and older women, which is in line with results from a recent finnish study (18). On the other hand, the ffq showed that women in many age groups were more frequent consumers of not only fruit, but also salad and other raw vegetables . F&v it seems that swedes are not used to including f&v in mixed dishes, but rather eat them separately as they are . On the other hand, the authors are aware of the limitations of the study questionnaire, where only one open - ended item on mixed dishes was included . This may have led to some underreporting, indicating that actual consumption may be higher than reported . The present study further showed some interesting differences between women and men in factors associated with f&v consumption . Men born outside sweden had higher f&v consumption than men born in sweden did, which may reflect the different habits associated with other food cultures . For instance, non - western immigrants in denmark have been reported to have higher odds for daily consumption of cooked and raw vegetables (35), and iranians living in sweden also show higher consumption of f&v (36). However, because the specific country of birth is not reported in the present study, no conclusions regarding specific food cultures can be drawn . Pa was the only variable of those investigated that was associated with total f&v consumption in both genders . Therefore, we may speculate that f&v consumption is an integrated part of a lifestyle in which pa also plays an important role . However, the limitations of only using a single question to measure level of pa are recognized (25), and more detailed assessments are encouraged to gain better understanding on the associations between pa and consumption of f&v . From a methodological point of view, the ffq may enable better prediction of average consumption over a longer time period, whereas the self - administered 24-h recall was used to more accurately assess consumption over a specified period . Also, there is a certain risk of over - reporting actual consumption in the ffq, but this was not regarded as a problem when ranking individuals and subgroups according to their consumption (37). In addition, although consumption has not been reported in grams, consumption frequency as such is a good measure of consumption, because portion sizes have not been reported to differ between high and low consumers (12). We are aware of the possibility of a type i error for false significant findings (38) due to the many significance tests conducted . However, because the main findings are significant at a level well below 1%, and both dietary assessment measures showed similar findings, this is not regarded as a problem . In the present study, all days of the week were equally represented in the data (data not shown), which eliminates the possible bias caused by consumption differences across the weekdays . Seasonal consumption variation can also be excluded as a confounding factor, because the data consist of roughly equally large groups of participants in different seasonal groups . The aim was to show an average consumption of the population over one year and not to compare seasonal variation as such . The present results have to be interpreted with caution owing to the relatively large proportion of non - respondents (49%), although the drop - out rate was nearly as high in the latest nationwide dietary survey used as a reference here (13). Men in general, and the youngest age group (1824 years), but also the oldest women (7584 years) were somewhat underrepresented in the present survey . However, the relatively high total number of respondents should be representative of actual f&v consumption levels in sweden, although in most cases, respondent selection in postal surveys probably leads to overrepresentation of people who are more interested in the topic, or who already have healthier dietary habits . The cross - sectional design limits conclusions about the temporal or causal nature of the findings, but the study design can provide answers that address the study aims . From a data collection perspective, the present study gives valuable experience in using a web - based questionnaire as an alternative response measure . Giving respondents the opportunity to choose between a traditional pen - and - paper and a web - based questionnaire was intended to increase the response rate and attract particularly younger respondents, but age differences could not be identified in the present study (data not shown). In accordance with danish experiences (39), the majority of respondents preferred the paper version to the web - based questionnaire . However, using the internet may still be worthwhile, as it saves both environmental and labor resources . The present study showed average f&v consumption close to the recommended level of five portions per day . Fresh f&v showed the highest consumption, whereas berries and processed f&v products were less popular . University education was positively associated with higher f&v consumption for women, and men born outside sweden showed higher consumption than did men born in sweden . Respondents who reported more hours per week engaged in doing pa had higher f&v consumption in both genders . Although total consumption seems to have increased, the role of other underlying factors besides the sociodemographic factors and pa studied here remains unclear . In addition, other perspectives on f&v consumption, such as possible seasonal variation in availability of different f&v types, should be taken into consideration when implementing new dietary interventions or guidelines . The authors have not received any funding or benefits from industry to conduct this study.
Hypertension (htn) is a medical condition that is characterized by high or uncontrolled blood pressure . Inadequate control of htn can lead to more serious vascular conditions affecting the major blood vessels in the heart, brain, and body . Additionally, htn and diabetes mellitus (dm) frequently coexist, which further increases the risk of developing vascular complications . Hypertension is a major risk factor for vascular disease including heart attacks and strokes . In 2008, of those 17.3 million vascular - associated deaths, 6.2 million were due to strokes . It is predicted that, by the year 2030, an estimated 23.3 million will die from stroke and heart disease . Addressing risk factors that contribute to htn may help prevent vascular complications . According to the world health organization (who), complications of htn such as strokes account for 9.4 million of the astounding 17 million vascular - associated deaths . Another consideration is the financial burden of htn; according to the centers for disease control and prevention (cdc), the annual cost of htn treatment was 131 billion dollars . The physical and financial burdens of htn are not unique to any one group of individuals . However, it has been well documented that african americans (aas) have a disproportionate burden of morbidity and mortality compared to caucasians . Data collected from 2008 suggest that non - hispanic blacks accounted for 31.7% of the 59.4 million people with htn, whereas non - hispanic whites accounted for only 26.8% . Despite research and interventions to decrease both the physical and financial burdens of uncontrolled htn, specifically in the aa population, provider - centered barriers are the focus of this study and include limited patient - provider communication regarding lifestyle changes, lack of adherence to established guidelines for htn management, and resistance to change . In addition, systems barriers were assessed and include access to care, medication costs, and lack of healthcare coverage . Racial disparities related to geographical areas in healthcare lead to disproportionate mortality and morbidity in rural areas . Healthcare disparities such as ethnicity, poverty, and access to care are all associated with rurality and contribute to the higher incidence of htn in aas . For example, barriers to healthcare in rural communities include transportation, lack of health insurance, and lack of healthcare facilities and providers, all of which contribute to limited access to healthcare . As a result, rural communities have a higher incidence of chronic diseases such as htn and have poorer outcomes . As previously mentioned, a major problem for rural communities is access to healthcare . Improving access to healthcare for rural america the national rural health association has developed a timeline for the affordable care act, which is designed to address the issues pertaining to access to healthcare . Provisions on the timeline include workforce improvement, payment reimbursement, and requirement of the electronic health record requirements, to name a few . Student loan repayment programs for those working in rural or underserved areas and improving medicare and medicaid reimbursement in rural practices are some specific provisions that have been implemented to improve access to healthcare in rural communities . The theoretical framework of avedis donabedian was used as a tool to guide this research . The three components that form the foundation of this theory are (1) structure of care, (2) process of care, and (3) outcomes . The concept is grounded on the principle of healthcare outcomes as a result of the medical care provided by medical professionals . Describes structure of care as any process that relates to the organizational and physical aspects of care settings . A few specific examples of this process are facilities, equipment, and operational and financial processes supporting medical care . Process of care is dependent upon the structures of care to supply resources and methods that are necessary for participants to carry out patient care activities . Patient - provider communication, practice habits, and care management are all examples of process of care . Further, the goal of process of care is to improve patient health by promoting recovery, patient survival, and even patient satisfaction . The final concept of this model, outcomes, is simply the patient outcomes based on medical health after the application of the two previous components . Figure 1 depicts the components of donabedian's theory and how it is applicable to this study . A retrospective review of the emr was conducted to identify hypertensive aa patients in a rural clinic who were seen from july 1, 2014, to august 31, 2014 . A descriptive, preexperimental, quantitative method was used to evaluate the degree of provider adherence to national htn guidelines in aas living in a rural community . Inclusion criteria for the patients included (figure 2) (a) age 20 to 80 years, (b) aas with a diagnosis of htn, and (c) receiving antihypertensive medications . Exclusion criteria included (a) specific end organ damage (i.e., ckd, stroke, cardiomyopathy, or myocardial infarctions), (b) age younger than 20 or greater than 80 years, (c) no office visits during research dates or office visits for reasons other than htn, (d) no established relationship with a single primary care provider (pcp), (e) diagnosis of medical nonadherence, (f) race other than aa, and (g) deceased patients . There are four primary care providers, one cardiologist, two pulmonologists, one neurologist, and one podiatrist . The primary source data were selected from the emr centricity developed by general electric healthcare . An emr is a digital or electronic version of a paper chart that contains the patient's medical history . A report was populated using the following criteria: (1) the practice site location, (2) race specified as black or african american, (3) birthdate on or after 01/01/1949 but before 01/01/1995, (4) appointment date on or after 07/01/2014 but before 09/01/2014, and (5) active international classification of diseases, ninth revision (icd-9) codes containing 401 for hypertension . The emr was reviewed to identify onset of htn if feasible, provider selection of antihypertensive drugs for initial treatment, and additional drug choices . Htn was defined as a blood pressure 140/90 mmhg in the general population and> 130/80 mmhg in hypertensive individuals with a comorbidity of dm in accordance with jnc 7 or patients taking antihypertensive medications . Potential participants were consecutively recruited and a sample size of 62 participants met the inclusion criteria . Other variables that were considered include the following antihypertensive drug classes: (a) thiazide diuretics, (b) angiotensin - converting - enzyme inhibitors (aceis), (c) angiotensin ii receptor blockers (arbs), and (d) calcium channel blockers (ccbs). Jnc 7 (as cited in chobanian et al .) Describes htn as a systolic blood pressure 140 mmhg or a diastolic blood pressure of 90 mmhg in the general population, including aas . If the patient has a comorbidity such as dm, a systolic blood pressure> 130 mmhg and a diastolic blood pressure of> 80 mmhg are considered suboptimal in the treatment of htn . The coexistence of htn and dm further increases the risk of vascular complications such as strokes and renal disease, which is why the optimal blood pressure goal is lower . Diagnostic measurements for the classification of htn were performed based on jnc 7 guidelines (table 1). According to jnc 7, two consecutive readings in contralateral arms at least 5 minutes apart while sitting are categorized as htn . By auscultation, blood pressures were manually obtained by nurses using the appropriate size cuff with a sphygmomanometer . Patients were in a seated position with feet on the floor and arm positioned at the level of the heart . A normal blood pressure is a systolic blood pressure of <140 mmhg and a diastolic blood pressure of <90 mmhg . Stage 1 is a systolic blood pressure reading of 140 to 159 mmhg or a diastolic bp reading of 90 to 99 mmhg . Stage 2 is classified as a systolic blood pressure 160 mmhg and a diastolic reading of 100 mmhg . In the general aa population, initial monotherapy with diuretics, specifically thiazide diuretics (tds), or ccbs should be used for stage 1 htn or a diuretic in combination with other drug classes for combination drug therapy regimen for stage 2 htn . Jnc 7 recommends specialty referrals if blood pressure is not controlled after maximizing three medication classes, with one being a td . Lastly, for those with compelling indications, such as those with a comorbidity of dm, aceis are recommended to reduce strokes and other vascular complications . With regard to follow - up, jnc 7 recommends a monthly follow - up office visit if blood pressure is not at goal and a follow - up office visit every 3 to 6 months if bp is at goal . Laboratory values for potassium and creatinine should be obtained 1 to 2 times annually and patients with a comorbidity of dm should have their urine microalbumin levels measured at least annually . Patients newly diagnosed with htn should have a urinalysis, blood glucose, hematocrit, potassium, creatinine, calcium, and lipid profile drawn prior to beginning pharmacological treatment . Better outcomes have been found when lifestyle modification is incorporated into the plan of care . The following are the areas recommended for lifestyle modification: (a) weight loss, (b) following the dietary approaches to stop hypertension (dash) diet, which consists of a diet rich in fruit and vegetables, low fat dairy products, and reduced intake of saturated and total fat, (c) adhering to sodium restrictions, (d) regular physical activity, and (e) limiting alcohol consumption . Statistical analyses were performed on the outcomes of blood pressure control in participants who were prescribed antihypertensive medications based on jnc 7 guidelines compared to those who were not and also on blood pressures that were at goal and those that were not . Additionally, outcomes of provider adherence to the guidelines were measured based on adherence to medication choice recommendations, documented lifestyle modification recommendations, laboratory studies, and follow - up for patients with htn and htn with a comorbidity of dm . Descriptive analysis was conducted using crosstabs, frequencies, and means comparison and reported as percentages to describe the results . Crosstabs were used to determine the number of times the recommended combination of a thiazide diuretic was used in combination with an acei or arb . Frequencies were conducted to identify the percentage of patients not prescribed a td or ccb as monotherapy . Further, the use of means comparison was to compare differences in bp outcomes in patients prescribed aceis compared to tds as monotherapy . Additionally, a chi square analysis was performed to determine if there is a relationship between provider adherence and blood pressure outcomes . Physicians accounted for 64.5% (n = 40) of the providers in this study . Of the 29 patients with blood pressure at goal, a physician was the provider in 75.9% (n = 22) of the office visits while nps provided care in 24.1% (n = 7) of the visits . Patient age was divided into 2 categories: less than 65 years and 65 years and older . The most frequent stage of uncontrolled htn was stage 1 accounting for 84.4% of the 32 patients . Of those 16, 81% had stage 1 htn and the remaining 19% had stage 2 htn . In patients aged less than 65 years, 45.2% of the 31 patients had stage 1 htn and 12.9% had stage 2 htn . In the age group of 65 and over, stage 1 accounted for 41.9% of patients and stage 2 htn accounted for 3.2% . Blue cross blue shield (bcbs) accounted for the second most utilized health insurance with 24.2% of the patients enrolled . Medicaid, self - pay, and private insurances each accounted for 6.5% of the patients . Of the 62 patients studied, 12.9% (n = 8) were on monotherapy and 87.1% (n = 54) were on combination therapy . Combination therapy is described as taking two or more medications . Those with a comorbidity of dm accounted for 53.2% (n = 33) of the 62 patients . Jnc 7 guidelines suggest that patients with a comorbidity of dm should take aceis to decrease morbidity and mortality . Of the 33 diabetic patients, only 69.7% (n = 23) were taking aceis as recommended . Of the 54 patients taking combination therapy, 87% (n = 47) were taking either a td or ccb . In the patients studied, 53.2% (n = 33) of the 62 warranted medication adjustments as a result of uncontrolled blood pressure . Only 15.2% (n = 5) had medication adjustments, leaving 84.8% (n = 28) inadequately treated . One patient (1.6%) required a referral to a htn specialist as a result of maximizing three different medication classes, including a td . That patient was not referred . In the eight patients on monotherapy, 37.5% (n = 3) of them met their blood pressure goal despite not being on a td or ccb . Of the 54 patients on combination therapy, 87% (n = 47) were on a td or ccb as recommended by jnc 7 . Of those 47 patients, 55.3% (n = 26) achieved goal blood pressures . A chi square test was used to determine if there is a relationship between being prescribed jnc 7 medication regimen and blood pressure outcomes . There was no significant relation between taking the recommended td or ccb and blood pressure control (= 0.0; p = 0.99). The categories examined under lifestyle modifications included dash diet, weight loss, sodium restrictions, physical activity (pa), and alcohol consumption (see figure 3). Only 6.5% (n = 4) of the 62 patients had documentation of provider recommendations for the dash diet and alcohol consumption . Weight loss, sodium restriction, and pa recommendations were documented in 82.3% (n = 51) of the patients . Jnc 7 recommends follow - up every 3 to 6 months if bp is controlled . Providers were adherent to follow - up recommendations 96.6% (n = 28) of the time in the 29 patients with controlled blood pressure . In the remaining 33 patients who required monthly follow - up due to uncontrolled blood pressure, providers were only 9.1% (n providers were adherent to obtaining laboratory tests prior to initiating treatment in 0% of the two patients with new diagnoses of htn . The adherence rate for biannual laboratory tests in patients with historical diagnosis of htn was 65% (n = 39) of the 60 qualifying patients . In patients with a comorbidity of dm, providers were 15.2% (n = 5) adherent to the guidelines in the 33 diabetic patients . Endless and organized activities that result in measurable improvement in healthcare services and targeted patient outcomes have been described as qi . The us department of health and human services identified the 4 principles of quality improvement (qi) as (1) qi work as systems and processes, (2) focus on patients, (3) focus on being part of the team, and (4) focus on use of data . Qi work as systems and processes refers to resources and activities that are carried out and are evaluated simultaneously to improve quality of care or outcomes . This study focused on the systems or structural components of systems barriers such as the rural setting the study was conducted in, emr structure, emr utilization, providers, and policy . Activities assessed included provider barriers, access to jnc 7 guidelines, provider adherence to those guidelines, recommendation of lifestyle changes, laboratory assessment, and follow - up . Outcome goals include decreasing the prevalence of uncontrolled htn in aas, decreasing cost associated with htn, increasing quality of life, and equity . This study was conducted to assess what is currently being done in this rural primary care setting to address the increased prevalence and mortality of htn in aas . Using the methodical framework of donabedian, both quantitative (frequencies) and qualitative (descriptive) data were collected and analyzed to assess the current system and to identify areas for improvement . The national heart lung and blood institute (nhlbi) traditionally has endorsed previous versions . Controversy surrounding the eighth report of the joint national committee (jnc 8) has led to nhlbi not endorsing jnc 8 . The controversy surrounds the increased bp goal of <150/90 in patients aged> 60 and a goal of <140/90 for those aged 18 to 60, including those having comorbidities of dm and ckd . Jnc 8 guidelines were avoided for this study due to this controversy and its relatively new release . First, the first - line drug choice as monotherapy in the treatment of htn in aas should be tds or ccbs, as recommended by jnc 7 . While there were only eight patients receiving monotherapy, none of them were on tds or ccbs, which indicates 100% nonadherence to the guidelines regarding monotherapy . In fact, the majority of the patients on monotherapy were on aceis, while the remaining were on arbs . However, studies have found that aceis and arbs are less effective in the aa population . These findings are consistent with the studies reviewed in the literature review for this study . Whites had a greater systolic (mean difference of 4.64) and diastolic (mean difference of 2.82) reduction in bp compared to aas . In contrast, providers were more consistent with the guideline recommendations in aas on combination drug therapy . Provider adherence was documented in 87% of the patients receiving combination therapy . One of the goals of a previous study was to determine provider adherence to national guidelines including a td in combination therapy in aas of nigerian decent . The majority (88.8%) of the study sample in addition, combination therapy was more effective than monotherapy in reducing both systolic and diastolic bp (32.64 mmhg compared to 15.43 mmhg and 18.56 mmhg compared to 6.96 mmhg, resp . ). Less than half of the 62 patients in this study have at goal bp readings at the level recommended by jnc 7 despite moderate provider adherence . Similar findings were found in a previous study . Provider adherence to the guidelines overall was 76% . Mean bp values decreased but insignificantly concluding no correlation with provider adherence and attaining bp goals . In this study, additionally, provider adherence in prescribing aceis in patients with a comorbidity of dm was seen in 70% of the population . Provider adherence to prescribing an acei or arb in patients with comorbidities such as dm was seen in 88% of the population . Studies have shown that the use of aceis in this population decreases mortality and morbidity by decreasing end organ damage and cardiovascular incidents . Lifestyle modification, as an adjunct to pharmacologic therapy, has been associated with better bp control . Detailed recommendations for the dash diet and alcohol were only documented in 4 of the 62 emrs . Adherence was high in the recommendations for physical activity, weight loss, and sodium restrictions . The smart plan is inclusive of these 3 recommendations, which was documented in 51 of the 62 patients . Patient adherence with adequate office visit follow - up has been known to yield better bp control . Jnc 7 recommends an office visit follow - up every 3 to 6 months in patients with bp at goal and monthly visits for those who are not at goal . Provider adherence was evident in the 3-to-6-month follow - up population (97%). A monthly follow - up recommendation for those with uncontrolled bp uncontrolled bp can lead to end organ damage such as renal insufficiency or failure, heart attacks, or strokes . Further, the medications used to treat htn can have adverse effects on other organs . Jnc 7 recommendations include a urinalysis, blood glucose, hematocrit, potassium, creatinine, calcium, and lipids in patients newly diagnosed with htn before initiating therapy . Due to the limitations of the emr, only 2 patients were identified as newly diagnosed . Of these patients, neither of them had laboratory testing performed prior to starting treatment . For example, the finding of no documentation of patients receiving labs prior to the initiation of drug therapy may provide a greater impact and consistency in a larger sample size . Secondly, the study was conducted during only the summer months and over a short duration . Extending the study period and expanding the study to include fall or winter months may provide input for comparison to determine if seasons impact bp control . Despite evidence - based recommendations by jnc 7, provider adherence in aas has room for improvement . Provider pharmacologic choices and lifestyle modification recommendations are major components to blood pressure control in this population . Ccbs are preferred over aceis because of the increased risk of stroke, myocardial infarctions, and other vascular conditions associated with aceis . Better adherence in prescribing a td or ccb is seen in prescribing patterns for patients on combination therapy . Providers are not adherent to the monthly follow - up recommendations required for medication adjustment or specialist referrals when bp is not at goal . Lack of lifestyle modification documentation, specifically the dash diet and alcohol consumption, is consistent with nonadherence to the jnc 7 guidelines . Although there appears to be no relationship between receiving the recommended medications and bp outcomes, more than half of the population did not meet bp goals . Specific components impacting provider barriers include access to jnc 7 guidelines, provider adherence to jnc 7 guidelines, recommendation of lifestyle changes, and follow - up . Lack of documentation, provider - prescribing habits, and lack of knowledge of up - to - date, evidence - based guidelines may be contributing factors . While there is a gap between evidence - based national guidelines and clinical practice to controlling htn, all contributing factors, including physician, patient, and systems barriers,
In recent years there has been a shift toward minimally invasive surgical techniques . Included in this shift has been the widespread adoption of laparoscopy as an alternative to the open operative approach in colon and rectal surgery . With the advancement of laparoscopic techniques compared with open surgery, laparoscopy has been shown to reduce intraoperative blood loss, length of incision, and length of hospital stay . As was seen with the movement from purely open surgery to laparoscopy, we are now witnessing a rising popularity and acceptance of robot - assisted procedures in a variety of surgical fields . The approval and increasing use of robotic equipment among surgeons stem somewhat from the technologic advancements that robotic surgery provides over traditional laparoscopic surgery . Robotic surgery has been observed to be advantageous in its 3-dimensionally represented operating field, eliminating difficulties associated with depth perception as are seen with standard laparoscopy's 2-dimensional image . In addition, a surgeon - operated camera allows for full control of the visual operating field, whereas the endowrist function (intuitive surgical, sunnyvale, california) provides increased articulation and rotation in a confined space . Much of the controversy surrounding the robot pertains to the high cost and longer operative time associated with robotic procedures . The learning curve associated with new technology, as well as the increased time involved in docking (and redocking in some cases), contributes to the overall operative time and, consequently, the cost of the procedure compared with traditional laparoscopy . In a study by park et al, a robotic right colectomy cost the patient> $3600 more out of pocket than a laparoscopic right colectomy . Although some of the technical limitations of standard laparoscopy may obviously be addressed with the robotic apparatus, whether these advantages are enough to offset the higher cost of the robot are still debatable . Furthermore, few studies have conclusively shown whether robot - assisted procedures yield different outcomes . Specifically, studies conducted primarily in asia and europe have been published, but there still remains a paucity of studies in the united states comparing outcomes such as length of hospital stay, estimated blood loss, duration of the procedure, and complications between a robotic approach and laparoscopy for colon and rectal operations . The lack of comparative studies between robotic and laparoscopic approaches regarding specific outcomes, combined with the cost of new technology like the da vinci robot (intuitive surgical), is a prohibitive factor for widespread adoption of the robot in many hospital centers . This study aims to compare and contrast our experience with robot - assisted and laparoscopic approaches to colon and rectal procedures to elucidate any differences in outcomes . We performed a retrospective review of 40 patients who underwent either standard laparoscopic or robotic colorectal surgery with the da vinci si robot (intuitive surgical) at tulane medical center, new orleans, louisiana, between january 2008 and february 2013 . Patients were randomly assigned to undergo either a standard laparoscopic or robotic procedure based on the availability of the robot apparatus . Indications for surgery were documented but did not factor into the inclusion or exclusion criteria for the study . The primary data points included operation time, estimated blood loss, length of stay, complications, and whether the procedure was converted to open . There was no standard protocol in place for advancement of the patients' diet postoperatively . When malignancy was the indication for surgery, additional data points including histologic diagnosis, clinical stage, and number of nodes collected were noted . Cases were performed by 1 of 2 authors (or both). The student t test and test (as well as the fisher exact test where appropriate) were used to examine the association between each of the independent factors and outcomes for continuous and categorical variables, respectively . Given the small sample size and varied procedure types, 2 subanalyses were performed for the aforementioned intraoperative and postoperative outcomes, one excluding procedures with concomitant liver resection and one solely for right hemicolectomy . All statistical analyses were performed by use of spss software (version 19; ibm, armonk, new york). All procedures were performed by a single surgeon who had prior experience with the da vinci si robot in liver, spleen, pancreas, stomach, thyroid, and gallbladder procedures . In this series the surgical steps did not differ between the robotic and laparoscopic approaches, as has been described in previously published studies . The differences in port placement between the laparoscopic and robot - assisted procedures are to accommodate the robotic arms, in addition to an extra port(s) for the surgeon's assistant . Port placement was standard for the type of procedure and for the approach (laparoscopic vs robot assisted), as has been described previously . We performed a retrospective review of 40 patients who underwent either standard laparoscopic or robotic colorectal surgery with the da vinci si robot (intuitive surgical) at tulane medical center, new orleans, louisiana, between january 2008 and february 2013 . Patients were randomly assigned to undergo either a standard laparoscopic or robotic procedure based on the availability of the robot apparatus . Indications for surgery were documented but did not factor into the inclusion or exclusion criteria for the study . The primary data points included operation time, estimated blood loss, length of stay, complications, and whether the procedure was converted to open . There was no standard protocol in place for advancement of the patients' diet postoperatively . When malignancy was the indication for surgery, additional data points including histologic diagnosis, clinical stage, and number of nodes collected were noted . Cases were performed by 1 of 2 authors (or both). The student t test and test (as well as the fisher exact test where appropriate) were used to examine the association between each of the independent factors and outcomes for continuous and categorical variables, respectively . Given the small sample size and varied procedure types, 2 subanalyses were performed for the aforementioned intraoperative and postoperative outcomes, one excluding procedures with concomitant liver resection and one solely for right hemicolectomy . All statistical analyses were performed by use of spss software (version 19; ibm, armonk, new york). All procedures were performed by a single surgeon who had prior experience with the da vinci si robot in liver, spleen, pancreas, stomach, thyroid, and gallbladder procedures . In this series the surgical steps did not differ between the robotic and laparoscopic approaches, as has been described in previously published studies . The differences in port placement between the laparoscopic and robot - assisted procedures are to accommodate the robotic arms, in addition to an extra port(s) for the surgeon's assistant . Port placement was standard for the type of procedure and for the approach (laparoscopic vs robot assisted), as has been described previously . Sixty - five percent of the patients were male patients with a mean body mass index (bmi) of 28.0 5.8, and 37.5% had a history of abdominal surgery . Of the study population, 37.5% had a complication related to the operation . In terms of operative technique there were no significant differences between the groups in terms of age, bmi, or history of abdominal surgery . The mean age of patients undergoing laparoscopic surgery versus robotic surgery was 61.1 10.7 years versus 61.1 8.5 years (p = .997), the mean bmi was 28.9 6.3 versus 26.2 4.2 (p = .158), and the percentage with a history of abdominal surgery was 44.0% versus 26.7% (p = .273). There was a significant difference in terms of sex, with more patients being male and undergoing robotic surgery (86.7% vs 52.0%, p = .026). There was no significant difference in surgical indication between the 2 groups (p = .303). Eighteen patients underwent right hemicolectomy, 1 underwent a sigmoidectomy, 3 underwent abdominoperineal resection (apr), and 3 underwent low anterior resection (lar) performed laparoscopically . In addition, 4 patients in the laparoscopy group underwent concomitant liver resection for metastases . In the robotic group, 7 patients underwent a right hemicolectomy, 2 underwent a left hemicolectomy, 1 underwent apr, and 5 underwent lar . Patient characteristics of laparoscopic and robotic groups data are presented as mean (standard deviation) unless otherwise indicated . Operative time was similar between the laparoscopic and robotic groups (190.8 84.3 minutes vs 258.4 170.8 minutes, p = .183), with similar estimated blood loss (163.3 249.2 ml vs 96.8 157.7 ml, p = .385). In the laparoscopic group, 16.0% of cases were converted to open compared with 20.0% in the robotic group (p>.99). The mean time until postoperative passage of stool was 4.6 1.9 days in the laparoscopic group versus 4.2 0.83 days in the robotic group (p = .427); the mean time until the initiation of a regular diet (4.5 1.5 days vs 5.8 3.2 days, p = .159) was not significantly different between the 2 groups . Furthermore, the mean length of stay after laparoscopic surgery was 9.6 7.3 days and was not different from the mean length of stay after robotic surgery (6.5 3.8 days, p = .091). The rate of complications was similar for patients undergoing the laparoscopic approach versus those undergoing the robotic approach (36.0% vs 20.0%, p = .457) (table 2). Of note, 1 patient undergoing the robotic procedure had an intraoperative splenic injury, which was repaired with splenorrhaphy . In addition, 1 patient a 67-year - old woman undergoing a robot - assisted apr intraoperative and postoperative outcomes data are presented as mean (standard deviation) unless otherwise indicated . The oncologic characteristics of the colorectal operations performed for cancer resection were also noted (table 3). There was no significant difference in tumor stage (p = .4882) or histologic grade (p>.99) between the 2 groups . In addition, there was no significant difference in the number of lymph nodes harvested between the laparoscopic group (14.0 6.5) and the robotic group (12.3 4.2, p = .683). Pathologic characteristics for colorectal cancer operations the subanalysis for outcomes of procedures excluding concomitant liver resections is shown in table 4 . No liver resections were performed robotically; thus the data in the subanalysis only varied in the laparoscopic arm . The duration of laparoscopic procedures averaged 175.2 67.6 minutes versus 258.4 170.8 minutes for robotic procedures (p = .183). Furthermore, blood loss in the laparoscopic group (69.7 74.2 ml) was not different from that in the robotic group (96.8 157.7 ml, p = .544). For all other parameters rate of conversion to laparotomy, time to passage of stool, time until resumption of a regular diet, length of stay, and complications there remained no statistically significant differences or any large changes to the raw data . Intraoperative and postoperative outcomes for operations excluding concomitant liver resection data are presented as mean (standard deviation) unless otherwise indicated . The mean operative time was 146.9 50.0 minutes in the laparoscopic group compared with 145.4 39.9 minutes in the robotic group (p = .945). Mean blood loss was likewise not statistically different between the laparoscopic group (78.1 79.6 ml) and robotic group (43.6 29.8 ml, p = .288). The times to passage of stool were similar between the laparoscopic group (4.1 1.7 days) and the robotic group (4.0 0.6 days), and the finding was not significant (p = .902). The remaining outcomes examined, including conversion to laparotomy, length of stay, and complications, continued to be similar to the aggregate analysis and were not statistically significant . Intraoperative and postoperative outcomes for right hemicolectomy data are presented as mean (standard deviation) unless otherwise indicated . The subanalysis for outcomes of procedures excluding concomitant liver resections is shown in table 4 . No liver resections were performed robotically; thus the data in the subanalysis only varied in the laparoscopic arm . The duration of laparoscopic procedures averaged 175.2 67.6 minutes versus 258.4 170.8 minutes for robotic procedures (p = .183). Furthermore, blood loss in the laparoscopic group (69.7 74.2 ml) was not different from that in the robotic group (96.8 157.7 ml, p = .544). For all other parameters rate of conversion to laparotomy, time to passage of stool, time until resumption of a regular diet, length of stay, and complications there remained no statistically significant differences or any large changes to the raw data . Intraoperative and postoperative outcomes for operations excluding concomitant liver resection data are presented as mean (standard deviation) unless otherwise indicated . The mean operative time was 146.9 50.0 minutes in the laparoscopic group compared with 145.4 39.9 minutes in the robotic group (p = .945). Mean blood loss was likewise not statistically different between the laparoscopic group (78.1 79.6 ml) and robotic group (43.6 29.8 ml, p = .288). The times to passage of stool were similar between the laparoscopic group (4.1 1.7 days) and the robotic group (4.0 0.6 days), and the finding was not significant (p = .902). The remaining outcomes examined, including conversion to laparotomy, length of stay, and complications, continued to be similar to the aggregate analysis and were not statistically significant . Intraoperative and postoperative outcomes for right hemicolectomy data are presented as mean (standard deviation) unless otherwise indicated . Interest in use of the robot in colorectal procedures has increased in recent years . For any new operative technique to become an accepted alternative to traditional methods for instance, studies have emerged since the adoption of laparoscopy for colorectal operations that have shown that it can yield a decreased length of hospital stay, oncologically adequate resection, and no differences in postoperative complications or in - hospital deaths when compared with a traditional open approach . Because of studies like these, laparoscopy is now considered an acceptable alternative to an open approach in colorectal resection . Our current experience shows many of the similarities between patients undergoing laparoscopic colorectal surgery and those undergoing robotic - assisted colorectal surgery and suggests that robot - assisted colon and rectal surgery is a safe and feasible alternative to the conventional laparoscopic approach . This study was conducted in groups of patients that were similar in terms of demographic characteristics and indications for operation . There was no significant difference between the robotic and laparoscopic groups in terms of age, bmi, or history of abdominal surgery . Regarding operative outcomes, no significant difference was noted between the 2 groups in terms of complication rate, estimated blood loss, conversion to open procedure, or length of hospital stay . Return of bowel function and resumption of a regular diet were also noted to be similar between the 2 groups . Across all operations and approaches, the number and location of ports did not appear to have a clinically observable effect on intraoperative and postoperative outcomes including the need to convert to laparotomy, complications, and length of hospital stay . Consequently, this study of well - matched patients establishes the equivalence in outcomes that can be achieved between laparoscopic and robotic approaches to colon and rectal surgery . The 2 subanalyses sought to create better - matched patient groups and decrease the large standard deviations as a result of aggregating a broad range of procedures . Two ways of accomplishing this were to (1) eliminate procedures with concomitant liver resection and (2) include only right colectomies, the most commonly performed procedure in our study . In the subanalysis of outcomes, excluding cases with concomitant liver resection yielded a large drop in estimated blood loss, as well as duration of the procedure . However, there continued to be no statistically significant difference in any of the outcomes . Likewise, although the subanalysis of right colectomies showed nearly identical operative times, greatly decreased blood loss (laparoscopy - associated blood loss again greater than robotic), and smaller standard deviations, none of the differences were significant . Thus, despite attempting to better match the patient groups, the results remained similar between the laparoscopic and robotic procedures . Our results are similar to those shown in the randomized clinical trial by park et al that compared outcomes of robot - assisted and laparoscopic approaches for right - sided colon cancer . They showed no difference in complications, blood loss, conversion to open surgery, time to passage of flatus, or time to resume a regular diet between the 2 groups . Other studies, by rawlings et al and d'annibale et al, have also shown similar findings . In the study by rawlings et al, when examining right colectomy operations, no difference was seen between the laparoscopic and robot - assisted groups in terms of length of hospital stay and estimated blood loss . At present, the literature shows conflicting results in terms of the duration of the operation between the 2 surgical techniques . Similar to our findings, d'annibale et al noted no significant variation in operative times between the robotic and laparoscopic groups . In contrast, park et al found that the duration of the operation was significantly shorter in the laparoscopic group compared with the robot - assisted group (130 minutes vs 195 minutes, p <.001). Likewise, rawlings et al noted a significant difference in operative time (mean of 169 minutes in laparoscopic group vs 219 minutes in robotic group, p = .002). Further well - matched studies are needed to truly elucidate whether there is a significant difference in operative times between the 2 surgical approaches . Whether patients had a history of abdominal surgery the fact that patients in both study arms had similar histories of abdominal operations suggests that prior abdominal surgery is not a contraindication to robotic - assisted surgery . In addition, the rate of conversion to an open procedure was not significantly different between the laparoscopic and robot - assisted groups . This finding is comparable with results reported in studies by park et al and trastulli et al, both of which examined patients undergoing robotic right colon resections . In the comparative study by park et al, there was no difference in the number of cases converted to an open procedure: none of the 35 robot - assisted cases were converted to open surgery; nor were any of the 35 laparoscopic cases . Likewise, in the study by trastulli et al examining a consecutive series of 20 patients, none were converted to open surgery . In our study, none of the robotic right colon resections were converted to an open procedure, whereas in the laparoscopic group, only 1 patient, who also underwent concomitant liver resection, was converted to open surgery . In contrast to the aforementioned results, a study of rectal cancer resections in 84 patients (laparoscopic in 37 and robot assisted in 47) by baek et al found a significantly higher rate of conversion to open surgery in the laparoscopic group compared with the robotic group (p = .020). Together, these findings indicate that conversion to an open procedure likely occurs at similar rates between the 2 approaches and that there may in fact be superior outcomes after a robotic approach for colon and rectal surgery . When operations are performed for cancer resection, new techniques must not only be safe but also provide a comparable outcome for oncologic resection . In this study we performed a subanalysis comparing laparoscopic versus robotic surgery that examined oncologic outcome . There was no difference in the number of lymph nodes harvested in cases performed as a result of colorectal malignancy, and both approaches yielded an average number of lymph nodes> 12, proving the techniques oncologically sufficient . Similarly, studies by d'annibale et al and park et al reported no difference between the approaches in harvesting nodes . In these studies, robot - assisted resection obtained, on average, 17 nodes and 29.9 nodes, respectively the series of 20 patients undergoing robotic right colectomy reported by trastulli et al also showed oncologic sufficiency by harvesting an average of 17.6 lymph nodes . Although the technical limitations of standard laparoscopy are addressed with the robotic apparatus by using a 3-dimensional field and improved instrument articulation and rotation, there remain certain disadvantages to consider . Because robot - assisted operations are still relatively new, the process to set up and dock robotic arms increases the length of time in the operating room . Even with an experienced team, the prolonged time is a drawback compared with conventional laparoscopy . Perhaps more important than operating room time, however, is the duration of the procedure because it is of greatest importance to the patient that prolonged risks of anesthesia are mitigated . It has been shown that colorectal surgery is associated with cardiac complications that are exacerbated by longer operative times and are associated with mortality rates of 20% to 40% . The single patient death in this study, as a result of cardiac arrest, occurred in a 67-year - old woman undergoing a particularly complicated robotic apr for squamous cell carcinoma of the anal canal that lasted 492 minutes . As was seen in this study, however, as well as other studies of right colectomies, the duration of the operation overall was not significantly different between the laparoscopic group and the robotic group . When the robotic operative time is averaged after excluding this apr case, the time is 240.5 160.3 minutes, a nonsignificant difference from the laparoscopic time . This time is similar to average operative times for robotic colorectal procedures published in the current literature . Although some surgeons may question, on the basis of this instance of death after a robotic apr, the safety of the robot as a surgical modality, studies have shown low mortality rates . A systematic review by kanji et al of robot - assisted colorectal procedures encompassing 854 patients yielded no reported deaths . Similarly, salman et al, in an assessment of the nationwide inpatient sample, found a mortality rate of 79.1 per 10 000 laparoscopic colorectal procedures compared with a rate of 0.0 per 10 000 robotic cases (p <.05). Thus, despite the single case of death in our study, both laparoscopic colorectal surgery and robotic colorectal surgery have been shown to have low in - hospital mortality rates . Multiple studies have shown that robot - assisted surgery is significantly more costly than standard laparoscopic surgery . We did not analyze cost in our study, but prior publications showed a greater expense of thousands of dollars when using the robotic approach compared with traditional laparoscopy . In addition to cost being a limitation to the robotic approach in hospitals, robotic surgery also results in a greater out - of - pocket expense for patients . Although many studies, including our study, have shown that in most aspects, outcomes are similar between both modalities, significant advantages and benefits to the robotic approach over the laparoscopic approach may be necessary to justify the use of the robot in some centers . In other centers, however, the standardization of robotics in surgery may lead to cost savings over time . The small sample size and retrospective nature of our study present some inherent limitations . At our institution, the robotic approach to colorectal surgery has not become widely adopted, and as such, there are fewer of these procedures being performed . However, this study and its exploratory nature serve as preliminary evidence in the comparison of laparoscopic and robotic colorectal surgery through an appropriate design . At the same time, this study establishes a basis for larger - scale investigation with wider financial and organizational resources . The study design was limited by the availability of the robot and could be remedied by a future prospective randomized study . As mentioned previously, the additional costs incurred when using the robot are a prohibitive factor, especially at an urban academic medical center such as ours that typically treats underinsured patient populations . Furthermore, right hemicolectomy was the predominantly performed operation in this study, a procedure that is technically less challenging than an apr, for example . As such, this has a number of implications regarding operative time, blood loss, and perioperative and postoperative complications . Although our study is a small retrospective comparison and thus subject to the limitations of such a study, it presents promising data on the efficacy of robotic surgery at institutions similar to ours . Further investigation into the comparative costs and into the magnitude of the effects in a larger patient population is necessary to better elucidate the differences between laparoscopic and robot - assisted techniques in colon and rectal operations . In our early experience, the robotic - assisted technique is a safe and efficacious approach to colorectal surgery, in addition to preserving oncologically sufficient outcomes.
Ms is a chronic progressive cns inflammatory disease, in which the autoimmune response against the cns myelin proteins leads to a chronic inflammatory response [1, 2]. During the inflammatory response, autoreactive t - cells migrate through the otherwise impermeable blood - brain barrier into the cns perivascular areas, where they cause demyelination and axonal degeneration . The chronic inflammatory response leads to neuronal conduction deficits associated with neurological symptoms and eventually results in the loss of functional neuronal tissue . Several immunomodulatory and immunosuppressive therapies (ifn, glatiramer acetate, fingolimod, natalizumab, and mitoxantrone) are used in clinical practice as effective therapies in controlling disease activity and disability progression in patients with rr ms . Th17-cells have been shown to play a critical role in the development of autoimmune responses in several autoimmune diseases, including ms, rheumatoid arthritis, psoriasis, juvenile diabetes, ulcerative colitis, and autoimmune uveitis [3, 4]. Th17-cells are identified in the cns ms lesions, cerebrospinal fluid, and among the blood - derived mononuclear cells from ms patients, implying that they may play a critical role in the immunopathogenesis of ms [58]. Our laboratory has identified increased numbers of th17-cells and an increase in the th17-cells' master regulatory transcription factor, retinoic acid - related orphan nuclear factor (rorc), and cytokines that mediate th17-cell expansion in ms lesions . Th17-cell frequency is approximately 7 times higher in the peripheral circulation of rr ms patients in comparison to healthy controls (hcs), and it positively correlates with the clinical disease activity . While multiple studies have reported on the association of th17-cells and autoimmune diseases, only several reports have provided a mechanistic data on the function of il-17a in the development of the autoimmune response . Il-17a induces the secretion of cxcl1 and cxcl2, neutrophil - attracting cytokines, which attract those inflammatory cells into the cns in the early or acute phase of the disease . Il-17a together with il-22 induces blood brain barrier permeability due to their effect on the endothelial cells . Il-17a induces production of additional proinflammatory cytokines, including il-1 and il-6, and cytokines coexpressed by th17-cells, il-9, il-21, il-22, and gm - csf, also contribute to the development of the autoimmune response . Socs proteins are a family of intracellular cytokine - inducible proteins, consisting of 8 members (cis and socs1-socs7). They have two structural components: an src homology domain (sh2), which is involved in phosphotyrosine binding to activated signaling molecules and a c - terminal socs box involved in the degradation of signaling molecules through the ubiquitin - proteasome pathway . Socs gene expression is triggered by interleukins, interferons, haematopoietic growth factors, and tlr ligands such as lipopolysaccharides (lps) and cpg - containing dna [13, 14]. The induction of the socs proteins occurs through cytokine - mediated activation of the janus kinase / signal transducers and activators of the transcription (jak / stat) signaling pathway, which leads to the phosphorylation of the stat transcription factors . The socs proteins negatively regulate cytokine signaling through their association with phosphorylated tyrosine residues on jak proteins and/or cytokine receptors or by inhibition of stat binding to the cytoplasmic domain of the receptors . They terminate the inflammatory responses by mediating proteasomal degradation of the bound proteins [13, 15, 16]. Among the socs family members, socs1 and socs3 have been described to play the most important role in the regulation of the autoimmune response . They block phosphorylation - dependent activation of stat1 in response to ifn-, or stat3 in response to il-6, and target the ifnr- and il-6r - signaling complexes for proteasomal degradation . Interestingly, two recent large genetic studies have identified socs1 as one of the genes with the strongest association with the susceptibility for ms [18, 19]. Among the available ms therapies, ifn and the recently introduced statins have been reported to exert their immunomodulatory effects through the induction of socs1 and socs3 in various inflammatory cell subsets . Ifn and statins inhibit th17-cell differentiation directly and indirectly via their effects on antigen - presenting cells (apcs). In this paper, we will discuss their therapeutic effects in rr ms patients, which are indirectly mediated through the induction of socs1 and socs3 in monocytes, dcs, and b - cells as well as directly affecting the th17-cells . Similar to th1- and th2-cells, the differentiation of th17-cells is orchestrated by cytokines secreted by apcs . The differentiation of mouse and human th1-cells occurs upon exposure to il-12 and ifn- and th2-cells upon exposure to il-4 and il-10, whereas the differentiation of mouse and human th17-cells differ in the required th17-polarizing cytokines [20, 21]. Tgf- and il-6 are required in the mouse, while il-6, il-1, and il-23 drive human th17-cell differentiation [2224]. Specific stat molecules are involved in the differentiation of each t - cell subset . Th1-cells' differentiation induced by ifn- and il-12 mediate activation of stat4 and stat1, which directly control the transcription factor t - bet . In the differentiation of th2-cells, il-4-induced stat6 phosphorylation is crucial for the gene transcription of the master regulatory transcription factor gata-3, whereas stat3 is pivotal in human and mouse th17-cell differentiation, where it is induced by il-6, il-23, and il-21 . These studies have demonstrated a pivotal role of stat molecules in t - cell differentiation . Stats' regulation is critical for the cytokine secretion profile and the subsequent inflammatory t - cell responses . Socs1 is induced by various cytokines, including ifn, ifn, il-4, and il-6 [27, 28], which activate the jak / stat signaling pathway . Several studies have demonstrated that socs1 is induced by the tlr4 (lps) and tlr9 ligands (cpg - dna) [14, 29]. Socs1 classically inhibits ifn signaling through association with the ifn- receptor 1 (ifnar1) and ifn- receptor (ifngr) subunits and suppression of ifn - induced stat1 and stat3 phosphorylation [3032]. In addition to ifn regulation, socs1 also inhibits tnf- signaling [14, 29]. Socs1 deficiency leads to overresponsiveness to ifn-, whereas socs1 overexpression leads to a reduced responsiveness to ifn- in various cell subsets [31, 33, 34], implying that socs1 plays a negative regulatory role in ifn- signaling . Socs3 is expressed in dcs, monocytes, t - cells and b - cells upon induction by il-2, il-3, il-6, il-12, il-23, ifn//, il-27, il-4, il-10, il-1, tgf, tnf-, gm - csf, and lps . Socs3 expression is high in resting cd4 cells, but it rapidly decreases after t - cell receptor activation . Earlier studies have reported that during t - cell differentiation, socs3 is selectively expressed in th2-cells, while socs1 expression is higher in th1-cells . High socs3 expression in transgenic mice led to skewing to th2 type differentiation, because socs3 binds to il-12rb2 and inhibits the il-12-mediated stat4 activation, therefore blocking th1-cell development . Socs3 inhibits il-6 signaling by binding to the il-6 gp130 receptor complex and mediating its proteasomal degradation [36, 37]., stat3 induces the expression of the master regulatory transcription factor rorc and is, therefore, critical for the differentiation of human and mouse th17-cells [26, 38, 39]. A socs3 deficiency in nave t - cells leads to a sustained stat3 phosphorylation and results in higher frequencies of differentiated th17-cells . In addition, socs3 deficiency in t - cells is associated with enhanced il-17a production, induced by il-23 or il-6 plus tgf- . Il-27 signaling can also induce socs3 via stat1 so that il-27 may block th17-cell development, as may type i and ii ifns, via sequential activation of stat1 and socs3, resulting in stat3 antagonism . Monocytes, cd4 and cd8 t - cells were found to have a lower socs3 and increased stat3 expression during ms relapses . Furthermore, socs3 suppresses the th17-polarizing cytokine il-1 and il-23 secretion by dcs and b - cells [43, 44]. Socs3 is induced by several stimuli in apcs, where it plays an important role in the inhibition of th17 polarizing cytokines il-1 and il-23, which suppress stat3 activation required for the gene transcription of the master th17 cell regulatory transcription factor rorc . These studies suggest that socs3 induction may represent a beneficial therapeutic approach in patients with rr ms . Ifn is an innate immune response cytokine that suppresses the disease activity and disability progression of rr ms and its animal model, experimental autoimmune encephalomyelitis (eae). Earlier studies in mice and humans have demonstrated an association between an endogenous ifn deficiency and an increased susceptibility for eae and rr ms [45, 46]. In addition, the administration of exogenous ifn effectively reduced the clinical relapse rate and the formation of new cns lesions in several large placebo - controlled clinical trials . An increase in the th1 receptor il-12r2 expression and the secretion of the immunoregulatory cytokine il-10 [48, 49] were identified as the biomarkers of ifn's therapeutic effects . Multiple proposed mechanisms of ifn's therapeutic effect include inhibition of antigen presentation, suppression of t - cell proliferation and migration, and modulation of proinflammatory cytokine production [48, 49]. More recent studies have shown that ifn effectively suppresses th17-cells differentiation in mouse and human . Mice deficient for ifnar1 receptor and its downstream signaling molecules have been found to be more susceptible to eae [50, 51]. In addition, durelli et al . Have demonstrated that ifn reduced the numbers of th17-cells in their longitudinal study of ifn-1a - treated rr ms patients . This finding has been supported by our in vitro experiments on the effect of ifn on human th17-cell differentiation, where we demonstrated that ifn suppresses th17-cell differentiation via its effects on monocytes, dcs, b - cells and nave t - cells [43, 44, 52]. Monocytes, macrophages, dcs and b - cells induce human th17-cell differentiation through their secretion of il-1 and il-23 . Have reported an increased expression of il-23p19 in acute ms brain lesions, while vaknin - dembinsky et al . Identified an increased synthesis of il-23 by dcs derived from ms patients [53, 54]. In our in vitro experiments, we found a decreased expression of il-1 and il-23, whereas il-12p35 and il-27 gene expression was increased in ifn-treated dcs . Rr ms patients treated with ifn have been reported to have reduced il-23p19 gene expression in their peripheral blood mononuclear cells (pbmcs), a finding that is reinforced by our in vitro experiments showing that dcs and b - cells exhibited decreased il-23 secretion upon incubation with ifn [43, 44, 52]. We also demonstrated that the reduced secretion of il-1 and il-23 in supernatants (sns) from ifn-treated dcs led to a decreased differentiation of th17-cells . The addition of il-1 and il-23 and the blocking of il-27 in the sns from ifn-treated dcs and b - cells lead to a reversal of the ifn effect and an increase in th17-cell differentiation [43, 44]. In ifnar knock - out mice that are highly susceptible to eae, the eae is reversed with il-27 administration . These studies led us to conclude that ifn suppresses the th17-cell differentiation by inhibiting il-1 and il-23 and inducing il-27 secretion in dcs and b - cells as shown in figure 1 . Ifn is a potent inducer of socs1 and socs3, molecules that contribute to th17-cell differentiation [43, 55, 56]. We observed an increased expression of socs3 in ifn-treated dcs, which is induced through stat3 activation [43, 44]. Several studies have reported that socs3 suppresses il-1 and il-23 expression [57, 58]. Collectively, these reported in vitro and in vivo findings indicate that ifn suppresses the il-1 and il-23 expression through socs3 upregulation in dcs and b - cells [43, 44]. We found that b - cells from rr ms patients and hcs exhibit an increased socs1 expression upon ifn-induced stat1 phosphorylation . In vivo studies by liu et al . Have demonstrated that ifn-1b treatment of rr ms patients inhibits the cd40 co - stimulatory molecule expression on b - cells . We further identified in our experiments that ifn inhibited cd40 expression on b - cells through the induction of socs1 . Stat1 inhibition with fludarabine leads to increased cd40 expression in b - cells and the reversal of ifn-1b's in - vitro effect [44, 55]. Similar findings have been reported for the ifn-- and ifn--induced cd40 expression on macrophages . In a recent study, we have demonstrated that socs1 plays an important role in the regulation of b - cell cd40 expression and subsequently on their antigen presenting capacity . The t - cell proliferation decreased when ifn-pretreated b - cells were used as apcs and cocultured with the antigen - specific t - cells . In contrast, the proliferative response was reversed when the ifn-treated b - cells were simultaneously incubated with the stat1 inhibitor fludarabine . These results confirm the role of ifn-1b - induced stat1 phosphorylation and socs1 expression in the inhibition of the antigen presenting capacity of b - cells . In a recent study, tanaka et al . Have demonstrated that the eae induction was reduced in mice with a t - cell - specific socs1 knockout, which differentiated into th1-cells, while the frequency of th17-cells was reduced . The socs1-deficient t - cells exhibited a sustained stat1 activation . In the absence of an socs1 inhibitory effect on ifn- signaling, nave t - cells not all rr ms patients respond to ifn therapy, and early identification of nonresponders is important to avoid irreversible disability progression . Have recently demonstrated that monocytes from rr ms nonresponders have an increased baseline level of stat1 phosphorylation and ifnar1 expression compared to ifn-responders, which are identified by the suppression of clinical disease activity . The expression of socs1 and socs3 was similar in responders and non - responders, suggesting that these negative regulators of stat1 activation may be expressed but functionally deficient in non - responders . In summary the induction of socs1 in b - cells leads to cd40 suppression, whereas the induction of socs3 inhibits the gene expression of th17-polarizing cytokines il-1 and il-23 . In nave cd45ra t - cells, ifn also induces socs3 which inhibits stat3 cell signaling and a subsequent expression of the th17-cell master regulatory transcription factor rorc . Statins are selective inhibitors of 3-hydroxy-3-methylglutaryl (hmg)-coa reductase, an enzyme involved in the conversion of hmg - coa to mevalonic acid . Statins have been widely used as cholesterol - lowering agents in the treatment of cardiovascular diseases . More recently, they have been found to have anti - inflammatory and immunomodulatory properties, since they inhibit dcs' maturation and antigen presentation [62, 63]. The anti - inflammatory benefits of statins are related to their ability to reduce mevalonate and the mevalonate - derived isoprenoids farnesyl pyrophosphate (fpp) and geranylgeranyl pyrophosphate (ggpp). Fpp and ggpp are involved in the posttranslational modification of small g - proteins . Simvastatin may have a therapeutic potential in rr ms, since it has been demonstrated to decrease new cns lesion formation by 42% after six months of treatment in comparison to the baseline magnetic resonance imaging studies . We have also reported that nave cd45ra t - cells cultured with sns from simvastatin - treated monocytes decreased th17-cell differentiation . The simvastatin treatment of monocytes and dcs from rr ms patients and hc induced decreased expression of the th17-promoting cytokines il-1 and il-23 [66, 67]. We have also identified an increase in the socs3 expression in simvastatin - treated monocytes [68, 69]. Statin - induced socs3 downregulates the expression of il-1 and il-23, creating a cytokine milieu that inhibits the th17-cell differentiation, as shown in figure 1 . Previous eae studies have indicated that statins shifted th1 cytokine (ifn-, il-12, and tnf-) to th2 cytokine production (il-4, il-5, and il-10). A more recent study has suggested that statins inhibit human th17-cells' differentiation and the production of the th17 cytokines il-17a, il-17f, il-21, and il-22 . Huang et al . Have demonstrated that statins block stat1 phosphorylation, which is crucial in ifn- signaling and th1-cell differentiation . Socs3, a negative regulator of stat1 and stat3 activation, is increased in the statin - treated cells . Statin - induced socs3 expression is proposed to downregulate the stat1 and stat3 phosphorylation during th1 and th17-cell differentiation, through which its therapeutic effect is mediated in rr ms . Ifn and statins have been shown to be an effective treatment of rr ms . Despite different mechanisms of action, both therapies target similar signaling pathways . Ifn suppresses the differentiation of pathogenic th17-cells, through its effect on the cells of the innate system (macrophages, monocytes, dcs, and b - cells), by the inhibition of the th17-cell - promoting cytokines il-1 and il-23 via induction of socs3 . In b - cells, ifn downregulates cd40 costimulatory molecule expression through the induction of socs1 . Statins lead to socs3 and socs7 expression in the innate immune response cells . In monocytes and dcs, socs3 inhibits il-1 and il-23 expression, which leads to an inhibitory cytokine milieu for the th17-cells' differentiation . Statins and ifn both induce the socs3 expression, which is crucial in the suppression of th17-cell differentiation and consequently for their therapeutic effect in rr ms . The available results have identified socs proteins as an attractive therapeutic target in autoimmune diseases . The designer socs - mimetic drugs have already been tested in an animal model of the cns inflammatory disease . Tyrosine kinase inhibitor peptide (tkip), a short peptide socs1 mimetic, both prevented and treated active eae, thus representing a promising therapeutic approach that will likely be further pursued in clinical testing.
Febrile neutropenia (fn) in cancer patients is a common complication related to antineoplastic therapy, such as chemotherapy and radiotherapy . It is a high risk factor for developing serious bacterial infections that can result in fatal outcomes . Mortality has been reported to be higher in fn patients with bacteremia than in those without bacteremia . Recently, more cancer patients receive chemotherapy in outpatient settings, so the number of patients that visit the emergency department (ed) with complications related to antineoplastic therapy is increasing . Therefore an immediate and appropriate strategy for this population in ed is required to reduce treatment delays and improve outcomes . Focus of infection is uncertain, and only a few clinical signs such as fever, headache, and hypotension may indicate bacterial infections in many cases of fn . Efforts to predict bacteremia have been made, but their sensitivity and specificity have been poor . Even though blood cultures are the gold standard for the diagnosis of bacteremia, obtaining and testing these is time - consuming and their results are not available immediately in the ed . Therefore, a predictive tool to diagnose bacterial infections in fn is crucial for early diagnosis in the ed . Several inflammatory markers have been studied for the diagnosis of infection . Among them, c - reactive protein (crp) is frequently used and is a good marker of infection but it rarely distinguishes between bacterial and viral infection . Procalcitonin (pct) is a prohormone of calcitonin secreted from c - cells of the thyroid gland, and has been proposed as a candidate marker for diagnosis of active bacterial infections . Serum pct concentration in healthy individuals is low, but raises during septic conditions, especially when related to bacterial infections . In this study, we aimed to evaluate the usefulness of pct and crp as early diagnostic markers of bacteremia in cancer patients with chemotherapy - related fn in the ed . Subjects enrolled in this study were adult cancer patients (16 years or older) with chemotherapy - associated fn who visited the ed of a university - affiliated tertiary referral medical center, between june 2009 and august 2010 . Fever was defined as a single oral temperature of 38.3 or a temperature of 38.0 for 1 hour, and neutropenia was defined as a neutrophil count of <500 cells / mm, or a count of <1,000 cells / mm with a predicted decrease to <500 cells / mm . Laboratory data were obtained with complete blood count, serum creatinine, blood urea nitrogen, aspartate transaminase, and alanine transaminase (alt) as well as pct and crp, at the time of admission to ed . The chi - square test and student's t - test were used for univariate analysis . The wilcoxon rank sum test for continuous data median values with interquartile range were calculated for inflammatory markers including pct and crp . For univariate analysis, age was categorized by the median value and clinical measurements were classified as hypotension (systolic blood pressure [sbp]<90 mm hg), tachycardia (pulse rate>120 beats / min), tachypnea (respiratory rate>24 breathes / min), and high body temperature (> 39). Pct were grouped by three cut - off values of 0.1, 0.5, and 1.0 ng / ml, and similarly crp by cutoff values of 5, 10, and 20 mg / dl . Parameters considered significantly associated with a high risk of bacteremia were selected in univariate analysis, and the logistic regression for multivariate analysis was calculated for odds ratio (or) and 95% confidence interval (ci). Diagnostic values for bacteremia of pct and crp were calculated by analyzing the receiver operating characteristic (roc) curves . A total of 286 patients were included as the study population, including 239 (83.6%) from solid tumors and 47 (16.4%) from hematologic malignancies . Among solid tumors, breast cancer was the most common in 94 followed by gastrointestinal cancer in 68 and lung cancer in 37 patients . Hematologic malignancies consisted of 37 lymphoma, 4 myelodysplastic syndromes, and 3 leukemia patients . The median age of patients was 54 years and females were dominant in the population (male: female=1: 1.25). As shown in table 1, bacteremia was detected in 38 episodes (13.3%). In comparison between groups with and without bacteremia, the bacteremia group showed significantly higher rates of pulse (115 beats / min vs. 108 beats / min, p=0.01) and respiration (22 breaths / min vs. 20 breaths / min, p <0.01) than the non - bacteremia group whereas sbp (114 mm hg vs. 117 mm hg) and body temperature (38.5 vs. 38.4) were not significantly different between the two groups (p>0.05, each). The bacteremia group had poorer laboratory findings than the non - bacteremia group, although there was no significant difference in absolute neutrophil count (anc) and alt . In the same way, pct and crp showed much higher levels in the bacteremia group compared to the non - bacteremia group (the median value of pct, 2.75 ng / ml vs. 0.00 ng / ml, p<0.01; the median value of crp, 15.9 mg / dl vs. 5.6 mg / dl, p<0.01). The majority of patients in the bacteremia group were older than those in the non - bacteremia group (68% vs. 44%, p<0.01). Hypotension (24% vs. 4%), tachycardia (42% vs. 19%), tachypnea (37% vs. 9%), and high body temperature (42% vs. 21%) were reported more commonly and significantly in the bacteremia group than in the non - bacteremia group (p<0.01 for all). As shown in table 2, in all comparisons of various cut - off values of pct, the bacteremia group had higher pct levels than the non - bacteremia group with statistical significance . On the other hand, in a category of crp with the cut - off value of 5 mg / dl, there was no significant difference between bacteremia and non - bacteremia groups (68% vs. 52%, p=0.08), even though significant differences were observed in other categories of crp with the cut - off value of 10 mg / dl (58% vs. 33%, p<0.01) and 20 mg / dl (37% vs. 12%, p<0.01) (table 2). On multivariate analysis, pct with a cutoff value of 0.5 ng / ml (or, 3.6; 95% ci, 1.4 to 9.2; p<0.01) and tachypnea (or, 3.4; 95% ci, 1.4 to 8.5; p<0.01) were independent early diagnostic markers for bacteremia in fn patients at ed (table 3). 1 . The area under the curve (auc) of pct was 74.8% (95% ci, 65.1 to 84.6%) while the auc of crp was 65.5% (95% ci, 54.8 to 76.1%), representing higher diagnostic accuracy of pct to predict bacteremia than the accuracy of crp (p<0.05). With a pct cutoff of 0.5 ng / ml, crp with a cutoff of 10 mg / dl showed sensitivity and specificity of crp as 57.6% and 67.3%, respectively . Table 4 shows sensitivity and specificity, as well as positive and negative likelihood ratios for pct and crp . A total of 286 patients were included as the study population, including 239 (83.6%) from solid tumors and 47 (16.4%) from hematologic malignancies . Among solid tumors, breast cancer was the most common in 94 followed by gastrointestinal cancer in 68 and lung cancer in 37 patients . Hematologic malignancies consisted of 37 lymphoma, 4 myelodysplastic syndromes, and 3 leukemia patients . The median age of patients was 54 years and females were dominant in the population (male: female=1: 1.25). As shown in table 1, bacteremia was detected in 38 episodes (13.3%). In comparison between groups with and without bacteremia, the bacteremia group showed significantly higher rates of pulse (115 beats / min vs. 108 beats / min, p=0.01) and respiration (22 breaths / min vs. 20 breaths / min, p <0.01) than the non - bacteremia group whereas sbp (114 mm hg vs. 117 mm hg) and body temperature (38.5 vs. 38.4) were not significantly different between the two groups (p>0.05, each). The bacteremia group had poorer laboratory findings than the non - bacteremia group, although there was no significant difference in absolute neutrophil count (anc) and alt . In the same way, pct and crp showed much higher levels in the bacteremia group compared to the non - bacteremia group (the median value of pct, 2.75 ng / ml vs. 0.00 ng / ml, p<0.01; the median value of crp, 15.9 mg / dl vs. 5.6 mg / dl, p<0.01). The majority of patients in the bacteremia group were older than those in the non - bacteremia group (68% vs. 44%, p<0.01). Hypotension (24% vs. 4%), tachycardia (42% vs. 19%), tachypnea (37% vs. 9%), and high body temperature (42% vs. 21%) were reported more commonly and significantly in the bacteremia group than in the non - bacteremia group (p<0.01 for all). As shown in table 2, in all comparisons of various cut - off values of pct, the bacteremia group had higher pct levels than the non - bacteremia group with statistical significance . On the other hand, in a category of crp with the cut - off value of 5 mg / dl, there was no significant difference between bacteremia and non - bacteremia groups (68% vs. 52%, p=0.08), even though significant differences were observed in other categories of crp with the cut - off value of 10 mg / dl (58% vs. 33%, p<0.01) and 20 mg / dl (37% vs. 12%, p<0.01) (table 2). On multivariate analysis, pct with a cutoff value of 0.5 ng / ml (or, 3.6; 95% ci, 1.4 to 9.2; p<0.01) and tachypnea (or, 3.4; 95% ci, 1.4 to 8.5; p<0.01) were independent early diagnostic markers for bacteremia in fn patients at ed (table 3). 1 . The area under the curve (auc) of pct was 74.8% (95% ci, 65.1 to 84.6%) while the auc of crp was 65.5% (95% ci, 54.8 to 76.1%), representing higher diagnostic accuracy of pct to predict bacteremia than the accuracy of crp (p<0.05). With a pct cutoff of 0.5 ng / ml, crp with a cutoff of 10 mg / dl showed sensitivity and specificity of crp as 57.6% and 67.3%, respectively . Table 4 shows sensitivity and specificity, as well as positive and negative likelihood ratios for pct and crp . Fn with infection is a medical emergency that requires rapid diagnosis and intervention as soon as possible . Localizing signs and symptoms of infection are minimal or often absent and the progression of infection can be rapid in fn patients . Therefore, an early diagnostic test to predict bacteremia in fn would be of great value by providing physicians with more definite evidence of the etiology of fever; especially in the ed where the first point of care has to be done . On account of difficulties in diagnosis of bacterial infection in the fn, attempts to improve accuracy and rapidity of diagnosis of infection have been made through efforts on biomarkers . Among various biomarkers, pct and crp have been considered useful . In previous reports on pct and crp, pct was shown to be more strongly associated with documented bacterial infection in fn patients . Pct increased earlier in bacterial infection and returned to the normal range more quickly than crp . In healthy individuals, pct concentrations were below the detection limit but levels increased with increasing severity of the inflammatory response to bacterial infection . In comparison with pct, there was a wider overlap of crp levels between groups with and without bacteremia . On multivariate analysis, pct was an independent, useful marker whereas crp was not significant in predicting bacteremia . A cut - off value of serum pct to discriminate bacteremia from non - bacterial infection was adopted in this study as proposed previously . On the basis of the reported pct values in fn, pct values<0.5 ng / ml were less likely to occur in patients with bacteremia . For a cut - off value of crp, 10 mg / dl was used as proposed in the previous study . In this study, the incidence of bacteremia was 13.3% and variables including age, initial vital signs, laboratory data except anc and alt, pct and crp, were significantly different between groups with and without bacteremia . However, to discover factors related with unrevealed bacteremia in early phase and to evaluate the usefulness of inflammatory markers, vital signs recorded initially at the ed and inflammatory markers, including pct and crp, at the time of admission were analyzed . As the result, tachypnea as well as pct was significant as an early diagnostic marker for bacteremia . In the study by bossink et al ., among the systemic inflammatory response syndrme (sirs) criteria, tachypnea was the only factor that significantly predicted shock development in febrile patients using multivariate analysis . Considering that rapid respiratory rate and elevated pct were independently and strongly associated with bacteremia, physicians should pay more attention to fn patients who present these characteristics . Origins of inflammatory pct are controversial since the production of pct in the infection phase is not related to thyroid tissues . The exact site of production during sepsis has not been identified, but it has been demonstrated that immunoreactive cells including neutrophils were possible sources of pct production . Therefore, concerns have been raised about possible impairment of pct production in patients with neutropenia . However, other studies have demonstrated higher pct levels in fn patients with documented bacterial infections, and our study also supported the plausibility of pct as a reliable marker for bacterial infection in fn . Some recent studies suggested that pct kinetics were more valuable to assess prognosis in infectious diseases . In this study, however, the levels of pct were evaluated only once at the time of admission at the ed . Cancer patients have great variation in the degree of immunosuppression and long - term survival . Patients with hematologic malignancies are more likely to be immunocompromised than patients with solid organ malignancy and are at high risk of sepsis and have worse prognosis compared to solid tumors . Pct may not or may only slightly increase when infection remains in a localized tissue with no systemic manifestations . In patients with localized infections without signs of systemic manifestation, therapeutic measures such as antibiotics or surgical intervention may be necessary despite of normal pct levels . Although elevated pct values during severe infections may decrease to very low levels with appropriate therapy, this does not always indicate complete eradication of the infection but merely that generalization of the infection or the septic response is under control . Continuation of antibiotic therapy or surgical measures may be necessary until all clinical signs of infection have disappeared . Serum pct concentration were significantly higher in patients with bacteremia . In a multivariate analysis, these findings suggest that pct is a useful early diagnostic marker to detect bacteremia in cancer patients with fn and has better diagnostic value than crp . It is recommended to establish an early treatment strategy to prevent complications of bacterial infection in fn patients with high serum pct concentration in the ed.
Pineal region tumors (prts) are a heterogeneous group of tumors that can be assigned to four main categories: germ cell tumors, pineal parenchymal tumors (ppts), glial cell tumors, and other miscellaneous tumors and cysts . Prts, which are rare tumors, account for approximately 0.4 - 1.0% of intracranial tumors . Ppts are even rarer, and approximately 30% of ppts occur in neoplasms of the pineal region . According to the world health organization (who) classification of tumors in the central nervous system, which was revised in 2007, ppts are subdivided into well differentiated pineocytoma (pc), ppt with intermediate differentiation (pptid), and poorly differentiated pineoblastoma (pb). A standard treatment strategy for these tumors various treatments from surgery or radiotherapy and chemotherapy alone or in combination have been applied . Part of the tumor was initially removed through surgery followed by radiation therapy; however, this treatment was not effective; therefore, chemotherapy was applied and resulted in successful elimination of the tumor . In this study, we also discuss the pathological and biological features of ppt and available treatment options . A 37-year - old male visited a clinic due to a headache and dizziness in december 2010 . There was no distinguishable observation in his past history, physical examination, and laboratory tests . In addition, the head - up - tilt - table test and video eyeball exam showed no obvious abnormalities . Computed tomography (ct) of his brain was performed and a mass measuring 2.5 cm in size was observed in the midbrain and obstructive hydrocephalus . The tumor showed intermediate enhancement in t1-weighted magnetic resonance (mr) imaging and a high intensity of enhancement in t2-weighted mr (fig . Histological diagnosis concluded that the mass was a ppt with intermediate differentiation . The majority of the tumor tissue consisted of small hyperchromatic cells with moderately increased cellularity and a high nuclear to cytoplasmic ratio . A clear homer wright rosette, many of which have been termed " pineocytomatous resettes " was not found (fig . Diffuse staining for neuron specific enolase and focal staining for synaptophysin were observed, while the immunohistochemistry analysis showed very little glial fibrillary acidic protein (gfap) staining . Such a focal staining pattern of synaptophysin staining in the pineal region neoplasm, coupled with the lack of gfap staining was most consistent with a ppt (fig . He underwent irradiation with 54 gy of radiation on 27 fractions for removal of the remaining tumor for approximately one month after surgery . However, a remnant mass in the superoposterior aspect of the midbrain had extended to the hypothalamus and the third ventricle approximately five months after the operation . He was referred to the department of medical oncology for palliative chemotherapy and was treated with a procarbazine, lomustine, vincristine (pcv) regimen one month later . The size of the remaining tumor in the midbrain and the leptomeningeal enhancement was reduced in the follow - up brain mr imaging . Two months later, after the sixth cycle of pcv chemotherapy, no evidence of the tumor was observed in the brain mr imaging (fig . No additional signs of a tumor were observed in the latest follow - up imaging, which was performed approximately 20 months after the initial diagnosis . The patient was free of any signs of recurrence without any neurological deficits six months after the end of treatment . There are still some controversies with regard to ppt classification, primarily due to the rare occurrence of these tumors . Many older published studies (prior to 2007) separated ppt into only two histological subtypes; pc and pb . Pc was classified as an indolent tumor and designated as grade i with a benign feature . Pb was categorized as a highly malignant primitive neuroectodermal tumor and assigned a who grade iv, which tends to have a higher propensity for seeding the cerebrospinal axis . The 2007 who classification of tumors of the central nervous system designated a new category of ppt, called pptid, which describes a group of tumors that have an intermediate malignancy between pc and pb . Proposed a new prognostic grading system that subdivides the category of pptid into two groups with different prognoses (grades ii and iii) according to the mitotic activity and the degree of neuronal differentiation . Grade iii has been defined as pptid with either six or more than six mitoses or fewer than six mitoses but no immunostaining for neurofilaments . In our case, the patient had been diagnosed as pptid grade iii, since the tumor contained more than six mitoses and atypical mitosis . Fauchon et al . Reported that grade iii pptid had a much more aggressive biologic behavior compared with grade ii . They reported that grade ii and grade iii differed by 74% and 39% in five - year survival and by 26% and 56% in the recurrence rate, respectively . A previous report compared the histological types between initial diagnosed and recurrent tumors in pptid . A 47-year - old male who had been diagnosed with pptid iii through endoscopic third ventriculostomy was treated with gamma knife surgery and no residual tumor was observed . However, a new mass lesion appeared on the cerebellum four years later and was found to be pb after a creniectomy and open biopsy were performed . In regard to the reoccurrence of ppt, no cases of a changed diagnosis have been reported, except for the report described above . However, ppt might be morphologically heterogeneous within a tumor and an endoscopic biopsy might not be sufficient for observation of the whole tumor . The authors even stated that the first tumor might have been a mixed pptid - pb . Although we did not perform a repeat biopsy in our case, it is likely that the recurred cancer was also a pptid of high grade . A previous study recommended a variety of treatment approaches ranging from surgery or external irradiation alone to combined treatment with surgery, radiotherapy, or chemotherapy . Surgery has been reported to play a significant role in relieving the local mass effect and providing a maximal tissue sample for histological analysis of low - grade ppt . Despite the significant progress in surgical techniques and perioperative care, surgical intervention in the pineal area contemporary studies have reported a surgical mortality rate of 4 - 7%, and the permanent morbidity rate may be as high as 10% . Some authors found no correlation between the extent of resection and survival, although total resection showed an association with better local control . In a study of a children's cancer group, which included 25 prt patients, no significant difference in survival was observed (<90% surgical resection vs.90% surgical resection (p>0.3, data not shown). Pbs or high grade pptids usually require more aggressive treatment, including craniospinal irradiation and chemotherapy . A retrospective study of 22 ppt patients with pb, mixed ppt or pptid with seeding potential found that fractionated irradiation applied primarily or as an adjuvant postoperatively could control the tumor and increase survival . The one - year, three - year, and five - year survival rates for these patients (seeding varieties) were 88%, 78%, and 58% . The indications and protocols were heterogenous in the initial stages when chemotherapy was administered during postoperative treatment . Because of the harmful effect of radiotherapy on the developing nervous system and the hypothalamic - pituitary axis in children, concerns about radiation toxicity have prompted efforts to reduce radiation therapy . In the pediatric oncology group (pog) experience, all 11 reported children under the age of 36 months with pb were treated with multi - agent chemotherapy for 12 - 24 months in order to delay radiation until the age of 36 months . Gururangan et al . Studied the efficacy of high - dose chemotherapy with or without craniospinal radiotherapy for pb . They reported that five of 12 patients who had undergone radical tumor resection followed by chemotherapy survived and four of seven patients treated with chemotherapy after biopsy or incomplete resection lived without any recurrences for a median follow - up period of 62 months . Recent studies on chemotherapy have focused primarily on pb and few studies on pptid have been reported . . Reported on a patient with pptid ii who had received treatment with 36 gy of craniospinal irradiation and an additional local boost of 19.8 gy after undergoing partial tumor resection . The patient received one cycle of intensive chemo - therapy consisting of cisplatin, oral etoposide, cyclophosphamide, and vincristine . Chemotherapy could not be continued due to development of thrombocytopenia, and cyberknife radiotherapy (marginal doses of 23 gy/3 fractions) was performed two months later . The report stated that the patient was free of any signs of recurrence without any neurological deficits 17 months after the end of cyberknife radiotherapy . In this study, we report on a case of pptid, in which remission was achieved through pcv chemotherapy . Pptid is extremely rare and few large - scale studies have reviewed the long - term effects of treatment, and there have been no definite conclusions regarding treatment plans for pptid in adults . In addition, few cases involving successful treatment of pptid in adults with neoadjuvant chemotherapy and craniospinal irradiation have been reported . We would like this form of treatment to help a larger number of ppt patients . Therefore, based on the findings of this case, combining surgery and irradiation with chemotherapy may be a feasible and efficient therapeutic approach for treatment of pptid . However, conduct of a prospective study including a larger number of patient groups will be needed in order to conclusively demonstrate the effectiveness of chemo- and radiotherapy for treatment of ppts.

Subsets and Splits

No community queries yet

The top public SQL queries from the community will appear here once available.